Energetics of amino acid synthesis in hydrothermal ecosystems

NASA Technical Reports Server (NTRS)

Amend, J. P.; Shock, E. L.

1998-01-01

Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

Amino Acid Synthesis in Photosynthesizing Spinach Cells: Effects of Ammonia on Pool Sizes and Rates of Labeling from 14CO 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Larsen, Peder Olesen; Cornwell, Karen L.; Gee, Sherry L.

1981-08-01

In this paper, isolated cells from leaves of Spinacia oleracea have been maintained in a state capable of high rates of photosynthetic CO 2 fixation for more than 60 hours. The incorporation of 14CO 2 under saturating CO 2 conditions into carbohydrates, carboxylic acids, and amino acids, and the effect of ammonia on this incorporation have been studied. Total incorporation, specific radioactivity, and pool size have been determined as a function of time for most of the protein amino acids and for γ-aminobutyric acid. The measurements of specific radio-activities and of the approaches to 14C “saturation” of some amino acidsmore » indicate the presence and relative sizes of metabolically active and passive pools of these amino acids. Added ammonia decreased carbon fixation into carbohydrates and increased fixation into carboxylic acids and amino acids. Different amino acids were, however, affected in different and highly specific ways. Ammonia caused large stimulatory effects in incorporation of 14C into glutamine (a factor of 21), aspartate, asparagine, valine, alanine, arginine, and histidine. No effect or slight decreases were seen in glycine, serine, phenylalanine, and tyrosine labeling. In the case of glutamate, 14C labeling decreased, but specific radioactivity increased. The production of labeled γ-aminobutyric acid was virtually stopped by ammonia. The results indicate that added ammonia stimulates the reactions mediated by pyruvate kinase and phosphoenolpyruvate carboxylase, as seen with other plant systems. Finally, the data on the effects of added ammonia on total labeling, pool sizes, and specific radioactivities of several amino acids provides a number of indications about the intracellular sites of principal synthesis from carbon skeletons of these amino acids and the selective nature of effects of increased intracellular ammonia concentration on such synthesis.« less

Effect of the quality of dietary amino acids composition on the urea synthesis in rats.

PubMed

Tujioka, Kazuyo; Ohsumi, Miho; Hayase, Kazutoshi; Yokogoshi, Hidehiko

2011-01-01

We have shown that urinary urea excretion increased in rats given a lower quality protein. The purpose of present study was to determine whether the composition of dietary amino acids affects urea synthesis. Experiments were done on three groups of rats given diets containing a 10% gluten amino acid mix diet or 10% casein amino acid mix diet or 10% whole egg protein amino acids mix diet for 10 d. The urinary excretion of urea, the liver concentration of N-acetylglutamate, and the liver concentration of free serine, glutamic acids and alanine were greater in the group given the amino acid mix diet of lower quality. The fractional and absolute rates of protein synthesis in tissues declined with a decrease in quality of dietary amino acids. The hepatic concentration of ornithine and the activities of hepatic urea-cycle enzymes were not related to the urea excretion. These results suggest that the increased concentrations of amino acids and N-acetylglutamate seen in the liver of rats given the amino acid mix diets of lower quality are likely among the factors stimulating urea synthesis. The protein synthesis in tissues is at least partly related to hepatic concentrations of amino acids. The composition of dietary amino acids is likely to be one of the factors regulating urea synthesis when the quality of dietary protein is manipulated.

Effects of Abscisic Acid and Ethylene on the Gibberellic Acid-Induced Synthesis of α-Amylase by Isolated Wheat Aleurone Layers 1

PubMed Central

Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.

1983-01-01

Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284

Quantitation of the rates of hepatic and intestinal cholesterol synthesis in lysosomal acid lipase-deficient mice before and during treatment with ezetimibe.

PubMed

Chuang, Jen-Chieh; Lopez, Adam M; Turley, Stephen D

2017-07-01

Esterified cholesterol (EC) and triglycerides, contained within lipoproteins taken up by cells, are hydrolysed by lysosomal acid lipase (LAL) in the late endosomal/lysosomal (E/L) compartment. The resulting unesterified cholesterol (UC) is transported via Niemann-Pick type C2 and C1 into the cytosolic compartment where it enters a putative pool of metabolically active cholesterol that is utilized in accordance with cellular needs. Loss-of-function mutations in LIPA, the gene encoding LAL, result in dramatic increases in tissue concentrations of EC, a hallmark feature of Wolman disease and cholesteryl ester storage disease (CESD). The lysosomal sequestration of EC causes cells to respond to a perceived deficit of sterol by increasing their rate of cholesterol synthesis, particularly in the liver. A similar compensatory response occurs with treatments that disrupt the enterohepatic movement of cholesterol or bile acids. Here we measured rates of cholesterol synthesis in vivo in the liver and small intestine of a mouse model for CESD given the cholesterol absorption inhibitor ezetimibe from weaning until early adulthood. Consistent with previous findings, this treatment significantly reduced the amount of EC sequestered in the liver (from 132.43±7.35 to 70.07±6.04mg/organ) and small intestine (from 2.78±0.21 to 1.34±0.09mg/organ) in the LAL-deficient mice even though their rates of hepatic and intestinal cholesterol synthesis were either comparable to, or exceeded those in matching untreated Lal -/- mice. These data reveal the role of intestinal cholesterol absorption in driving the expansion of tissue EC content and disease progression in LAL deficiency. Copyright © 2017 Elsevier Inc. All rights reserved.

Rate in template-directed polymer synthesis.

PubMed

Saito, Takuya

2014-06-01

We discuss the temporal efficiency of template-directed polymer synthesis, such as DNA replication and transcription, under a given template string. To weigh the synthesis speed and accuracy on the same scale, we propose a template-directed synthesis (TDS) rate, which contains an expression analogous to that for the Shannon entropy. Increasing the synthesis speed accelerates the TDS rate, but the TDS rate is lowered if the produced sequences are diversified. We apply the TDS rate to some production system models and investigate how the balance between the speed and the accuracy is affected by changes in the system conditions.

Synthesis of amino acids

DOEpatents

Davis, J.W. Jr.

1979-09-21

A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

Assessment of cardiac proteome dynamics with heavy water: slower protein synthesis rates in interfibrillar than subsarcolemmal mitochondria

PubMed Central

Dabkowski, Erinne R.; Shekar, Kadambari Chandra; Li, Ling; Ribeiro, Rogerio F.; Walsh, Kenneth; Previs, Stephen F.; Sadygov, Rovshan G.; Willard, Belinda; Stanley, William C.

2013-01-01

Traditional proteomics provides static assessment of protein content, but not synthetic rates. Recently, proteome dynamics with heavy water (2H2O) was introduced, where 2H labels amino acids that are incorporated into proteins, and the synthesis rate of individual proteins is calculated using mass isotopomer distribution analysis. We refine this approach with a novel algorithm and rigorous selection criteria that improve the accuracy and precision of the calculation of synthesis rates and use it to measure protein kinetics in spatially distinct cardiac mitochondrial subpopulations. Subsarcolemmal mitochondria (SSM) and interfibrillar mitochondria (IFM) were isolated from adult rats, which were given 2H2O in the drinking water for up to 60 days. Plasma 2H2O and myocardial 2H-enrichment of amino acids were stable throughout the experimental protocol. Multiple tryptic peptides were identified from 28 proteins in both SSM and IFM and showed a time-dependent increase in heavy mass isotopomers that was consistent within a given protein. Mitochondrial protein synthesis was relatively slow (average half-life of 30 days, 2.4% per day). Although the synthesis rates for individual proteins were correlated between IFM and SSM (R2 = 0.84; P < 0.0001), values in IFM were 15% less than SSM (P < 0.001). In conclusion, administration of 2H2O results in stable enrichment of the cardiac precursor amino acid pool, with the use of refined analytical and computational methods coupled with cell fractionation one can measure synthesis rates for cardiac proteins in subcellular compartments in vivo, and protein synthesis is slower in mitochondria located among the myofibrils than in the subsarcolemmal region. PMID:23457012

Amino acids augment muscle protein synthesis in neonatal pigs during acute endotoxemia by stimulating mTOR-dependent translation initiation

USDA-ARS?s Scientific Manuscript database

In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...

Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

PubMed

Awasthi, Neeraj Praphulla; Singh, R P

2007-01-01

Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

[Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

PubMed

Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

2016-03-01

Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

PubMed

Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

2014-09-01

Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

ERIC Educational Resources Information Center

Simmonds, Richard J.

1987-01-01

Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.

PubMed

Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko

2016-09-01

Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

ERIC Educational Resources Information Center

Forster, Denis; DeKleva, Thomas W.

1986-01-01

Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

Exogenous fatty acids affect CDP-choline pathway to increase phosphatidylcholine synthesis in granular pneumocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chander, A.; Gullo, J.; Reicherter, J.

1987-05-01

Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased onlymore » by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.« less

Fed levels of amino acids are required for the somatotropin-induced increase in muscle protein synthesis.

PubMed

Wilson, Fiona A; Suryawan, Agus; Orellana, Renán A; Nguyen, Hanh V; Jeyapalan, Asumthia S; Gazzaneo, Maria C; Davis, Teresa A

2008-10-01

Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 microg x kg(-1) x day(-1)) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P<0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P<0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1.eIF4E complex association, and increased active eIF4E.eIF4G complex formation (P<0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex.

Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid

NASA Technical Reports Server (NTRS)

Nakashima, T.; Fox, S. W.

1980-01-01

The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.

Synthesis of alpha-amino acids

DOEpatents

Davis, Jr., Jefferson W.

1983-01-01

A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

Synthesis of alpha-amino acids

DOEpatents

Davis, Jr., Jefferson W.

1983-01-01

A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.

PubMed

Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M

2012-03-27

In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages. © 2012 American Chemical Society

Acidolysis and glyceride synthesis reactions using fatty acids with two Pseudomonas lipases having different substrate specificities.

PubMed

Kojima, Yuzo; Sakuradani, Eiji; Shimizu, Sakayu

2006-09-01

Enzymatic acidolysis and glyceride synthesis using polyunsaturated fatty acids (PUFAs) with lipases from Pseudomonas fluorescens HU380 (HU-lipase), P. fluorescens AK102 (AK-lipase), and Candida rugosa (CR-lipase) were studied. The acidolysis of triolein with eicosapentaenoic acid (EPA) or docosahexaenoic acid (DHA) in n-hexane was evaluated with lipases immobilized on Celite 545. HU-lipase showed the highest incorporation rate at a low temperature (10 degrees C) with either EPA or DHA as the acyl donor, and the rate decreased with increasing reaction temperature. At 45 degrees C, the rates for EPA and DHA were 7.1 and 0.5 relative to those at 10 degrees C, respectively. The EPA incorporation rate was even higher at a low temperature (10 degrees C), and the DHA incorporation rate increased with decreasing temperature. Although AK-lipase showed the reverse tendency for incorporation rate, the DHA incorporation rate increased with increasing reaction temperature with both PUFAs. HU-lipase reacted well with PUFAs such as DHA, EPA, arachidonic acid (AA), mead acid (MA), and dihomo-gamma-linolenic acid (DGLA) on acidolysis and glyceride synthesis. The reactivities of AK-lipase toward these PUFAs except for DGLA, i.e., MA, AA, EPA, and DHA, were low for both reactions. The unique substrate specificities of the lipases from the Pseudomonas strains will enable us to use these lipases for the modification of fats and oils containing PUFAs such as fish oil.

Synthesis of new kojic acid based unnatural α-amino acid derivatives.

PubMed

Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Uma Devi, P; Behera, Manoranjan

2015-11-01

An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond. Copyright © 2015 Elsevier Ltd. All rights reserved.

Effect of Thymine Starvation on Messenger Ribonucleic Acid Synthesis in Escherichia coli

PubMed Central

Luzzati, Denise

1966-01-01

Luzzati, Denise (Institut de Biologie Physico-Chimique, Paris, France). Effect of thymine starvation on messenger ribonucleic acid synthesis in Escherichia coli. J. Bacteriol. 92:1435–1446. 1966.—During the course of thymine starvation, the rate of synthesis of messenger ribonucleic acid (mRNA, the rapidly labeled fraction of the RNA which decays in the presence of dinitrophenol or which hybridizes with deoxyribonucleic acid) decreases exponentially, in parallel with the viability of the thymine-starved bacteria. The ability of cell-free extracts of starved bacteria to incorporate ribonucleoside triphosphates into RNA was determined; it was found to be inferior to that of extracts from control cells. The analysis of the properties of cell-free extracts of starved cells shows that their decreased RNA polymerase activity is the consequence of a modification of their deoxyribonucleic acid, the ability of which to serve as a template for RNA polymerase decreases during starvation. PMID:5332402

Synthesis of medium-chain fatty acids and their incorporation into triacylglycerols by cell-free fractions from Cuphea embryos.

PubMed

Deerberg, S; von Twickel, J; Förster, H H; Cole, T; Fuhrmann, J; Heise, K P

1990-02-01

During their rapid maturation period, seeds of Cuphea wrightii A. Gray mainly accumulate medium-chain fatty acids (C8 to C14) in their storage lipids. The rate of lipid deposition (40-50 mg·d(-1)·(g fresh weight)(-1)) is fourfold higher than in seeds of Cuphea racemosa (L. f.) Spreng, which accumulate long-chain fatty acids (C16 to C18). Measurements of the key enzymes of fatty-acid synthesis in cell-free extracts of seeds of different maturities from Cuphea wrightii show that malonyl-CoA synthesis may be a triggering factor for the observed high capacity for fatty-acid synthesis. Experiments on the incorporation of [1-(14)C]acetate into fatty acids by purified plastid preparations from embryos of Cuphea wrightii have demonstrated that the biosynthesis of medium-chain fatty acids (C8 to C14) is localized in the plastid. Thus, in the presence of cofactors for lipid synthesis (ATP, NADPH, NADH, acyl carrier protein, and sn-glycerol-3-phosphate), purified plastid fractions predominantly synthesized free fatty acids, 30% of which were of medium chain length. Transesterification of the freshly synthesized fatty acids to coenzyme A and recombination with the microsomal fraction of the embryo homogenate induced triacylglycerol synthesis. It also stimulated fatty-acid synthesis by a factor 2-3 and increased the relative amount of medium-chain fatty acids bound to triacylglycerols, which corresponded to about 60-80% in this lipid fraction.

Rewiring protein synthesis: From natural to synthetic amino acids.

PubMed

Fan, Yongqiang; Evans, Christopher R; Ling, Jiqiang

2017-11-01

The protein synthesis machinery uses 22 natural amino acids as building blocks that faithfully decode the genetic information. Such fidelity is controlled at multiple steps and can be compromised in nature and in the laboratory to rewire protein synthesis with natural and synthetic amino acids. This review summarizes the major quality control mechanisms during protein synthesis, including aminoacyl-tRNA synthetases, elongation factors, and the ribosome. We will discuss evolution and engineering of such components that allow incorporation of natural and synthetic amino acids at positions that deviate from the standard genetic code. The protein synthesis machinery is highly selective, yet not fixed, for the correct amino acids that match the mRNA codons. Ambiguous translation of a codon with multiple amino acids or complete reassignment of a codon with a synthetic amino acid diversifies the proteome. Expanding the genetic code with synthetic amino acids through rewiring protein synthesis has broad applications in synthetic biology and chemical biology. Biochemical, structural, and genetic studies of the translational quality control mechanisms are not only crucial to understand the physiological role of translational fidelity and evolution of the genetic code, but also enable us to better design biological parts to expand the proteomes of synthetic organisms. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.

Transaminases for the synthesis of enantiopure beta-amino acids

PubMed Central

2012-01-01

Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122

Genetics Home Reference: congenital bile acid synthesis defect type 1

MedlinePlus

... type 1 Congenital bile acid synthesis defect type 1 Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 1 ...

Synthesis of alpha-amino acids

DOEpatents

Davis, J.W. Jr.

1983-01-25

A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

Antimycobacterial action of thiolactomycin: an inhibitor of fatty acid and mycolic acid synthesis.

PubMed Central

Slayden, R A; Lee, R E; Armour, J W; Cooper, A M; Orme, I M; Brennan, P J; Besra, G S

1996-01-01

Thiolactomycin (TLM) possesses in vivo antimycobacterial activity against the saprophytic strain Mycobacterium smegmatis mc2155 and the virulent strain M. tuberculosis Erdman, resulting in complete inhibition of growth on solid media at 75 and 25 micrograms/ml, respectively. Use of an in vitro murine macrophage model also demonstrated the killing of viable intracellular M. tuberculosis in a dose-dependent manner. Through the use of in vivo [1,2-14C]acetate labeling of M. smegmatis, TLM was shown to inhibit the synthesis of both fatty acids and mycolic acids. However, synthesis of the shorter-chain alpha'-mycolates of M. smegmatis was not inhibited by TLM, whereas synthesis of the characteristic longer-chain alpha-mycolates and epoxymycolates was almost completely inhibited at 75 micrograms/ml. The use of M. smegmatis cell extracts demonstrated that TLM specifically inhibited the mycobacterial acyl carrier protein-dependent type II fatty acid synthase (FAS-II) but not the multifunctional type I fatty acid synthase (FAS-I). In addition, selective inhibition of long-chain mycolate synthesis by TLM was demonstrated in a dose-response manner in purified, cell wall-containing extracts of M. smegmatis cells. The in vivo and in vitro data and knowledge of the mechanism of TLM resistance in Escherichia coli suggest that two distinct TLM targets exist in mycobacteria, the beta-ketoacyl-acyl carrier protein synthases involved in FAS-II and the elongation steps leading to the synthesis of the alpha-mycolates and oxygenated mycolates. The efficacy of TLM against M. smegmatis and M. tuberculosis provides the prospects of identifying fatty acid and mycolic acid biosynthetic genes and revealing a novel range of chemotherapeutic agents directed against M. tuberculosis. PMID:9124847

Morphokinetic Reaction of Cells of Streptococcus faecalis (ATCC 9790) to Specific Inhibition of Macromolecular Synthesis: Dependence of Mesosome Growth on Deoxyribonucleic Acid Synthesis

PubMed Central

Higgins, Michael L.; Daneo-Moore, Lolita

1972-01-01

The application of quantitative electron microscopy to thin sections of cells of Streptococcus faecalis specifically inhibited for deoxyribonucleic acid (DNA), ribonucleic acid, and protein synthesis shows that septal mesosomes (i) increase in size when protein synthesis is inhibited by at least 80% while DNA synthesis proceeds at no less than 50% of the control rate and (ii) decrease in size when DNA synthesis is inhibited 50% or more during the initial 10 min of treatment. This indicates that fluctuations in mesosome size are dependent on the extent of DNA synthesis. The fluctuations in mesosome areas observed on treatment do not correlate with the kinetics of glycerol incorporation per milliliter of a culture. However, when glycerol incorporation is placed on a per cell basis, a strong correlation is observed between increases in (i) the thickness of the electron-transparent layer of the cytoplasmic membrane and (ii) the amount of glycerol incorporated per cell. It seems that the electron-transparent membrane layer may thicken to accommodate changes in lipid content when protein and lipid synthesis are uncoupled. Images PMID:4110926

Kinetics of Nucleic Acid Synthesis in Human Embryonic Kidney Cultures Infected with Adenovirus 2 or 12: Inhibition of Cellular Deoxyribonucleic Acid Synthesis

PubMed Central

Ledinko, Nada; Fong, Caroline K. Y.

1969-01-01

Infection of human embryonic kidney (HEK) cell cultures with adenovirus types 2 or 12 resulted in an initial drop in the rate of incorporation of 3H-thymidine into deoxyribonucleic acid (DNA) during the early latent period of virus growth, followed by a marked rise in label uptake. It was shown by cesium chloride isopycnic centrifugation that, after adenovirus 2 infection, there was a decrease in the rate of incorporation of thymidine into cellular DNA. Moreover, DNA-DNA hybridization experiments revealed that, by 28 to 32 hr after infection with either adenovirus 2 or 12, the amount of isolated pulse-labeled DNA capable of hybridizing with HEK cell DNA was reduced by approximately 60 to 70%. Autoradiographic measurements showed that the inhibition of cellular DNA synthesis was due to a decrease in the ability of an infected cell to synthesize DNA. The adenovirus-induced inhibition of host cell DNA synthesis was not due to degradation of cellular DNA. 3H-thymidine incorporated into cellular DNA at the time of infection remained acid-precipitable, and labeled material was not incorporated into viral DNA. Furthermore, when zone sedimentation through neutral or alkaline sucrose density gradients was employed, no detectable change was observed in the sedimentation rate of this cellular DNA at various times after infection with adenovirus 2 or 12. In addition, there was no increase in deoxyribonuclease activity in cells infected with either virus. Cultures infected for 38 hr with adenovirus 2 or 12 incorporated three to four times as much 3H-uridine into ribonucleic acid (RNA) as did non-infected cultures. Furthermore, the net RNA synthesized by infected cultures substantially exceeded that of control cultures. The activity of thymidine kinase was induced, but there was no stimulation of uridine kinase. PMID:5806981

An efficient synthesis of tetramic acid derivatives with extended conjugation from L-Ascorbic Acid

PubMed Central

Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P

2006-01-01

Background Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L- ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. Results 5,6-O-Isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. Conclusion An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance. PMID:17147830

An efficient synthesis of tetramic acid derivatives with extended conjugation from L-ascorbic acid.

PubMed

Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P

2006-12-06

Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L-ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. 5,6-O-isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance.

Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

1989-04-01

We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that inmore » control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.« less

Choroidal retinoic acid synthesis: a possible mediator between refractive error and compensatory eye growth.

PubMed

Mertz, J R; Wallman, J

2000-04-01

Research over the past two decades has shown that the growth of young eyes is guided by vision. If near- or far-sightedness is artificially imposed by spectacle lenses, eyes of primates and chicks compensate by changing their rate of elongation, thereby growing back to the pre-lens optical condition. Little is known about what chemical signals might mediate between visual effects on the retina and alterations of eye growth. We present five findings that point to choroidal retinoic acid possibly being such a mediator. First, the chick choroid can convert retinol into all-trans-retinoic acid at the rate of 11 +/- 3 pmoles mg protein(-1) hr(-1), compared to 1.3 +/- 0.3 for retina/RPE and no conversion for sclera. Second, those visual conditions that cause increased rates of ocular elongation (diffusers or negative lens wear) produce a sharp decrease in all-trans-retinoic acid synthesis to levels barely detectable with our assay. In contrast, visual conditions which result in decreased rates of ocular elongation (recovery from diffusers or positive lens wear) produce a four- to five-fold increase in the formation of all-trans-retinoic acid. Third, the choroidal retinoic acid is found bound to a 28-32 kD protein. Fourth, a large fraction of the choroidal retinoic acid synthesized in culture is found in a nucleus-enriched fraction of sclera. Finally, application of retinoic acid to cultured sclera at physiological concentrations produced an inhibition of proteoglycan production (as assessed by measuring sulfate incorporation) with a EC50 of 8 x 10(-7) M. These results show that the synthesis of choroidal retinoic acid is modulated by those visual manipulations that influence ocular elongation and that this retinoic acid may reach the sclera in concentrations adequate to modulate scleral proteoglycan formation.

Exchanging partially hydrogenated fat for palmitic acid in the diet increases LDL-cholesterol and endogenous cholesterol synthesis in normocholesterolemic women.

PubMed

Sundram, Kalyana; French, Margaret A; Clandinin, M Thomas

2003-08-01

Partial hydrogenation of oil results in fats containing unusual isomeric fatty acids characterized by cis and trans configurations. Hydrogenated fats containing trans fatty acids increase plasma total cholesterol (TC) and LDL-cholesterol while depressing HDL-cholesterol levels. Identifying the content of trans fatty acids by food labeling is overshadowed by a reluctance of health authorities to label saturates and trans fatty acids separately. Thus, it is pertinent to compare the effects of trans to saturated fatty acids using stable isotope methodology to establish if the mechanism of increase in TC and LDL-cholesterol is due to the increase in the rate of endogenous synthesis of cholesterol. Ten healthy normocholesterolemic female subjects consumed each of two diets containing approximately 30% of energy as fat for a fourweek period. One diet was high in palmitic acid (10.6% of energy) from palm olein and the other diet exchanged 5.6% of energy as partially hydrogenated fat for palmitic acid. This fat blend resulted in monounsaturated fatty acids decreasing by 4.9 % and polyunsaturated fats increasing by 2.7%. The hydrogenated fat diet treatment provided 3.1% of energy as elaidic acid. For each dietary treatment, the fractional synthesis rates for cholesterol were measured using deuterium-labeling procedures and blood samples were obtained for blood lipid and lipoprotein measurements. Subjects exhibited a higher total cholesterol and LDL-cholesterol level when consuming the diet containing trans fatty acids while also depressing the HDL-cholesterol level. Consuming the partially hydrogenated fat diet treatment increased the fractional synthesis rate of free cholesterol. Consumption of hydrogenated fats containing trans fatty acids in comparison to a mixtur e of palmitic and oleic acids increase plasma cholesterol levels apparently by increasing endogenous synthesis of cholesterol.

Synthesis and properties of fatty acid starch esters.

PubMed

Winkler, Henning; Vorwerg, Waltraud; Wetzel, Hendrik

2013-10-15

Being completely bio-based, fatty acid starch esters (FASEs) are attractive materials that represent an alternative to crude oil-based plastics. In this study, two synthesis methods were compared in terms of their efficiency, toxicity and, especially, product solubility with starch laurate (C12) as model compound. Laurates (DS>2) were obtained through transesterification of fatty acid vinylesters in DMSO or reaction with fatty acid chlorides in pyridine. The latter lead to higher DS-values in a shorter reaction time. But due to the much better solubility of the products compared to lauroyl chloride esterified ones, vinylester-transesterification was preferred to optimize reaction parameters, where reaction time could be shortened to 2h. FASEs C6-C18 were also successfully prepared via transesterification. To determine the DS of the resulting starch laurates, the efficient ATR-IR method was compared with common methods (elementary analysis, (1)H NMR). Molar masses (Mw) of the highly soluble starch laurates were analyzed using SEC-MALLS (THF). High recovery rates (>80%) attest to the outstanding solubility of products obtained through transesterification, caused by a slight disintegration during synthesis. Particle size distributions (DLS) demonstrated stable dissolutions in CHCl3 of vinyl laurate esterified - contrary to lauroyl chloride esterified starch. For all highly soluble FASEs (C6-C18), formation of concentrated solutions (10 wt%) is feasible. Copyright © 2013 Elsevier Ltd. All rights reserved.

Fed levels of amino acids are required for the somatotropin-induced increase in muscle protein synthesis

PubMed Central

Wilson, Fiona A.; Suryawan, Agus; Orellana, Renán A.; Nguyen, Hanh V.; Jeyapalan, Asumthia S.; Gazzaneo, Maria C.; Davis, Teresa A.

2008-01-01

Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 μg·kg−1·day−1) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P < 0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P < 0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1·eIF4E complex association, and increased active eIF4E·eIF4G complex formation (P < 0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex. PMID:18682537

Effect of tannic acid on the synthesis of protein and nucleic acid by rat liver

PubMed Central

Badawy, A. A.-B.; White, Audrey E.; Lathe, G. H.

1969-01-01

1. As early as 1hr. after the intraperitoneal administration of tannic acid to rats, it could be demonstrated in the liver. At 3hr. the nuclear fraction contained the largest amount of tannic acid. 2. Nuclear RNA synthesis was inhibited in vivo 2hr. after the administration of tannic acid. Induction by cortisol of tryptophan pyrrolase was 90% inhibited at 24hr. 3. Incorporation of [1-14C]leucine into protein by liver slices from treated rats was decreased by 50% after 24hr. Its incorporation into postmitochondrial supernatant from treated animals was not inhibited. Incorporation into slices and postmitochondrial supernatants were inhibited in vitro by tannic acid. 4. The sequence of events: concentration of tannic acid in nuclei, inhibition of nuclear RNA synthesis, inhibition of protein synthesis and production of necrosis, is discussed. PMID:5808319

Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles

NASA Astrophysics Data System (ADS)

Berti, Lorenzo; Burley, Glenn A.

2008-02-01

Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.

The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

NASA Technical Reports Server (NTRS)

Morowitz, Harold; Peterson, Eta; Chang, Sherwood

1995-01-01

This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

Glutamate dehydrogenase (RocG) in Bacillus licheniformis WX-02: Enzymatic properties and specific functions in glutamic acid synthesis for poly-γ-glutamic acid production.

PubMed

Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen

2017-04-01

Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis. Copyright © 2017 Elsevier Inc. All rights reserved.

Kinetics of photoirradiation-induced synthesis of soy oil-conjugated linoleic acid isomers.

PubMed

Jain, Vishal P; Proctor, Andrew

2007-02-07

Photoirradiation of soy oil with UV/visible light has been shown to produce significant amounts of trans,trans conjugated linoleic acid (CLA) isomers through conversion of various synthesized intermediate cis,trans isomers. The objective of this study was to determine the kinetics of CLA isomers synthesis to better understand the production of various isomers. Soy oil was irradiated with UV/visible light for 144 h in the presence of an iodine catalyst and CLA isomers analyzed by gas chromatography (GC). Arrhenius plots were developed for the conversion of soy oil linoleic acid (A) to form cis-, trans/trans-, cis-CLA (B), conversion of cis-, trans/trans-, cis-CLA to form trans,trans-CLA (C) with respect to B, and formation of trans,trans-CLA isomers with respect to C. The kinetics of consumption of linoleic acid (LA) to form cis-, trans/trans-, cis-CLA was found to be of second-order with a rate constant of 9.01 x 10-7 L/mol s. The rate of formation of cis-, trans/trans-, cis-CLA isomers depends on the rate of formation from LA and its rate of consumption to form trans,trans-CLA isomers. The conversion of cis-, trans/trans-, cis-CLA isomers to trans,trans-CLA isomers was found to be of first-order with a rate constant of 2.75 x 10-6 s-1. However, the formation of thermodynamically stable trans,trans-CLA isomers (C) with respect to C was found to be a zero-order reaction with a rate constant of 10.66 x 10-7 mol/L s. The consumption of LA was found to be the rate-determining step in the CLA isomers formation reaction mechanism. The findings provide a better understanding of the mechanism of CLA isomers synthesis by photoirradiation and the factors controlling the ratio of various isomers.

Sensitivity of whole body protein synthesis to amino acid administration during short-term bed rest.

PubMed

Biolo, Gianni; Ciocchi, Beniamino; Lebenstedt, Marion; Heer, Martina; Guarnieri, Gianfranco

2002-07-01

We tested the hypothesis that a reduced stimulation of whole-body protein synthesis by amino acid administration represents a major mechanism for the bed rest-induced loss of lean body mass. Healthy young subjects and matched controls were studied on the last day of a 14-day bed rest or ambulatory period, as part of the overall protocol "Short-term Bed Rest - Integrated Physiology" set up by the German Aerospace Centre (DLR) in co-operation with the European Space Agency. A balanced mixture of essential and non-essential amino acids was intravenously infused in the postabsorptive state for 3 hours at the rate of 0.1 g/kg/hour. The oxidative and non-oxidative (i.e., to protein synthesis) disposal of the infused leucine was determined by stable isotope and mass spectrometry techniques. The clearance of total infused amino acids tended to be greater (P=0.07) in the ambulatory group than in the bed rest group. When leucine clearance was partitioned between its oxidative and non-oxidative (i.e., to protein synthesis) components, the results indicated that the oxidative disposal was not statistically different in the bed rest and in the ambulatory groups. In contrast, the non-oxidative leucine disposal (i.e., to protein synthesis) was about 20% greater (P<0.01) in the ambulatory group than in the bed rest group. In conclusion, these preliminary data suggest that 14-day bed rest impairs the ability to utilise exogenous amino acids for protein synthesis.

