Sample records for acid synthesis rates

  1. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.


    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  2. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.


    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P


    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life. PMID:27012633

  3. Whole body synthesis rates of DHA from α-linolenic acid are greater than brain DHA accretion and uptake rates in adult rats[S

    PubMed Central

    Domenichiello, Anthony F.; Chen, Chuck T.; Trepanier, Marc-Olivier; Stavro, P. Mark; Bazinet, Richard P.


    Docosahexaenoic acid (DHA) is important for brain function, however, the exact amount required for the brain is not agreed upon. While it is believed that the synthesis rate of DHA from α-linolenic acid (ALA) is low, how this synthesis rate compares with the amount of DHA required to maintain brain DHA levels is unknown. The objective of this work was to assess whether DHA synthesis from ALA is sufficient for the brain. To test this, rats consumed a diet low in n-3 PUFAs, or a diet containing ALA or DHA for 15 weeks. Over the 15 weeks, whole body and brain DHA accretion was measured, while at the end of the study, whole body DHA synthesis rates, brain gene expression, and DHA uptake rates were measured. Despite large differences in body DHA accretion, there was no difference in brain DHA accretion between rats fed ALA and DHA. In rats fed ALA, DHA synthesis and accretion was 100-fold higher than brain DHA accretion of rats fed DHA. Also, ALA-fed rats synthesized approximately 3-fold more DHA than the DHA uptake rate into the brain. This work indicates that DHA synthesis from ALA may be sufficient to supply the brain. PMID:24212299

  4. Metabolism of Nonessential N15-Labeled Amino Acids and the Measurement of Human Whole-Body Protein Synthesis Rates

    NASA Technical Reports Server (NTRS)

    Stein, T. P.; Settle, R. G.; Albina, J. A.; Dempsey, D. T.; Melnick, G.


    Eight N-15 labeled nonessential amino acids plus (15)NH4Cl were administered over a 10 h period to four healthy adult males using a primed-constant dosage regimen. The amount of N-15 excreted in the urine and the urinary ammonia, hippuric acid, and plasma alanine N-15 enrichments were measured. There was a high degree of consistency across subjects in the ordering of the nine compounds based on the fraction of N-15 excreted (Kendall coefficient of concordance W = 0.83, P is less than 0.01). Protein synthesis rates were calculated from the urinary ammonia plateau enrichment and the cumulative excretion of N-15. Glycine was one of the few amino acids that gave similar values by both methods.

  5. Enhanced skeletal muscle protein synthesis rates in pigs treated with somatotropin requires fed amino acids levels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chronic somatotropin (pST) treatment in pigs increases skeletal muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin alone could not account for the pST-induced increase in protein synthesis. This study...

  6. Drying rate and dehydrin synthesis associated with abscisic acid-induced dehydration tolerance in Spathoglottis plicata orchidaceae protocorms.


    Wang, Xing-Jun; Loh, Chiang-Shiong; Yeoh, Hock-Hin; Sun, Wendell Q


    Dehydration tolerance of in vitro orchid protocorms was investigated under controlled drying conditions and after abscisic acid (ABA) pretreatment. Protocorms were obtained by germinating seeds on Murashige and Skoog (MS) medium containing 10% (v/v) coconut water, 2% (w/v) sucrose and 0.8% (w/v) agar, and were dehydrated in relative humidities (RH) ranging from 7% to 93% at 25 degrees C. The critical water content of dehydration tolerance was determined, using the electrolyte leakage method. Drying rate affected the critical water content. Slow drying under high RH conditions achieved the greatest tolerance to dehydration. ABA pretreatment decreased the drying rate of protocorms, and increased dehydration tolerance. Improved tolerance to dehydration after ABA treatment was correlated with the effect of ABA on drying rate of protocorms. When critical water content of protocorms dried under different RH was plotted as a function of actual drying rate, no significant difference in tolerance to dehydration was observed between ABA-treated and control protocorms. ABA pretreatment and dehydration of orchid protocorms induced the synthesis of dehydrin, especially under the slow drying conditions. ABA pretreatment also promoted dry matter accumulation such as carbohydrates and soluble proteins and increased the concentration of K(+) and Na(+) ions in protocorms. The ABA-induced decrease in drying rate was correlated with lower osmotic potential, the enhanced maturity of protocorms and the accumulation of dehydrin in protocorms during pretreatment. PMID:11847254

  7. Synthesis of amino acids


    Davis, J.W. Jr.


    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  8. Synthesis of (+)-Coronafacic Acid

    PubMed Central

    Taber, Douglass F.; Sheth, Ritesh B.; Tian, Weiwei


    An enantioselective synthesis of (+)-coronafacic acid has been achieved. Rhodium catalyzed cyclization of an α-diazoester provided the intermediate cyclopentanone in high enantiomeric purity. Subsequent Fe-mediated cyclocarbonylation of a derived alkenyl cyclopropane gave a bicyclic enone, that then was hydrogenated and carried on to the natural product. PMID:19231870

  9. Determining synthesis rates of individual proteins in zebrafish (Danio rerio) with low levels of a stable isotope labelled amino acid.


    Geary, Bethany; Magee, Kieran; Cash, Phillip; Young, Iain S; Whitfield, Phillip D; Doherty, Mary K


    The zebrafish is a powerful model organism for the analysis of human cardiovascular development and disease. Understanding these processes at the protein level not only requires changes in protein concentration to be determined but also the rate at which these changes occur on a protein-by-protein basis. The ability to measure protein synthesis and degradation rates on a proteome-wide scale, using stable isotope labelling in conjunction with mass spectrometry is now a well-established experimental approach. With the advent of more selective and sensitive mass spectrometers, it is possible to accurately measure lower levels of stable isotope incorporation, even when sample is limited. In order to challenge the sensitivity of this approach, we successfully determined the synthesis rates of over 600 proteins from the cardiac muscle of the zebrafish using a diet where either 30% or 50% of the L-leucine was replaced with a stable isotope labelled analogue ([(2) H7 ]L-leucine]. It was possible to extract sufficient protein from individual zebrafish hearts to determine the incorporation rate of the label into hundreds of proteins simultaneously, with the two labelling regimens showing a good correlation of synthesis rates. PMID:26929125


    SciTech Connect

    Larsen, Peder Olesen; Cornwell, Karen L.; Gee, Sherry L.; Bassham, James A.


    Isolated cells from leaves of Spinacea oleracea have been maintained in a state capable of high rates of photosynthetic CO{sub 2} fixation for more than 60 h. The incorporation of {sup 14}CO{sub 2} under saturating CO{sub 2} conditions into carbohydrates, carboxylic acids, and amino acids, and the effect of ammonia on this incorporation have been studied. Total incorporation, specific radioactivity and pool size have been determined as a function of time for most of the protein amino acids and for {gamma}-aminobutyric acid. the measurements of specific activities and of the approaches to {sup 14}C "saturation" of some amino acids indicate the presence and relative sizes of metabolically active and passive pools of these amino acids. Added ammonia decreased carbon fixation into carbohydrates and increased fixation into carboxylic acids and amino acids. Different amino acids were, however, affected in different and highly specific ways. Ammonia caused large stimulatory effects in incorporation of {sup 14}C into glutamine (a factor of 16), No effect or slight decreases were seen in glycine, serine, phenylalanine, and tyrosine labeling, In.the case of glutamate, {sup 14}C-labeling decreased, but specific activity increased. The production of labeled {gamma}-aminobutyric acid was virtually stopped by ammonia. The results indicate that added ammonia stimulates the reactions mediated by pyruvate kinase and phosphoenolpyruvate carboxylase, as seen with other plant systems. The data on the effects of added ammonia on total labeling, pool sizes, and specific activities of several amino acids provides a number of indications about the intracellular sites of principal synthesis from carbon skeletons of these amino acids and the selective nature of effects of increased intracellular ammonia concentration on such synthesis.

  11. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.


    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  12. Metabolism of nonessential N-15-labeled amino acids and the measurement of human whole-body protein synthesis rates

    NASA Technical Reports Server (NTRS)

    Stein, T. P.; Settle, R. G.; Albina, J. A.; Melnick, G.; Dempsey, D. T.


    Eight N-15-labeled nonessential amino acids plus (N-15)H4Cl were administered over a 10-h period to four healthy adult males using a primed-constant dosage regimen. The amount of N-15 excreted in the urine and the urinary ammonia, hippuric acid, and plasma alanine N-15 enrichments were measured. There was a high degree of consistency across subjects in the ordering of the nine compounds based on the fraction of N-15 excreted.

  13. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.


    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  14. Rate in template-directed polymer synthesis

    NASA Astrophysics Data System (ADS)

    Saito, Takuya


    We discuss the temporal efficiency of template-directed polymer synthesis, such as DNA replication and transcription, under a given template string. To weigh the synthesis speed and accuracy on the same scale, we propose a template-directed synthesis (TDS) rate, which contains an expression analogous to that for the Shannon entropy. Increasing the synthesis speed accelerates the TDS rate, but the TDS rate is lowered if the produced sequences are diversified. We apply the TDS rate to some production system models and investigate how the balance between the speed and the accuracy is affected by changes in the system conditions.

  15. Synthesis of fatty acids in the perused mouse liver.


    Salmon, D M; Bowen, N L; Hems, D A


    1. Fatty acid synthesis de novo was measured in the perfused liver of fed mice. 2. The total rate, measured by the incorporation into fatty acid of (3)H from (3)H(2)O (1-7mumol of fatty acid/h per g of fresh liver), resembled the rate found in the liver of intact mice. 3. Perfusions with l-[U-(14)C]lactic acid and [U-(14)C]glucose showed that circulating glucose at concentrations less than about 17mm was not a major carbon source for newly synthesized fatty acid, whereas lactate (10mm) markedly stimulated fatty acid synthesis, and contributed extensive carbon to lipogenesis. 4. The identification of 50% of the carbon converted into newly synthesized fatty acid lends further credibility to the use of (3)H(2)O to measure hepatic fatty acid synthesis. 5. The total rate of fatty acid synthesis, and the contribution of glucose carbon to lipogenesis, were directly proportional to the initial hepatic glycogen concentration. 6. The proportion of total newly synthesized lipid that was released into the perfusion medium was 12-16%. 7. The major products of lipogenesis were saturated fatty acids in triglyceride and phospholipid. 8. The rate of cholesterol synthesis, also measured with (3)H(2)O, expressed as acetyl residues consumed, was about one-fourth of the basal rate of fatty acid synthesis. 9. These results are discussed in terms of the carbon sources of hepatic newly synthesized fatty acids, and the effect of glucose, glycogen and lactate in stimulating lipogenesis, independently of their role as precursors. PMID:4464843

  16. Genetics Home Reference: congenital bile acid synthesis defect type 1


    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  17. Genetics Home Reference: congenital bile acid synthesis defect type 2


    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  18. Hydroxamic acids in asymmetric synthesis.


    Li, Zhi; Yamamoto, Hisashi


    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst's center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Because of their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless asymmetric epoxidation, which uses the titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless asymmetric epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  19. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi


    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  20. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.


    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  1. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth


    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  2. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John


    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  3. Synthesis of new polysialic acid derivatives.


    Su, Yi; Kasper, Cornelia; Kirschning, Andreas; Dräger, Gerald; Berski, Silke


    In this paper we report the first synthesis of novel polysialic acid derivatives which is initiated by treatment of polysialic acid with EDC-HCl to yield the inter-residual delta-lactone. Subsequent reaction with amines or hydrazine gives the corresponding polysialic acid amides and hydrazide. Alkylation of the tetrabutylammonium salt of polysialic acid yields polysialic acid esters. In contrast a variety of N-derivatives of polysialic acid can be prepared starting from deacetylated polysialic acid. The N-derivatives prepared in this communication can be used for the Cu-catalyzed as well as Cu-free "click" chemistry. PMID:20602419

  4. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.


    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  5. Total synthesis of (+)-zaragozic acid C.


    Armstrong, A; Barsanti, P A; Jones, L H; Ahmed, G


    A total synthesis of (+)-zaragozic acid C is described. Key features of the synthesis are the use of a double Sharpless asymmetric dihydroxylation reaction of diene 6 to control stereochemistry at four contiguous stereocenters from C3 to C6; the introduction of the C1-side chain by reaction between the anion derived from the dithiane monosulfoxide 27 and the core aldehyde 12; a high yielding, acid-mediated simultaneous acetonide deprotection-dithiane removal-ketalization procedure leading exclusively to the 2, 8-dioxabicyclo[3.2.1]octane core 34; and a novel triple oxidation procedure allowing installation of the tricarboxylic acid. PMID:11031024

  6. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.


    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809


    Technology Transfer Automated Retrieval System (TEKTRAN)

    In adults, sepsis reduces protein synthesis in skeletal muscle by restraining translation. The effect of sepsis on amino acid-stimulated muscle protein synthesis has not been determined in neonates, a population who is highly anabolic and whose muscle protein synthesis rates are uniquely sensitive ...

  8. Synthesis of alpha-amino acids


    Davis, Jr., Jefferson W.


    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  9. Synthesis of alpha-amino acids


    Davis, Jr., Jefferson W.


    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  10. Bile Acid Synthesis in the Isolated, Perfused Rabbit Liver

    PubMed Central

    Mosbach, E. H.; Rothschild, M. A.; Bekersky, I.; Oratz, M.; Mongelli, J.


    These experiments were carried out to demonstrate the usefulness of the perfused rabbit liver for studies of bile acid metabolism, and to determine the rate-limiting enzyme of bile acid synthesis. Rabbits were fed a semisynthetic diet, with or without the addition of 1% cholestyramine, under controlled conditions. At the end of 2-5 wk, the livers were removed and perfused for 2.5 hr employing various 14C-labeled precursors to measure de novo cholic acid synthesis. The livers were then analyzed for cholesterol, and the bile collected during the perfusion was analyzed for cholesterol and bile acids. Control bile contained, on the average, 0.34 mg of glycocholate, 7.4 mg of glycodeoxycholate, and 0.06 mg of cholesterol. After cholestyramine treatment of the donor rabbits, the bile contained 3.3 mg of glycocholate, 3.7 mg of glycodeoxycholate, and 0.05 mg of cholesterol. It was assumed that in cholestyramine-treated animals the enterohepatic circulation of the bile acids had been interrupted sufficiently to release the feedback inhibition of the rate-controlling enzyme of bile acid synthesis. Therefore, a given precursor should be incorporated into bile acids at a more rapid rate in livers of cholestyramine-treated animals, provided that the precursor was acted upon by the rate-controlling enzyme. It was found that the incorporation of acetate-14C, mevalonolactone-14C, and cholesterol-14C into cholate was 5-20 times greater in the livers of cholestyramine-treated animals than in the controls. In contrast, there was no difference in the incorporation of 7α-hydroxycholesterol-14C into cholate regardless of dietary pretreatment. It was concluded that given an adequate precursor pool, the 7α-hydroxylation of cholesterol is the rate-limiting step in bile acid formation. PMID:5097576

  11. Enantioselective Total Synthesis of Secalonic Acid E.


    Ganapathy, Dhandapani; Reiner, Johannes R; Löffler, Lorenz E; Ma, Ling; Gnanaprakasam, Boopathy; Niepötter, Benedikt; Koehne, Ingo; Tietze, Lutz F


    The first enantioselective synthesis of a secalonic acid containing a dimeric tetrahydroxanthenone skeleton is described, using a Wacker-type cyclization of a methoxyphenolic compound to form a chiral chroman with a quaternary carbon stereogenic center with >99% ee. Further steps are a Sharpless dihydroxylation and a Dieckmann condensation to give a tetrahydroxanthenone. A late-stage one-pot palladium-catalyzed Suzuki-dimerization reaction leads to the 2,2'-biphenol linkage to complete the enantioselective total synthesis of secalonic acid E in 18 steps with 8% overall yield. PMID:26447631

  12. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].


    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua


    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  13. Synthesis of (+) and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  14. Synthesis of (+)- and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  15. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.


    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  16. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.


    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  17. Synthesis of nucleic acid methylphosphonothioates.

    PubMed Central

    Roelen, H C; de Vroom, E; van der Marel, G A; van Boom, J H


    The reagent obtained in situ by treating methylphosphonothioic dichloride with 1-hydroxy-6-trifluoromethylbenzotriazole could be used for the introduction of methylphosphonothioate linkages. The individual diastereomers of the protected dimer d-Tp(S,Me)A were applied in the synthesis of the chiral pure (R or S) hexamers d-[CpCpTp(S,Me)ApGpG]. The reagent showed also to be very effective for the preparation of the 3',5'-cyclic methylphosphonothioate of uridine. PMID:3412896

  18. Effect of rate of weight gain of steers during the stocker phase. IV. Rumen fermentation characteristics and expression of genes involved in substrate utilization for fatty acid synthesis in adipose tissues of growing-finishing beef cattle.


    Lancaster, P A; Sharman, E D; Horn, G W; Krehbiel, C R; Dillwith, J W; Starkey, J D


    The objective of this study was to determine the impact of stocker production systems differing in growth rate on rumen fermentation characteristics and utilization of substrates for fatty acid synthesis in intramuscular (IM), subcutaneous (SC), and perirenal (PR) adipose tissues. Angus steers were assigned to 4 stocker cattle production systems in 2 consecutive years: 1) 1.0 kg/d of 40% CP cottonseed meal–based supplement while grazing dormant native range (CON), 2) ground corn/soybean meal–based supplement while grazing dormant native range fed at 1% of BW (CORN), 3) grazing wheat pasture at a high stocking rate to achieve a low rate of BW gain (LGWP), and 4) grazing wheat pasture at a low stocking rate for a high rate of BW gain (HGWP). Eight ruminally cannulated steers were used to determine rumen fermentation characteristics. Steers were harvested during the stocker phase at similar age (different carcass weight) in Exp. 1 (3 steers/treatment) or at similar carcass weight in Exp. 2 (4 steers/treatment). Adipose tissues were analyzed for mRNA expression of genes involved in glucose (solute carrier family 2, member 4 [GLUT4], glucose-6-phosphate dehydrogenase [G6PDH], phosphofructokinase, muscle [PFKM], and pyruvate kinase 2, muscle [PK2]), lactate (lactate dehydrogenase B [LDHB]), and acetate (acetyl-CoA synthetase, cytosol [ACSS2]) utilization for fatty acid synthesis. The acetate:propionate ratio was least (P < 0.05) for HGWP steers, intermediate for CORN and LGWP steers, and greatest for CON steers. At similar age, LGWP and HGWP steers tended (F-test; P < 0.15) to have greater (P < 0.10) G6PDH and ACSS2 mRNA expression than CON and CORN steers in SC and PR but not IM adipose tissue. Expression of PFKM and PK2 mRNA tended (F-test; P < 0.15) to be greater (P < 0.10) in HGWP than CON and LGWP steers in IM but not SC or PR adipose tissue. At similar HCW, expression of GLUT4 and G6PDH mRNA were greater (P < 0.10) in SC adipose tissue of LGWP and HGWP steers

  19. Synthesis of alpha-amino acids


    Davis, Jr., Jefferson W.


    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  20. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.


    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  1. Synthesis of carbon-13-labeled tetradecanoic acids.


    Sparrow, J T; Patel, K M; Morrisett, J D


    The synthesis of tetradecanoic acid enriched with 13C at carbons 1, 3, or 6 is described. The label at the carbonyl carbon was introduced by treating 1-bromotridecane with K13CN (90% enriched) to form the 13C-labeled nitrile, which upon hydrolysis yielded the desired acid. The [3-13C]tetradecanoic acid was synthesized by alkylation of diethyl sodio-malonate with [1-13C]1-bromododecane; the acid was obtained upon saponification and decarboxylation. The label at the 6 position was introduced by coupling the appropriately labeled alkylcadmium chloride with the half acid chloride methyl ester of the appropriate dioic acid, giving the corresponding oxo fatty acid ester. Formation of the tosylhydrazone of the oxo-ester followed by reduction with sodium cyanoborohydride gave the labeled methyl tetradecanoate which, upon hydrolysis, yielded the desired tetradecanoic acid. All tetradecanoic acids were identical to unlabeled analogs as evaluated by gas-liquid chromatography and infrared or NMR spectroscopy. These labeled fatty acids were used subsequently to prepare the correspondingly labeled diacyl phosphatidylcholines. PMID:6631228

  2. Synthesis of alpha-amino acids


    Davis, J.W. Jr.


    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  3. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.


    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  4. Amino Acid Synthesis in Photosynthesizing Spinach Cells 1

    PubMed Central

    Larsen, Peder Olesen; Cornwell, Karen L.; Gee, Sherry L.; Bassham, James A.


    Isolated cells from leaves of Spinacia oleracea have been maintained in a state capable of high rates of photosynthetic CO2 fixation for more than 60 hours. The incorporation of 14CO2 under saturating CO2 conditions into carbohydrates, carboxylic acids, and amino acids, and the effect of ammonia on this incorporation have been studied. Total incorporation, specific radioactivity, and pool size have been determined as a function of time for most of the protein amino acids and for γ-aminobutyric acid. The measurements of specific radio-activities and of the approaches to 14C “saturation” of some amino acids indicate the presence and relative sizes of metabolically active and passive pools of these amino acids. Added ammonia decreased carbon fixation into carbohydrates and increased fixation into carboxylic acids and amino acids. Different amino acids were, however, affected in different and highly specific ways. Ammonia caused large stimulatory effects in incorporation of 14C into glutamine (a factor of 21), aspartate, asparagine, valine, alanine, arginine, and histidine. No effect or slight decreases were seen in glycine, serine, phenylalanine, and tyrosine labeling. In the case of glutamate, 14C labeling decreased, but specific radioactivity increased. The production of labeled γ-aminobutyric acid was virtually stopped by ammonia. The results indicate that added ammonia stimulates the reactions mediated by pyruvate kinase and phosphoenolpyruvate carboxylase, as seen with other plant systems. The data on the effects of added ammonia on total labeling, pool sizes, and specific radioactivities of several amino acids provides a number of indications about the intracellular sites of principal synthesis from carbon skeletons of these amino acids and the selective nature of effects of increased intracellular ammonia concentration on such synthesis. PMID:16661904

  5. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.


    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  6. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.


    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  7. On the nature of rate acceleration in the synthesis and fragmentation of triazolines by Brønsted acid: secondary catalysis by water (hydronium triflate).


    Hong, Ki Bum; Donahue, Matthew G; Johnston, Jeffrey N


    Rate acceleration of the addition of benzyl azide to an electron deficient olefin is characterized using in situ IR spectroscopy. Under strictly anhydrous conditions and at depressed temperature (-20 degrees C), a triazoline intermediate is selectively formed. The stability of this protonated triazoline intermediate at -20 degrees C is indefinite, but warming of the reaction mixture to 0 degrees C or above results in its conversion to the beta-amino oxazolidine dione observed under conditions used in our earlier report. As an alternative to warming, the same conversion can be effected by the addition of a single equivalent of water. Our experiments collectively demonstrate the metastability of the protonated triazoline intermediate and secondary catalysis of triazolinium ring fragmentation by water. This behavior is attributed to the ability of water to transfer a proton from N3 to N1 of the triazoline, thereby allowing ring fragmentation and nitrogen expulsion. PMID:18217758

  8. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )


    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  9. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei


    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  10. Hyaluronic acid lipoate: synthesis and physicochemical properties.


    Picotti, Fabrizio; Fabbian, Matteo; Gianni, Rita; Sechi, Alessandra; Stucchi, Luca; Bosco, Marco


    The synthesis and physicochemical characterisation of mixed lipoic and formic esters of hyaluronan (Lipohyal) are presented in this paper. The synthesis was conducted by activating lipoic acid with 1,1'-carbonyldiimidazole to obtain lipoyl imidazolide, which reacted with hyaluronan (HA) in formamide under basic conditions. This procedure allows researchers to modulate easily the degree of substitution over a range of 0.05-1.8. Radical scavenger properties were analysed by UV-vis spectroscopy, where improved performance was demonstrated for Lipohyal with respect to the HA row material and lipoic acid. The chemical modification also causes HA to show an improved resistance to hyaluronidase digestion. These findings show that Lipohyal is a highly interesting derivative for applications in the tricological and dermo-cosmetic field and as an anti-aging ingredient. Moreover, Lipohyal can be easily crosslinked by UV irradiation, resulting in an innovative hydrogel with distinctive viscoelastic properties that is suitable as both a dermal-filler and as an intra-articular medical device. PMID:23465930

  11. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.


    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  12. Amino acids augment muscle protein synthesis in neonatal pigs during acute endotoxemia by stimulating mTOR-dependent translation initiation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...

  13. Rapid synthesis of the 7-deoxy zaragozic acid core.


    Calter, Michael A; Zhu, Cheng; Lachicotte, Rene J


    [reaction: see text] We have developed an efficient synthesis of the 7-deoxy zaragozic acid core. The synthesis begins with a Feist-Bénary reaction that assembles all three carbons of the polycarboxylic acid portion of the core. This reaction is followed by highly diastereoselective aldol and dihydroxylation reactions that set the remaining stereocenters of the core. The synthesis finishes with lactol oxidation and lactone alcoholysis/ketal formation reactions to construct the bicyclic ring system of the core. PMID:11796052

  14. First total synthesis of prasinic acid and its anticancer activity.


    Chakor, Narayan; Patil, Ganesh; Writer, Diana; Periyasamy, Giridharan; Sharma, Rajiv; Roychowdhury, Abhijit; Mishra, Prabhu Dutt


    The first total synthesis of prasinic acid is being reported along with its biological evaluation. The ten step synthesis involved readily available and cheap starting materials and can easily be transposed to large scale manufacturing. The crucial steps of the synthesis included the formation of two different aromatic units (7 and 9) and their coupling reaction. The synthetic prasinic acid exhibited moderate antitumor activity (IC(50) 4.3-9.1 μM) in different lines of cancer cells. PMID:23031589

  15. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds.


    Adhikari, Neil D; Bates, Philip D; Browse, John


    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  16. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John


    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  17. Inhibition of sterol but not fatty acid synthesis by valproate in developing rat brain in vivo.

    PubMed Central

    Bolaños, J P; Medina, J M; Williamson, D H


    The effect of administration of valproate on lipogenesis in the developing rat brain in vivo was studied. Valproate inhibited by 21-38% the rate of 3H2O incorporation into brain sterols, without significantly affecting fatty acid synthesis. Similarly, R-[2-14C]mevalonate incorporation into sterols was inhibited by 33-54%; the low rate of fatty acid synthesis under these conditions was not affected by valproate. Plasma ketone bodies decreased after treatment with valproate. Valproate inhibited (about 50%) both sterol and fatty acid synthesis in livers of weanling rats. It is concluded that valproate can specifically inhibit sterol synthesis in the brain during development, in part at a stage after mevalonate formation, and also by decreased exogenous precursor supply. PMID:2264830

  18. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.


    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  19. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.


    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine


    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  20. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine


    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  1. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.


    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G


    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  2. Role of Malic Enzyme during Fatty Acid Synthesis in the Oleaginous Fungus Mortierella alpina

    PubMed Central

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao


    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi. PMID:24532075

  3. Increased collagen synthesis rate during wound healing in muscle.


    Zhou, Shaobo; Salisbury, Jonathan; Preedy, Victor R; Emery, Peter W


    Wound healing in muscle involves the deposition of collagen, but it is not known whether this is achieved by changes in the synthesis or the degradation of collagen. We have used a reliable flooding dose method to measure collagen synthesis rate in vivo in rat abdominal muscle following a surgical incision. Collagen synthesis rate was increased by 480% and 860% on days 2 and 7 respectively after surgery in the wounded muscle compared with an undamaged area of the same muscle. Collagen content was increased by approximately 100% at both day 2 and day 7. These results demonstrate that collagen deposition during wound healing in muscle is achieved entirely by an increase in the rate of collagen synthesis. PMID:23526975

  4. Circulating protein synthesis rates reveal skeletal muscle proteome dynamics.


    Shankaran, Mahalakshmi; King, Chelsea L; Angel, Thomas E; Holmes, William E; Li, Kelvin W; Colangelo, Marc; Price, John C; Turner, Scott M; Bell, Christopher; Hamilton, Karyn L; Miller, Benjamin F; Hellerstein, Marc K


    Here, we have described and validated a strategy for monitoring skeletal muscle protein synthesis rates in rodents and humans over days or weeks from blood samples. We based this approach on label incorporation into proteins that are synthesized specifically in skeletal muscle and escape into the circulation. Heavy water labeling combined with sensitive tandem mass spectrometric analysis allowed integrated synthesis rates of proteins in muscle tissue across the proteome to be measured over several weeks. Fractional synthesis rate (FSR) of plasma creatine kinase M-type (CK-M) and carbonic anhydrase 3 (CA-3) in the blood, more than 90% of which is derived from skeletal muscle, correlated closely with FSR of CK-M, CA-3, and other proteins of various ontologies in skeletal muscle tissue in both rodents and humans. Protein synthesis rates across the muscle proteome generally changed in a coordinate manner in response to a sprint interval exercise training regimen in humans and to denervation or clenbuterol treatment in rodents. FSR of plasma CK-M and CA-3 revealed changes and interindividual differences in muscle tissue proteome dynamics. In human subjects, sprint interval training primarily stimulated synthesis of structural and glycolytic proteins. Together, our results indicate that this approach provides a virtual biopsy, sensitively revealing individualized changes in proteome-wide synthesis rates in skeletal muscle without a muscle biopsy. Accordingly, this approach has potential applications for the diagnosis, management, and treatment of muscle disorders. PMID:26657858

  5. Circulating protein synthesis rates reveal skeletal muscle proteome dynamics

    PubMed Central

    Shankaran, Mahalakshmi; King, Chelsea L.; Angel, Thomas E.; Holmes, William E.; Li, Kelvin W.; Colangelo, Marc; Price, John C.; Turner, Scott M.; Bell, Christopher; Hamilton, Karyn L.; Miller, Benjamin F.; Hellerstein, Marc K.


    Here, we have described and validated a strategy for monitoring skeletal muscle protein synthesis rates in rodents and humans over days or weeks from blood samples. We based this approach on label incorporation into proteins that are synthesized specifically in skeletal muscle and escape into the circulation. Heavy water labeling combined with sensitive tandem mass spectrometric analysis allowed integrated synthesis rates of proteins in muscle tissue across the proteome to be measured over several weeks. Fractional synthesis rate (FSR) of plasma creatine kinase M-type (CK-M) and carbonic anhydrase 3 (CA-3) in the blood, more than 90% of which is derived from skeletal muscle, correlated closely with FSR of CK-M, CA-3, and other proteins of various ontologies in skeletal muscle tissue in both rodents and humans. Protein synthesis rates across the muscle proteome generally changed in a coordinate manner in response to a sprint interval exercise training regimen in humans and to denervation or clenbuterol treatment in rodents. FSR of plasma CK-M and CA-3 revealed changes and interindividual differences in muscle tissue proteome dynamics. In human subjects, sprint interval training primarily stimulated synthesis of structural and glycolytic proteins. Together, our results indicate that this approach provides a virtual biopsy, sensitively revealing individualized changes in proteome-wide synthesis rates in skeletal muscle without a muscle biopsy. Accordingly, this approach has potential applications for the diagnosis, management, and treatment of muscle disorders. PMID:26657858

  6. Cell Division During Inhibition of Deoxyribonucleic Acid Synthesis in Escherichia coli

    PubMed Central

    Helmstetter, Charles E.; Pierucci, Olga


    When cultures of Escherichia coli B/r growing at various rates were exposed to ultraviolet light, mitomycin C, or nalidixic acid, deoxyribonucleic acid (DNA) synthesis stopped but cell division continued for at least 20 min. The chromosome configurations in the cells which divided were estimated by determining the rate of DNA synthesis during the division cycle. The cultures were pulse-labeled with 14C-thymidine, and the amount of label incorporated into cells of different ages was found by measuring the radioactivity in cells born subsequent to the labeling period. The cells which divided in the absence of DNA synthesis were those which had completed a round of chromosome replication prior to the treatments. It was concluded that completion of a round of replication is a necessary and sufficient condition of DNA synthesis for cell division. PMID:4870278

  7. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.


    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  8. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central


    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  9. Total synthesis and complete stereostructure of gambieric acid A.


    Fuwa, Haruhiko; Ishigai, Kazuya; Hashizume, Keisuke; Sasaki, Makoto


    Total synthesis of gambieric acid A, a potent antifungal polycyclic ether metabolite, has been accomplished for the first time, which firmly established the complete stereostructure of this natural product. PMID:22779404

  10. High-deposition-rate ceramics synthesis

    SciTech Connect

    Allendorf, M.D.; Osterheld, T.H.; Outka, D.A.


    Parallel experimental and computational investigations are conducted in this project to develop validated numerical models of ceramic synthesis processes. Experiments are conducted in the High-Temperature Materials Synthesis Laboratory in Sandia`s Combustion Research Facility. A high-temperature flow reactor that can accommodate small preforms (1-3 cm diameter) generates conditions under which deposition can be observed, with flexibility to vary both deposition temperature (up to 1500 K) and pressure (as low as 10 torr). Both mass spectrometric and laser diagnostic probes are available to provide measurements of gas-phase compositions. Experiments using surface analytical techniques are also applied to characterize important processes occuring on the deposit surface. Computational tools developed through extensive research in the combustion field are employed to simulate the chemically reacting flows present in typical industrial reactors. These include the CHEMKIN and Surface-CHEMKIN suites of codes, which permit facile development of complex reaction mechanisms and vastly simplify the implementation of multi-component transport and thermodynamics. Quantum chemistry codes are also used to estimate thermodynamic and kinetic data for species and reactions for which this information is unavailable.

  11. A symmetry-based formal synthesis of zaragozic acid A.


    Freeman-Cook, K D; Halcomb, R L


    A symmetry-based strategy for the synthesis of the zaragozic acids is reported. Two enantioselective dihydroxylations were used to establish the absolute configuration of a C(2) symmetric intermediate. Noteworthy transformations include a group-selective lactonization, which accomplished an end-differentiation of a pseudo-C(2) symmetric intermediate. Late stage protecting group adjustments and oxidations accomplished a formal synthesis of zaragozic acid A. PMID:10987953

  12. Photoorganocatalytic One-Pot Synthesis of Hydroxamic Acids from Aldehydes.


    Papadopoulos, Giorgos N; Kokotos, Christoforos G


    An efficient one-pot synthesis of hydroxamic acids from aldehydes and hydroxylamine is described. A fast, visible-light-mediated metal-free hydroacylation of dialkyl azodicarboxylates was used to develop the subsequent addition of hydroxylamine hydrochloride. A range of aliphatic and aromatic aldehydes were employed in this reaction to give hydroxamic acids in high to excellent yields. Application of the current methodology was demonstrated in the synthesis of the anticancer medicine vorinostat. PMID:27038037

  13. Exogenous fatty acids affect CDP-choline pathway to increase phosphatidylcholine synthesis in granular pneumocytes

    SciTech Connect

    Chander, A.; Gullo, J.; Reicherter, J.; Fisher, A.


    Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased only by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.

  14. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.


    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  15. Protein synthesis rates in atrophied gastrocnemius muscles after limb immobilization

    NASA Technical Reports Server (NTRS)

    Tucker, K. R.; Seider, M. J.; Booth, F. W.


    Noting that protein synthesis declines in the gastrocnemius 6 hr after immobilization, the study sought to detect an increase of protein synthesis when the limb was freed, and to examine the effects of exercise on the rate of increase. Rats were used as subjects, with their hind legs in plaster of Paris in plantar flexion to eliminate strain on the gastrocnemius. Periods of immobilization were varied and samples of blood from the muscle were taken to track protein synthesis rates for different groups in immobilization and exercise regimens (running and weightlifting). Synthesis rates declined 3.6% during time in the cast, then increased 6.3%/day after the casts were removed. Both running and weightlifting were found to increase the fractional rate of protein formation in the gastrocnemius muscle when compared with contralateral muscles that were not exercised and were used as controls, suggesting that the mechanism controlling protein synthesis in skeletal muscles is rapidly responsive to changes in muscular contractile activity.

  16. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    SciTech Connect

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.


    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  17. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.


    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  18. Differential regulation of protein synthesis by amino acids and insulin in peripheral and visceral tissues of neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and ...


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Skeletal muscle grows at a very rapid rate in the neonatal pig, due in part to an enhanced sensitivity of protein synthesis to the postprandial rise in amino acids. An increase in leucine alone stimulates protein synthesis in skeletal muscle of the neonatal pig; however, the effect of isoleucine and...

  20. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  1. Retinol metabolism in LLC-PK1 Cells. Characterization of retinoic acid synthesis by an established mammalian cell line.


    Napoli, J L


    Specific assays, based on gas chromatography-mass spectrometry and high-performance liquid chromatography, were used to quantify the conversion of retinol and retinal into retinoic acid by the pig kidney cell line LLC-PK1. Retinoic acid synthesis was linear for 2-4 h as well as with graded amounts of either substrate to at least 50 microM. Retinoic acid concentrations increased through 6-8 h, but decreased thereafter because of substrate depletion (t1/2 of retinol = 13 h) and product metabolism (1/2 = 2.3 h). Retinoic acid metabolism was accelerated by treating cells with 100 nM retinoic acid for 10 h (t1/2 = 1.7 h) and was inhibited by the antimycotic imidazole ketoconazole. Feedback inhibition was not indicated since retinoic acid up to 100 nM did not inhibit its own synthesis. Retinol dehydrogenation was rate-limiting. The reduction and dehydrogenation of retinal were 4-8-fold and 30-60-fold faster, respectively. Greater than 95% of retinol was converted into metabolites other than retinoic acid, whereas the major metabolite of retinal was retinoic acid. The synthetic retinoid 13-cis-N-ethylretinamide inhibited retinoic acid synthesis, but 4-hydroxylphenylretinamide did not. 4'-(9-Acridinylamino)methanesulfon-m-anisidide, an inhibitor of aldehyde oxidase, and ethanol did not inhibit retinoic acid synthesis. 4-Methylpyrazole was a weak inhibitor: disulfiram was a potent inhibitor. These data indicate that retinol dehydrogenase is a sulfhydryl group-dependent enzyme, distinct from ethanol dehydrogenase. Homogenates of LLC-PK1 cells converted retinol into retinoic acid and retinyl palmitate and hydrolyzed retinyl palmitate. This report suggests that substrate availability, relative to enzyme activity/amount, is a primary determinant of the rate of retinoic acid synthesis, identifies inhibitors of retinoic acid synthesis, and places retinoic acid synthesis into perspective with several other known pathways of retinoid metabolism. PMID:3759984

  2. Nucleic acid arrays and methods of synthesis


    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles


    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  3. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.


    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  4. Solid Phase Synthesis of C-Terminal Boronic Acid Peptides.


    Behnam, Mira A M; Sundermann, Tom R; Klein, Christian D


    Peptides and peptidomimetics with a C-terminal boronic acid group have prolific applications in numerous fields of research, but their synthetic accessibility remains problematic. A convenient, high yield synthesis of peptide-boronic acids on a solid support is described here, using commercially available 1-glycerol polystyrene resin. The method is compatible with Fmoc chemistry and offers a versatile approach to aryl and alkyl aminoboronic acids without additional purification steps. PMID:27104613

  5. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.


    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  6. Calcite crystal growth rate inhibition by polycarboxylic acids

    USGS Publications Warehouse

    Reddy, M.M.; Hoch, A.R.


    Calcite crystal growth rates measured in the presence of several polycarboxyclic acids show that tetrahydrofurantetracarboxylic acid (THFTCA) and cyclopentanetetracarboxylic acid (CPTCA) are effective growth rate inhibitors at low solution concentrations (0.01 to 1 mg/L). In contrast, linear polycarbocylic acids (citric acid and tricarballylic acid) had no inhibiting effect on calcite growth rates at concentrations up to 10 mg/L. Calcite crystal growth rate inhibition by cyclic polycarboxyclic acids appears to involve blockage of crystal growth sites on the mineral surface by several carboxylate groups. Growth morphology varied for growth in the absence and in the presence of both THFTCA and CPTCA. More effective growth rate reduction by CPTCA relative to THFTCA suggests that inhibitor carboxylate stereochemical orientation controls calcite surface interaction with carboxylate inhibitors. ?? 20O1 Academic Press.

  7. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.


    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D


    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective. PMID:25055961

  8. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood


    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  9. Total synthesis of legionaminic acid as basis for serological studies.


    Matthies, Stefan; Stallforth, Pierre; Seeberger, Peter H


    Legionaminic acid is a nine-carbon diamino monosaccharide that is found coating the surface of various bacterial human pathogens. Its unique structure makes it a valuable biological probe, but access via isolation is difficult and no practical synthesis has been reported. We describe a stereoselective synthesis that yields a legionaminic acid building block as well as linker-equipped conjugation-ready legionaminic acid starting from cheap d-threonine. To set the desired amino and hydroxyl group pattern of the target, we designed a concise sequence of stereoselective reactions. The key transformations rely on chelation-controlled organometallic additions and a Petasis multicomponent reaction. The legionaminic acid was synthesized in a form that enables attachment to surfaces. Glycan microarray containing legionaminic acid revealed that human antibodies bind the synthetic glycoside. The synthetic bacterial monosaccharide is a valuable probe to detect an immune response to bacterial pathogens such as Legionella pneumophila, the causative agent of Legionnaire's disease. PMID:25668389

  10. Synthesis of α-aminoboronic acids.


    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos


    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton. PMID:26853637

  11. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger


    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  12. Fractional synthesis rates of DNA and protein in rabbit skin are not correlated.


    Zhang, Xiao-jun; Chinkes, David L; Wu, Zhanpin; Martini, Wenjun Z; Wolfe, Robert R


    We developed a method for measurement of skin DNA synthesis, reflecting cell division, in conscious rabbits by infusing D-[U-(13)C(6)]glucose and L-[(15)N]glycine. Cutaneous protein synthesis was simultaneously measured by infusion of L-[ring-(2)H(5)]phenylalanine. Rabbits were fitted with jugular venous and carotid arterial catheters, and were studied during the infusion of an amino acid solution (10% Travasol). The fractional synthetic rate (FSR) of DNA from the de novo nucleotide synthesis pathway, a reflection of total cell division, was 3.26 +/- 0.59%/d in whole skin and 3.08 +/- 1.86%/d in dermis (P = 0.38). The de novo base synthesis pathway accounted for 76 and 60% of the total DNA FSR in whole skin and dermis, respectively; the contribution from the base salvage pathway was 24% in whole skin and 40% in dermis. The FSR of protein in whole skin was 5.35 +/- 4.42%/d, which was greater (P < 0.05) than that in dermis (2.91 +/- 2.52%/d). The FSRs of DNA and protein were not correlated (P = 0.33), indicating that cell division and protein synthesis are likely regulated by different mechanisms. This new approach enables investigations of metabolic disorders of skin diseases and regulation of skin wound healing by distinguishing the 2 principal components of skin metabolism, which are cell division and protein synthesis. PMID:15333735

  13. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.


    Awasthi, Neeraj Praphulla; Singh, R P


    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  14. Loss of nuclear receptor SHP impairs but does not eliminate negative feedback regulation of bile acid synthesis.


    Kerr, Thomas A; Saeki, Shigeru; Schneider, Manfred; Schaefer, Karen; Berdy, Sara; Redder, Thadd; Shan, Bei; Russell, David W; Schwarz, Margrit


    The in vivo role of the nuclear receptor SHP in feedback regulation of bile acid synthesis was examined. Loss of SHP in mice caused abnormal accumulation and increased synthesis of bile acids due to derepression of rate-limiting CYP7A1 and CYP8B1 hydroxylase enzymes in the biosynthetic pathway. Dietary bile acids induced liver damage and restored feedback regulation. A synthetic agonist of the nuclear receptor FXR was not hepatotoxic and had no regulatory effects. Reduction of the bile acid pool with cholestyramine enhanced CYP7A1 and CYP8B1 expression. We conclude that input from three negative regulatory pathways controls bile acid synthesis. One is mediated by SHP, and two are SHP independent and invoked by liver damage and changes in bile acid pool size. PMID:12062084

  15. Comparison of bile acid synthesis determined by isotope dilution versus fecal acidic sterol output in human subjects

    SciTech Connect

    Duane, W.C.; Holloway, D.E.; Hutton, S.W.; Corcoran, P.J.; Haas, N.A.


    Fecal acidic sterol output has been found to be much lower than bile acid synthesis determined by isotope dilution. Because of this confusing discrepancy, we compared these 2 measurements done simultaneously on 13 occasions in 5 normal volunteers. In contrast to previous findings, bile acid synthesis by the Lindstedt isotope dilution method averaged 16.3% lower than synthesis simultaneously determined by fecal acidic sterol output (95% confidence limit for the difference - 22.2 to -10.4%). When one-sample determinations of bile acid pools were substituted for Lindstedt pools, bile acid synthesis by isotope dilution averaged 5.6% higher than synthesis by fecal acidic sterol output (95% confidence limits -4.9 to 16.1%). These data indicate that the 2 methods yield values in reasonably close agreement with one another. If anything, fecal acidic sterol outputs are slightly higher than synthesis by isotope dilution.

  16. Synthesis of biobased succinonitrile from glutamic acid and glutamine.


    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M


    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  17. Acid-labile mPEG-Vinyl Ether-1,2-Dioleylglycerol Lipids with Tunable pH Sensitivity: Synthesis and Structural Effects on Hydrolysis Rates, DOPE Liposome Release Performance and Pharmacokinetics

    PubMed Central

    Shin, Junhwa; Shum, Pochi; Grey, Jessica; Fujiwara, Shin-ichi; Malhotra, Guarov S.; González-Bonet, Andres; Hyun, Seok-Hee; Moase, Elaine; Allen, Theresa M.; Thompson, David H.


    A family of 3-methoxypoly(ethylene glycol)-vinyl ether-1,2-dioleylglycerol (mPEG-VE-DOG) lipopolymer conjugates, designed on the basis of DFT calculations to possess a wide range of proton affinities, was synthesized and tested for their hydrolysis kinetics in neutral and acidic buffers. Extruded ~100 nm liposomes containing these constructs in ≥90 mol% 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) produced dispersions that retained their calcein cargo for more than 2 days at pH 7.5, but released the encapsulated contents over a wide range of timescales as a function of the electronic properties of the vinyl ether linkage, the solution pH and the mPEG-VE-DOG composition in the membrane. The in vivo performance of two different 90:10 DOPE:mPEG-VE-DOG compositions was also evaluated for blood circulation time and biodistribution in mice, using 125I-tyraminylinulin as a label. The pharmacokinetic profiles gave a T1/2 of 7 h and 3 h for 90:10 DOPE:ST302 and 90:10 DOPE:ST502, respectively, with the liposomes being cleared predominantly by liver and spleen uptake. The behavior of these DOPE:mPEG-VE-DOG formulations is consistent with their relative rates of vinyl ether hydrolysis, i.e., the more acid-sensitive mPEG-VE-DOG derivatives produce faster leakage rates from DOPE:mPEG-VE-DOG liposomes, but decreased the blood circulation times in mice. These findings suggest that the vinyl ether-based PEG-lipid derivatives are promising agents for stabilizing acid-sensitive DOPE liposomes to produce formulations with a priori control over their pH-responsiveness in vitro. Our data also suggest, however, that the same factors that contribute to enhanced acid-sensitivity of the DOPE:mPEG-VE-DOG dispersions are also likely responsible for their reduced pharmacokinetic profiles. PMID:23030381

  18. Acid-labile mPEG-vinyl ether-1,2-dioleylglycerol lipids with tunable pH sensitivity: synthesis and structural effects on hydrolysis rates, DOPE liposome release performance, and pharmacokinetics.


    Shin, Junhwa; Shum, Pochi; Grey, Jessica; Fujiwara, Shin-ichi; Malhotra, Guarov S; González-Bonet, Andres; Hyun, Seok-Hee; Moase, Elaine; Allen, Theresa M; Thompson, David H


    A family of 3-methoxypoly(ethylene glycol)-vinyl ether-1,2-dioleylglycerol (mPEG-VE-DOG) lipopolymer conjugates, designed on the basis of DFT calculations to possess a wide range of proton affinities, was synthesized and tested for their hydrolysis kinetics in neutral and acidic buffers. Extruded ∼100 nm liposomes containing these constructs in ≥90 mol % 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) produced dispersions that retained their calcein cargo for more than 2 days at pH 7.5, but released the encapsulated contents over a wide range of time scales as a function of the electronic properties of the vinyl ether linkage, the solution pH, and the mPEG-VE-DOG composition in the membrane. The in vivo performance of two different 90:10 DOPE:mPEG-VE-DOG compositions was also evaluated for blood circulation time and biodistribution in mice, using (125)I-tyraminylinulin as a label. The pharmacokinetic profiles gave a t(1/2) of 7 and 3 h for 90:10 DOPE:ST302 and 90:10 DOPE:ST502, respectively, with the liposomes being cleared predominantly by liver and spleen uptake. The behavior of these DOPE:mPEG-VE-DOG formulations is consistent with their relative rates of vinyl ether hydrolysis, i.e., the more acid-sensitive mPEG-VE-DOG derivatives produced faster leakage rates from DOPE:mPEG-VE-DOG liposomes, but decreased the blood circulation times in mice. These findings suggest that the vinyl ether-based PEG-lipid derivatives are promising agents for stabilizing acid-sensitive DOPE liposomes to produce formulations with a priori control over their pH responsiveness in vitro. Our data also suggest, however, that the same factors that contribute to enhanced acid sensitivity of the DOPE:mPEG-VE-DOG dispersions are also likely responsible for their reduced pharmacokinetic profiles. PMID:23030381

  19. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.