The spark discharge synthesis of amino acids from various hydrocarbons

NASA Technical Reports Server (NTRS)

Ring, D.; Miller, S. L.

1984-01-01

The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

Influence of branched-chain amino acid composition of culture media on the synthesis of plasma proteins by serum-free cultured rat hepatocytes.

PubMed

Montoya, A; Gómez-Lechón, M J; Castell, J V

1989-04-01

Supplementation of Ham's F12 culture medium with essential amino acids (EAA) up to the rat plasma levels increased the rates of synthesis of albumin and transferrin by cultured rat hepatocytes by 1.3 and 1.7, respectively. Fifty percent of this increase could be attributed to three of the EAA: the branched-chain amino acids (BCAA: Leu Ile and Val). Non-branched-chain essential amino acids (non-BC-EAA) stimulated only 25% of the increase produced by the whole EAA mixture. When each EAA was tested individually, none of them caused an appreciable increase in albumin and transferrin in culture medium. When the concentrations of all EAA were raised to rat postprandial portal levels, albumin and transferrin synthesis rates reached a maximum, increasing by 3.2 and 3.5, respectively. Supplementation with BCAA at postprandial portal concentrations increased albumin and transferrin synthesis rates by 2.2 and 2.0, respectively, and had no noteworthy effect on the synthesis of cellular proteins. Non-BC-EAA at their postprandial portal concentrations increased albumin and transferrin synthesis rates by 1.7 and 1.9, respectively. Supplementation with alanine to reach a nitrogen content equal to that of the modified EAA-enriched medium had no stimulatory effect. Our results show that EAA have a specific effect on the synthesis of plasma proteins by cultured hepatocytes, and that BCAA at physiologic concentrations account for the major part of this stimulatory effect. Consequently, EAA and particularly BCAA concentration should be elevated in serum-free nutrient media to sustain maximum plasma protein synthesis.

Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.

PubMed

Matsuno, Koya; Fujimura, Tatsuhito

2014-03-01

A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Synthesis of alpha-amino acids

DOEpatents

Davis, Jr., Jefferson W.

1983-01-01

A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?

PubMed Central

Parsons, Joshua B.; Rock, Charles O.

2011-01-01

The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391

A Key Role for Lipoic Acid Synthesis During Plasmodium Liver stage Development

PubMed Central

Falkard, Brie; Santha Kumar, T. R.; Hecht, Leonie-Sophie; Matthews, Krista A.; Henrich, Philipp P.; Gulati, Sonia; Lewis, Rebecca E.; Manary, Micah J.; Winzeler, Elizabeth A.; Sinnis, Photini; Prigge, Sean T.; Heussler, Volker; Deschermeier, Christina; Fidock, David

2013-01-01

SUMMARY The successful navigation of malaria parasites through their life cycle, which alternates between vertebrate hosts and mosquito vectors, requires a complex interplay of metabolite synthesis and salvage pathways. Using the rodent parasite Plasmodium berghei, we have explored the synthesis and scavenging pathways for lipoic acid, a short-chain fatty acid derivative that regulates the activity of α-ketoacid dehydrogenases including pyruvate dehydrogenase. In Plasmodium, lipoic acid is either synthesized de novo in the apicoplast or is scavenged from the host into the mitochondrion. Our data show that sporozoites lacking the apicoplast lipoic acid protein ligase LipB are markedly attenuated in their infectivity for mice, and in vitro studies document a very late liver stage arrest shortly before the final phase of intra-hepatic parasite maturation. LipB-deficient asexual blood stage parasites show unimpaired rates of growth in normal in vitro or in vivo conditions. However, these parasites showed reduced growth in lipid-restricted conditions induced by treatment with the lipoic acid analog 8-bromo-octanoate or with the lipid-reducing agent clofibrate. This finding has implications for understanding Plasmodium pathogenesis in malnourished children that bear the brunt of malarial disease. This study also highlights the potential of exploiting lipid metabolism pathways for the design of genetically attenuated sporozoite vaccines. PMID:23490300

Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

PubMed Central

Cronan, John E.

2014-01-01

Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

Distribution, industrial applications, and enzymatic synthesis of D-amino acids.

PubMed

Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang

2015-04-01

D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.

Synthesis of Phenolics and Flavonoids in Ginger (Zingiber officinale Roscoe) and Their Effects on Photosynthesis Rate

PubMed Central

Ghasemzadeh, Ali; Jaafar, Hawa Z. E.; Rahmat, Asmah

2010-01-01

The relationship between phenolics and flavonoids synthesis/accumulation and photosynthesis rate was investigated for two Malaysian ginger (Zingiber officinale) varieties grown under four levels of glasshouse light intensity, namely 310, 460, 630 and 790 μmol m−2s−1. High performance liquid chromatography (HPLC) was employed to identify and quantify the polyphenolic components. The results of HPLC analysis indicated that synthesis and partitioning of quercetin, rutin, catechin, epicatechin and naringenin were high in plants grown under 310 μmol m−2s−1. The average value of flavonoids synthesis in leaves for both varieties increased (Halia Bentong 26.1%; Halia Bara 19.5%) when light intensity decreased. Photosynthetic rate and plant biomass increased in both varieties with increasing light intensity. More specifically, a high photosynthesis rate (12.25 μmol CO2 m−2s−1 in Halia Bara) and plant biomass (79.47 g in Halia Bentong) were observed at 790 μmol m−2s−1. Furthermore, plants with the lowest rate of photosynthesis had highest flavonoids content. Previous studies have shown that quercetin inhibits and salicylic acid induces the electron transport rate in photosynthesis photosystems. In the current study, quercetin was an abundant flavonoid in both ginger varieties. Moreover, higher concentration of quercetin (1.12 mg/g dry weight) was found in Halia Bara leaves grown under 310 μmol m−2s−1 with a low photosynthesis rate. Furthermore, a high content of salicylic acid (0.673 mg/g dry weight) was detected in Halia Bara leaves exposed under 790 μmol m−2s−1 with a high photosynthesis rate. No salicylic acid was detected in gingers grown under 310 μmol m−2s−1. Ginger is a semi-shade loving plant that does not require high light intensity for photosynthesis. Different photosynthesis rates at different light intensities may be related to the absence or presence of some flavonoid and phenolic compounds. PMID:21151455

Age-related changes in cyclic phosphatidic acid-induced hyaluronic acid synthesis in human fibroblasts.

PubMed

Sano, Katsura; Gotoh, Mari; Dodo, Kyoko; Tajima, Noriaki; Shimizu, Yoshibumi; Murakami-Murofushi, Kimiko

2018-01-01

Hyaluronic acid is a major component of the extracellular matrix, which is important for skin hydration. As aging brings skin dehydration, we aimed to clarify the mRNA expression of hyaluronic acid-related proteins in human skin fibroblasts from donors of various ages (range 0.7-69 years). Previously, we reported that cyclic phosphatidic acid (cPA), a unique phospholipid mediator, stimulated the expression of HAS2 and increased hyaluronic acid synthesis in human skin fibroblasts (donor age: 3 days). In this study, we measured the mRNA expression of hyaluronic acid-related proteins: hyaluronan synthase (HAS) 1-3, hyaluronidase-1, -2, and hyaluronic acid-binding protein (versican). In addition, we tested whether cPA could increase hyaluronic acid synthesis in skin fibroblasts derived from donors of various ages. The expression of HAS1, 3, hyaluronidase-1, and -2 did not change with aging. However, the mRNA expression of versican decreased with aging. Although it is thought that the amount of hyaluronic acid in the dermis decreases with aging, the mRNA expression of HAS2 was increased. But the amount of hyaluronic acid secreted by fibroblasts did not increase with aging. This suggests that the activity and/or protein expression of HAS2 decrease with aging. Furthermore, we observed that cPA caused the increase of hyaluronic acid synthesis at any age, and this effect was increased with aging. These results suggest that aging made the fibroblasts more sensitive to cPA treatment. Therefore, cPA represents a suitable candidate for the health maintenance and improvement of the skin by increasing the level of hyaluronic acid in the dermis.

Derivatives of diphosphonic acids: synthesis and biological activity

NASA Astrophysics Data System (ADS)

Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.

1993-07-01

The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.

Parenteral amino acids increase albumin and skeletal muscle protein fractional synthetic rates in premature newborn minipigs.

PubMed

Hellstern, Gerald; Kaempf-Rotzoll, Daisy; Linderkamp, Otwin; Langhans, Klaus-Dieter; Rating, Dietz

2002-09-01

Early administration of parenteral amino acids increases whole body nitrogen retention in premature infants. Tracer kinetic studies suggest an increase in whole body protein synthesis as a possible mechanism for this increase in nitrogen retention. However, the effect of early parenteral amino acids on synthesis of specific proteins remains uncertain. Using premature newborn minipigs as a model for human premature newborns, we investigated the effects of parenterally administered amino acids on albumin and skeletal muscle protein fractional synthetic rates. Fifteen Yucatan minipigs were delivered by cesarean section 6 days before the mean expected delivery date (day 106 of gestation; expected gestation, 111-113 days) and randomized to two groups immediately after birth: 7 piglets received a mixture of amino acids (0.4 g. kg. h ) and glucose (0.8 g. kg. h ) for 5 hours, and 8 piglets (control group) received glucose only. All piglets received a continuous primed infusion of 1-[ C]valine. Arterial plasma free C-valine enrichment was measured by gas chromatography/mass spectrometry, and protein synthetic rates were determined by measuring incorporation of C-valine into albumin and skeletal muscle protein using gas chromatography/combustion/isotope ratio mass spectrometry. Administration of amino acids increased albumin (87.0% +/- 42.1% [mean +/- SD] vs. 37.6% +/- 6.8% per 24 hours; < 0.05) and skeletal muscle fractional synthetic rates (11.60% +/- 6.9% vs. 6.5% +/- 1.5% per 24 hours; < 0.05). We conclude that parenteral amino acids increase albumin and skeletal muscle fractional synthetic rates in premature piglets on the first day of life.

Regulation of vascular prostaglandin synthesis by metabolites of arachidonic acid in perfused rabbit aorta.

PubMed Central

Kent, R S; Diedrich, S L; Whorton, A R

1983-01-01

To address the hypothesis that metabolites of arachidonic acid are important regulators of prostaglandin (PG) synthesis in intact vascular tissue, we studied arachidonate metabolism in rabbit aortas in response to a continuous infusion of arachidonic acid, 10 micrograms/ml. Prostacyclin (PGI2; measured as 6-keto-PGF1 alpha) production rate accelerated during the first 2 min, reached peak velocity at 2 min, and then progressively decelerated. The velocity profile of PGI2 production was similar to that previously reported for cyclooxygenase holoenzyme assayed in vitro, and was consistent with progressive inactivation of the enzymes leading to PGI2 synthesis. We determined the specific inhibition of cyclooxygenase and prostacyclin synthetase by measuring PGI2 and PGE2 production rates and by infusing cyclic endoperoxides. Our results indicate preferential inactivation of cyclooxygenase during arachidonate metabolism, most likely due to cyclooxygenase-derived oxidative intermediates. This was a dose-dependent response and resulted in a progressive decrease in the 6-keto-PGF1 alpha/PGE2 ratio. Exogenously added 15-hydroperoxy eicosatetraenoic acid, on the other hand, actually stimulated cyclooxygenase activity at low doses, while markedly inhibiting prostacyclin synthetase. This finding, along with the accelerating nature of arachidonate metabolism, is consistent with the concept of "peroxide tone" as a mediator of cyclooxygenase activity in this system. These results demonstrate that arachidonate metabolites regulate PG synthesis in intact blood vessels. The progressive enzymatic inhibition intrinsic to arachidonate metabolism may be a model for similar changes occurring in states of enhanced lipid peroxidation. These metabolic alterations might greatly influence the numerous vascular functions known to involve arachidonic acid metabolism. PMID:6409932

Quantifying protein synthesis and degradation in Arabidopsis by dynamic 13CO2 labeling and analysis of enrichment in individual amino acids in their free pools and in protein.

PubMed

Ishihara, Hirofumi; Obata, Toshihiro; Sulpice, Ronan; Fernie, Alisdair R; Stitt, Mark

2015-05-01

Protein synthesis and degradation represent substantial costs during plant growth. To obtain a quantitative measure of the rate of protein synthesis and degradation, we supplied (13)CO2 to intact Arabidopsis (Arabidopsis thaliana) Columbia-0 plants and analyzed enrichment in free amino acids and in amino acid residues in protein during a 24-h pulse and 4-d chase. While many free amino acids labeled slowly and incompletely, alanine showed a rapid rise in enrichment in the pulse and a decrease in the chase. Enrichment in free alanine was used to correct enrichment in alanine residues in protein and calculate the rate of protein synthesis. The latter was compared with the relative growth rate to estimate the rate of protein degradation. The relative growth rate was estimated from sequential determination of fresh weight, sequential images of rosette area, and labeling of glucose in the cell wall. In an 8-h photoperiod, protein synthesis and cell wall synthesis were 3-fold faster in the day than at night, protein degradation was slow (3%-4% d(-1)), and flux to growth and degradation resulted in a protein half-life of 3.5 d. In the starchless phosphoglucomutase mutant at night, protein synthesis was further decreased and protein degradation increased, while cell wall synthesis was totally inhibited, quantitatively accounting for the inhibition of growth in this mutant. We also investigated the rates of protein synthesis and degradation during leaf development, during growth at high temperature, and compared synthesis rates of Rubisco large and small subunits of in the light and dark. © 2015 American Society of Plant Biologists. All Rights Reserved.

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

PubMed

Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

2016-04-01

Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans.

Abiotic synthesis of fatty acids

NASA Technical Reports Server (NTRS)

Leach, W. W.; Nooner, D. W.; Oro, J.

1978-01-01

The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

Effects of exogenous fatty acids and inhibition of de novo fatty acid synthesis on disaturated phosphatidylcholine production by fetal lung cells and adult type II cells.

PubMed

Maniscalco, W M; Finkelstein, J N; Parkhurst, A B

1989-05-01

De novo fatty acid synthesis may be an important source of saturated fatty acids for fetal lung disaturated phosphatidylcholine (DSPC) production. To investigate the roles of de novo fatty acid synthesis and exogenous fatty acids, we incubated dispersed fetal lung cells and freshly isolated adult type II cells with exogenous palmitate and oleate and measured DSPC synthesis. Unlike adult type II cells, fetal lung cells did not increase DSPC synthesis when exogenous palmitate was available; adult type II cells increased DSPC synthesis by 70% in the presence of palmitate. Exogenous oleate decreased DSPC synthesis by 48% in fetal cells but not in adult type II cells. Incubation of fetal lung cells with TOFA [2-furancarboxylate, 5-(tetradecyloxy)-sodium], a metabolic inhibitor of fatty acid synthesis, decreased fatty acid synthesis by 65%. There was a simultaneous 56% inhibition of DSPC production, but no effect on protein, DNA, or glyceride-glycerol production, measured by precursor incorporation. The inhibition of DSPC synthesis associated with TOFA was partially prevented by exogenous palmitate but not oleate. Fetal cells prepared from explants that had been cultured in dexamethasone also had TOFA-associated inhibition of DSPC synthesis that was similar to non-dexamethasone-exposed cells. These studies suggest that under baseline conditions of low fatty acid availability, such as in the fetus, de novo fatty acid synthesis in fetal cells, but not in adult type II cells, provides sufficient saturated fatty acids to support maximal DSPC production. Inhibition of de novo fatty acid synthesis resulting in decreased DSPC production in fetal lung cells in conditions of low fatty acid availability suggests that fatty acid synthesis may be central to maintain DSPC synthesis in the fetus.

Guanosine 3'-diphosphate 5'-diphosphate is not required for growth rate-dependent control of rRNA synthesis in Escherichia coli.

PubMed Central

Gaal, T; Gourse, R L

1990-01-01

rRNA synthesis in Escherichia coli is subject to at least two regulation systems, growth rate-dependent control and stringent control. The inverse correlation between rRNA synthesis rates and guanosine 3'-diphosphate 5'-diphosphate (ppGpp) levels under various physiological conditions has led to the supposition that ppGpp is the mediator of both control mechanisms by inhibiting transcription from rrn P1 promoters. Recently, relA- spoT- strains have been constructed in which both ppGpp synthesis pathways most likely have been removed (M. Cashel, personal communication). We have confirmed that such strains produce no detectable ppGpp and therefore offer a direct means for testing the involvement of ppGpp in the regulation of rRNA synthesis in vivo. Stringent control was determined by measurement of rRNA synthesis after amino acid starvation, while growth rate control was determined by measurement of rRNA synthesis under different nutritional conditions. As expected, the relA- spoT- strain is relaxed for stringent control. However, growth rate-dependent regulation is unimpaired. These results indicate that growth rate regulation can occur in the absence of ppGpp and imply that ppGpp is not the mediator, or at least is not the sole mediator, of growth rate-dependent control. Therefore, growth rate-dependent control and stringent control may utilize different mechanisms for regulating stable RNA synthesis. PMID:2196571

Synthesis, characterization and application of lipase-conjugated citric acid-coated magnetic nanoparticles for ester synthesis using waste frying oil.

PubMed

Patel, Unisha; Chauhan, Kishor; Gupte, Shilpa

2018-04-01

In the present work, magnetic nanoparticles (MNPs) were prepared by chemical precipitation of trivalent and divalent iron ions which were functionalized using citric acid. The bacterial isolate Staphylococcus epidermidis KX781317 was isolated from oil-contaminated site. The isolate produced lipase, which was purified and immobilized on magnetic nanoparticles (MNPs) for ester synthesis from waste frying oil (WFO). The characterization of MNPs employed conventional TEM, XRD and FTIR techniques. TEM analysis of MNPs showed the particle size in the range of 20-50 nm. FTIR spectra revealed the binding of citric acid to Fe 3 O 4 and lipase on citric acid-coated MNPs. The citric acid-coated MNPs and lipase-conjugated citric acid-coated MNPs had similar XRD patterns which indicate MNPs could preserve their magnetic properties. The maximum immobilization efficiency 98.21% of lipase-containing citric acid-coated MNPs was observed at ratio 10:1 of Cit-MNPs:lipase. The pH and temperature optima for lipase conjugated with Cit-MNPs were 7 and 35 °C, respectively. Isobutanol was found to be an effective solvent for ester synthesis and 1:2 ratio of oil:alcohol observed significant for ester formation. The ester formation was determined using TLC and the % yield of ester conversion was calculated. The rate of ester formation is directly proportional to the enzyme load. Formed esters were identified as isobutyl laurate ester and isobutyl myristate ester through GC-MS analysis.

Enzymatic routes for the synthesis of ursodeoxycholic acid.

PubMed

Eggert, Thorsten; Bakonyi, Daniel; Hummel, Werner

2014-12-10

Ursodeoxycholic acid, a secondary bile acid, is used as a drug for the treatment of various liver diseases, the optimal dose comprises the range of 8-10mg/kg/day. For industrial syntheses, the structural complexity of this bile acid requires the use of an appropriate starting material as well as the application of regio- and enantio-selective enzymes for its derivatization. Most strategies for the synthesis start from cholic acid or chenodeoxycholic acid. The latter requires the conversion of the hydroxyl group at C-7 from α- into β-position in order to obtain ursodeoxycholic acid. Cholic acid on the other hand does not only require the same epimerization reaction at C-7 but the removal of the hydroxyl group at C-12 as well. There are several bacterial regio- and enantio-selective hydroxysteroid dehydrogenases (HSDHs) to carry out the desired reactions, for example 7α-HSDHs from strains of Clostridium, Bacteroides or Xanthomonas, 7β-HSDHs from Clostridium, Collinsella, or Ruminococcus, or 12α-HSDH from Clostridium or from Eggerthella. However, all these bioconversion reactions need additional steps for the regeneration of the coenzymes. Selected multi-step reaction systems for the synthesis of ursodeoxycholic acid are presented in this review. Copyright © 2014 Elsevier B.V. All rights reserved.

Plasma L-5-oxoproline kinetics and whole blood glutathione synthesis rates in severely burned adult humans.

PubMed

Yu, Yong-Ming; Ryan, Colleen M; Fei, Zhe-Wei; Lu, Xiao-Ming; Castillo, Leticia; Schultz, John T; Tompkins, Ronald G; Young, Vernon R

2002-02-01

Compromised glutathione homeostasis is associated with increased morbidity in various disease states. We evaluated the kinetics of L-5-oxoproline, an intermediate in the gamma-glutamyl cycle of glutathione production, in fourteen severely burned adults by use of a primed, constant intravenous infusion of L-5-[1-(13)C]oxoproline. In nine of these patients, whole blood glutathione synthesis and plasma kinetics of glycine and leucine were also measured with [(15)N]glycine and L-[(2)H(3)]leucine tracers. Patients were studied under a "basal" condition that provided a low dose of glucose and total parenteral nutrition. For comparison with control subjects, whole blood glutathione synthesis was estimated in six healthy adults. Burn patients in a basal condition showed significantly higher rates of plasma oxoproline clearance and urinary D- and L-oxoproline excretion compared with fasting healthy control subjects. Whole blood glutathione concentration and absolute synthesis rate in the basal state were lower than for control subjects. Total parenteral feeding without cysteine but with generous methionine did not affect oxoproline kinetics or whole blood glutathione synthesis. The estimated rate of glycine de novo synthesis was also lower in burn patients, suggesting a possible change in glycine availability for glutathione synthesis. The roles of precursor amino acid availability, as well as alterations in metabolic capacity, in modulating whole blood glutathione production in burns now require investigation.

Quantifying Protein Synthesis and Degradation in Arabidopsis by Dynamic 13CO2 Labeling and Analysis of Enrichment in Individual Amino Acids in Their Free Pools and in Protein1[OPEN

PubMed Central

Fernie, Alisdair R.; Stitt, Mark

2015-01-01

Protein synthesis and degradation represent substantial costs during plant growth. To obtain a quantitative measure of the rate of protein synthesis and degradation, we supplied 13CO2 to intact Arabidopsis (Arabidopsis thaliana) Columbia-0 plants and analyzed enrichment in free amino acids and in amino acid residues in protein during a 24-h pulse and 4-d chase. While many free amino acids labeled slowly and incompletely, alanine showed a rapid rise in enrichment in the pulse and a decrease in the chase. Enrichment in free alanine was used to correct enrichment in alanine residues in protein and calculate the rate of protein synthesis. The latter was compared with the relative growth rate to estimate the rate of protein degradation. The relative growth rate was estimated from sequential determination of fresh weight, sequential images of rosette area, and labeling of glucose in the cell wall. In an 8-h photoperiod, protein synthesis and cell wall synthesis were 3-fold faster in the day than at night, protein degradation was slow (3%–4% d−1), and flux to growth and degradation resulted in a protein half-life of 3.5 d. In the starchless phosphoglucomutase mutant at night, protein synthesis was further decreased and protein degradation increased, while cell wall synthesis was totally inhibited, quantitatively accounting for the inhibition of growth in this mutant. We also investigated the rates of protein synthesis and degradation during leaf development, during growth at high temperature, and compared synthesis rates of Rubisco large and small subunits of in the light and dark. PMID:25810096

Inhibition of fatty acid synthesis in isolated adipocytes by 5-(tetradecyloxy)-2-furoic acid.

PubMed

Halvorson, D L; McCune, S A

1984-11-01

The compound 5-(tetradecyloxy)-2-furoic acid (TOFA), a hypolipidemic agent, inhibits fatty acid synthesis, lactate and pyruvate accumulation and CO2 release in isolated rat adipocytes. TOFA stimulates the accumulation of citrate. ATP levels are not lowered by TOFA. In comparison with the natural fatty acid, oleate, TOFA exhibited a much greater inhibitory effect on lipogenesis. TOFyl-CoA formation within intact adipocytes was demonstrated. Although not inhibited by TOFA, acetyl-CoA carboxylase is inhibited by TOFyl-CoA. It is proposed that many of the metabolic effects of TOFA in isolated adipocytes can be explained by TOFyl-CoA inhibition of acetyl-CoA carboxylase. TOFA inhibits glycolysis as a secondary event with the primary event of inhibition of fatty acid synthesis causing an accumulation of citrate which is an inhibitor of phosphofructokinase.

Glutamic Acid as Enhancer of Protein Synthesis Kinetics in Hepatocytes from Old Rats.

PubMed

Brodsky, V Y; Malchenko, L A; Butorina, N N; Lazarev Konchenko, D S; Zvezdina, N D; Dubovaya, T K

2017-08-01

Dense cultures of hepatocytes from old rats (~2 years old, body weight 530-610 g) are different from similar cultures of hepatocytes from young rats by the low amplitude of protein synthesis rhythm. Addition of glutamic acid (0.2, 0.4, or 0.6 mg/ml) into the culture medium with hepatocytes of old rats resulted in increase in the oscillation amplitudes of the protein synthesis rhythm to the level of young rats. A similar action of glutamic acid on the protein synthesis kinetics was observed in vivo after feeding old rats with glutamic acid. Inhibition of metabotropic receptors of glutamic acid with α-methyl-4-carboxyphenylglycine (0.01 mg/ml) abolished the effect of glutamic acid. The amplitude of oscillation of the protein synthesis rhythm in a cell population characterizes synchronization of individual oscillations caused by direct cell-cell communications. Hence, glutamic acid, acting as a receptor-dependent transmitter, enhanced direct cell-cell communications of hepatocytes that were decreased with aging. As differentiated from other known membrane signaling factors (gangliosides, norepinephrine, serotonin, dopamine), glutamic acid can penetrate into the brain and thus influence the communications and protein synthesis kinetics that are disturbed with aging not only in hepatocytes, but also in neurons.

Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

PubMed

Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

2016-08-01

Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.

Stereoselective synthesis of conformationally constrained omega-amino acid analogues from pyroglutamic acid.

PubMed

Bentz, Emilie L; Goswami, Rajesh; Moloney, Mark G; Westaway, Susan M

2005-08-07

Bicyclic lactams derived from pyroglutamic acid provide a useful scaffold for synthesis of conformationally restricted analogues of lysine, ornithine and glutamine, as well as an Ala-Ala dipeptide analogue. Amino alcohol and carboxylic acid derivatives are accessible from a common intermediate. In this strategy, the bicyclic lactam system not only controls, but also facilitates the determination of the stereochemistry of the synthetic intermediates.

Ribonucleic Acid Synthesis and Glutamate Excretion in Escherichia coli

PubMed Central

Broda, Paul

1968-01-01

Cultures of Escherichia coli excreted glutamate into the medium when protein synthesis was blocked in RCrel strains or when it was blocked with chloramphenicol in either RCstr or RCrel strains. Both of these conditions resulted in continued ribonucleic acid (RNA) synthesis in the absence of protein synthesis. Glutamate was also excreted by both RCstr and RCrel strains when RNA synthesis was inhibited by uracil starvation or by treatment with actinomycin D. It is proposed that, in each of these cases, glutamate excretion resulted from an increase in the permeability of the cell membrane. PMID:4973126

A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.

PubMed

Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L

2015-04-01

The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.

Synthesis and chirality of amino acids under interstellar conditions.

PubMed

Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

2013-01-01

Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.

Arginine depletion by arginine deiminase does not affect whole protein metabolism or muscle fractional protein synthesis rate in mice.

PubMed

Marini, Juan C; Didelija, Inka Cajo

2015-01-01

Due to the absolute need for arginine that certain cancer cells have, arginine depletion is a therapy in clinical trials to treat several types of cancers. Arginine is an amino acids utilized not only as a precursor for other important molecules, but also for protein synthesis. Because arginine depletion can potentially exacerbate the progressive loss of body weight, and especially lean body mass, in cancer patients we determined the effect of arginine depletion by pegylated arginine deiminase (ADI-PEG 20) on whole body protein synthesis and fractional protein synthesis rate in multiple tissues of mice. ADI-PEG 20 successfully depleted circulating arginine (<1 μmol/L), and increased citrulline concentration more than tenfold. Body weight and body composition, however, were not affected by ADI-PEG 20. Despite the depletion of arginine, whole body protein synthesis and breakdown were maintained in the ADI-PEG 20 treated mice. The fractional protein synthesis rate of muscle was also not affected by arginine depletion. Most tissues (liver, kidney, spleen, heart, lungs, stomach, small and large intestine, pancreas) were able to maintain their fractional protein synthesis rate; however, the fractional protein synthesis rate of brain, thymus and testicles was reduced due to the ADI-PEG 20 treatment. Furthermore, these results were confirmed by the incorporation of ureido [14C]citrulline, which indicate the local conversion into arginine, into protein. In conclusion, the intracellular recycling pathway of citrulline is able to provide enough arginine to maintain protein synthesis rate and prevent the loss of lean body mass and body weight.

Salicylic acid derivatives: synthesis, features and usage as therapeutic tools.

PubMed

Ekinci, Deniz; Sentürk, Murat; Küfrevioğlu, Ömer İrfan

2011-12-01

In the field of medicinal chemistry, there is a growing interest in the use of small molecules. Although acetyl salicylic acid is well known for medical applications, little is known about other salicylic acid derivatives, and there is serious lack of data and information on the effects and biological evaluation that connect them. This review covers the synthesis and drug potencies of salicylic acid derivatives. After a brief overview of the information on salicylic acid and its features, a detailed review of salicylic acids as drugs and prodrugs, usage as cyclooxygenase inhibitors, properties in plants, synthesis and recent patents, is developed. Salicylic acid research is still an important area and innovations continue to arise, which offer hope for new therapeutics in related fields. It is anticipated that this review will guide the direction of long-term drug/nutraceutical safety trials and stimulate ideas for future research.

Whole-body DHA synthesis-secretion kinetics from plasma eicosapentaenoic acid and alpha-linolenic acid in the free-living rat.

PubMed

Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P

2016-09-01

Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

MECHANISMS IN ENDOCRINOLOGY: Exogenous insulin does not increase muscle protein synthesis rate when administered systemically: a systematic review.

PubMed

Trommelen, Jorn; Groen, Bart B L; Hamer, Henrike M; de Groot, Lisette C P G M; van Loon, Luc J C

2015-07-01

Though it is well appreciated that insulin plays an important role in the regulation of muscle protein metabolism, there is much discrepancy in the literature on the capacity of exogenous insulin administration to increase muscle protein synthesis rates in vivo in humans. To assess whether exogenous insulin administration increases muscle protein synthesis rates in young and older adults. A systematic review of clinical trials was performed and the presence or absence of an increase in muscle protein synthesis rate was reported for each individual study arm. In a stepwise manner, multiple models were constructed that excluded study arms based on the following conditions: model 1, concurrent hyperaminoacidemia; model 2, insulin-induced hypoaminoacidemia; model 3, supraphysiological insulin concentrations; and model 4, older, more insulin resistant, subjects. From the presented data in the current systematic review, we conclude that: i) exogenous insulin and amino acid administration effectively increase muscle protein synthesis, but this effect is attributed to the hyperaminoacidemia; ii) exogenous insulin administered systemically induces hypoaminoacidemia which obviates any insulin-stimulatory effect on muscle protein synthesis; iii) exogenous insulin resulting in supraphysiological insulin levels exceeding 50, 000  pmol/l may effectively augment muscle protein synthesis; iv) exogenous insulin may have a diminished effect on muscle protein synthesis in older adults due to age-related anabolic resistance; and v) exogenous insulin administered systemically does not increase muscle protein synthesis in healthy, young adults. © 2015 European Society of Endocrinology.

Circulating protein synthesis rates reveal skeletal muscle proteome dynamics

PubMed Central

Shankaran, Mahalakshmi; King, Chelsea L.; Angel, Thomas E.; Holmes, William E.; Li, Kelvin W.; Colangelo, Marc; Price, John C.; Turner, Scott M.; Bell, Christopher; Hamilton, Karyn L.; Miller, Benjamin F.; Hellerstein, Marc K.

2015-01-01

Here, we have described and validated a strategy for monitoring skeletal muscle protein synthesis rates in rodents and humans over days or weeks from blood samples. We based this approach on label incorporation into proteins that are synthesized specifically in skeletal muscle and escape into the circulation. Heavy water labeling combined with sensitive tandem mass spectrometric analysis allowed integrated synthesis rates of proteins in muscle tissue across the proteome to be measured over several weeks. Fractional synthesis rate (FSR) of plasma creatine kinase M-type (CK-M) and carbonic anhydrase 3 (CA-3) in the blood, more than 90% of which is derived from skeletal muscle, correlated closely with FSR of CK-M, CA-3, and other proteins of various ontologies in skeletal muscle tissue in both rodents and humans. Protein synthesis rates across the muscle proteome generally changed in a coordinate manner in response to a sprint interval exercise training regimen in humans and to denervation or clenbuterol treatment in rodents. FSR of plasma CK-M and CA-3 revealed changes and interindividual differences in muscle tissue proteome dynamics. In human subjects, sprint interval training primarily stimulated synthesis of structural and glycolytic proteins. Together, our results indicate that this approach provides a virtual biopsy, sensitively revealing individualized changes in proteome-wide synthesis rates in skeletal muscle without a muscle biopsy. Accordingly, this approach has potential applications for the diagnosis, management, and treatment of muscle disorders. PMID:26657858

Abscisic acid negatively regulates elicitor-induced synthesis of capsidiol in wild tobacco.

PubMed

Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence

2009-07-01

In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8'-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8'-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants.

New hydrazones of ferulic acid: synthesis, characterization and biological activity.

PubMed

Wolszleger, Maria; Stan, Cătălina Daniela; Apotrosoaei, Maria; Vasincu, Ioana; Pânzariu, Andreea; Profire, Lenuţa

2014-01-01

The ferulic acid (4-hydroxy-3-methoxy-cinnamic acid) is a phenolic compound with important antioxidant effects and which nowadays is being extensively studied for his potential indications in inflammatory and neurodegenerative diseases, hypertension, atherosclerosis, etc. The synthesis of new ferulic acid compounds with potential antioxidant activity. The synthesis of the designed compounds was performed in several steps: (i) the obtaining of ferulic acid chloride by reacting of ferulic acid with thionyl chloride; (ii) the reaction between the ferulic acid chloride and hydrazine hydrate 98% to obtain the ferulic acid hydrazide; (iii) the condensation of ferrulic acid hydrazide with various benzaldehydes (2-hydroxy/3-hydroxy/4-hydroxy/2-nitro/3-nitro/4-nitro/2-methoxi/ 4-chloro/4-fluoro/4-bromo-benzaldehyde) resulting the correspond- ing hydrazones. The structure of the synthesized compounds was confirmed by FT-IR spectroscopy and the evaluation of antioxidant potential was achieved by determining the total antioxidant capacity and reducing power. In this study new hydrazones of ferulic acid have been synthesized, physic-chemical and spectral characterized. The evaluation of antioxidant potential using in vitro methods showed the favorable influence of the structural modulation on the antioxidant effects of ferulic acid.

Expeditious Synthesis of Dianionic-Headed 4-Sulfoalkanoic Acid Surfactants.

PubMed

Jiang, Jianghui; Xu, Jiaxi

2017-04-16

4-Sulfoalkanoic acids are a class of important dianionic-headed surfactants. Various 4-sulfoalkanoic acids with straight C8, C10, C12, C14, C16, and C18 chains were synthesized expeditiously through the radical addition of methyl 2-((ethoxycarbonothioyl)thio)acetate to linear terminal olefins and subsequent oxidation with peroxyformic acid. This is a useful and convenient strategy for the synthesis of dianionic-headed surfactants with a carboxylic acid and sulfonic acid functionalities in the head group region.

Synthesis of monomethyl 5,5'-dehydrodiferulic acid

USDA-ARS?s Scientific Manuscript database

Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid and its topoisomerase I inhibitory activity

PubMed Central

Carballeira, Néstor M.; Sanabria, David; Oyola, Delise

2006-01-01

An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032

Total amino acid stabilization during cell-free protein synthesis reactions.

PubMed

Calhoun, Kara A; Swartz, James R

2006-05-17

Limitations in amino acid supply have been recognized as a substantial problem in cell-free protein synthesis reactions. Although enzymatic inhibitors and fed-batch techniques have been beneficial, the most robust way to stabilize amino acids is to remove the responsible enzymatic activities by genetically modifying the source strain used for cell extract preparation. Previous work showed this was possible for arginine, serine, and tryptophan, but cysteine degradation remained a major limitation in obtaining high protein synthesis yields. Through radiolabel techniques, we confirmed that cysteine degradation was caused by the activity of glutamate-cysteine ligase (gene gshA) in the cell extract. Next, we created Escherichia coli strain KC6 that combines a gshA deletion with previously described deletions for arginine, serine, and tryptophan stabilization. Strain KC6 grows well, and active cell extract can be produced from it for cell-free protein synthesis reactions. The extract from strain KC6 maintains stable amino acid concentrations of all 20 amino acids in a 3-h batch reaction. Yields for three different proteins improved 75-250% relative to cell-free expression using the control extract.

Determining synthesis rates of individual proteins in zebrafish (Danio rerio) with low levels of a stable isotope labelled amino acid.

PubMed

Geary, Bethany; Magee, Kieran; Cash, Phillip; Young, Iain S; Whitfield, Phillip D; Doherty, Mary K

2016-05-01

The zebrafish is a powerful model organism for the analysis of human cardiovascular development and disease. Understanding these processes at the protein level not only requires changes in protein concentration to be determined but also the rate at which these changes occur on a protein-by-protein basis. The ability to measure protein synthesis and degradation rates on a proteome-wide scale, using stable isotope labelling in conjunction with mass spectrometry is now a well-established experimental approach. With the advent of more selective and sensitive mass spectrometers, it is possible to accurately measure lower levels of stable isotope incorporation, even when sample is limited. In order to challenge the sensitivity of this approach, we successfully determined the synthesis rates of over 600 proteins from the cardiac muscle of the zebrafish using a diet where either 30% or 50% of the L-leucine was replaced with a stable isotope labelled analogue ([(2) H7 ]L-leucine]. It was possible to extract sufficient protein from individual zebrafish hearts to determine the incorporation rate of the label into hundreds of proteins simultaneously, with the two labelling regimens showing a good correlation of synthesis rates. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Protein synthesis rates in atrophied gastrocnemius muscles after limb immobilization

NASA Technical Reports Server (NTRS)

Tucker, K. R.; Seider, M. J.; Booth, F. W.

1981-01-01

Noting that protein synthesis declines in the gastrocnemius 6 hr after immobilization, the study sought to detect an increase of protein synthesis when the limb was freed, and to examine the effects of exercise on the rate of increase. Rats were used as subjects, with their hind legs in plaster of Paris in plantar flexion to eliminate strain on the gastrocnemius. Periods of immobilization were varied and samples of blood from the muscle were taken to track protein synthesis rates for different groups in immobilization and exercise regimens (running and weightlifting). Synthesis rates declined 3.6% during time in the cast, then increased 6.3%/day after the casts were removed. Both running and weightlifting were found to increase the fractional rate of protein formation in the gastrocnemius muscle when compared with contralateral muscles that were not exercised and were used as controls, suggesting that the mechanism controlling protein synthesis in skeletal muscles is rapidly responsive to changes in muscular contractile activity.

Stereoselective synthesis of unsaturated α-amino acids.

PubMed

Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

2015-06-01

Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.

Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

PubMed

Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

2016-04-01

The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

An amino acid depleted cell-free protein synthesis system for the incorporation of non-canonical amino acid analogs into proteins.

PubMed

Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D

2014-05-20

Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies. Copyright © 2014 Elsevier B.V. All rights reserved.

Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

PubMed

Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

2016-07-02

Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

Proline supplementation to parenteral nutrition results in greater rates of protein synthesis in the muscle, skin, and small intestine in neonatal Yucatan miniature piglets.

PubMed

Brunton, Janet A; Baldwin, Mark P; Hanna, Rodney A; Bertolo, Robert F

2012-06-01

Proline and arginine are each indispensable during parenteral feeding due to limited interconversion by an atrophied gut. Commercial amino acid parenteral products designed for neonates contain proline concentrations that differ by almost 4-fold. To assess the adequacy of the lowest concentration of proline provided in commercial total parenteral nutrition (TPN) products, we compared rates of tissue-specific protein synthesis and nitrogen balance in neonatal piglets provided TPN at 2 different proline concentrations. Yucatan miniature piglets (9-11 d old, n = 12) were randomized to complete isonitrogenous TPN diets with low proline (LP; L-proline as 3% of amino acids) or proline supplemented (PS; 9%). After 7 d of receiving TPN, rates of protein synthesis in liver, gastrocnemius muscle, jejunal mucosa, and skin were determined by the flooding dose technique and tissue free amino acids were measured. Nitrogen balance was assessed during the last 3 d. The LP TPN resulted in lower free proline concentrations in plasma, muscle, and skin (P < 0.05) and lower rates of protein synthesis in the jejunum (by 25%; P = 0.02), muscle (by 45%; P = 0.015), and skin (by 60%; P = 0.01); there was no difference in liver. Nitrogen retention was 20% lower in the LP group (P = 0.01). In conclusion, muscle and skin protein synthesis was profoundly sensitive to parenteral proline supply and the reduced protein synthesis in the intestine could affect intestinal integrity. Low-proline TPN solutions that are currently in wide use in neonatal care may result in impaired tissue growth.

Insulin does not stimulate muscle protein synthesis during increased plasma branched-chain amino acids alone but still decreases whole body proteolysis in humans.

PubMed

Everman, Sarah; Meyer, Christian; Tran, Lee; Hoffman, Nyssa; Carroll, Chad C; Dedmon, William L; Katsanos, Christos S

2016-10-01

Insulin stimulates muscle protein synthesis when the levels of total amino acids, or at least the essential amino acids, are at or above their postabsorptive concentrations. Among the essential amino acids, branched-chain amino acids (BCAA) have the primary role in stimulating muscle protein synthesis and are commonly sought alone to stimulate muscle protein synthesis in humans. Fourteen healthy young subjects were studied before and after insulin infusion to examine whether insulin stimulates muscle protein synthesis in relation to the availability of BCAA alone. One half of the subjects were studied in the presence of postabsorptive BCAA concentrations (control) and the other half in the presence of increased plasma BCAA (BCAA). Compared with that prior to the initiation of the insulin infusion, fractional synthesis rate of muscle protein (%/h) did not change (P > 0.05) during insulin in either the control (0.04 ± 0.01 vs 0.05 ± 0.01) or the BCAA (0.05 ± 0.02 vs. 0.05 ± 0.01) experiments. Insulin decreased (P < 0.01) whole body phenylalanine rate of appearance (μmol·kg -1 ·min -1 ), indicating suppression of muscle proteolysis, in both the control (1.02 ± 0.04 vs 0.76 ± 0.04) and the BCAA (0.89 ± 0.07 vs 0.61 ± 0.03) experiments, but the change was not different between the two experiments (P > 0.05). In conclusion, insulin does not stimulate muscle protein synthesis in the presence of increased circulating levels of plasma BCAA alone. Insulin's suppressive effect on proteolysis is observed independently of the levels of circulating plasma BCAA. Copyright © 2016 the American Physiological Society.

Insulin does not stimulate muscle protein synthesis during increased plasma branched-chain amino acids alone but still decreases whole body proteolysis in humans

PubMed Central

Everman, Sarah; Meyer, Christian; Tran, Lee; Hoffman, Nyssa; Carroll, Chad C.; Dedmon, William L.

2016-01-01

Insulin stimulates muscle protein synthesis when the levels of total amino acids, or at least the essential amino acids, are at or above their postabsorptive concentrations. Among the essential amino acids, branched-chain amino acids (BCAA) have the primary role in stimulating muscle protein synthesis and are commonly sought alone to stimulate muscle protein synthesis in humans. Fourteen healthy young subjects were studied before and after insulin infusion to examine whether insulin stimulates muscle protein synthesis in relation to the availability of BCAA alone. One half of the subjects were studied in the presence of postabsorptive BCAA concentrations (control) and the other half in the presence of increased plasma BCAA (BCAA). Compared with that prior to the initiation of the insulin infusion, fractional synthesis rate of muscle protein (%/h) did not change (P > 0.05) during insulin in either the control (0.04 ± 0.01 vs 0.05 ± 0.01) or the BCAA (0.05 ± 0.02 vs. 0.05 ± 0.01) experiments. Insulin decreased (P < 0.01) whole body phenylalanine rate of appearance (μmol·kg−1·min−1), indicating suppression of muscle proteolysis, in both the control (1.02 ± 0.04 vs 0.76 ± 0.04) and the BCAA (0.89 ± 0.07 vs 0.61 ± 0.03) experiments, but the change was not different between the two experiments (P > 0.05). In conclusion, insulin does not stimulate muscle protein synthesis in the presence of increased circulating levels of plasma BCAA alone. Insulin's suppressive effect on proteolysis is observed independently of the levels of circulating plasma BCAA. PMID:27530230

Pyroglutamic acid stimulates DNA synthesis in rat primary hepatocytes through the mitogen-activated protein kinase pathway.

PubMed

Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo

2015-01-01

We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.

Phosphatidic Acid Synthesis in Bacteria

PubMed Central

Yao, Jiangwei; Rock, Charles O.

2012-01-01

Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

Ravynic acid, an antibiotic polyeneyne tetramic acid from Penicillium sp. elucidated through synthesis.

PubMed

Myrtle, J D; Beekman, A M; Barrow, R A

2016-09-21

A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1).

Decreased rate of protein synthesis, caspase-3 activity, and ubiquitin-proteasome proteolysis in soleus muscles from growing rats fed a low-protein, high-carbohydrate diet.

PubMed

Batistela, Emanuele; Pereira, Mayara Peron; Siqueira, Juliany Torres; Paula-Gomes, Silvia; Zanon, Neusa Maria; Oliveira, Eduardo Brandt; Navegantes, Luiz Carlos Carvalho; Kettelhut, Isis C; Andrade, Claudia Marlise Balbinotti; Kawashita, Nair Honda; Baviera, Amanda Martins

2014-06-01

The aim of this study was to investigate the changes in the rates of both protein synthesis and breakdown, and the activation of intracellular effectors that control these processes in soleus muscles from growing rats fed a low-protein, high-carbohydrate (LPHC) diet for 15 days. The mass and the protein content, as well as the rate of protein synthesis, were decreased in the soleus from LPHC-fed rats. The availability of amino acids was diminished, since the levels of various essential amino acids were decreased in the plasma of LPHC-fed rats. Overall rate of proteolysis was also decreased, explained by reductions in the mRNA levels of atrogin-1 and MuRF-1, ubiquitin conjugates, proteasome activity, and in the activity of caspase-3. Soleus muscles from LPHC-fed rats showed increased insulin sensitivity, with increased levels of insulin receptor and phosphorylation levels of AKT, which probably explains the inhibition of both the caspase-3 activity and the ubiquitin-proteasome system. The fall of muscle proteolysis seems to represent an adaptive response that contributes to spare proteins in a condition of diminished availability of dietary amino acids. Furthermore, the decreased rate of protein synthesis may be the driving factor to the lower muscle mass gain in growing rats fed the LPHC diet.

Duodenal prostaglandin synthesis and acid load in health and in duodenal ulcer disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahlquist, D.A.; Dozois, R.R.; Zinsmeister, A.R.

1983-09-01

We sought to test the hypothesis that duodenal ulcer disease results from an imbalance between duodenal acid load, an injurious force, and mucosal prostaglandin generation, a protective factor. Ten patients with duodenal ulcer and 8 healthy controls were studied. The duodenal acid load after an amino acid soup was quantified by a double-marker technique. Mucosal biopsy specimens were taken endoscopically from the duodenal bulb before and after the test meal. Prostaglandin synthesis activity was measured by incubating biopsy homogenates in excess (/sup 14/C)arachidonic acid. Although mean duodenal acid load was higher in duodenal ulcer, ranges overlapped. Neither the qualitative normore » quantitative profile of mucosal prostaglandin synthesis activities differed significantly between test groups. Prostaglandin synthesis activities, however, tended to increase post cibum in controls, but change little or decrease in duodenal ulcer. Only by comparing the responses with a meal of both parameters together (duodenal acid load and the change in prostaglandin synthesis activities) was there complete or nearly complete separation of duodenal ulcer from controls. Greatest discrimination was observed with prostacyclin (6-keto-PGF1 alpha). We conclude that in health, mucosal prostaglandin generation in the duodenum is induced post cibum in relation to duodenal acid load; this may be a physiologic example of adaptive cytoprotection. In duodenal ulcer there may be a defect in such a mechanism.« less

Kinetics and Optimization of Lipophilic Kojic Acid Derivative Synthesis in Polar Aprotic Solvent Using Lipozyme RMIM and Its Rheological Study.

PubMed

Ishak, Nurazwa; Lajis, Ahmad Firdaus B; Mohamad, Rosfarizan; Ariff, Arbakariya B; Mohamed, Mohd Shamzi; Halim, Murni; Wasoh, Helmi

2018-02-24

The synthesis of kojic acid derivative (KAD) from kojic and palmitic acid (C16:0) in the presence of immobilized lipase from Rhizomucor miehei (commercially known as Lipozyme RMIM), was studied using a shake flask system. Kojic acid is a polyfunctional heterocycles that acts as a source of nucleophile in this reaction allowing the formation of a lipophilic KAD. In this study, the source of biocatalyst, Lipozyme RMIM, was derived from the lipase of Rhizomucor miehei immobilized on weak anion exchange macro-porous Duolite ES 562 by the adsorption technique. The effects of solvents, enzyme loading, reaction temperature, and substrate molar ratio on the reaction rate were investigated. In one-factor-at-a-time (OFAT) experiments, a high reaction rate (30.6 × 10 -3 M·min -1 ) of KAD synthesis was recorded using acetone, enzyme loading of 1.25% ( w / v ), reaction time of 12 h, temperature of 50 °C and substrate molar ratio of 5:1. Thereafter, a yield of KAD synthesis was optimized via the response surface methodology (RSM) whereby the optimized molar ratio (fatty acid: kojic acid), enzyme loading, reaction temperature and reaction time were 6.74, 1.97% ( w / v ), 45.9 °C, and 20 h respectively, giving a high yield of KAD (64.47%). This condition was reevaluated in a 0.5 L stirred tank reactor (STR) where the agitation effects of two impellers; Rushton turbine (RT) and pitch-blade turbine (PBT), were investigated. In the STR, a very high yield of KAD synthesis (84.12%) was achieved using RT at 250 rpm, which was higher than the shake flask, thus indicating better mixing quality in STR. In a rheological study, a pseudoplastic behavior of KAD mixture was proposed for potential application in lotion formulation.

Interactions between fatty acid synthesis, oxidation, and esterification in the production of triglyceride-rich lipoproteins by the liver.

PubMed

Fukuda, N; Ontko, J A

1984-08-01

In a series of experiments with male rat livers perfused with or without 5-tetradecyloxy-2-furoic acid (TOFA) in the presence and absence of oleate, the relationships between fatty acid synthesis, oxidation, and esterification from newly synthesized and exogenous fatty acid substrates have been examined. When livers from fed rats were perfused without exogenous fatty acid substrate, 20% of the triglyceride secreted was derived from de novo fatty acid synthesis. Addition of TOFA caused immediate and nearly complete inhibition of fatty acid synthesis, measured by incorporation of 3H2O into fatty acids. Concurrently, ketone body production increased 140% and triglyceride secretion decreased 84%. These marked reciprocal alterations in fatty acid synthesis and oxidation in the liver almost completely abolished the production of very low density lipoproteins (VLDL). Cholesterol synthesis was also depressed by TOFA, suggesting that this drug also inhibited lipid synthesis at a site other than acetyl-CoA carboxylase. When livers from fed rats were supplied with a continuous infusion of [1-14C]oleate as exogenous substrate, similar proportions, about 45-47%, of both ketone bodies and triglyceride in the perfusate were derived from the infused [1-14C]oleate. The production of ketone bodies was markedly increased by TOFA; the secretion of triglyceride and cholesterol were decreased. Altered conversion of [1-14C]oleate into these products occurred in parallel. While TOFA decreased esterification of oleate into triglyceride, incorporation of [1-14C]oleate into liver phospholipid was increased, indicating that TOFA also affected glycerolipid synthesis at the stage of diglyceride processing. The decreased secretion of triglyceride and cholesterol following TOFA treatment was localized almost exclusively in VLDL. The specific activities of 3H and of 14C fatty acids in triglyceride of the perfusate were greater than those of liver triglyceride, indicating preferential secretion of

By-products of electrochemical synthesis of suberic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.

By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

Fatty acid synthesis in Escherichia coli

PubMed Central

Knivett, V. A.; Cullen, Julia

1967-01-01

1. Fatty acid formation by cells of a strain of Escherichia coli has been studied in the exponential, post-exponential and stationary phases of growth. 2. During the exponential phase of growth, the metabolic quotient (mμmoles of fatty acid synthesized/mg. dry wt. of cells/hr.) for each fatty acid in the extractable lipid was constant. 3. The newly synthesized fatty acid mixtures produced during this phase contained hexadecanoic acid (41%), hexadecenoic acid (31%), octadecenoic acid (21%) and the C17-cyclopropane acid, methylenehexadecanoic acid (4%). 4. As the proportion of newly synthesized material increased, changes in the fatty acid composition of the cells during this period were towards this constant composition. 5. Abrupt changes in fatty acid synthesis occurred when exponential growth ceased. 6. In media in which glycerol, or SO42− or Mg2+, was growth-limiting there was a small accumulation of C17-cyclopropane acid in cells growing in the post-exponential phase of growth. 7. Where either NH4+ or PO43− was growth-limiting and there were adequate supplies of glycerol, Mg2+ and SO42−, there was a marked accumulation of C17-cyclopropane acid and C19-cyclopropane acid appeared. 8. Under appropriate conditions the metabolic quotient for C17-cyclopropane acid increased up to sevenfold at the end of exponential growth. Simultaneously the metabolic quotients of the other acids fell. 9. A mixture of glycerol, Mg2+ and SO42− stimulated cyclopropane acid formation in resting cells. PMID:5340364

Racemic synthesis and solid phase peptide synthesis application of the chimeric valine/leucine derivative 2-amino-3,3,4-trimethyl-pentanoic acid.

PubMed

Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R

2014-07-01

The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.

Synthesis of guanidinoacetate and creatine from amino acids by rat pancreas.

PubMed

da Silva, Robin P; Clow, Kathy; Brosnan, John T; Brosnan, Margaret E

2014-02-01

Creatine is an important molecule involved in cellular energy metabolism. Creatine is spontaneously converted to creatinine at a rate of 1·7% per d; creatinine is lost in the urine. Creatine can be obtained from the diet or synthesised from endogenous amino acids via the enzymes arginine:glycine amidinotransferase (AGAT) and guanidinoacetate N-methyltransferase (GAMT). The liver has high GAMT activity and the kidney has high AGAT activity. Although the pancreas has both AGAT and GAMT activities, its possible role in creatine synthesis has not been characterised. In the present study, we examined the enzymes involved in creatine synthesis in the pancreas as well as the synthesis of guanidinoacetate (GAA) and creatine by isolated pancreatic acini. We found significant AGAT activity and somewhat lower GAMT activity in the pancreas and that pancreatic acini had measurable activities of both AGAT and GAMT and the capacity to synthesise GAA and creatine from amino acids. Creatine supplementation led to a decrease in AGAT activity in the pancreas, though it did not affect its mRNA or protein abundance. This was in contrast with the reduction of AGAT activity and mRNA and protein abundance in the kidney, suggesting that the regulatory mechanisms that control the expression of this enzyme in the pancreas are different from those in the kidney. Dietary creatine increased the concentrations of GAA, creatine and phosphocreatine in the pancreas. Unexpectedly, creatine supplementation decreased the concentrations of S-adenosylmethionine, while those of S-adenosylhomocysteine were not altered significantly.

Inhibition of rotavirus replication by downregulation of fatty acid synthesis.

PubMed

Gaunt, Eleanor R; Cheung, Winsome; Richards, James E; Lever, Andrew; Desselberger, Ulrich

2013-06-01

Recently the recruitment of lipid droplets (LDs) to sites of rotavirus (RV) replication was reported. LDs are polymorphic organelles that store triacylglycerols, cholesterol and cholesterol esters. The neutral fats are derived from palmitoyl-CoA, synthesized via the fatty acid biosynthetic pathway. RV-infected cells were treated with chemical inhibitors of the fatty acid biosynthetic pathway, and the effects on viral replication kinetics were assessed. Treatment with compound C75, an inhibitor of the fatty acid synthase enzyme complex (FASN), reduced RV infectivity 3.2-fold (P = 0.07) and modestly reduced viral RNA synthesis (1.2-fold). Acting earlier in the fatty acid synthesis pathway, TOFA [5-(Tetradecyloxy)-2-furoic acid] inhibits the enzyme acetyl-CoA carboxylase 1 (ACC1). TOFA reduced the infectivity of progeny RV 31-fold and viral RNA production 6-fold. The effect of TOFA on RV infectivity and RNA replication was dose-dependent, and infectivity was reduced by administering TOFA up to 4 h post-infection. Co-treatment of RV-infected cells with C75 and TOFA synergistically reduced viral infectivity. Knockdown by siRNA of FASN and ACC1 produced findings similar to those observed by inhibiting these proteins with the chemical compounds. Inhibition of fatty acid synthesis using a range of approaches uniformly had a more marked impact on viral infectivity than on viral RNA yield, inferring a role for LDs in virus assembly and/or egress. Specific inhibitors of fatty acid metabolism may help pinpoint the critical structural and biochemical features of LDs that are essential for RV replication, and facilitate the development of antiviral therapies.

Effect of synthesis parameters on polymethacrylic acid xerogel structures and equilibrium swelling

NASA Astrophysics Data System (ADS)

Panić, V.; Jovanović, J.; Adnadjević, B.; Velicković, S.

2009-09-01

Hydrogels based on crosslinked polymethacrylic acid were synthesized via free-radical polymerization in aqueous solution, using N,N'-methylene bisacrylamide as a crosslinking agent and 2,2'-azobis-[2-(2-imidazolin-2-yl)propane] dihydrochloride as an initiator. The influence of the reaction parameters (the neutralization degree of methacrylic acid and the initial monomer concentration) on the equilibrium swelling degree, the swelling kinetic parameters and the basic structural properties of xerogels was investigated. The change of synthesis parameters leads to the change of the basic structural parameters of xerogel, as well as the equilibrium swelling degree and the initial swelling rate of the hydrogels. It is found that there are power form relationships between the equilibrium swelling degree, the initial swelling rate and the structural xerogel’s properties and the change of the neutralization degree of monomer, i.e. the monomer concentration. The examined correlations proved that the crosslinking density is the crucial parameter which determines all the other investigated structural and swelling parameters.

Ingestion of Wheat Protein Increases In Vivo Muscle Protein Synthesis Rates in Healthy Older Men in a Randomized Trial.

PubMed

Gorissen, Stefan Hm; Horstman, Astrid Mh; Franssen, Rinske; Crombag, Julie Jr; Langer, Henning; Bierau, Jörgen; Respondek, Frederique; van Loon, Luc Jc

2016-09-01

Muscle mass maintenance is largely regulated by basal muscle protein synthesis and the capacity to stimulate muscle protein synthesis after food intake. The postprandial muscle protein synthetic response is modulated by the amount, source, and type of protein consumed. It has been suggested that plant-based proteins are less potent in stimulating postprandial muscle protein synthesis than animal-derived proteins. However, few data support this contention. We aimed to assess postprandial plasma amino acid concentrations and muscle protein synthesis rates after the ingestion of a substantial 35-g bolus of wheat protein hydrolysate compared with casein and whey protein. Sixty healthy older men [mean ± SEM age: 71 ± 1 y; body mass index (in kg/m(2)): 25.3 ± 0.3] received a primed continuous infusion of l-[ring-(13)C6]-phenylalanine and ingested 35 g wheat protein (n = 12), 35 g wheat protein hydrolysate (WPH-35; n = 12), 35 g micellar casein (MCas-35; n = 12), 35 g whey protein (Whey-35; n = 12), or 60 g wheat protein hydrolysate (WPH-60; n = 12). Plasma and muscle samples were collected at regular intervals. The postprandial increase in plasma essential amino acid concentrations was greater after ingesting Whey-35 (2.23 ± 0.07 mM) than after MCas-35 (1.53 ± 0.08 mM) and WPH-35 (1.50 ± 0.04 mM) (P < 0.01). Myofibrillar protein synthesis rates increased after ingesting MCas-35 (P < 0.01) and were higher after ingesting MCas-35 (0.050% ± 0.005%/h) than after WPH-35 (0.032% ± 0.004%/h) (P = 0.03). The postprandial increase in plasma leucine concentrations was greater after ingesting Whey-35 than after WPH-60 (peak value: 580 ± 18 compared with 378 ± 10 μM, respectively; P < 0.01), despite similar leucine contents (4.4 g leucine). Nevertheless, the ingestion of WPH-60 increased myofibrillar protein synthesis rates above basal rates (0.049% ± 0.007%/h; P = 0.02). The myofibrillar protein synthetic response to the ingestion of 35 g casein is greater than after an

Synthesis and characterization of an anomeric sulfur analogue of CMP-sialic acid.

PubMed

Cohen, S B; Halcomb, R L

2000-09-22

alpha-2,3-Sialyltransferase catalyzes the transfer of sialic acid from CMP-sialic acid (1) to a lactose acceptor. An analogue of 1 was synthesized in which the anomeric oxygen atom was replaced with a sulfur atom (1S). The key step in the synthesis of 1S was a tetrazole-promoted coupling of a cytidine-5'-phosphoramidite with a glycosyl thiol of a protected sialic acid. Compounds 1 and 1S were characterized for their activity in a sialyl transfer assay. The rate of solvolysis in aqueous buffer of analogue 1S was 50-fold slower than that of 1. Analogue 1S was found to be substrate for alpha-2,3-sialyltransferase. The K(m) of 1S was just 3-fold higher than that of 1, while the k(cat) of 1S was 2 orders of magnitude lower compared to 1.

Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.