    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko


    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. PMID:24845645

  20. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.


    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  1. Stereoselective synthesis of unsaturated α-amino acids.


    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine


    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid. PMID:25715756

  2. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.


    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  3. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  4. Enantioselective synthesis of isotopically labeled homocitric acid lactone.


    Moore, Jared T; Hanhan, Nadine V; Mahoney, Maximillian E; Cramer, Stephen P; Shaw, Jared T


    A concise synthesis of homocitric acid lactone was developed to accommodate systematic placement of carbon isotopes (specifically (13)C) for detailed studies of this cofactor. This new route uses a chiral allylic alcohol, available in multigram quantities from enzymatic resolution, as a starting material, which transposes asymmetry through an Ireland-Claisen rearrangement. PMID:24180620

  5. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.


    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  6. Amino acid synthesis in Europa's subsurface environment

    NASA Astrophysics Data System (ADS)

    Abbas, Sam H.; Schulze-Makuch, Dirk


    It has been suggested that Europa's subsurface environment may provide a haven for prebiotic evolution and the development of exotic biotic systems. The detection of hydrogen peroxide, sulfuric acid, water, hydrates and related species on the surface, coupled with observed mobility of icebergs, suggests the presence of a substantial subsurface liquid reservoir that actively exchanges materials with the surface environment. The atmospheric, surface and subsurface environments are described with their known chemistry. Three synthetic schemes using hydrogen peroxide, sulfuric acid and hydrocyanic acid leading to the production of larger biologically important molecules such as amino acids are described. Metabolic pathways based on properties of the subsurface ocean environment are detailed. Tidal heating, osmotic gradients, chemical cycling, as well as hydrothermal vents, provide energy and materials that may support a course of prebiotic evolution leading to the development or sustenance of simple biotic systems. Putative organisms may employ metabolic pathways based on chemical oxidation reduction cycles occurring in the putative subsurface ocean environment.

  7. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji


    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  8. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.


    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  9. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.


    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu


    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues. PMID:26572799

  10. Synthesis and chirality of amino acids under interstellar conditions.


    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J


    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  11. Glucose and Insulin Induction of Bile Acid Synthesis

    PubMed Central

    Li, Tiangang; Francl, Jessica M.; Boehme, Shannon; Ochoa, Adrian; Zhang, Youcai; Klaassen, Curtis D.; Erickson, Sandra K.; Chiang, John Y. L.


    Bile acids facilitate postprandial absorption of nutrients. Bile acids also activate the farnesoid X receptor (FXR) and the G protein-coupled receptor TGR5 and play a major role in regulating lipid, glucose, and energy metabolism. Transgenic expression of cholesterol 7α-hydroxylase (CYP7A1) prevented high fat diet-induced diabetes and obesity in mice. In this study, we investigated the nutrient effects on bile acid synthesis. Refeeding of a chow diet to fasted mice increased CYP7A1 expression, bile acid pool size, and serum bile acids in wild type and humanized CYP7A1-transgenic mice. Chromatin immunoprecipitation assays showed that glucose increased histone acetylation and decreased histone methylation on the CYP7A1 gene promoter. Refeeding also induced CYP7A1 in fxr-deficient mice, indicating that FXR signaling did not play a role in postprandial regulation of bile acid synthesis. In streptozocin-induced type I diabetic mice and genetically obese type II diabetic ob/ob mice, hyperglycemia increased histone acetylation status on the CYP7A1 gene promoter, leading to elevated basal Cyp7a1 expression and an enlarged bile acid pool with altered bile acid composition. However, refeeding did not further increase CYP7A1 expression in diabetic mice. In summary, this study demonstrates that glucose and insulin are major postprandial factors that induce CYP7A1 gene expression and bile acid synthesis. Glucose induces CYP7A1 gene expression mainly by epigenetic mechanisms. In diabetic mice, CYP7A1 chromatin is hyperacetylated, and fasting to refeeding response is impaired and may exacerbate metabolic disorders in diabetes. PMID:22144677

  12. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.


    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  13. De novo fatty acid synthesis at the mitotic exit is required to complete cellular division

    PubMed Central

    Scaglia, Natalia; Tyekucheva, Svitlana; Zadra, Giorgia; Photopoulos, Cornelia; Loda, Massimo


    Although the regulation of the cell cycle has been extensively studied, much less is known about its coordination with the cellular metabolism. Using mass spectrometry we found that lysophospholipid levels decreased drastically from G2/M to G1 phase, while de novo phosphatidylcholine synthesis, the main phospholipid in mammalian cells, increased, suggesting that enhanced membrane production was concomitant to a decrease in its turnover. In addition, fatty acid synthesis and incorporation into membranes was increased upon cell division. The rate-limiting reaction for de novo fatty acid synthesis is catalyzed by acetyl-CoA carboxylase. As expected, its inhibiting phosphorylation decreased prior to cytokinesis initiation. Importantly, the inhibition of fatty acid synthesis arrested the cells at G2/M despite the presence of abundant fatty acids in the media. Our results suggest that de novo lipogenesis is essential for cell cycle completion. This “lipogenic checkpoint” at G2/M may be therapeutically exploited for hyperproliferative diseases such as cancer. PMID:24418822

  14. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.


    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  15. Effect of Growth Rate on Histidine Catabolism and Histidase Synthesis in Aerobacter aerogenes1

    PubMed Central

    Jensen, Donald E.; Neidhardt, Frederick C.


    A study was made of how the catabolism of a carbon and energy source is affected by the biosynthetic demands of growing bacterial cells. Cultures of Aerobacter aerogenes in l-histidine medium were grown in a chemostat at rates determined by the supply of either sulfate or a required amino acid, l-arginine. It was discovered that the rate at which these cells grow under a biosynthetic restriction determines both the rate and the pattern of histidine degradation. (i) Histidine catabolism is partially coupled to the growth rate. This coupling is achieved by catabolite repression of histidase (histidine ammonia lyase; EC, and also by a slightly decreased in vivo function of this enzyme at low growth rates. (ii) The looseness of the coupling results in a direct relationship between growth rate and growth yield, and possibly is correlated with an altered pattern of carbon flow from histidine. (iii) Sudden decreases in growth rate cause total repression of histidase synthesis for substantial periods of time. (iv) Sudden release of biosynthetic restriction leads rapidly to an increase in the functioning of the cells' complement of histidase, an increase in the rate of synthesis of this enzyme, and an increase in the growth yield from histidine. PMID:5781570

  16. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis.


    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing


    N-Acetylneuraminic acid lyase (NAL, E.C. number is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a "GRAS" (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  17. Lactide Synthesis and Chirality Control for Polylactic acid Production.


    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert


    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties. PMID:27071863

  18. TORC1 inhibits GSK3-mediated Elo2 phosphorylation to regulate very long chain fatty acid synthesis and autophagy.


    Zimmermann, Christine; Santos, Aline; Gable, Kenneth; Epstein, Sharon; Gururaj, Charulatha; Chymkowitch, Pierre; Pultz, Dennis; Rødkær, Steven V; Clay, Lorena; Bjørås, Magnar; Barral, Yves; Chang, Amy; Færgeman, Nils J; Dunn, Teresa M; Riezman, Howard; Enserink, Jorrit M


    Very long chain fatty acids (VLCFAs) are essential fatty acids with multiple functions, including ceramide synthesis. Although the components of the VLCFA biosynthetic machinery have been elucidated, how their activity is regulated to meet the cell's metabolic demand remains unknown. The goal of this study was to identify mechanisms that regulate the rate of VLCFA synthesis, and we discovered that the fatty acid elongase Elo2 is regulated by phosphorylation. Elo2 phosphorylation is induced upon inhibition of TORC1 and requires GSK3. Expression of nonphosphorylatable Elo2 profoundly alters the ceramide spectrum, reflecting aberrant VLCFA synthesis. Furthermore, VLCFA depletion results in constitutive activation of autophagy, which requires sphingoid base phosphorylation. This constitutive activation of autophagy diminishes cell survival, indicating that VLCFAs serve to dampen the amplitude of autophagy. Together, our data reveal a function for TORC1 and GSK3 in the regulation of VLCFA synthesis that has important implications for autophagy and cell homeostasis. PMID:24239358

  19. Synthesis and phosphorylation of the glial fibrillary acidic protein during brain development: A tissue slice study

    SciTech Connect

    Noetzel, M.J. )


    Brain slices were incubated with either (3H) amino acids or (32P) orthophosphate in order to characterize the synthesis and phosphorylation of the glial fibrillary acidic protein (GFAP) in the rat nervous system. The incorporation of (3H) amino acids into GFAP was found to increase significantly during early postnatal development, reaching a peak of activity on day 5 of life and then declining over the next 2 weeks. Concomitant with this peak of synthetic activity the content of GFAP in rat brain was also observed to increase dramatically. GFAP continued to accumulate in brain through postnatal day 30 despite a decrease in the synthesis of the protein. These results indicate that the increase in GFAP during the first month of life cannot be ascribed solely to the rate of GFAP synthesis. The findings are consistent with the hypothesis that during later stages of astrocytic development the accumulation of GFAP may be primarily dependent upon a low rate of protein degradation. The pattern of GFAP phosphorylation in the developing rat brain differed from that observed for the incorporation of (3H) amino acids. The peak incorporation of 32P into GFAP occurred on postnatal day 10 at a time when synthesis of the protein had declined by 43%. These findings suggest that during development phosphorylation of GFAP is mediated by factors different from those directing its synthesis. In addition, phosphorylation of GFAP did not alter its solubility in cytoskeletal preparations indicating that GFAP phosphorylation is probably not a major regulatory mechanism in disassembly of the astroglial filaments.


    EPA Science Inventory

    SPARC chemical reactivity models were extended to calculate hydrolysis rate constants for carboxylic acid esters from molecular structure. The energy differences between the initial state and the transition state for a molecule of interest are factored into internal and external...

  1. Heart Rate Response and Lactic Acid Concentration in Squash Players.

    ERIC Educational Resources Information Center

    Beaudin, Paula; And Others


    It was concluded that playing squash is an activity that results in heart rate responses of sufficient intensity to elicit aerobic training effects without producing high lactic acid concentration in the blood. (MM)

  2. Insulin-independent regulation of hepatic triglyceride synthesis by fatty acids

    PubMed Central

    Vatner, Daniel F.; Majumdar, Sachin K.; Kumashiro, Naoki; Petersen, Max C.; Rahimi, Yasmeen; Gattu, Arijeet K.; Bears, Mitchell; Camporez, João-Paulo G.; Cline, Gary W.; Jurczak, Michael J.; Samuel, Varman T.; Shulman, Gerald I.


    A central paradox in type 2 diabetes is the apparent selective nature of hepatic insulin resistance—wherein insulin fails to suppress hepatic glucose production yet continues to stimulate lipogenesis, resulting in hyperglycemia, hyperlipidemia, and hepatic steatosis. Although efforts to explain this have focused on finding a branch point in insulin signaling where hepatic glucose and lipid metabolism diverge, we hypothesized that hepatic triglyceride synthesis could be driven by substrate, independent of changes in hepatic insulin signaling. We tested this hypothesis in rats by infusing [U-13C] palmitate to measure rates of fatty acid esterification into hepatic triglyceride while varying plasma fatty acid and insulin concentrations independently. These experiments were performed in normal rats, high fat-fed insulin-resistant rats, and insulin receptor 2′-O-methoxyethyl chimeric antisense oligonucleotide-treated rats. Rates of fatty acid esterification into hepatic triglyceride were found to be dependent on plasma fatty acid infusion rates, independent of changes in plasma insulin concentrations and independent of hepatocellular insulin signaling. Taken together, these results obviate a paradox of selective insulin resistance, because the major source of hepatic lipid synthesis, esterification of preformed fatty acids, is primarily dependent on substrate delivery and largely independent of hepatic insulin action. PMID:25564660

  3. A quantitative autoradiographic method for the measurement of local rates of brain protein synthesis

    SciTech Connect

    Dwyer, B.E.; Donatoni, P.; Wasterlain, C.G.


    We have developed a new method for measuring local rates of brain protein synthesis in vivo. It combines the intraperitoneal injection of a large dose of low specific activity amino acid with quantitative autoradiography. This method has several advantages: 1) It is ideally suited for young or small animals or where immobilizing an animal is undesirable. 2 The amino acid injection ''floods'' amino acid pools so that errors in estimating precursor specific activity, which is especially important in pathological conditions, are minimized. 3) The method provides for the use of a radioautographic internal standard in which valine incorporation is measured directly. Internal standards from experimental animals correct for tissue protein content and self-absorption of radiation in tissue sections which could vary under experimental conditions.

  4. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.


    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi


    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions. PMID:26807980

  5. Synthesis of Branched Methyl Hydroxy Stearates Including an Ester from Bio-Based Levulinic Acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report the synthesis of 5 useful branched methyl alpha-hydroxy oleate esters from commercially available methyl oleate and common organic acids. Of special interest is the synthesis utilizing the natural byproduct, levulinic acid. The other common organic acids used herein were propionic acid, ...

  6. Voluntary Exercise Regionally Augments Rates of Cerebral Protein Synthesis

    PubMed Central

    Nadel, Jeffrey; Huang, Tianjian; Xia, Zengyan; Burlin, Thomas; Zametkin, Alan; Smith, Carolyn Beebe


    Exercise is a natural form of neurophysiologic stimulation that has known benefits for mental health, maintenance of cerebral function, and stress reduction. Exercise is known to induce an upregulation of brain-derived neurotrophic factor and this is thought to be involved in associated increases in neural plasticity. Protein synthesis is also an essential component of adaptive plasticity. We hypothesized that exercise may stimulate changes in brain protein synthesis as part of its effects on plasticity. Here, we applied the quantitative autoradiographic L-[1-14C] leucine method to the in vivo determination of regional rates of cerebral protein synthesis (rCPS) in adult rats following a seven day period of voluntary wheel-running and their sedentary counterparts. In four of 21 brain regions examined, the mean values of rCPS in the exercised rats were statistically significantly higher than in sedentary controls; regions affected were paraventricular hypothalamic nucleus, ventral hippocampus as a whole, CA1 pyramidal cell layer in ventral hippocampus, and frontal cortex. Increases in rCPS approached statistical significance in dentate gyrus of the ventral hippocampus. Our results affirm the value of exercise in encouraging hippocampal and possibly cortical neuroplasticity, and also suggest that exercise may modulate stimulation of stress-response pathways. Ultimately, our study indicates that measurement of rCPS with PET might be used as a marker of brain response to exercise in human subjects. PMID:24016692

  7. Factors influencing the rate of non-enzymatic activation of carboxylic and amino acids by ATP

    NASA Technical Reports Server (NTRS)

    Mullins, D. W., Jr.; Lacey, J. C., Jr.


    The nonenzymatic formation of adenylate anhydrides of carboxylic and amino acids is discussed as a necessary step in the origin of the genetic code and protein biosynthesis. Results of studies are presented which have shown the rate of activation to depend on the pKa of the carboxyl group, the pH of the medium, temperature, the divalent metal ion catalyst, salt concentration, and the nature of the amino acid. In particular, it was found that of the various amino acids investigated, phenylalanine had the greatest affinity for the adenine derivatives adenosine and ATP. Results thus indicate that selective affinities between amino acids and nucleotides were important during prebiotic chemical evolution, and may have played a major role in the origin of protein synthesis and genetic coding.

  8. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.


    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip


    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  9. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  10. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.


    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie


    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5 % based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications. PMID:26895244

  11. Synthesis of bosutinib from 3-methoxy-4-hydroxybenzoic acid.


    Yin, Xiao Jia; Xu, Guan Hong; Sun, Xu; Peng, Yan; Ji, Xing; Jiang, Ke; Li, Fei


    This paper reports a novel synthesis of bosutinib starting from 3-methoxy-4-hydroxybenzoic acid. The process starts with esterification of the starting material, followed by alkylation, nitration, reduction, cyclization, chlorination and two successive amination reactions. The intermediates and target molecule were characterized by (1)H-NMR, (13)C-NMR, MS and the purities of all the compounds were determined by HPLC. PMID:20657439

  12. Strategies for the Total Synthesis of Clavicipitic Acid.


    Ito, Mamoru; Tahara, Yu-Ki; Shibata, Takanori


    Clavicipitic acid is an ergot alkaloid, which was isolated from Claviceps strain and Claviceps fusiformis. Its unique tricyclic azepinoindole skeleton has attracted synthetic chemists, and various strategies have been developed for its total synthesis. These strategies can be generally categorized into two types based on the synthetic intermediates, namely, 4-substituted gramine derivatives and 4-substituted tryptophan derivatives. This Minireview summarizes the reported total syntheses from the point of these two key intermediates. PMID:26822254

  13. Total Synthesis of (−)-Nodulisporic Acid D

    PubMed Central

    Zou, Yike; Melvin, Jason E.; Gonzales, Stephen S.; Spafford, Matthew J.; Smith, Amos B.


    A convergent total synthesis of the architecturally complex indole diterpenoid (−)-nodulisporic acid D has been achieved. Key synthetic transformations include vicinal difunctionalization of an advanced α,β-unsaturated aldehyde to form the E,F-transfused 5,6-ring system of the eastern hemisphere and a cascade cross-coupling/indolization protocol leading to the CDE multisubstituted indole core. PMID:26029849

  14. Synthesis of Rosin Acid Starch Catalyzed by Lipase

    PubMed Central

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin


    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156

  15. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun


    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  16. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.


    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G


    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  17. Insulin accelerates global and mitochondrial protein synthesis rates in neonatal muscle during sepsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In neonatal pigs, sepsis decreases protein synthesis in skeletal muscle by decreasing translation initiation. However, insulin stimulates muscle protein synthesis despite persistent repression of translation initiation signaling. To determine whether the insulin-induced increase in global rates of m...

  18. Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans

    PubMed Central

    Watts, Jennifer L.; Browse, John


    Polyunsaturated fatty acids (PUFAs) are important membrane components and precursors of signaling molecules. To investigate the roles of these fatty acids in growth, development, and neurological function in an animal system, we isolated Caenorhabditis elegans mutants deficient in PUFA synthesis by direct analysis of fatty acid composition. C. elegans possesses all the desaturase and elongase activities to synthesize arachidonic acid and eicosapentaenoic acid from saturated fatty acid precursors. In our screen we identified mutants with defects in each fatty acid desaturation and elongation step of the PUFA biosynthetic pathway. The fatty acid compositions of the mutants reveal the substrate preferences of the desaturase and elongase enzymes and clearly demarcate the steps of this pathway. The mutants show that C. elegans does not require n3 or Δ5-unsaturated PUFAs for normal development under laboratory conditions. However, mutants with more severe PUFA deficiencies display growth and neurological defects. The mutants provide tools for investigating the roles of PUFAs in membrane biology and cell function in this animal model. PMID:11972048

  19. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others


    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  20. Urinary excretion of mevalonic acid as an indicator of cholesterol synthesis.


    Lindenthal, B; Simatupang, A; Dotti, M T; Federico, A; Lütjohann, D; von Bergmann, K


    Urinary excretion of mevalonic acid was investigated as an indicator of cholesterol synthesis. In normolipemic volunteers, excretion of mevalonic acid averaged 3.51 +/- 0.59 (SD) micrograms/kg x day1; (n = 24) and was not different from patients with hypercholesterolemia (3.30 +/- 0.92 micrograms/kg x day1; n = 24). In patients with cerebrotendineous xanthomatosis, the excretion was significantly higher (8.55 +/- 1.92 micrograms/kg x day1; n = 6, P < 0.001) but comparable to volunteers treated with cholestyramine (6.69 +/- 2.6 micrograms/kg x day1; n = 5). A significant correlation was found between 24-h excretion of mevalonic acid and cholesterol synthesis (r = 0.835; n = 35; P < 0.001). The coefficient of variation of excretion of mevalonic acid during 3 consecutive days was small (9.8%; n = 7). However, urinary output of mevalonic acid was significantly higher during the night (164 +/- 14 micrograms/12-h) than during the day (129 +/- 9 micrograms/12-h; n = 11; P < 0.05). In patients treated with simvastatin (40 mg/day) for 6 weeks, the ratio of mevalonic acid to creatinine in a morning urine sample decreased significantly compared to pretreatment values (110 +/- 25 micrograms/g vs. 66 +/- 25 micrograms/g; P < 0.001). Furthermore, the ratio of mevalonic acid to creatinine in a morning urine sample correlated with the ratio from the 24-h collection period (r = 0.714; n = 34; P < 0.001). The results indicate that the analysis of urinary mevalonic acid, either in 24-h collection or in a single morning sample, is an attractive method for evaluation of long and very short term changes of the rates of cholesterol synthesis. PMID:8906596

  1. Synthesis of Phenolics and Flavonoids in Ginger (Zingiber officinale Roscoe) and Their Effects on Photosynthesis Rate

    PubMed Central

    Ghasemzadeh, Ali; Jaafar, Hawa Z. E.; Rahmat, Asmah


    The relationship between phenolics and flavonoids synthesis/accumulation and photosynthesis rate was investigated for two Malaysian ginger (Zingiber officinale) varieties grown under four levels of glasshouse light intensity, namely 310, 460, 630 and 790 μmol m−2s−1. High performance liquid chromatography (HPLC) was employed to identify and quantify the polyphenolic components. The results of HPLC analysis indicated that synthesis and partitioning of quercetin, rutin, catechin, epicatechin and naringenin were high in plants grown under 310 μmol m−2s−1. The average value of flavonoids synthesis in leaves for both varieties increased (Halia Bentong 26.1%; Halia Bara 19.5%) when light intensity decreased. Photosynthetic rate and plant biomass increased in both varieties with increasing light intensity. More specifically, a high photosynthesis rate (12.25 μmol CO2 m−2s−1 in Halia Bara) and plant biomass (79.47 g in Halia Bentong) were observed at 790 μmol m−2s−1. Furthermore, plants with the lowest rate of photosynthesis had highest flavonoids content. Previous studies have shown that quercetin inhibits and salicylic acid induces the electron transport rate in photosynthesis photosystems. In the current study, quercetin was an abundant flavonoid in both ginger varieties. Moreover, higher concentration of quercetin (1.12 mg/g dry weight) was found in Halia Bara leaves grown under 310 μmol m−2s−1 with a low photosynthesis rate. Furthermore, a high content of salicylic acid (0.673 mg/g dry weight) was detected in Halia Bara leaves exposed under 790 μmol m−2s−1 with a high photosynthesis rate. No salicylic acid was detected in gingers grown under 310 μmol m−2s−1. Ginger is a semi-shade loving plant that does not require high light intensity for photosynthesis. Different photosynthesis rates at different light intensities may be related to the absence or presence of some flavonoid and phenolic compounds. PMID:21151455

  2. Amino acids fail to prevent halothane depression of albumin synthesis: studies in the isolated perfused rat liver.


    Kruskal, J B; Franks, J J; Kirsch, R E


    Halothane (1.3 MAC) and ethanol (0.4%) depress albumin synthesis in isolated perfused rat livers (IPRLs). Addition of amino acids prevents depression by ethanol. We have examined the effects of amino acids on albumin synthesis by IPRLs exposed to halothane. Seventeen livers were perfused with a mixture of rat erythrocytes and rabbit plasma. Five were exposed to oxygen/carbon dioxide alone and 12 to oxygen/carbon dioxide with 1.5% halothane. A mixture of 10 essential amino acids was added to the perfusate of six of the halothane-exposed livers to a concentration approximately 10 times the normal rat plasma level. Perfusate concentrations of newly synthesized albumin were measured by radial immunodiffusion, and the rate of synthesis for the 4.25-h study period was calculated. The mean +/- SEM albumin synthetic rate (mg/h per 300-g rat) in the control group (12.13 +/- 1.36) was significantly greater than in the group receiving halothane alone (6.98 +/- 0.92). Amino acid treatment failed to prevent halothane depression of albumin synthesis (8.68 +/- 0.84). Thus, although amino acids block ethanol depression of albumin synthesis, we could show no such effect in rat livers exposed to halothane. PMID:1984365

  3. In Vitro Fatty Acid Synthesis and Complex Lipid Metabolism in the Cyanobacterium Anabaena variabilis: I. Some Characteristics of Fatty Acid Synthesis.


    Lem, N W; Stumpf, P K


    In vitro fatty acid synthesis was examined in crude cell extracts, soluble fractions, and 80% (NH(4))(2)SO(4) fractions from Anabaena variabilis M3. Fatty acid synthesis was absolutely dependent upon acyl carrier protein and required NADPH and NADH. Moreover, fatty acid synthesis and elongation occurred in the cytoplasm of the cell. The major fatty acid products were palmitic acid (16:0) and stearic acid (18:0). Of considerable interest, both stearoyl-acyl carrier protein and stearoyl-coenzyme A desaturases were not detected in any of the fractions from A. variabilis. The similarities and differences in fatty acid synthesis between A. variabilis and higher plant tissues are discussed with respect to the endosymbiotic theory of chloroplast evolution. PMID:16663367

  4. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.


    Cronan, John E


    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise, and the BioH esterase is responsible for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl acyl carrier protein of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyltransferase followed by sulfur insertion at carbons C-6 and C-8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and, thus, there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA, a dual-function protein

  5. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.


    Cronan, John E


    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid was discovered 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway, in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin, were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase, followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and thus there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system exerted through BirA, a dual-function protein that both represses

  6. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.


    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  7. Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid

    NASA Technical Reports Server (NTRS)

    Nakashima, T.; Fox, S. W.


    The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.

  8. Arginine Depletion by Arginine Deiminase Does Not Affect Whole Protein Metabolism or Muscle Fractional Protein Synthesis Rate in Mice

    PubMed Central

    Marini, Juan C.; Didelija, Inka Cajo


    Due to the absolute need for arginine that certain cancer cells have, arginine depletion is a therapy in clinical trials to treat several types of cancers. Arginine is an amino acids utilized not only as a precursor for other important molecules, but also for protein synthesis. Because arginine depletion can potentially exacerbate the progressive loss of body weight, and especially lean body mass, in cancer patients we determined the effect of arginine depletion by pegylated arginine deiminase (ADI-PEG 20) on whole body protein synthesis and fractional protein synthesis rate in multiple tissues of mice. ADI-PEG 20 successfully depleted circulating arginine (<1 μmol/L), and increased citrulline concentration more than tenfold. Body weight and body composition, however, were not affected by ADI-PEG 20. Despite the depletion of arginine, whole body protein synthesis and breakdown were maintained in the ADI-PEG 20 treated mice. The fractional protein synthesis rate of muscle was also not affected by arginine depletion. Most tissues (liver, kidney, spleen, heart, lungs, stomach, small and large intestine, pancreas) were able to maintain their fractional protein synthesis rate; however, the fractional protein synthesis rate of brain, thymus and testicles was reduced due to the ADI-PEG 20 treatment. Furthermore, these results were confirmed by the incorporation of ureido [14C]citrulline, which indicate the local conversion into arginine, into protein. In conclusion, the intracellular recycling pathway of citrulline is able to provide enough arginine to maintain protein synthesis rate and prevent the loss of lean body mass and body weight. PMID:25775142

  9. Ascorbic acid intake and oxalate synthesis.


    Knight, John; Madduma-Liyanage, Kumudu; Mobley, James A; Assimos, Dean G; Holmes, Ross P


    In humans, approximately 60 mg of ascorbic acid (AA) breaks down in the body each day and has to be replaced by a dietary intake of 70 mg in women and 90 mg in men to maintain optimal health and AA homeostasis. The breakdown of AA is non-enzymatic and results in oxalate formation. The exact amount of oxalate formed has been difficult to ascertain primarily due to the limited availability of healthy human tissue for such research and the difficulty in measuring AA and its breakdown products. The breakdown of 60 mg of AA to oxalate could potentially result in the formation of up to 30 mg oxalate per day. This exceeds our estimates of the endogenous production of 10-25 mg oxalate per day, indicating that degradative pathways that do not form oxalate exist. In this review, we examine what is known about the pathways of AA metabolism and how oxalate forms. We further identify how gaps in our knowledge may be filled to more precisely determine the contribution of AA breakdown to oxalate production in humans. The use of stable isotopes of AA to directly assess the conversion of vitamin to oxalate should help fill this void. PMID:27002809

  10. The regulation of triglyceride synthesis and fatty acid synthesis in rat epididymal adipose tissue. Effects of altered dietary and hormonal conditions

    PubMed Central

    Saggerson, E. D.; Greenbaum, A. L.


    1. Epididymal adipose tissues obtained from rats that had been previously starved, starved and refed a high fat diet for 72h, starved and refed bread for 144h or fed a normal diet were incubated in the presence of insulin+glucose or insulin+glucose+acetate. 2. Measurements were made of the whole-tissue concentrations of hexose phosphates, triose phosphates, glycerol 1-phosphate, 3-phosphoglycerate, 6-phosphogluconate, adenine nucleotides, acid-soluble CoA, long-chain fatty acyl-CoA, malate and citrate after 1h of incubation. The release of lactate, pyruvate and glycerol into the incubation medium during this period was also determined. 3. The rates of metabolism of glucose in the hexose monophosphate pathway, the glycolytic pathway, the citric acid cycle and into glyceride glycerol, fatty acids and lactate+pyruvate were also determined over a 2h period in similarly treated tissues. The metabolism of acetate to CO2 and fatty acids in the presence of glucose was also measured. 4. The activities of acetyl-CoA carboxylase, fatty acid synthetase and isocitrate dehydrogenase were determined in adipose tissues from starved, starved and fat-refed, and alloxan-diabetic animals and also in tissues from animals that had been starved and refed bread for up to 96h. Changes in these activities were compared with the ability of similar tissues to incorporate [14C]glucose into fatty acids in vitro. 5. The activities of acetyl-CoA carboxylase and fatty acid synthetase roughly paralleled the ability of tissues to incorporate glucose into fatty acids. 6. Rates of triglyceride synthesis and fatty acid synthesis could not be correlated with tissue concentrations of long-chain fatty acyl-CoA, citrate or glycerol 1-phosphate. In some cases changes in phosphofructokinase flux rates could be correlated with changes in citrate concentration. 7. The main lesion in fatty acid synthesis in tissues from starved, starved and fat-refed, and alloxan-diabetic rats appeared to reside at the level of

  11. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.


    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R


    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives. PMID:26784936

  12. Core-collapse supernova rate synthesis within 11 Mpc

    NASA Astrophysics Data System (ADS)

    Xiao, Lin; Eldridge, J. J.


    The 11 Mpc Hα and Ultraviolet Galaxy Survey (11HUGS) traces the star formation activity of nearby galaxies. In addition, within this volume the detection completeness of core-collapse supernovae (CCSNe) is high therefore by comparing these observed stellar births and deaths we can make a sensitive test of our understanding of how stars live and die. In this paper, we use the results of the Binary Population and Spectral Synthesis (BPASS) code to simulate the 11HUGS galaxies' Hα and far-ultraviolet (FUV) star formation rate indicators (SFRIs) and simultaneously match the CCSN rate. We find that stellar population including interacting binary stars makes little difference to the total CCSN rate but increases the Hα and FUV fluxes for a constant number of stars being formed. In addition, they significantly increase the predicted rate of Type Ibc SNe relative to Type II SNe to the level observed in the 11HUGS galaxies. We also find that instead of assuming a constant star formation history for the galaxies our best-fitting models have an SFR that peaked more than 3 Myr ago.

  13. Physiologic hyperinsulinemia stimulates protein synthesis and enhances transport of selected amino acids in human skeletal muscle.

    PubMed Central

    Biolo, G; Declan Fleming, R Y; Wolfe, R R


    We have investigated the mechanisms of the anabolic effect of insulin on muscle protein metabolism in healthy volunteers, using stable isotopic tracers of amino acids. Calculations of muscle protein synthesis, breakdown, and amino acid transport were based on data obtained with the leg arteriovenous catheterization and muscle biopsy. Insulin was infused (0.15 mU/min per 100 ml leg) into the femoral artery to increase femoral venous insulin concentration (from 10 +/- 2 to 77 +/- 9 microU/ml) with minimal systemic perturbations. Tissue concentrations of free essential amino acids decreased (P < 0.05) after insulin. The fractional synthesis rate of muscle protein (precursor-product approach) increased (P < 0.01) after insulin from 0.0401 +/- 0.0072 to 0.0677 +/- 0.0101%/h. Consistent with this observation, rates of utilization for protein synthesis of intracellular phenylalanine and lysine (arteriovenous balance approach) also increased from 40 +/- 8 to 59 +/- 8 (P < 0.05) and from 219 +/- 21 to 298 +/- 37 (P < 0.08) nmol/min per 100 ml leg, respectively. Release from protein breakdown of phenylalanine, leucine, and lysine was not significantly modified by insulin. Local hyperinsulinemia increased (P < 0.05) the rates of inward transport of leucine, lysine, and alanine, from 164 +/- 22 to 200 +/- 25, from 126 +/- 11 to 221 +/- 30, and from 403 +/- 64 to 595 +/- 106 nmol/min per 100 ml leg, respectively. Transport of phenylalanine did not change significantly. We conclude that insulin promoted muscle anabolism, primarily by stimulating protein synthesis independently of any effect on transmembrane transport. Images PMID:7860765

  14. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.


    Smith, B A; Dworkin, M


    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  15. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.


    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  16. Increased Bile Acid Synthesis and Deconjugation After Biliopancreatic Diversion.


    Ferrannini, Ele; Camastra, Stefania; Astiarraga, Brenno; Nannipieri, Monica; Castro-Perez, Jose; Xie, Dan; Wang, Liangsu; Chakravarthy, Manu; Haeusler, Rebecca A


    Biliopancreatic diversion (BPD) improves insulin sensitivity and decreases serum cholesterol out of proportion with weight loss. Mechanisms of these effects are unknown. One set of proposed contributors to metabolic improvements after bariatric surgeries is bile acids (BAs). We investigated the early and late effects of BPD on plasma BA levels, composition, and markers of BA synthesis in 15 patients with type 2 diabetes (T2D). We compared these to the early and late effects of Roux-en-Y gastric bypass (RYGB) in 22 patients with T2D and 16 with normal glucose tolerance. Seven weeks after BPD, insulin sensitivity had doubled and serum cholesterol had halved. At this time, BA synthesis markers and total plasma BAs, particularly unconjugated BAs, had markedly risen; this effect could not be entirely explained by low FGF19. In contrast, after RYGB, insulin sensitivity improved gradually with weight loss and cholesterol levels declined marginally; BA synthesis markers were decreased at an early time point (2 weeks) after surgery and returned to the normal range 1 year later. These findings indicate that BA synthesis contributes to the decreased serum cholesterol after BPD. Moreover, they suggest a potential role for altered enterohepatic circulation of BAs in improving insulin sensitivity and cholesterol metabolism after BPD. PMID:26015549

  17. The acid tolerance response of Salmonella typhimurium involves transient synthesis of key acid shock proteins.

    PubMed Central

    Foster, J W


    Although Salmonella typhimurium prefers neutral-pH environments, it can adapt to survive conditions of severe low-pH stress (pH 3.3). The process, termed the acid tolerance response (ATR), includes two distinct stages. The first stage, called pre-acid shock, is induced at pH 5.8 and involves the production of an inducible pH homeostasis system functional at external pH values below 4.0. The second stage occurs following an acid shock shift to pH 4.5 or below and is called the post-acid shock stage. During this stage of the ATR, 43 acid shock proteins (ASPs) are synthesized. The present data reveal that several ASPs important for pH 3.3 acid tolerance are only transiently produced. Their disappearance after 30 to 40 min of pH 4.4 acid shock coincides with an inability to survive subsequent pH 3.3 acid challenge. Clearly, an essential feature of inducible acid tolerance is an ability to synthesize these key ASPs. The pre-acid shock stage, with its inducible pH homeostasis system, offers the cell an enhanced ability to synthesize ASPs following rapid shifts to conditions below pH 4.0, an external pH that normally prevents ASP synthesis. The data also address possible signals for ASP synthesis. The inducing signal for 22 ASPs appears to be internal acidification, while external pH serves to induce 13 others. Of the 14 transient ASPs, 10 are induced in response to changes in internal pH. Mutations in the fur (ferric uptake regulator) locus that produce an Atr- acid-sensitive phenotype also eliminate induction of six transiently induced ASPs. Images PMID:8458840

  18. The rate of the molecular clock and the cost of gratuitous protein synthesis

    PubMed Central


    Background The nature of the protein molecular clock, the protein-specific rate of amino acid substitutions, is among the central questions of molecular evolution. Protein expression level is the dominant determinant of the clock rate in a number of organisms. It has been suggested that highly expressed proteins evolve slowly in all species mainly to maintain robustness to translation errors that generate toxic misfolded proteins. Here we investigate this hypothesis experimentally by comparing the growth rate of Escherichia coli expressing wild type and misfolding-prone variants of the LacZ protein. Results We show that the cost of toxic protein misfolding is small compared to other costs associated with protein synthesis. Complementary computational analyses demonstrate that there is also a relatively weaker, but statistically significant, selection for increasing solubility and polarity in highly expressed E. coli proteins. Conclusions Although we cannot rule out the possibility that selection against misfolding toxicity significantly affects the protein clock in species other than E. coli, our results suggest that it is unlikely to be the dominant and universal factor determining the clock rate in all organisms. We find that in this bacterium other costs associated with protein synthesis are likely to play an important role. Interestingly, our experiments also suggest significant costs associated with volume effects, such as jamming of the cellular environment with unnecessary proteins. PMID:20920270


    SciTech Connect

    Pickel, Deanna L; Pickel, Joseph M; Devenyi, Jozsef; Britt, Phillip F


    Block copolymer micelle synthesis and characterization has been extensively studied. In particular, most studies have focused on the properties of the hydrophilic corona due to the micelle corona structure s impact on the biodistribution and biocompatibility. Unfortunately, less attention has been given to the effect of the core block on the micelle stability, morphology, and the rate of diffusion of small molecules from the core. This investigation is focused on the synthesis of block copolymers composed of meta-substituted styrenes and acrylic acid by Atom Transfer Radical Polymerization. Micelles with cores composed of substituted styrenes having Tgs ranging from -30 to 100 oC have been prepared and the size and shape of these micelles were characterized by Static and Dynamic Light Scattering and TEM. In addition, the critical micelle concentration and rate of diffusion of small molecules from the core were determined by fluorimetry using pyrene as the probe.

  20. High-yield synthesis of bioactive ethyl cinnamate by enzymatic esterification of cinnamic acid.


    Wang, Yun; Zhang, Dong-Hao; Zhang, Jiang-Yan; Chen, Na; Zhi, Gao-Ying


    In this paper, Lipozyme TLIM-catalyzed synthesis of ethyl cinnamate through esterification of cinnamic acid with ethanol was studied. In order to increase the yield of ethyl cinnamate, several media, including acetone, isooctane, DMSO and solvent-free medium, were investigated in this reaction. The reaction showed a high yield by using isooctane as reaction medium, which was found to be much higher than the yields reported previously. Furthermore, several parameters such as shaking rate, water activity, reaction temperature, substrate molar ratio and enzyme loading had important influences on this reaction. For instance, when temperature increased from 10 to 50 °C, the initial reaction rate increased by 18 times and the yield of ethyl cinnamate increased by 6.2 times. Under the optimum conditions, lipase-catalyzed synthesis of ethyl cinnamate gave a maximum yield of 99%, which was of general interest for developing industrial processes for the preparation of ethyl cinnamate. PMID:26213020

  1. Evidence for transport intermediates in aromatic amino acid synthesis of non-green tissues

    SciTech Connect

    Leuschner, C.; Schultz, G. )


    Quinate (QA) is the predominant pre-aromatic compound formed at high rates in leaves of many plants at the early vegetation stage and transported through the phloem. The transfer of 3-dehydroquinate, 3-dehydroshikimate and (SkA) across the plastidial membranes has been evidenced. The question was whether the rate of QA uptake is comparable to that of the 3 SkA-pathway intermediates. To demonstrate this, /U-{sup 14}C/QA and /U-{sup 14}C/SkA were applied to Brassica rapa roots. Both compounds were uptaken at considerable rates and incorporated into aromatic amino acids (Phe + Tyr + Trp formation, in nmol/g fresh wt x h: applying 145 {mu}mol QA: 21.2; applying 156 {mu}mol Ska: 31.8). Thus, QA is a possible candidate for transport into non-green tissues for aromatic amino acid synthesis.

  2. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.


    van den Broek, Lambertus A M; Boeriu, Carmen G


    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described. PMID:23465902

  3. Simian Virus 40 Deoxyribonucleic Acid Synthesis: Analysis by Gel Electrophoresis

    PubMed Central

    Tegtmeyer, Peter; Macasaet, Francisco


    An agarose-gel electrophoresis technique has been developed to study simian virus 40 deoxyribonucleic acid (DNA) synthesis. Superhelical DNA I, relaxed DNA II, and replicative intermediate (RI) molecules were clearly resolved from one another for analytical purposes. Moreover, the RI molecules could be identified as early or late forms on the basis of their electrophoretic migration in relation to that of DNA II. The technique has been utilized to study the kinetics of simian virus 40 DNA synthesis in pulse and in pulse-chase experiments. The average time required to complete the replication of prelabeled RI molecules and to convert them into DNA I was approximately 10 min under the experimental conditions employed. PMID:4343542

  4. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.


    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian


    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  5. Protein synthesis in isolated rabbit forelimb muscles. The possible role of metabolites of arachidonic acid in the response to intermittent stretching.

    PubMed Central

    Smith, R H; Palmer, R M; Reeds, P J


    Protein synthesis was measured in isolated intact rabbit muscles by the incorporation of [3H]phenylalanine added at a high concentration (2.5 mM) to the incubation medium. Intermittent mechanical stretching substantially increased the rate of protein synthesis relative to that in control muscles incubated under a constant tension. Indomethacin and meclofenamic acid, inhibitors of the enzyme cyclo-oxygenase, which converts free arachidonic acid into the prostaglandins, prostacyclins and thromboxanes, decreased the rate of protein synthesis in intermittently stretched muscles, but had no effect on synthesis rates in the unstimulated controls. Arachidonic acid at concentrations of 0.2 and 1.0 microM gave a highly significant increase in the rate of protein synthesis in muscles incubated under a constant tension. The ability of arachidonic acid to increase protein-synthesis rates was abolished by the addition of indomethacin. Activation of protein synthesis by intermittent stretching persisted for 10-20 min after the stretch stimulation had ceased. Indomethacin, added either during the initial incubation with intermittent stretching or during the subsequent period when protein synthesis was measured after stimulation had ceased, decreased protein-synthesis rates. This decrease was similar whether indomethacin was present during the initial, final or entire incubation period. In experiments analogous with those in (4) above, when Ca2+ was withheld and EGTA added for the entire incubation, rates of protein synthesis were again decreased. The rates of protein synthesis observed when Ca2+ was present during either an initial stimulation phase or a final, unstimulated, measurement phase were similar, and were intermediate between control rates and those in muscles incubated without Ca2+ for the whole experiment. Two prostaglandins, F2 alpha (2.8 microM) and A1 (28 microM), increased rates of protein synthesis in unstimulated muscles, but prostaglandins E2 and D2 and the

  6. Synthesis and evaluation of colletoic acid core derivatives.


    Ling, Taotao; Gautam, Lekh Nath; Griffith, Elizabeth; Das, Sourav; Lang, Walter; Shadrick, William R; Shelat, Anang; Lee, Richard; Rivas, Fatima


    Cortisol homeostasis has been linked to the pathogenesis of metabolic syndrome (MetS), since it stimulates hepatic gluconeogenesis and adipogenesis. MetS is classified as a constellation of health conditions that increase the risk of type 2 diabetes and cardiovascular disease. Intracellular cortisol levels are regulated by 11β-hydroxysteroid dehydrogenase (type 1 and type 2) in a tissue dependent manner. The type 1 enzyme (11β-HSD1) is widely expressed in glucocorticoid targeted tissues and is responsible for the conversion of cortisone to the active cortisol. Local reduction of cortisol regeneration presents a potential strategy for MetS treatment. Recently we disclosed the total synthesis of (+)-colletoic acid as a potent 11β-HSD1 inhibitor. Herein, we describe our improved processing chemistry for the synthesis of the colletoic acid core to access a diverse number of derivatives for evaluation against 11β-HSD1. The Evan's chiral auxiliary was utilized to construct the acyclic precursor 12 to afford the acorane core 9 using a modified Heck reaction in excellent chemical yields. The colletoic acid core derivatives showed modest activity against 11β-HSD1 and will serve for further biological evaluation. PMID:26820555

  7. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu


    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  8. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis.


    Arendt, Kristin L; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M; Tang, Yitai; Cho, Ahryon; Graef, Isabella A; Chen, Lu


    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca(2+) levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca(2+)-levels to RA synthesis remains unknown. Here we identify the Ca(2+)-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca(2+)-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  9. Rates of synthesis of prealbumin and retinol-binding protein during acute inflammation in the rat.


    Felding, P; Fex, G


    The rates of synthesis of prealbumin (PA), retinol-binding protein (RBP), and other plasma proteins were measured in primary monolayer cultures of rat hepatocytes isolated from normal rats and from rats 18 h after induction of an inflammatory reaction by subcutaneous injection of croton oil. The inflammatory pattern of protein synthesis seemed to persist in the isolated hepatocytes for 1-2 days. This pattern included significantly decreased rates of synthesis of PA. The rate of synthesis of RBP was probably also decreased, but significantly less than the rate of PA synthesis. The results support the idea that it is mainly the decreased rate of PA synthesis which is responsible for the decreased plasma concentration of PA, and its ligand RBP and retinol during inflammation. PMID:4039519

  10. Chloramphenicol-induced changes in the synthesis of ribosomal, transfer, and messenger ribonucleic acids in Escherichia coli B/r.


    Shen, V; Bremer, H


    The synthesis of ribosomal ribonucleic acid (rRNA), transfer RNA (tRNA) and messenger RNA (mRNA) was measured in Escherichia coli B/r after the addition of 100 mug of chloramphenicol (CAM) per ml to cultures growing either in one of three minimal media (succinate, glycerol, or glucose) or in one of the same three media supplemented with 20 amino acids. (i) During CAM treatment, rRNA and tRNA were synthesized in the same relative proportions (85:15) as during exponential growth. The faster accumulation of tRNA relative to rRNA in CAM was due to a decreased stability of rRNA that is synthesized in the presence of or immediately before the addition of CAM. (ii) CAM stimulated the synthesis of rRNA and tRNA two- to eightfold. The results fell into two groups; one group was from studies done in minimal media and the other was from amino acid-supplemented media. In each group the stimulation decreased with increasing growth rate of the culture during exponential growth before the addition of CAM; however, the stimulation in minimal media was lower than that in amino acid-supplemented media. (iii) CAM caused an increase in the proportion of rRNA and tRNA synthesis and a corresponding decrease in the proportion of mRNA synthesis. In minimal media, the residual proportion of mRNA synthesis after CAM treatment was 10 to 15% of total RNA synthesis; in amino acid-supplemented media this proportion was 0 to 10%. In either case, the residual proportion of mRNA synthesis was independent of the proportions observed during exponential growth in these media. (iv) The absolute rate of mRNA synthesis decreased severalfold with the addition of CAM; i.e., the rate of synthesis of rRNA and tRNA was increased at the expense of mRNA synthesis. (v) During exponential growth, the fraction of the instantaneous rate of total RNA synthesis that corresponds to mRNA is a function of both the growth rate and the presence or absence of amino acids in the growth medium: in the absence of amino acids

  11. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio


    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  12. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.


    Kitadai, Norio


    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids. PMID:25796392

  13. Degradation rates of glycerol polyesters at acidic and basic conditions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyesters prepared from glycerol with mixtures of adipic and citric acids were evaluated in the laboratory to estimate degradation rates over a range of pH conditions. These renewable polymers provide a market for glycerol that is generated during biodiesel production. The polyesters were prepared...

  14. Design and synthesis of boronic acid inhibitors of endothelial lipase.


    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W


    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  15. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.


    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  16. Synthesis and biological activity of novel deoxycholic acid derivatives.


    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F


    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  17. Synthesis of all nineteen appropriately protected chiral alpha-hydroxy acid equivalents of the alpha-amino acids for Boc solid-phase depsi-peptide synthesis.


    Deechongkit, Songpon; You, Shu-Li; Kelly, Jeffery W


    [reaction: see text] The preparation of depsi-peptides, amide-to-ester-substituted peptides used to probe the role of hydrogen bonding in protein folding energetics, is accomplished by replacing specific l-alpha-amino acid residues by their alpha-hydroxy acid counterparts in a solid-phase synthesis employing a t-Boc strategy. Herein we describe the efficient stereoselective synthesis of all 19 appropriately protected alpha-hydroxy acid equivalents of the l-alpha-amino acids, employing commercially available materials, expanding the number of available alpha-hydroxy acids from 9 to 19. PMID:14961607

  18. Synthesis and characterization of acidic mesoporous borosilicate thin films.


    Xiu, Tongping; Liu, Qian; Wang, Jiacheng


    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc. PMID:19441565

  19. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen


    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  20. Synthesis of 14C-labeled perfluorooctanoic and perfluorodecanoic acids; Purification of perfluorodecanoic acid

    SciTech Connect

    Reich, I.L.; Reich, H.J.; Menahan, L.A.; Peterson, R.E.


    Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.

  1. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica


    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  2. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams


    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  3. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.


    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams


    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  4. Synthesis kinetics of CdSe quantum dots in trioctylphosphine oxide and in stearic acid

    NASA Astrophysics Data System (ADS)

    Dickerson, B. D.; Irving, D. M.; Herz, E.; Claus, R. O.; Spillman, W. B.; Meissner, K. E.


    A diffusion-barrier model described the early evolution of size-dependent photoluminescence emission from CdSe quantum dots formed by organometallic synthesis. Emission peak widths, emission redshift rates, and nanocrystal growth rates all decreased to a minimum at a reaction completion time. Growth after the completion time by Ostwald ripening was marked by a doubling of the activation energy. The temperature dependence of both reaction completion rates and photoluminescence redshift rates followed Arrhenius behavior governed by activation energies that increased with solvent molecular weight, in this limited case. In stearic acid and in trioctylphosphine oxide, the typical activation energies were 0.6±0.1 and 0.92±0.26eV/molecule, respectively.

  5. Total synthesis of the squalene synthase inhibitor zaragozic acid C.


    Nakamura, Seiichi


    Zaragozic acids and squalestatins were documented by Merck, Glaxo, and Tokyo Noko University/Mitsubishi Kasei Corporation as part of a program aimed at identifying novel inhibitors of squalene synthase, as well as farnesyl transferase. These natural products have attracted considerable attention from numerous synthetic chemists because of their therapeutic potential and novel architecture. This review highlights our total syntheses of zaragozic acid C by two convergent strategies. The key steps in our first-generation synthesis involve 1) simultaneous creation of the C4 and C5 quaternary stereocenters through the Sn(OTf)2-promoted aldol coupling reaction between the alpha-keto ester and silyl ketene thioacetal derived from L- and D-tartaric acids, respectively; and 2) construction of the bicyclic core structure via acid-catalyzed internal ketalization under kinetically controlled conditions. The second-generation strategy relies on a tandem carbonyl ylide formation/1,3-dipolar cycloaddition approach and features elongation of the C1 alkyl side chain through an olefin cross-metathesis as well as high convergency and flexibility. PMID:15635219

  6. Synthesis and scavenging role of furan fatty acids

    PubMed Central

    Lemke, Rachelle A. S.; Peterson, Amelia C.; Ziegelhoffer, Eva C.; Westphall, Michael S.; Tjellström, Henrik; Coon, Joshua J.; Donohue, Timothy J.


    Fatty acids play important functional and protective roles in living systems. This paper reports on the synthesis of a previously unidentified 19 carbon furan-containing fatty acid, 10,13-epoxy-11-methyl-octadecadienoate (9-(3-methyl-5-pentylfuran-2-yl)nonanoic acid) (19Fu-FA), in phospholipids from Rhodobacter sphaeroides. We show that 19Fu-FA accumulation is increased in cells containing mutations that increase the transcriptional response of this bacterium to singlet oxygen (1O2), a reactive oxygen species generated by energy transfer from one or more light-excited donors to molecular oxygen. We identify a previously undescribed class of S-adenosylmethionine-dependent methylases that convert a phospholipid 18 carbon cis unsaturated fatty acyl chain to a 19 carbon methylated trans unsaturated fatty acyl chain (19M-UFA). We also identify genes required for the O2-dependent conversion of this 19M-UFA to 19Fu-FA. Finally, we show that the presence of 1O2 leads to turnover of 19Fu-Fa in vivo. We propose that furan-containing fatty acids like 19Fu-FA can act as a membrane-bound scavenger of 1O2, which is naturally produced by integral membrane enzymes of the R. sphaeroides photosynthetic apparatus. PMID:25092314

  7. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters


    Moens, Luc


    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  8. Measurement of local rates of brain protein synthesis by quantitative autoradiography: validation with L-(/sup 3/H)valine

    SciTech Connect

    Dwyer, B.E.; Donatoni, P.; Wasterlain, C.G.


    Following the injection of 4-day old rats with 150 mM L-(3,4-/sup 3/H)valine (10 mumol/g, IP) the incorporation of /sup 3/H into protein was linear 2 hours. Valine specific activity in the brain acid-soluble fraction was constant between 30 and 120 min after injection with a mean value of 82.3% of the injectate. Significant amounts of tritated metabolites accumulated in the brain acid-soluble fraction (41.4% of radioactivity at 120 min) but do not prove an impediment to measuring rates of protein synthesis. The rate of protein synthesis in cerebral cortex of the 4-day old rat was measured by quantitative autoradiography using (/sup 3/H)valine and /sup 3/H-sensitive film. The measured rate shows excellent agreement with that found previously using L-(1-/sup 14/C)valine. Our results suggest that (/sup 3/H)valine can be a useful precursor to measure local rates of brain protein synthesis by quantitative autoradiography.

  9. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.


    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki


    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved. PMID:17511507

  10. Fructose utilization for nucleic acid synthesis in the fetal pig.


    White, C E; Piper, E L; Noland, P R; Daniels, L B


    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  11. Regulation of Bile Acid Synthesis by Fat-soluble Vitamins A and D*

    PubMed Central

    Schmidt, Daniel R.; Holmstrom, Sam R.; Fon Tacer, Klementina; Bookout, Angie L.; Kliewer, Steven A.; Mangelsdorf, David J.


    Bile acids are required for proper absorption of dietary lipids, including fat-soluble vitamins. Here, we show that the dietary vitamins A and D inhibit bile acid synthesis by repressing hepatic expression of the rate-limiting enzyme CYP7A1. Receptors for vitamin A and D induced expression of Fgf15, an intestine-derived hormone that acts on liver to inhibit Cyp7a1. These effects were mediated through distinct cis-acting response elements in the promoter and intron of Fgf15. Interestingly, transactivation of both response elements appears to be required to maintain basal Fgf15 expression levels in vivo. Furthermore, whereas induction of Fgf15 by vitamin D is mediated through its receptor, the induction of Fgf15 by vitamin A is mediated through the retinoid X receptor/farnesoid X receptor heterodimer and is independent of bile acids, suggesting that this heterodimer functions as a distinct dietary vitamin A sensor. Notably, vitamin A treatment reversed the effects of the bile acid sequestrant cholestyramine on Fgf15, Shp, and Cyp7a1 expression, suggesting a potential therapeutic benefit of vitamin A under conditions of bile acid malabsorption. These results reveal an unexpected link between the intake of fat-soluble vitamins A and D and bile acid metabolism, which may have evolved as a means for these dietary vitamins to regulate their own absorption. PMID:20233723

  12. Effect of penicillin on fatty acid synthesis and excretion in Streptococcus mutans BHT

    SciTech Connect

    Brissette, J.L.; Pieringer, R.A.


    Treatment of exponentially growing cultures of Streptococcus mutans BHT with growth-inhibitory concentrations (0.2 microgram/ml) of benzylpenicillin stimulates the incorporation of (2-/sup 14/C) acetate into lipids excreted by the cells by as much as 69-fold, but does not change the amount of /sup 14/C incorporated into intracellular lipids. At this concentration of penicillin cellular lysis does not occur. The radioactive label is incorporated exclusively into the fatty acid moieties of the glycerolipids. During a 4-hr incubation in the presence of penicillin, the extracellular fatty acid ester concentration increases 1.5 fold, even though there is no growth or cellular lysis. An indication of the relative rate of fatty acid synthesis was most readily obtained by placing S. mutans BHT in a buffer containing /sup 14/C-acetate. Under these nongrowing conditions free fatty acids are the only lipids labeled, a factor which simplifies the assay. The addition of glycerol to the buffer causes all of the nonesterified fatty acids to be incorporated into glycerolipid. The cells excrete much of the lipid whether glycerol is present or not. Addition of penicillin to the nongrowth supporting buffer system does not stimulate the incorporation of (/sup 14/C)-acetate into fatty acids.

  13. Analyzing the effects of mechanical and osmotic loading on glycosaminoglycan synthesis rate in cartilaginous tissues.


    Gao, Xin; Zhu, Qiaoqiao; Gu, Weiyong


    The glycosaminoglycan (GAG) plays an important role in cartilaginous tissues to support and transmit mechanical loads. Many extracellular biophysical stimuli could affect GAG synthesis by cells. It has been hypothesized that the change of cell volume is a primary mechanism for cells to perceive the stimuli. Experimental studies have shown that the maximum synthesis rate of GAG is achieved at an optimal cell volume, larger or smaller than this level the GAG synthesis rate decreases. Based on the hypothesis and experimental findings in the literature, we proposed a mathematical model to quantitatively describe the cell volume dependent GAG synthesis rate in the cartilaginous tissues. Using this model, we investigated the effects of osmotic loading and mechanical loading on GAG synthesis rate. It is found our proposed mathematical model is able to well describe the change of GAG synthesis rate in isolated cells or in cartilage with variations of the osmotic loading or mechanical loading. This model is important for evaluating the GAG synthesis activity within cartilaginous tissues as well as understanding the role of mechanical loading in tissue growth or degeneration. It is also important for designing a bioreactor system with proper extracellular environment or mechanical loading for growing tissue at the maximum synthesis rate of the extracellular matrix. PMID:25638034

  14. Reduction Rates for Higher Americium Oxidation States in Nitric Acid

    SciTech Connect

    Grimes, Travis Shane; Mincher, Bruce Jay; Schmitt, Nicholas C


    The stability of hexavalent americium was measured using multiple americium concentrations and nitric acid concentrations after contact with the strong oxidant sodium bismuthate. Contrary to our hypotheses Am(VI) was not reduced faster at higher americium concentrations, and the reduction was only zero-order at short time scales. Attempts to model the reduction kinetics using zero order kinetic models showed Am(VI) reduction in nitric acid is more complex than the autoreduction processes reported by others in perchloric acid. The classical zero-order reduction of Am(VI) was found here only for short times on the order of a few hours. We did show that the rate of Am(V) production was less than the rate of Am(VI) reduction, indicating that some Am(VI) undergoes two electron-reduction to Am(IV). We also monitored the Am(VI) reduction in contact with the organic diluent dodecane. A direct comparison of these results with those in the absence of the organic diluent showed the reduction rates for Am(VI) were not statistically different for both systems. Additional americium oxidations conducted in the presence of Ce(IV)/Ce(III) ions showed that Am(VI) is reduced without the typical growth of Am(V) observed in the systems sans Ce ion. This was an interesting result which suggests a potential new reduction/oxidation pathway for Am in the presence of Ce; however, these results were very preliminary, and will require additional experiments to understand the mechanism by which this occurs. Overall, these studies have shown that hexavalent americium is fundamentally stable enough in nitric acid to run a separations process. However, the complicated nature of the reduction pathways based on the system components is far from being rigorously understood.

  15. Synthesis of E. faecium wall teichoic acid fragments.


    van der Es, Daan; Groenia, Nadia A; Laverde, Diana; Overkleeft, Herman S; Huebner, Johannes; van der Marel, Gijsbert A; Codée, Jeroen D C


    The first synthesis of different Enterococcus faecium wall teichoic acid (WTA) fragments is presented. The structure of these major cell wall components was elucidated recently and it was shown that these glycerolphosphate (GroP) based polymers are built up from -6-(GalNAc-α(1-3)-GalNAc-β(1-2)-GroP)- repeating units. We assembled WTA fragments up to three repeating units in length, in two series that differ in the stereochemistry of the glycerolphosphate moiety. The key GalNAc-GalNAc-GroP synthons, required for the synthesis, were generated from galactosazide building blocks that were employed in highly stereoselective glycosylation reactions to furnish both the α- and β-configured linkages. By comparing the NMR spectra of the synthesized fragments with the isolated material it appears that the hereto undefined stereochemistry of the glycerol phosphate moiety is sn-glycerol-3-phosphate. The generated fragments will be valuable tools to study their immunological activity at the molecular level. PMID:26993744

  16. [Effect of gibberellic acid on RNA synthesis in dwarf peas].


    Kilev, S N; Kholodar', A V; Chekurov, V M; Mertvetsov, N P


    The effect of gibberellic acid (GA) on total RNA and polysomal poly-[A]+-RNA synthesis in epicotylia and embryos of dwarf pea of two varieties differing in their physiological sensitivity to GA was studied. It was found that incubation with GA increases the accumulation of total RNA in pea epicotylia, var. "Pioner" and "Polzunok". The maximal stimulation of RNA accumulation makes up to 40% for the low sensitivity variety "Polzunok" and 150% for the highly sensitive variety "Pioner". GA increases the synthesis of polysomal poly (A)+-mRNA in 5-year-old pea sprouts and that of newly synthesized poly (A)+-mRNA in epicotylian polysomes of both varieties 5, 24, 48 and 72 hrs after incubation with GA. GA at concentrations of 10(-6) and 10(-5) stimulates the incorporation of [3H]uridine into polysomal mRNA during the first 1--3 hours after treatment and enhances the accumulation of newly synthesized mRNA in pea embryonic polyribosomes. The stimulating effect is directly proportional to the dose of the hormone. The mechanisms of GA effect on the transcription and translation in pea plant cells are discussed. PMID:6177351

  17. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.


    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  18. Intermediates in the Synthesis of Type 2 Adenovirus Deoxyribonucleic Acid

    PubMed Central

    Horwitz, Marshall S.


    Intermediates in the synthesis of adenovirus type 2 deoxyribonucleic acid (DNA) were studied in HeLa cells. Pieces of DNA smaller than the viral genome were demonstrated after labeling with 3H-thymidine for 10 to 240 sec. Intermediates as small as the Okazaki fragments (8 to 10S) do not predominate at any of the above times. No detectable addition of nucleotides to parental genome could be shown, nor was there any breakdown of recently synthesized viral DNA. The DNA intermediates were of viral origin for they hybridized to viral DNA and were made at a stage of the cell cycle (G2) when host DNA is not synthesized. PMID:5132696

  19. Synthesis of some glucose-fatty acid esters by lipase from Candida antarctica and their emulsion functions.


    Ren, Kangzi; Lamsal, Buddhi P


    The synthesis of glucose esters with palmitic acid, lauric acid and hexanoic acid using lipase enzyme was studied and their emulsion functionality in oil-in-water system were compared. Reactions at 3:1M ratio of fatty acids-to-glucose had the highest conversion percentages (over 90% for each of the fatty acid). Initial conversion rate increased as substrate solubility increased. Ester bond formation was confirmed by nuclear magnetic resonance technique that the chemical shifts of glucose H-6 and α-carbon protons of fatty acids in the ester molecules shifted to the higher fields. Contact angle of water on esters' pelleted surface increased as the hydrophobicity increased. Glucose esters' and commercial sucrose esters' functionality as emulsifiers were compared. Glucose esters delayed, but did not prevent coalescence, because the oil droplets diameter doubled during 7days. Sucrose esters prevented coalescence during 7days since the droplets diameter did not have significant change. PMID:27507510

  20. Co-ordination between membrane phospholipid synthesis and accelerated biosynthesis of cytoplasmic ribonucleic acid and protein

    PubMed Central

    Tata, J. R.


    1. The rate of synthesis of membrane phospholipid was studied in rat liver and seminal vesicles by following the incorporation of [32P]orthophosphate, [14C]choline and [14C]glycerol. Particular emphasis was laid on the endoplasmic reticulum, which was fractionated into smooth microsomal membranes, heavy rough membranes, light rough membranes and free polyribosomes. 2. Phospholipid labelling patterns suggested a heterogeneity in the synthesis and turnover of the different lipid moieties of smooth and rough endoplasmic membranes. The major phospholipids, phosphatidylcholine and phosphatidylethanolamine, were labelled relatively rapidly with 32P over a short period of time whereas incorporation of radioisotope into the minor phospholipids, sphingomyelin, lysolecithin and phosphatidylinositol proceeded slowly but over a longer period of time. 3. The incorporation of orotic acid into RNA and labelled amino acids into protein of the four submicrosomal fractions was also studied. 4. Rapid growth of the liver was induced by the administration of growth hormone and tri-iodothyronine to hypophysectomized and thyroidectomized rats and by partial hepatectomy. Growth of seminal vesicles of castrated rats was stimulated with testosterone propionate. 5. The rate of labelling of membrane phospholipids was enhanced in all major subcellular particulate fractions (nuclear, mitochondrial and microsomal) during induced growth. However, it was in the rough endoplasmic reticulum that the accumulation of phospholipids, RNA and protein was most marked. The effect of hormone administration was also to accelerate preferentially the labelling with 32P of sphingomyelin relative to that of phosphatidylcholine or phosphatidylethanolamine. 6. Time-course analyses showed that, in all four growth systems studied, the enhancement of the rate of membrane phospholipid synthesis coincided with the rather abrupt increase in the synthesis of RNA and protein of the rough endoplasmic reticulum. Growth

  1. Xylonucleic acid: synthesis, structure, and orthogonal pairing properties

    PubMed Central

    Maiti, Mohitosh; Maiti, Munmun; Knies, Christine; Dumbre, Shrinivas; Lescrinier, Eveline; Rosemeyer, Helmut; Ceulemans, Arnout; Herdewijn, Piet


    There is a common interest for studying xeno-nucleic acid systems in the fields of synthetic biology and the origin of life, in particular, those with an engineered backbone and possessing novel properties. Along this line, we have investigated xylonucleic acid (XyloNA) containing a potentially prebiotic xylose sugar (a 3′-epimer of ribose) in its backbone. Herein, we report for the first time the synthesis of four XyloNA nucleotide building blocks and the assembly of XyloNA oligonucleotides containing all the natural nucleobases. A detailed investigation of pairing and structural properties of XyloNAs in comparison to DNA/RNA has been performed by thermal UV-melting, CD, and solution state NMR spectroscopic studies. XyloNA has been shown to be an orthogonal self-pairing system which adopts a slightly right-handed extended helical geometry. Our study on one hand, provides understanding for superior structure-function (-pairing) properties of DNA/RNA over XyloNA for selection as an informational polymer in the prebiotic context, while on the other hand, finds potential of XyloNA as an orthogonal genetic system for application in synthetic biology. PMID:26175047

  2. Hydrothermal synthesis spherical TiO2 and its photo-degradation property on salicylic acid

    NASA Astrophysics Data System (ADS)

    Guo, Wenlu; Liu, Xiaolin; Huo, Pengwei; Gao, Xun; Wu, Di; Lu, Ziyang; Yan, Yongsheng


    Anatase TiO2 spheres have been prepared using hydrothermal synthesis. The prepared spheres were characterized by X-ray diffraction (XRD), scanning electron microscope (SEM) and UV-vis diffuse reflectance spectra (UV-vis DRS). The TiO2 consisted of well-defined spheres with size of 3-5 μm. The photocatalytic activity of spherical TiO2 was determined by degradation of salicylic acid under visible light irradiation. It was revealed that the degradation rate of the spherical TiO2 which was processed at 150 °C for 48 h could reach 81.758%. And the kinetics of photocatalytic degradation obeyed first-order kinetic, which the rate constant value was 0.01716 S-1 of the salicylic acid onto TiO2 (temperature: 150, time: 48 h). The kinetics of adsorption followed the pseudo-second-order model and the rate constant was 1.2695 g mg-1 of the salicylic acid onto TiO2 (temperature: 150, time: 48 h).

  3. An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid and its topoisomerase I inhibitory activity

    PubMed Central

    Carballeira, Néstor M.; Sanabria, David; Oyola, Delise


    An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032

  4. Synthesis of novel acid electrolytes for phosphoric acid fuel cells. Final report, May 1985-October 1988

    SciTech Connect

    Adcock, J.L.


    Construction of a 40-millimole-per-hour-scale aerosol direct-fluorination reactor was completed June 26, 1986. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4-methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy-1-propene, 18 grams of F-3-(2-methoxy.ethoxy)-1-propene, and 37 grams of F-3,3-dimethyl-1-butene. Eighteen grams of F-2,2-dimethyl-1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy-1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy)-1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other GRI contractors for synthesis of perfluorinated sulfur(VI) and phosphorous(V) acids.

  5. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA


    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  6. Synthesis of hyaluronic acid oligosaccharides and exploration of a fluorous-assisted approach.


    Macchione, Giuseppe; de Paz, José L; Nieto, Pedro M


    The synthesis of hyaluronic acid oligomers (tri- and tetrasaccharide) is described. We have followed a pre-glycosylation oxidation strategy. Glucuronic acid units were directly employed in coupling reactions with suitably protected glucosamine derivatives. In order to simplify the purification of synthetic intermediates, a fluorous-assisted strategy has been also explored. Using this approach, a hyaluronic acid trisaccharide was prepared. PMID:24930061

  7. Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.


    Dacquin, J P; Lee, A F; Pirez, C; Wilson, K


    Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. PMID:22089025

  8. The rate of synthesis and decomposition of tissue proteins in hypokinesia and increased muscular activity

    NASA Technical Reports Server (NTRS)

    Fedorov, I. V.; Chernyy, A. V.; Fedorov, A. I.


    During hypokinesia and physical loading (swimming) of rats, the radioactivity of skeletal muscle, liver, kidney, heart, and blood proteins was determined after administration of radioactive amino acids. Tissue protein synthesis decreased during hypokinesia, and decomposition increased. Both synthesis and decomposition increased during physical loading, but anabolic processes predominated in the total tissue balance. The weights of the animals decreased in hypokinesia and increased during increased muscle activity.

  9. Dietary crude protein intake influences rates of whole-body protein synthesis in weanling horses.


    Tanner, S L; Wagner, A L; Digianantonio, R N; Harris, P A; Sylvester, J T; Urschel, K L


    The objective of this study was to measure whole-body protein kinetics in weanling horses receiving forage and one of two different concentrates: (1) commercial crude protein (CCP) concentrate, which with the forage provided 4.1 g CP/kg bodyweight (BW)/day (189 mg lysine (Lys)/kg BW/day), and (2) recommended crude protein (RCP) concentrate which, with the same forage, provided 3.1 g CP/kg BW/day (194 mg Lys/kg BW/day). Blood samples were taken to determine the response of plasma amino acid concentrations to half the daily concentrate allocation. The next day, a 2 h-primed, constant infusion of [(13)C]sodium bicarbonate and a 4 h-primed, constant infusion of [1-(13)C]phenylalanine were used with breath and blood sampling to measure breath (13)CO2 and blood [(13)C]phenylalanine enrichment. Horses on the CCP diet showed an increase from baseline in plasma isoleucine, leucine, lysine, threonine, valine, alanine, arginine, asparagine, glutamine, ornithine, proline, serine, and tyrosine at 120 min post-feeding. Baseline plasma amino acid concentrations were greater with the CCP diet for histidine, isoleucine, leucine, threonine, valine, asparagine, proline, and serine. Phenylalanine, lysine, and methionine were greater in the plasma of horses receiving the RCP treatment at 0 and 120 min. Phenylalanine intake was standardized between groups; however, horses receiving the RCP diet had greater rates of phenylalanine oxidation (P = 0.02) and lower rates of non-oxidative phenylalanine disposal (P = 0.04). Lower whole-body protein synthesis indicates a limiting amino acid in the RCP diet. PMID:24973006

  10. Selective synthesis of 3-hydroxy acids from Meldrum's acids using SmI2-H2O.


    Szostak, Michal; Spain, Malcolm; Procter, David J


    The single-step synthesis of 3-hydroxy carboxylic acids from readily available Meldrum's acids involves a selective monoreduction using a SmI(2)-H(2)O complex to give products in high crude purity, and it represents a considerable advancement over other methods for the synthesis of 3-hydroxy acids. The protocol includes a detailed guide to the preparation of a single electron-reducing SmI(2)-H(2)O complex and describes two representative examples of the methodology: monoreduction of a fully saturated Meldrum's acid (5-(4-bromobenzyl)-2,2-dimethyl-1,3-dioxane-4,6-dione) and tandem conjugate reduction-selective monoreduction of α,β-unsaturated Meldrum's acid (5-(4-methoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione). The protocol for selective monoreduction of Meldrum's acids takes ∼6 h to complete. PMID:22538848

  11. Antitumor effects of a drug combination targeting glycolysis, glutaminolysis and de novo synthesis of fatty acids.


    Cervantes-Madrid, Diana; Dueñas-González, Alfonso


    There is a strong rationale for targeting the metabolic alterations of cancer cells. The most studied of these are the higher rates of glycolysis, glutaminolysis and de novo synthesis of fatty acids (FAs). Despite the availability of pharmacological inhibitors of these pathways, no preclinical studies targeting them simultaneously have been performed. In the present study it was determined whether three key enzymes for glycolysis, glutaminolysis and de novo synthesis of FAs, hexokinase-2, glutaminase and fatty acid synthase, respectively, were overexpressed as compared to primary fibroblasts. In addition, we showed that at clinically relevant concentrations lonidamine, 6-diazo-5-oxo-L-norleucine and orlistat, known inhibitors of the mentioned enzymes, exerted a cell viability inhibitory effect. Genetic downregulation of the three enzymes also reduced cell viability. The three drugs were highly synergistic when administered as a triple combination. Of note, the cytotoxicity of the triple combination was low in primary fibroblasts and was well tolerated when administered into healthy BALB/c mice. The results suggest the feasibility and potential clinical utility of the triple metabolic targeting which merits to be further studied by using either repositioned old drugs or newer, more selective inhibitors. PMID:26134042

  12. Ultrasound assisted synthesis of isopropyl esters from palm fatty acid distillate.


    Deshmane, Vishwanath G; Gogate, Parag R; Pandit, Aniruddha B


    Esterification is one of the most preferred synthesis routes for organic esters which are most frequently used as plasticizers, solvents and perfumery and flavour chemicals. The present work deals with acid catalyzed synthesis of isopropyl esters from palm fatty acid distillate (PFAD) in the presence of ultrasonic irradiations operating at 25kHz frequency and 1kW of supplied power. Effect of different operating parameters such as molar ratio of reactants, catalyst quantity and operating temperature has been studied with an aim of optimization. It has been observed that ultrasound enhances the rate of reaction and the extent of equilibrium conversion. The optimum parameters for this process have been found to be 1:5 molar ratio of PFAD to isopropanol, catalyst concentration of 5% of PFAD and 60 degrees C reaction temperature. Maximum conversion levels of about 80% have been obtained in 6h of reaction time under these optimized conditions. Analysis of the kinetic data indicates that the reaction follows first order reversible path. PMID:18977682

  13. Dihydrolipoic acid activates oligomycin-sensitive thiol groups and increases ATP synthesis in mitochondria.


    Zimmer, G; Mainka, L; Krüger, E


    Investigations with dihydrolipoic acid in rat heart mitochondria and mitoplasts reveal an activation of ATP-synthase up to 45%, whereas ATPase activities decrease by 36%. In parallel with an increase in ATP synthesis oligomycin-sensitive mitochondrial -SH groups are activated at 2-4 nmol dihydrolipoic acid/mg protein. ATPase activation by the uncouplers carbonylcyanide-p-trifluoromethoxyphenylhydrazone and oleate is diminished by dihydrolipoic acid, and ATP synthesis depressed by oleate is partially restored. No such efficiency of dihydrolipoic acid is seen with palmitate-induced ATPase activation or decrease of ATP synthesis. This indicates different interference of oleate and palmitate with mitochondria. In addition to its known coenzymatic properties dihydrolipoic acid may act as a substitute for coenzyme A, thereby diminishing the uncoupling efficiency of oleate. Furthermore, dihydrolipoic acid is a very potent antioxidant, shifting the -SH-S-S- equilibrium in mitochondria to the reduced state and improving the energetic state of cells. PMID:1832845

  14. Change of hyaluronic acid synthesis during differentiation of myogenic cells and its relation to transformation of myoblasts by Rous sarcoma virus.


    Yoshimura, M


    Hyaluronic acid synthesis was examined in cultures of differentiating chick embryo muscle cells before, during and after fusion. Prior to fusion, hyaluronic acid was synthesized and secreted into the medium, but once fusion began this synthesis was reduced significantly. Synthesis then increased again after completion of fusion. Thus, production of hyaluronic acid was lowest at the time of or right before cell fusion. When myoblasts were transformed by Rous sarcoma virus (RSV), a higher amount of hyaluronic acid was synthesized, and cells were not able to fuse. The turnover rate of hyaluronic acid might be different between myotubes and RSV-transformed myoblasts. The addition of exogenous hyaluronic acid to myoblast cultures resulted in the partial inhibition of fusion. The effect was reversible because fusion took place after removal of the exogenous hyaluronic acid. These observations suggest that hyaluronic acid plays an important role in the differentiation of myogenic cells, and that elevated hyaluronic acid synthesis may partly be the reason for inhibition of myotube formation upon transformation by Rous sarcoma virus. PMID:2988797

  15. Skeletal Muscle Myofibrillar and Sarcoplasmic Protein Synthesis Rates Are Affected Differently by Altitude-Induced Hypoxia in Native Lowlanders

    PubMed Central

    Holm, Lars; Haslund, Mads Lyhne; Robach, Paul; van Hall, Gerrit; Calbet, Jose A. L.; Saltin, Bengt; Lundby, Carsten


    As a consequence to hypobaric hypoxic exposure skeletal muscle atrophy is often reported. The underlying mechanism has been suggested to involve a decrease in protein synthesis in order to conserve O2. With the aim to challenge this hypothesis, we applied a primed, constant infusion of 1-13C-leucine in nine healthy male subjects at sea level and subsequently at high-altitude (4559 m) after 7–9 days of acclimatization. Physical activity levels and food and energy intake were controlled prior to the two experimental conditions with the aim to standardize these confounding factors. Blood samples and expired breath samples were collected hourly during the 4 hour trial and vastus lateralis muscle biopsies obtained at 1 and 4 hours after tracer priming in the overnight fasted state. Myofibrillar protein synthesis rate was doubled; 0.041±0.018 at sea-level to 0.080±0.018%⋅hr−1 (p<0.05) when acclimatized to high altitude. The sarcoplasmic protein synthesis rate was in contrast unaffected by altitude exposure; 0.052±0.019 at sea-level to 0.059±0.010%⋅hr−1 (p>0.05). Trends to increments in whole body protein kinetics were seen: Degradation rate elevated from 2.51±0.21 at sea level to 2.73±0.13 µmol⋅kg−1⋅min−1 (p = 0.05) at high altitude and synthesis rate similar; 2.24±0.20 at sea level and 2.43±0.13 µmol⋅kg−1⋅min−1 (p>0.05) at altitude. We conclude that whole body amino acid flux is increased due to an elevated protein turnover rate. Resting skeletal muscle myocontractile protein synthesis rate was concomitantly elevated by high-altitude induced hypoxia, whereas the sarcoplasmic protein synthesis rate was unaffected by hypoxia. These changed responses may lead to divergent adaptation over the course of prolonged exposure. PMID:21187972

  16. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong


    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  17. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  18. An Alkyne Diboration/6π-Electrocyclization Strategy for the Synthesis of Pyridine Boronic Acid Derivatives.


    Mora-Radó, Helena; Bialy, Laurent; Czechtizky, Werngard; Méndez, María; Harrity, Joseph P A


    A new and efficient synthesis of pyridine-based heteroaromatic boronic acid derivatives is reported through a novel diboration/6π-electrocyclization strategy. This method delivers a range of functionalized heterocycles from readily available starting materials. PMID:27059895

  19. Synthesis and self-assembly of poly(3-hexylthiophene)-block-poly(acrylic acid)

    SciTech Connect

    Li, Zicheng; Ono, Robert J.; Wu, Zong-Quan; Bielawski, Christopher W.


    A modular and convenient synthesis of ethynyl end functionalized poly(3-hexylthiophene) in high purity is reported; this material facilitated access to poly(3-hexylthiophene)-block-poly(acrylic acid) which self-assembled into hierarchical structures.

  20. Electrochemical synthesis of poly(3-aminophenylboronic acid) in ethylene glycol without exogenous protons.


    Wang, Feifan; Zou, Feixue; Yu, Xinxin; Feng, Zhenyu; Du, Na; Zhong, Yaohua; Huang, Xirong


    A non-aqueous solution of tetra-n-butylammonium fluoride (TBAF) in ethylene glycol has been tried for the first time as a supporting electrolyte for the electropolymerization of 3-aminophenylboronic acid (APBA). Unlike the traditional acidic aqueous solution, the present medium needs no exogenous protons; moreover, the presence of CF3COOH is found to be unfavorable for the polymerization. The protons are in situ generated by the reaction between the boronic acid group on APBA and 1,2-dihydroxyl on ethylene glycol. So, ethylene glycol serves as not only the solvent but also the proton source. As a part of the supporting electrolyte, F(-) is found to be involved in the electrochemical synthesis of poly(3-aminophenylboronic acid) (PAPBA), but it is not indispensable. Studies on the electropolymerization process indicate that the size of the ions in the electrolyte affects the rate of the doping/dedoping process. The smaller the cation, the easier the doping/dedoping process, and the better the stability of the grown film. As demonstrated by Fourier transform infrared spectra, UV-vis spectra, and scanning electron microscopy, the obtained PAPBA is a cross-linked nanoporous polymer membrane that has a good adherence to the glassy carbon electrode. PMID:27004602

  1. Synthesis of monoacylglycerol containing pinolenic acid via stepwise esterification using a cold active lipase.


    Pyo, Young-Gil; Hong, Seung In; Kim, Yangha; Kim, Byung Hee; Kim, In-Hwan


    High purity monoacylglycerol (MAG) containing pinolenic acid was synthesized via stepwise esterification of glycerol and fatty acids from pine nut oil using a cold active lipase from Penicillium camembertii as a biocatalyst. Effects of temperature, molar ratio, water content, enzyme loading, and vacuum on the synthesis of MAG by lipase-catalyzed esterification of glycerol and fatty acid from pine nut oil were investigated. Diacylglycerol (DAG) as well as MAG increased significantly when temperature was increased from 20 to 40 °C. At a molar ratio of 1:1, MAG content decreased because of the significant increase in DAG content. Water has a profound influence on both MAG and DAG content through the entire course of reaction. The reaction rate increased significantly as enzyme loading increased up to 600 units. Vacuum was an effective method to reduce DAG content. The optimum temperature, molar ratio, water content, enzyme loading, vacuum, and reaction time were 20 °C, 1:5 (fatty acid to glycerol), 2%, 600 units, 5 torr, and 24 h, respectively. MAG content further increased via lipase-catalyzed second step esterification at subzero temperature. P. camembertii lipase exhibited esterification activity up to -30 °C. PMID:22753389

  2. High emission rate of sulfuric acid from Bezymianny volcano, Kamchatka

    NASA Astrophysics Data System (ADS)

    Zelenski, Michael; Taran, Yuri; Galle, Bo


    High concentrations of primary sulfuric acid (H2SO4) in fumarolic gases and high emission rate of sulfuric acid aerosol in the plume were measured at Bezymianny volcano, an active dome-growing andesitic volcano in central Kamchatka. Using direct sampling, filter pack sampling, and differential optical absorption spectroscopy measurements, we estimated an average emission of H2SO4 at 243 ± 75 t/d in addition to an average SO2 emission of 212 ± 65 t/d. The fumarolic gases of Bezymianny correspond to arc gases released by several magma bodies at different stages of degassing and contain 25-92% of entrained air. H2SO4 accounts for 6-87 mol% of the total sulfur content, 42.8 mol% on average, and SO2 is the rest. The high H2SO4 in Bezymianny fumaroles can be explained by catalytic oxidation of SO2 inside the volcanic dome. Because sulfate aerosol is impossible to measure remotely, the total sulfur content in a plume containing significant H2SO4 may be seriously underestimated.

  3. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.


    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  4. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.


    Snowden, Roger L


    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed. PMID:18618391

  5. Synthesis of carboranyl amino acids, hydantoins, and barbiturates

    SciTech Connect

    Wyzlic, I.M.; Tjarks, W.; Soloway, A.H.


    The syntheses of three novel boronated hydantoins, 5-(o-carboran-1-ylmethyl)hydantoin, 14, the tetraphenylphosphonium salt of 7-(hydantoin-5-ylmethyl)dodecahydro-7,8-dicarba-nido-undecaborate, 15, 5-(o-carboran-1-ylmethyl)-2-thiohydantoin, 16, and two new barbiturates, 5,5-bis(but-2-ynyl)barbiturate, 18, and 5,5-bis[(2-methyl-0-carboran-1-yl)methyl]barbiturate, 20, are described. Hydantoins 14-16 were synthesized from o-carboranylalanine (Car, 13). The detailed synthesis of Car and two other carborane-containing amino acids, O-(o-carboran-1-ylmethyl)tyrosine (CBT, 5a) and p-(o-carboran-1-yl)phenylalanine (CBPA, 5b), presented earlier as a communication, {sup 16} are also described. Hydantoin 14 and barbiturates 18 and 20 were tested for their potential anticonvulsant activity. Initial qualitative screening showed moderate activities for hydantoin 14 and barbiturate 18. Barbiturate 20 had no activity. Compound 14 appeared to be nontoxic at doses of 300 mg/kg (mice, ip) and 50 mg/kg (rats, oral). However, 18 was very toxic under similar conditions.

  6. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  7. Lactic acid as an invaluable green solvent for ultrasound-assisted scalable synthesis of pyrrole derivatives.


    Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang


    Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. PMID:25605585

  8. Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies

    PubMed Central

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa


    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  9. Abc Amino Acids: Design, Synthesis, and Properties of New Photoelastic Amino Acids

    SciTech Connect

    Standaert, Robert F; Park, Dr Seung Bum


    Photoisomerizable amino acids provide a direct avenue to the experimental manipulation of bioactive polypeptides, potentially allowing real-time, remote control of biological systems and enabling useful applications in nanobiotechnology. Herein, we report a new class of photoisomerizable amino acids intended to cause pronounced expansion and contraction in the polypeptide backbone, i.e., to be photoelastic. These compounds, termed Abc amino acids, employ a photoisomerizable azobiphenyl chromophore to control the relative disposition of aminomethyl and carboxyl substituents. Molecular modeling of nine Abc isomers led to the identification of one with particularly attractive properties, including the ability to induce contractions up to 13A in the backbone upon transa?cis photoisomerization. This isomer, designated mpAbc, has substituents at meta and para positions on the inner (azo-linked) and outer rings, respectively. An efficient synthesis of Fmoc-protected mpAbc was executed in which the biaryl components were formed via Suzuki couplings and the azo linkage was formed via amine/nitroso condensation; protected forms of three other Abc isomers were prepared similarly. A decapeptide incorporating mpAbc was synthesized by conventional solid-phase methods and displayed characteristic azobenzene photochemical behavior with optimal conversion to the cis isomer at 360 nm and a thermal cisa?trans half life of 100 min. at 80 AoC.

  10. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng


    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  11. Respiratory CO(2) as Carbon Source for Nocturnal Acid Synthesis at High Temperatures in Three Species Exhibiting Crassulacean Acid Metabolism.


    Winter, K; Schröppel-Meier, G; Caldwell, M M


    TEMPERATURE EFFECTS ON NOCTURNAL CARBON GAIN AND NOCTURNAL ACID ACCUMULATION WERE STUDIED IN THREE SPECIES OF PLANTS EXHIBITING CRASSULACEAN ACID METABOLISM: Mamillaria woodsii, Opuntia vulgaris, and Kalanchoë daigremontiana. Under conditions of high soil moisture, nocturnal CO(2) gain and acid accumulation had temperature optima at 15 to 20 degrees C. Between 5 and 15 degrees C, uptake of atmospheric CO(2) largely accounted for acid accumulation. At higher tissue temperatures, acid accumulation exceeded net carbon gain indicating that acid synthesis was partly due to recycling of respiratory CO(2). When plants were kept in CO(2)-free air, acid accumulation based on respiratory CO(2) was highest at 25 to 35 degrees C. Net acid synthesis occurred up to 45 degrees C, although the nocturnal carbon balance became largely negative above 25 to 35 degrees C. Under conditions of water stress, net CO(2) exchange and nocturnal acid accumulation were reduced. Acid accumulation was proportionally more decreased at low than at high temperatures. Acid accumulation was either similar over the whole temperature range (5-45 degrees C) or showed an optimum at high temperatures, although net carbon balance became very negative with increasing tissue temperatures. Conservation of carbon by recycling respiratory CO(2) was temperature dependent. At 30 degrees C, about 80% of the dark respiratory CO(2) was conserved by dark CO(2) fixation, in both well irrigated and water stressed plants. PMID:16664827

  12. Nitrogen mineralization rates of the acidic, xeric soils of the New Jersey Pinelands: field rates

    SciTech Connect

    Poovarodom, S.; Tate, R.L. III; Bloom, R.A.


    Using the buried-bag procedure, the authors quantified nitrogen mineralization rates in the xeric, acidic Lakehurst, and Atsion sands of the New Jersey Pine Barrens. Average annual nitrogen yields in the upper 15 cm for the Lakehurst and the Atsion sands were 38.4 and 53.0 kg N/ha, corresponding to 4.5 and 2.5% of the total nitrogen, respectively. Net nitrogen mineralization in both soils exhibited distinct seasonal patterns with maxima in summer and minimum rates in the winter. Nitrification accounted for only 5% of the total N mineralized in both soils. This is consistent with the finding of low populations of autotrophic nitrifiers in these soils.

  13. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.


    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  14. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.


    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea


    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition. PMID:27213289

  15. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.


    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  16. High fat intake lowers hepatic fatty acid synthesis and raises fatty acid oxidation in aerobic muscle in Shetland ponies.


    Geelen, S N; Blázquez, C; Geelen, M J; Sloet van Oldruitenborgh-Oosterbaan, M M; Beynen, A C


    The metabolic effects of feeding soyabean oil instead of an isoenergetic amount of maize starch plus glucose were studied in ponies. Twelve adult Shetland ponies were given a control diet (15 g fat/kg DM) or a high-fat diet (118 g fat/kg DM) according to a parallel design. The diets were fed for 45 d. Plasma triacylglycerol (TAG) concentrations decreased by 55 % following fat supplementation. Fat feeding also reduced glycogen concentrations significantly by up to 65 % in masseter, gluteus and semitendinosus muscles (P < 0.05 and P < 0.01 and P < 0.01 respectively). The high-fat diet significantly increased the TAG content of semitendinosus muscle by 80 % (P < 0.05). Hepatic acetyl-CoA carboxylase and fatty acid synthase activities were 53 % (P < 0.01) and 56 % (P < 0.01) lower respectively in the high-fat group, but diacylglycerol acyltransferase activity was unaffected. Although carnitine palmitoyltransferase-I (CPT-I) activity in liver mitochondria was not influenced, fat supplementation did render CPT-I less sensitive to inhibition by malonyl-CoA. There was no significant effect of diet on the activity of phosphofructokinase in the different muscles. The activity of citrate synthase was raised significantly (by 25 %; P < 0.05) in the masseter muscle of fat-fed ponies, as was CPT-I activity (by 46 %; P < 0.01). We conclude that fat feeding enhances both the transport of fatty acids through the mitochondrial inner membrane and the oxidative capacity of highly-aerobic muscles. The higher oxidative ability together with the depressed rate of de novo fatty acid synthesis in liver may contribute to the dietary fat-induced decrease in plasma TAG concentrations in equines. PMID:11432762

  17. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.


    Hansen, Alexandar L; Behrman, Edward J


    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. PMID:27258673

  18. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf


    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  19. Synthesis of novel trivalent amino acid glycoconjugates based on the cyclotriveratrylene ('CTV') scaffold.


    van Ameijde, Jeroen; Liskamp, Rob M J


    The convenient synthesis of novel trivalent amino acid glycoconjugates based on cyclotriveratrylene ('CTV') is described. These constructs consist of the CTV scaffold, three oligoethylene glycol spacers of variable length connected to a glyco amino acid residue which can also be varied. The resulting library of trivalent glycoconjugates can be used for studying multivalent interactions. PMID:12948190

  20. Prolonged stimulation of muscle protein synthesis by leucine in neonates is dependent on amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The rise in amino acids and insulin after a meal independently stimulate protein synthesis in skeletal muscle of neonates by activating the intracellular signalling pathways that regulate mRNA translation. Leucine, in particular, is important in mediating the response to amino acids. Previously, w...

  1. Diesters from Oleic Acid: Synthesis, Low Temperature Properties, and Oxidation Stability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several diesters were prepared from commercially available oleic acid and common organic acids. The key step in the three step synthesis of oleochemical diesters entails a ring opening esterification of alkyl 9,10-epoxyoctadecanoates (alkyl: propyl, iso-propyl, octyl, 2-ethylhexyl) using propionic a...

  2. [The clinical evaluation of the hypocholesterolemic effects of an inhibitor of cholesterol synthesis: mevalonic acid].


    Del Nero, E; Aloe, N; Augeri, C; Avola, F; Carta, G; Cavagnaro, A; De Grandi, R; Gianfreda, M; Magro, G P; Mazzarello, G P


    Twenty eight patients with heterozygous familial hypercholesterolemia were treated with mevalonic acid (an inhibitor of cholesterol synthesis) for 45 days. Patients received a daily dose of 750 to 1500 mg mevalonic acid depending on plasma cholesterol levels. Results showed a significant reduction in cholesterol values whereas no significant difference was observed in HDL cholesterol and triglyceride levels. PMID:1505176

  3. Ascorbic acid and rates of cognitive decline in Alzheimer's disease.


    Bowman, Gene L; Dodge, Hiroko; Frei, Balz; Calabrese, Carlo; Oken, Barry S; Kaye, Jeffrey A; Quinn, Joseph F


    The brain maintains high levels of ascorbic acid (AA) despite a concentration gradient favoring diffusion from brain to peripheral tissues. Dietary antioxidants, including AA, appear to modify the risk of Alzheimer's disease (AD). The objective of this study was to test the hypothesis that neurodegeneration in AD is modified by brain levels of AA. Thirty-two patients with mild to moderate AD participated in a biomarker study involving standardized clinical assessments over one year. Cerebrospinal fluid (CSF) and serum were collected at baseline for AA and albumin content. Cognitive measures were collected at baseline and one year. CSF and plasma AA failed to predict cognitive decline independently, however, CSF: plasma AA ratio did. After adding CSF Albumin Index (an established marker of blood-brain barrier integrity) to the regression models the effect of CSF: plasma AA ratio as a predictor of cognitive decline was weakened. CSF: plasma AA ratio predicts rate of decline in AD. This relationship may indicate that the CSF: plasma AA ratio is an index of AA availability to the brain or may be an artifact of a relationship between blood-brain barrier impairment and neurodegeneration. PMID:19158425

  4. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.


    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  5. Selective inhibition of leukotriene C/sub 4/ synthesis in human neutrophils by ethacrynic acid

    SciTech Connect

    Leung, K.H.


    Addition of glutathione S-transferase inhibitors, ethyacrynic acid (ET), caffeic acid (CA), and ferulic acid (FA) to human neutrophils led to inhibition of leukotriene C/sub 4/ (LTC/sub 4/) synthesis induced by calcium ionophore A23187. ET is the most specific of these inhibitors for it had little effect on LTB/sub 4/, PGE/sub 2/, and 5-HETE synthesis. The inhibition of LTC/sub 4/ was irreversible and time dependent. ET also had little effect on /sup 3/H-AA release from A23187-stimulated neutrophils.

  6. Synthesis of zirconium carbide nanosized powders by pursed wire discharge in oleic acid

    NASA Astrophysics Data System (ADS)

    Sugashima, Kenta; Suzuki, Kazuma; Suzuki, Tsuneo; Nakayama, Tadachika; Suematsu, Hisayuki; Niihara, Koichi


    In this study, we propose novel PWD methods in inert gas mixed organic vapor and organic liquid which work as harmless carbon sources. Metal zirconium wire evaporation by PWD in organic vapor or liquid media was investigated. It was confirmed that in the PWD process using oleic acid liquid, single phase zirconium carbide nanopowders were synthesized by a reaction between Zr vapor and oleic acid. A new method for synthesis of carbide nanopowders was developed using the PWD in organic liquid. Therefore, the present result suggested that PWD method in oleic acid liquids is effective for the synthesis of carbide nanopowders.

  7. Computer-assisted automated synthesis. III. Synthesis of substituted N-(carboxyalkyl) amino-acid tert-butyl ester derivatives.


    Hayashi, N; Sugawara, T; Kato, S


    A versatile automated synthesis apparatus, equipped with a chemical artificial intelligence, was developed to prepare and isolate a wide variety of compounds. The apparatus was to the synthesis of substituted N-(carboxyalkyl)amino-acids. The apparatus [1,2] is composed of units for performing various tasks,for example reagent supply, reaction, purification and separation, each linked to a control system. All synthetic processes, including washing and drying of the apparatus after each synthetic run, were automatically performed from the mixing of the reactants to the isolation of the products as powders or crystals. The reaction of an amino-acid tertbutyl ester acetic acid salt with a 2-keto acid sodium salt produces an unstable intermediate, Schiff base, which is reduced with sodum cyanoborohydride to give a substituted N-(carboxyalkyl)aminoacid tert-butyl ester sodium salt. The equilibrium and the consecutive reactions were controlled by adding sodium cyanoborohydride using the artificial intelligence software, which contained novel kinetic equations [3] and substituent effects [4].Substitued N-(carboxyalkyl)amino-acid tert-butyl esters, 90 derivatives, were automatically synthesized using the computerassisted automated synthesis apparatus. The syntheses were performed unattended 24 hours a day, except for supplying the raw materials, reagents and solvents. The apparatus is extremely valuable for synthesizing many derivatives of a particular compound. The configurations of the products were determined by circular dichroism measurements. PMID:18924904

  8. Computer-assisted automated synthesis. III. Synthesis of substituted N-(carboxyalkyl) amino-acid tert-butyl ester derivatives

    PubMed Central

    Hayashi, Nobuyoshi; Sugawara, Tohru; Kato, Shinji


    A versatile automated synthesis apparatus, equipped with a chemical artificial intelligence, was developed to prepare and isolate a wide variety of compounds. The apparatus was to the synthesis of substituted N-(carboxyalkyl)amino-acids. The apparatus [1,2] is composed of units for performing various tasks,for example reagent supply, reaction, purification and separation, each linked to a control system. All synthetic processes, including washing and drying of the apparatus after each synthetic run, were automatically performed from the mixing of the reactants to the isolation of the products as powders or crystals. The reaction of an amino-acid tertbutyl ester acetic acid salt with a 2-keto acid sodium salt produces an unstable intermediate, Schiff base, which is reduced with sodum cyanoborohydride to give a substituted N-(carboxyalkyl)aminoacid tert-butyl ester sodium salt. The equilibrium and the consecutive reactions were controlled by adding sodium cyanoborohydride using the artificial intelligence software, which contained novel kinetic equations [3] and substituent effects [4]. Substitued N-(carboxyalkyl)amino-acid tert-butyl esters, 90 derivatives, were automatically synthesized using the computerassisted automated synthesis apparatus. The syntheses were performed unattended 24 hours a day, except for supplying the raw materials, reagents and solvents. The apparatus is extremely valuable for synthesizing many derivatives of a particular compound. The configurations of the products were determined by circular dichroism measurements. PMID:18924904

  9. Chemical Synthesis of Uncommon Natural Bile Acids: The 9α-Hydroxy Derivatives of Chenodeoxycholic and Lithocholic Acids.


    Iida, Takashi; Namegawa, Kazunari; Nakane, Naoya; Iida, Kyoko; Hofmann, Alan Frederick; Omura, Kaoru


    The chemical synthesis of the 9α-hydroxy derivatives of chenodeoxycholic and lithocholic acids is reported. For initiating the synthesis of the 9α-hydroxy derivative of chenodeoxycholic acid, cholic acid was used; for the synthesis of the 9α-hydroxy derivative of lithocholic acid, deoxycholic acid was used. The principal reactions involved were (1) decarbonylation of conjugated 12-oxo-Δ(9(11))-derivatives using in situ generated monochloroalane (AlH2Cl) prepared from LiAlH4 and AlCl3, (2) epoxidation of the deoxygenated Δ(9(11))-enes using m-chloroperbenzoic acid catalyzed by 4,4'-thiobis-(6-tert-butyl-3-methylphenol), (3) subsequent Markovnikov 9α-hydroxylation of the Δ(9(11))-enes with AlH2Cl, and (4) selective oxidation of the primary hydroxyl group at C-24 in the resulting 3α,9α,24-triol and 3α,7α,9α,24-tetrol to the corresponding C-24 carboxylic acids using sodium chlorite (NaClO2) in the presence of a catalytic amount of 2,2,6,6-tetramethylpiperidine 1-oxyl free radical (TEMPO) and sodium hypochlorite (NaOCl). The (1)H- and (13)C-NMR spectra are reported. The 3α,7α,9α-trihydroxy-5β-cholan-24-oic acid has been reported to be present in the bile of the Asian bear, and its 7-deoxy derivative is likely to be a bacterial metabolite. These bile acids are now available as authentic reference standards, permitting their identification in vertebrate bile acids. PMID:27319285

  10. Latency, duration and dose response relationships of amino acid effects on human muscle protein synthesis.


    Rennie, Michael J; Bohé, Julien; Wolfe, Robert R


    The components of the stimulatory effect of food on net deposition of protein are beginning to be identified and separated. One of the most important of these appears to be the effect of amino acids per se in stimulating muscle anabolism. Amino acids appear to have a linear stimulatory effect within the range of normal diurnal plasma concentrations from postabsorptive to postprandial. Within this range, muscle protein synthesis (measured by incorporation of stable isotope tracers of amino acids into biopsied muscle protein) appears to be stimulated approximately twofold; however, little further increase occurs when very high concentrations of amino acids (>2.5 times the normal postabsorptive plasma concentration) are made available. Amino acids provided in surfeit of the ability of the system to synthesize protein are disposed of by oxidation, ureagenesis and gluconeogenesis. The stimulatory effect of amino acids appears to be time dependent; a square wave increase in the availability of amino acids causes muscle protein synthesis to be stimulated and to fall back to basal values, despite continued amino acid availability. The relationship between muscle protein synthesis and insulin availability suggests that most of the stimulatory effects occur at low insulin concentrations, with large increases having no effect. These findings may have implications for our understanding of the body's requirements for protein. The maximal capacity for storage of amino acids as muscle protein probably sets an upper value on the extent to which amino acids can be stored after a single meal. PMID:12368422

  11. Synthesis and degradation test of hyaluronic acid hydrogels.


    Hahn, Sei Kwang; Park, Jung Kyu; Tomimatsu, Takashi; Shimoboji, Tsuyoshi


    Hyaluronic acid (HA) hydrogels prepared with three different crosslinking reagents were assessed by in vitro and in vivo degradation tests for various tissue engineering applications. Adipic acid dihydrazide grafted HA (HA-ADH) was synthesized and used for the preparation of methacrylated HA (HA-MA) with methacrylic anhydride and thiolated HA (HA-SH) with Traut's reagent (imminothiolane). (1)H NMR analysis showed that the degrees of HA-ADH, HA-MA, and HA-SH modification were 69, 29, and 56 mol%, respectively. HA-ADH hydrogel was prepared by the crosslinking with bis(sulfosuccinimidyl) suberate (BS(3)), HA-MA hydrogel with dithiothreitol (DTT) by Michael addition, and HA-SH hydrogel with sodium tetrathionate by disulfide bond formation. According to in vitro degradation tests, HA-SH hydrogel was degraded very fast, compared to HA-ADH and HA-MA hydrogels. HA-ADH hydrogel was degraded slightly faster than HA-MA hydrogel. Based on these results, HA-MA hydrogels and HA-SH hydrogels were implanted in the back of SD rats and their degradation was assessed according to the pre-determined time schedule. As expected from the in vitro degradation test results, HA-SH hydrogel was in vivo degraded completely only in 2 weeks, whereas HA-MA hydrogels were degraded only partially even in 29 days. The degradation rate of HA hydrogels were thought to be controlled by changing the crosslinking reagents and the functional group of HA derivatives. In addition, the state of HA hydrogel was another factor in controlling the degradation rate. Dried HA hydrogel at 37 degrees C for a day resulted in relatively slow degradation compared to the bulk HA hydrogel. There was no adverse effect during the in vivo tests. PMID:17101173

  12. Catabolism of Branched Chain Amino Acids Contributes Significantly to Synthesis of Odd-Chain and Even-Chain Fatty Acids in 3T3-L1 Adipocytes

    PubMed Central

    Crown, Scott B.; Marze, Nicholas; Antoniewicz, Maciek R.


    The branched chain amino acids (BCAA) valine, leucine and isoleucine have been implicated in a number of diseases including obesity, insulin resistance, and type 2 diabetes mellitus, although the mechanisms are still poorly understood. Adipose tissue plays an important role in BCAA homeostasis by actively metabolizing circulating BCAA. In this work, we have investigated the link between BCAA catabolism and fatty acid synthesis in 3T3-L1 adipocytes using parallel 13C-labeling experiments, mass spectrometry and model-based isotopomer data analysis. Specifically, we performed parallel labeling experiments with four fully 13C-labeled tracers, [U-13C]valine, [U-13C]leucine, [U-13C]isoleucine and [U-13C]glutamine. We measured mass isotopomer distributions of fatty acids and intracellular metabolites by GC-MS and analyzed the data using the isotopomer spectral analysis (ISA) framework. We demonstrate that 3T3-L1 adipocytes accumulate significant amounts of even chain length (C14:0, C16:0 and C18:0) and odd chain length (C15:0 and C17:0) fatty acids under standard cell culture conditions. Using a novel GC-MS method, we demonstrate that propionyl-CoA acts as the primer on fatty acid synthase for the production of odd chain fatty acids. BCAA contributed significantly to the production of all fatty acids. Leucine and isoleucine contributed at least 25% to lipogenic acetyl-CoA pool, and valine and isoleucine contributed 100% to lipogenic propionyl-CoA pool. Our results further suggest that low activity of methylmalonyl-CoA mutase and mass action kinetics of propionyl-CoA on fatty acid synthase result in high rates of odd chain fatty acid synthesis in 3T3-L1 cells. Overall, this work provides important new insights into the connection between BCAA catabolism and fatty acid synthesis in adipocytes and underscores the high capacity of adipocytes for metabolizing BCAA. PMID:26710334

  13. Compendium and synthesis of bacterial manganese reduction rates

    NASA Astrophysics Data System (ADS)

    Bandstra, Joel Z.; Ross, Daniel E.; Brantley, Susan L.; Burgos, William D.


    We have compiled time-series concentration data for the biological reduction of manganese(III/IV) published between 1985 and 2004 and fit these data with a simple hyperbolic rate expression or, when appropriate, one of its limiting forms. The compiled data and rate constants are available in Electronic Annex EA-1. The zero- and first-order rate constants appear to follow a log-normal distribution that could be used, for example, in predictive modeling of Mn-oxide reduction in a reactive transport scenario. We have also included details of the experimental procedures used to generate each time-series data-set in our compilation. These meta-data—mostly pertaining to the type and concentration of micro-organism, electron donor, and electron acceptor—enable us to examine the rate data for trends. We have computed a number of rudimentary, mono-variate statistics on the compiled data with the hope of stimulating both more detailed statistical analyses of the data and new experiments to fill gaps in the existing data-set. We have also analyzed the data with parametric models based on the log-normal distribution and rate equations that are hyperbolic in the concentration of cells and Mn available for reduction. This parametric analysis allows us to provide best estimates of zero- and first-order rate constants both ignoring and accounting for the meta-data.

  14. Leucine disposal rate for assessment of amino acid metabolism in maintenance hemodialysis patients

    PubMed Central

    Denny, Gerald B.; Deger, Serpil M.; Chen, Guanhua; Bian, Aihua; Sha, Feng; Booker, Cindy; Kesler, Jaclyn T.; David, Sthuthi; Ellis, Charles D.; Ikizler, T. Alp


    Background Protein energy wasting (PEW) is common in patients undergoing maintenance hemodialysis (MHD) and closely associated with poor outcomes. Insulin resistance and associated alterations in amino acid metabolism are potential pathways leading to PEW. We hypothesized that the measurement of leucine disposal during a hyperinsulinemic- euglycemic-euaminoacidemic clamp (HEAC) procedure would accurately measure the sensitivity to insulin for its actions on concomitant carbohydrate and protein metabolism in MHD patients. Methods We examined 35 MHD patients and 17 control subjects with normal kidney function by hyperinsulinemic-euglycemic clamp (HEGC) followed by HEAC clamp procedure to obtain leucine disposal rate (LDR) along with isotope tracer methodology to assess whole body protein turnover. Results The glucose disposal rate (GDR) by HEGC was 5.1 ± 2.1 mg/kg/min for the MHD patients compared to 6.3 ± 3.9 mg/kg/min for the controls (p = 0.38). The LDR during HEAC was 0.09 ± 0.03 mg/kg/min for the MHD patients compared to 0.11 ± 0.05 mg/kg/min for the controls (p = 0.009). The LDR level was correlated with whole body protein synthesis (r = 0.25; p = 0.08), with whole body protein breakdown (r = −0.38 p = 0.01) and net protein balance (r = 0.85; p < 0.001) in the overall study population. Correlations remained significant in subgroup analysis. The GDR derived by HEGC and LDR correlated well in the controls (r = 0.79, p < 0.001), but less so in the MHD patients (r = 0.58, p < 0.001). Conclusions Leucine disposal rate reliably measures amino acid utilization in MHD patients and controls in response to high dose insulin. PMID:27413537

  15. Kinetics of enzymatic synthesis of liquid wax ester from oleic acid and oleyl alcohol.


    Radzi, Salina Mat; Mohamad, Rosfarizan; Basri, Mahiran; Salleh, Abu Bakar; Ariff, Arbakariya; Rahman, Mohammad Basyaruddin Abdul; Rahman, Raja Noor Zaliha Raja Abdul


    The kinetics of wax ester synthesis from oleic acid and oleyl alcohol using immobilized lipase from Candida antartica as catalyst was studied with different types of impeller (Rushton turbine and AL-hydrofoil) to create different mixing conditions in 2l stirred tank reactor. The effects of catalyst concentration, reaction temperature, and impeller tip speed on the synthesis were also evaluated. Rushton turbine impeller exhibited highest conversion rate at lower impeller tip speed as compared to AL-hydrofoil impeller. A second-order reversible kinetic model from single progress curve for the prediction of fractional conversion at given reaction time was proposed and the corresponding kinetic parameter values were calculated by non-linear regression method. The results from the simulation using the proposed model showed satisfactory agreement with the experimental data. Activation energy shows a value of 21.77 Kcal/mol. The thermodynamic parameters of the process, enthalpy and entropy, were 21.15 Kcal/mol and 52.07 cal/mol.K, respectively. PMID:20124754

  16. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan


    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  17. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.


    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  18. Effect of Poliovirus on Deoxyribonucleic Acid Synthesis in HeLa Cells

    PubMed Central

    Ackermann, W. W.; Cox, D. C.; Kurtz, H.; Powers, C. D.; Davies, S. J.


    Ackermann, W. W. (University of Michigan, Ann Arbor), D. C. Cox, H. Kurtz, C. D. Powers, and S. J. Davies. Effect of poliovirus on deoxyribonucleic acid synthesis in HeLa cells. J. Bacteriol. 91:1943–1952. 1966.—Both poliovirus and arginine stimulated deoxyribonucleic acid (DNA) synthesis in cultures of HeLa cells which were preconditioned by incubation in a medium deficient in arginine. However, the number of cells producing DNA was unaffected. DNA synthesis in such preconditioned cells was 10 to 20% of the maximal value obtained with a full complement of amino acids. Inhibition of DNA synthesis was produced in these cultures either by increasing the multiplicity of exposure above 40 plaque-forming units of virus per cell or by increasing the concentration of the deficient amino acid at the time of virus addition. Inhibition of DNA synthesis resulted from a reduction in the fraction of cells producing DNA. The concentration of arginine required for viral inhibition of DNA synthesis is greater than that for viral multiplication. PMID:4287076

  19. Dietary fiber and short-chain fatty acids affect cell proliferation and protein synthesis in isolated rat colonocytes.


    Marsman, K E; McBurney, M I


    Colonic metabolism may be affected by dietary fiber and short-chain fatty acids, the products of fiber fermentation. The aim of this study was to assess the effects of fiber supplementation (150 g/kg diet) on dynamic measurements of metabolism in isolated rat colonic epithelial cells. Additionally, we investigated the effect of in vitro short-chain fatty acid and glutamine concentrations and media osmolarity on oxygen uptake, protein synthesis, cell proliferation and anaplerotic flux. Colonocyte oxygen consumption did not differ due to fiber supplementation or the inclusion of short -chain fatty acids in incubation media. Cell proliferation (3H-thymidine uptake) was increased by fiber consumption (P acids in vitro (P synthesis (3H-phenylalanine incorporation) was unaffected by fiber supplementation but was decreased when short-chain fatty acids were present in incubation media (P rate indicates that there was no concurrent increase in energy expenditure. PMID:8618140

  20. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The reaction between epoxidized methyl oleate and the multifunctional carboxylic acid, levulinic acid, is shown to give two products of differing chemical reactivity. A branched alpha-hydroxy ester product which is acid stable, and a ketal product, which shows acid cleavability can be formed. The ...

  1. Control of the Synthesis of Fatty-Acid Synthetase in Rat Liver by Insulin, Glucagon, and Adenosine 3′:5′ Cyclic Monophosphate

    PubMed Central

    Lakshmanan, M. R.; Nepokroeff, Carl M.; Porter, John W.


    The usual increase in the activity of liver fatty-acid synthetase that occurs on refeeding of a fat-free diet to previously fasted rats is abolished in diabetic animals. Insulin specifically restores this increase by enhancement of the rate of synthesis of fatty-acid synthetase. However, glucagon and cyclic AMP inhibit the increase in the activity of fatty-acid synthetase. Therefore, the concentration of fatty-acid synthetase in rat liver is under the control of the relative concentrations of insulin and glucagon. PMID:4345502

  2. Parallel Chemoenzymatic Synthesis of Sialosides Containing a C5-Diversified Sialic Acid

    PubMed Central

    Cao, Hongzhi; Muthana, Saddam; Li, Yanhong; Cheng, Jiansong; Chen, Xi


    A convenient chemoenzymatic strategy for synthesizing sialosides containing a C5-diversified sialic acid was developed. The α2,3- and α2,6-linked sialosides containing a 5-azido neuraminic acid synthesized by a highly efficient one-pot three-enzyme approach were converted to C5″-amino sialosides, which were used as common intermediates for chemical parallel synthesis to quickly generate a series of sialosides containing various sialic acid forms. PMID:19740656

  3. Visible-light photoredox synthesis of unnatural chiral α-amino acids.


    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua


    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  4. Visible-light photoredox synthesis of unnatural chiral α-amino acids

    PubMed Central

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua


    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  5. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.


    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  6. Dietary Sugars Stimulate Fatty Acid Synthesis in Adults123

    PubMed Central

    Parks, Elizabeth J.; Skokan, Lauren E.; Timlin, Maureen T.; Dingfelder, Carlus S.


    The goal of this study was to determine the magnitude by which acute consumption of fructose in a morning bolus would stimulate lipogenesis (measured by infusion of 13C1-acetate and analysis by GC-MS) immediately and after a subsequent meal. Six healthy subjects [4 men and 2 women; aged (mean ± SD) 28 ± 8 y; BMI, 24.3 ± 2.8 kg/m2; and serum triacylglycerols (TG), 1.03 ± 0.32 mmol/L] consumed carbohydrate boluses of sugars (85 g each) in a random and blinded order, followed by a standardized lunch 4 h later. Subjects completed a control test of glucose (100:0) and a mixture of 50:50 glucose:fructose and one of 25:75 (wt:wt). Following the morning boluses, serum glucose and insulin after 100:0 were greater than both other treatments (P < 0.05) and this pattern occurred again after lunch. In the morning, fractional lipogenesis was stimulated when subjects ingested fructose and peaked at 15.9 ± 5.4% after the 50:50 treatment and at 16.9 ± 5.2% after the 25:75 treatment, values that were greater than after the 100:0 treatment (7.8 ± 5.7%; P < 0.02). When fructose was consumed, absolute lipogenesis was 2-fold greater than when it was absent (100:0). Postlunch, serum TG were 11–29% greater than 100:0 and TG-rich lipoprotein-TG concentrations were 76–200% greater after 50:50 and 25:75 were consumed (P < 0.05). The data demonstrate that an early stimulation of lipogenesis after fructose, consumed in a mixture of sugars, augments subsequent postprandial lipemia. The postlunch blood TG elevation was only partially due to carry-over from the morning. Acute intake of fructose stimulates lipogenesis and may create a metabolic milieu that enhances subsequent esterification of fatty acids flowing to the liver to elevate TG synthesis postprandially. PMID:18492831

  7. Low Phytic Acid Barley Responses to Phosphorus Rates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Low phytic acid (LPA) barley (Hordeum vulgare L.) cultivars partition phosphorus in seed tissue differently than conventional barley cultivars through a reduction in seed phytic acid (myo-inositol-1,2,3,4,5,6-hexkisphosphate) coupled with an increase in inorganic phosphorus. The response of the LPA...

  8. Copper-mediated arylation with arylboronic acids: Facile and modular synthesis of triarylmethanes

    PubMed Central

    Rao, A Veera Bhadra


    Summary A facile and modular synthesis of triarylmethanes was achieved in good yield via a two-step sequence in which the final step is the copper(II)-catalyzed arylation of diarylmethanols with arylboronic acids. By using this protocol a variety of symmetrical and unsymmetrical triarylmethanes were synthesized. As an application of the newly developed methodology, we demonstrate a high-yielding synthesis of the triarylmethane intermediate towards an anti-breast-cancer drug candidate. PMID:27340442

  9. Synthesis and proteinase inhibitory properties of diphenyl phosphonate analogues of aspartic and glutamic acids.


    Hamilton, R; Walker, B; Walker, B J


    The synthesis of diphenyl phosphonate analogues of aspartic and glutamic acid, and their inhibitory activity against S. aureus V8 protease and granzyme B, is described. The study has revealed difficulties with protecting group compatibility in the synthesis of these analogues. Two analogues, Acetyl. AspP (OPh)2 and Acetyl.GluP (OPh)2 were found to function as irreversible inactivators of V8 proteinase, yet exhibit no activity against granzyme B. PMID:9873408

  10. Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W

    PubMed Central

    Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence


    In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326

  11. Wavelength dependence of mycosporine-like amino acid synthesis in Gyrodinium dorsum.


    Klisch, M; Häder, D-P


    The synthesis or accumulation of mycosporine-like amino acids (MAAs) is an important UV tolerance mechanism in aquatic organisms. To investigate the wavelength dependence of MAA synthesis in the marine dinoflagellate Gyrodinium dorsum, the organism was exposed to polychromatic radiation (PAR and UV) from a solar simulator for up to 72 h. Different irradiance spectra were produced by inserting various cut-off filters between lamp and samples. A polychromatic action spectrum for the synthesis of MAA synthesis was constructed. PAR and long wavelength UV-A radiation showed almost no effect while the most effective wavelength range was around 310 nm. Shorter wavelengths where less effective in the induction of MAA synthesis. Wavelengths below 300 nm damaged the organisms severely as indicated by a decrease in chlorophyll a absorption. PMID:11849984

  12. Mechanism of Shope Fibroma Virus-Induced Suppression of Host Deoxyribonucleic Acid Synthesis

    PubMed Central

    Chan, James C.; Hodes, M. E.


    The effects of treatment with live or inactivated Shope fibroma virus on host cell deoxyribonucleic acid (DNA) synthesis were determined. The incorporation of 3H-thymidine into nuclear DNA was suppressed by both active and inactivated virus, although live virus was more effective. During the early phase of infection, stimulation of host nuclear DNA synthesis of up to 240% of control value was observed in cells infected with active virus. Inhibition of DNA synthesis began at about the 8th h and was maximal by 12 h postinfection. Virus inactivated by ultraviolet-irradiation or heat treatment did not induce viral DNA synthesis but was, nevertheless, able to suppress host DNA synthesis. PMID:4202660

  13. Receptor-mediated uptake of low density lipoprotein stimulates bile acid synthesis by cultured rat hepatocytes

    SciTech Connect

    Junker, L.H.; Davis, R.A. )


    The cellular mechanisms responsible for the lipoprotein-mediated stimulation of bile acid synthesis in cultured rat hepatocytes were investigated. Adding 280 micrograms/ml of cholesterol in the form of human or rat low density lipoprotein (LDL) to the culture medium increased bile acid synthesis by 1.8- and 1.6-fold, respectively. As a result of the uptake of LDL, the synthesis of (14C)cholesterol from (2-14C)acetate was decreased and cellular cholesteryl ester mass was increased. Further studies demonstrated that rat apoE-free LDL and apoE-rich high density lipoprotein (HDL) both stimulated bile acid synthesis 1.5-fold, as well as inhibited the formation of (14C)cholesterol from (2-14C)acetate. Reductive methylation of LDL blocked the inhibition of cholesterol synthesis, as well as the stimulation of bile acid synthesis, suggesting that these processes require receptor-mediated uptake. To identify the receptors responsible, competitive binding studies using 125I-labeled apoE-free LDL and 125I-labeled apoE-rich HDL were performed. Both apoE-free LDL and apoE-rich HDL displayed an equal ability to compete for binding of the other, suggesting that a receptor or a group of receptors that recognizes both apolipoproteins is involved. Additional studies show that hepatocytes from cholestyramine-treated rats displayed 2.2- and 3.4-fold increases in the binding of apoE-free LDL and apoE-rich HDL, respectively. These data show for the first time that receptor-mediated uptake of LDL by the liver is intimately linked to processes activating bile acid synthesis.

  14. Synthesis and biological properties of amino acids and peptides containing a tetrazolyl moiety

    NASA Astrophysics Data System (ADS)

    Popova, E. A.; Trifonov, R. E.


    Literature data published mainly in the last 15 years on the synthesis and biological properties of amino acid analogues and derivatives containing tetrazolyl moieties are analyzed. Tetrazolyl analogues and derivatives of amino acids and peptides are shown to be promising for medicinal chemistry. Being polynitrogen heterocyclic systems comprising four endocyclic nitrogen atoms, tetrazoles can behave as acids and bases and form strong hydrogen bonds with proton donors (more rarely, with acceptors). They have high metabolic stability and are able to penetrate biological membranes. The review also considers the synthesis and properties of linear and cyclic peptides based on modified amino acids incorporating a tetrazolyl moiety. A special issue is the discussion of the biological properties of tetrazole-containing amino acids and peptides, which exhibit high biological activity and can be used to design new drugs. The bibliography includes 200 references.

  15. Impaired rate of microsomal fatty acid elongation in undernourished neonatal rat brain

    SciTech Connect

    Yeh, Y.Y.


    Hypomyelination caused by undernourishment in characterized by low concentrations of myelin lipids and marked reduction in lignocerate (C/sub 24:0/) and nervonate (C/sub 24:1/) moiety of cerebroside and sulfatide. Since microsomal elongation is the major source of long chain (22 to 24 carbons) fatty acids in the brain, the effect of neonatal undernourishment on acyl elongation was investigated. Undernourishment of suckling rats were induced after birth by restricting maternal dietary intake to 40% of that consumed by dams fed ad libitum. Neonates suckled by the normally fed dams served as controls. Microsomal elongation was measured as nmol from (2-/sup 14/C) malonyl CoA incorporated/h per mg of protein. At 19 days of age, rates of behenoyl CoA (C/sub 22:0/) and erucoyl CoA (C/sub 22:1/) elongation in whole brain of undernourished neonates were 30-40% lower than that of the control, whereas the elongation rates of acyl CoA 16, 18 and 20 carbons in length either saturated or monounsaturated were similar in both groups. Undernourishment had no effect on cytoplasmic de novo fatty acid synthesis from acetyl CoA. If there are multiple elongation factors, the results indicate that the depressed activity of elongating enzyme(s) for C/sub 22:0/ and C/sub 22:1/ is an important contributing factor in lowering S/sub 24:0/ and C/sub 24:1/ content in cerebroside and sulfatide. This impairment may be a specific lesion leading to hypomyelination in undernourished rats.

  16. Synthesis of Hydroxymethylenebisphosphonic Acid Derivatives in Different Solvents.


    Nagy, Dávid Illés; Grün, Alajos; Garadnay, Sándor; Greiner, István; Keglevich, György


    The syntheses of hydroxymethylenebisphosphonic acid derivatives (dronic acid derivatives) starting from the corresponding substituted acetic acids and P-reagents, mainly phosphorus trichloride and phosphorous acid are surveyed according to the solvents applied. The nature of the solvent is a critical point due to the heterogeneity of the reaction mixtures. This review sheds light on the optimum choice and ratio of the P-reactants, and on the optimum conditions. PMID:27529200

  17. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen


    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  18. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines


    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  19. Synthesis of alpha-hydroxyphosphonic acids from Lesquerella oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella oil has been a substance of growing chemical interest, due to the ease with which it is produced and its similarity in structure to castor oil. The primary fatty acid in Lesquerella oil, lesquerolic acid, is very similar to the principal component of castor oil, ricinoleic acid, and may ...

  20. Measuring synthesis rates of nitrogen-containing polymers by using stable isotope tracers.


    Fan, M Z; Chiba, L I; Matzat, P D; Yang, X; Yin, Y L; Mine, Y; Stein, H H


    The major N-containing polymer compounds in the body include protein, RNA, and DNA. The endogenous gastrointestinal secretions as well as the portal-drained visceral and peripheral immune responses are basic physiological functions. Elevated endogenous secretions and immune activities, as affected by developmental stages, diets, and management factors, decrease the availability of dietary nutrients for peripheral muscle synthesis and deposition. Measurements of in vivo protein, RNA, and DNA synthesis rates associated with the viscera, peripheral immune cells, and skeletal muscles should, in principle, be the sensitive biochemical and cellular endpoints for studying factors affecting nonruminant nutrition, metabolism, and growth. The selection of stable isotope tracers for precursors, routes of tracer delivery, and mass spectrometric analyses of tracer enrichments are the major methodological considerations. To measure in vivo protein, RNA, and DNA synthesis rates, oral feeding with heavy water (2H2O), and continuous infusion of [U-13C]glucose and [15N]Gly intravenously for labeling the sugar moieties ribose and deoxyribose and de novo purine base synthesis have been established. Flooding doses of tracer Phe, for example, L-[ring-2H5]Phe, via the i.p. route are reliable and cost-effective for measuring in vivo protein synthesis rates, especially for the viscera in small nonruminants. Therefore, measurements of the major N-containing polymer synthesis rates in the viscera, the peripheral immune cells, and muscles through oral feeding with 2H2O and/or i.p. flooding doses of Phe tracers are the emerging tools for studying nonruminant nutrition, metabolism, and growth under research and field test conditions. PMID:16582095

  1. Fed levels of amino acids are required for the somatotropin-induced increase in muscle protein synthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were...

  2. Fatty acid carbon is essential for dNTP synthesis in endothelial cells

    PubMed Central

    Missiaen, Rindert; Queiroz, Karla CS; Borgers, Gitte; Elia, Ilaria; Zecchin, Annalisa; Cantelmo, Anna Rita; Christen, Stefan; Goveia, Jermaine; Heggermont, Ward; Goddé, Lucica; Vinckier, Stefan; Van Veldhoven, Paul P.; Eelen, Guy; Schoonjans, Luc; Gerhardt, Holger; Dewerchin, Mieke; Baes, Myriam; De Bock, Katrien; Ghesquière, Bart; Lunt, Sophia Y.; Fendt, Sarah-Maria; Carmeliet, Peter


    The metabolism of endothelial cells (ECs) during vessel sprouting remains poorly studied. Here, we report that endothelial loss of CPT1a, a rate-limiting enzyme of fatty acid oxidation (FAO), caused vascular sprouting defects due to impaired proliferation, not migration of ECs. Reduction of FAO in ECs did not cause energy depletion or disturb redox homeostasis, but impaired de novo nucleotide synthesis for DNA replication. Isotope labeling studies in control ECs showed that fatty acid carbons substantially replenished the Krebs cycle, and were incorporated into aspartate (a nucleotide precursor), uridine monophosphate (a precursor of pyrimidine nucleoside triphosphates) and DNA. CPT1a silencing reduced these processes and depleted EC stores of aspartate and deoxyribonucleoside triphosphates. Acetate (metabolized to acetyl-CoA, thereby substituting for the depleted FAO-derived acetyl-CoA) or a nucleoside mix rescued the phenotype of CPT1a-silenced ECs. Finally, CPT1 blockade inhibited pathological ocular angiogenesis, suggesting a novel strategy for blocking angiogenesis. PMID:25830893

  3. Selection and properties of Escherichia coli mutants defective in the synthesis of cyclopropane fatty acids.

    PubMed Central

    Taylor, F; Cronan, J E


    Mutants of Escherichia coli K-12 defective in the synthesis of cyclopropane fatty acids (CFA) have been selected and isolated by a L-[methyl-3H]methionine suicide procedure. Two mutants were isolated. Stationary-phase cultures of both mutants contain less than 0.7% of the CFA content found in the parental strain. The CFA deficiency is attributed to a deficiency of CFA synthetase activity. Extracts of both mutants contain less than 10% of the CFA synthetase activity found in extracts of the parental strain. Experiments in which parental and mutant extracts were mixed indicate that the lack of activity in the mutant strains is not due to an inhibitor of CFA synthetase present in the mutant extracts. We have not yet detected a physiological phenotype for these mutants. These strains grow normally at various temperatures in a variety of media. We have tested survival (colony-forming ability) in response to (i) prolonged incubation in stationary phase, (ii) exposure to drying, and (iii) exposure to detergents, heavy metals, low pH, high salt concentration, and a variety of other environmental conditions. The survival of both mutants is identical to that of the parental strain under all conditions tested. The compositions (excepting the CFA deficiency) and metabolic turnover rates of the phospholipids of both mutant strains are indistinguishable from those of the wild-type strain. The transport of several amino acids also seems normal in these mutants. PMID:1107324

  4. Synthesis of phosphatidylcholines in ozone-exposed alveolar type II cells isolated from adult rat lung: is glycerolphosphate acyltransferase a rate-limiting enzyme

    SciTech Connect

    Haagsman, H.P.; Schuurmans, E.A.; Batenburg, J.J.; van Golde, L.M.


    Type II cells were exposed to ozone by gas diffusion through the thin Teflon bottom of culture dishes. The rate of phosphatidylcholine synthesis by type II cells, monitored by the incorporation of (Me-/sup 14/C)choline, was impaired by ozone at concentrations that did not affect other cellular parameters. The enzymes choline kinase and cholinephosphate cytidylyltransferase were not susceptible to inactivation by ozone at concentrations at which the activity of glycerolphosphate acyltransferase was decreased. The enzyme activity of lactate dehydrogenase increased after ozone exposure. The specific activity of choline kinase in the cytosolic fraction of type II cells was fivefold that in whole lung. The metabolism of (Me-/sup 14/C)choline was studied as a function of the choline concentration. Maximal rates of phosphatidylcholine synthesis were already attained at a concentration of 20 microM choline. Exposure of type II cells to ozone did not affect the recovery of label from (Me-/sup 14/C)choline in choline phosphate and CDP choline. However, the maximal rate of phosphatidylcholine synthesis decreased after ozone exposure, which indicates that the decreased apparent activity of glycerolphosphate acyltransferase limits the supply of diacylglycerols and thereby the rate of phosphatidylcholine synthesis. If the flux through the diacylglycerol pathway was stimulated by the addition of palmitic acid, a higher maximal rate of phosphatidylcholine synthesis was observed. The uptake of (Me-/sup 14/C)choline and the recovery of label in CDPcholine were not altered by the addition of different concentrations of palmitate. It is concluded that type II cells take up choline very efficiently, probably due to the high specific activity of choline kinase. At low choline concentrations the rate of phosphatidylcholine synthesis is determined by the supply of CDPcholine.

  5. Effect of frequency of dosing of plant sterols on plasma cholesterol levels and synthesis rate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective was to compare the effects of plant sterols (PS) consumed as a single dose (single) at breakfast or as three doses consumed with breakfast, lunch and dinner (divided) on plasma lipoprotien levels and cholesterol endogenous fractional synthesis rate (FSR). A randomized, placebo-controll...

  6. In vivo measurement of DNA synthesis rates of colon epithelial cells in carcinogenesis

    SciTech Connect

    Kim, Sylvia Jeewon; Turner, Scott; Killion, Salena; Hellerstein, Marc K. . E-mail:


    We describe here a highly sensitive technique for measuring DNA synthesis rates of colon epithelial cells in vivo. Male SD rats were given {sup 2}H{sub 2}O (heavy water). Colon epithelial cells were isolated, DNA was extracted, hydrolyzed to deoxyribonucleosides, and the deuterium enrichment of the deoxyribose moiety was determined by gas chromatographic/mass spectrometry. Turnover time of colon crypts and the time for migration of cells from basal to top fraction of the crypts were measured. These data were consistent with cell cycle analysis and bromodeoxyuridine labeling. By giving different concentrations of a promoter, dose-dependent increases in DNA synthesis rates were detected, demonstrating the sensitivity of the method. Administration of a carcinogen increased DNA synthesis rates cell proliferation in all fractions of the crypt. In conclusion, DNA synthesis rates of colon epithelial cells can be measured directly in vivo using stable-isotope labeling. Potential applications in humans include use as a biomarker for cancer chemoprevention studies.

  7. The prebiotic synthesis of amino acids - interstellar vs. atmospheric mechanisms

    NASA Astrophysics Data System (ADS)

    Meierhenrich, U. J.; Muñoz Caro, G. M.; Schutte, W. A.; Barbier, B.; Arcones Segovia, A.; Rosenbauer, H.; Thiemann, W. H.-P.; Brack, A.


    Until very recently, prebiotic amino acids were believed to have been generated in the atmosphere of the early Earth, as successfully simulated by the Urey-Miller experiments. Two independent studies now identified ice photochemistry in the interstellar medium as a possible source of prebiotic amino acids. Ultraviolet irradiation of ice mixtures containing identified interstellar molecules (such as H2O, CO2, CO, CH3OH, and NH3) in the conditions of vacuum and low temperature found in the interstellar medium generated amino acid structures including glycine, alanine, serine, valine, proline, and aspartic acid. After warmup, hydrolysis and derivatization, our team was able to identify 16 amino acids as well as furans and pyrroles. Enantioselective analyses of the amino acids showed racemic mixtures. A prebiotic interstellar origin of amino acid structures is now discussed to be a plausible alternative to the Urey-Miller mechanism.

  8. Synthesis of new optically active propargylic fluorides and application to the enantioselective synthesis of monofluorinated analogues of fatty acid metabolites.


    Prakesch, M; Grée, D; Grée, R


    A new approach to obtain optically active unsaturated or polyunsaturated systems with a single fluorine atom in an allylic or propargylic position is reported. Central to this strategy is the high regio- and stereocontrol observed during the fluorination of propargylic alcohols allowing a short and efficient synthesis of 1. Further, simple functional group transformations gave the enals 2 and 3. These three key intermediates were used for the preparation of optically active monofluorinated analogues of fatty acid metabolites. PMID:11325281

  9. Protein synthesis rates in rat brain regions and subcellular fractions during aging

    SciTech Connect

    Avola, R.; Condorelli, D.F.; Ragusa, N.; Renis, M.; Alberghina, M.; Giuffrida Stella, A.M.; Lajtha, A.


    In vivo protein synthesis rates in various brain regions (cerebral cortex, cerebellum, hippocampus, hypothalamus, and striatum) of 4-, 12-, and 24-month-old rats were examined after injection of a flooding dose of labeled valine. The incorporation of labeled valine into proteins of mitochondrial, microsomal, and cytosolic fractions from cerebral cortex and cerebellum was also measured. At all ages examined, the incorporation rate was 0.5% per hour in cerebral cortex, cerebellum, hippocampus, and hypothalamus and 0.4% per hour in striatum. Of the subcellular fractions examined, the microsomal proteins were synthesized at the highest rate, followed by cytosolic and mitochondrial proteins. The results obtained indicate that the average synthesis rate of proteins in the various brain regions and subcellular fractions examined is fairly constant and is not significantly altered in the 4 to 24-month period of life of rats.

  10. Effect of the “Ribonucleic Acid Control” Locus in Escherichia coli on T4 Bacteriophage-Specific Ribonucleic Acid Synthesis

    PubMed Central

    Sköld, Ola


    Amino acid control of ribonucleic acid (RNA) synthesis in bacteria is known to be governed genetically by the rel locus. We investigated whether the rel gene of the host would also exert its effect on the regulation of phage-specific RNA synthesis in T4 phage-infected Escherichia coli cells. Since T-even phage infection completely shuts off host macromolecular synthesis, phage RNA synthesis could be followed specifically by the cumulative incorporation of radioactivity from labeled precursors into RNA of infected cells. Labeled uracil was shown to accumulate in phage-specific RNA for 30 to 35 min after infection, a phenomenon which probably reflects an expansion of the labile phage-RNA pool. Amino acid starvation was effected by the use of auxotrophic bacterial strains or thienylalanine. The latter substance is an amino acid analogue which induces a chemical auxotrophy by inhibiting the biosynthesis of phenylalanine, tyrosine, and tryptophan. Phage RNA synthesis was strictly dependent on the presence of amino acids, whereas phage deoxyribonucleic acid synthesis was not. By the use of several pairs of bacterial strains which were isogenic except for the rel gene, it was demonstrated that amino acid dependence was related to the allelic state of this gene. If the rel gene was mutated, amino acid starvation did not restrict phage RNA synthesis. PMID:4914097

  11. Effects of a New Glutamic Acid Derivative on Myocardial Contractility of Stressed Animals under Conditions of Nitric Oxide Synthesis Blockade.


    Tyurenkov, I N; Perfilova, V N; Sadikova, N V; Berestovitskaya, V M; Vasil'eva, O S


    Glufimet (glutamic acid derivative) in a dose of 28.7 mg/kg limited the reduction of the cardiac functional reserve in animals subjected to 24-h stress under conditions of nonselective NO synthase blockade with L-NAME (10 mg/kg). Adrenoreactivity and increased afterload tests showed that the increment of myocardial contraction/relaxation rates, left-ventricular pressure, and HR were significantly higher in glufimet-treated stressed animals with NO synthesis blockade than in animals which received no glufimet. The efficiency of glufimet was higher than that of phenibut (the reference drug). PMID:26205724

  12. Synthesis and antimycobacterial evaluation of new trans-cinnamic acid hydrazide derivatives.


    Carvalho, Samir A; da Silva, Edson F; de Souza, Marcus V N; Lourenço, Maria C S; Vicente, Felipe R


    In this work, we report the synthesis and the antimycobacterial evaluation of new trans-cinnamic acid derivatives of isonicotinic acid series (5) and benzoic acid series (6), designed by exploring the molecular hybridization approach between isoniazid (1) and trans-cinnamic acid derivative (3). The minimum inhibitory concentration (MIC) of the compounds 5a-d and 6c exhibited activity between 3.12 and 12.5 microg/mL and could be a good start point to find new lead compounds against multi-drug resistant tuberculosis. PMID:18068364

  13. A note on the prebiotic synthesis of organic acids in carbonaceous meteorites

    NASA Technical Reports Server (NTRS)

    Kerridge, John F.


    Strong similarities between monocarboxylic and hydrocarboxylic acids in the Murchison meteorite suggest corresponding similarities in their origins. However, various lines of evidence apparently implicate quite different precursor compounds in the synthesis of the different acids. These seeming inconsistencies can be resolved by postulating that the apparent precursors also share a related origin. Pervasive D enrichment indicates that this origin was in a presolar molecular cloud. The organic acids themselves were probably synthesized in an aqueous environment on an asteroidal parent body, the hydroxy (and amino) acids by means of the Strecker cyanohydrin reaction.

  14. Stimulation of muscle protein synthesis by prolonged parenteral infusion of leucine is dependent on amino acid availability in neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The postprandial rise in amino acids, particularly leucine, stimulates muscle protein synthesis in neonates. Previously, we showed that a 1-h infusion of leucine increased protein synthesis, but this response was not sustained for 2 h unless the leucine-induced decrease in amino acids was prevented....

  15. Evidence for a Relationship Between Equine Abortion (Herpes) Virus Deoxyribonucleic Acid Synthesis and the S Phase of the KB Cell Mitotic Cycle

    PubMed Central

    Lawrence, William C.


    Autoradiographic analyses of deoxyribonucleic acid (DNA) synthesis in randomly growing KB cell cultures infected with equine abortion virus (EAV) suggested that viral DNA synthesis was initiated only at times that coincided with the entry of noninfected control cells into the S phase of the cell cycle. Synchronized cultures of KB cells were infected at different stages of the cell cycle, and rates of synthesis of cellular and viral DNA were measured. When cells were infected at different times within the S phase, viral DNA synthesis was initiated 2 to 3 hr after infection. However, when cells in G1 and G2 were infected, the initiation of viral DNA synthesis was delayed and occurred only at times corresponding to the S phase. The times when viral DNA synthesis began were independent of the time of infection and differed by as much as 5 hr, depending on the stage of the cell cycle at which cells were infected. Viral one-step growth curves were also related to the S phase in a manner which indicated a relationship between the initiation of viral DNA synthesis and the S phase. These data support the concept that initiation of EAV DNA synthesis is dependent upon some cellular function(s) which is related to the S phase of the cell cycle. PMID:4254680

  16. The Use of Ascorbate as an Oxidation Inhibitor in Prebiotic Amino Acid Synthesis: A Cautionary Note

    NASA Astrophysics Data System (ADS)

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei


    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO2-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO2 was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO2-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO2-rich atmosphere under the conditions studied.

  17. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa


    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  18. Overexpression of Cholesterol 7α-hydroxylase promotes hepatic bile acid synthesis and secretion and maintains cholesterol homeostasis

    PubMed Central

    Li, Tiangang; Matozel, Michelle; Boehme, Shannon; Kong, Bo; Nilsson, Lisa-Mari; Guo, Grace; Ellis, Ewa; Chiang, John Y. L.


    Summary We reported previously that mice overexpressing Cyp7a1 (Cyp7a1-tg) are protected against high fat diet-induced hypercholesterolemia, obesity and insulin resistance (1). Here we investigated the underlying mechanism of bile acid signaling in maintaining cholesterol homeostasis in Cyp7a1-tg mice. Cyp7a1-tg mice had 2-fold higher Cyp7a1 activity and bile acid pool than wild type mice. Gallbladder bile acid composition changed from predominantly cholic acid (57%) in wild type to chenodeoxycholic acid (54%) in Cyp7a1-tg mice. Cyp7a1-tg mice had higher biliary and fecal cholesterol and bile acid secretion rates than wild type mice. Surprisingly, hepatic de novo cholesterol synthesis was markedly induced in Cyp7a1-tg mice but intestine fractional cholesterol absorption in Cyp7a1-tg mice remained the same as wild type mice despite increased intestine bile acids. Interestingly, hepatic but not intestinal expression of several cholesterol (ABCG5/G8, SR-B1) and bile acid (ABCB11) transporters were significantly induced in Cyp7a1-tg mice. Treatment of mouse or human hepatocytes with a farnesoid X receptor (FXR) agonist GW4064 or bile acids induced hepatic Abcg5/g8 expression. A functional FXR binding site was identified in the Abcg5 gene promoter. Study of tissue-specific Fxr knockout mice demonstrated that loss of the Fxr gene in the liver attenuated bile acid induction of hepatic Abcg5/g8 and gallbladder cholesterol content, suggesting a role of FXR in the regulation of cholesterol transport. In summary, this study revealed a new mechanism by which increased Cyp7a1 activity expands the hydrophobic bile acid pool, stimulating hepatic cholesterol synthesis and biliary cholesterol secretion without increasing intestinal cholesterol absorption. This study demonstrated that Cyp7a1 plays a critical role in maintaining cholesterol homeostasis and underscores the importance of bile acid signaling in regulating overall cholesterol homeostasis. PMID:21319191

  19. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.


    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr


    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials. PMID:27482849


    EPA Science Inventory

    Trichloroacetic acid (TCA) is a by-product of the chlorine disinfection of water containing natural organic material. t is detectable in finished drinking water at levels comparable to the trihalomethanes (930-160 ug/L). CA is also formed in vivo after ingestion of hypochelorite ...

  1. 5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group


    Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude


    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  2. 5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group


    Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.


    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.


    EPA Science Inventory

    Male chicks weighing 700 to 900 g. received an acute or eight doses IG of 60 or 40 mg/kg ethylene chlorohydrin (ECH) respectively and were sacrificed eighteen hours after the last dose. Mitochondrial elongation of fatty acids was decreased significantly while fatty acid synthetas...

  4. Improved synthesis of isostearic acid using zeolite catalysts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Isostearic acids are unique and important biobased products with superior properties. Unfortunately, they are not widely utilized in industry because they are produced as byproducts from a process called clay-catalyzed oligomerization of tall oil fatty acids. Generally, this clay method results in...


    EPA Science Inventory

    The project studies the inhibitory effect of lead on the enzymatic activity of brain glutamic amino acid decarboxylase (GADC). The enzyme is responsible for the catalytic formation of gamma amino butyric acid (GABA) inhibitory neurons which is believed to be involved with the tra...

  6. Bile acid production in human subjects: rate of oxidation of (24,25-/sup 3/H)cholesterol compared to fecal bile acid excretion

    SciTech Connect

    Davidson, N.O.; Bradlow, H.L.; Ahrens, E.H. Jr.; Rosenfeld, R.S.; Schwartz, C.C.