PubMed

Dacquin, J P; Lee, A F; Pirez, C; Wilson, K

2012-01-07

Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. This journal is © The Royal Society of Chemistry 2012

Prebiotic synthesis of carboxylic acids, amino acids and nucleic acid bases from formamide under photochemical conditions⋆

NASA Astrophysics Data System (ADS)

Botta, Lorenzo; Mattia Bizzarri, Bruno; Piccinino, Davide; Fornaro, Teresa; Robert Brucato, John; Saladino, Raffaele

2017-07-01

The photochemical transformation of formamide in the presence of a mixture of TiO2 and ZnO metal oxides as catalysts afforded a large panel of molecules of biological relevance, including carboxylic acids, amino acids and nucleic acid bases. The reaction was less effective when performed in the presence of only one mineral, highlighting the role of synergic effects between the photoactive catalysts. Taken together, these results suggest that the synthesis of chemical precursors for both the genetic and the metabolic apparatuses might have occurred in a simple environment, consisting of formamide, photoactive metal oxides and UV-radiation.

Enzymes involved in plastid-targeted phosphatidic acid synthesis are essential for Plasmodium yoelii liver stage development

PubMed Central

Lindner, Scott E.; Sartain, Mark J.; Hayes, Kiera; Harupa, Anke; Moritz, Robert L.; Kappe, Stefan H. I.; Vaughan, Ashley M.

2014-01-01

SUMMARY Malaria parasites scavenge nutrients from their host but also harbor enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbor genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic synthesis. Our research shows that apicoplast-targeted P. yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver stage development and deletion of the encoding genes resulted in late liver stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite lifecycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver stage maturation. PMID:24330260

Factors influencing the rate of non-enzymatic activation of carboxylic and amino acids by ATP

NASA Technical Reports Server (NTRS)

Mullins, D. W., Jr.; Lacey, J. C., Jr.

1981-01-01

The nonenzymatic formation of adenylate anhydrides of carboxylic and amino acids is discussed as a necessary step in the origin of the genetic code and protein biosynthesis. Results of studies are presented which have shown the rate of activation to depend on the pKa of the carboxyl group, the pH of the medium, temperature, the divalent metal ion catalyst, salt concentration, and the nature of the amino acid. In particular, it was found that of the various amino acids investigated, phenylalanine had the greatest affinity for the adenine derivatives adenosine and ATP. Results thus indicate that selective affinities between amino acids and nucleotides were important during prebiotic chemical evolution, and may have played a major role in the origin of protein synthesis and genetic coding.

Enzymes involved in plastid-targeted phosphatidic acid synthesis are essential for Plasmodium yoelii liver-stage development.

PubMed

Lindner, Scott E; Sartain, Mark J; Hayes, Kiera; Harupa, Anke; Moritz, Robert L; Kappe, Stefan H I; Vaughan, Ashley M

2014-02-01

Malaria parasites scavenge nutrients from their host but also harbour enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver-stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbour genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic acid synthesis. Our research shows that apicoplast-targeted Plasmodium yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver-stage development and deletion of the encoding genes resulted in late liver-stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite life cycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver-stage maturation. © 2013 John Wiley & Sons Ltd.

Synthesis of new Cα-tetrasubstituted α-amino acids

PubMed Central

Grauer, Andreas A

2009-01-01

Summary Cα-Tetrasubstituted α-amino acids are important building blocks for the synthesis of peptidemimetics with stabilized secondary structure, because of their ability to rigidify the peptide backbone. Recently our group reported a new class of cyclic Cα-tetrasubstituted tetrahydrofuran α-amino acids prepared from methionine and aromatic aldehydes. We now report the extension of this methodology to aliphatic aldehydes. Although such aldehydes are prone to give aldol products under the reaction conditions used, we were able to obtain the target cyclic amino acids in low to moderate yields and in some cases with good diastereoselectivity. PMID:19259341

A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

ERIC Educational Resources Information Center

Barrelle, M.; And Others

1983-01-01

Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

Synthesis of Amino Acid Precursors with Organic Solids in Planetesimals with Liquid Water

NASA Technical Reports Server (NTRS)

Kebukawa, Y; Misawa, S.; Matsukuma, J.; Chan, Q. H. S.; Kobayashi, J.; Tachibana, S.; Zolensky, M. E.

2017-01-01

Amino acids are important ingredients of life that would have been delivered to Earth by extraterrestrial sources, e.g., comets and meteorites. Amino acids are found in aqueously altered carbonaceous chondrites in good part in the form of precursors that release amino acids after acid hydrolysis. Meanwhile, most of the organic carbon (greater than 70 weight %) in carbonaceous chondrites exists in the form of solvent insoluble organic matter (IOM) with complex macromolecular structures. Complex macromolecular organic matter can be produced by either photolysis of interstellar ices or aqueous chemistry in planetesimals. We focused on the synthesis of amino acids during aqueous alteration, and demonstrated one-pot synthesis of a complex suite of amino acids simultaneously with IOM via hydrothermal experiments simulating the aqueous processing

Acid Gradient across Plasma Membrane Can Drive Phosphate Bond Synthesis in Cancer Cells: Acidic Tumor Milieu as a Potential Energy Source

PubMed Central

Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam

2015-01-01

Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623

Synthesis of novel acid electrolytes for phosphoric acid fuel cells

NASA Astrophysics Data System (ADS)

Adcock, James L.

1988-11-01

A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

Catabolism of Branched Chain Amino Acids Contributes Significantly to Synthesis of Odd-Chain and Even-Chain Fatty Acids in 3T3-L1 Adipocytes.

PubMed

Crown, Scott B; Marze, Nicholas; Antoniewicz, Maciek R

2015-01-01

The branched chain amino acids (BCAA) valine, leucine and isoleucine have been implicated in a number of diseases including obesity, insulin resistance, and type 2 diabetes mellitus, although the mechanisms are still poorly understood. Adipose tissue plays an important role in BCAA homeostasis by actively metabolizing circulating BCAA. In this work, we have investigated the link between BCAA catabolism and fatty acid synthesis in 3T3-L1 adipocytes using parallel 13C-labeling experiments, mass spectrometry and model-based isotopomer data analysis. Specifically, we performed parallel labeling experiments with four fully 13C-labeled tracers, [U-13C]valine, [U-13C]leucine, [U-13C]isoleucine and [U-13C]glutamine. We measured mass isotopomer distributions of fatty acids and intracellular metabolites by GC-MS and analyzed the data using the isotopomer spectral analysis (ISA) framework. We demonstrate that 3T3-L1 adipocytes accumulate significant amounts of even chain length (C14:0, C16:0 and C18:0) and odd chain length (C15:0 and C17:0) fatty acids under standard cell culture conditions. Using a novel GC-MS method, we demonstrate that propionyl-CoA acts as the primer on fatty acid synthase for the production of odd chain fatty acids. BCAA contributed significantly to the production of all fatty acids. Leucine and isoleucine contributed at least 25% to lipogenic acetyl-CoA pool, and valine and isoleucine contributed 100% to lipogenic propionyl-CoA pool. Our results further suggest that low activity of methylmalonyl-CoA mutase and mass action kinetics of propionyl-CoA on fatty acid synthase result in high rates of odd chain fatty acid synthesis in 3T3-L1 cells. Overall, this work provides important new insights into the connection between BCAA catabolism and fatty acid synthesis in adipocytes and underscores the high capacity of adipocytes for metabolizing BCAA.

Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis

PubMed Central

Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L. Ashley; Lopes-Virella, Maria F.

2018-01-01

It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages. PMID:29474492

Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis.

PubMed

Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L Ashley; Lopes-Virella, Maria F; Huang, Yan

2018-01-01

It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages.

Skeletal Muscle Myofibrillar and Sarcoplasmic Protein Synthesis Rates Are Affected Differently by Altitude-Induced Hypoxia in Native Lowlanders

PubMed Central

Holm, Lars; Haslund, Mads Lyhne; Robach, Paul; van Hall, Gerrit; Calbet, Jose A. L.; Saltin, Bengt; Lundby, Carsten

2010-01-01

As a consequence to hypobaric hypoxic exposure skeletal muscle atrophy is often reported. The underlying mechanism has been suggested to involve a decrease in protein synthesis in order to conserve O2. With the aim to challenge this hypothesis, we applied a primed, constant infusion of 1-13C-leucine in nine healthy male subjects at sea level and subsequently at high-altitude (4559 m) after 7–9 days of acclimatization. Physical activity levels and food and energy intake were controlled prior to the two experimental conditions with the aim to standardize these confounding factors. Blood samples and expired breath samples were collected hourly during the 4 hour trial and vastus lateralis muscle biopsies obtained at 1 and 4 hours after tracer priming in the overnight fasted state. Myofibrillar protein synthesis rate was doubled; 0.041±0.018 at sea-level to 0.080±0.018%⋅hr−1 (p<0.05) when acclimatized to high altitude. The sarcoplasmic protein synthesis rate was in contrast unaffected by altitude exposure; 0.052±0.019 at sea-level to 0.059±0.010%⋅hr−1 (p>0.05). Trends to increments in whole body protein kinetics were seen: Degradation rate elevated from 2.51±0.21 at sea level to 2.73±0.13 µmol⋅kg−1⋅min−1 (p = 0.05) at high altitude and synthesis rate similar; 2.24±0.20 at sea level and 2.43±0.13 µmol⋅kg−1⋅min−1 (p>0.05) at altitude. We conclude that whole body amino acid flux is increased due to an elevated protein turnover rate. Resting skeletal muscle myocontractile protein synthesis rate was concomitantly elevated by high-altitude induced hypoxia, whereas the sarcoplasmic protein synthesis rate was unaffected by hypoxia. These changed responses may lead to divergent adaptation over the course of prolonged exposure. PMID:21187972

Comparative studies on fatty acid synthesis, glycogen metabolism, and gluconeogenesis by hepatocytes isolated from lean and obese Zucker rats.

PubMed

McCune, S A; Durant, P J; Jenkins, P A; Harris, R A

1981-12-01

Hepatocytes isolated from genetically obese female Zucker rats and lean female Zucker rats were compared. Hepatocytes from fed obese rats exhibited greater rates of fatty acid synthesis, more extensive accumulation of lactate and pyruvate from their glycogen stores, increased rates of net glucose utilization but produced less ketone bodies from exogenous fatty acids and had lower citrate levels than hepatocytes from lean rats. Lipogenesis was not as sensitive to dibutyryl cyclic AMP (DBcAMP) inhibition in hepatocytes from obese rats but glycogenolysis was stimulated to the same extent by this nucleotide in both preparations. Ketogenesis was less sensitive to stimulation by DBcAMP in hepatocytes from obese rats. A difference in sensitivity of lipogenesis to DBcAMP was not found when lactate plus pyruvate was added to the incubation medium, suggesting that a greater rate of glycolysis by hepatocytes from obese rats accounts for their relative insensitivity to DBcAMP. Citrate levels were elevated by DBcAMP to a greater extent in hepatocytes from obese rats. Hepatocytes prepared from lean rats starved for 48 hr were glycogen depleted and lacked significant capacity for lipogenesis and glycogen synthesis. In contrast, hepatocytes isolated from starved obese rats retained considerable amounts of liver glycogen and exhibited detectable rates of lipogenesis and glycogen synthesis. Hepatocytes prepared from starved lean rats gave faster apparent rates of lactate gluconeogenesis than hepatocytes prepared from starved obese rats. Thus, hepatocytes prepared from obese Zucker rats are more glycogenic, glycolytic, and lipogenic but less ketogenic and glucogenic than hepatocytes prepared from lean rats.

PROTEASOME INHIBITOR TREATMENT REDUCED FATTY ACID, TRIACYLGLYCEROL AND CHOLESTEROL SYNTHESIS

PubMed Central

Oliva, Joan; French, Samuel W.; Li, Jun; Bardag-Gorce, Fawzia

2014-01-01

In the present study, the beneficial effects of proteasome inhibitor treatment in reducing ethanol-induced steatosis were investigated. A microarray analysis was performed on the liver of rats injected with PS-341 (Bortezomib, Velcade®), and the results showed that proteasome inhibitor treatment significantly reduced the mRNA expression of SREBP-1c, and the downstream lipogenic enzymes, such as fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC), which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ELOVL6, which is responsible for fatty acids long chain elongation, was also significantly down regulated by proteasome inhibitor treatment. Moreover, PS-341 administration significantly reduced the expression of acyl-glycerol-3-phosphate acyltransferase (AGPAT), and diacylglycerol acyltransferase (DGAT), enzyme involved in triacylglycerol (TAG) synthesis. Finally, PS-341 was found to down regulate the enzymes 3-hydroxy-3-methylglutaryl-CoenzymeA synthase (HMG-CoA synthase) that is responsible for cholesterol synthesis. Proteasome inhibitor was also found to play a role in intestinal lipid adsorption because apolipoproteins A (apoA-I, apoAII, apoA-IV and ApoCIII) were down regulated by proteasome inhibitor treatment, especially ApoA-II that is known to be a marker of alcohol consumption. Proteasome inhibitor treatment also decreased apobec-1 complementation factor (ACF) leading to lower level of editing and production of ApoB protein. Moreover apolipoprotein C-III, a major component of chylomicrons was significantly down regulated. However, lipoprotein lipase (Lpl) and High density lipoprotein binding protein (Hdlbp) mRNA levels were increased by proteasome inhibitor treatment. These results suggested that proteasome inhibitor treatment could be used to reduce the alcohol-enhanced lipogenesis and alcohol-induced liver steatosis. A morphologic analysis, performed on the liver of rats fed ethanol for one

Synthesis and antituberculosis activity of new fatty acid amides.

PubMed

D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes

2010-09-01

This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains. Copyright 2010 Elsevier Ltd. All rights reserved.

Pulmonary fatty acid synthesis. I. Mitochondrial acetyl transfer by rat lung in vitro.

PubMed

Evans, R M; Scholz, R W

1977-04-01

Incorporation of tritiated water into fatty acids by rat adipose tissue and lung tissue slices incubated with 5 mM glucose indicated a level of fatty acid synthesis in rat lung approximately 15% that observed in adipose tissue in vitro. (-)-Hydroxycitrate, and inhibitor of ATP citrate lyase, markedly reduced tritiated water incorporation into fatty acids by lung tissue slices. The effects of (-)-hydroxycitrate and n-butymalonate on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate suggested that citrate is a major acetyl carrier for de novo fatty acid synthesis in lung tissue. Alternative mechanisms to citrate as an acetyl carrier were also considered. Lung mitochondrial preparations formed significant levels of acetylcarnitine in the presence of pyruvate and carnitine. However, the effect of carnitine on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate into fatty acids by lung tissue slices indicated that acetylcarnitine may not be a significant acetyl carrier for fatty acid synthesis but may serve as an acetyl "buffer" in the control of mitochondrial acetyl-CoA levels. Additionally, it appears unlikely that either acetylaspartate or acetoacetate are of major importance in acetyl transfer in lung tissue.

Synthesis of the sulfur amino acids: cysteine and methionine.

PubMed

Wirtz, Markus; Droux, Michel

2005-12-01

This review will assess new features reported for the molecular and biochemical aspects of cysteine and methionine biosynthesis in Arabidopsis thaliana with regards to early published data from other taxa including crop plants and bacteria (Escherichia coli as a model). By contrast to bacteria and fungi, plant cells present a complex organization, in which the sulfur network takes place in multiple sites. Particularly, the impact of sulfur amino-acid biosynthesis compartmentalization will be addressed in respect to localization of sulfur reduction. To this end, the review will focus on regulation of sulfate reduction by synthesis of cysteine through the cysteine synthase complex and the synthesis of methionine and its derivatives. Finally, regulatory aspects of sulfur amino-acid biosynthesis will be explored with regards to interlacing processes such as photosynthesis, carbon and nitrogen assimilation.

Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W

PubMed Central

Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence

2009-01-01

In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326

Intracellular synthesis of glutamic acid in Bacillus methylotrophicus SK19.001, a glutamate-independent poly(γ-glutamic acid)-producing strain.

PubMed

Peng, Yingyun; Zhang, Tao; Mu, Wanmeng; Miao, Ming; Jiang, Bo

2016-01-15

Bacillus methylotrophicus SK19.001 is a glutamate-independent strain that produces poly(γ-glutamic acid) (γ-PGA), a polymer of D- and L-glutamic acids that possesses applications in food, the environment, agriculture, etc. This study was undertaken to explore the synthetic pathway of intracellular L- and D-glutamic acid in SK19.001 by investigating the effects of tricarboxylic acid cycle intermediates and different amino acids as metabolic precursors on the production of γ-PGA and analyzing the activities of the enzymes involved in the synthesis of L- and D-glutamate. Tricarboxylic acid cycle intermediates and amino acids could participate in the synthesis of γ-PGA via independent pathways in SK19.001. L-Aspartate aminotransferase, L-glutaminase and L-glutamate synthase were the enzymatic sources of L-glutamate. Glutamate racemase was responsible for the formation of D-glutamate for the synthesis of γ-PGA, and the synthetase had stereoselectivity for glutamate substrate. The enzymatic sources of L-glutamate were investigated for the first time in the glutamate-independent γ-PGA-producing strain, and multiple enzymatic sources of L-glutamate were verified in SK19.001, which will benefit efforts to improve production of γ-PGA with metabolic engineering strategies. © 2015 Society of Chemical Industry.

Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

PubMed

Hansen, Alexandar L; Behrman, Edward J

2016-08-05

We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. Copyright © 2016 Elsevier Ltd. All rights reserved.

Gluconeogenesis, non-essential amino acid synthesis and substrate partitioning in chicken embryos during later development.

PubMed

Hu, Q; Agarwal, U; Bequette, B J

2017-02-01

We aimed to quantify the rate of gluconeogenesis (GNG), non-essential amino-acid (NEAA) synthesis, and substrate partitioning to the Krebs cycle in embryonic (e) day e14 and e19 chicken embryos. An in ovo continuous tracer infusion approach was employed to test the hypotheses that GNG and NEAA synthesis in developing chicken embryo increases from e14 to e19. [ 13 C 6 ]Glucose or [ 13 C 3 ]glycerol was continuously infused (8 h) into the chorio-allantoic compartment of eggs on e14 and e19. Glucose entry rate, Cori cycling, and GNG were higher (P < 0.05) in e19 compared to e14 embryos, presumably to support higher glycogen deposition in liver and muscle. Whereas de novo synthesis of alanine, aspartate, and glutamate via glycolysis and the Krebs cycle was higher (P < 0.01) in e14 embryos, synthesis of these NEAA from glycerol was higher (P < 0.05) in e19 compared to e14 embryos. These patterns of glucose and glycerol utilization suggest a metabolic shift to conserve glucose for glycogen synthesis and an increased utilization of yolk glycerol (from triacylglyceride) after e14. Although the contribution of glycerol to GNG in e19 embryos was higher (P < 0.05) than that in e14 embryos, the contribution of glycerol to GNG (1.3 to 6.0%) was minor. Based on [ 13 C 6 ]glucose tracer kinetics, the activities of both pyruvate carboxylase (PC) and pyruvate dehydrogenase (PDH) in the liver were higher (P < 0.05) in e19 embryos; whereas the higher (P < 0.01) relative activity of liver PC compared to PDH in e14 embryos suggests a greater anaplerotic flux into the Krebs cycle. In summary, the in ovo continuous tracer infusion approach allowed for a measurement of chicken embryo whole body and liver metabolism over a shorter window of development. This study provided quantitative estimates of the developmental shifts in substrate utilization, GNG, and NEAA synthesis by chicken embryos, as well as qualitative estimates of the activities of enzymes central to the Krebs cycle

Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.

PubMed

Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos

2016-08-29

α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed.

Synthesis and characterization of 3-ketohexadecanoic acid-1-14-C, DL-3-hydroxyhexadecanoic acid-1-14-C, and trans-2-hexadecenoic acid-1-14-C.

PubMed

Jones, J A; Blecher, M

1966-05-01

The chemical synthesis and characterization of three intermediates in the Beta oxidation of palmitic acid-1-(14)C by rat liver mitochondria, namely, 3-ketohexadecanoic acid-1-(14)C, DL-3-hydroxyhexadecanoic acid-1-(14)C, and trans-2-hexadecenoic acid-1-(14)C, are described.

α-Ketophosphonic Acid Esters — Synthesis, Structure, and Reactions

NASA Astrophysics Data System (ADS)

Zhdanov, Yu A.; Uzlova, L. A.; Glebova, Z. I.

1980-09-01

Studies on the synthesis and properties of α-ketophosphonic acid esters (KPE) — a class of highly reactive organophosphorus compounds — are surveyed. Data are presented concerning instances of the anomalous course of the process in the synthesis of KPE by the Arbuzov reaction. The reactions of KPE with nucleophiles, including those which lead to the rupture of the phosphorus-carbon bond, are examined in detail. The problems of the stereochemistry of KPE are dealt with briefly. The bibliography includes 162 references.

Physiological effects of γ-linolenic acid and sesamin on hepatic fatty acid synthesis and oxidation.

PubMed

Ide, Takashi; Iwase, Haruka; Amano, Saaya; Sunahara, Saki; Tachihara, Ayuka; Yagi, Minako; Watanabe, Tsuyoshi

2017-03-01

Interrelated effects of γ-linolenic acid (GLA) and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin) and containing 100 g/kg of palm oil (saturated fat), safflower oil rich in linoleic acid, or oil of evening primrose origin containing 43% GLA (GLA oil) for 18 days. In rats fed sesamin-free diets, GLA oil, compared with other oils, increased the activity and mRNA levels of various enzymes involved in fatty acid oxidation, except for some instances. Sesamin greatly increased these parameters, and the enhancing effects of sesamin on peroxisomal fatty acid oxidation rate and acyl-CoA oxidase, enoyl-CoA hydratase and acyl-CoA thioesterase activities were more exaggerated in rats fed GLA oil than in the animals fed other oils. The combination of sesamin and GLA oil also synergistically increased the mRNA levels of some peroxisomal fatty acid oxidation enzymes and of several enzymes involved in fatty acid metabolism located in other cell organelles. In the groups fed sesamin-free diets, GLA oil, compared with other oils, markedly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin reduced all these parameters, except for malic enzyme, in rats fed palm and safflower oils, but the effects were attenuated in the animals fed GLA oil. These changes by sesamin and fat type accompanied profound alterations in serum lipid levels. This may be ascribable to the changes in apolipoprotein-B-containing lipoproteins. Copyright © 2016 Elsevier Inc. All rights reserved.

Synthesis, characterization and reactivity of 3-mercaptopyruvic acid.

PubMed

Galardon, Erwan; Lec, Jean-Chrstophe

2018-05-20

A synthesis of the sulfur metabolic compound 3-mercaptopyruvic acid (3-MPH) is reported and allowed its isolation and characterization for the first time. Detailed kinetic, thermodynamic and spectroscopic studies of its complex behaviour in solution are discussed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Glass-ionomer cement formulations. II. The synthesis of novel polycarobxylic acids.

PubMed

Crisp, S; Kent, B E; Lewis, B G; Ferner, A J; Wilson, A D

1980-06-01

The synthesis of many polycarboxylic acids is reported. An account is given of their stability in aqueous solution and the properties of cements formed by their reaction with ion-leachable glasses. A copolymer of acrylic and itaconic acids was found to combine several favorable characteristics.

Synthesis and Hydrolytic Degradation of Substituted Poly(DL-Lactic Acid)s

PubMed Central

Tsuji, Hideto; Eto, Takehiko; Sakamoto, Yuzuru

2011-01-01

Non-substituted racemic poly(DL-lactic acid) (PLA) and substituted racemic poly(DL-lactic acid)s or poly(DL-2-hydroxyalkanoic acid)s with different side-chain lengths, i.e., poly(DL-2-hydroxybutanoic acid) (PBA), poly(DL-2-hydroxyhexanoic acid) (PHA), and poly(DL-2-hydroxydecanoic acid) (PDA) were synthesized by acid-catalyzed polycondensation of DL-lactic acid (LA), DL-2-hydroxybutanoic acid (BA), DL-2-hydroxyhexanoic acid (HA), and DL-2-hydroxydecanoic acid (DA), respectively. The hydrolytic degradation behavior was investigated in phosphate-buffered solution at 80 and 37 °C by gravimetry and gel permeation chromatography. It was found that the reactivity of monomers during polycondensation as monitored by the degree of polymerization (DP) decreased in the following order: LA > DA > BA > HA. The hydrolytic degradation rate traced by DP and weight loss at 80 °C decreased in the following order: PLA > PDA > PHA > PBA and that monitored by DP at 37 °C decreased in the following order: PLA > PDA > PBA > PHA. LA and PLA had the highest reactivity during polymerization and hydrolytic degradation rate, respectively, and were followed by DA and PDA. BA, HA, PBA, and PHA had the lowest reactivity during polymerization and hydrolytic degradation rate. The findings of the present study strongly suggest that inter-chain interactions play a major role in the reactivity of non-substituted and substituted LA monomers and degradation rate of the non-substituted and substituted PLA, along with steric hindrance of the side chains as can be expected. PMID:28824149

Metabolism of trans-3-hexadecenoic acid in broad bean.

PubMed

Harwood, J L; James, A T

1975-01-02

1. Broad bean (Vicia faba) leaves contain rather high concentrations (about 4% of total fatty acids) of the trans-3-hexadecenoic acid. 2. Amounts of the acid increase with the age of the leaves and are absent from etiolated tissue. 3. Changes in the levels of trans-delta-4-hexadecenoic acid can be produced by subjecting the intact plants to various light/dark periods. 4. Chloroplasts isolated from broad-bean leaves show high rates of fatty acid synthesis from [1-14C]acetate. Synthesis is dependent on coenzyme A and ATP but is insensitive to the addition of exogenous acyl carrier protein. 5. The pattern of acids made includes about 20% palmitic, 5% hexadeconoic, 10% stearic and 60% oleic. trans-3-Hexadecenoic acid synthesis was most active in chloroplasts from plants exposed to the dark for 5 days and light for 3 days. 6. Arsenite addition inhibited stearate formation by isolated chloroplasts but resulted in a two-fold stimulation of overall synthesis. 7. The rate of fatty acid synthesis by isolated chloroplasts paralleled the changes in endogenous trans-3-hexadecenoic acid levels in the leaves from which they were isolated.

Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.

PubMed

Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide

2012-05-18

A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.

Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid

PubMed Central

Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A.; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A.

2017-01-01

mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein–12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. PMID:28223357

Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid.

PubMed

Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A

2017-04-14

mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein-12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G 1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Synthesis and characterization of bis-thiourea having amino acid derivatives

NASA Astrophysics Data System (ADS)

Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah

2016-11-01

In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.

From N-triisopropylsilylpyrrole to an optically active C-4 substituted pyroglutamic acid: total synthesis of penmacric acid.

PubMed

Berini, Christophe; Pelloux-Léon, Nadia; Minassian, Frédéric; Denis, Jean-Noël

2009-11-07

The stereoselective synthesis of penmacric acid, an optically active C-4 substituted pyroglutamic acid, has been efficiently achieved through an unusual 11-step sequence starting from simple N-triisopropylsilylpyrrole. The key-steps are the initial addition of the pyrrole nucleus onto a chiral nitrone and the obtention of the pyroglutamic acid moiety by reductive hydrogenation of the pyrrole followed by oxidation of the corresponding pyrrolidine into pyrrolidinone.

Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

USDA-ARS?s Scientific Manuscript database

The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

Chemoselective synthesis of sialic acid 1,7-lactones.

PubMed

Allevi, Pietro; Rota, Paola; Scaringi, Raffaella; Colombo, Raffaele; Anastasia, Mario

2010-08-20

The chemoselective synthesis of the 1,7-lactones of N-acetylneuraminic acid, N-glycolylneuraminic acid, and 3-deoxy-d-glycero-d-galacto-nononic acid is accomplished in two steps: a simple treatment of the corresponding free sialic acid with benzyloxycarbonyl chloride and a successive hydrogenolysis of the formed 2-benzyloxycarbonyl 1,7-lactone. The instability of the 1,7-lactones to protic solvents has been also evidenced together with the rationalization of the mechanism of their formation under acylation conditions. The results permit to dispose of authentic 1,7-sialolactones to be used as reference standards and of a procedure useful for the preparation of their isotopologues to be used as inner standards in improved analytical procedures for the gas liquid chromatography-mass spectrometry (GLC-MS) analysis of 1,7-sialolactones in biological media.

Automated synthesis of N-(2-[18 F]Fluoropropionyl)-l-glutamic acid as an amino acid tracer for tumor imaging on a modified [18 F]FDG synthesis module.

PubMed

Liu, Shaoyu; Sun, Aixia; Zhang, Zhanwen; Tang, Xiaolan; Nie, Dahong; Ma, Hui; Jiang, Shende; Tang, Ganghua

2017-06-15

N-(2-[ 18 F]Fluoropropionyl)-l-glutamic acid ([ 18 F]FPGLU) is a potential amino acid tracer for tumor imaging with positron emission tomography. However, due to the complicated multistep synthesis, the routine production of [ 18 F]FPGLU presents many challenging laboratory requirements. To simplify the synthesis process of this interesting radiopharmaceutical, an efficient automated synthesis of [ 18 F]FPGLU was performed on a modified commercial fluorodeoxyglucose synthesizer via a 2-step on-column hydrolysis procedure, including 18 F-fluorination and on-column hydrolysis reaction. [ 18 F]FPGLU was synthesized in 12 ± 2% (n = 10, uncorrected) radiochemical yield based on [ 18 F]fluoride using the tosylated precursor 2. The radiochemical purity was ≥98%, and the overall synthesis time was 35 minutes. To further optimize the radiosynthesis conditions of [ 18 F]FPGLU, a brominated precursor 3 was also used for the preparation of [ 18 F]FPGLU, and the improved radiochemical yield was up to 20 ± 3% (n = 10, uncorrected) in 35 minutes. Moreover, all these results were achieved using the similar on-column hydrolysis procedure on the modified fluorodeoxyglucose synthesis module. Copyright © 2017 John Wiley & Sons, Ltd.

Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis.

PubMed

Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki; Dever, Thomas E

2017-08-21

Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

PubMed Central

Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

2015-01-01

To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

NASA Technical Reports Server (NTRS)

Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

2011-01-01

Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

NASA Astrophysics Data System (ADS)

Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

2014-03-01

MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.

Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lake, April D.; Novak, Petr; Shipkova, Petia

2013-04-15

Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BAmore » profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile

Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

PubMed Central

Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

2016-01-01

Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

Thyroid hormone reduces PCSK9 and stimulates bile acid synthesis in humans[S

PubMed Central

Bonde, Ylva; Breuer, Olof; Lütjohann, Dieter; Sjöberg, Stefan; Angelin, Bo; Rudling, Mats

2014-01-01

Reduced plasma LDL-cholesterol is a hallmark of hyperthyroidism and is caused by transcriptional stimulation of LDL receptors in the liver. Here, we investigated whether thyroid hormone (TH) actions involve other mechanisms that may also account for the reduction in LDL-cholesterol, including effects on proprotein convertase subtilisin/kexin type 9 (PCSK9) and bile acid synthesis. Twenty hyperthyroid patients were studied before and after clinical normalization, and the responses to hyperthyroidism were compared with those in 14 healthy individuals after 14 days of treatment with the liver-selective TH analog eprotirome. Both hyperthyroidism and eprotirome treatment reduced circulating PCSK9, lipoprotein cholesterol, apoB and AI, and lipoprotein(a), while cholesterol synthesis was stable. Hyperthyroidism, but not eprotirome treatment, markedly increased bile acid synthesis and reduced fibroblast growth factor (FGF) 19 and dietary cholesterol absorption. Eprotirome treatment, but not hyperthyroidism, reduced plasma triglycerides. Neither hyperthyroidism nor eprotirome treatment altered insulin, glucose, or FGF21 levels. TH reduces circulating PSCK9, thereby likely contributing to lower plasma LDL-cholesterol in hyperthyroidism. TH also stimulates bile acid synthesis, although this response is not critical for its LDL-lowering effect. PMID:25172631

Mitochondrial fatty acid synthesis, fatty acids and mitochondrial physiology.