    Bile acid production has been quantitated in seven subjects by methods that compare the results of two independent approaches, namely, quantitation of cholesterol side-chain oxidation and fecal bile acid excretion. Six hypertriglyceridemic (HT) subjects and one normolipidemic control were studied by both techniques. A further control subject was studied by the cholesterol side-chain oxidation method alone. Cholesterol side-chain oxidation was quantitated by measuring the appearance of /sup 3/H/sub 2/O after intravenous administration of (24,25-/sup 3/H)cholesterol, using multicompartmental analysis of plasma cholesterol and (/sup 3/H)water specific activity. Body water kinetics were independently defined by use of oral D/sub 2/O. Two HT subjects were restudied while they were taking cholestyramine, 16 g/day. In all ten studies, multicompartmental analysis closely simulated the observed appearance of /sup 3/H/sub 2/O. Values obtained for bile acid production suggest that cholesterol oxidation, or bile acid input, was significantly greater than fecal bile acid output in the HT subjects (P less than 0.05). Cholesterol side-chain oxidation rates in the two normal subjects were lower than those encountered in HT subjects, being similar to published values for normal subjects both for bile acid synthesis as determined by isotope dilution kinetics and fecal bile acid excretion. Studies conducted with two, synthetically different, preparations of (24,25-/sup 3/H)cholesterol indicated that, in one of the two preparations, approximately 20% of the tritium label was at positions proximal to C24. In the other preparation examined, all of the tritium was located at, or distal to, C24. Further studies revealed that 0.055-0.24% of the dose was present as labile tritium by virtue of its appearance as /sup 3/H/sub 2/O following in vitro incubation with human plasma. (Abstract Truncated)

  7. Size control by rate control in colloidal PbSe quantum dot synthesis

    NASA Astrophysics Data System (ADS)

    Čapek, Richard Karel; Yanover, Dianna; Lifshitz, Efrat


    A recently demonstrated approach to control the size of colloidal nanoparticles, ``size control by rate control'', which was validated on the examples of colloidal CdSe- and CdS-quantum dot (CQD) synthesis, appears to be a general strategy for designing technically applicable CQD-syntheses. The ``size control by rate control'' concept allows full-yield syntheses of ensembles of CQDs with different sizes by tuning the solute formation rate. In this work, we extended this strategy to dialkylphosphine enhanced hot-injection synthesis of PbSe-CQDs. Furthermore, we provide new insight into the reaction mechanism of dialkylphosphine enhancement in TOPSe based CQD-syntheses.A recently demonstrated approach to control the size of colloidal nanoparticles, ``size control by rate control'', which was validated on the examples of colloidal CdSe- and CdS-quantum dot (CQD) synthesis, appears to be a general strategy for designing technically applicable CQD-syntheses. The ``size control by rate control'' concept allows full-yield syntheses of ensembles of CQDs with different sizes by tuning the solute formation rate. In this work, we extended this strategy to dialkylphosphine enhanced hot-injection synthesis of PbSe-CQDs. Furthermore, we provide new insight into the reaction mechanism of dialkylphosphine enhancement in TOPSe based CQD-syntheses. Electronic supplementary information (ESI) available: Additional data about the reaction and growth kinetics, NMR-data and exemplary TEM images of PbSe-CQDs prepared by the procedure described in this publication. See DOI: 10.1039/c5nr00028a

  8. Post-exercise whey protein hydrolysate supplementation induces a greater increase in muscle protein synthesis than its constituent amino acid content.


    Kanda, Atsushi; Nakayama, Kyosuke; Fukasawa, Tomoyuki; Koga, Jinichiro; Kanegae, Minoru; Kawanaka, Kentaro; Higuchi, Mitsuru


    It is well known that ingestion of a protein source is effective in stimulating muscle protein synthesis after exercise. In addition, there are numerous reports on the impact of leucine and leucine-rich whey protein on muscle protein synthesis and mammalian target of rapamycin (mTOR) signalling. However, there is only limited information on the effects of whey protein hydrolysates (WPH) on muscle protein synthesis and mTOR signalling. The aim of the present study was to compare the effects of WPH and amino acids on muscle protein synthesis and the initiation of translation in skeletal muscle during the post-exercise phase. Male Sprague–Dawley rats swam for 2 h to depress muscle protein synthesis. Immediately after exercise, the animals were administered either carbohydrate (CHO), CHO plus an amino acid mixture (AA) or CHO plus WPH. At 1 h after exercise, the supplements containing whey-based protein (AA and WPH) caused a significant increase in the fractional rate of protein synthesis (FSR) compared with CHO. WPH also caused a significant increase in FSR compared with AA. Post-exercise ingestion of WPH caused a significant increase in the phosphorylation of mTOR levels compared with AA or CHO. In addition, WPH caused greater phosphorylation of ribosomal protein S6 kinase and eukaryotic initiation factor 4E-binding protein 1 than AA and CHO. In contrast, there was no difference in plasma amino acid levels following supplementation with either AA or WPH. These results indicate that WPH may include active components that are superior to amino acids for stimulating muscle protein synthesis and initiating translation. PMID:23388415

  9. Water evaporation rates across hydrophobic acid monolayers at equilibrium spreading pressure.


    Tsuji, Minami; Nakahara, Hiromichi; Moroi, Yoshikiyo; Shibata, Osamu


    The effect of alkanoic acid [CH(3)(CH(2))(n-2)COOH; HCn] and perfluoroalkanoic acid [CF(3)(CF(2))(n-2)COOH; FCn] monolayers on the water evaporation rate was investigated by thermogravimetry tracing the decrease in amount of water with time. The evaporation rate from the surface covered by a monolayer was measured as a function of temperature and hydrophobic chain length of the acids, where the monolayer was under an equilibrium spreading pressure. From thermal behavior of the crystallized acids, their solid states are C-type in crystalline state over the temperature range from 298.2 to 323.2 K. The dry air was flowed through a furnace tube of a thermogravimetry apparatus at the flow rate of 80 mL min(-1), where the evaporation rate becomes almost constant irrespective of the flow rate. The temperature dependence of the evaporation rate was analyzed kinetically to evaluate the activation energy and thermodynamics values for the activated complex, which demonstrated that these values were almost the same for both alkanoic acids and perfluoroalkanoic acids, although the effect of perfluoroalkanoic acids on the evaporation rate was smaller than that of corresponding hydrogenated fatty acids. The difference in the evaporation rate between FCn and HCn was examined by atomic force microscopy (AFM), Brewster angle microscopy (BAM), surface potential (DeltaV) at equilibrium spreading pressure, and Langmuir curve (pi-A isotherm), and their results were consistent and supported the difference. PMID:18048050

  10. Relationship between the electrochemical activity of Raney nickel and the rate of hydrogenation of maleic acid

    SciTech Connect

    Pervii, E.N.; Sofronkov, A.N.; Fedyshina, N.M.


    The purpose of this investigation was to determine the conditions in which a direct correlation exists between the rate of hydrogenation of maleic acid and the electrochemical activity of catalysts of hydrogen ionization. The rate of maleic acid hydrogenation in presence of Raney nickel catalyst was studied by a combination of volumetric and potentiometric methods.

  11. Synthesis and characterization of hydrogen-bond acidic functionalized graphene

    NASA Astrophysics Data System (ADS)

    Yang, Liu; Han, Qiang; Pan, Yong; Cao, Shuya; Ding, Mingyu


    Hexafluoroisopropanol phenyl group functionalized materials have great potential in the application of gas-sensitive materials for nerve agent detection, due to the formation of strong hydrogen-bonding interactions between the group and the analytes. In this paper, take full advantage of ultra-large specific surface area and plenty of carbon-carbon double bonds and hexafluoroisopropanol phenyl functionalized graphene was synthesized through in situ diazonium reaction between -C=C- and p-hexafluoroisopropanol aniline. The identity of the as-synthesis material was confirmed by transmission electron microscopy, Raman spectroscopy, ultraviolet visible spectroscopy, X-ray photoelectron spectroscopy and thermo gravimetric analysis. The synthesis method is simply which retained the excellent physical properties of original graphene. In addition, the novel material can be assigned as an potential candidate for gas sensitive materials towards organophosphorus nerve agent detection.

  12. Stimulation of muscle protein synthesis by leucine is dependent on plasma amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that a physiological increase in plasma leucine increased translation initiation factor activity during 60- and 120-min leucine infusion. Muscle protein synthesis was stimulated at 60 min but not at 120 min, perhaps due to the decrease (-50%) in plasma essential amino acids (AA). ...

  13. Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids

    PubMed Central

    Cativiela, Carlos; Ordóñez, Mario


    The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486

  14. Tandem Ru-alkylidene-catalysed cross metathesis/hydrogenation: synthesis of lipophilic amino acids.


    Wang, Zhen J; Spiccia, Nicolas D; Jackson, W Roy; Robinson, Andrea J


    Highly efficient synthesis of lipidic amino acids can be achieved via Ru-alkylidene-catalysed cross metathesis of long chain alkenes with commercially available allylglycine. The resultant unsaturated analogues can be then optionally hydrogenated under mild reaction conditions by using the spent metathesis catalyst. PMID:23733491

  15. One-Pot Synthesis of Arylketones from Aromatic Acids via Palladium-Catalyzed Suzuki Coupling.


    Wu, Hongxiang; Xu, Baiping; Li, Yue; Hong, Fengying; Zhu, Dezhao; Jian, Junsheng; Pu, Xiaoer; Zeng, Zhuo


    A palladium-catalyzed one-pot procedure for the synthesis of aryl ketones has been developed. Triazine esters when coupled with aryl boronic acids provided aryl ketones in moderate to excellent yields (up to 95%) in the presence of 1 mol % Pd(PPh3)2Cl2 for 30 min. PMID:26949103


    EPA Science Inventory

    An environmentally benign aqueous protocol for the synthesis of cyclic, bi-cyclic, and heterocyclic hydrazones using polystyrene sulfonic acid (PSSA) as a catalyst has been developed; the simple reaction proceeds efficiently in water in the absence of any organic solvent under mi...

  17. Synthesis and bioactivity of novel caffeic acid esters from Zuccagnia punctata.


    Ramachandra, M S; Subbaraju, G V


    Synthesis of novel caffeic acid esters (1 and 2) was accomplished starting from appropriately substituted benzaldehydes (3 and 9). While compound 2 exhibited potent anti-oxidative activity in both the nitroblue tetrazolium and 1,1-diphenyl-2-picrylhydrazyl radical-scavenging models, compound 1 showed moderate 5-lipoxygenase inhibitory activity. PMID:17145655

  18. Templated synthesis of nylon nucleic acids and characterization by nuclease digestion

    PubMed Central

    Liu, Yu; Wang, Risheng; Ding, Liang; Sha, Roujie


    Nylon nucleic acids containing oligouridine nucleotides with pendent polyamide linkers and flanked by unmodified heteronucleotide sequences were prepared by DNA templated synthesis. Templation was more efficient than the single-stranded synthesis: Coupling step yields were as high as 99.2%, with up to 7 amide linkages formed in the synthesis of a molecule containing 8 modified nucleotides. Controlled digestion by calf spleen phosphodiesterase enabled the mapping of modified nucleotides in the sequences. A combination of complete degradation of nylon nucleic acids by snake venom phosphodiesterase and dephosphorylation of the resulting nucleotide fragments by bacterial alkaline phosphatase, followed by LCMS analysis, clarified the linear structure of the oligo-amide linkages. The templated synthesis strategy afforded nylon nucleic acids in the target structure and was compatible with the presence heteronucleotides. The complete digestion procedure produced a new species of DNA analogues, nylon ribonucleosides, which display nucleosides attached via a 2′-alkylthio linkage to each diamine and dicarboxylate repeat unit of the original nylon nucleic acids. The binding affinity of a nylon ribonucleoside octamer to the complementary DNA was evaluated by thermal denaturing experiments. The octamer was found to form stable duplexes with an inverse dependence on salt concentration, in contrast to the salt-dependent DNA control. PMID:23125913

  19. Insulin and amino acids stimulate whole body protein synthesis in neonates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Insulin and amino acids (AA) stimulate muscle protein synthesis in neonatal pigs. To determine the effects of insulin and AA on whole body protein turnover, hyperinsulinemic (0 and 100 ng/(kg[0.66]/min))-euglycemic-AA clamps were performed during euaminoacidemia or hyperaminoacidemia in fasted 7-d-...

  20. Synthesis of selenium-containing amino acid analogues and their biological study.


    Abdel-Hafez, S H; Saad, H A; Aly, M R E


    Synthesis of selenium-containing amino acid analogues is described. These compounds were prepared in a concise and short synthetic route in good yields by nucleophilic substitution reaction of pyridineselenol and quinolineselenol derivatives with N-phthaloylglycyl chloride followed by hydrazinolysis. The newly synthesized compounds were screened against different strains of bacteria and fungi. PMID:21899043

  1. Hydroxy fatty acid synthesis and lipid gene expression during seed development in Lesquerella fendleri (L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella fendleri is a developing oilseed crop in U.S. Its seed oil is rich in hydroxy fatty acid (HFA), lesquerolate (C20:1OH), suitable as a raw material for many industrial applications. To understand regulatory mechanism underlying synthesis and accumulation of the lesquerolate, we have inves...

  2. Quantifying Protein Synthesis and Degradation in Arabidopsis by Dynamic 13CO2 Labeling and Analysis of Enrichment in Individual Amino Acids in Their Free Pools and in Protein1[OPEN

    PubMed Central

    Fernie, Alisdair R.; Stitt, Mark


    Protein synthesis and degradation represent substantial costs during plant growth. To obtain a quantitative measure of the rate of protein synthesis and degradation, we supplied 13CO2 to intact Arabidopsis (Arabidopsis thaliana) Columbia-0 plants and analyzed enrichment in free amino acids and in amino acid residues in protein during a 24-h pulse and 4-d chase. While many free amino acids labeled slowly and incompletely, alanine showed a rapid rise in enrichment in the pulse and a decrease in the chase. Enrichment in free alanine was used to correct enrichment in alanine residues in protein and calculate the rate of protein synthesis. The latter was compared with the relative growth rate to estimate the rate of protein degradation. The relative growth rate was estimated from sequential determination of fresh weight, sequential images of rosette area, and labeling of glucose in the cell wall. In an 8-h photoperiod, protein synthesis and cell wall synthesis were 3-fold faster in the day than at night, protein degradation was slow (3%–4% d−1), and flux to growth and degradation resulted in a protein half-life of 3.5 d. In the starchless phosphoglucomutase mutant at night, protein synthesis was further decreased and protein degradation increased, while cell wall synthesis was totally inhibited, quantitatively accounting for the inhibition of growth in this mutant. We also investigated the rates of protein synthesis and degradation during leaf development, during growth at high temperature, and compared synthesis rates of Rubisco large and small subunits of in the light and dark. PMID:25810096

  3. Measurement of the rates of oxindole-3-acetic acid turnover, and indole-3-acetic acid oxidation in Zea mays seedlings

    NASA Technical Reports Server (NTRS)

    Nonhebel, H. M.; Bandurski, R. S. (Principal Investigator)


    Oxindole-3-acetic acid is the principal catabolite of indole-3-acetic acid in Zea mays seedlings. In this paper measurements of the turnover of oxindole-3-acetic acid are presented and used to calculate the rate of indole-3-acetic acid oxidation. [3H]Oxindole-3-acetic acid was applied to the endosperm of Zea mays seedlings and allowed to equilibrate for 24 h before the start of the experiment. The subsequent decrease in its specific activity was used to calculate the turnover rate. The average half-life of oxindole-3-acetic acid in the shoots was found to be 30 h while that in the kernels had an average half-life of 35h. Using previously published values of the pool sizes of oxindole-3-acetic acid in shoots and kernels from seedlings of the same age and variety, and grown under the same conditions, the rate of indole-3-acetic acid oxidation was calculated to be 1.1 pmol plant-1 h-1 in the shoots and 7.1 pmol plant-1 h-1 in the kernels.

  4. Synthesis of polyacrylic-acid-based thermochromic polymers

    NASA Astrophysics Data System (ADS)

    Srivastava, Jyoti; Alam, Sarfaraz; Mathur, G. N.


    Smart materials respond to environmental stimuli with particular changes in some variables (for example temperature, pressure and electric field etc), for that reason they are often called responsive materials. In the present work, we have synthesized thermochromic polymer based on poly acrylic acid cobalt chloride (CoCl2) and phosphoric acid (H3PO4) that visually and reversibly changes color in the temperature range (70 - 130°C). These thermochromic materials can be used as visual sensors of temperature. Thermochromic polymers are based on polyacrylic acid and CoCl2 complex.

  5. The effect of organic acids on plagioclase dissolution rates and stoichiometry

    NASA Astrophysics Data System (ADS)

    Welch, Susan A.; Ullman, William J.


    The rates of plagioclase dissolution in solutions containing organic acids are up to ten times greater than the rates determined in solutions containing inorganic acids at the same acidity. Initial rates of dissolution are poorly reproduced in replicate experiments. After a day, however, the rates of plagioclase dissolution calculated from the rates of silicon release are reproducible and constant for up to nineteen days. Steady-state rates of dissolution are highest (up to 1.3 × 10 -8 mol/m 2/sec) in acidic solutions (pH ≈ 3) and decrease (to 1 × 10 -11 mol/m 2/sec) as acidity decreases toward neutral pH. The polyfunctional acids, oxalate, citrate, succinate, pyruvate, and 2-ketoglutarate, are the most effective at promoting dissolution. Acetate and propionate are not as effective as the other organic acids but are nonetheless more effective than solutions containing only inorganic acids. The degree of ligand-promoted enhancement of dissolution rate (rate in organic-containing solution/rate in inorganic solution at the same pH) decreases as acidity increases, indicating that the ligand-promoted dissolution mechanism becomes relatively more important as the rate of proton-promoted dissolution decreases. The stoichiometry of release to solution indicates that dissolution is selective even after the rates of dissolution become constant. As in previously published studies, Na and Ca are rapidly released from the plagioclase feldspar, leaving a surface enriched in Si and/or Al. The ratio of Al/Si released to solution indicates that the stoichiometry of the residual plagioclase surface is a function of pH and the nature of the organic ligand. The ligands which remove Al in preference to Si from the dissolving mineral surface are also those which enhance overall plagioclase dissolution rates.

  6. Induction of cellular deoxyribonucleic acid synthesis in butyrate-treated cells by simian virus 40 deoxyribonucleic acid

    SciTech Connect

    Kawasaki, S.; Diamond, L.; Baserga, R.


    Sodium butyrate (3mM) inhibited the entry into the S phase of quiescent 3T3 cells stimulated by serum, but had no effect on the accumulation of cellular ribonucleic acid. Simian virus 40 infection or manual microinjection of cloned fragments from the simian virus 40 A gene caused quiescent 3T3 cells to enter the S phase even in the presence of butyrate. NGI cells, a line of 3T3 cells transformed by simian virus 40, grew vigorously in 3 mM butyrate. Homokaryons were formed between G/sub 1/ and S-phase 3T3 cells. Butyrate inhibited the induction of deoxyribonucleic acid synthesis that usually occurs in G/sub 1/ nuclei when G/sub 1/ cells are fused with S-phase cells. However, when G/sub 1/ 3T3 cells were fused with exponentially growing NGI cells, the 3T3 nuclei were induced to enter deoxyribonucleic acid synthesis. In tsAF8 cells, a ribonucleic acid polymerase II mutant that stops in the G/sub 1/ phase of the cell cycle, no temporal sequence was demonstrated between the butyrate block and the temperature-sensitive block. These results confirm previous reports that certain virally coded proteins can induce cell deoxyribonucleic acid synthesis in the absence of cellular functions that are required by serum-stimulated cells. The author's interpretation of these data is that butyrate inhibited cell growth by inhibiting the expression of genes required for the G/sub o/ ..-->.. G/sub 1/ ..-->.. S transition and that the product of the simian virus 40 A gene overrode this inhibition by providing all of the necessary functions for the entry into the S phase.

  7. Highly efficient enzymatic synthesis of an ascorbyl unstaturated fatty acid ester with ecofriendly biomass-derived 2-methyltetrahydrofuran as cosolvent.


    Hu, Ying-Dan; Qin, Ye-Zhi; Li, Ning; Zong, Min-Hua


    Enzymatic synthesis of ascorbyl undecylenate, an unsaturated fatty acid ester of ascorbic acid, was reported with biomass-derived 2-methyltetrahydrofuran (MeTHF) as the cosolvent. Of the immobilized lipases tested, Candida antarctica lipase B (CAL-B) showed the highest activity for enzymatic synthesis of ascorbyl undecylenate. Effect of reaction media on the enzymatic reaction was studied. The cosolvent mixture, t-butanol-MeTHF (1:4, v/v) proved to be the optimal medium, in which not only ascorbic acid had moderate solubility, but also CAL-B showed a high activity, thus addressing the major problem of the solvent conflict for dissolving substrate and keeping satisfactory enzyme activity. In addition, the enzyme was much more stable in MeTHF and t-butanol-MeTHF (1:4) than in previously widely used organic solvents, t-butanol, 2-methyl-2-butanol, and acetone. The much higher initial reaction rate in this cosolvent mixture may be rationalized by the much lower apparent activation energy of this enzymatic reaction (26.6 vs. 38.1-39.1 kJ/mol) and higher enzyme catalytic efficiency (Vmax /Km , 8.4 vs. 1.3-1.4 h(-1) ). Ascorbyl undecylenate was obtained with the yields of 84-89% and 6-regioselectivity of >99% in t-butanol-MeTHF (1:4) at supersaturated substrate concentrations (60 and 100 mM) after 5-8 h. PMID:24891225

  8. Optimization of synthesis and peptization steps to obtain iron oxide nanoparticles with high energy dissipation rates

    NASA Astrophysics Data System (ADS)

    Mérida, Fernando; Chiu-Lam, Andreina; Bohórquez, Ana C.; Maldonado-Camargo, Lorena; Pérez, María-Eglée; Pericchi, Luis; Torres-Lugo, Madeline; Rinaldi, Carlos


    Magnetic Fluid Hyperthermia (MFH) uses heat generated by magnetic nanoparticles exposed to alternating magnetic fields to cause a temperature increase in tumors to the hyperthermia range (43-47 °C), inducing apoptotic cancer cell death. As with all cancer nanomedicines, one of the most significant challenges with MFH is achieving high nanoparticle accumulation at the tumor site. This motivates development of synthesis strategies that maximize the rate of energy dissipation of iron oxide magnetic nanoparticles, preferable due to their intrinsic biocompatibility. This has led to development of synthesis strategies that, although attractive from the point of view of chemical elegance, may not be suitable for scale-up to quantities necessary for clinical use. On the other hand, to date the aqueous co-precipitation synthesis, which readily yields gram quantities of nanoparticles, has only been reported to yield sufficiently high specific absorption rates after laborious size selective fractionation. This work focuses on improvements to the aqueous co-precipitation of iron oxide nanoparticles to increase the specific absorption rate (SAR), by optimizing synthesis conditions and the subsequent peptization step. Heating efficiencies up to 1048 W/gFe (36.5 kA/m, 341 kHz; ILP=2.3 nH m2 kg-1) were obtained, which represent one of the highest values reported for iron oxide particles synthesized by co-precipitation without size-selective fractionation. Furthermore, particles reached SAR values of up to 719 W/gFe (36.5 kA/m, 341 kHz; ILP=1.6 nH m2 kg-1) when in a solid matrix, demonstrating they were capable of significant rates of energy dissipation even when restricted from physical rotation. Reduction in energy dissipation rate due to immobilization has been identified as an obstacle to clinical translation of MFH. Hence, particles obtained with the conditions reported here have great potential for application in nanoscale thermal cancer therapy.

  9. Synthesis and biological evaluation of novel lipoamino acid derivatives.


    Kaki, Shiva Shanker; Arukali, Sammaiah; Korlipara, Padmaja V; Prasad, R B N; Yedla, Poornachandra; Ganesh Kumar, C


    Seven novel lipoamino acid conjugates were synthesized from methyl oleate and amino acids. Methyl oleate was grafted to different amino acids using thioglycolic acid as a spacer group. Seven derivatives (3a-g) were prepared and characterized by spectral data (NMR, IR and MS spectral studies). All the derivatives were studied for their antimicrobial, anti-biofilm and anticancer activities. Among all the derivatives, it was found that compound 3b was the most potent antibacterial compound which showed good activity against four Gram positive bacterial strains and also exhibited excellent antifungal activity against a fungal strain. In the anti-biofilm assay, compound 3b showed promising activity with IC50 value of 2.8μM against Bacillus subtilis MTCC 121. All the compounds showed anticancer activities with 3c showing promising anticancer activity (IC50=15.3-22.4μM) against the four cell lines tested. PMID:26586599

  10. Synthesis and Functionalization of Cyclic Sulfonimidamides: A Novel Chiral Heterocyclic Carboxylic Acid Bioisostere

    PubMed Central


    An efficient synthesis of aryl substituted cyclic sulfonimidamides designed as chiral nonplanar heterocyclic carboxylic acid bioisosteres is described. The cyclic sulfonimidamide ring system could be prepared in two steps from a trifluoroacetyl protected sulfinamide and methyl ester protected amino acids. By varying the amino acid, a range of different C-3 substituted sulfonimidamides could be prepared. The compounds could be further derivatized in the aryl ring using standard cross-coupling reactions to yield highly substituted cyclic sulfonimidamides in excellent yields. The physicochemical properties of the final compounds were examined and compared to those of the corresponding carboxylic acid and tetrazole derivatives. The unique nonplanar shape in combination with the relatively strong acidity (pKa 5–6) and the ease of modifying the chemical structure to fine-tune the physicochemical properties suggest that this heterocycle can be a valuable addition to the range of available carboxylic acid isosteres. PMID:24900513

  11. Synthesis of a bicyclic delta-amino acid as a constrained Gly-Asn dipeptide isostere.


    Trabocchi, A; Menchi, G; Danieli, E; Guarna, A


    Delta-amino acids are very attractive in drug discovery, especially in the peptidomimetic area, because of their capability to act as dipeptide isosteres and reverse turn mimetics. Herein we report the synthesis of a rigid delta-amino acid constrained by a 3-aza-6,8-dioxabicyclo[3.2.1]octane-based scaffold, which can be considered as a Gly-Asn dipeptide mimetic. Key steps are the condensation of glycidol and tartaric acid derivatives, and the intramolecular trans-acetalization of the oxidized adduct to give the bicyclic delta-amino acid. Starting from L-tartaric acid derivative, it was achieved the corresponding Gly-D-Asn isostere, whereas from the enantiomeric D-tartaric acid derivative the corresponding Gly-L-Asn isostere could be obtained, thus giving access to both enantiomeric dipeptide sequences. PMID:18235990

  12. Synthesis and properties of coumaric acid derivative homo-polymers.


    Thi, Tran Hang; Matsusaki, Michiya; Shi, Dongjian; Kaneko, Tatsuo; Akashi, Mitsuru


    Poly(4-hydroxycinnamic acid) (P4HCA), poly(3-hydroxycinnamic acid) (P3HCA), poly(3-methoxy-4-hydroxycinnamic acid) (PMHCA) and poly(3,4-dihydroxycinnamic acid) (PDHCA) were synthesized by the thermal poly-condensation of the corresponding monomers, which are lignin precursors, coumaric acid derivatives consisting of cinnamoyl groups and different position and number of OH groups. The solubility of the homo-polymers in organic solvents decreased in the order of P3HCA > PDHCA > P4HCA > PMHCA. The wide angle X-ray diffraction (WAXD) results indicated that P4HCA or PMHCA with p-OH group had higher crystallinity, in contrast to P3HCA or PDHCA with m-OH group which had lower crystallinity. Crossed-polarizing microscopy suggested that P4HCA had the nematic liquid crystal properties at 220 degrees C and PDHCA showed birefringence properties at 200 degrees C. In cell-adhesion tests, PDHCA showed the highest cell adhesion (ca. 70%), whereas P3HCA, P4HCA and PMHCA had 50, 18 and 10% cell adhesion, respectively. The coumaric acid derivative homo-polymers can be useful as cell adhesion controllable thermotropic polymers for biomedical and environmental fields. PMID:18177555

  13. Dissolution rates of carbonated hydroxyapatite in hydrochloric acid.


    Hankermeyer, Christine R; Ohashi, Kevin L; Delaney, David C; Ross, John; Constantz, Brent R


    Osteoclasts have been shown to dissolve efficiently and effectively the mineral phase of bone by locally controlling the environment surrounding the cell. Although this mineral phase has been identified and well characterized as carbonated hydroxyapatite, there is little understanding of the factors that affect the dissolution properties of this mineral phase. Mimicking the mechanism by which osteoclasts dissolve the mineral phase of bone may provide insight into methods for the decalcification of atherosclerotic mineral deposits in the vascular system. Accordingly, a detailed characterization of the effects of various chemical and mechanical parameters on the dissolution of carbonated hydroxyapatite mineral was investigated in this study. Increases in the mineral dissolution rate (2-10 times) were associated with increases in dissolving solution [H+], osmolality, temperature, and flow rate. Mineral dissolution rate increases (5-8 times) were associated with greater surface area of the mineral and mechanical agitation of the dissolving solution. PMID:11771694

  14. Optimization of [11C]HCN production and no-carrier-added [1-11C]amino acid synthesis.


    Iwata, R; Ido, T; Takahashi, T; Nakanishi, H; Iida, S


    The optimal conditions for the catalytic production of [11C]HCN from [11C]CO2 were investigated. [11C]CO2 was reduced to [11C]CH4 with H2 on Ni and then converted to [11C]HCN by reaction with NH3 on Pt in a radiochemical yield of more than 95% under the optimized conditions of an NH3 concentration of 5 vol%, a Pt furnace temperature of 920 degrees C, and a reaction gas flow rate of over 200 mL/min. Absorbers were used to remove O2 and H2O from the reaction gas. The synthesis of no-carrier-added [1-11C]amino acids from [11C]HCN via [11C]aminonitriles was successfully carried out. This method is suitable for automation of [1-11C]amino acid production. PMID:3032866

  15. Synthesis of novel conjugates of a saccharide, amino acids, nucleobase and the evaluation of their cell compatibility.


    Yuan, Dan; Du, Xuewen; Shi, Junfeng; Zhou, Ning; Baoum, Abdulgader Ahmed; Xu, Bing


    This article reports the synthesis of a novel type of conjugate of three fundamental biological build blocks (i.e., saccharide, amino acids, and nucleobase) and their cell compatibility. The facile synthesis starts with the synthesis of nucleobase and saccharide derivatives, then uses solid-phase peptide synthesis (SPPS) to build the peptide segment (Phe-Arg-Gly-Asp or naphthAla-Phe-Arg-Gly-Asp with fully protected groups), and later, an amidation reaction in liquid phase connects these three parts together. The overall yield of these multiple step synthesis is about 34%. Besides exhibiting excellent solubility, these conjugates of saccharide-amino acids-nucleobase (SAN), like the previously reported conjugates of nucleobase-amino acids-saccharide (NAS) and nucleobase-saccharide-amino acids (NSA), are mammalian cell compatible. PMID:25383110

  16. Synthesis of phosphoramidites of isoGNA, an isomer of glycerol nucleic acid

    PubMed Central

    Kim, Keunsoo; Punna, Venkateshwarlu; Karri, Phaneendrasai


    Summary IsoGNA, an isomer of glycerol nucleic acid GNA, is a flexible (acyclic) nucleic acid with bases directly attached to its linear backbone. IsoGNA exhibits (limited) base-pairing properties which are unique compared to other known flexible nucleic acids. Herein, we report on the details of the preparation of isoGNA phosphoramidites and an alternative route for the synthesis of the adenine derivative. The synthetic improvements described here enable an easy access to isoGNA and allows for the further exploration of this structural unit in oligonucleotide chemistry thereby spurring investigations of its usefulness and applicability. PMID:25246971

  17. Tunable and Diastereoselective Brønsted Acid Catalyzed Synthesis of β-Enaminones.


    Kang, Ye-Won; Cho, Yu Jin; Han, Seung Jin; Jang, Hye-Young


    The Brønsted acid catalyzed Meyer-Schuster reaction of hemiaminals was studied for the stereoselective synthesis of β-enaminones. Hemiaminals were formed from propargyl aldehydes (or the oxidation of propargyl alcohols) and amines in the presence of Brønsted acids. A critical step to control the stereochemistry of the products is the protonation of the corresponding allenol intermediate, which is dictated by the Brønsted acid used, the steric effect of the amine, and the electronic effect of the propargyl aldehyde. PMID:26741050

  18. Chemoenzymatic synthesis of CMP-N-acetyl-7-fluoro-7-deoxy-neuraminic acid.


    Hartlieb, Sina; Günzel, Almut; Gerardy-Schahn, Rita; Münster-Kühnel, Anja K; Kirschning, Andreas; Dräger, Gerald


    7-Fluoro sialic acid was prepared and activated as cytidine monophosphate (CMP) ester. The synthesis started with d-glucose, which was efficiently converted into N-acetyl-4-fluoro-4-deoxy-d-mannosamine. Aldolase catalyzed transformation yielded the corresponding fluorinated sialic acid which was activated as CMP ester using three different synthetases in the presence as well as in the absence of pyrophosphatase which possesses inhibitory properties. Finally, conditions were optimized to perform a one-pot reaction starting from fluorinated mannosamine, which yielded the 7-fluoro-7-deoxy-CMP-sialic acid by incubation with three enzymes. PMID:18353292

  19. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids

    NASA Astrophysics Data System (ADS)

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D. V. S.; Sharma, Rohit K.


    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  20. De novo fatty acid synthesis controls the fate between regulatory T and T helper 17 cells.


    Berod, Luciana; Friedrich, Christin; Nandan, Amrita; Freitag, Jenny; Hagemann, Stefanie; Harmrolfs, Kirsten; Sandouk, Aline; Hesse, Christina; Castro, Carla N; Bähre, Heike; Tschirner, Sarah K; Gorinski, Nataliya; Gohmert, Melanie; Mayer, Christian T; Huehn, Jochen; Ponimaskin, Evgeni; Abraham, Wolf-Rainer; Müller, Rolf; Lochner, Matthias; Sparwasser, Tim


    Interleukin-17 (IL-17)-secreting T cells of the T helper 17 (TH17) lineage play a pathogenic role in multiple inflammatory and autoimmune conditions and thus represent a highly attractive target for therapeutic intervention. We report that inhibition of acetyl-CoA carboxylase 1 (ACC1) restrains the formation of human and mouse TH17 cells and promotes the development of anti-inflammatory Foxp3(+) regulatory T (Treg) cells. We show that TH17 cells, but not Treg cells, depend on ACC1-mediated de novo fatty acid synthesis and the underlying glycolytic-lipogenic metabolic pathway for their development. Although TH17 cells use this pathway to produce phospholipids for cellular membranes, Treg cells readily take up exogenous fatty acids for this purpose. Notably, pharmacologic inhibition or T cell-specific deletion of ACC1 not only blocks de novo fatty acid synthesis but also interferes with the metabolic flux of glucose-derived carbon via glycolysis and the tricarboxylic acid cycle. In vivo, treatment with the ACC-specific inhibitor soraphen A or T cell-specific deletion of ACC1 in mice attenuates TH17 cell-mediated autoimmune disease. Our results indicate fundamental differences between TH17 cells and Treg cells regarding their dependency on ACC1-mediated de novo fatty acid synthesis, which might be exploited as a new strategy for metabolic immune modulation of TH17 cell-mediated inflammatory diseases. PMID:25282359

  1. Nature's Starships: Amino Acid Synthesis, Frequency, and Delivery to Earth via Meteorites

    NASA Astrophysics Data System (ADS)

    Cobb, Alyssa; Pudritz, Ralph


    Understanding the origin of organic molecules on Earth is vital to our understanding of the origins of life. One proposed mechanism for the introduction of organic material to our planet is via meteorite impacts. Meteoritic parent bodies contain organic material and water ice, which, given radionuclide decay in their interiors, cause the ice to melt and the parent bodies to undergo a process called aqueous alteration. An example of this internal chemistry is Strecker synthesis, a process resulting in the production of various amino acids. Our work summarizes recent discoveries regarding amino acid synthesis and concentration data. We present the amino acid concentrations collated from a variety of meteorites (~20) covering a range of meteorite classes. We can use the dependence of amino acid frequency on variables such as temperature and pressure to model Strecker synthesis inside a theoretical parent body. Our modeling software takes a set of chemical species and outputs their relative frequencies based on a minimization of their Gibbs free energies. The goal of this work is to predict and quantify the presence of amino acids on a foreign landscape using thermodynamic principles.

  2. Templated synthesis of peptide nucleic acids via sequence-selective base-filling reactions.


    Heemstra, Jennifer M; Liu, David R


    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either reductive amination or amine acylation chemistries, we observed efficient and selective addition of each of the four nucleobases to an abasic site in the middle of the PNA strand. We also describe the addition of single nucleobases to the end of a PNA strand through base filling, as well as the tandem addition of two bases to the middle of the PNA strand. These findings represent an experimental foundation for nonenzymatic information transfer through base filling. PMID:19722647

  3. Templated Synthesis of Peptide Nucleic Acids via Sequence-Selective Base-Filling Reactions

    PubMed Central


    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either reductive amination or amine acylation chemistries, we observed efficient and selective addition of each of the four nucleobases to an abasic site in the middle of the PNA strand. We also describe the addition of single nucleobases to the end of a PNA strand through base filling, as well as the tandem addition of two bases to the middle of the PNA strand. These findings represent an experimental foundation for nonenzymatic information transfer through base filling. PMID:19722647

  4. Rates of insulin secretion in INS-1 cells are enhanced by coupling to anaplerosis and Kreb's cycle flux independent of ATP synthesis.


    Cline, Gary W; Pongratz, Rebecca L; Zhao, Xiaojian; Papas, Klearchos K


    Mechanistic models of glucose stimulated insulin secretion (GSIS) established in minimal media in vitro, may not accurately describe the complexity of coupling metabolism with insulin secretion that occurs in vivo. As a first approximation, we have evaluated metabolic pathways in a typical growth media, DMEM as a surrogate in vivo medium, for comparison to metabolic fluxes observed under the typical experimental conditions using the simple salt-buffer of KRB. Changes in metabolism in response to glucose and amino acids and coupling to insulin secretion were measured in INS-1 832/13 cells. Media effects on mitochondrial function and the coupling efficiency of oxidative phosphorylation were determined by fluorometrically measured oxygen consumption rates (OCRs) combined with (31)P NMR measured rates of ATP synthesis. Substrate preferences and pathways into the TCA cycle, and the synthesis of mitochondrial 2nd messengers by anaplerosis were determined by (13)C NMR isotopomer analysis of the fate of [U-(13)C] glucose metabolism. Despite similar incremental increases in insulin secretion, the changes of OCR in response to increasing glucose from 2.5 to 15mM were blunted in DMEM relative to KRB. Basal and stimulated rates of insulin secretion rates were consistently higher in DMEM, while ATP synthesis rates were identical in both DMEM and KRB, suggesting greater mitochondrial uncoupling in DMEM. The relative rates of anaplerosis, and hence synthesis and export of 2nd messengers from the mitochondria were found to be similar in DMEM to those in KRB. And, the correlation of total PC flux with insulin secretion rates in DMEM was found to be congruous with the correlation in KRB. Together, these results suggest that signaling mechanisms associated with both TCA cycle flux and with anaplerotic flux, but not ATP production, may be responsible for the enhanced rates of insulin secretion in more complex, and physiologically-relevant media. PMID:22008547

  5. Multiple inputs control sulfur-containing amino acid synthesis in Saccharomyces cerevisiae

    PubMed Central

    Sadhu, Meru J.; Moresco, James J.; Zimmer, Anjali D.; Yates, John R.; Rine, Jasper


    In Saccharomyces cerevisiae, transcription of the MET regulon, which encodes the proteins involved in the synthesis of the sulfur-containing amino acids methionine and cysteine, is repressed by the presence of either methionine or cysteine in the environment. This repression is accomplished by ubiquitination of the transcription factor Met4, which is carried out by the SCF(Met30) E3 ubiquitin ligase. Mutants defective in MET regulon repression reveal that loss of Cho2, which is required for the methylation of phosphatidylethanolamine to produce phosphatidylcholine, leads to induction of the MET regulon. This induction is due to reduced cysteine synthesis caused by the Cho2 defects, uncovering an important link between phospholipid synthesis and cysteine synthesis. Antimorphic mutants in S-adenosyl-methionine (SAM) synthetase genes also induce the MET regulon. This effect is due, at least in part, to SAM deficiency controlling the MET regulon independently of SAM's contribution to cysteine synthesis. Finally, the Met30 protein is found in two distinct forms whose relative abundance is controlled by the availability of sulfur-containing amino acids. This modification could be involved in the nutritional control of SCF(Met30) activity toward Met4. PMID:24648496

  6. Synthesis and properties of synthetic fulvic acid derived from hematoxylin

    NASA Astrophysics Data System (ADS)

    Litvin, Valentina A.; Minaev, Boris F.; Baryshnikov, Gleb V.


    A model fulvic acid (FA) was synthesized from a natural dye, hematoxylin, in a slow oxidative polymerization/condensation reaction catalysed by OH- at pH ca. 12. The resulting dark-brown product, acidified to pH ca. 2, did not precipitate from the reaction solution. It was isolated and purified by cation-exchange resin. Its physicochemical and spectroscopic properties, as determined by means of elemental analysis, molecular weight analyses, Fourier transform infra red (FTIR) and ultraviolet-visible (UV-VIS) spectroscopy, X-ray diffraction and electron paramagnetic resonance (EPR) spectroscopy, showed a close resemblance to natural FA. The similarity and differences between synthetic fulvic acids derived from hematoxylin and the natural fulvic acids substances are discussed. Quantum-chemical calculations of the supposed primary oxidation products of hematoxylin are performed and compared with observations.

  7. Synthesis of asymmetric tetracarboxylic acids and corresponding dianhydrides

    NASA Technical Reports Server (NTRS)

    Chuang, Chun-Hua (Inventor)


    This invention relates to processes for preparing asymmetrical biphenyl tetracarboxylic acids and the corresponding asymmetrical dianhydrides, namely 2,3,3',4'-biphenyl dianhydride (a-BPDA), 2,3,3',4'-benzophenone dianhydride (a-BTDA) and 3,4'-methylenediphthalic anhydride (-MDPA). By cross-coupling reactions of reactive metal substituted o-xylenes or by cross-coupling o-xylene derivatives in the presence of catalysts, this invention specifically produces asymmetrical biphenyl intermediates that are subsequently oxidized or hydrolyzed and oxidized to provide asymmetric biphenyl tetracarboxylic acids in comparatively high yields. These asymmetrical biphenyl tetracarboxylic acids are subsequently converted to the corresponding asymmetrical dianhydrides without contamination by symmetrical biphenyl dianhydrides.

  8. Amino acids in a Fischer Tropsch type synthesis

    NASA Technical Reports Server (NTRS)

    Brown, D. L.; Lawless, J. G.


    One postulation is described for the presence of organic compounds in meteorites which states that they were formed during the condensation of the solar nebula. A viable laboratory simulation of these conditions can be modeled after the industrial Fischer Tropsch reaction, which is known to produce organic compounds called hydrocarbons. In this simulation, a mixture of carbon monoxide, hydrogen and ammonia is heated in the presence of iron meteorite. The reaction products for amino acids, a class of organic compounds important to life, were examined. A large number of these compounds is found in meteorites and other chemical evolution experiments, but only small quantities of a few amino acids were found in the present simulation work. These results are at odds with the existing literature in which many amino acids were reported.

  9. Evaluation of the Strecker synthesis as a source of amino acids on carbonaceous chondrites

    NASA Technical Reports Server (NTRS)

    Lerner, N. R.; Peterson, Etta; Chang, S.


    The Strecker synthesis (SS) has been proposed as the source of amino acids (AA) formed during aqueous alteration of carbonaceous chondrites. It is postulated that the aldehyde and ketone precursors of the meteoritic AA originated in interstellar syntheses and accreted on the meteorite parent body along with other reactant species in cometesimal ices. The SS has been run with formaldehyde, acetyldehyde, propionaldehyde, acetone, and methyl ketone as starting materials. To study the effect of minerals on the reaction, the SS was run in the presence and absence of dust from the Allende meteorite using deuterated aldehydes and ketones as starting materials. The products were studied by GC/MS. With the exception of glycine, the retention of deuterium in the AA was greater than 90 pct. Some D exchange with water does occur, however, and determination of the rate of exchange as a function of pH and temperature may allow some bounds to be placed on the duration of parent body aqueous alteration. The retention of D by the AA under conditions studied thus far is consistent with the model that a SS starting from interstellar aldehydes and ketones led to the production of meteoritic AA.

  10. Synthesis of hydroxyeicosatetraenoic acids (HETE's) by adrenal glomerulosa cells and incorporation into cellular lipids

    SciTech Connect

    Campbell, W.B.; Richards, C.F.; Brady, M.T.; Falck, J.R.


    The role of lipoxygenase metabolites of arachidonic acid (AA) in the regulation of aldosterone secretion was studied in isolated rat adrenal glomerulosa cells. Cells were incubated with /sup 14/C-AA in the presence of angiotensin (AII). The media was extracted, metabolites isolated by HPLC, and structures of the metabolites determined by UV absorbance and mass spectrometry. The major products were 12- and 15-HETE with lesser amounts of 11- and 5-HETE. When adrenal cells were incubated with 15-, 12- or 5-HPETE or their respective HETE's (0.03-300nM), there was no significant change in basal or AII-stimulated aldosterone release. Cells were incubated with (/sup 3/H)-AA, -5-HETE, -15-HETE, -12-HETE or -LTB. The cellular lipids were extracted and analyzed by TLC. AA was incorporated into phospholipids (22%), cholesterol esters (50%) and triglycerides (21%). Neither the HETE's or LTB/sub 4/ were incorporated into phospholipids. 5-HETE was taken up into di- and mono-glycerides. The rates of incorporation of AA and 5-HETE were similar (+ 1/2 = 10 min). The incorporation of 5-HETE into glycerol esters did not modify the release of aldosterone by the cells. Thus, while adrenal cells synthesize HETE's, these eicosanoids do not appear to alter the synthesis of aldosterone.

  11. CFD investigation of Schizochytrium sp. impeller configurations on cell growth and docosahexaenoic acid synthesis.


    Zhao, Xiaoyan; Ren, Lujing; Guo, Dongsheng; Wu, Wenjia; Ji, Xiaojun; Huang, He


    Effects of impeller configurations on docosahexaenoic acid production and flow characteristics were investigated by Schizochytrium sp. in a 15 L bioreactor. 6-straight blade disc turbine (6-SBDT), 6-arrowy-blade disc turbine (6-ABDT) and down-pumping propeller (DPP) were combined to form different impeller configurations. Simulated results showed that configuration SSA consisting of upper two 6-SBDT and one bottom 6-ABDT possessed the worst oxygen supply capacity. But it obtained the highest DHA percentage of 48.17 % and DHA yield of 21.42 g/L, indicating that it was beneficial for DHA synthesis and converting glucose to biomass and lipids. Configuration SAS consisting of one middle 6-ABDT and two 6-SBDT provided better mixing capacity, which resulted in the maximum glucose consumption rate of 2.86 g/L h and the highest biomass of 108.09 g/L. This study would improve insight into understanding the relationship between flow field and the physiology of Schizochytrium sp. for the scale-up of industrial DHA production. PMID:27102911

  12. One-Pot synthesis of phosphorylated mesoporous carbon heterogeneous catalysts with tailored surface acidity

    SciTech Connect

    Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T; Bauer, Christopher; Wang, Xiqing; Veith, Gabriel M; Dai, Sheng


    Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contents were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.

  13. Five Decades with Polyunsaturated Fatty Acids: Chemical Synthesis, Enzymatic Formation, Lipid Peroxidation and Its Biological Effects

    PubMed Central

    Catalá, Angel


    I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074

  14. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    NASA Technical Reports Server (NTRS)

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.


    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  15. Thyroid hormone reduces PCSK9 and stimulates bile acid synthesis in humans[S

    PubMed Central

    Bonde, Ylva; Breuer, Olof; Lütjohann, Dieter; Sjöberg, Stefan; Angelin, Bo; Rudling, Mats


    Reduced plasma LDL-cholesterol is a hallmark of hyperthyroidism and is caused by transcriptional stimulation of LDL receptors in the liver. Here, we investigated whether thyroid hormone (TH) actions involve other mechanisms that may also account for the reduction in LDL-cholesterol, including effects on proprotein convertase subtilisin/kexin type 9 (PCSK9) and bile acid synthesis. Twenty hyperthyroid patients were studied before and after clinical normalization, and the responses to hyperthyroidism were compared with those in 14 healthy individuals after 14 days of treatment with the liver-selective TH analog eprotirome. Both hyperthyroidism and eprotirome treatment reduced circulating PCSK9, lipoprotein cholesterol, apoB and AI, and lipoprotein(a), while cholesterol synthesis was stable. Hyperthyroidism, but not eprotirome treatment, markedly increased bile acid synthesis and reduced fibroblast growth factor (FGF) 19 and dietary cholesterol absorption. Eprotirome treatment, but not hyperthyroidism, reduced plasma triglycerides. Neither hyperthyroidism nor eprotirome treatment altered insulin, glucose, or FGF21 levels. TH reduces circulating PSCK9, thereby likely contributing to lower plasma LDL-cholesterol in hyperthyroidism. TH also stimulates bile acid synthesis, although this response is not critical for its LDL-lowering effect. PMID:25172631

  16. Functional analysis of a tomato salicylic acid methyl transferase and its role in synthesis of the flavor volatile methyl salicylate.


    Tieman, Denise; Zeigler, Michelle; Schmelz, Eric; Taylor, Mark G; Rushing, Sarah; Jones, Jeffrey B; Klee, Harry J


    Methyl salicylate (MeSA) is a volatile plant secondary metabolite that is an important contributor to taste and scent of many fruits and flowers. It is synthesized from salicylic acid (SA), a phytohormone that contributes to plant pathogen defense. MeSA is synthesized by members of a family of O-methyltransferases. In order to elaborate the mechanism of MeSA synthesis in tomato, we screened a set of O-methyltransferases for activity against multiple substrates. An enzyme that specifically catalyzes methylation of SA, SlSAMT, as well as enzymes that act upon jasmonic acid and indole-3-acetic acid were identified. Analyses of transgenic over- and under-producing lines validated the function of SlSAMT in vivo. The SlSAMT gene was mapped to a position near the bottom of chromosome 9. Analysis of MeSA emissions from an introgression population derived from a cross with Solanum pennellii revealed a quantitative trait locus (QTL) linked to higher fruit methyl salicylate emissions. The higher MeSA emissions associate with significantly higher SpSAMT expression, consistent with SAMT gene expression being rate limiting for ripening-associated MeSA emissions. Transgenic plants that constitutively over-produce MeSA exhibited only slightly delayed symptom development following infection with the disease-causing bacterial pathogen, Xanthomonas campestris pv. vesicatoria (Xcv). Unexpectedly, pathogen-challenged leaves accumulated significantly higher levels of SA as well as glycosylated forms of SA and MeSA, indicating a disruption in control of the SA-related metabolite pool. Taken together, the results indicate that SlSAMT is critical for methyl salicylate synthesis and methyl salicylate, in turn, likely has an important role in controlling SA synthesis. PMID:20070566

  17. Convenient and Scalable Synthesis of Fmoc-Protected Peptide Nucleic Acid Backbone

    PubMed Central

    Feagin, Trevor A.; Shah, Nirmal I.; Heemstra, Jennifer M.


    The peptide nucleic acid backbone Fmoc-AEG-OBn has been synthesized via a scalable and cost-effective route. Ethylenediamine is mono-Boc protected, then alkylated with benzyl bromoacetate. The Boc group is removed and replaced with an Fmoc group. The synthesis was performed starting with 50 g of Boc anhydride to give 31 g of product in 32% overall yield. The Fmoc-protected PNA backbone is a key intermediate in the synthesis of nucleobase-modified PNA monomers. Thus, improved access to this molecule is anticipated to facilitate future investigations into the chemical properties and applications of nucleobase-modified PNA. PMID:22848796

  18. Convenient and scalable synthesis of fmoc-protected Peptide nucleic Acid backbone.


    Feagin, Trevor A; Shah, Nirmal I; Heemstra, Jennifer M


    The peptide nucleic acid backbone Fmoc-AEG-OBn has been synthesized via a scalable and cost-effective route. Ethylenediamine is mono-Boc protected, then alkylated with benzyl bromoacetate. The Boc group is removed and replaced with an Fmoc group. The synthesis was performed starting with 50 g of Boc anhydride to give 31 g of product in 32% overall yield. The Fmoc-protected PNA backbone is a key intermediate in the synthesis of nucleobase-modified PNA monomers. Thus, improved access to this molecule is anticipated to facilitate future investigations into the chemical properties and applications of nucleobase-modified PNA. PMID:22848796

  19. Synthesis and antihyperlipidemic activity of piperic acid derivatives.


    A, Rong; Bao, Narisu; Sun, Zhaorigetu; Borjihan, Gereltu; Qiao, Yanjiang; Jin, Zhuang


    A series of piperic acid derivatives were designed and synthesized from piperine/piperlonguminine, and their antihyperlipidemic activities evaluated in diet-induced hyperlipidemic rats with respect to simvastatin. Two promising analogues 3 and 10 were discovered and their antihyperlipidemic activities were comparable to or better than those of simvastatin. PMID:25920263

  20. Design, synthesis and biological evaluation of novel betulinic acid derivatives

    PubMed Central


    Background Tumor, is one of the major reason for human death, due to its widespread occurrence. Betulinic acid derivatives have attracted considerable attention as cancer chemopreventive agents and also as cancer therapeutics. Many of its derivatives inhibit the growth of human cancer cell lines by triggering apoptosis. With this background, we planned to synthesize a series of betulinic acid derivatives to assess their antiproliferation efficacy on human cancer cell lines. Results A series of novel betulinic acid derivatives were designed and synthesized as highlighted by the preliminary antitumor evaluation against MGC-803, PC3, A375, Bcap-37 and A431 human cancer cell lines in vitro. The pharmacological results showed that some of the compounds displayed moderate to high levels of antitumor activities with most of new exhibiting higher inhibitory activities compared to BA. The IC50 values of compound 3c on the five cancer cell lines were 2.3, 4.6, 3.3, 3.6, and 4.3 μM, respectively. Subsequent fluorescence staining and flow cytometry analysis (FCM) indicated that compound 3c could induce apoptosis in MGC-803 and PC3 cell lines, and the apoptosis ratios reached the peak (37.38% and 33.74%) after 36 h of treatment at 10 μM. Conclusions This study suggests that most of betulinic acid derivatives could inhibit the growth of human cancer cell lines. Furthermore, compound 3c could induce apoptosis of cancer cells. PMID:23174002

  1. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes.


    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A


    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  2. Synthesis and physical properties of isostearic acids and their esters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Saturated branched-chain fatty acids (sbc-FAs) are found as minor constituents in several natural fats and oils. Sbc-FAs are of interest since they have lower melting points than their linear counterparts and exhibit good oxidative stability; properties that make them ideally suited in a number of ...

  3. Influence of light on the free amino acid content and γ-aminobutyric acid synthesis in Brassica juncea seedlings.


    Li, Xiaohua; Kim, Yeon Bok; Uddin, Md Romij; Lee, Sanghyun; Kim, Sun-Ju; Park, Sang Un


    Glutamate decarboxylase (GAD; EC is an important enzyme in γ-aminobutyric acid (GABA) biosynthesis. Here we report the influence of light on amino acid accumulation and investigate the molecular mechanism by which light influences GABA biosynthesis at the seedling stage of two mustard (Brassica juncea) cultivars (green-leaf and purple-leaf). Gene expression profiles of four GAD-encoding genes (GAD1, GAD2, GAD4a, and GAD4b) and their impact on GABA biosynthesis were analyzed. Light exerted an obvious influence on amino acid accumulation in mustard seedlings. GAD gene expression was also significantly regulated by light/dark or dark treatment, which differentially regulated GABA biosynthesis in B. juncea seedlings. High-performance liquid chromatography (HPLC) revealed that the seeds of purple cultivars contain a higher amount of free amino acids and GABA than do the seeds of green cultivars. After seed germination, however, the accumulation of free amino acids peaked in dark-treated seedlings on day 9 in both cultivars, whereas GABA synthesis peaked at 9 days under light conditions. This study may provide a foundation for understanding the effect of light on amino acids, particularly GABA biosynthesis in Brassica plants. PMID:23909820

  4. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2

    PubMed Central

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing


    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  5. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2.


    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing


    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru-Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  6. Synthesis and Biological Evaluation of Novel Phosphatidylcholine Analogues Containing Monoterpene Acids as Potent Antiproliferative Agents

    PubMed Central

    Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna


    The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59–87%) and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts). The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2. PMID:27310666

  7. Rate and topography of peptidoglycan synthesis during cell division in Escherichia coli: Concept of a leading edge

    SciTech Connect

    Wientjes, F.B.; Nanninga, N. )


    The rate at which the peptidoglycan of Escherichia coli is synthesized during the division cycle was studied with two methods. One method involved synchronization of E. coli MC4100 lysA cultures by centrifugal elutriation and subsequent pulse-labeling of the synchronously growing cultures with (meso-{sup 3}H)diaminopimelic acid (({sup 3}H)Dap). The second method was autoradiography of cells pulse-labeled with ({sup 3}H)Dap. It was found that the peptidoglycan is synthesized at a more or less exponentially increasing rate during the division cycle with a slight acceleration in this rate as the cells start to constrict. Apparently, polar cap formation requires synthesis of extra surface components, presumably to accommodate for a change in the surface-to-volume ratio. Furthermore, it was found that the pool size of Dap was constant during the division cycle. Close analysis of the topography of ({sup 3}H)Dap incorporation at the constriction site revealed that constriction proceeded by synthesis of peptidoglycan at the leading edge of the invaginating cell envelope. During constriction, no reallocation of incorporation occurred, i.e., the incorporation at the leading edge remained high throughout the process of constriction. Impairment of penicillin-binding protein 3 by mutation or by the specific {beta}-lactam antibiotic furazlocillin did not affect ({sup 3}H)Dap incorporation during initiation of constriction. However, the incorporation at the constriction site was inhibited in later stages of the constriction process. It is concluded that during division at least two peptidoglycan-synthesizing systems are operating sequentially.

  8. Gene regulation of UDP-galactose synthesis and transport: Potential rate limiting processes in initiation of milk production in humans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lactose synthesis is believed to be rate-limiting for milk production. However, understanding the molecular events controlling lactose synthesis in humans is still rudimentary. We have utilized our established model of the RNA isolated from breast milk fat globule from 7 healthy exclusively breastfe...

  9. The effects of retinoic acid on immunoglobulin synthesis by human cord blood mononuclear cells.


    Israel, H; Odziemiec, C; Ballow, M


    Derivatives of vitamin A have attracted considerable attention as agents which have immune potentiating properties and possibly tumor-suppressive effects. Recent investigations have shown that retinoic acid (RA) can augment immunoglobulin production of B-cell hybridomas from patients with immune deficiency. In this study we examined the ability of RA to modify the mitogen-induced polyclonal immunoglobulin synthesis of cord blood mononuclear cells (CBMC). RA in concentrations ranging from 10(-5) to 10(-7) M augmented IgM synthesis of CBMC in response to formalinized Cowans I strain Staphylococcus aureus (SAC) up to 45.6-fold which was greater at suboptimal responses to SAC. There were no changes in IgG or IgA synthesis and minimal effects on SAC-induced proliferative responses. RA did not produce similar changes in IgM synthesis of SAC-stimulated adult peripheral blood mononuclear cells (PBMC), and RA had no effect on the immunoglobulin synthesis of Epstein-Barr virus (EBV)-stimulated CBMC or adult PBMC. Time course studies showed that peak enhancement occurred when RA was added between 4 and 24 hr after culture initiation and required prior activation by SAC for augmentation of IgM synthesis. Cell separation experiments showed that prior incubation (18 hr) of an enriched T-cell fraction with RA enhanced the IgM synthesis of a T-cell-depleted B-cell fraction. These experiments and the findings that RA-induced augmentation of IgM production in response to SAC, but not to EBV suggest that the immunoregulatory effects of RA may be mediated by either T cells or T-cell products. Further studies will be necessary to understand the mechanism by which RA augments IgM synthesis of CBMC. PMID:2029794

  10. Direct Synthesis of 5-Aryl Barbituric Acids by Rhodium(II)-Catalyzed Reactions of Arenes with Diazo Compounds**

    PubMed Central

    Best, Daniel; Burns, David J; Lam, Hon Wai


    A commercially available rhodium(II) complex catalyzes the direct arylation of 5-diazobarbituric acids with arenes, allowing straightforward access to 5-aryl barbituric acids. Free N—H groups are tolerated on the barbituric acid, with no complications arising from N—H insertion processes. This method was applied to the concise synthesis of a potent matrix metalloproteinase (MMP) inhibitor. PMID:25959544

  11. Complestatin exerts antibacterial activity by the inhibition of fatty acid synthesis.


    Kwon, Yun-Ju; Kim, Hyun-Ju; Kim, Won-Gon


    Bacterial enoyl-acyl carrier protein (ACP) reductase has been confirmed as a novel target for antibacterial drug development. In the screening of inhibitors of Staphylococcus aureus enoyl-ACP reductase (FabI), complestatin was isolated as a potent inhibitor of S. aureus FabI together with neuroprotectin A and chloropeptin I from Streptomyces chartreusis AN1542. Complestatin and related compounds inhibited S. aureus FabI with IC₅₀ of 0.3-0.6 µM. They also prevented the growth of S. aureus as well as methicillin-resistance S. aureus (MRSA) and quinolone-resistant S. aureus (QRSA), with minimum inhibitory concentrations (MICs) of 2-4 µg/mL. Consistent with its FabI-inhibition, complestatin selectively inhibited the intracellular fatty acid synthesis in S. aureus, whereas it did not affect the macromolecular biosynthesis of other cellular components, such as DNA, RNA, proteins, and the cell wall. Additionally, supplementation with exogenous fatty acids reversed the antibacterial effect of complestatin, demonstrating that it targets fatty acid synthesis. In this study, we reported that complestatin and related compounds showed potent antibacterial activity via inhibiting fatty acid synthesis. PMID:25947917

  12. Synthesis and characterization of a pH responsive folic acid functionalized polymeric drug delivery system.


    Li, Xia; McTaggart, Matt; Malardier-Jugroot, Cecile


    We report the computational analysis, synthesis and characterization of folate functionalized poly(styrene-alt-maleic anhydride), PSMA for drug delivery purpose. The selection of the proper linker between the polymer and the folic acid group was performed before conducting the synthesis using Density Functional Theory (DFT). The computational results showed the bio-degradable linker 2, 4-diaminobutyric acid, DABA as a good candidate allowing flexibility of the folic acid group while maintaining the pH sensitivity of PSMA, used as a trigger for drug release. The synthesis was subsequently carried out in multi-step experimental procedures. The functionalized polymer was characterized using InfraRed spectroscopy, Nuclear Magnetic Resonance and Dynamic Light Scattering confirming both the chemical structure and the pH responsiveness of PSMA-DABA-Folate polymers. This study provides an excellent example of how computational chemistry can be used in selection process for the functional materials and product characterization. The pH sensitive polymers are expected to be used in delivering anti-cancer drugs to solid tumors with overly expressed folic acid receptors. PMID:27183249

  13. Role of amidation in bile acid effect on DNA synthesis by regenerating mouse liver.


    Barbero, E R; Herrera, M C; Monte, M J; Serrano, M A; Marin, J J


    Effect of bile acids on DNA synthesis by the regenerating liver was investigated in mice in vivo after partial hepatectomy (PH). Radioactivity incorporation into DNA after [14C]thymidine intraperitoneal administration peaked at 48 h after PH. At this time a significant taurocholate-induced dose-dependent reduction in DNA synthesis without changes in total liver radioactivity content was found (half-maximal effect at approximately 0.1 mumol/g body wt). Effect of taurocholate (0.5 mumol/g body wt) was mimicked by chocolate, ursodeoxycholate, deoxycholate, dehydrocholate, tauroursodeoxycholate, taurochenodeoxycholate, and taurodeoxycholate. In contrast, chenodeoxycholate, glycocholate, glycochenodeoxycholate, glycoursodeoxycholate, glycodeoxycholate, 5 beta-cholestane, bromosulfophthalein, and free taurine lacked this effect. No relationship between hydrophobic-hydrophilic balance and inhibitory effect was observed. Analysis by high-performance liquid chromatography indicated that inhibition of thymidine incorporation into DNA was not accompanied by an accumulation of phosphorylated DNA precursors in the liver but rather by a parallel increase in nucleotide catabolism. Bile acid-induced modifications in DNA synthesis were observed in vivo even in the absence of changes in toxicity tests, which suggests that the inhibitory effect shared by most unconjugated and tauroconjugated bile acids but not by glycoconjugated bile acids should be accounted for by mechanisms other than nonselective liver cell injury. PMID:7611405

  14. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    PubMed Central

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi


    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon. PMID:25648201

  15. Synthesis and biological activity of tetralone abscisic acid analogues.


    Nyangulu, James M; Nelson, Ken M; Rose, Patricia A; Gai, Yuanzhu; Loewen, Mary; Lougheed, Brenda; Quail, J Wilson; Cutler, Adrian J; Abrams, Suzanne R


    Bicyclic analogues of the plant hormone abscisic acid (ABA) were designed to incorporate the structural elements and functional groups of the parent molecule that are required for biological activity. The resulting tetralone analogues were predicted to have enhanced biological activity in plants, in part because oxidized products would not cyclize to forms corresponding to the inactive catabolite phaseic acid. The tetralone analogues were synthesized in seven steps from 1-tetralone and a range of analogues were accessible through a second route starting with 2-methyl-1-naphthol. Tetralone ABA 8 was found to have greater activity than ABA in two bioassays. The absolute configuration of (+)-8 was established by X-ray crystallography of a RAMP hydrazone derivative. The hydroxymethyl compounds 10 and 11, analogues for studying the roles of 8- and 9-hydroxy ABA 3 and 6, were also synthesized and found to be active. PMID:16557330

  16. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    NASA Astrophysics Data System (ADS)

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-Ichi


    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon.

  17. Synthesis and verification of biobased terephthalic acid from furfural.


    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi


    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon. PMID:25648201

  18. Synthesis and antifungal activity of bile acid-derived oxazoles.


    Fernández, Lucía R; Svetaz, Laura; Butassi, Estefanía; Zacchino, Susana A; Palermo, Jorge A; Sánchez, Marianela


    Peracetylated bile acids (1a-g) were used as starting materials for the preparation of fourteen new derivatives bearing an oxazole moiety in their side chain (6a-g, 8a-g). The key step for the synthetic path was a Dakin-West reaction followed by a Robinson-Gabriel cyclodehydration. A simpler model oxazole (12) was also synthesized. The antifungal activity of the new compounds (6a-g) as well as their starting bile acids (1a-g) was tested against Candida albicans. Compounds 6e and 6g showed the highest percentages of inhibition (63.84% and 61.40% at 250 μg/mL respectively). Deacetylation of compounds 6a-g, led to compounds 8a-g which showed lower activities than the acetylated derivatives. PMID:26827629

  19. Mitochondrial fatty acid synthesis is required for normal mitochondrial morphology and function in Trypanosoma brucei

    PubMed Central

    Guler, Jennifer L.; Kriegova, Eva; Smith, Terry K.; Lukeš, Julius; Englund, Paul T.


    Summary Trypanosoma brucei use microsomal elongases for de novo synthesis of most of its fatty acids. In addition, this parasite utilizes an essential mitochondrial type II synthase for production of octanoate (a lipoic acid precursor) as well as longer fatty acids such as palmitate. Evidence from other organisms suggests that mitochondrially synthesized fatty acids are required for efficient respiration but the exact relationship remains unclear. In procyclic form trypanosomes, we also found that RNAi depletion of the mitochondrial acyl carrier protein, an important component of the fatty acid synthesis machinery, significantly reduces cytochrome-mediated respiration. This reduction was explained by RNAi-mediated inhibition of respiratory complexes II, III and IV, but not complex I. Other effects of RNAi, such as changes in mitochondrial morphology and alterations in membrane potential, raised the possibility of a change in mitochondrial membrane composition. Using mass spectrometry, we observed a decrease in total and mitochondrial phosphatidylinositol and mitochondrial phosphatidylethanolamine. Thus, we conclude that the mitochondrial synthase produces fatty acids needed for maintaining local phospholipid levels that are required for activity of respiratory complexes and preservation of mitochondrial morphology and function. PMID:18221265

  20. Synthesis of 4-substituted nipecotic acid derivatives and their evaluation as potential GABA uptake inhibitors.


    Hellenbrand, Tim; Höfner, Georg; Wein, Thomas; Wanner, Klaus T


    In this study, we disclose the design and synthesis of novel 4-susbtituted nipecotic acid derivatives as inhibitors of the GABA transporter mGAT1. Based on molecular modeling studies the compounds are assumed to adopt a binding pose similar to that of the potent mGAT1 inhibitor nipecotic acid. As substitution in 4-position should not cause an energetically unfavorable orientation of nipecotic acid as it is the case for N-substituted derivatives this is expected to lead to highly potent binders. For the synthesis of novel 4-substituted nipecotic acid derivatives a linear synthetic strategy was employed. As a key step, palladium catalyzed cross coupling reactions were used to attach the required biaryl moieties to the ω-position of the alkenyl- or alkynyl spacers of varying length in the 4-position of the nipecotic acid scaffold. The resulting amino acids were characterized with respect to their binding affinities and inhibitory potencies at mGAT1. Though the biological activities found were generally insignificant to poor, two compounds, one of which possesses a reasonable binding affinity for mGAT1, rac-57, the other a notable inhibitory potency at mGAT4, rac-84, both displaying a slight subtype selectivity for the individual transporters, could be identified. PMID:27039250

  1. Synthesis of glycoaminooxy acid and N-oxyamide-linked glycolipids.


    Chen, N; Xie, J


    Aminooxyl sugar derivatives are versatile building blocks for the generation of various glycoconjugates with interesting bioactivities. We report herein a synthetic method for the preparation of orthogonally protected glycoaminooxy acid from methyl α-d-glycopyranoside in 7 steps. The key steps involve the selective protection, O-alkylation and Mitsunobu reaction. Fully deprotected N-oxyamide-linked novel glycolipids can be easily generated from the glycoaminooxy ester or from the 2-hydroxy free sugar in 5 or 6 steps. PMID:26646087

  2. Synthesis and properties of N-hexadecyl ethylenediamine triacetic acid.


    Wang, Xixin; Zhao, Jianling; Yao, Xingzhi; Chen, Wentao


    A new kind of surfactant named N-hexadecyl ethylenediamine triacetic acid (HED3A) was synthesized from anhydrous ethylenediamine, 1-bromohexadecane, and chloroacetic acid. Testing showed stability of HED3A in hard water, wetting power, dispersing power, and surface tension increased along with pH value. Stability in hard water of trisodium N-hexadecyl ethylenediamine triacetate (3NaHED3A) was at level 4, which was better than that of sodium dodecylsulfate (SDS) and sodium dodecylbenzene sulfonate (LAS). Other properties of 3NaHED3A including wetting power, dispersing power, emulsifying power, and surface tension had intermediate value between SDS, LAS, AES, peregal-O, and cetyltrimethylammonium chloride (CTAC). The ethylenediamine triacetic acid (ED3A) group in 3NaHED3A can chelate many kinds of metal ions, which indicates a promising application prospect in many fields including metal anticorrosion, corrosion control agent, additives in electroplating solution, and ore selection and solid surface treatment. PMID:15464823

  3. Synthesis and bioactivity of 2',3'-benzoabscisic acid analogs.


    Han, Xiaoqiang; Wan, Chuan; Li, Xiuyun; Li, Hong; Yang, Dongyan; Du, Shijie; Xiao, Yumei; Qin, Zhaohai


    2',3'-Benzoabscisic acid 4a is significantly more active than (±)-ABA and can be potentially used as a plant growth regulator for agriculture. In this study, six 4a analogs were designed and synthesized. Bioassay showed that 4a displayed greater activity than (±)-ABA and the six analogs produced less inhibition than 4a itself. Specially, some analogs displayed markedly different activities to different physiological and biochemical process, which were largely different from ABA and 4a. Compared to (±)-ABA, 4b and 4c were more effective germination inhibitors for lettuce, but less effective inhibitors for rice elongation. Five-membered analog 5 was higher or slightly weaker in inhibiting Arabidopsis seed germination and rice elongation, respectively, but at least 10 times less effective than (±)-ABA in lettuce seed germination. Dual acid 6 and alkyne acid 20 nearly produced no inhibitory activity for Arabidopsis seed germination, but displayed excellent activity in inhibiting rice seedling growth. The preference of the analogs to different physiology process indicated that they might provide a strategy to develop novel ABA agonists or antagonist and be used as probe to investigate the function of different ABA receptors. PMID:25913114

  4. Evidence That a Malate/Inorganic Phosphate Exchange Translocator Imports Carbon across the Leucoplast Envelope for Fatty Acid Synthesis in Developing Castor Seed Endosperm.

    PubMed Central

    Eastmond, P. J.; Dennis, D. T.; Rawsthorne, S.


    In this study we examined the processes by which malate and pyruvate are taken up across the leucoplast envelope for fatty acid synthesis in developing castor (Ricinus communis L.) seed endosperm. Malate was taken up by isolated leucoplasts with a concentration dependence indicative of protein-mediated transport. The maximum rate of malate uptake was 704 [plus or minus] 41 nmol mg-1 protein h-1 and the Km was 0.62 [plus or minus] 0.08 mM. In contrast, the rate of pyruvate uptake increased linearly with respect to the substrate concentration and was 5-fold less than malate at a concentration of 5 mM. Malate uptake was inhibited by inorganic phosphate (Pi), glutamate, malonate, succinate, 2-oxoglutarate, and n-butyl malonate, an inhibitor of the mitochondrial malate/Pi-exchange translocator. Back-exchange experiments confirmed that malate was taken up by leucoplasts in counterexchange for Pi. The exchange stoichiometry was 1:1. The rate of malate-dependent fatty acid synthesis by isolated leucoplasts was 3-fold greater than from pyruvate at a concentration of 5 mM and was inhibited by n-butyl malonate. It is proposed that leucoplasts from developing castor endosperm contain a malate/Pi translocator that imports malate for fatty acid synthesis. This type of dicarboxylate transport activity has not been identified previously in plastids. PMID:12223747

  5. Effects of starvation for potassium and other inorganic ions on protein degradation and ribonucleic acid synthesis in Escherichia coli.


    St John, A C; Goldberg, A L


    Starvation of Escherichia coli for potassium, phosphate, or magnesium ions leads to a reversible increase in the rate of protein degradation and an inhibition of ribonucleic acid (RNA) synthesis. In cells deprived of potassium, the breakdown of the more stable cell proteins increased two- to threefold, whereas the hydrolysis of short-lived proteins, both normal ones and analog-containing polypeptides, did not change. The mechanisms initiating the enhancement of proteolysis during starvation for these ions were examined. Upon starvation for amino acids or amino acyl-transfer RNA (tRNA), protein breakdown increases in relA+ (but not relA) cells as a result of the rapid synthesis of guanosine-5'-diphosphate-3'-diphosphate (ppGpp). However, a lack of amino acyl-tRNA does not appear to be responsible for the increased protein breakdown in cells starved for inorganic ions, since protein breakdown increased in the absence of these ions in both relA+ and relA cultures, and since a large excess of amino acids did not affect this response. In bacteria in which energy production is restricted, ppGpp levels also rise, and protein breakdown increases. The ion-deprived cultures did show a 40 to 75% reduction in adenosine-5'-triphosphate levels,l similar to that seen upon glucose starvation. However, this decrease in ATP content does not appear to cause the increase in protein breakdown or lead to an accumulation of ppGpp. No consistent change in intracellular ppGpp levels was found in relA+ or relA cells starved for these ions. In addition, in relX mutants, removal of these ions led to accelerated protein degradation even though relX cells are unable to increase ppGpp levels or proteolysis when deprived of a carbon source. In the potassium-, phosphate-, and magnesium-deprived cultures, the addition of choramphenicol or tetracycline caused a reduction in protein breakdown toward basal levels. Such findings, however, do not indicate that protein synthesis is essential for the

  6. Akt phosphorylation and regulation of transketolase is a nodal point for amino acid control of purine synthesis.


    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T; Phan, Tony; Pilz, Renate B; Boss, Gerry R


    The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mammalian target of rapamycin 2 and IκB kinase regulate Akt activity and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the nonoxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the nonoxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for 2 days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  7. Liquid-Phase Heat-Release Rates of the Systems Hydrazine-Nitric Acid and Unsymmetrical Dimethylhydrazine-Nitric Acid

    NASA Technical Reports Server (NTRS)

    Somogyi, Dezso; Feiler, Charles E.


    The initial rates of heat release produced by the reactions of hydrazine and unsymmetrical dimethylhydrazine with nitric acid were determined in a bomb calorimeter under conditions of forced mixing. Fuel-oxidant weight ratio and injection velocity were varied. The rate of heat release apparently depended on the interfacial area between the propellants. Above a narrow range of injection velocities representing a critical amount of interfacial area, the rates reached a maximum and were almost constant with injection velocity. The maximum rate for hydrazine was about 70 percent greater than that for unsymmetrical dimethylhydrazine. The total heat released did not vary with mixture ratio over the range studied.

  8. Concise synthesis of the A/BCD-ring fragment of gambieric acid A

    PubMed Central

    Fuwa, Haruhiko; Fukazawa, Ryo; Sasaki, Makoto


    Gambieric acid A (GAA) and its congeners belong to the family of marine polycyclic ether natural products. Their highly complex molecular architecture and unique biological activities have been of intense interest within the synthetic community. We have previously reported the first total synthesis, stereochemical reassignment, and preliminary structure–activity relationships of GAA. Here we disclose a concise synthesis of the A/BCD-ring fragment of GAA. The synthesis started from our previously reported synthetic intermediate that represents the A/B-ring. The C-ring was synthesized via an oxiranyl anion coupling and a 6-endo cyclization, and the D-ring was forged by means of an oxidative lactonization and subsequent palladium-catalyzed functionalization of the lactone ring. In this manner, the number of linear synthetic steps required for the construction of the C- and D-rings was reduced from 22 to 11. PMID:25629027

  9. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.


    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  10. Structure and functional characterization of a bile acid 7α dehydratase BaiE in secondary bile acid synthesis.


    Bhowmik, Shiva; Chiu, Hsien-Po; Jones, David H; Chiu, Hsiu-Ju; Miller, Mitchell D; Xu, Qingping; Farr, Carol L; Ridlon, Jason M; Wells, James E; Elsliger, Marc-André; Wilson, Ian A; Hylemon, Phillip B; Lesley, Scott A


    Conversion of the primary bile acids cholic acid (CA) and chenodeoxycholic acid (CDCA) to the secondary bile acids deoxycholic acid (DCA) and lithocholic acid (LCA) is performed by a few species of intestinal bacteria in the genus Clostridium through a multistep biochemical pathway that removes a 7α-hydroxyl group. The rate-determining enzyme in this pathway is bile acid 7α-dehydratase (baiE). In this study, crystal structures of apo-BaiE and its putative product-bound [3-oxo-Δ(4,6) -lithocholyl-Coenzyme A (CoA)] complex are reported. BaiE is a trimer with a twisted α + β barrel fold with similarity to the Nuclear Transport Factor 2 (NTF2) superfamily. Tyr30, Asp35, and His83 form a catalytic triad that is conserved across this family. Site-directed mutagenesis of BaiE from Clostridium scindens VPI 12708 confirm that these residues are essential for catalysis and also the importance of other conserved residues, Tyr54 and Arg146, which are involved in substrate binding and affect catalytic turnover. Steady-state kinetic studies reveal that the BaiE homologs are able to turn over 3-oxo-Δ(4) -bile acid and CoA-conjugated 3-oxo-Δ(4) -bile acid substrates with comparable efficiency questioning the role of CoA-conjugation in the bile acid metabolism pathway. PMID:26650892

  11. Acid gradient across plasma membrane can drive phosphate bond synthesis in cancer cells: acidic tumor milieu as a potential energy source.


    Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam


    Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623

  12. Protodeboronation of Heteroaromatic, Vinyl, and Cyclopropyl Boronic Acids: pH-Rate Profiles, Autocatalysis, and Disproportionation.


    Cox, Paul A; Leach, Andrew G; Campbell, Andrew D; Lloyd-Jones, Guy C


    pH-rate profiles for aqueous-organic protodeboronation of 18 boronic acids, many widely viewed as unstable, have been studied by NMR and DFT. Rates were pH-dependent, and varied substantially between the boronic acids, with rate maxima that varied over 6 orders of magnitude. A mechanistic model containing five general pathways (k1-k5) has been developed, and together with input of [B]tot, KW, Ka, and KaH, the protodeboronation kinetics can be correlated as a function of pH (1-13) for all 18 species. Cyclopropyl and vinyl boronic acids undergo very slow protodeboronation, as do 3- and 4-pyridyl boronic acids (t0.5 > 1 week, pH 12, 70 °C). In contrast, 2-pyridyl and 5-thiazolyl boronic acids undergo rapid protodeboronation (t0.5 ≈ 25-50 s, pH 7, 70 °C), via fragmentation of zwitterionic intermediates. Lewis acid additives (e.g., Cu, Zn salts) can attenuate (2-pyridyl) or accelerate (5-thiazolyl and 5-pyrazolyl) fragmentation. Two additional processes compete when the boronic acid and the boronate are present in sufficient proportions (pH = pKa ± 1.6): (i) self-/autocatalysis and (ii) sequential disproportionations of boronic acid to borinic acid and borane. PMID:27355973

  13. Synthesis of alanyl nucleobase amino acids and their incorporation into proteins.


    Talukder, Poulami; Dedkova, Larisa M; Ellington, Andrew D; Yakovchuk, Petro; Lim, Jaebum; Anslyn, Eric V; Hecht, Sidney M


    Proteins which bind to nucleic acids and regulate their structure and functions are numerous and exceptionally important. Such proteins employ a variety of strategies for recognition of the relevant structural elements in their nucleic acid substrates, some of which have been shown to involve rather subtle interactions which might have been difficult to design from first principles. In the present study, we have explored the preparation of proteins containing unnatural amino acids having nucleobase side chains. In principle, the introduction of multiple nucleobase amino acids into the nucleic acid binding domain of a protein should enable these modified proteins to interact with their nucleic acid substrates using Watson-Crick and other base pairing interactions. We describe the synthesis of five alanyl nucleobase amino acids protected in a fashion which enabled their attachment to a suppressor tRNA, and their incorporation into each of two proteins with acceptable efficiencies. The nucleobases studied included cytosine, uracil, thymine, adenine and guanine, i.e. the major nucleobase constituents of DNA and RNA. Dihydrofolate reductase was chosen as one model protein to enable direct comparison of the facility of incorporation of the nucleobase amino acids with numerous other unnatural amino acids studied previously. The Klenow fragment of DNA polymerase I was chosen as a representative DNA binding protein whose mode of action has been studied in detail. PMID:27452282

  14. Study on Synthesis, Characterization and Antiproliferative Activity of Novel Diisopropylphenyl Esters of Selected Fatty Acids.


    Reddy, Yasa Sathyam; Kaki, Shiva Shanker; Rao, Bala Bhaskara; Jain, Nishant; Vijayalakshmi, Penumarthy


    The present study describes the synthesis, characterization and evaluation of antiproliferative activity of novel diisopropylphenyl esters of alpha-linolenic acid (ALA), valproic acid (VA), butyric acid (BA) and 2-ethylhexanoic acid (2-EHA). These esters were chemically synthesized by the esterification of fatty acids with 2,6-diisopropylphenol and 2,4-diisopropylphenol (propofol). The structure of new conjugates viz. propofol-(alpha-linolenic acid) (2,6P-ALA and 2,4P-ALA), propofol-valproic acid (2,6P-VA and 2,4P-VA), propofol-butyric acid (2,6P-BA and 2,4P-BA) and propofol-(2-ethylhexanoic acid) (2,6P2-EHA and 2,4P-2-EHA) were characterized by FT-IR, NMR ((1)H, (13)C) and mass spectral data. The synthesized conjugates having more lipophilic character were tested for antiproliferative in vitro studies on A549, MDA-MB-231, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. All the conjugates showed specific growth inhibition on studied cancer cell lines. Among the synthesized esters, the conjugates synthesized from BA, VA and 2-EHA exhibited prominent growth inhibition against A549, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. The preliminary results suggest that the entire novel conjugates possess antiproliferative properties that reduce the proliferation of cancer cells in vitro. PMID:26666272

  15. Overexpression of malate dehydrogenase in transgenic alfalfa enhances organic acid synthesis and confers tolerance to aluminum.


    Tesfaye, M; Temple, S J; Allan, D L; Vance, C P; Samac, D A


    Al toxicity is a severe impediment to production of many crops in acid soil. Toxicity can be reduced through lime application to raise soil pH, however this amendment does not remedy subsoil acidity, and liming may not always be practical or cost-effective. Addition of organic acids to plant nutrient solutions alleviates phytotoxic Al effects, presumably by chelating Al and rendering it less toxic. In an effort to increase organic acid secretion and thereby enhance Al tolerance in alfalfa (Medicago sativa), we produced transgenic plants using nodule-enhanced forms of malate dehydrogenase and phosphoenolpyruvate carboxylase cDNAs under the control of the constitutive cauliflower mosaic virus 35S promoter. We report that a 1.6-fold increase in malate dehydrogenase enzyme specific activity in root tips of selected transgenic alfalfa led to a 4.2-fold increase in root concentration as well as a 7.1-fold increase in root exudation of citrate, oxalate, malate, succinate, and acetate compared with untransformed control alfalfa plants. Overexpression of phosphoenolpyruvate carboxylase enzyme specific activity in transgenic alfalfa did not result in increased root exudation of organic acids. The degree of Al tolerance by transformed plants in hydroponic solutions and in naturally acid soil corresponded with their patterns of organic acid exudation and supports the concept that enhancing organic acid synthesis in plants may be an effective strategy to cope with soil acidity and Al toxicity. PMID:11743127

  16. Effects of Long Chain Fatty Acid Synthesis and Associated Gene Expression in Microalga Tetraselmis sp

    PubMed Central

    Adarme-Vega, T. Catalina; Thomas-Hall, Skye R.; Lim, David K. Y.; Schenk, Peer M.


    With the depletion of global fish stocks, caused by high demand and effective fishing techniques, alternative sources for long chain omega-3 fatty acids are required for human nutrition and aquaculture feeds. Recent research has focused on land-based cultivation of microalgae, the primary producers of omega-3 fatty acids in the marine food web. The effect of salinity on fatty acids and related gene expression was studied in the model marine microalga, Tetraselmis sp. M8. Correlations were found for specific fatty acid biosynthesis and gene expression according to salinity and the growth phase. Low salinity was found to increase the conversion of C18:4 stearidonic acid (SDA) to C20:4 eicosatetraenoic acid (ETA), correlating with increased transcript abundance of the Δ-6-elongase-encoding gene in salinities of 5 and 10 ppt compared to higher salinity levels. The expression of the gene encoding β-ketoacyl-coenzyme was also found to increase at lower salinities during the nutrient deprivation phase (Day 4), but decreased with further nutrient stress. Nutrient deprivation also triggered fatty acids synthesis at all salinities, and C20:5 eicosapentaenoic acid (EPA) increased relative to total fatty acids, with nutrient starvation achieving a maximum of 7% EPA at Day 6 at a salinity of 40 ppt. PMID:24901700

  17. Computer-assisted automatic synthesis II. Development of a fully automated apparatus for preparing substituted N–(carboxyalkyl)amino acids

    PubMed Central

    Hayashi, Nobuyoshi; Sugawara, Tohru; Shintani, Motoaki; Kato, Shinji


    A versatile automated apparatus, equipped with an artificial intelligence has been developed which may be used to prepare and isolate a wide variety of compounds. The prediction of the optimum reaction conditions and the reaction control in real time, are accomplished using novel kinetic equations and substituent effects in an artificial intelligence software which has already reported [1]. This paper deals with the design and construction of the fully automated system, and its application to the synthesis of a substituted N-(carboxyalkyl)amino acid. The apparatus is composed of units for perfoming various tasks, e.g. reagent supply, reaction, purification and separation, each linked to a control system. All synthetic processes including washing and drying of the apparatus after each synthetic run were automatically performed from the mixing of the reactants to the isolation of the products as powders with purities of greater than 98%. The automated apparatus has been able to run for 24 hours per day, and the average rate of synthesis of substituted N-(carboxyalkyl)amino acids has been three compounds daily. The apparatus is extremely valuable for synthesizing many derivatives of one particular compound structure. Even if the chemical yields are low under the optimum conditions, it is still possible to obtain a sufficient amount of the desired product by repetition of the reaction. Moreover it was possible to greatly reduce the manual involvement of the many syntheses which are a necessary part of pharmaceutical research. PMID:18924679

  18. Computer-assisted automatic synthesis II. Development of a fully automated apparatus for preparing substituted N-(carboxyalkyl)amino acids.


    Hayashi, N; Sugawara, T; Shintani, M; Kato, S


    A versatile automated apparatus, equipped with an artificial intelligence has been developed which may be used to prepare and isolate a wide variety of compounds. The prediction of the optimum reaction conditions and the reaction control in real time, are accomplished using novel kinetic equations and substituent effects in an artificial intelligence software which has already reported [1]. This paper deals with the design and construction of the fully automated system, and its application to the synthesis of a substituted N-(carboxyalkyl)amino acid. The apparatus is composed of units for perfoming various tasks, e.g. reagent supply, reaction, purification and separation, each linked to a control system. All synthetic processes including washing and drying of the apparatus after each synthetic run were automatically performed from the mixing of the reactants to the isolation of the products as powders with purities of greater than 98%. The automated apparatus has been able to run for 24 hours per day, and the average rate of synthesis of substituted N-(carboxyalkyl)amino acids has been three compounds daily. The apparatus is extremely valuable for synthesizing many derivatives of one particular compound structure. Even if the chemical yields are low under the optimum conditions, it is still possible to obtain a sufficient amount of the desired product by repetition of the reaction. Moreover it was possible to greatly reduce the manual involvement of the many syntheses which are a necessary part of pharmaceutical research. PMID:18924679

  19. Measurement of Fatty Acid Oxidation Rates in Animal Tissues and Cell Lines

    PubMed Central

    Huynh, Frank K.; Green, Michelle F.; Koves, Timothy R.; Hirschey, Matthew D.


    While much oncological research has focused on metabolic shifts in glucose and amino acid oxidation, recent evidence suggests that fatty acid oxidation (FAO) may also play an important role in the metabolic reprogramming of cancer cells. Here, we present a simple method for measuring FAO rates using radiolabeled palmitate, common laboratory reagents, and standard supplies. This protocol is broadly applicable for measuring FAO rates in cultured cancer cells as well as in both malignant and nontransformed animal tissues. PMID:24862277

  20. Rates of insulin secretion in INS-1 cells are enhanced by coupling to anaplerosis and Kreb's cycle flux independent of ATP synthesis

    SciTech Connect

    Cline, Gary W.; Pongratz, Rebecca L.; Zhao, Xiaojian; Papas, Klearchos K.


    Highlights: Black-Right-Pointing-Pointer We studied media effects on mechanisms of insulin secretion of INS-1 cells. Black-Right-Pointing-Pointer Insulin secretion was higher in DMEM than KRB despite identical ATP synthesis rates. Black-Right-Pointing-Pointer Insulin secretion rates correlated with rates of anaplerosis and TCA cycle. Black-Right-Pointing-Pointer Mitochondria metabolism and substrate cycles augment secretion signal of ATP. -- Abstract: Mechanistic models of glucose stimulated insulin secretion (GSIS) established in minimal media in vitro, may not accurately describe the complexity of coupling metabolism with insulin secretion that occurs in vivo. As a first approximation, we have evaluated metabolic pathways in a typical growth media, DMEM as a surrogate in vivo medium, for comparison to metabolic fluxes observed under the typical experimental conditions using the simple salt-buffer of KRB. Changes in metabolism in response to glucose and amino acids and coupling to insulin secretion were measured in INS-1 832/13 cells. Media effects on mitochondrial function and the coupling efficiency of oxidative phosphorylation were determined by fluorometrically measured oxygen consumption rates (OCRs) combined with {sup 31}P NMR measured rates of ATP synthesis. Substrate preferences and pathways into the TCA cycle, and the synthesis of mitochondrial 2nd messengers by anaplerosis were determined by {sup 13}C NMR isotopomer analysis of the fate of [U-{sup 13}C] glucose metabolism. Despite similar incremental increases in insulin secretion, the changes of OCR in response to increasing glucose from 2.5 to 15 mM were blunted in DMEM relative to KRB. Basal and stimulated rates of insulin secretion rates were consistently higher in DMEM, while ATP synthesis rates were identical in both DMEM and KRB, suggesting greater mitochondrial uncoupling in DMEM. The relative rates of anaplerosis, and hence synthesis and export of 2nd messengers from the mitochondria were found

  1. Comparison of rates of enamel synthesis in impeded and unimpeded rat incisors.


    Skobe, Z; Heeley, J D; Dobeck, J M; Prostak, K S; Maravelis, L; Stern, D N


    Periodic intubations of rats with solutions of fluoride (F) lead to the appearance of bands of disrupted pigmentation in continuously erupting incisors. Distances between fluorotic bands reflect time intervals between intubations. In this experiment, the periodicity of fluorotic banding was used for estimation of the rate of enamel synthesis in impeded and unimpeded rat incisors. Rats kept on a low-F diet and distilled water were intubated two or four times per week with 2 mg NaF/150 g body weight. In a group of rats, one of the mandibular incisors was cut at the gingival margin after two weeks, and intubations were continued for an additional two weeks. In another group of F-intubated rats, incisors were cut or notched at the gingival margin twice, six days apart. Control rats either received the same periodic F intubations or were maintained on the low-F diet without intubation. Measurements of spacing between fluorotic bands were identical in impeded and unimpeded teeth, even though the latter erupted at a faster rate. In an unimpeded mandibular incisors, there was a significant elongation of the secretory zone and a shortening of the pigmentation zone, resulting in reduced pigmentation intensity of the erupted portions of the teeth. The results show that the rate of enamel synthesis is independent of the eruption rate. PMID:8418106

  2. Partial restoration of protein synthesis rates by the small molecule ISRIB prevents neurodegeneration without pancreatic toxicity

    PubMed Central

    Halliday, M; Radford, H; Sekine, Y; Moreno, J; Verity, N; le Quesne, J; Ortori, C A; Barrett, D A; Fromont, C; Fischer, P M; Harding, H P; Ron, D; Mallucci, G R


    Activation of the PERK branch of the unfolded protein response (UPR) in response to protein misfolding within the endoplasmic reticulum (ER) results in the transient repression of protein synthesis, mediated by the phosphorylation of the alpha subunit of eukaryotic initiation factor 2 (eIF2α). This is part of a wider integrated physiological response to maintain proteostasis in the face of ER stress, the dysregulation of which is increasingly associated with a wide range of diseases, particularly neurodegenerative disorders. In prion-diseased mice, persistently high levels of eIF2α cause sustained translational repression leading to catastrophic reduction of critical proteins, resulting in synaptic failure and neuronal loss. We previously showed that restoration of global protein synthesis using the PERK inhibitor GSK2606414 was profoundly neuroprotective, preventing clinical disease in prion-infected mice. However, this occured at the cost of toxicity to secretory tissue, where UPR activation is essential to healthy functioning. Here we show that pharmacological modulation of eIF2α-P-mediated translational inhibition can be achieved to produce neuroprotection without pancreatic toxicity. We found that treatment with the small molecule ISRIB, which restores translation downstream of eIF2α, conferred neuroprotection in prion-diseased mice without adverse effects on the pancreas. Critically, ISRIB treatment resulted in only partial restoration of global translation rates, as compared with the complete restoration of protein synthesis seen with GSK2606414. ISRIB likely provides sufficient rates of protein synthesis for neuronal survival, while allowing some residual protective UPR function in secretory tissue. Thus, fine-tuning the extent of UPR inhibition and subsequent translational de-repression uncouples neuroprotective effects from pancreatic toxicity. The data support the pursuit of this approach to develop new treatments for a range of neurodegenerative

  3. Partial restoration of protein synthesis rates by the small molecule ISRIB prevents neurodegeneration without pancreatic toxicity.


    Halliday, M; Radford, H; Sekine, Y; Moreno, J; Verity, N; le Quesne, J; Ortori, C A; Barrett, D A; Fromont, C; Fischer, P M; Harding, H P; Ron, D; Mallucci, G R


    Activation of the PERK branch of the unfolded protein response (UPR) in response to protein misfolding within the endoplasmic reticulum (ER) results in the transient repression of protein synthesis, mediated by the phosphorylation of the alpha subunit of eukaryotic initiation factor 2 (eIF2α). This is part of a wider integrated physiological response to maintain proteostasis in the face of ER stress, the dysregulation of which is increasingly associated with a wide range of diseases, particularly neurodegenerative disorders. In prion-diseased mice, persistently high levels of eIF2α cause sustained translational repression leading to catastrophic reduction of critical proteins, resulting in synaptic failure and neuronal loss. We previously showed that restoration of global protein synthesis using the PERK inhibitor GSK2606414 was profoundly neuroprotective, preventing clinical disease in prion-infected mice. However, this occured at the cost of toxicity to secretory tissue, where UPR activation is essential to healthy functioning. Here we show that pharmacological modulation of eIF2α-P-mediated translational inhibition can be achieved to produce neuroprotection without pancreatic toxicity. We found that treatment with the small molecule ISRIB, which restores translation downstream of eIF2α, conferred neuroprotection in prion-diseased mice without adverse effects on the pancreas. Critically, ISRIB treatment resulted in only partial restoration of global translation rates, as compared with the complete restoration of protein synthesis seen with GSK2606414. ISRIB likely provides sufficient rates of protein synthesis for neuronal survival, while allowing some residual protective UPR function in secretory tissue. Thus, fine-tuning the extent of UPR inhibition and subsequent translational de-repression uncouples neuroprotective effects from pancreatic toxicity. The data support the pursuit of this approach to develop new treatments for a range of neurodegenerative

  4. Electrodialysis synthesis of concentrated solutions of perrhenic acid

    NASA Astrophysics Data System (ADS)

    Palant, A. A.; Bryukvin, V. A.; Levin, A. M.; Reshetova, O. V.


    The presented results demonstrate the possibility of electrodialysis production of concentrated solutions of perrhenic acid (HReO4 concentration >400 g/l). KReO4 is used as a precursor. The investigations are performed in a three-chamber electrodialysis cell in a continuous mode. The optimal processing parameters are as follows: the current is 3-5 A, the voltage is 30-40 V, and the anode chamber temperature is 20-25°C. Grade AR-0 ammonium perrhenate is precipitated from the obtained HReO4 solution.