PubMed

Kastaniotis, Alexander J; Autio, Kaija J; Kerätär, Juha M; Monteuuis, Geoffray; Mäkelä, Anne M; Nair, Remya R; Pietikäinen, Laura P; Shvetsova, Antonina; Chen, Zhijun; Hiltunen, J Kalervo

2017-01-01

Mitochondria and fatty acids are tightly connected to a multiplicity of cellular processes that go far beyond mitochondrial fatty acid metabolism. In line with this view, there is hardly any common metabolic disorder that is not associated with disturbed mitochondrial lipid handling. Among other aspects of mitochondrial lipid metabolism, apparently all eukaryotes are capable of carrying out de novo fatty acid synthesis (FAS) in this cellular compartment in an acyl carrier protein (ACP)-dependent manner. The dual localization of FAS in eukaryotic cells raises the questions why eukaryotes have maintained the FAS in mitochondria in addition to the "classic" cytoplasmic FAS and what the products are that cannot be substituted by delivery of fatty acids of extramitochondrial origin. The current evidence indicates that mitochondrial FAS is essential for cellular respiration and mitochondrial biogenesis. Although both β-oxidation and FAS utilize thioester chemistry, CoA acts as acyl-group carrier in the breakdown pathway whereas ACP assumes this role in the synthetic direction. This arrangement metabolically separates these two pathways running towards opposite directions and prevents futile cycling. A role of this pathway in mitochondrial metabolic sensing has recently been proposed. This article is part of a Special Issue entitled: Lipids of Mitochondria edited by Guenther Daum. Copyright © 2016 Elsevier B.V. All rights reserved.

Changes in tissue protein synthesis are involved in regulating urea synthesis in rats given proteins of different quality.

PubMed

Tujioka, Kazuyo; Lyou, Sunok; Sano, Atushi; Hayase, Kazutoshi; Yokogoshi, Hidehiko

2004-10-01

The purpose of present study was to determine whether the regulation of urea synthesis is mediated through changes in supply of amino acids by protein synthesis and whether the concentration of ammonia, or activities of amino acid catabolizing enzymes, regulate urea synthesis when the dietary protein quality is manipulated. Experiments were done on three groups of rats given diets containing 10 g gluten, 10 g casein or 10 g whole egg protein/100 g for 10 d. The urinary excretion of urea, and the liver concentrations of glutamate, serine and alanine increased with a decrease in quality of dietary protein. The fractional and absolute rates of protein synthesis in tissues declined with the decrease in quality of dietary protein quality. The ammonia concentration in plasma and liver, and activities of hepatic amino acid catabolizing enzymes was not related to urea excretion under these conditions. These results suggest that the lower protein synthesis seen in tissues of rats given the lower quality of protein is likely to be one of the factors to increasing the supply of amino acids and stimulating urea synthesis.

Calcite crystal growth rate inhibition by polycarboxylic acids

USGS Publications Warehouse

Reddy, M.M.; Hoch, A.R.

2001-01-01

Calcite crystal growth rates measured in the presence of several polycarboxyclic acids show that tetrahydrofurantetracarboxylic acid (THFTCA) and cyclopentanetetracarboxylic acid (CPTCA) are effective growth rate inhibitors at low solution concentrations (0.01 to 1 mg/L). In contrast, linear polycarbocylic acids (citric acid and tricarballylic acid) had no inhibiting effect on calcite growth rates at concentrations up to 10 mg/L. Calcite crystal growth rate inhibition by cyclic polycarboxyclic acids appears to involve blockage of crystal growth sites on the mineral surface by several carboxylate groups. Growth morphology varied for growth in the absence and in the presence of both THFTCA and CPTCA. More effective growth rate reduction by CPTCA relative to THFTCA suggests that inhibitor carboxylate stereochemical orientation controls calcite surface interaction with carboxylate inhibitors. ?? 20O1 Academic Press.

Synthesis of Rosin Acid Starch Catalyzed by Lipase

PubMed Central

Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

2014-01-01

Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156

Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis

PubMed Central

Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki

2017-01-01

Abstract Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. PMID:28637321

Control of the Protein Turnover Rates in Lemna minor

PubMed Central

Trewavas, A.

1972-01-01

The control of protein turnover in Lemna minor has been examined using a method described in the previous paper for determining the rate constants of synthesis and degradation of protein. If Lemna is placed on water, there is a reduction in the rate constants of synthesis of protein and an increase (3- to 6-fold) in the rate constant of degradation. The net effect is a loss of protein from the tissue. Omission of nitrate, phosphate, sulfate, magnesium, or calcium results in increases in the rate constant of degradation of protein. An unusual dual effect of benzyladenine on the turnover constants has been observed. Treatment of Lemna grown on sucrose-mineral salts with benzyladenine results in alterations only in the rate constant of synthesis. Treatment of Lemna grown on water with benzyladenine alters only the rate constant of degradation. Abscisic acid on the other hand alters both rate constants of synthesis and degradation of protein together. Inclusion of growth-inhibiting amino acids in the medium results in a reduction in the rate constants of synthesis and increases in the rate constant of degradation of protein. It is concluded that the rate of turnover of protein in Lemna is very dependent on the composition of the growth medium. Conditions which reduce growth rates also reduce the rates of synthesis of protein and increase those of degradation. PMID:16657895

Effect of penicillin on fatty acid synthesis and excretion in Streptococcus mutans BHT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brissette, J.L.; Pieringer, R.A.

Treatment of exponentially growing cultures of Streptococcus mutans BHT with growth-inhibitory concentrations (0.2 microgram/ml) of benzylpenicillin stimulates the incorporation of (2-/sup 14/C) acetate into lipids excreted by the cells by as much as 69-fold, but does not change the amount of /sup 14/C incorporated into intracellular lipids. At this concentration of penicillin cellular lysis does not occur. The radioactive label is incorporated exclusively into the fatty acid moieties of the glycerolipids. During a 4-hr incubation in the presence of penicillin, the extracellular fatty acid ester concentration increases 1.5 fold, even though there is no growth or cellular lysis. An indicationmore » of the relative rate of fatty acid synthesis was most readily obtained by placing S. mutans BHT in a buffer containing /sup 14/C-acetate. Under these nongrowing conditions free fatty acids are the only lipids labeled, a factor which simplifies the assay. The addition of glycerol to the buffer causes all of the nonesterified fatty acids to be incorporated into glycerolipid. The cells excrete much of the lipid whether glycerol is present or not. Addition of penicillin to the nongrowth supporting buffer system does not stimulate the incorporation of (/sup 14/C)-acetate into fatty acids.« less

Macromolecular Synthesis During the Germination of Saccharomyces cerevisiae Spores

PubMed Central

Rousseau, Paul; Halvorson, Harlyn O.

1973-01-01

After the dormancy of Saccharomyces cerevisiae ascospores had been broken, the synthesis of proteins was observed first, followed rapidly by synthesis of ribonucleic acid (RNA) and much later by deoxyribonucleic acid (DNA) synthesis. Phosphoglucomutase activity increased in a periodic (step) fashion, whereas the activity of five other enzymes increased linearly during germination and outgrowth. The rate of synthesis of these enzymes was highest at about the period of DNA replication. The amino acid pools of dormant spores contained high levels of proline, glutamic acid, and histidine. At 2 h after onset of germination, the pools of phenylalanine and methionine had disappeared and the other components had decreased significantly. By 3.5 h, with the exception of proline and cystine, most amino acid pool components had significantly increased. PMID:4570780

From synthesis to function via iterative assembly of N-methyliminodiacetic acid boronate building blocks.

PubMed

Li, Junqi; Grillo, Anthony S; Burke, Martin D

2015-08-18

The study and optimization of small molecule function is often impeded by the time-intensive and specialist-dependent process that is typically used to make such compounds. In contrast, general and automated platforms have been developed for making peptides, oligonucleotides, and increasingly oligosaccharides, where synthesis is simplified to iterative applications of the same reactions. Inspired by the way natural products are biosynthesized via the iterative assembly of a defined set of building blocks, we developed a platform for small molecule synthesis involving the iterative coupling of haloboronic acids protected as the corresponding N-methyliminodiacetic acid (MIDA) boronates. Here we summarize our efforts thus far to develop this platform into a generalized and automated approach for small molecule synthesis. We and others have employed this approach to access many polyene-based compounds, including the polyene motifs found in >75% of all polyene natural products. This platform further allowed us to derivatize amphotericin B, the powerful and resistance-evasive but also highly toxic last line of defense in treating systemic fungal infections, and thereby understand its mechanism of action. This synthesis-enabled mechanistic understanding has led us to develop less toxic derivatives currently under evaluation as improved antifungal agents. To access more Csp(3)-containing small molecules, we gained a stereocontrolled entry into chiral, non-racemic α-boryl aldehydes through the discovery of a chiral derivative of MIDA. These α-boryl aldehydes are versatile intermediates for the synthesis of many Csp(3) boronate building blocks that are otherwise difficult to access. In addition, we demonstrated the utility of these types of building blocks in accessing pharmaceutically relevant targets via an iterative Csp(3) cross-coupling cycle. We have further expanded the scope of the platform to include stereochemically complex macrocyclic and polycyclic molecules

Influence of virgin coconut oil-enriched diet on the transcriptional regulation of fatty acid synthesis and oxidation in rats - a comparative study.

PubMed

Arunima, Sakunthala; Rajamohan, Thankappan

2014-05-28

The present study was carried out to evaluate the effects of virgin coconut oil (VCO) compared with copra oil, olive oil and sunflower-seed oil on the synthesis and oxidation of fatty acids and the molecular regulation of fatty acid metabolism in normal rats. Male Sprague-Dawley rats were fed the test oils at 8 % for 45 d along with a synthetic diet. Dietary supplementation of VCO decreased tissue lipid levels and reduced the activity of the enzymes involved in lipogenesis, namely acyl CoA carboxylase and fatty acid synthase (FAS) (P< 0·05). Moreover, VCO significantly (P< 0·05) reduced the de novo synthesis of fatty acids by down-regulating the mRNA expression of FAS and its transcription factor, sterol regulatory element-binding protein-1c, compared with the other oils. VCO significantly (P< 0·05) increased the mitochondrial and peroxisomal β-oxidation of fatty acids, which was evident from the increased activities of carnitine palmitoyl transferase I, acyl CoA oxidase and the enzymes involved in mitochondrial β-oxidation; this was accomplished by up-regulating the mRNA expression of PPARα and its target genes involved in fatty acid oxidation. In conclusion, the present results confirmed that supplementation of VCO has beneficial effects on lipid parameters by reducing lipogenesis and enhancing the rate of fatty acid catabolism; this effect was mediated at least in part via PPARα-dependent pathways. Thus, dietary VCO reduces the risk for CHD by beneficially modulating the synthesis and degradation of fatty acids.

One-pot synthesis of bioactive cyclopentenones from α-linolenic acid and docosahexaenoic acid.

PubMed

Maynard, Daniel; Müller, Sara Mareike; Hahmeier, Monika; Löwe, Jana; Feussner, Ivo; Gröger, Harald; Viehhauser, Andrea; Dietz, Karl-Josef

2018-04-01

Oxidation products of the poly-unsaturated fatty acids (PUFAs) arachidonic acid, α-linolenic acid and docosahexaenoic acid are bioactive in plants and animals as shown for the cyclopentenones prostaglandin 15d-PGJ 2 and PGA 2 , cis-(+)-12-oxophytodienoic acid (12-OPDA), and 14-A-4 neuroprostane. In this study an inexpensive and simple enzymatic multi-step one-pot synthesis is presented for 12-OPDA, which is derived from α-linolenic acid, and the analogous docosahexaenoic acid (DHA)-derived cyclopentenone [(4Z,7Z,10Z)-12-[[-(1S,5S)-4-oxo-5-(2Z)-pent-2-en-1yl]-cyclopent-2-en-1yl] dodeca-4,7,10-trienoic acid, OCPD]. The three enzymes utilized in this multi-step cascade were crude soybean lipoxygenase or a recombinant lipoxygenase, allene oxide synthase and allene oxide cyclase from Arabidopsis thaliana. The DHA-derived 12-OPDA analog OCPD is predicted to have medicinal potential and signaling properties in planta. With OCPD in hand, it is shown that this compound interacts with chloroplast cyclophilin 20-3 and can be metabolized by 12-oxophytodienoic acid reductase (OPR3) which is an enzyme relevant for substrate bioactivity modulation in planta. Copyright © 2017 Elsevier Ltd. All rights reserved.

Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

USDA-ARS?s Scientific Manuscript database

Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

SYNTHESIS OF MIXED FULL AND SEMIESTERS OF PHOSPHOROUS ACID AS ORGANIC MOTOR OIL ADDITIVES,

DTIC Science & Technology

The synthesis of mixed full and semiesters of phosphonic acid was effected using alkylphenols produced by the chemical industry. By condensation of...industrial alkylphenol or the condensation of acid chloride of di-(alkylphenyl)-phosphorous acid with diethylamine, the corresponding mixed full and semiesters

Synthesis of fatty acids from [1-14C]acetylcoenzyme A in subcellular particles of rat epididymal adipose tissue

PubMed Central

Kanoh, H.; Lindsay, D. B.

1972-01-01

1. Mitochondrial and microsomal fractions of rat epididymal adipose tissue incorporated [1-14C]acetyl-CoA equally well into various fatty acids by a chain-elongation mechanism. C18 and C20 fatty acids were the two major products, and comprised about 80% of the total fatty acids synthesized in both particles. 2. When incubated in air, mitochondria synthesized stearic acid, octadecenoic acid and eicosamonoenoic acid in almost equal amounts (about 20% each), whereas in microsomal fractions, the synthesis of octadecenoic acid was more than fivefold the stearic acid formation. In both fractions, major components of synthesized monoenoic fatty acids were the Δ11:12 isomers. Hexadecenoic acid and octadecenoic acid from whole adipose tissue contained approx. 11 and 14% of the Δ11:12 isomer respectively. 3. When mitochondria or microsomal fractions were incubated in nitrogen, there was increased synthesis of stearic acid and palmitic acid and less of C16 and C18 monoenoic acids; synthesis of C20 acids remained predominantly of the monoenoic acids. Determination of the position of the double bond in the monoenoic acids supported the view that the synthesis of hexadecenoic acid and octadecenoic acid involves a desaturase activity, whereas eicosamonoenoic acid and eicosadienoic acid are formed only by elongation of endogenous fatty acids. 4. Most of the radioactivity was found in free fatty acids (63%) and the phospholipid (26%) fraction. In phospholipids, phosphatidylcholine and phosphatidylethanolamine were the two major components. 5. Most of the fatty acids synthesized, including those not normally found in particle lipids (arachidic acid, eicosamonoenoic acid and eicosadienoic acid) were distributed fairly evenly in the phospholipid and free fatty acid fractions. However, stearic acid was found predominantly in the phospholipid fraction. PMID:4638795

Neuromuscular electrical stimulation prior to presleep protein feeding stimulates the use of protein-derived amino acids for overnight muscle protein synthesis.

PubMed

Dirks, Marlou L; Groen, Bart B L; Franssen, Rinske; van Kranenburg, Janneau; van Loon, Luc J C

2017-01-01

Short periods of muscle disuse result in substantial skeletal muscle atrophy. Recently, we showed that both neuromuscular electrical stimulation (NMES) as well as presleep dietary protein ingestion represent effective strategies to stimulate muscle protein synthesis rates. In this study, we test our hypothesis that NMES can augment the use of presleep protein-derived amino acids for overnight muscle protein synthesis in older men. Twenty healthy, older [69 ± 1 (SE) yr] men were subjected to 24 h of bed rest, starting at 8:00 AM. In the evening, volunteers were subjected to 70-min 1-legged NMES, while the other leg served as nonstimulated control (CON). Immediately following NMES, 40 g of intrinsically l-[1- 13 C]-phenylalanine labeled protein was ingested prior to sleep. Blood samples were taken throughout the night, and muscle biopsies were obtained from both legs in the evening and the following morning (8 h after protein ingestion) to assess dietary protein-derived l-[1- 13 C]-phenylalanine enrichments in myofibrillar protein. Plasma phenylalanine concentrations and plasma l-[1- 13 C]-phenylalanine enrichments increased significantly following protein ingestion and remained elevated for up to 6 h after protein ingestion (P < 0.05). During overnight sleep, myofibrillar protein-bound l-[1- 13 C]-phenylalanine enrichments (MPE) increased to a greater extent in the stimulated compared with the control leg (0.0344 ± 0.0019 vs. 0.0297 ± 0.0016 MPE, respectively; P < 0.01), representing 18 ± 6% greater incorporation of presleep protein-derived amino acids in the NMES compared with CON leg. In conclusion, application of NMES prior to presleep protein feeding stimulates the use of dietary protein-derived amino acids for overnight muscle protein synthesis in older men. Neuromuscular electrical stimulation (NMES) as well as presleep dietary protein ingestion represent effective strategies to stimulate muscle protein synthesis rates. Here we demonstrate that in older

Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.

PubMed

Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra

2016-09-01

α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.

Fatty acid carbon is essential for dNTP synthesis in endothelial cells

PubMed Central

Missiaen, Rindert; Queiroz, Karla CS; Borgers, Gitte; Elia, Ilaria; Zecchin, Annalisa; Cantelmo, Anna Rita; Christen, Stefan; Goveia, Jermaine; Heggermont, Ward; Goddé, Lucica; Vinckier, Stefan; Van Veldhoven, Paul P.; Eelen, Guy; Schoonjans, Luc; Gerhardt, Holger; Dewerchin, Mieke; Baes, Myriam; De Bock, Katrien; Ghesquière, Bart; Lunt, Sophia Y.; Fendt, Sarah-Maria; Carmeliet, Peter

2015-01-01

The metabolism of endothelial cells (ECs) during vessel sprouting remains poorly studied. Here, we report that endothelial loss of CPT1a, a rate-limiting enzyme of fatty acid oxidation (FAO), caused vascular sprouting defects due to impaired proliferation, not migration of ECs. Reduction of FAO in ECs did not cause energy depletion or disturb redox homeostasis, but impaired de novo nucleotide synthesis for DNA replication. Isotope labeling studies in control ECs showed that fatty acid carbons substantially replenished the Krebs cycle, and were incorporated into aspartate (a nucleotide precursor), uridine monophosphate (a precursor of pyrimidine nucleoside triphosphates) and DNA. CPT1a silencing reduced these processes and depleted EC stores of aspartate and deoxyribonucleoside triphosphates. Acetate (metabolized to acetyl-CoA, thereby substituting for the depleted FAO-derived acetyl-CoA) or a nucleoside mix rescued the phenotype of CPT1a-silenced ECs. Finally, CPT1 blockade inhibited pathological ocular angiogenesis, suggesting a novel strategy for blocking angiogenesis. PMID:25830893

Low-protein, high-carbohydrate diet increases glucose uptake and fatty acid synthesis in brown adipose tissue of rats.

PubMed

Aparecida de França, Suélem; Pavani Dos Santos, Maísa; Nunes Queiroz da Costa, Roger Vinícius; Froelich, Mendalli; Buzelle, Samyra Lopes; Chaves, Valéria Ernestânia; Giordani, Morenna Alana; Pereira, Mayara Peron; Colodel, Edson Moleta; Marlise Balbinotti Andrade, Cláudia; Kawashita, Nair Honda

2014-04-01

The aim of this study was to evaluate glucose uptake and the contribution of glucose to fatty acid (FA) synthesis and the glycerol-3-phosphate (G3P) of triacylglycerol synthesis by interscapular brown adipose tissue (IBAT) of low-protein, high-carbohydrate (LPHC) diet-fed rats. LPHC (6% protein; 74% carbohydrate) or control (17% protein; 63% carbohydrate) diets were administered to rats (∼ 100 g) for 15 d. Total FA and G3P synthesis and the synthesis of FA and G3P from glucose were evaluated in vivo by (3)H2O and (14)C-glucose. Sympathetic neural contribution for FA synthesis was evaluated by comparing the synthesis in denervated (7 d before) IBAT with that of the contralateral innervated side. The insulin signaling and β3 adrenergic receptor (β3-AR) contents, as well as others, were determined by Western blot (Student's t test or analysis of variance; P ≤ 0.05). Total FA synthesis in IBAT was 133% higher in the LPHC group and was reduced 85% and 70% by denervation for the LPHC and control groups, respectively. Glucose uptake was 3.5-fold higher in the IBAT of LPHC rats than in that of the control rats, and the contribution of glucose to the total FA synthesis increased by 12% in control rats compared with 18% in LPHC rats. The LPHC diet increased the G3P generation from glucose by 270% and the insulin receptor content and the p-AKT insulin stimulation in IBAT by 120% and reduced the β3-AR content by 50%. The LPHC diet stimulated glucose uptake, both the total rates and the rates derived from glucose-dependent FA and G3P synthesis, by increasing the insulin sensitivity and the sympathetic flux, despite a reduction in the β3-AR content. Copyright © 2014 Elsevier Inc. All rights reserved.

A comparison of the metabolic fate of Fatty acids of different chain lengths in developing oilseeds.

PubMed

Battey, J F; Ohlrogge, J B

1989-07-01

To determine if medium and long chain fatty acids can be appropriately metabolized by species that normally produce 16 and 18 carbon fatty acids, homogenates of developing Cuphea wrightii, Carthamus tinctorius, and Crambe abyssinica seeds were incubated with radiolabeled lauric, palmitic, oleic, and erucic acids. In all three species, acyl-CoA synthetase showed broad substrate specificity in synthesis of acyl-coenzyme A (CoA) from any of the fatty acids presented. In Carthamus, two- to fivefold less of the foreign FAs, lauric, and erucic acid was incorporated into acyl-CoAs than palmitic and oleic acid. Lauric and erucic acid also supported less glycerolipid synthesis in Carthamus than palmitic and oleic acid, but the rate of acyl-CoA synthesis did not control rate of glycerolipid synthesis. In all species examined, medium and long chain fatty acids were incorporated predominantly into triacylglycerols and were almost excluded from phospholipid synthesis, whereas palmitic and oleic acid were found predominantly in polar lipids. However, the rate of esterification of unusual fatty acids to triacylglycerol is slow in species that do not normally synthesize these acyl substrates.

A Comparison of the Metabolic Fate of Fatty Acids of Different Chain Lengths in Developing Oilseeds

PubMed Central

Battey, James F.; Ohlrogge, John B.

1989-01-01

To determine if medium and long chain fatty acids can be appropriately metabolized by species that normally produce 16 and 18 carbon fatty acids, homogenates of developing Cuphea wrightii, Carthamus tinctorius, and Crambe abyssinica seeds were incubated with radiolabeled lauric, palmitic, oleic, and erucic acids. In all three species, acyl-CoA synthetase showed broad substrate specificity in synthesis of acyl-coenzyme A (CoA) from any of the fatty acids presented. In Carthamus, two- to fivefold less of the foreign FAs, lauric, and erucic acid was incorporated into acyl-CoAs than palmitic and oleic acid. Lauric and erucic acid also supported less glycerolipid synthesis in Carthamus than palmitic and oleic acid, but the rate of acyl-CoA synthesis did not control rate of glycerolipid synthesis. In all species examined, medium and long chain fatty acids were incorporated predominantly into triacylglycerols and were almost excluded from phospholipid synthesis, whereas palmitic and oleic acid were found predominantly in polar lipids. However, the rate of esterification of unusual fatty acids to triacylglycerol is slow in species that do not normally synthesize these acyl substrates. PMID:16666885

In vitro synthesis of 9,10-dihydroxyhexadecanoic acid using recombinant Escherichia coli.

PubMed

Kaprakkaden, Anees; Srivastava, Preeti; Bisaria, Virendra Swarup

2017-05-18

Hydroxy fatty acids are widely used in food, chemical and cosmetic industries. A variety of dihydroxy fatty acids have been synthesized so far; however, no studies have been done on the synthesis of 9,10-dihydroxyhexadecanoic acid. In the present study recombinant E. coli has been used for the heterologous expression of fatty acid hydroxylating enzymes and the whole cell lysate of the induced culture was used for in vitro production of 9,10-dihydroxyhexadecanoic acid. A first of its kind proof of principle has been successfully demonstrated for the production of 9,10-dihydroxyhexadecanoic acid using three different enzymes viz. fatty acid desaturase (FAD) from Saccharomyces cerevisiae, epoxide hydrolase (EH) from Caenorhabditis elegance and epoxygenase (EPOX) from Stokasia laevis. The genes for these proteins were codon-optimised, synthesised and cloned in pET 28a (+) vector. The culture conditions for induction of these three proteins in E. coli were optimised in shake flask. The induced cell lysates were used both singly and in combination along with the trans-supply of hexadecanoic acid and 9-hexadecenoic acid, followed by product profiling by GC-MS. Formation of 9,10-dihydroxyhexadecanoic acid was successfully achieved when combination of induced cell lysates of recombinant E. coli containing FAD, EH, and EPOX were incubated with 9-hexadecenoic acid. The in vitro production of 9,10-dihydroxyhexadecanoic acid synthesis using three fatty acid modification genes from different sources has been successfully demonstrated. The strategy adopted can be used for the production of similar compounds.

Synthesis of 14C-labeled perfluorooctanoic and perfluorodecanoic acids; Purification of perfluorodecanoic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reich, I.L.; Reich, H.J.; Menahan, L.A.

1987-01-01

Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.

Synthesis oftrans-3-hexadecenoic acid and oftrans-3-hexadecenoic-1-C(14) acid.

PubMed

Knipprath, W G; Stein, R A

1966-01-01

Thetrans-3-hexadecenoic acid has been synthesized. Physical properties and chemical degradation prove its identity with the acid earlier isolated from several plant lipids. In the sequence of the synthesis, the introduction of a terminal triple bond into commercially available 1-tetradecene was performed by bromination and debromination with KOH and NaNH(2). Chain elongation by a Grignard reaction with CO(2) gave a carboxylic acid with a triple bond in the 2-position. Reduction with LiAlH(4) yielded the corresponding alcohol, and reduction of the triple to thetrans double bond was accomplished with Na in ethanol. Bromination of the alcohol with PBr(3) and conversion of the bromide to the nitrile with KCN or KC(14)N elongated the carbon chain to the desired length. Methanolysis with HCl in methanol and saponification with KOH formed the acid with acceptable yields, and in the case of the C(14)-labeled carboxyl, group, with high specific activity.

Kinetic resolution and stereoselective synthesis of 3-substituted aspartic acids by using engineered methylaspartate ammonia lyases.

PubMed

Raj, Hans; Szymanski, Wiktor; de Villiers, Jandré; Puthan Veetil, Vinod; Quax, Wim J; Shimamoto, Keiko; Janssen, Dick B; Feringa, Ben L; Poelarends, Gerrit J

2013-08-19

Enzymatic amino acid synthesis: Kinetic resolution and asymmetric synthesis of various valuable 3-substituted aspartic acids, which were obtained in fair to good yields with diastereomeric ratio values of up to >98:2 and enantiomeric excess values of up to >99 %, by using engineered methylaspartate ammonia lyases are described. These biocatalytic methodologies for the selective preparation of aspartic acid derivatives appear to be attractive alternatives for existing chemical methods. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.

PubMed

Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij

2016-08-01

The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively).

Spin labeled amino acid nitrosourea derivatives--synthesis and antitumour activity.

PubMed

Zheleva, A; Raikov, Z; Ilarionova, M; Todorov, D

1995-01-01

The synthesis of three spin labeled derivatives of N-[N'-(chloroethyl)-N'-nitrosocarbamoyl] amino acids is reported. The new nitrosoureas are obtained by condensation of the corresponding N-[N'-(2-chloroethyl)-N'-nitrosocarbamoyl] amino acid with 2,2,6,6-tetramethyl-1-oxyl-4-aminopiperidine using dicyclohexylcarbodiimide. Their chemical structures are confirmed by elemental analysis, IR, MS, and EPR spectroscopy. All newly synthesized compounds showed high antitumour activity against the lymphoid leukemia L1210 in BDF1 mice.

Analyzing the effects of mechanical and osmotic loading on glycosaminoglycan synthesis rate in cartilaginous tissues.

PubMed

Gao, Xin; Zhu, Qiaoqiao; Gu, Weiyong

2015-02-26

The glycosaminoglycan (GAG) plays an important role in cartilaginous tissues to support and transmit mechanical loads. Many extracellular biophysical stimuli could affect GAG synthesis by cells. It has been hypothesized that the change of cell volume is a primary mechanism for cells to perceive the stimuli. Experimental studies have shown that the maximum synthesis rate of GAG is achieved at an optimal cell volume, larger or smaller than this level the GAG synthesis rate decreases. Based on the hypothesis and experimental findings in the literature, we proposed a mathematical model to quantitatively describe the cell volume dependent GAG synthesis rate in the cartilaginous tissues. Using this model, we investigated the effects of osmotic loading and mechanical loading on GAG synthesis rate. It is found our proposed mathematical model is able to well describe the change of GAG synthesis rate in isolated cells or in cartilage with variations of the osmotic loading or mechanical loading. This model is important for evaluating the GAG synthesis activity within cartilaginous tissues as well as understanding the role of mechanical loading in tissue growth or degeneration. It is also important for designing a bioreactor system with proper extracellular environment or mechanical loading for growing tissue at the maximum synthesis rate of the extracellular matrix. Copyright © 2015 Elsevier Ltd. All rights reserved.

Specificity and rate of human and mouse liver and plasma phosphatidylcholine synthesis analyzed in vivo[S

PubMed Central

Pynn, Christopher J.; Henderson, Neil G.; Clark, Howard; Koster, Grielof; Bernhard, Wolfgang; Postle, Anthony D.

2011-01-01

Phosphatidylcholine (PC) synthesis by the direct cytidine diphosphate choline (CDP-choline) pathway in rat liver generates predominantly mono- and di-unsaturated molecular species, while polyunsaturated PC species are synthesized largely by the phosphatidylethanolamine-N-methyltransferase (PEMT) pathway. Although altered PC synthesis has been suggested to contribute to development of hepatocarcinoma and nonalcoholic steatohepatitis, analysis of the specificity of hepatic PC metabolism in human patients has been limited by the lack of sensitive and safe methodologies. Here we incorporated a deuterated methyl-d9-labled choline chloride, to quantify biosynthesis fluxes through both of the PC synthetic pathways in vivo in human volunteers and compared these fluxes with those in mice. Rates and molecular specificities of label incorporated into mouse liver and plasma PC were very similar and strongly suggest that label incorporation into human plasma PC can provide a direct measure of hepatic PC synthesis in human subjects. Importantly, we demonstrate for the first time that the PEMT pathway in human liver is selective for polyunsaturated PC species, especially those containing docosahexaenoic acid. Finally, we present a multiple isotopomer distribution analysis approach, based on transfer of deuterated methyl groups to S-adenosylmethionine and subsequent sequential methylations of PE, to quantify absolute flux rates through the PEMT pathway that are applicable to studies of liver dysfunction in clinical studies. PMID:21068006

Lactic acid as an invaluable green solvent for ultrasound-assisted scalable synthesis of pyrrole derivatives.

PubMed

Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-Ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang

2015-09-01

Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. Copyright © 2015 Elsevier B.V. All rights reserved.

Fatty Acid Synthesis and Pyruvate Metabolism Pathways Remain Active in Dihydroartemisinin-Induced Dormant Ring Stages of Plasmodium falciparum

PubMed Central

Chen, Nanhua; LaCrue, Alexis N.; Teuscher, Franka; Waters, Norman C.; Gatton, Michelle L.; Kyle, Dennis E.

2014-01-01

Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment. PMID:24913167

Fatty acid synthesis and pyruvate metabolism pathways remain active in dihydroartemisinin-induced dormant ring stages of Plasmodium falciparum.

PubMed

Chen, Nanhua; LaCrue, Alexis N; Teuscher, Franka; Waters, Norman C; Gatton, Michelle L; Kyle, Dennis E; Cheng, Qin

2014-08-01

Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Growth and Synthesis of Nucleic Acid and Protein by Excised Radish Cotyledons 1

PubMed Central

Nieman, R. H.; Poulsen, L. L.

1967-01-01

Nutritional and light requirements for growth and synthesis of RNA, DNA, and protein by cotyledons excised from 5-day-old seedlings of Raphanus sativus L. were investigated, and the course of synthesis was followed through the cell cycle. The minimum requirements for a net increase in nucleic acid and protein were sugar, nitrate, and light. The cotyledons used nitrite at low concentration, but not ammonium ion. Light was required for preliminary steps in synthesis of RNA, DNA, and protein, but the actual polymerization reactions occurred in the dark. The cotyledons contained sufficient endogenous growth factors for about half of the cells to complete 1 cycle on a medium of 1% sucrose, 80 mm KNO3. The increase in DNA was limited to about 50% and was accompanied by a comparable increase in cell number. Fresh weight, RNA, and protein tended to increase in proportion to DNA. Growth of the isolated cotyledons commenced with cell enlargement. RNA began to increase after about 4 hours, DNA after about 12. The major increase in protein also began at about 12 hours. The maximum rate of increase for all 3 occurred between 12 and 16 hours. Cell counts indicated that by 28 hours most of the cells which had replicated DNA had also completed cell division. PMID:16656601

Enhanced skeletal muscle protein synthesis rates in pigs treated with somatotropin requires fed amino acids levels

USDA-ARS?s Scientific Manuscript database

Chronic somatotropin (pST) treatment in pigs increases skeletal muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin alone could not account for the pST-induced increase in protein synthesis. This study...

Medium-chain fatty acid synthesis in lactating-rabbit mammary gland. Intracellular concentration and specificity of medium-chain acyl thioester hydrolase.

PubMed Central

Knudsen, J

1979-01-01

The concentration of medium-chain acyl thioester hydrolase and of fatty acid synthetase was determined by rocket immunoelectrophoresis in nine different particle-free supernatant fractions from lactating-rabbit mammary gland. The molar ratio of the hydrolase to fatty acid synthetase was 1.99 +/- 0.66 (mean +/- S.D.). A rate-limiting concentration of malonyl-CoA was required to ensure the predominant synthesis of medium-chain fatty acids when 2 mol of the hydrolase was added per mol of fatty acid synthetase. The interaction of the hydrolase with fatty acid synthetase was concentration-dependent, though an optimum concentration of hydrolase to synthetase could not be obtained. The lactating-rabbit mammary gland hydrolase altered the pattern of fatty acids synthesized by fatty acid synthetases prepared from cow, goat, sheep and rabbit lactating mammary glands, rabbit liver and cow adipose tissue. PMID:574008

Antibacterial activity of lichen secondary metabolite usnic acid is primarily caused by inhibition of RNA and DNA synthesis.

PubMed

Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata

2014-04-01

Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Tuning of acyl-ACP thioesterase activity directed for tailored fatty acid synthesis.

PubMed

Feng, Yanbin; Zhang, Yunxiu; Wang, Yayue; Liu, Jiao; Liu, Yinghui; Cao, Xupeng; Xue, Song

2018-04-01

Medium-chain fatty acids have attracted significant attention as sources of biofuels in recent years. Acyl-ACP thioesterase, which is considered as the key enzyme to determine the carbon chain length, catalyzes the termination of de novo fatty acid synthesis. Although recombinant medium-chain acyl-ACP thioesterase (TE) affects the fatty acid profile in heterologous cells, tailoring of the fatty acid composition merely by engineering a specific TE is still intractable. In this study, the activity of a C8-C10-specific thioesterase FatB2 from Cuphea hookeriana on C10-ACP was quantified twice as high as that on C8-ACP based on a synthetic C8-C16 acyl-ACP pool in vitro. Whereas in vivo, it was demonstrated that ChFatB2 preferred to accumulate C8 fatty acids with 84.9% composition in the ChFatB2-engineered E. coli strain. To achieve C10 fatty acid production, ChFatB2 was rationally tuned based on structural investigation and enzymatic analysis. An I198E mutant was identified to redistribute the C8-ACP flow, resulting in C10 fatty acid being produced as the principal component at 57.6% of total fatty acids in vivo. It was demonstrated that the activity of TE relative to β-ketoacyl-ACP synthases (KAS) directly determined the fatty acid composition. Our results provide a prospective strategy in tailoring fatty acid synthesis by tuning of TE activities based on TE-ACP interaction.

Kinetics of enzymatic synthesis of liquid wax ester from oleic acid and oleyl alcohol.

PubMed

Radzi, Salina Mat; Mohamad, Rosfarizan; Basri, Mahiran; Salleh, Abu Bakar; Ariff, Arbakariya; Rahman, Mohammad Basyaruddin Abdul; Rahman, Raja Noor Zaliha Raja Abdul

2010-01-01

The kinetics of wax ester synthesis from oleic acid and oleyl alcohol using immobilized lipase from Candida antartica as catalyst was studied with different types of impeller (Rushton turbine and AL-hydrofoil) to create different mixing conditions in 2l stirred tank reactor. The effects of catalyst concentration, reaction temperature, and impeller tip speed on the synthesis were also evaluated. Rushton turbine impeller exhibited highest conversion rate at lower impeller tip speed as compared to AL-hydrofoil impeller. A second-order reversible kinetic model from single progress curve for the prediction of fractional conversion at given reaction time was proposed and the corresponding kinetic parameter values were calculated by non-linear regression method. The results from the simulation using the proposed model showed satisfactory agreement with the experimental data. Activation energy shows a value of 21.77 Kcal/mol. The thermodynamic parameters of the process, enthalpy and entropy, were 21.15 Kcal/mol and 52.07 cal/mol.K, respectively.

Dipeptide derivative synthesis catalyzed by Pseudomonas aeruginosa elastase.

PubMed

Rival, S; Besson, C; Saulnier, J; Wallach, J

1999-02-01

Pseudomonas aeruginosa elastase was used to synthesize various N-protected dipeptide amides. The identity of the products was confirmed by FAB(+)-MS. After recrystallization, the yield of their synthesis was calculated, their purity was checked by RP-HPLC and their melting point was measured. With regard to the hydrolysis, it is well-established that the enzyme prefers hydrophobic amino acids in P'1 position and it has a wide specificity for the P1 position. This specificity was demonstrated to be quite unchanged when comparing the initial rates of peptide bond formation between different carboxyl donors (Z-aa) and nucleophiles (aa-NH2). The elastase, but not the thermolysin, was notably able to incorporate tyrosine and tryptophan in P'1 position. Furthermore, synthesis initial rates were at least 100 times faster with the elastase. To overcome the problematic condensation of some amino acids during chemical peptide synthesis, it has been previously suggested that enzymatic steps can combine with a chemical strategy. We demonstrated that the elastase readily synthesizes dipeptide derivatives containing various usual N-protecting groups. It was especially able to condense phenylalaninamide to Fmoc- and Boc-alanine. Increasing interest in peptides containing unnatural amino acids led us to try the elastase-catalyzed synthesis of Z-dipeptide amides including those amino acids in the P1 position. A synthesis was demonstrated with alphaAbu, Nle, Nva and Phg.

Fed levels of amino acids are required for the somatotropin-induced increase in muscle protein synthesis

USDA-ARS?s Scientific Manuscript database

Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were...

Formal synthesis of berkelic acid: a lesson in α-alkylation chemistry.

PubMed

McLeod, Michael C; Wilson, Zoe E; Brimble, Margaret A

2012-01-06

The full details of our enantioselective formal synthesis of the biologically active natural product berkelic acid are described. The insertion of the C-18 methyl group proved challenging, with three different approaches investigated to install the correct stereochemistry. Our initial Horner-Wadsworth-Emmons/oxa-Michael approach to the berkelic acid core proved unsuccessful upon translation to the natural product itself. However, addition of a silyl enol ether to an oxonium ion, followed by a one-pot debenzylation/spiroketalisation/thermodynamic equilibration procedure, afforded the tetracyclic structure of the berkelic acid core as a single diastereoisomer.

Valproate induced hepatic steatosis by enhanced fatty acid uptake and triglyceride synthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bai, Xupeng; Hong, Weipeng; Cai, Peiheng

Steatosis is the characteristic type of VPA-induced hepatotoxicity and may result in life-threatening hepatic lesion. Approximately 61% of patients treated with VPA have been diagnosed with hepatic steatosis through ultrasound examination. However, the mechanisms underlying VPA-induced intracellular fat accumulation are not yet fully understood. Here we demonstrated the involvement of fatty acid uptake and lipogenesis in VPA-induced hepatic steatosis in vitro and in vivo by using quantitative real-time PCR (qRT-PCR) analysis, western blotting analysis, fatty acid uptake assays, Nile Red staining assays, and Oil Red O staining assays. Specifically, we found that the expression of cluster of differentiation 36 (CD36),more » an important fatty acid transport, and diacylglycerol acyltransferase 2 (DGAT2) were significantly up-regulated in HepG2 cells and livers of C57B/6J mice after treatment with VPA. Furthermore, VPA treatment remarkably enhanced the efficiency of fatty acid uptake mediated by CD36, while this effect was abolished by the interference with CD36-specific siRNA. Also, VPA treatment significantly increased DGAT2 expression as a result of the inhibition of mitogen-activated protein kinase kinase (MEK) – extracellular regulated kinase (ERK) pathway; however, DGAT2 knockdown significantly alleviated VPA-induced intracellular lipid accumulation. Additionally, we also found that sterol regulatory element binding protein-1c (SREBP-1c)-mediated fatty acid synthesis may be not involved in VPA-induced hepatic steatosis. Overall, VPA-triggered over-regulation of CD36 and DGAT2 could be helpful for a better understanding of the mechanisms underlying VPA-induced hepatic steatosis and may offer novel therapeutic strategies to combat VPA-induced hepatotoxicity. - Highlights: • VPA induced hepatic steatosis and modulated genes associated with lipid metabolism. • CD36-mediated fatty acid uptake contributed to VPA-induced lipid accumulation. • PA increased the

Hypophosphatemia promotes lower rates of muscle ATP synthesis.

PubMed

Pesta, Dominik H; Tsirigotis, Dimitrios N; Befroy, Douglas E; Caballero, Daniel; Jurczak, Michael J; Rahimi, Yasmeen; Cline, Gary W; Dufour, Sylvie; Birkenfeld, Andreas L; Rothman, Douglas L; Carpenter, Thomas O; Insogna, Karl; Petersen, Kitt Falk; Bergwitz, Clemens; Shulman, Gerald I

2016-10-01

Hypophosphatemia can lead to muscle weakness and respiratory and heart failure, but the mechanism is unknown. To address this question, we noninvasively assessed rates of muscle ATP synthesis in hypophosphatemic mice by using in vivo saturation transfer [ 31 P]-magnetic resonance spectroscopy. By using this approach, we found that basal and insulin-stimulated rates of muscle ATP synthetic flux (V ATP ) and plasma inorganic phosphate (P i ) were reduced by 50% in mice with diet-induced hypophosphatemia as well as in sodium-dependent P i transporter solute carrier family 34, member 1 (NaPi2a)-knockout (NaPi2a -/- ) mice compared with their wild-type littermate controls. Rates of V ATP normalized in both hypophosphatemic groups after restoring plasma P i concentrations. Furthermore, V ATP was directly related to cellular and mitochondrial P i uptake in L6 and RC13 rodent myocytes and isolated muscle mitochondria. Similar findings were observed in a patient with chronic hypophosphatemia as a result of a mutation in SLC34A3 who had a 50% reduction in both serum P i content and muscle V ATP After oral P i repletion and normalization of serum P i levels, muscle V ATP completely normalized in the patient. Taken together, these data support the hypothesis that decreased muscle ATP synthesis, in part, may be caused by low blood P i concentrations, which may explain some aspects of muscle weakness observed in patients with hypophosphatemia.-Pesta, D. H., Tsirigotis, D. N., Befroy, D. E., Caballero, D., Jurczak, M. J., Rahimi, Y., Cline, G. W., Dufour, S., Birkenfeld, A. L., Rothman, D. L., Carpenter, T. O., Insogna, K., Petersen, K. F., Bergwitz, C., Shulman, G. I. Hypophosphatemia promotes lower rates of muscle ATP synthesis. © The Author(s).

Hypophosphatemia promotes lower rates of muscle ATP synthesis

PubMed Central

Pesta, Dominik H.; Tsirigotis, Dimitrios N.; Befroy, Douglas E.; Caballero, Daniel; Jurczak, Michael J.; Rahimi, Yasmeen; Cline, Gary W.; Dufour, Sylvie; Birkenfeld, Andreas L.; Rothman, Douglas L.; Carpenter, Thomas O.; Insogna, Karl; Petersen, Kitt Falk; Bergwitz, Clemens; Shulman, Gerald I.

2016-01-01

Hypophosphatemia can lead to muscle weakness and respiratory and heart failure, but the mechanism is unknown. To address this question, we noninvasively assessed rates of muscle ATP synthesis in hypophosphatemic mice by using in vivo saturation transfer [31P]-magnetic resonance spectroscopy. By using this approach, we found that basal and insulin-stimulated rates of muscle ATP synthetic flux (VATP) and plasma inorganic phosphate (Pi) were reduced by 50% in mice with diet-induced hypophosphatemia as well as in sodium-dependent Pi transporter solute carrier family 34, member 1 (NaPi2a)-knockout (NaPi2a−/−) mice compared with their wild-type littermate controls. Rates of VATP normalized in both hypophosphatemic groups after restoring plasma Pi concentrations. Furthermore, VATP was directly related to cellular and mitochondrial Pi uptake in L6 and RC13 rodent myocytes and isolated muscle mitochondria. Similar findings were observed in a patient with chronic hypophosphatemia as a result of a mutation in SLC34A3 who had a 50% reduction in both serum Pi content and muscle VATP. After oral Pi repletion and normalization of serum Pi levels, muscle VATP completely normalized in the patient. Taken together, these data support the hypothesis that decreased muscle ATP synthesis, in part, may be caused by low blood Pi concentrations, which may explain some aspects of muscle weakness observed in patients with hypophosphatemia.—Pesta, D. H., Tsirigotis, D. N., Befroy, D. E., Caballero, D., Jurczak, M. J., Rahimi, Y., Cline, G. W., Dufour, S., Birkenfeld, A. L., Rothman, D. L., Carpenter, T. O., Insogna, K., Petersen, K. F., Bergwitz, C., Shulman, G. I. Hypophosphatemia promotes lower rates of muscle ATP synthesis. PMID:27338702

5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group

DOEpatents

Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude

1999-01-01

The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

4-Methylene-2-octyl-5-oxotetrahydrofuran-3-carboxylic Acid (C75), an Inhibitor of Fatty-acid Synthase, Suppresses the Mitochondrial Fatty Acid Synthesis Pathway and Impairs Mitochondrial Function*

PubMed Central

Chen, Cong; Han, Xiao; Zou, Xuan; Li, Yuan; Yang, Liang; Cao, Ke; Xu, Jie; Long, Jiangang; Liu, Jiankang; Feng, Zhihui

2014-01-01

4-Methylene-2-octyl-5-oxotetrahydrofuran-3-carboxylic acid (C75) is a synthetic fatty-acid synthase (FASN) inhibitor with potential therapeutic effects in several cancer models. Human mitochondrial β-ketoacyl-acyl carrier protein synthase (HsmtKAS) is a key enzyme in the newly discovered mitochondrial fatty acid synthesis pathway that can produce the substrate for lipoic acid (LA) synthesis. HsmtKAS shares conserved catalytic domains with FASN, which are responsible for binding to C75. In our study, we explored the possible effect of C75 on HsmtKAS and mitochondrial function. C75 treatment decreased LA content, impaired mitochondrial function, increased reactive oxygen species content, and reduced cell viability. HsmtKAS but not FASN knockdown had an effect that was similar to C75 treatment. In addition, an LA supplement efficiently inhibited C75-induced mitochondrial dysfunction and oxidative stress. Overexpression of HsmtKAS showed cellular protection against low dose C75 addition, whereas there was no protective effect upon high dose C75 addition. In summary, the mitochondrial fatty acid synthesis pathway has a vital role in mitochondrial function. Besides FASN, C75 might also inhibit HsmtKAS, thereby reducing LA production, impairing mitochondrial function, and potentially having toxic effects. LA supplements sufficiently ameliorated the toxicity of C75, showing that a combination of C75 and LA may be a reliable cancer treatment. PMID:24784139

Lipase-catalyzed synthesis of fattythioic acids from palm oil.

PubMed

Al-Mulla, Emad A Jaffar

2011-01-01

The present work focuses on the synthesis of fattythioic acids (FTAs) by a one-step lipase catalyzed reaction of palm oil with carbonothioic S,S-acid using Lipozyme. The product was characterized using Fourier transform infrared (FTIR) spectroscopy, proton nuclear magnetic resonance ((1)H NMR) technique and elemental analysis. The effects of various reaction parameters such as reaction time, temperature, amount of enzyme, molar ratio of substrates, and various organic solvents of the reaction system were investigated. The optimum conditions to produce FTAs were respectively, incubation time, 20 h, temperature, 40°C, amount of enzyme, 0.05 g and molar ratio of carbonothioic S,S-acid to palm oil, 5.0:1.0. Hexane was the best solvent for this reaction. The conversion of the products at optimum conditions was around 91%.

Synthesis of glyceryl ferulate by immobilized ferulic acid esterase.

PubMed

Matsuo, Takemasa; Kobayashi, Takashi; Kimura, Yukitaka; Tsuchiyama, Moriyasu; Oh, Tadanobu; Sakamoto, Tatsuji; Adachi, Shuji

2008-12-01

Glyceryl ferulate was synthesized by the condensation of ferulic acid with glycerol using Pectinase PL "Amano" from Aspergillus niger, which contained ferulic acid esterase, to improve the water-solubility of ferulic acid. The optimum reaction medium was glycerol/0.1 M acetate buffer, pH 4.0, (98:2 v/v). The enzyme immobilized onto Chitopearl BCW3003 exhibited the highest activity among the those immobilized onto various kinds of Chitopearl BCW resins. The optimum temperature for the immobilized enzyme was 50 degrees C, and it could be reused at least five times without a significant loss in activity for the synthesis of glyceryl ferulate in batch reaction. Storage of the reaction mixture at 25 degrees C improved the molar fraction of glyceryl ferulate relative to the dissolved ferulic residues.

The effect of folic acid on porphyrin synthesis in tumors and normal skin of mice treated with 5-aminolevulinic acid or methyl 5-aminolevulinate.

PubMed

Ma, LiWei; Steindal, Arnfinn E; Juzeniene, Asta; Iani, Vladimir; Moan, Johan

2006-08-01

5-Aminolevulinic acid (ALA) or its derivative methyl 5-aminolevulinate (MAL) combined with folic acid was applied in nude mice bearing human colon adenocarcinoma. The aim of the study is to see whether folic acid may increase biosynthesis of porphyrins in tumor tissue after systemic or topical administration of ALA or MAL. The production of porphyrins was determined by spectrofluorometric measurements with an optical fibre probe. It was found that the porphyrin production after i.p injection of 200 mg kg(-1) ALA or MAL was significantly increased by i.p injection of 100 mg kg(-1) folic acid. However, in the case of topically applied 20% ALA, folic acid had no effect. In the case of topically applied 20% MAL, folic acid (i.p or topically applied) reduced the porphyrin synthesis. This might be used for the protection of normal skin against photosensitization. The effects of folic acid were similar in tumors and normal skin. Two mechanisms may explain the results: enhancement of the efficiency of the rate-limiting enzyme porphobilinogen deaminase by folic acid or interference of folic acid with the transport of ALA and MAL to and into the cells synthesizing porphyrins in the tissues. The present data seem to favour the latter mechanism. Folic acid may have a role as an adjuvant in photodynamic therapy with systemically administered ALA and its derivatives.

SYNTHESIS OF H$sup 3$-LABELED AMINO ACIDS WITH HIGH SPECIFIC ACTIVITY AND THEIR APPLICATION FOR HISTOAUTORADIOGRAPHY

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hempel, K.

1962-01-01

New methods for synthesis of tritium-labeled amino acids with high specific activity (1000 mc/m mole and above) are described. Changes in tritium- labeled amino acids during storage are studied. An absorbed BETA energy of 10/ sup 5/ rad results in radiochemical disintegration of 1.5%. Autoradiographic studies were made with several amino acids. It was demonstrated that protein production is 2 to 3 times higher in butter-vellux, tumors than in liver tissue. Synthesis of melanine was studied in vivo with melanineproducing tumors. (Gmelin Inst.)

Facile total synthesis and antimicrobial activity of the marine fatty acids (Z)-2-methoxy-5-hexadecenoic acid and (Z)-2-methoxy-6-hexadecenoic acid.

PubMed

Carballeira, N M; Emiliano, A; Hernández-Alonso, N; González, F A

1998-12-01

The total synthesis of the naturally occurring (Z)-2-methoxy-5-hexadecenoic acid and (Z)-2-methoxy-6-hexadecenoic acid was accomplished using as a key step Mukaiyama's trimethylsilyl cyanide addition to 4- and 5-pentadecenal, respectively. These syntheses further confirm the structures of the natural marine fatty acids and corroborate their cis double-bond stereochemistry. The title compounds were antimicrobial against the Gram-positive bacteria Staphylococcus aureus (MIC 0.35 micromol/mL) and Streptococcus faecalis (MIC 0.35 micromol/mL).

Chemo-Enzymatic Synthesis of Each Enantiomer of Orthogonally-Protected 4,4-Difluoroglutamic Acid – A Candidate Monomer for Chiral Brønsted-Acid Peptide-Based Catalysts

PubMed Central

Li, Yang

2011-01-01

We have accomplished an asymmetric synthesis of each enantiomer of 4,4-difluoroglutamic acid. This α-amino acid has been of interest in medicinal chemistry circles. Key features of the synthesis include highly scalable procedures, a Reformatsky-based coupling reaction, and straightforward functional group manipulations to make the parent amino acid. Enantioenrichment derives from an enzymatic resolution of the synthetic material. Conversion of the optically enriched compounds to orthogonally protected forms allows selective formation of peptide bonds. 4,4- Difluoroglutamic acid, in a suitably protected form, is also shown to exhibit enhanced catalytic activity in both an oxidation reaction and a reduction reaction, in comparison to the analogous glutamic acid derivative. PMID:22039908

β-Functionalization of Indolin-2-one-Derived Aliphatic Acids for the Divergent Synthesis of Spirooxindole γ-Butyrolactones.

PubMed

Cao, Jing; Dong, Shuding; Jiang, Delu; Zhu, Peiyu; Zhang, Han; Li, Rui; Li, Zhanyi; Wang, Xuanyu; Tang, Weifang; Du, Ding

2017-04-21

β-Functionalization of indolin-2-one-derived aliphatic acids has been applied in formal [3 + 2] annualtions for catalyst-free and divergent synthesis of two series of structurally interesting 3,3'-spirooxindole γ-butyrolactones that may be attractive for potential drug discovery. These findings also pave the way for further diversity-oriented synthesis of spirooxindoles starting from indolin-2-one-derived aliphatic acids or their derivatives.

Induction of Crassulacean Acid Metabolism in Mesembryanthemum crystallinum by High Salinity: Mass Increase and de Novo Synthesis of PEP-Carboxylase 1

PubMed Central

Höfner, Roswitha; Vazquez-Moreno, Luz; Winter, Klaus; Bohnert, Hans J.; Schmitt, Jürgen M.

1987-01-01

Intact plants of the halophilic species Mesembryanthemum crystallinum were induced to exhibit Crassulacean acid metabolism by irrigation with nutrient solution containing 500 millimolar NaCl. During the induction period, the extractable activity of phosphoenolpyruvate carboxylase (PEPcase) increased approximately 40-fold. This increase was linearly correlated with a mass increase of PEPcase protein as measured by single radial immunodiffusion. De novo synthesis of PEPcase protein was shown by immunoprecipitation of the newly synthesized, radioactively labeled protein in leaf discs from salt-treated plants. Nontreated plants were characterized by a low level of the enzyme and low rates of PEPcase synthesis. Synthesis of this enzyme in leaf discs was correlated with the concentration of NaCl in the nutrient solution during growth. Images Fig. 1 Fig. 2 Fig. 3 PMID:16665363

One-Pot synthesis of phosphorylated mesoporous carbon heterogeneous catalysts with tailored surface acidity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T

2012-01-01

Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contentsmore » were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.« less

Salutary effect of Aurintricarboxylic acid (ATA) on endotoxin- and sepsis-induced changes in muscle protein synthesis and inflammation

PubMed Central

Laufenberg, Lacee; Kazi, Abid A.; Lang, Charles H.

2014-01-01

Small molecule nonpeptidyl molecules are potentially attractive drug candidates as adjunct therapies in the treatment of sepsis-induced metabolic complications. As such, the current study investigates the use of aurintricarboxylic acid (ATA), which stimulates insulin-like growth factor (IGF)-I receptor and AKT signaling, for its ability to ameliorate the protein metabolic effects of endotoxin (LPS) + interferon (IFN)γ in C2C12 myotubes and sepsis in skeletal muscle. ATA dose- and time-dependently increases mTOR-dependent protein synthesis. Pretreatment with ATA prevents the LPS/IFNγ-induced decrease in protein synthesis at least in part by maintaining mTOR kinase activity, while post-treatment with ATA is able to increase protein synthesis when added up to 6 h after LPS/IFNγ. ATA also reverses the amino acid resistance which is detected in response to nutrient deprivation. Conversely, ATA decreases the basal rate of protein degradation and prevents the LPS/IFNγ-increase in proteolysis, and the latter change is associated reduced atrogin-1 and MuRF1 mRNA. The ability of ATA to antagonize LPS/IFNγ-induced changes in protein metabolism were associated with its ability to prevent the increases in IL-6 and NOS2 and decreases in IGF-I. In vivo studies indicate ATA acutely increases skeletal muscle, but not cardiac, protein synthesis, and attenuates the loss of lean body mass over 5 days. These data suggest ATA and other small molecule agonists of endogenous anabolic hormones may prove beneficial in treating sepsis by decreasing the inflammatory response and improving muscle protein balance. PMID:24430547

Habituation to low or high protein intake does not modulate basal or postprandial muscle protein synthesis rates: a randomized trial.

PubMed

Gorissen, Stefan Hm; Horstman, Astrid Mh; Franssen, Rinske; Kouw, Imre Wk; Wall, Benjamin T; Burd, Nicholas A; de Groot, Lisette Cpgm; van Loon, Luc Jc

2017-02-01

of dietary protein-derived amino acids in the circulation and does not lower basal muscle protein synthesis rates or increase postprandial muscle protein synthesis rates after ingestion of 25 g protein in older men. This trial was registered at clinicaltrials.gov as NCT01986842. © 2017 American Society for Nutrition.

Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies

PubMed Central

Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa

2014-01-01

In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

Abscisic Acid Synthesis and Response

PubMed Central

Finkelstein, Ruth

2013-01-01

Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

Chiral Sugars Drive Enantioenrichment in Prebiotic Amino Acid Synthesis.

PubMed

Wagner, Alexander J; Zubarev, Dmitry Yu; Aspuru-Guzik, Alán; Blackmond, Donna G

2017-04-26

Chiral pentose sugars mediate the enantioselective synthesis of amino acid precursors, with the magnitude of the chiral induction dictated by a subtle cooperativity between sugar hydroxyl groups. Ribose and lyxose give opposite chiral preferences, and theoretical calculations reveal the pseudoenantiomeric nature of transition state structures from the two sugars. Prebiotically plausible mixtures of natural d-sugars lead to enantioenrichment of natural l-amino acid precursors. Temporal monitoring and kinetic modeling of the reaction reveal an unusual dynamic kinetic resolution that shifts toward an enantioselective pathway over time, providing an amplification mechanism for the transfer of chiral information. This work adds to growing evidence for synergy in the etiology of the single chirality of the two most important classes of biological molecules, the sugars that make up DNA and RNA and the amino acids that form proteins.

Chiral Sugars Drive Enantioenrichment in Prebiotic Amino Acid Synthesis

PubMed Central

2017-01-01

Chiral pentose sugars mediate the enantioselective synthesis of amino acid precursors, with the magnitude of the chiral induction dictated by a subtle cooperativity between sugar hydroxyl groups. Ribose and lyxose give opposite chiral preferences, and theoretical calculations reveal the pseudoenantiomeric nature of transition state structures from the two sugars. Prebiotically plausible mixtures of natural d-sugars lead to enantioenrichment of natural l-amino acid precursors. Temporal monitoring and kinetic modeling of the reaction reveal an unusual dynamic kinetic resolution that shifts toward an enantioselective pathway over time, providing an amplification mechanism for the transfer of chiral information. This work adds to growing evidence for synergy in the etiology of the single chirality of the two most important classes of biological molecules, the sugars that make up DNA and RNA and the amino acids that form proteins. PMID:28470050

Spillover of dietary fatty acids and use of serum nonesterified fatty acids for the synthesis of VLDL-triacylglycerol under two different feeding regimens.

PubMed

Barrows, Brian R; Timlin, Maureen T; Parks, Elizabeth J

2005-09-01

The present study quantified dietary fatty acid flux in healthy men (n = 6) who were fed a liquid formula through a duodenal feeding tube (continuous feeding group) or who consumed the same formula in meals (meal feeding group). A triacylglycerol (TAG) stable isotope was added to the formula to determine the entry of dietary fatty acids into the serum and its clearance to the liver and resecretion into serum via VLDL. The contribution of dietary fatty acids to serum nonesterified fatty acids (NEFAs) was higher with meal feeding (24.4 +/- 2.6%) compared with continuous feeding (10.8 +/- 2.9%, P < 0.01) and, when multiplied by the NEFA concentration, resulted in similar absolute fatty acid spillover. Diet-derived NEFAs subsequently represented 10.6 +/- 1.2% and 4.7 +/- 1.3% of hepatic VLDL-TAG (meal feeding vs. continuous feeding, respectively, P = 0.004). Chylomicron remnant uptake by the liver contributed 9.3 +/- 1.9% of fatty acids to hepatic VLDL-TAG synthesis with meal feeding compared with continuous feeding (4.4 +/- 0.8%, P < 0.03). These data suggest that the extent of dietary fatty acid recycling via serum NEFAs and VLDL-TAG is determined by the rate of delivery of dietary fat to the intestine. The inefficient removal of dietary fat from the circulation may maintain VLDL-TAG production but may also result in prolonged postprandial lipemia.