  5. Synthesis, preliminary bioevaluation and computational analysis of caffeic acid analogues.


    Liu, Zhiqian; Fu, Jianjun; Shan, Lei; Sun, Qingyan; Zhang, Weidong


    A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO) generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification. PMID:24857914

  6. Synthesis, Preliminary Bioevaluation and Computational Analysis of Caffeic Acid Analogues

    PubMed Central

    Liu, Zhiqian; Fu, Jianjun; Shan, Lei; Sun, Qingyan; Zhang, Weidong


    A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO) generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification. PMID:24857914

  7. Concise synthesis of ether analogues of lysobisphosphatidic acid.


    Jiang, Guowei; Xu, Yong; Falguières, Thomas; Gruenberg, Jean; Prestwich, Glenn D


    We describe a versatile, efficient method for the preparation of ether analogues of (S,S)-lysobisphosphatidic acid (LBPA) and its enantiomer from (S)-solketal. Phosphorylation of a protected sn-2-O-octadecenyl glyceryl ether with 2-cyanoethyl bis-N,N-diisopropylamino phosphine and subsequent deprotection generated the bisether LBPA analogues. By simply changing the sequence of deprotection steps, we obtained the (R,R)- and (S,S)-enantiomers of 2,2'-bisether LBPA. An ELISA assay with anti-LBPA monoclonal antibodies showed that the bisether LBPAs were recognized with the same affinity as the natural 2,2'-bisoleolyl LBPA. [reaction: see text] PMID:16119911

  8. Clearance and synthesis rates of beta 2-microglobulin in patients undergoing hemodialysis and in normal subjects

    SciTech Connect

    Floege, J.; Bartsch, A.; Schulze, M.; Shaldon, S.; Koch, K.M.; Smeby, L.C. )


    Retention of {beta} 2-microglobulin in patients undergoing hemodialysis is associated with a {beta} 2-microglobulin-derived amyloidosis. Removal of {beta} 2-microglobulin by renal replacement therapy has been proposed for the prevention of this amyloidosis. Currently, however, data on the {beta} 2-microglobulin synthesis rate in patients undergoing hemodialysis are scarce, and consequently it remains speculative how much removal would be necessary to counterbalance synthesis. The plasma kinetics of iodine 131-labeled {beta} 2-microglobulin were therefore examined in 11 patients with anuria who were undergoing long-term hemodialysis. Five healthy persons served as controls. Kinetic modeling of the plasma curves showed that the data fitted a two-pool model (r2 greater than 0.96) consisting of a rapid 2 to 4 hour distribution phase followed by a less steep curve, described by the plasma (metabolic) clearance (Clp). Synthetic rates were calculated from Clp and the {beta} 2-microglobulin steady state plasma concentration (plus {beta} 2-microglobulin removal during hemodialysis in the case of high flux hemodialysis). The results showed a significantly higher Clp in normal controls as compared with patients undergoing hemodialysis (65.5 {plus minus} 12.8 ml/min (mean {plus minus} SD) versus 3.4 {plus minus} 0.7 ml/min). In contrast, the {beta} 2-microglobulin synthesis rate in the patient group (3.10 {plus minus} 0.79 mg/kg/day) was not significantly different from that of normal controls (2.40 {plus minus} 0.67 mg/kg/day), which was due to markedly elevated {beta} 2-microglobulin plasma concentrations in the patients (37.6 {plus minus} 14.1 mg/L vs 1.92 {plus minus} 0.27 mg/L). These findings suggest that the presence of end-stage renal disease does not have a significant impact on the beta 2-microglobulin generation rate.

  9. Continuous-flow reactor-based synthesis of carbohydrate and dihydrolipoic acid-capped quantum dots.


    Laurino, Paola; Kikkeri, Raghavendra; Seeberger, Peter H


    A detailed protocol for the large-scale synthesis of carbohydrate and dihydrolipoic acid (DHLA)-coated CdSe/ZnS and CdTe/ZnS nanoparticles using continuous flow reactors is described here. Three continuous flow microreaction systems, operating at three different temperatures, are used for the synthesis of mannose-, galactose- or DHLA-functionalized quantum dots (QDs). In the first step of synthesis, the CdSe and CdTe nanoparticles are prepared. The size and spectral properties of the CdSe core of the nanoparticles are controlled by adjustment of the residence time and the temperature. As a second step, the zinc sulfide capping under homogenous conditions is carried out at a substantially lower temperature than is required for nanoparticle growth in batch processes. Finally, the trioctylphosphine/oleic acid ligand is effectively replaced with either carbohydrate PEG-thiol moieties or DHLA at 60 °C. This new protocol allows the synthesis of biologically active fluorescent QDs in 4 d. PMID:21799489

  10. Synthesis and Evaluation of Aryl Boronic Acids as Fluorescent Artificial Receptors for Biological Carbohydrates

    PubMed Central

    Craig, Sandra


    Carbohydrates in various forms play a vital role in numerous critical biological processes. The detection of such saccharides can give insight into the progression of such diseases such as cancer. Boronic acids react with 1,2 and 1,3 diols of saccharides in non-aqueous or basic aqueous media. Herein, we describe the design, synthesis and evaluation of three bisboronic acid fluorescent probes, each having about ten linear steps in its synthesis. Among these compounds that were evaluated, 9b was shown to selectively label HepG2, liver carcinoma cell line within a concentration range of 0.5–10 μM in comparison to COS-7, a normal fibroblast cell line. PMID:22177855

  11. Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.


    Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos


    α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed. PMID:27589703

  12. The Effects of Borate Minerals on the Synthesis of Nucleic Acid Bases, Amino Acids and Biogenic Carboxylic Acids from Formamide

    NASA Astrophysics Data System (ADS)

    Saladino, Raffaele; Barontini, Maurizio; Cossetti, Cristina; di Mauro, Ernesto; Crestini, Claudia


    The thermal condensation of formamide in the presence of mineral borates is reported. The products afforded are precursors of nucleic acids, amino acids derivatives and carboxylic acids. The efficiency and the selectivity of the reaction was studied in relation to the elemental composition of the 18 minerals analyzed. The possibility of synthesizing at the same time building blocks of both genetic and metabolic apparatuses, along with the production of amino acids, highlights the interest of the formamide/borate system in prebiotic chemistry.

  13. Stimulation of skeletal muscle protein synthesis in neonatal pigs by long-term infusion of leucine is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 hr increases skeletal muscle protein synthesis in neonatal pigs, but this is not sustained for 2 h unless the leucine-induced fall in amino acids is prevented. We aimed to determine whether continuous leucine infusion can stimulate protein synthesis for a prolonged period whe...

  14. Acetyl xylan esterase of Aspergillus ficcum catalyzed the synthesis of peracetic acid from ethyl acetate and hydrogen peroxide.


    Park, Seung-Moon


    Recombinant acetyl xylan esterase (rAXE) of Aspergillus ficcum catalyzed the synthesis of peracetic acid (PAA) from ethyl acetate and hydrogen peroxide. Ten micrograms of rAXE catalyzed the synthesis of 1.34 mM of PAA, which can be used for the pretreatment of cellulosic biomass in situ. PMID:21824816

  15. Efficient Synthesis of 3,3'-Mixed Bisindoles via Lewis Acid Catalyzed Reaction of Spiro-epoxyoxindoles and Indoles.


    Hajra, Saumen; Maity, Subrata; Maity, Ramkrishna


    An efficient strategy for the synthesis of 3-(3-indolyl)-oxindole-3-methanol has been developed to achieve a Lewis acid catalyzed, highly regioselective ring opening of spiro-epoxyoxindoles with indoles. The method is used for the gram-scale formal total synthesis of (±)-gliocladin C. PMID:26158390

  16. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease.


    Lake, April D; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D; Lu, Zhenqiang; Lehman-McKeeman, Lois D; Cherrington, Nathan J


    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the 'classical' (neutral) and 'alternative' (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. PMID:23391614

  17. Synthesis, biological activity, and bioavailability of moschamine, a safflomide-type phenylpropenoic acid amide found in Centaurea cyanus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Moschamine is a safflomide-type phenylpropenoic acid amide originally isolated from Centaurea cyanus. This paper describes the synthesis, detection of serotoninergic and COX inhibitory activities, and bioavailability of moschamine. Moschamine was chemically synthesized and identified using NMR spect...

  18. Computer Simulation Model for the Biosynthesis of Galactosyldiacylglycerols and Fatty Acid Desaturation in Plants (Determination of Rates of Desaturase Activity in Monogalactosyldiacylglycerol).

    PubMed Central

    Williams, J. P.; Khan, M. U.; Wong, D.


    The level of unsaturation of the constituent fatty acids of many glycerolipids in plant membranes is modified by environmental factors. The measurement of the rate of the desaturation of these fatty acids is essential to an understanding of how plants adapt to changing environments. This is difficult because of the complexity of the system and the problems involved in measuring rates of these enzyme reactions in cell-free preparations. A computer program has been developed that simulates the synthesis of galactosyldiacylglycerols and desaturation of their fatty acids in chloroplasts. The program uses the rate of incorporation and distribution of 14C in fatty acids after 14CO2 feeding to estimate rates of desaturation in the fatty acids of glycerolipids. Data are presented to demonstrate the use of the program in comparing rates of desaturation in the five enzyme reactions associated with monogalactosyldiacylglycerol in the chloroplastic pathway of leaves from Brassica napus. The method represents a quick, reliable, and accurate measure of desaturase activity in vivo and is the only method available to estimate desaturase activity of all five enzymes at the same time. PMID:12231750

  19. Oleic acid coated magnetic nano-particles: Synthesis and characterizations

    SciTech Connect

    Panda, Biswajit Goyal, P. S.


    Magnetic nano particles of Fe{sub 3}O{sub 4} coated with oleic acid were synthesized using wet chemical route, which involved co-precipitation of Fe{sup 2+} and Fe{sup 3+} ions. The nano particles were characterized using XRD, TEM, FTIR, TGA and VSM. X-ray diffraction studies showed that nano particles consist of single phase Fe{sub 3}O{sub 4} having inverse spinel structure. The particle size obtained from width of Bragg peak is about 12.6 nm. TEM analysis showed that sizes of nano particles are in range of 6 to 17 nm with a dominant population at 12 - 14 nm. FTIR and TGA analysis showed that -COOH group of oleic acid is bound to the surface of Fe{sub 3}O{sub 4} particles and one has to heat the sample to 278° C to remove the attached molecule from the surface. Further it was seen that Fe{sub 3}O{sub 4} particles exhibit super paramagnetism with a magnetization of about 53 emu/ gm.

  20. CML10, a variant of calmodulin, modulates ascorbic acid synthesis.


    Cho, Kwang-Moon; Nguyen, Ha Thi Kim; Kim, Soo Youn; Shin, Jin Seok; Cho, Dong Hwa; Hong, Seung Beom; Shin, Jeong Sheop; Ok, Sung Han


    Calmodulins (CaMs) regulate numerous Ca(2+) -mediated cellular processes in plants by interacting with their respective downstream effectors. Due to the limited number of CaMs, other calcium sensors modulate the regulation of Ca(2+) -mediated cellular processes that are not managed by CaMs. Of 50 CaM-like (CML) proteins identified in Arabidopsis thaliana, we characterized the function of CML10. Yeast two-hybrid screening revealed phosphomannomutase (PMM) as a putative interaction partner of CML10. In vitro and in vivo interaction assays were performed to analyze the interaction mechanisms of CML10 and PMM. PMM activity and the phenotypes of cml10 knock-down mutants were studied to elucidate the role(s) of the CML10-PMM interaction. PMM interacted specifically with CML10 in the presence of Ca(2+) through its multiple interaction motifs. This interaction promoted the activity of PMM. The phenotypes of cml10 knock-down mutants were more sensitive to stress conditions than wild-type plants, corresponding with the fact that PMM is an enzyme which modulates the biosynthesis of ascorbic acid, an antioxidant. The results of this research demonstrate that a calcium sensor, CML10, which is an evolutionary variant of CaM, modulates the stress responses in Arabidopsis by regulating ascorbic acid production. PMID:26315131

  1. Body pool and synthesis of ascorbic acid in adult sea lamprey (Petromyzon marinus): An agnathan fish with gulonolactone oxidase activity

    PubMed Central

    Moreau, Régis; Dabrowski, Konrad


    Although many vertebrates can synthesize ascorbic acid (vitamin C), it is still unclear from the evolutionary perspective when the ability to synthesize the vitamin first appeared in the animal kingdom and how frequently the trait has been lost. We report here ascorbic acid biosynthesis ability in sea lamprey (Petromyzon marinus) which represent the most ancient vertebrate lineage examined thus far for presence of gulonolactone oxidase, the enzyme catalyzing the terminal step in biosynthesis of vitamin C. This finding supports the view that the ancestors of living vertebrates were not scurvy prone and that the loss of gulonolactone oxidase activity subsequently occurred several times in vertebrate phylogeny. Adult sea lamprey allocate significant amounts of ascorbic acid to the gonads to guaranty high-quality gametes. Tissue stores of ascorbate were maintained by de novo synthesis (1.2–1.3 mg of ascorbic acid/300-g sea lamprey per day at 15°C) while sea lamprey fast during spawning migration. We estimate that the in vivo daily renewal rate of ascorbate is 4–5% of the whole-body ascorbate pool based on measurement of its biosynthesis and concentration in the whole animal. PMID:9707638

  2. [Synthesis and properties of nuclear hydroxylated derivatives of flufenamic acid and etofenamate (author's transl)].


    Boltze, K H; Bäcker, U; Kreisfeld, H


    Synthesis of six nuclear hydroxylated derivatives of flufenamic acid and etofenamate (5-OH-, 4'-OH and 5,4'-(OH2) on a preparative scale is described. All compounds show low toxicity, but only weak anti-inflammatory activity in the rat paw kaolin edema test as compared to 2-(2-hydroxyethoxy)ethyl-N-(a,a,a-trifluoro-m-tolyl)-anthranilate (etofenamate, active substance of Rheumon Gel). PMID:7200776

  3. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina


    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  4. Synthesis of milk specific fatty acids and proteins by dispersed goat mammary-gland epithelial cells.

    PubMed Central

    Hansen, H O; Tornehave, D; Knudsen, J


    The method now described for preparation of dispersed lactating goat mammary-gland cells gives a high yield of morphologically and functionally normal mammary cells. The cells synthesize specific goat milk fatty acids in the right proportions, and they respond to hormones by increased protein synthesis. The cells can be frozen and thawed without losing the above properties, which makes them an excellent tool for metabolic and hormonal studies. Images Fig. 1. Fig. 2. PMID:3800930

  5. Synthesis of 15-(p-iodophenyl)-6-tellurapentadecanoic acid: a new myocardial imaging agent

    SciTech Connect

    Goodman, M.M.; Knapp, F.F. Jr.


    1-Cl-9-(p-iodophenyl)nonane was coupled with sodium (methylvaleryl) telluride to produce methyl-15-(p-iodophenyl)-6-tellurapentadecanoate in 90% yield. Hydrolysis produced the title compound. /sup 1/HNMR and chromatographic analysis substantiated the structure. This method can be used in the synthesis of other fatty acid analogues. The compound has been prepared with iodine 125 and 131 labels. These agents showed prolonged myocardial retention in rats with little in vivo deiodination.

  6. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    SciTech Connect

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert


    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  7. Total synthesis of leopolic acid A, a natural 2,3-pyrrolidinedione with antimicrobial activity.


    Dhavan, Atul A; Kaduskar, Rahul D; Musso, Loana; Scaglioni, Leonardo; Martino, Piera Anna; Dallavalle, Sabrina


    The first total synthesis of leopolic acid A, a fungal metabolite with a rare 2,3-pyrrolidinedione nucleus linked to an ureido dipeptide, was designed and carried out. Crucial steps for the strategy include a Dieckmann cyclization to obtain the 2,3-pyrrolidinedione ring and a Wittig olefination to install the polymethylene chain. An oxazolidinone-containing leopolic acid A analogue was also synthesized. The antibacterial activity showed by both compounds suggests that they could be considered as promising candidates for future developments. PMID:27559415

  8. Synthesis and bioactivity of analogues of the marine antibiotic tropodithietic acid

    PubMed Central

    Rabe, Patrick; Klapschinski, Tim A; Brock, Nelson L; Citron, Christian A; D’Alvise, Paul; Gram, Lone


    Summary Tropodithietic acid (TDA) is a structurally unique sulfur-containing antibiotic from the Roseobacter clade bacterium Phaeobacter inhibens DSM 17395 and a few other related species. We have synthesised several structural analogues of TDA and used them in bioactivity tests against Staphylococcus aureus and Vibrio anguillarum for a structure–activity relationship (SAR) study, revealing that the sulfur-free analogue of TDA, tropone-2-carboxylic acid, has an antibiotic activity that is even stronger than the bioactivity of the natural product. The synthesis of this compound and of several analogues is presented and the bioactivity of the synthetic compounds is discussed. PMID:25161739

  9. Total synthesis of leopolic acid A, a natural 2,3-pyrrolidinedione with antimicrobial activity

    PubMed Central

    Dhavan, Atul A; Kaduskar, Rahul D; Musso, Loana; Scaglioni, Leonardo; Martino, Piera Anna


    Summary The first total synthesis of leopolic acid A, a fungal metabolite with a rare 2,3-pyrrolidinedione nucleus linked to an ureido dipeptide, was designed and carried out. Crucial steps for the strategy include a Dieckmann cyclization to obtain the 2,3-pyrrolidinedione ring and a Wittig olefination to install the polymethylene chain. An oxazolidinone-containing leopolic acid A analogue was also synthesized. The antibacterial activity showed by both compounds suggests that they could be considered as promising candidates for future developments. PMID:27559415

  10. Synthesis and sintering of nanocrystalline hydroxyapatite powders by citric acid sol-gel combustion method

    SciTech Connect

    Han Yingchao; Li Shipu; Wang Xinyu; Chen Xiaoming


    The citric acid sol-gel combustion method has been used for the synthesis of nanocrystalline hydroxyapatite (HAP) powder from calcium nitrate, diammonium hydrogen phosphate and citric acid. The phase composition of HAP powder was characterized by X-ray powder diffraction analysis (XRD). The morphology of HAP powder was observed by transmission electron microscope (TEM). The HAP powder has been sintered into microporous ceramic in air at 1200 deg. C with 3 h soaking time. The microstructure and phase composition of the resulting HAP ceramic were characterized by scanning electron microscope (SEM) and XRD, respectively. The physical characterization of open porosity and flexural strength have also been carried out.

  11. Increased fatty acid synthesis inhibits nitrogen starvation-induced autophagy in lipid droplet-deficient yeast.


    Régnacq, Matthieu; Voisin, Pierre; Sere, Yves Y; Wan, Bin; Soeroso, Venty M S; Bernard, Marianne; Camougrand, Nadine; Bernard, François-Xavier; Barrault, Christine; Bergès, Thierry


    Macroautophagy is a degradative pathway whereby cells encapsulate and degrade cytoplasmic material within endogenously-built membranes. Previous studies have suggested that autophagosome membranes originate from lipid droplets. However, it was recently shown that rapamycin could induce autophagy in cells lacking these organelles. Here we show that lipid droplet-deprived cells are unable to perform autophagy in response to nitrogen-starvation because of an accelerated lipid synthesis that is not observed with rapamycin. Using cerulenin, a potent inhibitor of fatty acid synthase, and exogenous addition of palmitic acid we could restore nitrogen-starvation induced autophagy in the absence of lipid droplets. PMID:27270031

  12. Synthesis, characterization, and crystal structure of 2-iodo-3,4,5-trimethoxybenzoic acid

    NASA Astrophysics Data System (ADS)

    Kolev, Iliyan N.; Petrova, Svetlana P.; Nikolova, Rositsa P.; Dimowa, Louiza T.; Shivachev, Boris L.


    This work describes the synthesis of 2-iodo-3,4,5-trimethoxybenzoic acid. The combination of iodine and silver trifluoroacetate (AgTFA) reagents was used successfully for the iodination of 3,4,5-trimetoxybenzoic acid. To improve the efficiency of the synthetic process a significant modification on the experimental design was also performed. The main structural features of the obtained aryl iodide were investigated by a single crystal X-ray diffraction analysis, FTIR, 1H and 13C NMR spectroscopy.

  13. Integrated process of distillation with side reactors for synthesis of organic acid esters

    SciTech Connect

    Panchal, Chandrakant B; Prindle, John C; Kolah, Aspri; Miller, Dennis J; Lira, Carl T


    An integrated process and system for synthesis of organic-acid esters is provided. The method of synthesizing combines reaction and distillation where an organic acid and alcohol composition are passed through a distillation chamber having a plurality of zones. Side reactors are used for drawing off portions of the composition and then recycling them to the distillation column for further purification. Water is removed from a pre-reactor prior to insertion into the distillation column. An integrated heat integration system is contained within the distillation column for further purification and optimizing efficiency in the obtaining of the final product.

  14. A Novel and Highly Regioselective Synthesis of New Carbamoylcarboxylic Acids from Dianhydrides

    PubMed Central

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A.; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario


    A regioselective synthesis has been developed for the preparation of a series of N,N′-disubstituted 4,4′-carbonylbis(carbamoylbenzoic) acids and N,N′-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3′,4,4′-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS. PMID:24511299

  15. Synthesis and use of deuterated palmitic acids to decipher the cryptoregiochemistry of a Delta13 desaturation.


    Abad, José-Luis; Serra, Montserrat; Camps, Francisco; Fabriàs, Gemma


    The synthesis of two hexadeuterated palmitic acids differing in the position of the diagnostic labels, and their use to decipher the cryptoregiochemistry of a Delta13 desaturation are described. A dithiane and a triple bond functionalities were used to introduce the diagnostic (C13 or C14) and tagging (C8 and C9) labels, respectively, in the palmitic acid skeleton. Using these probes, the cryptoregiochemistry of the Delta13 desaturation involved in the biosynthesis of Thaumetopoea pityocampa sex pheromone was studied by means of kinetic isotope effect determinations. Transformation of both (Z)-11-hexadecenoic and 11-hexadecynoic acids into (Z, Z)-11,13-hexadecadienoic and (Z)-13-hexadecen-11-ynoic acids, respectively, is initiated by abstraction of the hydrogen atom at the C13 position, followed by the fast elimination of the C14 hydrogen to give the double bond. PMID:17253792

  16. Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.


    Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij


    The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively). PMID:27017352

  17. Assessing the reproducibility of fractional rates of protein synthesis in muscle tissue measured using the flooding dose technique.


    McCarthy, Ian D; Brown, James


    The flooding dose technique of Garlick et al. (1980) has become the main method for measuring tissue and whole-animal rates of protein synthesis in ectotherms. However, single tissue samples are used to determine rates of protein synthesis and no studies have examined the pattern of flooding in large tissues such as the white muscle in fishes, which can comprise up to 55% of the wet body mass of a fish and which is poorly perfused. The present study has examined, for the first time, the patterns of flooding and measured rates of protein synthesis in five different regions of the white muscle in the Arctic charr Salvelinus alpinus ranging in size from 25g to 1.6kg following a flooding dose injection of L-[(3)H]-phenylalanine. The results indicate that the degree of flooding (i.e. free pool specific radioactivity relative to that of the injection solution) and elevation in free phenylalanine concentrations can vary between regions but the calculated fractional rates of protein synthesis were similar in four of the five regions studied. The variability in rates of protein synthesis increased with body size with greater variability observed between regions for fish >1kg in body mass. For consistency between studies, it is recommended that samples are taken from the epaxial muscle in the region below the dorsal fin when measuring fractional rates of white muscle synthesis in fishes. PMID:26970581

  18. Synthesis of non-aggregated nicotinic acid coated magnetite nanorods via hydrothermal technique

    NASA Astrophysics Data System (ADS)

    Attallah, Olivia A.; Girgis, E.; Abdel-Mottaleb, Mohamed M. S. A.


    Non-aggregated magnetite nanorods with average diameters of 20-30 nm and lengths of up to 350 nm were synthesized via in situ, template free hydrothermal technique. These nanorods capped with different concentrations (1, 1.5, 2 and 2.5 g) of nicotinic acid (vitamin B3); possessed good magnetic properties and easy dispersion in aqueous solutions. Our new synthesis technique maintained the uniform shape of the nanorods even with increasing the coating material concentration. The effect of nicotinic acid on the shape, particle size, chemical structure and magnetic properties of the prepared nanorods was evaluated using different characterization methods. The length of nanorods increased from 270 nm to 350 nm in nicotinic acid coated nanorods. Goethite and magnetite phases with different ratios were the dominant phases in the coated samples while a pure magnetite phase was observed in the uncoated one. Nicotinic acid coated magnetic nanorods showed a significant decrease in saturation magnetization than uncoated samples (55 emu/g) reaching 4 emu/g in 2.5 g nicotinic acid coated sample. The novel synthesis technique proved its potentiality to prepare coated metal oxides with one dimensional nanostructure which can function effectively in different biological applications.

  19. Total synthesis of gracilioether F. Development and application of Lewis acid promoted ketene–alkene [2+2] cycloadditions and late-stage C—H oxidation

    SciTech Connect

    Rasik, Christopher M.; Brown, M. Kevin


    The first synthesis of gracilioether F, a polyketide natural product with an unusual tricyclic core and five contiguous stereocenters, is described. Key steps of the synthesis include a Lewis acid promoted ketene–alkene [2+2] cycloaddition and a late-stage carboxylic acid directed C(sp³)—H oxidation. The synthesis requires only eight steps from norbornadiene.

  20. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters


    Moens, L.


    A process is disclosed for preparing an acid addition salt of delta-aminolevulinic acid comprising. The process involves dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing the alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  1. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters


    Moens, Luc


    A process of preparing an acid addition salt of delta-aminolevulinic acid comprising: dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures thereof to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing said alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  2. The effect of pantothenic acid deficiency on keratinocyte proliferation and the synthesis of keratinocyte growth factor and collagen in fibroblasts.


    Kobayashi, Daisaku; Kusama, Miho; Onda, Masaaki; Nakahata, Norimichi


    It has been reported that pantothenic acid (vitamin B5) and panthenol, an alcohol derivative of pantothenic acid, have beneficial moisturizing effects on the skin. However, few studies have investigated the mechanism of action of pantothenic acid on skin tissues. We tried to clarify the role of pantothenic acid on skin function by using keratinocytes and fibroblasts. The depletion of pantothenic acid from the culture medium suppressed keratinocyte proliferation and promoted differentiation. Moreover, pantothenic acid depletion decreased the synthesis of keratinocyte growth factor and procollagen 4a2 in fibroblasts. These results suggest that pantothenic acid is essential for maintaining keratinocyte proliferation and differentiation. PMID:21258175

  3. Δ(9)-Tetrahydrocannabinolic acid synthase production in Pichia pastoris enables chemical synthesis of cannabinoids.


    Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K


    Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale. PMID:26197418

  4. Oxidative cleavage of erucic acid for the synthesis of brassylic acid

    SciTech Connect

    Mohammed J. Nasrullah; Pooja Thapliyal; Erica N. Pfarr; Nicholas S. Dusek; Kristofer L. Schiele; James A. Bahr


    The main focus of this work is to synthesize Brassylic Acid (BA) using oxidative cleavage of Erucic Acid (EA). Crambe (Crambe abyssinica) is an industrial oilseed grown in North Dakota. Crambe has potential as an industrial fatty acid feedstock as a source of Erucic acid (EA). It has approximately 50-60 % of EA, a C{sub 22} monounsaturated fatty acid. Oxidative cleavage of unsaturated fatty acids derived from oilseeds produces long chain (9, 11, and 13 carbon atoms) dibasic and monobasic acids. These acids are known commercial feedstocks for the preparation of nylons, polyesters, waxes, surfactants, and perfumes. Other sources of EA are Rapeseed seed oil which 50-60 % of EA. Rapeseed is grown outside USA. The oxidative cleavage of EA was done using a high throughput parallel pressure reactor system. Kinetics of the reaction shows that BA yields reach a saturation at 12 hours. H{sub 2}WO{sub 4} was found to be the best catalyst for the oxidative cleavage of EA. High yields of BA were obtained at 80 C with bubbling of O{sub 2} or 10 bar of O{sub 2} for 12 hours.

  5. The Synthesis and Isolation of N-Tert-Butyl-2-Phenylsuccinamic Acid and N-Tert-Butyl-3-Phenylsuccinamic Acid: An Undergraduate Organic Chemistry Laboratory Experiment

    ERIC Educational Resources Information Center

    Cesare, Victor; Sadarangani, Ishwar; Rollins, Janet; Costello, Dennis


    The facile, high yielding synthesis of phenylsuccinamic acids is described and one of these syntheses, the reaction of phenylsuccinic anhydride with tert-butylamine, is successfully modified and adapted for use in the second-semester organic chemistry laboratory at St. John's University. Succinamic acids are compounds that contain both the amide…

  6. Lactating Porcine Mammary Tissue Catabolizes Branched-Chain Amino Acids for Glutamine and Aspartate Synthesis1–3

    PubMed Central

    Li, Peng; Knabe, Darrell A.; Kim, Sung Woo; Lynch, Christopher J.; Hutson, Susan M.; Wu, Guoyao


    The uptake of branched-chain amino acids (BCAA) from plasma by lactating porcine mammary gland substantially exceeds their output in milk, whereas glutamine output is 125% greater than its uptake from plasma. In this study, we tested the hypothesis that BCAA are catabolized for glutamine synthesis in mammary tissue. Mammary tissue slices from sows on d 28 of lactation were incubated at 37°C for 1 h in Krebs buffer containing 0.5 or 2 mmol/L l-[1-14C]– or l-[U-14C]–labeled leucine, isoleucine, or valine. Rates of BCAA transport and degradation in mammary tissue were high, with ∼60% of transaminated BCAA undergoing oxidative decarboxylation and the remainder being released as branched-chain α-ketoacids (BCKA). Most (∼70%) of the decarboxylated BCAA were oxidized to CO2. Rates of net BCAA transamination were similar to rates of glutamate, glutamine, aspartate, asparagine, and alanine synthesis. Consistent with the metabolic data, mammary tissue expressed BCAA aminotransferase (BCAT), BCKA decarboxylase, glutamine synthetase (GS), glutamate-oxaloacetate aminotransferase, glutamate-pyruvate aminotransferase, and asparagine synthetase, but no phosphate-activated glutaminase, activity. Western blot analysis indicated relatively high levels of mitochondrial and cytosolic isoforms of BCAT, as well as BCKA dehydrogenase and GS proteins in mammary tissue. Our results demonstrate that glutamine and aspartate (abundant amino acids in milk protein) were the major nitrogenous products of BCAA catabolism in lactating porcine mammary tissue and provide a biochemical basis to explain an enrichment of glutamine and aspartate in sow milk. PMID:19549750

  7. Synthesis of acid-base bifunctional mesoporous materials by oxidation and thermolysis

    SciTech Connect

    Yu, Xiaofang; Zou, Yongcun; Wu, Shujie; Liu, Heng; Guan, Jingqi; Kan, Qiubin


    Graphical abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst. The obtained sample of SO{sub 3}H-MCM-41-NH{sub 2} containing amine and sulfonic acids exhibits excellent catalytic activity in aldol condensation reaction. Research highlights: {yields} Synthesize acid-base bifunctional mesoporous materials SO{sub 3}H-MCM-41-NH{sub 2}. {yields} Oxidation and then thermolysis to generate acidic site and basic site. {yields} Exhibit good catalytic performance in aldol condensation reaction between acetone and various aldehydes. -- Abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst SO{sub 3}H-MCM-41-NH{sub 2}. This method was achieved by co-condensation of tetraethylorthosilicate (TEOS), 3-mercaptopropyltrimethoxysilane (MPTMS) and (3-triethoxysilylpropyl) carbamicacid-1-methylcyclohexylester (3TAME) in the presence of cetyltrimethylammonium bromide (CTAB), followed by oxidation and then thermolysis to generate acidic site and basic site. X-ray diffraction (XRD) and transmission electron micrographs (TEM) show that the resultant materials keep mesoporous structure. Thermogravimetric analysis (TGA), X-ray photoelectron spectra (XPS), back titration, solid-state {sup 13}C CP/MAS NMR and solid-state {sup 29}Si MAS NMR confirm that the organosiloxanes were condensed as a part of the silica framework. The bifunctional sample (SO{sub 3}H-MCM-41-NH{sub 2}) containing amine and sulfonic acids exhibits excellent acid-basic properties, which make it possess high activity in aldol condensation reaction between acetone and various aldehydes.

  8. Radiation synthesis of nanosilver nanohydrogels of poly(methacrylic acid)

    NASA Astrophysics Data System (ADS)

    Gupta, Bhuvanesh; Gautam, Deepti; Anjum, Sadiya; Saxena, Shalini; Kapil, Arti


    Nanosilver nanohydrogels (nSnH) of poly(methacrylic acid) were synthesized and stabilized using gamma irradiation. The main objective of this study was to develop silver nanoparticles and to evaluate the antimicrobial activity. Radiation helps in the polymerization, crosslinking and reduction of silver nitrate as well. Highly stable and uniformly distributed silver nanoparticles have been obtained within hydrogel network by water in oil nanoemulsion polymerization and were evaluated by dynamic light scattering (DLS) and transmission electron microscopy (TEM) respectively. TEM showed almost spherical and uniform distribution of silver nanoparticles through the hydrogel network. The mean size of silver nanoparticles ranging is 10-50 nm. The nanohydrogels showed good swelling in water. Antibacterial studies of nSnH suggest that it can be a good candidate as coating material in biomedical applications.

  9. Corrole and Porphyrin Amino Acid Conjugates: Synthesis and Physicochemical Properties.


    Karikis, Kostas; Georgilis, Evangelos; Charalambidis, Georgios; Petrou, Athanasia; Vakuliuk, Olena; Chatziioannou, Theodore; Raptaki, Iliana; Tsovola, Sofia; Papakyriacou, Ioanna; Mitraki, Anna; Gryko, Daniel T; Coutsolelos, Athanassios G


    A series of conjugates of amino acids with porphyrins and corroles was synthesized. Their self-assembling ability under defined conditions was investigated by scanning electron microscopy. The morphology and photophysical properties of these molecules were studied by absorption and fluorescence spectroscopy in solid, liquid, and self-assembled forms. We observed that both corrole and porphyrin conjugated with the l-phenylalanine-l-phenylalanine peptide to form spherical nanostructures with bathochromic shifts in the emission spectra, indicating the formation of aggregates. These aggregates are characterized by the impressive absorption of light over nearly the whole visible range. The broadening of all bands was particularly strong in the case of corroles. The fluorescence lifetimes of self-assembled species were longer as compared to the solid-state form. PMID:27356185

  10. Synthesis and antiproliferative activity of glutamic acid-based dipeptides.


    Silveira-Dorta, Gastón; Martín, Víctor S; Padrón, José M


    A small and focused library of 22 dipeptides derived from N,N-dibenzylglutamic acid α- and γ-benzyl esters was prepared in a straightforward manner. The evaluation of the antiproliferative activity in the human solid tumor cell lines HBL-100 (breast), HeLa (cervix), SW1573 (non-small cell lung), T-47D (breast), and WiDr (colon) provided γ-glutamyl methionine (GI50 = 6.0-41 μM) and α-glutamyl proline (GI50 = 7.5-18 μM) as lead compounds. In particular, glutamyl serine and glutamyl proline dipeptides were more active in the resistant cancer cell line WiDr than the conventional anticancer drugs cisplatin and etoposide. Glutamyl tryptophan dipeptides did not affect cell growth of HBL-100, while in T-47D cells, proliferation was inhibited. This result might be attributed to the inhibition of the ATB(0,+) transporter. PMID:25900811

  11. Effects of varying media, temperature, and growth rates on the intracellular concentrations of yeast amino acids.


    Martínez-Force, E; Benítez, T


    Variations of the yeast free amino acid pool under different culture conditions were studied in two Saccharomyces strains, the laboratory haploid strain S288C and the industrial fermentative yeast IFI256. The internal amino acid pool of both strains was measured when grown in laboratory (minimal and complete) versus semiindustrial (molasses with or without added biotin and/or diammonium phosphate) media, in fermentable (glucose, fructose, sucrose) versus respirable (glycerol) carbon sources, in different temperatures (22, 30, and 37 degrees C), pHs (2.0-4.75), and growth rates (0.018-0.24 h-1) in continuous culture, and at different phases of the growth curve in batch culture (lag, exponential, early and late stationary). Results indicated that environmental conditions, particularly the presence of amino acids in the media, enormously influenced the intracellular amino acid concentration. Higher values were detected in molasses than in laboratory media and in fermentable carbon sources (glucose, fructose, sucrose) than in glycerol. Variations in the amino acid pool along the growth curve were greater at 37 degrees C than at other temperatures; in all cases, the highest values were measured at the beginning of the exponential phase. In continuous culture and at different growth rates, intracellular free amino acid concentrations increased by 3-10-fold when the growth rate was lower than 0.05 h-1, representing 20-35% of the total (free plus protein) amino acid content and indicating that amino acid yield was a partly growth-linked parameter. PMID:7654310

  12. Support Effects on Bronsted acid site densities and alcohol dehydration turnover rates on tungsten oxide domains

    SciTech Connect

    Macht, Josef; Baertsch, Chelsey D.; May-Lozano, Marcos; Soled, Stuart L.; Wang, Yong; Iglesia, Enrique


    Initial activity and acid site density of several WAl, WSi (MCM41) and one WSn sample were determined. Trans/cis 2-butene selectivity is dependent on the support. Presumably, these differences are due to subtle differences in base strengths. 2-Butanol dehydration rates (per W-atom) reached maximum values at intermediate WOx surface densities on WAl, as reported for 2-butanol dehydration reactions on WZr. Titration results indicate that Bronsted acid sites are required for 2-butanol dehydration on WAl, WSi and WSn. UV-visible studies suggest that WAl is much more difficult to reduce than WZr. The detection of reduced centers on WAl, the number of which correlates to Bronsted acid site density and catalyst activity, as well as the temperature dependence of Bronsted acid site density indicate the in-situ formation of these active sites. We infer that this mechanism is common among all supported WOx samples described in this study. Turnover rates are a function of Bronsted acid site density only. High acid site densities lead to high turnover rates. Higher active site densities may cause stronger conjugate bases, as a higher electron density has to be stabilized, and thus weaker acidity, enabling a faster rate of product desorption. The maximum achievable active site density is dependent on the support. WZr reaches a higher active site density than WAl.

  13. d-Amino Acids Indirectly Inhibit Biofilm Formation in Bacillus subtilis by Interfering with Protein Synthesis

    PubMed Central

    Leiman, Sara A.; May, Janine M.; Lebar, Matthew D.; Kahne, Daniel; Kolter, Roberto


    The soil bacterium Bacillus subtilis forms biofilms on surfaces and at air-liquid interfaces. It was previously reported that these biofilms disassemble late in their life cycle and that conditioned medium from late-stage biofilms inhibits biofilm formation. Such medium contained a mixture of d-leucine, d-methionine, d-tryptophan, and d-tyrosine and was reported to inhibit biofilm formation via the incorporation of these d-amino acids into the cell wall. Here, we show that l-amino acids were able to specifically reverse the inhibitory effects of their cognate d-amino acids. We also show that d-amino acids inhibited growth and the expression of biofilm matrix genes at concentrations that inhibit biofilm formation. Finally, we report that the strain routinely used to study biofilm formation has a mutation in the gene (dtd) encoding d-tyrosyl-tRNA deacylase, an enzyme that prevents the misincorporation of d-amino acids into protein in B. subtilis. When we repaired the dtd gene, B. subtilis became resistant to the biofilm-inhibitory effects of d-amino acids without losing the ability to incorporate at least one noncanonical d-amino acid, d-tryptophan, into the peptidoglycan peptide side chain. We conclude that the susceptibility of B. subtilis to the biofilm-inhibitory effects of d-amino acids is largely, if not entirely, due to their toxic effects on protein synthesis. PMID:24097941

  14. D-amino acids indirectly inhibit biofilm formation in Bacillus subtilis by interfering with protein synthesis.


    Leiman, Sara A; May, Janine M; Lebar, Matthew D; Kahne, Daniel; Kolter, Roberto; Losick, Richard


    The soil bacterium Bacillus subtilis forms biofilms on surfaces and at air-liquid interfaces. It was previously reported that these biofilms disassemble late in their life cycle and that conditioned medium from late-stage biofilms inhibits biofilm formation. Such medium contained a mixture of D-leucine, D-methionine, D-tryptophan, and D-tyrosine and was reported to inhibit biofilm formation via the incorporation of these D-amino acids into the cell wall. Here, we show that L-amino acids were able to specifically reverse the inhibitory effects of their cognate D-amino acids. We also show that D-amino acids inhibited growth and the expression of biofilm matrix genes at concentrations that inhibit biofilm formation. Finally, we report that the strain routinely used to study biofilm formation has a mutation in the gene (dtd) encoding D-tyrosyl-tRNA deacylase, an enzyme that prevents the misincorporation of D-amino acids into protein in B. subtilis. When we repaired the dtd gene, B. subtilis became resistant to the biofilm-inhibitory effects of D-amino acids without losing the ability to incorporate at least one noncanonical D-amino acid, D-tryptophan, into the peptidoglycan peptide side chain. We conclude that the susceptibility of B. subtilis to the biofilm-inhibitory effects of D-amino acids is largely, if not entirely, due to their toxic effects on protein synthesis. PMID:24097941

  15. Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes.


    Iwane, Yoshihiko; Hitomi, Azusa; Murakami, Hiroshi; Katoh, Takayuki; Goto, Yuki; Suga, Hiroaki


    In ribosomal polypeptide synthesis the library of amino acid building blocks is limited by the manner in which codons are used. Of the proteinogenic amino acids, 18 are coded for by multiple codons and therefore many of the 61 sense codons can be considered redundant. Here we report a method to reduce the redundancy of codons by artificially dividing codon boxes to create vacant codons that can then be reassigned to non-proteinogenic amino acids and thereby expand the library of genetically encoded amino acids. To achieve this, we reconstituted a cell-free translation system with 32 in vitro transcripts of transfer RNASNN (tRNASNN) (S = G or C), assigning the initiator and 20 elongator amino acids. Reassignment of three redundant codons was achieved by replacing redundant tRNASNNs with tRNASNNs pre-charged with non-proteinogenic amino acids. As a demonstration, we expressed a 32-mer linear peptide that consists of 20 proteinogenic and three non-proteinogenic amino acids, and a 14-mer macrocyclic peptide that contains more than four non-proteinogenic amino acids. PMID:27001726

  16. Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes

    NASA Astrophysics Data System (ADS)

    Iwane, Yoshihiko; Hitomi, Azusa; Murakami, Hiroshi; Katoh, Takayuki; Goto, Yuki; Suga, Hiroaki


    In ribosomal polypeptide synthesis the library of amino acid building blocks is limited by the manner in which codons are used. Of the proteinogenic amino acids, 18 are coded for by multiple codons and therefore many of the 61 sense codons can be considered redundant. Here we report a method to reduce the redundancy of codons by artificially dividing codon boxes to create vacant codons that can then be reassigned to non-proteinogenic amino acids and thereby expand the library of genetically encoded amino acids. To achieve this, we reconstituted a cell-free translation system with 32 in vitro transcripts of transfer RNASNN (tRNASNN) (S = G or C), assigning the initiator and 20 elongator amino acids. Reassignment of three redundant codons was achieved by replacing redundant tRNASNNs with tRNASNNs pre-charged with non-proteinogenic amino acids. As a demonstration, we expressed a 32-mer linear peptide that consists of 20 proteinogenic and three non-proteinogenic amino acids, and a 14-mer macrocyclic peptide that contains more than four non-proteinogenic amino acids.

  17. Influence of Natural Thermal Gradients on Whole Animal Rates of Protein Synthesis in Marine Gammarid Amphipods

    PubMed Central

    Rastrick, Samuel P. S.; Whiteley, Nia M.


    Although temperature is known to have an important effect on protein synthesis rates and growth in aquatic ectotherms held in the laboratory, little is known about the effects of thermal gradients on natural populations in the field. To address this issue we determined whole-animal fractional rates of protein synthesis (ks) in four dominant species of gammarid amphipods with different distributions along the coasts of Western Europe from arctic to temperate latitudes. Up to three populations of each species were collected in the summer and ks measured within 48 h. Summer ks values were relatively high in the temperate species, Gammarus locusta, from Portugal (48°N) and Wales (53°N) and were maintained across latitudes by the conservation of translational efficiency. In sharp contrast, summer ks remained remarkably low in the boreal/temperate species G. duebeni from Wales, Scotland (58°N) and Tromsø (70°N), probably as a temporary energy saving strategy to ensure survival in rapidly fluctuating environments of the high intertidal. Values for ks increased in acclimated G. duebeni from Scotland and Tromsø showing a lack of compensation with latitude. In the subarctic/boreal species, G. oceanicus, summer ks remained unchanged in Scotland and Tromsø but fell significantly in Svalbard (79°N) at 5°C, despite a slight increase in RNA content. At 79°N, mean ks was 4.5 times higher in the circumpolar species G. setosus than in G. oceanicus due to a doubling in RNA content. The relationship between whole-animal protein synthesis rates and natural thermal gradients is complex, varies between species and appears to be associated with local temperatures and their variability, as well as changes in other environmental factors. PMID:23544122

  18. Synthesis of herpes simplex virus, vaccinia virus, and adenovirus DNA in isolated HeLa cell nuclei. I. Effect of viral-specific antisera and phosphonoacetic acid.

    PubMed Central

    Bolden, A; Aucker, J; Weissbach, A


    Purified nuclei, isolated from appropriately infected HeLa cells, are shown to synthesize large amounts of either herpes simplex virus (HSV) or vaccinia virus DNA in vitro. The rate of synthesis of DNA by nuclei from infected cells is up to 30 times higher than the synthesis of host DNA in vitro by nuclei isolated from uninfected HeLa cells. Thus HSV nuclei obtained from HSV-infected cells make DNA in vitro at a rate comparable to that seen in the intact, infected cell. Molecular hybridization studies showed that 80% of the DNA sequences synthesized in vitro by nuclei from herpesvirus-infected cells are herpesvirus specific. Vaccinia virus nuclei from vaccinia virus-infected cells, also produce comparable percentages of vaccinia virus-specific DNA sequences. Adenovirus nuclei from adenovirus 2-infected HeLa cells, which also synthesize viral DNA in vitro, have been included in this study. Synthesis of DNA by HSV or vaccinia virus nuclei is markedly inhibited by the corresponding viral-specific antisera. These antisera inhibit in a similar fashion the purified herpesvirus-induced or vaccinia virus-induced DNA polymerase isolated from infected cells. Phosphonoacetic acid, reported to be a specific inhibitor of herpesvirus formation and the herpesvirus-induced DNA polymerase, is equally effective as an inhibitor of HSV DNA synthesis in isolated nuclei in vitro. However, we also find phosphonoacetic acid to be an effective inhibitor of vaccinia virus nuclear DNA synthesis and the purified vaccinia virus-induced DNA polymerase. In addition, this compound shows significant inhibition of DNA synthesis in isolated nuclei obtained from adenovirus-infected or uninfected cells and is a potent inhibitor of HeLa cell DNA polymerase alpha. PMID:172658

  19. Measurement of Myocardial Fatty Acid Esterification Using [1-11C]Palmitate and PET: Comparison with Direct Measurements of Myocardial Triglyceride Synthesis

    PubMed Central

    Coggan, Andrew R.; Kisrieva-Ware, Zulfia; Dence, Carmen S.; Eisenbeis, Paul; Gropler, Robert J.; Herrero, Pilar


    The purpose of the present study was to assess the accuracy of non-invasive estimates of the rate of myocardial fatty acid esterification (MFAE) obtained using positron emission tomography (PET). Methods Sixteen dogs were studied after an overnight fast (FAST), during a euglycemic hyperinsulinemic clamp (CLAMP), or during infusion of Intralipid (IL) or IL plus dobutamine (IL/DOB) (n=4/group). The rate of MFAE was quantified using a bolus injection of [1-11C]palmitate and compartmental modeling as described by Bergmann et al.3 and compared to the rate of triglyceride (TG) synthesis measured directly using a continuous infusion of [1-13C]palmitate and tissue sampling. Results Across groups, mean plasma free fatty acid (FFA) concentration varied ~20-fold, with this variation in FFA availability accompanied by a ~20-fold range in directly-measured TG synthesis (i.e., from 7±1 nmol/min/g in CLAMP to 128±75 nmol/min/g in IL). PET-based estimates of MFAE varied to a similar degree (i.e., from 22±9 nmol/min/g in CLAMP to 543±551 nmol/min/g in IL), and were significantly correlated with TG synthesis (i.e., R=0.77, P<0.001). MFAE, however, was 3- to 4-fold higher than TG synthesis in FAST, CLAMP, and IL, but comparable when cardiac work was increased in IL/DOB, suggesting that MFAE reflects, in part, the incorporation of label into amino acids via TCA cycle exchange reactions (e.g., α-ketoglutarate ↔ glutamate) as well as the synthesis of TG and other lipids. Conclusions Changes in the rate of MFAE as determined using PET and the compartmental model of Bergmann et al.3 parallel changes in the rate of TG synthesis, at least in the basal state. Although such measurements are not as robust as rates of myocardial FFA uptake and oxidation as estimated by the model, this method should still be useful for quantifying acute changes in FFA storage by the heart in various pathophysiological states. PMID:19479313

  20. Enzymatic synthesis of theanine from glutamic acid γ-methyl ester and ethylamine by immobilized Escherichia coli cells with γ-glutamyltranspeptidase activity.