Kefir consumption does not alter plasma lipid levels or cholesterol fractional synthesis rates relative to milk in hyperlipidemic men: a randomized controlled trial [ISRCTN10820810

PubMed Central

St-Onge, Marie-Pierre; Farnworth, Edward R; Savard, Tony; Chabot, Denise; Mafu, Akier; Jones, Peter JH

2002-01-01

Background Fermented milk products have been shown to affect serum cholesterol concentrations in humans. Kefir, a fermented milk product, has been traditionally consumed for its potential health benefits but has to date not been studied for its hypocholesterolemic properties. Methods Thirteen healthy mildly hypercholesterolemic male subjects consumed a dairy supplement in randomized crossover trial for 2 periods of 4 wk each. Subjects were blinded to the dairy supplement consumed. Blood samples were collected at baseline and after 4 wk of supplementation for measurement of plasma total, low-density lipoprotein, and high-density lipoprotein cholesterol and triglyceride concentrations, as well as fatty acid profile and cholesterol synthesis rate. Fecal samples were collected at baseline and after 2 and 4 wk of supplementation for determination of fecal short chain fatty acid level and bacterial content. Results Kefir had no effect on total cholesterol, low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglyceride concentrations nor on cholesterol fractional synthesis rates after 4 wk of supplementation. No significant change on plasma fatty acid levels was observed with diet. However, both kefir and milk increased (p < 0.05) fecal isobutyric, isovaleric and propionic acids as well as the total amount of fecal short chain fatty acids. Kefir supplementation resulted in increased fecal bacterial content in the majority of the subjects. Conclusions Since kefir consumption did not result in lowered plasma lipid concentrations, the results of this study do not support consumption of kefir as a cholesterol-lowering agent. PMID:11825344

Ursolic Acid Inhibits Na+/K+-ATPase Activity and Prevents TNF-α-Induced Gene Expression by Blocking Amino Acid Transport and Cellular Protein Synthesis

PubMed Central

Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao

2011-01-01

Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122

Effect of aspartic acid and glutamate on metabolism and acid stress resistance of Acetobacter pasteurianus.

PubMed

Yin, Haisong; Zhang, Renkuan; Xia, Menglei; Bai, Xiaolei; Mou, Jun; Zheng, Yu; Wang, Min

2017-06-15

Acetic acid bacteria (AAB) are widely applied in food, bioengineering and medicine fields. However, the acid stress at low pH conditions limits acetic acid fermentation efficiency and high concentration of vinegar production with AAB. Therefore, how to enhance resistance ability of the AAB remains as the major challenge. Amino acids play an important role in cell growth and cell survival under severe environment. However, until now the effects of amino acids on acetic fermentation and acid stress resistance of AAB have not been fully studied. In the present work the effects of amino acids on metabolism and acid stress resistance of Acetobacter pasteurianus were investigated. Cell growth, culturable cell counts, acetic acid production, acetic acid production rate and specific production rate of acetic acid of A. pasteurianus revealed an increase of 1.04, 5.43, 1.45, 3.30 and 0.79-folds by adding aspartic acid (Asp), and cell growth, culturable cell counts, acetic acid production and acetic acid production rate revealed an increase of 0.51, 0.72, 0.60 and 0.94-folds by adding glutamate (Glu), respectively. For a fully understanding of the biological mechanism, proteomic technology was carried out. The results showed that the strengthening mechanism mainly came from the following four aspects: (1) Enhancing the generation of pentose phosphates and NADPH for the synthesis of nucleic acid, fatty acids and glutathione (GSH) throughout pentose phosphate pathway. And GSH could protect bacteria from low pH, halide, oxidative stress and osmotic stress by maintaining the viability of cells through intracellular redox equilibrium; (2) Reinforcing deamination of amino acids to increase intracellular ammonia concentration to maintain stability of intracellular pH; (3) Enhancing nucleic acid synthesis and reparation of impaired DNA caused by acid stress damage; (4) Promoting unsaturated fatty acids synthesis and lipid transport, which resulted in the improvement of cytomembrane

Synthesis of a Series of Caffeic Acid Phenethyl Amide (CAPA) Fluorinated Derivatives: Comparison of Cytoprotective Effects to Caffeic Acid Phenethyl Ester (CAPE)

DTIC Science & Technology

2010-06-11

the cinnamic acid phenyl ring. Although compound 4c proved to be very cytotoxic in HUVEC over a 24 h period, the toxicity is less apparent over a 5 h...drug development process, as it determines how much of the initial dose actually reaches the target site. Cinnamic acid -derived amides are known to...Synthesis of a series of caffeic acid phenethyl amide (CAPA) fluorinated derivatives: Comparison of cytoprotective effects to caffeic acid phenethyl

Nuclear Synthesis of Cytoplasmic Ribonucleic Acid in Amoeba proteus

PubMed Central

Prescott, David M.

1959-01-01

The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells. PMID:14434750

Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.

PubMed

PRESCOTT, D M

1959-10-01

The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.

Sustainable and Continuous Synthesis of Enantiopure l-Amino Acids by Using a Versatile Immobilised Multienzyme System.

PubMed

Velasco-Lozano, Susana; da Silva, Eunice S; Llop, Jordi; López-Gallego, Fernando

2018-02-16

The enzymatic synthesis of α-amino acids is a sustainable and efficient alternative to chemical processes, through which achieving enantiopure products is difficult. To more address this synthesis efficiently, a hierarchical architecture that irreversibly co-immobilises an amino acid dehydrogenase with polyethyleneimine on porous agarose beads has been designed and fabricated. The cationic polymer acts as an irreversible anchoring layer for the formate dehydrogenase. In this architecture, the two enzymes and polymer colocalise across the whole microstructure of the porous carrier. This multifunctional heterogeneous biocatalyst was kinetically characterised and applied to the enantioselective synthesis of a variety of canonical and noncanonical α-amino acids in both discontinuous (batch) and continuous modes. The co-immobilised bienzymatic system conserves more than 50 % of its initial effectiveness after five batch cycles and 8 days of continuous operation. Additionally, the environmental impact of this process has been semiquantitatively calculated and compared with the state of the art. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Inhibitors of Fatty Acid Synthesis Induce PPARα-Regulated Fatty Acid β-Oxidative Genes: Synergistic Roles of L-FABP and Glucose

PubMed Central

Huang, Huan; McIntosh, Avery L.; Martin, Gregory G.; Petrescu, Anca D.; Landrock, Kerstin K.; Landrock, Danilo; Kier, Ann B.; Schroeder, Friedhelm

2013-01-01

While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor-α (PPARα) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPARα transcription of the fatty acid β-oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPARα in the context of high glucose at levels similar to those in uncontrolled diabetes. PMID:23533380

Stimulation of muscle protein synthesis by prolonged parenteral infusion of leucine is dependent on amino acid availability in neonatal pigs

USDA-ARS?s Scientific Manuscript database

The postprandial rise in amino acids, particularly leucine, stimulates muscle protein synthesis in neonates. Previously, we showed that a 1-h infusion of leucine increased protein synthesis, but this response was not sustained for 2 h unless the leucine-induced decrease in amino acids was prevented....

Glutamine supplementation does not improve protein synthesis rate by the jejunal mucosa of the malnourished rat.

PubMed

Tannus, Andrea Ferreira S; Darmaun, Dominique; Ribas, Durval F; Oliveira, José Eduardo D; Marchini, Julio Sergio

2009-08-01

It has been demonstrated that glutamine, a conditionally essential amino acid, improves nitrogen balance, acts as a stimulant of protein synthesis, and decreases proteolysis in myopathic children. In contrast, other studies have shown no beneficial effect of glutamine supplementation on burn victims or critically ill patients. Nonetheless, we hypothesized that glutamine supplementation would increase the fractional protein synthesis rate (FSR) in the jejunal mucosa of malnourished male Wistar rats. Thus, the objective of the present study was to test the effect of daily oral glutamine supplementation (0.42 g kg(-1) d(-1) for 14 days) on the FSR of the jejunal mucosa of healthy and malnourished rats. A 4-hour kinetic study with l-[1-(13)C]leucine was subsequently performed, and jejunal biopsies were obtained 1.5 cm from the Treitz angle and analyzed. Malnourished rats showed a 25% weight loss and increased urinary nitrogen excretion. Plasma amino acid concentration did not differ between groups. (13)C enrichment in plasma and jejunal cells was higher in the malnourished groups than in the healthy group. The FSR (percent per hour) was similar for the control and experimental groups (P > .05), with a mean range of 22%/h to 27%/h. Oral glutamine supplementation alone did not induce higher protein incorporation by the jejunal mucosa in malnourished rats, regardless of total food intake or the presence or absence of glutamine supplementation.

Glucocorticoids shift arachidonic acid metabolism toward endocannabinoid synthesis: a non-genomic anti-inflammatory switch

PubMed Central

Malcher-Lopes, Renato; Franco, Alier; Tasker, Jeffrey G.

2008-01-01

Glucocorticoids are capable of exerting both genomic and non-genomic actions in target cells of multiple tissues, including the brain, which trigger an array of electrophysiological, metabolic, secretory and inflammatory regulatory responses. Here, we have attempted to show how glucocorticoids may generate a rapid anti-inflammatory response by promoting arachidonic acid-derived endocannabinoid biosynthesis. According to our hypothesized model, non-genomic action of glucocorticoids results in the global shift of membrane lipid metabolism, subverting metabolic pathways toward the synthesis of the anti-inflammatory endocannabinoids, anandamide (AEA) and 2-arachidonoyl-glycerol (2-AG), and away from arachidonic acid production. Post-transcriptional inhibition of cyclooxygenase-2 (COX2) synthesis by glucocorticoids assists this mechanism by suppressing the synthesis of pro-inflammatory prostaglandins as well as endocannabinoid-derived prostanoids. In the central nervous system (CNS) this may represent a major neuroprotective system, which may cross-talk with leptin signaling in the hypothalamus allowing for the coordination between energy homeostasis and the inflammatory response. PMID:18295199

The effect of Centella asiatica, vitamins, glycolic acid and their mixtures preparations in stimulating collagen and fibronectin synthesis in cultured human skin fibroblast.

PubMed

Hashim, Puziah

2014-03-01

Centella asiatica (Linn.) Urban is well known in promoting wound healing and provides significant benefits in skin care and therapeutic products formulation. Glycolic acid and vitamins also play a role in the enhancement of collagen and fibronectin synthesis. Here, we evaluate the specific effect of Centella asiatica (CA), vitamins, glycolic acid and their mixture preparations to stimulate collagen and fibronectin synthesis in cultured human fibroblast cells. The fibroblast cells are incubated with CA, glycolic acid, vitamins and their mixture preparations for 48 h. The cell lysates were analyzed for protein content and collagen synthesis by direct binding enzyme immunoassay. The fibronectin of the cultured supernatant was measured by sandwich enzyme immunoassay. The results showed that CA, glycolic acid, vitamins A, E and C significantly stimulate collagen and fibronectin synthesis in the fibroblast. Addition of glycolic acid and vitamins to CA further increased the levels of collagen and fibronectin synthesis to 8.55 and 23.75 μg/100 μg, respectively. CA, glycolic acid, vitamins A, E, and C, and their mixtures demonstrated stimulatory effect on both extra-cellular matrix synthesis of collagen and fibronectin in in vitro studies on human foreskin fibroblasts, which is beneficial to skin care and therapeutic products formulation.

Biomimetic synthesis of highly biocompatible gold nanoparticles with amino acid-dithiocarbamate as a precursor for SERS imaging

NASA Astrophysics Data System (ADS)

Li, Li; Liu, Jianbo; Yang, Xiaohai; Huang, Jin; He, Dinggeng; Guo, Xi; Wan, Lan; He, Xiaoxiao; Wang, Kemin

2016-03-01

Amino acid-dithiocarbamate (amino acid-DTC) was developed as both the reductant and ligand stabilizer for biomimetic synthesis of gold nanoparticles (AuNPs), which served as an excellent surface-enhanced Raman scattering (SERS) contrast nanoprobe for cell imaging. Glycine (Gly), glutamic acid (Glu), and histidine (His) with different isoelectric points were chosen as representative amino acid candidates to synthesize corresponding amino acid-DTC compounds through mixing with carbon disulfide (CS2), respectively. The pyrogenic decomposition of amino acid-DTC initiated the reduction synthesis of AuNPs, and the strong coordinating dithiocarbamate group of amino acid-DTC served as a stabilizer that grafted onto the surface of the AuNPs, which rendered the as-prepared nanoparticles a negative surface charge and high colloidal stability. MTT cell viability assay demonstrated that the biomimetic AuNPs possessed neglectful toxicity to the human hepatoma cell, which guaranteed them good biocompatibility for biomedical application. Meanwhile, the biomimetic AuNPs showed a strong SERS effect with an enhancement factor of 9.8 × 105 for the sensing of Rhodamine 6G, and two distinct Raman peaks located at 1363 and 1509 cm-1 could be clearly observed in the cell-imaging experiments. Therefore, biomimetic AuNPs can be explored as an excellent SERS contrast nanoprobe for biomedical imaging, and the amino acid-DTC mediated synthesis of the AuNPs has a great potential in bio-engineering and biomedical imaging applications.

The rate of synthesis and decomposition of tissue proteins in hypokinesia and increased muscular activity

NASA Technical Reports Server (NTRS)

Fedorov, I. V.; Chernyy, A. V.; Fedorov, A. I.

1978-01-01

During hypokinesia and physical loading (swimming) of rats, the radioactivity of skeletal muscle, liver, kidney, heart, and blood proteins was determined after administration of radioactive amino acids. Tissue protein synthesis decreased during hypokinesia, and decomposition increased. Both synthesis and decomposition increased during physical loading, but anabolic processes predominated in the total tissue balance. The weights of the animals decreased in hypokinesia and increased during increased muscle activity.

Synthesis and Evaluation of Aryl Boronic Acids as Fluorescent Artificial Receptors for Biological Carbohydrates

PubMed Central

Craig, Sandra

2011-01-01

Carbohydrates in various forms play a vital role in numerous critical biological processes. The detection of such saccharides can give insight into the progression of such diseases such as cancer. Boronic acids react with 1,2 and 1,3 diols of saccharides in non-aqueous or basic aqueous media. Herein, we describe the design, synthesis and evaluation of three bisboronic acid fluorescent probes, each having about ten linear steps in its synthesis. Among these compounds that were evaluated, 9b was shown to selectively label HepG2, liver carcinoma cell line within a concentration range of 0.5–10 μM in comparison to COS-7, a normal fibroblast cell line. PMID:22177855

Insulin accelerates global and mitochondrial protein synthesis rates in neonatal muscle during sepsis

USDA-ARS?s Scientific Manuscript database

In neonatal pigs, sepsis decreases protein synthesis in skeletal muscle by decreasing translation initiation. However, insulin stimulates muscle protein synthesis despite persistent repression of translation initiation signaling. To determine whether the insulin-induced increase in global rates of m...

Triacylglycerol synthesis in goat mammary gland. The effect of ATP, Mg2+ and glycerol 3-phosphate on the esterification of fatty acids synthesized de novo.

PubMed Central

Hansen, H O; Grunnet, I; Knudsen, J

1984-01-01

Goat mammary-gland microsomal fraction by itself induces synthesis of medium-chain-length fatty acids by goat mammary fatty acid synthetase and incorporates short- and medium-chain fatty acids into triacylglycerol. Addition of ATP in the absence or presence of Mg2+ totally inhibits triacylglycerol synthesis from short- and medium-chain fatty acids, and severely inhibits synthesis de novo of medium-chain fatty acids. The inhibition by ATP of fatty acid synthesis and triacylglycerol synthesis de novo can be relieved by glycerol 3-phosphate. The effect of ATP could not be mimicked by the non-hydrolysable ATP analogue, adenosine 5'-[beta,gamma-methylene]triphosphate and could not be shown to be caused by inhibition of the diacylglycerol acyltransferase by a phosphorylation reaction. Possible explanations for the mechanism of the inhibition by ATP are discussed, and a hypothetical model for its action is outlined. PMID:6547605

RETINOIC ACID SYNTHESIS AND DEGRADATION

PubMed Central

Kedishvili, Natalia Y.

2017-01-01

Retinoic acid was identified as the biologically active form of vitamin A almost 70 years ago, but the exact enzymes and control mechanisms that regulate its biosynthesis and degradation are yet to be fully defined. The currently accepted model postulates that RA is produced in two sequential oxidative steps: first, retinol is oxidized reversibly to retinaldehyde, and then retinaldehyde is oxidized irreversibly to RA, which is inactivated by conversion to hydroxylated derivatives. This chapter describes the history, development and recent advances in our understanding of the enzymatic pathways and mechanisms that control the rate of RA production and degradation. Gene knockout studies provided strong evidence that the members of the short chain dehydrogenase reductase superfamily of proteins play indispensable roles in retinoic acid biosynthesis during development. Furthermore, recent finding that two of these proteins regulate the rate of retinoic acid biosynthesis by mutually activating each other provided a novel insight into the mechanism of this regulation. Despite significant progress made since the middle of the 20th century many unanswered questions still remain, and there is much to be learned, especially about trafficking of the hydrophobic retinoid substrates between membrane bound and cytosolic enzymes and the roles of the retinoid binding proteins. PMID:27830503

Synthesis and antimycobacterial activity of isoniazid derivatives from renewable fatty acids.

PubMed

Rodrigues, Marieli O; Cantos, Jéssica B; D'Oca, Caroline R Montes; Soares, Karina L; Coelho, Tatiane S; Piovesan, Luciana A; Russowsky, Dennis; da Silva, Pedro A; D'Oca, Marcelo G Montes

2013-11-15

This work describes the synthesis of a series of fatty acid hydrazide derivatives of isoniazid (INH). The compounds were tested against Mycobacterium tuberculosis H37Rv (ATCC 27294) as well as INH-resistant (ATCC 35822 and 1896 HF) and rifampicin-resistant (ATCC 35338) M. tuberculosis strains. The fatty acid derivatives of INH showed high antimycobacterial potency against the studied strains, which is desirable for a pharmaceutical compound, suggesting that the increased lipophilicity of isoniazid plays an important role in its antimycobacterial activity. Copyright © 2013 Elsevier Ltd. All rights reserved.

Δ(9)-Tetrahydrocannabinolic acid synthase production in Pichia pastoris enables chemical synthesis of cannabinoids.

PubMed

Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K

2015-10-10

Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale. Copyright © 2015 Elsevier B.V. All rights reserved.

Mutants of Escherichia coli defective in membrane phospholipid synthesis: macromolecular synthesis in an sn-glycerol 3-phosphate acyltransferase Km mutant.

PubMed

Bell, R M

1974-03-01

sn-Glycerol 3-phosphate (G3P) auxotrophs of Escherichia coli have been selected from a strain which cannot aerobically catabolize G3P. The auxotrophy resulted from loss of the biosynthetic G3P dehydrogenase (EC 1.1.1.8) or from a defective membranous G3P acyltransferase. The apparent K(m) of the acyltransferase for G3P was 11- to 14-fold higher (from about 90 mum to 1,000 to 1,250 mum) in membrane preparations from the mutants than those of the parent. All extracts prepared from revertants of the G3P dehydrogenase mutants showed G3P dehydrogenase activity, but most contained less than 10% of the wild-type level. Membrane preparations from revertants of the acyltransferase mutants had apparent K(m)'s for G3P similar to that of the parent. Strains have been derived in which the G3P requirement can be satisfied with glycerol in the presence of glucose, presumably because the glycerol kinase was desensitized to inhibition by fructose 1,6-diphosphate. Investigations on the growth and macromolecular synthesis in a G3P acyltransferase K(m) mutant revealed that upon glycerol deprivation, net phospholipid synthesis stopped immediately; growth continued for about one doubling; net ribonucleic acid (RNA), deoxyribonucleic acid (DNA), and protein nearly doubled paralleling the growth curve; the rate of phospholipid synthesis assessed by labeling cells with (32)P-phosphate, (14)C-acetate, or (3)H-serine was reduced greater than 90%; the rates of RNA and DNA synthesis increased as the cells grew and then decreased as the cells stopped growing; the rate of protein synthesis showed no increase and declined more slowly than the rates of RNA and DNA synthesis when the cells stopped growing. The cells retained and gained in the capacity to synthesize phospholipids upon glycerol deprivation. These data indicate that net phospholipid synthesis is not required for continued macromolecular synthesis for about one doubling, and that the rates of these processes are not coupled during this

Metabolic basis for the differential susceptibility of Gram-positive pathogens to fatty acid synthesis inhibitors

PubMed Central

Parsons, Joshua B.; Frank, Matthew W.; Subramanian, Chitra; Saenkham, Panatda; Rock, Charles O.

2011-01-01

The rationale for the pursuit of bacterial type 2 fatty acid synthesis (FASII) as a target for antibacterial drug discovery in Gram-positive organisms is being debated vigorously based on their ability to incorporate extracellular fatty acids. The regulation of FASII by extracellular fatty acids was examined in Staphylococcus aureus and Streptococcus pneumoniae, representing two important groups of pathogens. Both bacteria use the same enzymatic tool kit for the conversion of extracellular fatty acids to acyl-acyl carrier protein, elongation, and incorporation into phospholipids. Exogenous fatty acids completely replace the endogenous fatty acids in S. pneumoniae but support only 50% of phospholipid synthesis in S. aureus. Fatty acids overcame FASII inhibition in S. pneumoniae but not in S. aureus. Extracellular fatty acids strongly suppress malonyl-CoA levels in S. pneumoniae but not in S. aureus, showing a feedback regulatory system in S. pneumoniae that is absent in S. aureus. Fatty acids overcame either a biochemical or a genetic block at acetyl-CoA carboxylase (ACC) in S. aureus, confirming that regulation at the ACC step is the key difference between these two species. Bacteria that possess a stringent biochemical feedback inhibition of ACC and malonyl-CoA formation triggered by environmental fatty acids are able to circumvent FASII inhibition. However, if exogenous fatty acids do not suppress malonyl-CoA formation, FASII inhibitors remain effective in the presence of fatty acid supplements. PMID:21876172

Efficient synthesis of anacardic acid analogues and their antibacterial activities.

PubMed

Mamidyala, Sreeman K; Ramu, Soumya; Huang, Johnny X; Robertson, Avril A B; Cooper, Matthew A

2013-03-15

Anacardic acid derivatives exhibit a broad range of biological activities. In this report, an efficient method for the synthesis of anacardic acid derivatives was explored, and a small set of salicylic acid variants synthesised retaining a constant hydrophobic element (a naphthyl tail). The naphthyl side chain was introduced via Wittig reaction and the aldehyde installed using directed ortho-metalation reaction of the substituted o-anisic acids. The failure of ortho-metalation using unprotected carboxylic acid group compelled us to use directed ortho-metalation in which a tertiary amide was used as a strong ortho-directing group. In the initial route, tertiary amide cleavage during final step was challenging, but cleaving the tertiary amide before Wittig reaction was beneficial. The Wittig reaction with protected carboxylic group (methyl ester) resulted in side-products whereas using sodium salt resulted in higher yields. The novel compounds were screened for antibacterial activity and cytotoxicity. Although substitution on the salicylic head group enhanced antibacterial activities they also enhanced cytotoxicity. Copyright © 2013 Elsevier Ltd. All rights reserved.

Thiamine pyrophosphate requirement for o-succinylbenzoic acid synthesis in Escherichia coli and evidence for an intermediate.

PubMed Central

Meganathan, R; Bentley, R

1983-01-01

Cell-free extracts of various strains of Escherichia coli synthesize the menaquinone biosynthetic intermediate o-succinylbenzoic acid (OSB) when supplied with chorismic acid, 2-ketoglutaric acid, and thiamine pyrophosphate (TPP). To assay for OSB synthesis, 2-[U-14C]ketoglutaric acid was used as substrate, and the synthesized OSB was examined by radiogas chromatography (as the dimethyl ester). [U-14C]Shikimic acid also gave rise to radioactive OSB if the cofactors necessary for enzymatic conversion to chorismic acid were added. Use of 2-[1-14C]ketoglutaric acid does not give rise to labeled OSB. In the absence of TPP during the incubations, OSB synthesis was much reduced; these observations are consistent with the proposed role for the succinic semialdehyde-TPP anion as the reagent adding to chorismic acid. Extracts of cells from menC and menD mutants did not form OSB separately, but did so in combination. There was evidence for formation of a product, X, by extracts of a menC mutant incubated with chorismic acid, TPP, and 2-ketoglutaric acid; X was converted to OSB by extracts of a menD mutant. It appears that the intermediate, X, is formed by one gene product and converted to OSB by the second gene product. PMID:6337125

Synthesis and Anti-microbial Activity of Novel Phosphatidylethanolamine-N-amino Acid Derivatives.

PubMed

Vijeetha, Tadla; Balakrishna, Marrapu; Karuna, Mallampalli Sri Lakshmi; Surya Koppeswara Rao, Bhamidipati Venkata; Prasad, Rachapudi Badari Narayana; Kumar, Koochana Pranay; Surya Narayana Murthy, Upadyaula

2015-01-01

The study involved synthesis of five novel amino acid derivatives of phosphatidylethanolamine isolated from egg yolk lecithin employing a three step procedure i) N-protection of L-amino acids with BOC anhydride in alkaline medium ii) condensation of - CO2H group of N-protected amino acid with free -NH2 of PE by a peptide linkage and iii) deprotection of N-protected group of amino acids to obtain phosphatidylethanolamine-N-amino acid derivatives in 60-75% yield. The five L-amino acids used were L glycine, L-valine, L-leucine, L-isoleucine and L-phenylalanine. The amino acid derivatives were screened for anti-baterial activity against B. subtilis, S. aureus, P. aeroginosa and E. coli taking Streptomycin as reference compound and anti-fungal activity against C. albicans, S. cervisiae, A. niger taking AmphotericinB as reference compound. All the amino acid derivatives exhibited extraordinary anti-bacterial activities about 3 folds or comparable to Streptomycin and moderate or no anti-fungal activity against Amphotericin-B.

Rates of insulin secretion in INS-1 cells are enhanced by coupling to anaplerosis and Kreb's cycle flux independent of ATP synthesis.

PubMed

Cline, Gary W; Pongratz, Rebecca L; Zhao, Xiaojian; Papas, Klearchos K

2011-11-11

Mechanistic models of glucose stimulated insulin secretion (GSIS) established in minimal media in vitro, may not accurately describe the complexity of coupling metabolism with insulin secretion that occurs in vivo. As a first approximation, we have evaluated metabolic pathways in a typical growth media, DMEM as a surrogate in vivo medium, for comparison to metabolic fluxes observed under the typical experimental conditions using the simple salt-buffer of KRB. Changes in metabolism in response to glucose and amino acids and coupling to insulin secretion were measured in INS-1 832/13 cells. Media effects on mitochondrial function and the coupling efficiency of oxidative phosphorylation were determined by fluorometrically measured oxygen consumption rates (OCRs) combined with (31)P NMR measured rates of ATP synthesis. Substrate preferences and pathways into the TCA cycle, and the synthesis of mitochondrial 2nd messengers by anaplerosis were determined by (13)C NMR isotopomer analysis of the fate of [U-(13)C] glucose metabolism. Despite similar incremental increases in insulin secretion, the changes of OCR in response to increasing glucose from 2.5 to 15mM were blunted in DMEM relative to KRB. Basal and stimulated rates of insulin secretion rates were consistently higher in DMEM, while ATP synthesis rates were identical in both DMEM and KRB, suggesting greater mitochondrial uncoupling in DMEM. The relative rates of anaplerosis, and hence synthesis and export of 2nd messengers from the mitochondria were found to be similar in DMEM to those in KRB. And, the correlation of total PC flux with insulin secretion rates in DMEM was found to be congruous with the correlation in KRB. Together, these results suggest that signaling mechanisms associated with both TCA cycle flux and with anaplerotic flux, but not ATP production, may be responsible for the enhanced rates of insulin secretion in more complex, and physiologically-relevant media. Copyright © 2011 Elsevier Inc. All

Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis

PubMed Central

Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet

2011-01-01

Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689

Individual bile acids have differential effects on bile acid signaling in mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Peizhen, E-mail: songacad@gmail.com; Rockwell, Cheryl E., E-mail: rockwelc@msu.edu; Cui, Julia Yue, E-mail: juliacui@uw.edu

2015-02-15

Bile acids (BAs) are known to regulate BA synthesis and transport by the farnesoid X receptor in the liver (FXR-SHP) and intestine (FXR-Fgf15). However, the relative importance of individual BAs in regulating these processes is not known. Therefore, mice were fed various doses of five individual BAs, including cholic acid (CA), chenodeoxycholic acid (CDCA), deoxoycholic acid (DCA), lithocholic acid (LCA), and ursodeoxycholic acid (UDCA) in their diets at various concentrations for one week to increase the concentration of one BA in the enterohepatic circulation. The mRNA of BA synthesis and transporting genes in liver and ileum were quantified. In themore » liver, the mRNA of SHP, which is the prototypical target gene of FXR, increased in mice fed all concentrations of BAs. In the ileum, the mRNA of the intestinal FXR target gene Fgf15 was increased at lower doses and to a higher extent by CA and DCA than by CDCA and LCA. Cyp7a1, the rate-limiting enzyme in BA synthesis, was decreased more by CA and DCA than CDCA and LCA. Cyp8b1, the enzyme that 12-hydroxylates BAs and is thus responsible for the synthesis of CA, was decreased much more by CA and DCA than CDCA and LCA. Surprisingly, neither a decrease in the conjugated BA uptake transporter (Ntcp) nor increase in BA efflux transporter (Bsep) was observed by FXR activation, but an increase in the cholesterol efflux transporter (Abcg5/Abcg8) was observed with FXR activation. Thus in conclusion, CA and DCA are more potent FXR activators than CDCA and LCA when fed to mice, and thus they are more effective in decreasing the expression of the rate limiting gene in BA synthesis Cyp7a1 and the 12-hydroxylation of BAs Cyp8b1, and are also more effective in increasing the expression of Abcg5/Abcg8, which is responsible for biliary cholesterol excretion. However, feeding BAs do not alter the mRNA or protein levels of Ntcp or Bsep, suggesting that the uptake or efflux of BAs is not regulated by FXR at physiological and

Inhibitors of Fatty Acid Synthesis Induce PPAR α -Regulated Fatty Acid β -Oxidative Genes: Synergistic Roles of L-FABP and Glucose.

PubMed

Huang, Huan; McIntosh, Avery L; Martin, Gregory G; Petrescu, Anca D; Landrock, Kerstin K; Landrock, Danilo; Kier, Ann B; Schroeder, Friedhelm

2013-01-01

While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor- α (PPAR α ) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPAR α transcription of the fatty acid β -oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPAR α in the context of high glucose at levels similar to those in uncontrolled diabetes.

Synthesis of Deoxyribonucleic Acid After Ultraviolet Irradiation of Sensitive and Resistant Haemophilus influenzae

PubMed Central

Modak, Sohan P.; Setlow, Jane K.

1969-01-01

Synthesis of deoxyribonucleic acid (DNA) has been measured as a function of ultraviolet (UV) radiation dose in wild-type and seven UV-sensitive strains of Haemophilus influenzae. At the UV doses used, all strains were able to resume DNA synthesis, even those which are unable to excise pyrimidine dimers from their DNA. These excisionless strains showed longer UV-induced delays in DNA synthesis than all but one of the other strains. The longest delay was shown by DB117, a strain which can excise dimers but which is recombination deficient and unable to rejoin X ray-induced single-strand breaks. All strains showed a progressive decrease in sensitivity as they approached the stationary phase. PMID:5305934

Electrochemical synthesis of formic acid from CO2 catalyzed by Shewanella oneidensis MR-1 whole-cell biocatalyst.