    Zhang, Fei; Zheng, Qing-Zhong; Jiao, Qing-Cai; Liu, Jun-Zhong; Zhao, Gen-Hai


    Theanine (γ-glutamylethylamide) is the main amino acid component in green tea. The demand for theanine in the food and pharmaceutical industries continues to increase because of its special flavour and multiple physiological effects. In this research, an improved method for enzymatic theanine synthesis is reported. An economical substrate, glutamic acid γ-methyl ester, was used in the synthesis catalyzed by immobilized Escherichia coli cells with γ-glutamyltranspeptidase (GGT) activity. The results show that GGT activity with glutamic acid γ-methyl ester as substrate was about 1.2-folds higher than that with glutamine as substrate. Reaction conditions were optimized by using 300 mmol/l glutamic acid γ-methyl ester, 3,000 mmol/l ethylamine, and 0.1 g/ml of immobilized GGT cells at pH 10 and 50°C. Under these conditions, the immobilized cells were continuously used ten times, yielding an average glutamic acid γ-methyl ester to theanine conversion rate of 69.3%. Bead activity did not change significantly the first six times they were used, and the average conversion rate during the first six instances was 87.2%. The immobilized cells exhibited favourable operational stability. PMID:20238131

  1. The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.


    Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S


    The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties. PMID:26159785

  2. Formation rates, stability and reactivity of sulfuric acid - amine clusters predicted by computational chemistry

    NASA Astrophysics Data System (ADS)

    Kurtén, Theo; Ortega, Ismael; Kupiainen, Oona; Olenius, Tinja; Loukonen, Ville; Reiman, Heidi; McGrath, Matthew; Vehkamäki, Hanna


    Despite the importance of atmospheric particle formation for both climate and air quality, both experiments and non-empirical models using e.g. sulfuric acid, ammonia and water as condensing vapors have so far been unable to reproduce atmospheric observations using realistic trace gas concentrations. Recent experimental and theoretical evidence has shown that this mystery is likely resolved by amines. Combining first-principles evaporation rates for sulfuric acid - dimethylamine clusters with cluster kinetic modeling, we show that even sub-ppt concentrations of amines, together with atmospherically realistic concentrations of sulfuric acid, result in formation rates close to those observed in the atmosphere. Our simulated cluster formation rates are also close to, though somewhat larger than, those measured at the CLOUD experiment in CERN for both sulfuric acid - ammonia and sulfuric acid - dimethylamine systems. A sensitivity analysis indicates that the remaining discrepancy for the sulfuric acid - amine particle formation rates is likely caused by steric hindrances to cluster formation (due to alkyl groups of the amine molecules) rather than by significant errors in the evaporation rates. First-principles molecular dynamic and reaction kinetic modeling shed further light on the microscopic physics and chemistry of sulfuric acid - amine clusters. For example, while the number and type of hydrogen bonds in the clusters typically reach their equilibrium values on a picosecond timescale, and the overall bonding patterns predicted by traditional "static" quantum chemical calculations seem to be stable, the individual atoms participating in the hydrogen bonds continuously change at atmospherically realistic temperatures. From a chemical reactivity perspective, we have also discovered a surprising phenomenon: clustering with sulfuric acid molecules slightly increases the activation energy required for the abstraction of alkyl hydrogens from amine molecules. This implies


    EPA Science Inventory

    SPARC (SPARC Performs Automated Reasoning in Chemistry) chemical reactivity models were extended to calculate acid and neutral hydrolysis rate constants of phosphate esters in water. The rate is calculated from the energy difference between the initial and transition states of a ...

  4. Design, Synthesis, and Antimycobacterial Activity of Novel Theophylline-7-Acetic Acid Derivatives With Amino Acid Moieties.


    Stavrakov, Georgi; Valcheva, Violeta; Voynikov, Yulian; Philipova, Irena; Atanasova, Mariyana; Konstantinov, Spiro; Peikov, Plamen; Doytchinova, Irini


    The theophylline-7-acetic acid (7-TAA) scaffold is a promising novel lead compound for antimycobacterial activity. Here, we derive a model for antitubercular activity prediction based on 14 7-TAA derivatives with amino acid moieties and their methyl esters. The model is applied to a combinatorial library, consisting of 40 amino acid and methyl ester derivatives of 7-TAA. The best three predicted compounds are synthesized and tested against Mycobacterium tuberculosis H37Rv. All of them are stable, non-toxic against human cells and show antimycobacterial activity in the nanomolar range being 60 times more active than ethambutol. PMID:26502828

  5. Whole-body DHA synthesis-secretion kinetics from plasma eicosapentaenoic acid and alpha-linolenic acid in the free-living rat.


    Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P


    Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. PMID:27263420

  6. The effect of limestone treatments on the rate of acid generation from pyritic mine gangue.


    Burt, R A; Caruccio, F T


    Surface water enters the Haile Gold Mine, Lancaster County, South Carolina by means of a small stream and is ponded behind a dam and in an abandoned pit. This water is affected by acidic drainage. In spite of the large exposures of potentially acid producing pyritic rock, the flux of acid to the water is relatively low. Nevertheless, the resulting pH values of the mine water are low (around 3.5) due to negligible buffering capacity. In view of the observed low release of acidity, the potential for acid drainage abatement by limestone ameliorants appears feasible.This study investigated the effects of limestone treatment on acid generation rates of the Haile mine pyritic rocks through a series of leaching experiments. Below a critical alkalinity threshold value, solutions of dissolved limestone were found consistently to accelerate the rate of pyrite oxidation by varying degrees. The oxidation rates were further accelerated by admixing solid limestone with the pyritic rock. However, after a period of about a month, the pyrite oxidation rate of the admixed samples declined to a level lower than that of untreated pyrite. Leachates produced by the pyrite and limestone mixtures contained little if any iron. Further, in the mixtures, an alteration of the pyrite surface was apparent.The observed behaviour of the treated pyrite appears to be related to the immersion of the pyrite grains within a high alkalinity/high pH environment. The high pH increases the rate of oxidation of ferrous iron which results in a higher concentration of ferric iron at the pyrite surface. This, in turn, increases the rate of pyrite oxidation. Above a threshold alkalinity value, the precipitation of hydrous iron oxides at the pyrite surface eventually outpaces acid generation and coats the pyrite surface, retarding the rate of pyrite oxidation. PMID:24214013

  7. Synthesis and Characterization of Hybrid Hyaluronic Acid-Gelatin Hydrogels

    PubMed Central

    Camci-Unal, Gulden; Cuttica, Davide; Annabi, Nasim; Demarchi, Danilo; Khademhosseini, Ali


    Biomimetic hybrid hydrogels have generated broad interest in tissue engineering and regenerative medicine. Hyaluronic acid (HA) and gelatin (hydrolyzed collagen) are naturally derived polymers and biodegradable under physiological conditions. Moreover, collagen and HA are major components of the extracellular matrix (ECM) in most of the tissues (e.g. cardiovascular, cartilage, neural). When used as a hybrid material, HA-gelatin hydrogels may enable mimicking the ECM of native tissues. Although HA-gelatin hybrid hydrogels are promising biomimetic substrates, their material properties have not been thoroughly characterized in the literature. Herein, we generated hybrid hydrogels with tunable physical and biological properties by using different concentrations of HA and gelatin. The physical properties of the fabricated hydrogels including swelling ratio, degradation, and mechanical properties were investigated. In addition, in vitro cellular responses in both two and three dimensional (2D and 3D) culture conditions were assessed. It was found that the addition of gelatin methacrylate (GelMA) into HA methacrylate (HAMA) promoted cell spreading in the hybrid hydogels. Moreover, the hybrid hydrogels showed significantly improved mechanical properties compared to their single component analogs. The HAMA-GelMA hydrogels exhibited remarkable tunability behavior and may be useful for cardiovascular tissue engineering applications. PMID:23419055

  8. Synthesis and characterization of hybrid hyaluronic acid-gelatin hydrogels.


    Camci-Unal, Gulden; Cuttica, Davide; Annabi, Nasim; Demarchi, Danilo; Khademhosseini, Ali


    Biomimetic hybrid hydrogels have generated broad interest in tissue engineering and regenerative medicine. Hyaluronic acid (HA) and gelatin (hydrolyzed collagen) are naturally derived polymers and biodegradable under physiological conditions. Moreover, collagen and HA are major components of the extracellular matrix (ECM) in most of the tissues (e.g., cardiovascular, cartilage, neural). When used as a hybrid material, HA-gelatin hydrogels may enable mimicking the ECM of native tissues. Although HA-gelatin hybrid hydrogels are promising biomimetic substrates, their material properties have not been thoroughly characterized in the literature. Herein, we generated hybrid hydrogels with tunable physical and biological properties by using different concentrations of HA and gelatin. The physical properties of the fabricated hydrogels including swelling ratio, degradation, and mechanical properties were investigated. In addition, in vitro cellular responses in both two and three-dimensional culture conditions were assessed. It was found that the addition of gelatin methacrylate (GelMA) into HA methacrylate (HAMA) promoted cell spreading in the hybrid hydogels. Moreover, the hybrid hydrogels showed significantly improved mechanical properties compared to their single component analogs. The HAMA-GelMA hydrogels exhibited remarkable tunability behavior and may be useful for cardiovascular tissue engineering applications. PMID:23419055

  9. Synthesis and characterization of europium- trimesic acid luminescent complex nanorods

    NASA Astrophysics Data System (ADS)

    Ren, Huijuan; Liu, Guixia; Song, Xinyuan; Hong, Guangyan; Cui, Zhenfeng


    Eu(III)-trimesic acid (TMA) luminescent complex Nanorods were synthesized in the polyvinylpyrrolidone matrix. The obtained sample was characterized by elemental analysis, Inductively Coupled Plasma-atomic emission spectroscopy(ICP-AES), X-ray diffraction(XRD), Fourier-transform Infrared spectroscopy(FT-IR), transmission electron microscopy(TEM) and photoluminescence spectra (PL). The results demonstrated that its chemical constitution is PVP/Eu(MTA) • 2H IIO. The XRD patterns show that the complex was a new kind of crystal whose structure is totally different with the ligand. TEM image indicated that the complex is nanocrystal with rod shape in one dimension, the size of rod diameter is about 50~100 nm, and the length ranges from hundred nanometer to a few micrometers, in addition, the dispersity is better. Photoluminescence analysis indicated that the complex emits Eu 3+ characteristic luminescence under ultraviolet excitation. TG-DTA curves indicated that the complex is heat stable under the temperature of 454°C. Therefore an thermal decomposition mechanism is: Eu(MTA) • 2H IIO->Eu(MTA)-> Eu IIO 3.

  10. Template-directed synthesis of oligoguanylic acids - Metal ion catalysis

    NASA Technical Reports Server (NTRS)

    Bridson, P. K.; Fakhrai, H.; Lohrmann, R.; Orgel, L. E.; Van Roode, M.


    The effects of Zn(2+), Pb(2+) and other metal ions on the efficiency and stereo-selectivity of the template-directed oligomerization of guanosine 5'-phosphorimidazolide are investigated. Reactions were run in the presence of a polyC template in a 2,6-lutidine buffer, and products analyzed by high-performance liquid chromatography on an RPC-5 column. The presence of the Pb(2+) ion is found to lead to the formation of 2'-5' linked oligomers up to the 40-mer, while Zn(2+) favors the formation of predominantly 3'-5' linked oligomers up to the 35-mer. When amounts of uracil, cytidine or adenosine 5'-phosphorimidazole equal to those of the guanosine derivative are included in the reaction mixture, the incorrect base is incorporated into the oligomer about 10% of the time with a Pb(2+) catalyst, but less than 0.5% of the time with Zn(2+). The Sn(2+), Sb(3+) and Bi(3+) ions are also found to promote the formation of 2'-5' oligomers, although not as effectively as Pb(2+), while no metal ions other than Zn(2+) promote the formation of the 3'-5' oligomers. The results may be important for the understanding of the evolution of nucleic acid replication in the absence of enzymes.

  11. Cardiac mitochondrial proteome dynamics with heavy water reveals stable rate of mitochondrial protein synthesis in heart failure despite decline in mitochondrial oxidative capacity.


    Shekar, Kadambari Chandra; Li, Ling; Dabkowski, Erinne R; Xu, Wenhong; Ribeiro, Rogerio Faustino; Hecker, Peter A; Recchia, Fabio A; Sadygov, Rovshan G; Willard, Belinda; Kasumov, Takhar; Stanley, William C


    We recently developed a method to measure mitochondrial proteome dynamics with heavy water ((2)H2O)-based metabolic labeling and high resolution mass spectrometry. We reported the half-lives and synthesis rates of several proteins in the two cardiac mitochondrial subpopulations, subsarcolemmal and interfibrillar (SSM and IFM), in Sprague Dawley rats. In the present study, we tested the hypothesis that the mitochondrial protein synthesis rate is reduced in heart failure, with possible differential changes in SSM versus IFM. Six to seven week old male Sprague Dawley rats underwent transverse aortic constriction (TAC) and developed moderate heart failure after 22weeks. Heart failure and sham rats of the same age received heavy water (5% in drinking water) for up to 80days. Cardiac SSM and IFM were isolated from both groups and the proteins were separated by 1D gel electrophoresis. Heart failure reduced protein content and increased the turnover rate of several proteins involved in fatty acid oxidation, electron transport chain and ATP synthesis, while it decreased the turnover of other proteins, including pyruvate dehydrogenase subunit in IFM, but not in SSM. Because of these bidirectional changes, the average overall half-life of proteins was not altered by heart failure in both SSM and IFM. The kinetic measurements of individual mitochondrial proteins presented in this study may contribute to a better understanding of the mechanisms responsible for mitochondrial alterations in the failing heart. PMID:24995939

  12. Direct synthesis of formic acid from carbon dioxide by hydrogenation in acidic media

    PubMed Central

    Moret, Séverine; Dyson, Paul J.; Laurenczy, Gábor


    The chemical transformation of carbon dioxide into useful products becomes increasingly important as CO2 levels in the atmosphere continue to rise as a consequence of human activities. In this article we describe the direct hydrogenation of CO2 into formic acid using a homogeneous ruthenium catalyst, in aqueous solution and in dimethyl sulphoxide (DMSO), without any additives. In water, at 40 °C, 0.2 M formic acid can be obtained under 200 bar, however, in DMSO the same catalyst affords 1.9 M formic acid. In both solvents the catalysts can be reused multiple times without a decrease in activity. Worldwide demand for formic acid continues to grow, especially in the context of a renewable energy hydrogen carrier, and its production from CO2 without base, via the direct catalytic carbon dioxide hydrogenation, is considerably more sustainable than the existing routes. PMID:24886955

  13. Chemical synthesis and enzymatic, stereoselective hydrolysis of a functionalized dihydropyrimidine for the synthesis of β-amino acids.


    Slomka, Christin; Zhong, Sabilla; Fellinger, Anna; Engel, Ulrike; Syldatk, Christoph; Bräse, Stefan; Rudat, Jens


    A novel substrate, 6-(4-nitrophenyl)dihydropyrimidine-2,4(1H,3H)-dione (pNO2PheDU), was chemically synthesized and analytically verified for the potential biocatalytic synthesis of enantiopure β-amino acids. The hydantoinase (EC from Arthrobacter crystallopoietes DSM20117 was chosen to prove the enzymatic hydrolysis of this substrate, since previous investigations showed activities of this enzyme toward 6-monosubstituted dihydrouracils. Whole cell biotransformations with recombinant Escherichia coli expressing the hydantoinase showed degradation of pNO2PheDU. Additionally, the corresponding N-carbamoyl-β-amino acid (NCarbpNO2 βPhe) was chemically synthesized, an HPLC-method with chiral stationary phases for detection of this product was established and thus (S)-enantioselectivity toward pNO2PheDU has been shown. Consequently this novel substrate is a potential precursor for the enantiopure β-amino acid para-nitro-β-phenylalanine (pNO2 βPhe). PMID:26705241

  14. Palladium-catalyzed synthesis of aromatic carboxylic acids with silacarboxylic acids.


    Friis, Stig D; Andersen, Thomas L; Skrydstrup, Troels


    Aryl iodides and bromides were easily converted to their corresponding aromatic carboxylic acids via a Pd-catalyzed carbonylation reaction using silacarboxylic acids as an in situ source of carbon monoxide. The reaction conditions were compatible with a wide range of functional groups, and with the aryl iodides, the carbonylation was complete within minutes. The method was adapted to the double and selective isotope labeling of tamibarotene. PMID:23441830

  15. Rates of various reactions catalyzed by ATP synthase as related to the mechanism of ATP synthesis

    SciTech Connect

    Berkich, D.A.; Williams, G.D.; Masiakos, P.T.; Smith, M.B.; Boyer, P.D.; LaNoue, K.F. )


    The forward and reverse rates of the overall reaction catalyzed by the ATP synthase in intact rat heart mitochondria, as measured with 32P, were compared with the rates of two partial steps, as measured with 18O. Such rates have been measured previously, but their relationship to one another has not been determined, nor have the partial reactions been measured in intact mitochondria. The partial steps measured were the rate of medium Pi formation from bound ATP (in state 4 this also equals the rate of medium Pi into bound ATP) and the rate of formation of bound ATP from bound Pi within the catalytic site. The rates of both partial reactions can be measured by 31P NMR analysis of the 18O distribution in Pi and ATP released from the enzyme during incubation of intact mitochondria with highly labeled (18O)Pi. Data were obtained in state 3 and 4 conditions with variation in substrate concentrations, temperature, and mitochondrial membrane electrical potential gradient (delta psi m). Although neither binding nor release of ATP is necessary for phosphate/H2O exchange, in state 4 the rate of incorporation of at least one water oxygen atom into phosphate is approximately twice the rate of the overall reaction rate under a variety of conditions. This can be explained if the release of Pi or ATP at one catalytic site does not occur, unless ATP or Pi is bound at another catalytic site. Such coupling provides strong support for the previously proposed alternating site mechanism. In state 3 slow reversal of ATP synthesis occurs within the mitochondrial matrix and can be detected as incorporation of water oxygen atoms into medium Pi even though medium (32P)ATP does not give rise to 32Pi in state 3. These data can be explained by lack of translocation of ATP from the medium to the mitochondrial matrix.

  16. Synthesis and structural characterisation of amides from picolinic acid and pyridine-2,6-dicarboxylic acid

    PubMed Central

    Devi, Prarthana; Barry, Sarah M.; Houlihan, Kate M.; Murphy, Michael J.; Turner, Peter; Jensen, Paul; Rutledge, Peter J.


    Coupling picolinic acid (pyridine-2-carboxylic acid) and pyridine-2,6-dicarboxylic acid with N-alkylanilines affords a range of mono- and bis-amides in good to moderate yields. These amides are of interest for potential applications in catalysis, coordination chemistry and molecular devices. The reaction of picolinic acid with thionyl chloride to generate the acid chloride in situ leads not only to the N-alkyl-N-phenylpicolinamides as expected but also the corresponding 4-chloro-N-alkyl-N-phenylpicolinamides in the one pot. The two products are readily separated by column chromatography. Chlorinated products are not observed from the corresponding reactions of pyridine-2,6-dicarboxylic acid. X-Ray crystal structures for six of these compounds are described. These structures reveal a general preference for cis amide geometry in which the aromatic groups (N-phenyl and pyridyl) are cis to each other and the pyridine nitrogen anti to the carbonyl oxygen. Variable temperature 1H NMR experiments provide a window on amide bond isomerisation in solution. PMID:25954918

  17. Thyroid hormone activation of retinoic acid synthesis in hypothalamic tanycytes

    PubMed Central

    Stoney, Patrick N.; Helfer, Gisela; Rodrigues, Diana; Morgan, Peter J.


    Thyroid hormone (TH) is essential for adult brain function and its actions include several key roles in the hypothalamus. Although TH controls gene expression via specific TH receptors of the nuclear receptor class, surprisingly few genes have been demonstrated to be directly regulated by TH in the hypothalamus, or the adult brain as a whole. This study explored the rapid induction by TH of retinaldehyde dehydrogenase 1 (Raldh1), encoding a retinoic acid (RA)‐synthesizing enzyme, as a gene specifically expressed in hypothalamic tanycytes, cells that mediate a number of actions of TH in the hypothalamus. The resulting increase in RA may then regulate gene expression via the RA receptors, also of the nuclear receptor class. In vivo exposure of the rat to TH led to a significant and rapid increase in hypothalamic Raldh1 within 4 hours. That this may lead to an in vivo increase in RA is suggested by the later induction by TH of the RA‐responsive gene Cyp26b1. To explore the actions of RA in the hypothalamus as a potential mediator of TH control of gene regulation, an ex vivo hypothalamic rat slice culture method was developed in which the Raldh1‐expressing tanycytes were maintained. These slice cultures confirmed that TH did not act on genes regulating energy balance but could induce Raldh1. RA has the potential to upregulate expression of genes involved in growth and appetite, Ghrh and Agrp. This regulation is acutely sensitive to epigenetic changes, as has been shown for TH action in vivo. These results indicate that sequential triggering of two nuclear receptor signalling systems has the capability to mediate some of the functions of TH in the hypothalamus. GLIA 2016;64:425–439 PMID:26527258

  18. Synthesis and anticancer activity of novel fluorinated asiatic acid derivatives.


    Gonçalves, Bruno M F; Salvador, Jorge A R; Marín, Silvia; Cascante, Marta


    A series of novel fluorinated Asiatic Acid (AA) derivatives were successfully synthesized, tested for their antiproliferative activity against HeLa and HT-29 cell lines, and their structure activity relationships were evaluated. The great majority of fluorinated derivatives showed stronger antiproliferative activity than AA in a concentration dependent manner. The most active compounds have a pentameric A-ring containing an α,β-unsaturated carbonyl group. The compounds with better cytotoxic activity were then evaluated against MCF-7, Jurkat, PC-3, A375, MIA PaCa-2 and BJ cell lines. Derivative 14 proved to be the most active compound among all tested derivatives and its mechanism of action was further investigated in HeLa cell line. The results showed that compound 14 induced cell cycle arrest in G0/G1 stage as a consequence of up-regulation of p21(cip1/waf1) and p27(kip1) and down-regulation of cyclin D3 and Cyclin E. Furthermore, compound 14 was found to induce caspase driven-apoptosis with activation of caspases-8 and caspase-3 and the cleavage of PARP. The cleavage of Bid into t-Bid, the up-regulation of Bax and the down-regulation of Bcl-2 were also observed after treatment of HeLa cells with compound 14. Taken together, these mechanistic studies revealed the involvement of extrinsic and intrinsic pathways in the apoptotic process induced by compound 14. Importantly, the antiproliferative activity of this compound on the non-tumor BJ human fibroblast cell line is weaker than in the tested cancer cell lines. The enhanced potency (between 45 and 90-fold more active than AA in a panel of cancer cell lines) and selectivity of this new AA derivative warrant further preclinical evaluation. PMID:26974379

  19. Effect of nitric acid concentrations on synthesis and stability of maghemite nanoparticles suspension.


    Nurdin, Irwan; Johan, Mohd Rafie; Yaacob, Iskandar Idris; Ang, Bee Chin


    Maghemite (γ-Fe2O3) nanoparticles have been synthesized using a chemical coprecipitation method at different nitric acid concentrations as an oxidizing agent. Characterization of all samples performed by several techniques including X-ray diffraction (XRD), transmission electron microscopy (TEM), alternating gradient magnetometry (AGM), thermogravimetric analysis (TGA), dynamic light scattering (DLS), and zeta potential. The XRD patterns confirmed that the particles were maghemite. The crystallite size of all samples decreases with the increasing concentration of nitric acid. TEM observation showed that the particles have spherical morphology with narrow particle size distribution. The particles showed superparamagnetic behavior with decreased magnetization values at the increasing concentration of nitric acid. TGA measurement showed that the stability temperature decreases with the increasing concentration of nitric acid. DLS measurement showed that the hydrodynamic particle sizes decrease with the increasing concentration of nitric acid. Zeta potential values show a decrease with the increasing concentration of nitric acid. The increasing concentration of nitric acid in synthesis of maghemite nanoparticles produced smaller size particles, lower magnetization, better thermal stability, and more stable maghemite nanoparticles suspension. PMID:24963510

  20. Effect of Nitric Acid Concentrations on Synthesis and Stability of Maghemite Nanoparticles Suspension

    PubMed Central

    Yaacob, Iskandar Idris


    Maghemite (γ-Fe2O3) nanoparticles have been synthesized using a chemical coprecipitation method at different nitric acid concentrations as an oxidizing agent. Characterization of all samples performed by several techniques including X-ray diffraction (XRD), transmission electron microscopy (TEM), alternating gradient magnetometry (AGM), thermogravimetric analysis (TGA), dynamic light scattering (DLS), and zeta potential. The XRD patterns confirmed that the particles were maghemite. The crystallite size of all samples decreases with the increasing concentration of nitric acid. TEM observation showed that the particles have spherical morphology with narrow particle size distribution. The particles showed superparamagnetic behavior with decreased magnetization values at the increasing concentration of nitric acid. TGA measurement showed that the stability temperature decreases with the increasing concentration of nitric acid. DLS measurement showed that the hydrodynamic particle sizes decrease with the increasing concentration of nitric acid. Zeta potential values show a decrease with the increasing concentration of nitric acid. The increasing concentration of nitric acid in synthesis of maghemite nanoparticles produced smaller size particles, lower magnetization, better thermal stability, and more stable maghemite nanoparticles suspension. PMID:24963510

  1. Effects of dietary amino acids, carbohydrates, and choline on neurotransmitter synthesis

    NASA Technical Reports Server (NTRS)

    Wurtman, Richard J.


    The ability of a meal to increase or decrease brain neurotransmitter synthesis has been studied. It is concluded that brain serotonin synthesis is directly controlled by the proportions of carbohydrate to protein in meals and snacks that increase or decrease brain tryptophan levels, thereby changing the substrate saturation of tryptophan hydroxylase and the rate of serotonin synthesis. The ability of serotoninergic neurons to have their output coupled to dietary macronutrients enables them to function as sensors of peripheral metabolism, and to subserve an important role in the control of appetite. The robust and selective responses of catecholaminergic and cholinergic neurons to supplemental tyrosine and choline suggest that these compounds may become useful as a new type of drug for treating deseases or conditions in which adequate quantities of the transmitter would otherwise be unavailable.

  2. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper.


    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo


    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  3. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper

    PubMed Central

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo


    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  4. Steroselective synthesis and application of L-( sup 15 N) amino acids

    SciTech Connect

    Unkefer, C.J. ); Lodwig, S.N. . Div. of Science)


    We have developed two general approaches to the stereoselective synthesis of {sup 15}N- and {sup 13}C-labeled amino acids. First, labeled serine, biosynthesized using the methylotrophic bacterium M. extorquens AM1, serves as a chiral precursor for the synthesis of other amino acids. For example, pyridoxal phosphate enzymes can be used for the conversion of L-({alpha}-{sup 15}N)serine to L-({alpha}-{sup 15}N)tyrosine, L-({alpha}-{sup 15}N)tryptophan, and L-({alpha}-{sup 15}N)cysteine. In the second approach, developed by Oppolzer and Tamura, an electrophilic amination'' reagent, 1-chloro-1-nitrosocyclohexane, was used to convert chiral enolates into L-{alpha}-amino acids. We prepared 1-chloro-1-({sup 15}N) nitrosocyclohexane and used it to aminate chiral enolates to produce L-({alpha}-{sup 15}N)amino acids. The stereoselectivity of this scheme using the Oppolzer sultam chiral auxiliary is remarkable, producing enantiomer ratios of 200 to 1. 22 refs., 4 figs.

  5. The effects of retinoic acid on immunoglobulin synthesis: Role of interleukin 6

    SciTech Connect

    Ballow, M.; Xiang, Shunan; Wang, Weiping; Brodsky, L. |


    Retinoic acid (RA) and its parent compound, retinol (ROH, vitamin A), have been recognized as important immunopotentiating agents. Previous studies from our laboratory have demonstrated that PA can augment formalin-treated Staphylococcus aureus (SAC) stimulated immunoglobulin (Ig) synthesis of cord blood mononuclear cells (CBMC). To determine the mechanism(s) by which RA modulates Ig synthesis, we studied the effects of RA on B cells and cytokine production. The addition of RA (10{sup -5} to 10{sup -10} M) to Epstein-Barr virus (EBV)-transformed B-cell clones derived from either adult or cord blood B cells augmented Ig secretion twofold. In contrast, cell proliferation was inhibited as measured by {sup 3}H-thymidine incorporation. We evaluated two cytokines known to be constitutively produced by EBV cell lines, IL-1 and IL-6. While RA had no effect on IL-1 production, IL-6 synthesis was greatly enhanced (20- to 45-fold), which was also reflected by an increase in steady-state mRNA levels for IL-6 but not TNF-{alpha} or TGF-{beta} on Northern blot analysis. Polyclonal rabbit anti-IL-6 antibodies were used to block the augmenting effects of RA on Ig synthesis of adenoidal B cells. RA-induced augmentation in IgG and IgA synthesis was blocked 58 and 29%, respectively, by anti-IL-6 antibodies. These studies suggest that the enhancing effects of RA on Ig synthesis are mediated, at least in part, by the autocrine or paracrine effects of IL-6 on B-cell differentiation. 37 refs., 5 figs.

  6. Flip-flop of oleic acid in a phospholipid membrane: rate and mechanism.


    Wei, Chenyu; Pohorille, Andrew


    Flip-flop of protonated oleic acid molecules dissolved at two different concentrations in membranes made of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine is studied with the aid of molecular dynamics simulations at a time scale of several microseconds. Direct, single-molecule flip-flop events are observed at this time scale, and the flip-flop rate is estimated at 0.2-0.3 μs(-1). As oleic acid molecules move toward the center of the bilayer during flip-flop, they undergo gradual, correlated translational, and rotational motion. Rare, double-flipping events of two hydrogen-bonded oleic acid molecules are also observed. A two-dimensional free energy surface is obtained for the translational and rotational degree of freedom of the oleic acid molecule, and the minimum energy path on this surface is determined. A barrier to flip-flop of ~4.2 kcal/mol is found at the center of the bilayer. A two-dimensional diffusion model is found to provide a good description of the flip-flop process. The fast flip-flop rate lends support to the proposal that fatty acids permeate membranes without assistance of transport proteins. It also suggests that desorption rather than flip-flop is the rate-limiting step in fatty acid transport through membranes. The relation of flip-flop rates to the evolution of ancestral cellular systems is discussed. PMID:25319959

  7. The single-biopsy approach in determining protein synthesis in human slow-turning-over tissue: use of flood-primed, continuous infusion of amino acid tracers.


    Holm, Lars; Reitelseder, Søren; Dideriksen, Kasper; Nielsen, Rie H; Bülow, Jacob; Kjaer, Michael


    Muscle protein synthesis (MPS) rate is determined conventionally by obtaining two or more tissue biopsies during a primed, continuous infusion of a stable isotopically labeled amino acid. The purpose of the present study was to test whether tracer priming given as a flooding dose, thereby securing an instantaneous labeling of the tissue pools of free tracee amino acids, followed by a continuous infusion of the same tracer to maintain tracer isotopic steady state, could be used to determine the MPS rate over a prolonged period of time by obtaining only a single tissue biopsy. We showed that the tracer from the flood prime appeared immediately in the muscle free pool of amino acids and that this abundance could be kept constant by a subsequent continuous infusion of the tracer. When using phenylalanine as tracer, the flood-primed, continuous infusion protocol does not stimulate the MPS rate per se. In conclusion, the flood-primed, continuous infusion protocol using phenylalanine as tracer can validly be used to measure the protein synthesis rate in human in vivo experiments by obtaining only a single tissue biopsy after a prolonged infusion period. PMID:24760987

  8. Synthesis of docosahexaenoic acid from eicosapentaenoic acid in retina neurons protects photoreceptors from oxidative stress.


    Simón, María Victoria; Agnolazza, Daniela L; German, Olga Lorena; Garelli, Andrés; Politi, Luis E; Agbaga, Martin-Paul; Anderson, Robert E; Rotstein, Nora P


    Oxidative stress is involved in activating photoreceptor death in several retinal degenerations. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in the retina, protects cultured retina photoreceptors from apoptosis induced by oxidative stress and promotes photoreceptor differentiation. Here, we investigated whether eicosapentaenoic acid (EPA), a metabolic precursor to DHA, had similar effects and whether retinal neurons could metabolize EPA to DHA. Adding EPA to rat retina neuronal cultures increased opsin expression and protected photoreceptors from apoptosis induced by the oxidants paraquat and hydrogen peroxide (H2 O2 ). Palmitic, oleic, and arachidonic acids had no protective effect, showing the specificity for DHA. We found that EPA supplementation significantly increased DHA percentage in retinal neurons, but not EPA percentage. Photoreceptors and glial cells expressed Δ6 desaturase (FADS2), which introduces the last double bond in DHA biosynthetic pathway. Pre-treatment of neuronal cultures with CP-24879 hydrochloride, a Δ5/Δ6 desaturase inhibitor, prevented EPA-induced increase in DHA percentage and completely blocked EPA protection and its effect on photoreceptor differentiation. These results suggest that EPA promoted photoreceptor differentiation and rescued photoreceptors from oxidative stress-induced apoptosis through its elongation and desaturation to DHA. Our data show, for the first time, that isolated retinal neurons can synthesize DHA in culture. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in retina photoreceptors, and its precursor, eicosapentaenoic acid (EPA) have multiple beneficial effects. Here, we show that retina neurons in vitro express the desaturase FADS2 and can synthesize DHA from EPA. Moreover, addition of EPA to these cultures protects photoreceptors from oxidative stress and promotes their differentiation through its metabolization to DHA. PMID:26662863

  9. Influence of fatty acid oxidation rate on glycerol release from cardiac myocytes

    SciTech Connect

    Larsen, T.S.; Severson, D.L.


    Quiescent cardiac myocytes are characterized by low rates of fatty acid oxidation due to the reduced energy demand compared with beating hearts. The accumulation of intracellular fatty acid metabolites may, therefore, result in feed-back inhibition of the cardiac lipase responsible for the mobilization of triacylglycerols (lipolysis). The objective of this study was to examine if interventions that increase fatty acid oxidation rates in myocytes have an effect on lipolysis. Addition of 100 dinitrophenol (DNP) to calcium-tolerant rat ventricular myocytes caused an increase in the rate of /sup 14/C-oleic acid oxidation from 1.11 +/- 0.06 to 2.38 +/- 0.17 nmol /sup 14/CO/sub 2//10/sup 6/ cells/min (115% stimulation; mean +/- S.D., n = 3). In parallel incubations, DNP increased the rate of lipolysis from 4.4 +/- 1.7 to 13.6 +/- 3.2 nmol glycerol/10/sup 6/ cells/30 min (215% stimulation). The addition of 1 mM barium to a modified Ringer's incubation medium produced an increase in the contractile activity of the myocytes, and increased the rates of oleic acid oxidation from 0.62 +/- 0.16 to 0.88 +/- 0.23 nmol/10/sup 6/ cells/min (42% stimulation; n = 6) and lipolysis from 13.1 +/- 6.5 to 22.2 +/- 6.4 nmol/10/sup 6/ cells/30 min (70% stimulation). These data show that stimulation of fatty acid oxidation in myocardial myocytes is accompanied by increased lipolytic rates, the latter probably due to release of feed-back inhibition of cardiac lipases by accumulated fatty acid metabolites.

  10. Synthesis of fluorescent D-amino acids (FDAAs) and their use for probing peptidoglycan synthesis and bacterial growth in situ

    PubMed Central

    Kuru, Erkin; Tekkam, Srinivas; Hall, Edward


    Fluorescent D-amino acids (FDAAs) are efficiently incorporated into the peptidoglycan of diverse bacterial species at the sites of active peptidoglycan biosynthesis, allowing specific and covalent probing of bacterial growth with minimal perturbation. Here, we provide a protocol for the synthesis of four FDAAs emitting light in blue, green or red and for their use in peptidoglycan labeling of live bacteria. Our modular synthesis protocol gives easy access to a library of different FDAAs made with commercially available fluorophores. FDAAs can be synthesized in a typical chemistry laboratory in 2–3 days. The simple labeling procedure involves addition of the FDAAs to the bacterial sample for the desired labeling duration and stopping further label incorporation by fixation or by washing away excess dye. We discuss several scenarios for the use of these labels including short or long labeling durations, and the combination of different labels in pure culture or complex environmental samples. Depending on the experiment, FDAA labeling can take as little as 30 s for a rapidly growing species such as Escherichia coli. PMID:25474031

  11. Formation of Amino Acid Thioesters for Prebiotic Peptide Synthesis: Catalysis By Amino Acid Products

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.; DeVincenzi, Donald L. (Technical Monitor)


    The origin of life can be described as a series of events in which a prebiotic chemical process came increasingly under the control of its catalytic products. In our search for this prebiotic process that yielded catalytic takeover products (such as polypeptides), we have been investigating a reaction system that generates peptide-forming amino acid thioesters from formaldehyde, glycolaldehyde, and ammonia in the presence of thiols. As shown below, this model process begins by aldol condensation of formaldehyde and glycolaldehyde to give trioses and releases. These sugars then undergo beta-dehydration yielding their respective alpha-ketoaldehydes. Addition of ammonia to the alpha-ketoaldehydes yields imines which can either: (a) rearrange in the presence of thesis to give amino acid thioesters or (be react with another molecule of aldehyde to give imidazoles. This 'one-pot' reaction system operates under mild aqueous conditions, and like modem amino acid biosynthesis, uses sugar intermediates which are converted to products by energy-yielding redox reactions. Recently, we discovered that amino acids, such as the alanine reaction product, catalyze the first and second steps of the process. In the presence of ammonia the process also generates other synthetically useful products, like the important biochemical -- pyruvic acid.

  12. The Synthesis of α,α-Disubstituted α-Amino Acids via Ichikawa Rearrangement.


    Szcześniak, Piotr; Pieczykolan, Michał; Stecko, Sebastian


    An approach to α,α-disubstituted α-amino acids is reported. The key step is allyl cyanate-to-isocyanate rearrangement. As demonstrated, the resultant allyl isocyanates can be directly trapped with various nucleophiles, for instance, alcohols, amines, and organometallic reagents, to provide a broad range of N-functionalized allylamines. The developed method has been successfully applied in the synthesis of two bioactive peptides: 2-aminoadamantane-2-carboxylic acid derived P2X7-evoked glutamate release inhibitor and 4-amino-tetrahydropyranyl-4-carboxylic acid derived dipeptide GSK-2793660, which is currently in clinical trials as cathepsin C inhibitor for the treatment of cystic fibrosis, noncystic fibrosis bronchiectasis, ANCA-associated vasculitis and bronchiectasis. PMID:26726732

  13. Hybrid Compounds Strategy in the Synthesis of Oleanolic Acid Skeleton-NSAID Derivatives.


    Pawełczyk, Anna; Olender, Dorota; Sowa-Kasprzak, Katarzyna; Zaprutko, Lucjusz


    The current study focuses on the synthesis of several hybrid individuals combining a natural oleanolic acid skeleton and synthetic nonsteroidal anti-inflammatory drug moieties (NSAIDs). It studied structural modifications of the oleanolic acid structure by use of the direct reactivity of hydroxyl or hydroxyimino groups at position C-3 of the triterpenoid skeleton with the carboxylic function of anti-inflammatory drugs leading to new perspective compounds with high potential pharmacological activities. Novel ester- and iminoester-type derivatives of oleanolic unit with the different NSAIDs, such as ibuprofen, aspirin, naproxen, and ketoprofen, were obtained and characterized. Moreover, preliminary research of compounds obtaining structure stability under acidic conditions was examined and the PASS method of prediction of activity spectra for substances was used to estimate the potential biological activity of these compounds. PMID:27077841

  14. Facile synthesis of PtAu alloy nanoparticles with high activity for formic acid oxidation

    SciTech Connect

    Zhang, Sheng; Shao, Yuyan; Yin, Geping; Lin, Yuehe


    We report the facile synthesis of carbon supported PtAu alloy nanoparticles with high electrocatalytic activity as the anode catalyst for direct formic acid fuel cells (DFAFCs). PtAu alloy nanopaticles are synthesized by co-reducing HAuCl4 and H2PtCl6 with NaBH4 in the presence of sodium citrate and then the nanoparticles are deposited on Vulcan XC-72R carbon support (PtAu/C). The obtained catalysts are characterized with X-ray diffraction (XRD) and transmission electron microscope (TEM), which reveal PtAu alloy formation with an average diameter of 4.6 nm. PtAu/C exhibits 8 times higher catalytic activity toward formic acid oxidation than Pt/C. The enhanced activity of PtAu/C catalyst is attributed to noncontinuous Pt sites formed in the presence of the neighbored Au sites, which promotes direct oxidation of formic acid by avoiding poison CO.

  15. Synthesis, characterization and biological activity of hydroxyl-bisphosphonic analogs of bile acids.


    Bortolini, Olga; Fantin, Giancarlo; Fogagnolo, Marco; Rossetti, Stefano; Maiuolo, Loredana; Di Pompo, Gemma; Avnet, Sofia; Granchi, Donatella


    Bisphosphonates (BPs) are now the most widely used drugs for diseases associated with increased bone resorption, such as osteoporosis, and tumor bone diseases. A significant drawback of the BPs is their poor oral absorption that is enhanced by the presence of bile acid substituents in the bisphosphonate framework, with no toxic effects. A straightforward synthesis of bile acid-containing hydroxy-bisphosphonates and a full characterization of these pharmaceutically important molecules, including an evaluation of affinity and the mechanism of binding to hydroxyapatite, is presented. The biological activity of bile acid-containing bisphosphonate salts was determined using the neutral-red assay on the L929 cell line and primary cultures of osteoclasts. The bioactivity of the new compounds was found superior than bisphosphonates of established activity. PMID:22483634

  16. Mechanism for differential sensitivity of the chromosome and growth cycles of mammalian cells to the rate of protein synthesis.

    PubMed Central

    Wu, R S; Bonner, W M


    It has been documented widely that when the generation times of eucaryotic cells are lengthened by slowing the rate of protein synthesis, the duration of the chromosome cycle (S, G2, and M phases) remains relatively invariant. Paradoxically, when the growth of exponentially growing cultures of CHO cells is partially inhibited with inhibitors of protein synthesis, the immediate effect is a proportionate reduction in the rate of total protein, histone protein, and DNA synthesis. However, on further investigation it was found that over the next 2 h the rates of histone protein and DNA synthesis recover, in some cases completely to the uninhibited rate, while the synthesis rates of other proteins do not recover. We called this process chromosome cycle compensation. The amount of compensation seen in CHO cell cultures can account quantitatively for the relative invariance in the length of the chromosome cycle (S, G2, and M phases) reported for these cells. The mechanism for this compensation involves a specific increase in the levels of histone mRNAs. An invariant chromosome cycle coupled with a lengthening growth cycle must result in a disproportionate lengthening of the G1 phase. Thus, these results suggest that chromosome cycle invariance may be due more to specific cellular compensation mechanisms rather than to the more usual interpretation involving a rate-limiting step for cell cycle progression in the G1 phase. Images PMID:3837839

  17. Synthesis of goethite in solutions of artificial seawater and amino acids: a prebiotic chemistry study

    NASA Astrophysics Data System (ADS)

    Carneiro, Cristine E. A.; Ivashita, Flávio F.; de Souza, Ivan Granemann; de Souza, Cláudio M. D.; Paesano, Andrea; da Costa, Antonio C. S.; di Mauro, Eduardo; de Santana, Henrique; Zaia, Cássia T. B. V.; Zaia, Dimas A. M.


    This study investigated the synthesis of goethite under conditions resembling those of the prebiotic Earth. The artificial seawater used contains all the major elements as well as amino acids (α-Ala, β-Ala, Gly, Cys, AIB) that could be found on the prebiotic Earth. The spectroscopic methods (FT-IR, EPR, Raman), scanning electron microscopy (SEM) and X-ray diffraction showed that in any condition Gly and Cys favoured the formation of goethite, artificial seawater plus β-Ala and distilled water plus AIB favoured the formation of hematite and for the other synthesis a mixture of goethite and hematite were obtained. Thus in general no protein amino acids (β-Ala, AIB) favoured the formation of hematite. As shown by surface enhanced Raman spectroscopy (SERS) spectra the interaction between Cys and Fe3+ of goethite is very complex, involving decomposition of Cys producing sulphur, as well as interaction of carboxylic group with Fe3+. SERS spectra also showed that amino/CN and C-CH3 groups of α-Ala are interacting with Fe3+ of goethite. For the other samples the shifting of several bands was observed. However, it was not possible to say which amino acid groups are interacting with Fe3+. The pH at point of zero charge of goethites increased with artificial seawater and decreased with amino acids. SEM images showed when only goethite was synthesized the images of the samples were acicular and when only hematite was synthesized the images of the samples were spherical. SEM images for the synthesis of goethite with Cys were spherical crystal aggregates with radiating acicular crystals. The highest resonance line intensities were obtained for the samples where only hematite was obtained. Electron paramagnetic resonance (EPR) and Mössbauer spectra showed for the synthesis of goethite with artificial seawater an isomorphic substitution of iron by seawater cations. Mössbauer spectra also showed that for the synthesis goethite in distilled water plus Gly only goethite was

  18. Synthesis of homo and hetero metal-phosphonate frameworks from bi-functional aminomethylphosphonic acid

    SciTech Connect

    Samanamu, Christian R.; Zamora, Elena Nicole; Montchamp, Jean-Luc; Richards, Anne F.


    The reaction between aminomethylphosphonic acid (ampa) and the metal salts of Zn, Cd, Hg, Pb, Ag, and Cu afforded seven metal-phosphonate polymers with unique structural features and includes the synthesis of a bimetallic metal-organic framework (Cu/Ag). The characterization of these metal phosphonates is reported by means of infrared spectroscopy, {sup 1}H-NMR, {sup 31}P-NMR, X-ray crystallography, energy dispersive X-ray (EDX), and thermogravimetric analysis (TGA). Individual structural features are compared based on the preferred coordination mode of ampa and the geometrical requirements for each metallic center that manipulates the structural motif. - Graphical abstract: The synthesis and characterization of polymeric metal phosphonates featuring zinc, cadmium, mercury, lead, and silver phosphonate are described from the reactions of the bi-funtional aminomethylphosphonic acid with the metal precursor in aqueous conditions. These previously undescribed polymers display unusual structural features and include the synthesis of a bimetallic metal-organic framework (Cu/Ag)

  19. Investigation of phospholipid synthesis and the disposition of amino acid and carbohydrate

    SciTech Connect

    Boehme, D.S.


    The synthesis of pulmonary phospholipids by offspring of diabetic female rats was assessed by means of high performance liquid chromatography combined with automated phosphate analysis. No changes in the pool sizes of the major phospholipids or their precursors were observed. However, offspring of both insulin-treated and untreated diabetic mothers displayed increased pulmonary lyso-phosphatidylcholine. The concentration of glycerylphosphorylcholine, the metabolic product of lyso-phosphatidylcholine, was also increased in these offspring, providing further evidence of a reduced reacylation pathway in the offspring of diabetic mothers. The concentration of phosphatidylglycerol was reduced in the lungs from offspring of diabetic mothers. Preliminary investigation suggested that the mechanism of insulin action on lungs from offspring of diabetic rats may be the diversion of substrate from lipid synthetic pathways into protein synthesis. The utilization of (14C)-labeled amino acids and carbohydrates by normal fetal rat lung, however, revealed no direct insulin effect on protein synthesis. The ability of the fetal lung to convert amino acids into Krebs Cycle intermediates was demonstrated.

  20. Total Synthesis of the Aristolochic Acids, Their Major Metabolites, and Related Compounds

    PubMed Central


    Plants from the Aristolochia genus have been recommended for the treatment of a variety of human ailments since the time of Hippocrates. However, many species produce the highly toxic aristolochic acids (AAs), which are both nephrotoxic and carcinogenic. For the purposes of extensive biological studies, a versatile approach to the synthesis of the AAs and their major metabolites was devised based primarily on a Suzuki–Miyaura coupling reaction. The key to success lies in the preparation of a common ring-A precursor, namely, the tetrahydropyranyl ether of 2-nitromethyl-3-iodo-4,5-methylendioxybenzyl alcohol (27), which was generated in excellent yield by oxidation of the aldoxime precursor 26. Suzuki–Miyaura coupling of 27 with a variety of benzaldehyde 2-boronates was accompanied by an aldol condensation/elimination reaction to give the desired phenanthrene intermediate directly. Deprotection of the benzyl alcohol followed by two sequential oxidation steps gave the desired phenanthrene nitrocarboxylic acids. This approach was used to synthesize AAs I–IV and several other related compounds, including AA I and AA II bearing an aminopropyloxy group at position-6, which were required for further conversion to fluorescent biological probes. Further successful application of the Suzuki–Miyaura coupling reaction to the synthesis of the N-hydroxyaristolactams of AA I and AA II then allowed the synthesis of the putative, but until now elusive, N-acetoxy- and N-sulfonyloxy-aristolactam metabolites. PMID:24877584