PubMed

Le, Quang Anh Tuan; Kim, Hee Gon; Kim, Yong Hwan

2018-09-01

The electro-biocatalytic conversion of CO 2 into formic acid using whole-cell and isolated biocatalysts is useful as an alternative route for CO 2 sequestration. In this study, Shewanella oneidensis MR-1 (S. oneidensis MR-1), a facultative aerobic bacterium that has been extensively studied for its utility as biofuel cells as well as for the detoxification of heavy metal oxides (i.e., MnO 2 , uranium), has been applied for the first time as a whole-cell biocatalyst for formic acid synthesis from gaseous CO 2 and electrons supplied from an electrode. S. oneidensis MR-1, when aerobically grown in Luria-Bertani (LB) medium, exhibited its ability as a whole-cell biocatalyst for the conversion of CO 2 into formic acid with moderate productivity of 0.59 mM h -1 for 24 h. In addition, an optimization of growth conditions of S. oneidensis MR-1 resulted in a remarkable increase in productivity. The CO 2 reduction reaction catalyzed by S. oneidensis MR-1, when anaerobically grown in newly optimized LB medium supplemented with fumarate and nitrate, exhibited 3.2-fold higher productivity (1.9 mM h -1 for 72 h) compared to that grown aerobically in only LB medium. Furthermore, the average conversion rate of formic acid synthesis catalyzed by S. oneidensis MR-1 when grown in the optimal medium over a period of 72 h was 3.8 mM h -1  g -1 wet-cell, which is 9.6-fold higher than that catalyzed by Methylobacterium extorquens AM1 whole-cells in our previous study. Copyright © 2018 Elsevier Inc. All rights reserved.

CO- and HCl-free synthesis of acid chlorides from unsaturated hydrocarbons via shuttle catalysis

NASA Astrophysics Data System (ADS)

Fang, Xianjie; Cacherat, Bastien; Morandi, Bill

2017-11-01

The synthesis of carboxylic acid derivatives from unsaturated hydrocarbons is an important process for the preparation of polymers, pharmaceuticals, cosmetics and agrochemicals. Despite its industrial relevance, the traditional Reppe-type carbonylation reaction using pressurized CO is of limited applicability to laboratory-scale synthesis because of: (1) the safety hazards associated with the use of CO, (2) the need for special equipment to handle pressurized gas, (3) the low reactivity of several relevant nucleophiles and (4) the necessity to employ different, often tailor-made, catalytic systems for each nucleophile. Herein we demonstrate that a shuttle-catalysis approach enables a CO- and HCl-free transfer process between an inexpensive reagent, butyryl chloride, and a wide range of unsaturated substrates to access the corresponding acid chlorides in good yields. This new transformation provides access to a broad range of carbonyl-containing products through the in situ transformation of the reactive acid chloride intermediate. In a broader context, this work demonstrates that isodesmic shuttle-catalysis reactions can unlock elusive catalytic reactions.

Dual Role for Phospholipid:Diacylglycerol Acyltransferase: Enhancing Fatty Acid Synthesis and Diverting Fatty Acids from Membrane Lipids to Triacylglycerol in Arabidopsis Leaves[C][W

PubMed Central

Fan, Jilian; Yan, Chengshi; Zhang, Xuebin; Xu, Changcheng

2013-01-01

There is growing interest in engineering green biomass to expand the production of plant oils as feed and biofuels. Here, we show that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is a critical enzyme involved in triacylglycerol (TAG) synthesis in leaves. Overexpression of PDAT1 increases leaf TAG accumulation, leading to oil droplet overexpansion through fusion. Ectopic expression of oleosin promotes the clustering of small oil droplets. Coexpression of PDAT1 with oleosin boosts leaf TAG content by up to 6.4% of the dry weight without affecting membrane lipid composition and plant growth. PDAT1 overexpression stimulates fatty acid synthesis (FAS) and increases fatty acid flux toward the prokaryotic glycerolipid pathway. In the trigalactosyldiacylglycerol1-1 mutant, which is defective in eukaryotic thylakoid lipid synthesis, the combined overexpression of PDAT1 with oleosin increases leaf TAG content to 8.6% of the dry weight and total leaf lipid by fourfold. In the plastidic glycerol-3-phosphate acyltransferase1 mutant, which is defective in the prokaryotic glycerolipid pathway, PDAT1 overexpression enhances TAG content at the expense of thylakoid membrane lipids, leading to defects in chloroplast division and thylakoid biogenesis. Collectively, these results reveal a dual role for PDAT1 in enhancing fatty acid and TAG synthesis in leaves and suggest that increasing FAS is the key to engineering high levels of TAG accumulation in green biomass. PMID:24076979

Synthesis and characterization of L-lactide and polylactic acid (PLA) from L-lactic acid for biomedical applications

NASA Astrophysics Data System (ADS)

Rahmayetty, Sukirno, Prasetya, Bambang; Gozan, Misri

2017-02-01

Lactide is the monomer for the polymer polylactic acid (PLA) from lactic acid through polycondensation and depolymerization process. The properties of PLA strongly depend on the quality of the lactide monomer from which it is synthesized. Optical purity of lactide produced in depolymerization process confirmed to be L-lactide. The highest yield of crude lactide was 38.5% at temperature 210 °C with average molecular weight (Mn) of oligomer was 2389. Ring opening polymerization of lactide using Candida rugosa lipase as biocatalyst to PLLA synthesis has been achieved to generate useful biomedical materials free from heavy metal.

Methanesulfonic acid-assisted synthesis of N/S co-doped hierarchically porous carbon for high performance supercapacitors

NASA Astrophysics Data System (ADS)

Huo, Silu; Liu, Mingquan; Wu, Linlin; Liu, Mingjie; Xu, Min; Ni, Wei; Yan, Yi-Ming

2018-05-01

Nitrogen and sulfur co-doped carbons are considered as electrode materials for high performance supercapacitors, while their further development is still limited by complicated synthesis procedure, unsatisfied structure and low energy density. Developing a simple synthetic strategy to obtain rationally structured carbon materials and high supercapacitor performance is remaining a grand challenge. Herein, we describe the synthesis of nitrogen and sulfur co-doped hierarchical porous carbons as high performance supercapacitors electrode by a methanesulfonic acid-assisted one-step carbonization and activation of the freeze-dried precursors mixture. The as-prepared carbon material not only exhibits ideally hierarchical pores, but also realizes uniform nitrogen and sulfur co-doping. In 6.0 M KOH electrolyte, the material can achieve a high specific capacitance of 272 F g-1 at 1.0 A g-1 and a promising rate performance retaining 172 F g-1 even at 100 A g-1. Moreover, a fabricated symmetric supercapacitor based on as-prepared nitrogen and sulfur co-doped hierarchical porous carbon delivers high energy densities of 12.4 W h kg-1 and 8.0 W h kg-1 in 6.0 M KOH liquid and KOH/PVA solid-state electrolytes, respectively. This work presents a simple and effective methanesulfonic acid-assisted approach for mass production of heteroatomic doping hierarchical porous carbons for future energy storage applications.

One-step synthesis of hydrothermally stable mesoporous aluminosilicates with strong acidity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang Dongjiang; School of Physical and Chemical Sciences, Queensland University of Technology, Brisbane, QLD 4001; Xu Yao

2008-09-15

Using tetraethylorthosilicate (TEOS), polymethylhydrosiloxane (PMHS) and aluminium isopropoxide (AIP) as the reactants, through a one-step nonsurfactant route based on PMHS-TEOS-AIP co-polycondensation, hydrothermally stable mesoporous aluminosilicates with different Si/Al molar ratios were successfully prepared. All samples exclusively showed narrow pore size distribution centered at 3.6 nm. To assess the hydrothermal stability, samples were subjected to 100 deg. C distilled water for 300 h. The boiled mesoporous aluminosilicates have nearly the same N{sub 2} adsorption-desorption isotherms and the same pore size distributions as those newly synthesized ones, indicating excellent hydrothermal stability. The {sup 29}Si MAS NMR spectra confirmed that PMHS and TEOSmore » have jointly condensed and CH{sub 3} groups have been introduced into the materials. The {sup 27}Al MAS NMR spectra indicated that Al atoms have been incorporated in the mesopore frameworks. The NH{sub 3} temperature-programmed desorption showed strong acidity. Due to the existence of large amount of CH{sub 3} groups, the mesoporous aluminosilicates obtained good hydrophobicity. Owing to the relatively large pore and the strong acidity provided by the uniform four-coordinated Al atoms, the excellent catalytic performance for 1,3,5-triisopropylbenzene cracking was acquired easily. The materials may be a profitable complement for the synthesis of solid acid catalysts. - Graphical abstract: Based on the nonsurfactant method, a facile one-step synthesis route has been developed to prepare methyl-modified mesoporous aluminosilicates that possessed hydrothermal stability and strong acidity.« less

Sites of abscisic acid synthesis and metabolism in Ricinus communis L

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zeevaart, J.A.D.

1977-05-01

The sites of abscisic acid (ABA) synthesis and metabolism in Ricinus communis L. were investigated by analyzing the levels of ABA and its two metabolites phaseic acid (PA) and dihydrophaseic acid (DPA) in the shoot tips, mature leaves, and phloem sap of stressed and nonstressed plants. Water stress increased the concentration of ABA, PA, and DPA in phloem exudate and also increased the levels of all three compounds in mature leaves and in shoot tips. The latter had a very high DPA content (18.7 ..mu..g/g fresh weight) even in plants not subjected to water stress. When young and mature leavesmore » were excised and allowed to wilt, the level of ABA increased in both, demonstrating that leaves at an early stage of development have the capacity to produce ABA. These results have been interpreted to mean that in mature leaves of nonstressed Ricinus plants, ABA is synthesized and metabolized, and that ABA itself, as well as its metabolites, are translocated in the phloem to the shoot tips (sinks). Since DPA, but not ABA, accumulates in the shoot tips, it follows that ABA is metabolized rapidly in the apical region. To what extent ABA present in young leaves of nonstressed plants is the consequence of synthesis in situ and of import from older leaves remains to be determined.« less

Supply of fatty acid is one limiting factor in the accumulation of triacylglycerol in developing embryos

PubMed

Bao; Ohlrogge

1999-08-01

The metabolic factors that determine oil yield in seeds are still not well understood. To begin to examine the limits on triacylglycerol (TAG) production, developing Cuphea lanceolata, Ulmus carpinifolia, and Ulmus parvifolia embryos were incubated with factors whose availability might limit oil accumulation. The addition of glycerol or sucrose did not significantly influence the rate of TAG synthesis. However, the rate of (14)C-TAG synthesis upon addition of 2.1 mM (14)C-decanoic acid (10:0) was approximately four times higher than the in vivo rate of TAG accumulation in C. lanceolata and two times higher than the in vivo rate in U. carpinifolia and U. parvifolia. In C. lanceolata embryos, the highest rate of (14)C-TAG synthesis (14.3 nmol h(-1) embryo(-1)) was achieved with the addition of 3.6 mM decanoic acid. (14)C-Decanoic acid was incorporated equally well in all three acyl positions of TAG. The results suggest that C. lanceolata, U. carpinifolia, and U. parvifolia embryos have sufficient acyltransferase activities and glycerol-3-phosphate levels to support rates of TAG synthesis in excess of those found in vivo. Consequently, the amount of TAG synthesized in these oilseeds may be in part determined by the amount of fatty acid produced in plastids.

Activation of the constitutive androstane receptor inhibits gluconeogenesis without affecting lipogenesis or fatty acid synthesis in human hepatocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lynch, Caitlin; Pan, Yongmei; Li, Linhao

Objective: Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods: Ligand-based structure–activity models were used for virtual screening of the Specs database ( (www.specs.net)) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluatedmore » in HPH. Results: Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion: Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications: Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. - Highlights: • Novel hCAR activators were identified by computational and biological approaches. �

Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids

PubMed Central

Cativiela, Carlos; Ordóñez, Mario

2010-01-01

The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486

Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

NASA Astrophysics Data System (ADS)

Kitadai, Norio

2015-12-01

Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

PubMed

Kitadai, Norio

2015-12-01

Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

Bile acid synthesis in man. In vivo activity of the 25-hydroxylation pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duane, W.C.; Pooler, P.A.; Hamilton, J.N.

1988-07-01

During biosynthesis of bile acid, carbons 25-26-27 are removed from the cholesterol side-chain. Side-chain oxidation begins either with hydroxylation at the 26-position, in which case the three-carbon fragment is released as propionic acid, or with hydroxylation at the 25-position, in which case the three-carbon fragment is released as acetone. We have previously shown in the rat that the contribution of the 25-hydroxylation pathway can be quantitated in vivo by measuring production of (/sup 14/C)acetone from (/sup 14/C)26-cholesterol. In the present study, we adapted this method to human subjects. 4 d after oral administration of 100 microCi of (/sup 14/C)26-cholesterol andmore » 1 d after beginning a constant infusion of 16.6 mumol/min unlabeled acetone, three men and two women underwent breath collections. Expired acetone was trapped and purified as the 2,4 dinitrophenylhydrazine derivative. /sup 14/CO/sub 2/ was trapped quantitatively using phenethylamine. Specific activity of breath acetone was multiplied by the acetone infusion rate to calculate production of (/sup 14/C)acetone. (/sup 14/C)Acetone production averaged 4.9% of total release of /sup 14/C from (/sup 14/C)26-cholesterol, estimated by /sup 14/CO2 output. The method was validated by showing that (/sup 14/C)acetone production from (/sup 14/C)isopropanol averaged 86.9% of the (/sup 14/C)-isopropanol infusion rate. We conclude that in man, as in the rat, the 25-hydroxylation pathway accounts for less than 5% of bile acid synthesis.« less

Increasing the fidelity of noncanonical amino acid incorporation in cell-free protein synthesis.

PubMed

Gan, Qinglei; Fan, Chenguang

2017-11-01

Cell-free protein synthesis provides a robust platform for co-translational incorporation of noncanonical amino acid (ncAA) into proteins to facilitate biological studies and biotechnological applications. Recently, eliminating the activity of release factor 1 has been shown to increase ncAA incorporation in response to amber codons. However, this approach could promote mis-incorporation of canonical amino acids by near cognate suppression. We performed a facile protocol to remove near cognate tRNA isoacceptors of the amber codon from total tRNAs, and used the phosphoserine (Sep) incorporation system as validation. By manipulating codon usage of target genes and tRNA species introduced into the cell-free protein synthesis system, we increased the fidelity of Sep incorporation at a specific position. By removing three near cognate tRNA isoacceptors of the amber stop codon [tRNA Lys , tRNA Tyr , and tRNA Gln (CUG)] from the total tRNA, the near cognate suppression decreased by 5-fold without impairing normal protein synthesis in the cell-free protein synthesis system. Mass spectrometry analyses indicated that the fidelity of ncAA incorporation was improved. Removal of near cognate tRNA isoacceptors of the amber codon could increase ncAA incorporation fidelity towards the amber stop codon in release factor deficiency systems. We provide a general strategy to improve fidelity of ncAA incorporation towards stop, quadruplet and sense codons in cell-free protein synthesis systems. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2016 Elsevier B.V. All rights reserved.

Use of the 2-chlorotrityl chloride resin for microwave-assisted solid phase peptide synthesis.

PubMed

Ieronymaki, Matthaia; Androutsou, Maria Eleni; Pantelia, Anna; Friligou, Irene; Crisp, Molly; High, Kirsty; Penkman, Kirsty; Gatos, Dimitrios; Tselios, Theodore

2015-09-01

A fast and efficient microwave (MW)-assisted solid-phase peptide synthesis protocol using the 2-chlorotrityl chloride resin and the Fmoc/tBu methodology, has been developed. The established protocol combines the advantages of MW irradiation and the acid labile 2-chlorotrityl chloride resin. The effect of temperature during the MW irradiation, the degree of resin substitution during the coupling of the first amino acids and the rate of racemization for each amino acid were evaluated. The suggested solid phase methodology is applicable for orthogonal peptide synthesis and for the synthesis of cyclic peptides. © 2015 Wiley Periodicals, Inc.

Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

PubMed Central

Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

2014-01-01

Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

Mechanochemical synthesis of bumetanide-4-aminobenzoic acid molecular cocrystals: a facile and green approach to drug optimization.

PubMed

Bruni, Giovanna; Maietta, Mariarosa; Berbenni, Vittorio; Mustarelli, Piercarlo; Ferrara, Chiara; Freccero, Mauro; Grande, Vincenzo; Maggi, Lauretta; Milanese, Chiara; Girella, Alessandro; Marini, Amedeo

2014-08-07

Molecular cocrystals are of growing interest in pharmaceutics for their improved physicochemical properties. Their mechanochemical synthesis is very promising, being easy, cheap, and "green". Here, for the first time, we report on cocrystallization of bumetanide, a diuretic and natriuretic active principle, and 4-aminobenzoic acid. The synthesis is performed both by wet and dry grinding. The cocrystal formation was investigated with a wide range of techniques, including solid-state NMR, IR, XRD, microscopy, and thermal analysis. Wet and dry grinding procedures led to different cocrystal polymorphs. In particular, the dry method gave a cocrystal by powder amorphization and subsequent crystallization. DFT calculations at the B3LYP/6-31+G(d,p) level of theory shed light on the H-bond scheme at the basis of cocrystal formation. The cocrystals showed improved solubility and dissolution rate with respect to the drug alone. This could guarantee a faster absorption and a better bioavailability of the active principle.

Age-related decrease in sensitivity to glucagon and dibutyryl cyclic AMP inhibition of fatty acid synthesis in hepatocytes isolated from obese female Zucker rats.

PubMed

McCune, S A; Durant, P J; Harris, R A

1984-02-01

Hepatocytes were isolated from 3 and 5 month old female genetically obese Zucker rats and their lean littermate controls. An age-dependent loss in sensitivity of fatty acid synthesis to inhibition by both glucagon and dibutyryl cyclic AMP was observed with hepatocytes from the obese rats. Hepatocytes from lean animals were much more sensitive to these agents, regardless of age. Low concentrations of glucagon and dibutyryl cyclic AMP actually produced some stimulation of fatty acid synthesis with hepatocytes prepared from the older obese rats. 5-Tetradecyloxy-2-furoic acid, a compound which inhibits fatty acid synthesis, was a very effective inhibitor of fatty acid synthesis by hepatocytes isolated from all rats used in the study. An inhibition of lactate plus pyruvate accumulation and a strong stimulation of glycogenolysis occurred in response to both glucagon and dibutyryl cyclic AMP with hepatocytes from both age groups of lean and obese rats. The results suggest that with aging of the obese female Zucker rat some step of hepatic fatty acid synthesis becomes progressively less sensitive to inhibition by glucagon and dibutyryl cyclic AMP. This may play an important role in maintenance of obesity in these animals.

Regulation of Lipid Synthesis in Soybeans by Two Benzoic Acid Herbicides 1

PubMed Central

Muslih, Raad K.; Linscott, Dean L.

1977-01-01

The effects of 3-nitro-2,5-dichlorobenzoic acid (dinoben) and 3-amino-2,4-dichlorobenzoic acid (chloramben) on lipid formation and on the incorporation of various substrates into lipids by intact seeds and subcellular fractions of germinating soybean (Glycine max [L.] Merr. `Amsoy') were studied. Dinoben (20 μg/ml) inhibited synthesis of total lipids 67%, neutral lipids 73%, glycolipids 51%, and phospholipids 39% in germinating seeds. When polar lipids were analyzed further, inhibition of individual lipid classes was also observed. Chloramben (20 μg/ml) stimulated total lipid synthesis 25%. With the exception of the mitochondrial fraction where malonate thiokinase was absent, dinoben inhibited up to 99% the incorporation of acetate and malonate into lipids, but did not inhibit acetyl-CoA and malonyl-CoA incorporation. Chloramben stimulated the incorporation of all substrates tested into lipids by all fractions except the mitochondrial fraction when malonate was the substrate. When dinoben and chloramben were used in combinations, chloramben did not reverse the inhibitory effect of dinoben. It is concluded that the dinoben inhibitory effect is specific and is associated with the acetate and malonate thiokinase systems. The chloramben effect is stimulatory to either acetyl-CoA carboxylase or fatty acid synthetase or both. PMID:16660173

Leucine and alpha-Ketoisocaproic acid, but not norleucine, stimulate skeletal muscle protein synthesis in neonatal pigs

USDA-ARS?s Scientific Manuscript database

The branched-chain amino acid, leucine, acts as a nutrient signal to stimulate protein synthesis in skeletal muscle of young pigs. However, the chemical structure responsible for this effect has not been identified. We have shown that the other branched-chain amino acids, isoleucine and valine, are ...

Engineering of Saccharomyces cerevisiae for the synthesis of short chain fatty acids.

PubMed

Leber, Christopher; Da Silva, Nancy A

2014-02-01

Carbon feedstocks from fossilized sources are being rapidly depleted due to rising demand for industrial and commercial applications. Many petroleum-derived chemicals can be directly or functionally substituted with chemicals derived from renewable feedstocks. Several short chain organic acids may fulfill this role using their functional groups as a target for chemical catalysis. Saccharomyces cerevisiae was engineered to produce short chain carboxylic acids (C6 to C10 ) from glucose using the heterologous Homo sapiens type I fatty acid synthase (hFAS). This synthase was activated by phosphopantetheine transfereases AcpS and Sfp from Escherichia coli and Bacillus subtilis, respectively, both in vitro and in vivo. hFAS was produced in the holo-form and produced carboxylic acids in vitro, confirmed by NADPH and ADIFAB assays. Overexpression of hFAS in a yeast FAS2 knockout strain, deficient in de novo fatty acid synthesis, demonstrated the full functional replacement of the native fungal FAS by hFAS. Two active heterologous short chain thioesterases (TEs) from Cuphea palustris (CpFatB1) and Rattus norvegicus (TEII) were evaluated for short chain fatty acid (SCFA) synthesis in vitro and in vivo. Three hFAS mutants were constructed: a mutant deficient in the native TE domain, a mutant with a linked CpFatB1 TE and a mutant with a linked TEII TE. Using the native yeast fatty acid synthase for growth, the overexpression of the hFAS mutants and the short-chain TEs (linked or plasmid-based) increased in vivo caprylic acid and total SCFA production up to 64-fold (63 mg/L) and 52-fold (68 mg/L), respectively, over the native yeast levels. Combined over-expression of the phosphopantetheine transferase with the hFAS mutant resulted in C8 titers of up to 82 mg/L and total SCFA titers of up to 111 mg/L. © 2013 Wiley Periodicals, Inc.

Arachidonic acid stimulates DNA synthesis in brown preadipocytes through the activation of protein kinase C and MAPK.

PubMed

Garcia, Bibian; Martinez-de-Mena, Raquel; Obregon, Maria-Jesus

2012-10-01

Arachidonic acid (AA) is a polyunsaturated fatty acid that stimulates the proliferation of many cellular types. We studied the mitogenic potential of AA in rat brown preadipocytes in culture and the signaling pathways involved. AA is a potent mitogen which induces 4-fold DNA synthesis in brown preadipocytes. The AA mitogenic effect increases by NE addition. AA also increases the mitogenic action of different growth factor combinations. Other unsaturated and saturated fatty acids do not stimulate DNA synthesis to the same extent as AA. We analyzed the role of PKC and MEK/MAPK signaling pathways. PKC inhibition by bisindolilmaleimide I (BIS) abolishes AA and phorbol ester stimulation of DNA synthesis and reduces the mitogenic activity of different growth factors in brown preadipocytes. Brown preadipocytes in culture express PKC α, δ, ε and ζ isoforms. Pretreatment with high doses of the phorbol ester PDBu, induces downregulation of PKCs ε and δ and reproduces the effect of BIS indicating that AA-dependent induction of DNA synthesis requires PKC activity. AA also activates MEK/MAPK pathway and the inhibition of MEK activity inhibits AA stimulation of DNA synthesis and brown adipocyte proliferation. Inhibition of PKC δ by rottlerin abolishes AA-dependent stimulation of DNA synthesis and MAPK activation, whereas PKC ε inhibition does not produce any effect. In conclusion, our results identify AA as a potent mitogen for brown adipocytes and demonstrate the involvement of the PDBu-sensitive PKC δ isoform and MEK/MAPK pathway in AA-induced proliferation of brown adipocytes. Increased proliferative activity might increase the thermogenic capacity of brown fat. Copyright © 2012 Elsevier B.V. All rights reserved.

A concise synthesis of benzimidazoles via the microwave-assisted one-pot batch reaction of amino acids up to a 10-g scale.

PubMed

Peng, Pai; Xiong, Jin-Feng; Mo, Guang-Zhen; Zheng, Jia-Li; Chen, Ren-Hong; Chen, Xiao-Yun; Wang, Zhao-Yang

2014-10-01

An efficient method for the synthesis of aminomethyl benzimidazoles is developed by using a one-pot batch reaction between amino acids and o-phenylenediamines. This reaction proceeds smoothly in an unmodified household microwave oven, even though scale-up is to 10 g. A desirable method for the quick synthesis of benzimidazoles, which are used as a kind of important intermediates in drug synthesis, is provided by the scale-up utilization of amino acid resource.

Supply of Fatty Acid Is One Limiting Factor in the Accumulation of Triacylglycerol in Developing Embryos1

PubMed Central

Bao, Xiaoming; Ohlrogge, John

1999-01-01

The metabolic factors that determine oil yield in seeds are still not well understood. To begin to examine the limits on triacylglycerol (TAG) production, developing Cuphea lanceolata, Ulmus carpinifolia, and Ulmus parvifolia embryos were incubated with factors whose availability might limit oil accumulation. The addition of glycerol or sucrose did not significantly influence the rate of TAG synthesis. However, the rate of 14C-TAG synthesis upon addition of 2.1 mm 14C-decanoic acid (10:0) was approximately four times higher than the in vivo rate of TAG accumulation in C. lanceolata and two times higher than the in vivo rate in U. carpinifolia and U. parvifolia. In C. lanceolata embryos, the highest rate of 14C-TAG synthesis (14.3 nmol h−1 embryo−1) was achieved with the addition of 3.6 mm decanoic acid. 14C-Decanoic acid was incorporated equally well in all three acyl positions of TAG. The results suggest that C. lanceolata, U. carpinifolia, and U. parvifolia embryos have sufficient acyltransferase activities and glycerol-3-phosphate levels to support rates of TAG synthesis in excess of those found in vivo. Consequently, the amount of TAG synthesized in these oilseeds may be in part determined by the amount of fatty acid produced in plastids. PMID:10444089

Sustainable Synthesis of Oxalic and Succinic Acid through Aerobic Oxidation of C6 Polyols Under Mild Conditions.

PubMed

Ventura, Maria; Williamson, David; Lobefaro, Francesco; Jones, Matthew D; Mattia, Davide; Nocito, Francesco; Aresta, Michele; Dibenedetto, Angela

2018-03-22

The sustainable chemical industry encompasses a shift from the use of fossil carbon to renewable carbon. The synthesis of chemicals from nonedible biomass (cellulosic or oil) represents one of the key steps for "greening" the chemical industry. In this paper, we report the aerobic oxidative cleavage of C6 polyols (5-HMF, glucose, fructose and sucrose) to oxalic acid (OA) and succinic acid (SA) in water under mild conditions using M@CNT and M@NCNT (M=Fe, V; CNT=carbon nanotubes; NCNT=N-doped CNT), which, under suitable conditions, were recoverable and reusable without any loss of efficiency. The influence of the temperature, O 2 pressure (PO2 ), reaction time and stirring rate are discussed and the best reaction conditions are determined for an almost complete conversion of the starting material and a good OA yield of 48 %. SA and formic acid were the only co-products. The former could be further converted into OA by oxidation in the presence of formic acid, resulting in an overall OA yield of >62 %. This process was clean and did not produce organic waste nor gas emissions. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Recycling rate of bile acids in the enterohepatic recirculation as a major determinant of whole body 75SeHCAT retention.

PubMed

Peters, A Michael; Walters, Julian R F

2013-10-01

Measurement of the whole body retention of orally administered (75)SeHCAT is used to investigate patients with unexplained diarrhoea. Retention values of <15 % at 7 days post-administration are taken to indicate bile acid malabsorption (BAM). Whilst idiopathic BAM is frequently diagnosed with (75)SeHCAT, functional and morphological studies of the terminal ileum rarely show any abnormality, so the disorder may be more appropriately termed bile acid diarrhoea (BAD). In addition to malabsorption, excess bile acid may reach the colon, where the events leading to diarrhoea take place, as a result firstly of increased bile acid synthesis and secondly of an increased recycling rate of bile acids. Increased recycling has been largely ignored as a cause of BAD, but, as shown in this study, can readily result in excess bile acids reaching the colon even when ileal absorption efficiency is normal (i.e. 95-97 %). There needs to be a re-evaluation of the causes of BAD in patients without a history of previous intestinal resection or evidence of ileal pathology, such as Crohn's disease.

Comparison of the effects of gemfibrozil and clofibric acid on peroxisomal enzymes and cholesterol synthesis of rat hepatocytes.

PubMed

Hashimoto, F; Taira, S; Hayashi, H

1998-11-01

We studied whether the peroxisomal proliferation, induction of 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase) and activation of cholesterol synthesis by gemfibrozil shown in whole body (Hashimoto F., Ishikawa T., Hamada S. and Hayashi H., Biochemical. Pharm., 49, 1213-1221 (1995)) is also detected at a culture cell level, and we made a comparative analysis of the effects of clofibric acid. Gemfibrozil at 0.25 mM increased the activity of some peroxisomal enzymes (catalase and the cyanide-insensitive fatty acyl-CoA oxidizing system) after incubation for 72 h. However, contrary to whole body experiments, gemfibrozil decreased the activity of HMG-CoA reductase and cholesterol synthesis from [14C]acetate. At 1 mM, gemfibrozil decreased not only the activity of HMG-CoA reductase and cholesterol synthesis, but also the protein content of the cells and peroxisomal enzyme activity, indicating nonspecific inhibition at this concentration. Clofibric acid (0.25 and 1 mM) increased the activity of peroxisomal enzymes, but decreased the activity of HMG-CoA reductase and cholesterol synthesis. With respect to the direct effect on HMG-CoA reductase in the cell homogenate, gemfibrozil at 0.25 mm did not affect the activity, but it clearly inhibited the activity at 2 mM and above. Clofibric acid at 2 mM hardly affected the activity, but it clearly decreased the activity at 5 mM and over. That is, gemfibrozil directly inhibited the activity more strongly than clofibric acid. The direct inhibition of the enzyme itself required higher concentrations of both agents than did inhibition at the culture cell level. These results suggest that the cytotoxicity of gemfibrozil is greater than that of clofibric acid, and that gemfibrozil, as well as clofibric acid, can induce peroxisomal enzymes in the culture cell level. In contrast to whole body results, gemfibrozil may suppress cholesterol synthesis from [14C]acetate through the inhibition of HMG-CoA reductase at the culture

The Synthesis and Isolation of N-Tert-Butyl-2-Phenylsuccinamic Acid and N-Tert-Butyl-3-Phenylsuccinamic Acid: An Undergraduate Organic Chemistry Laboratory Experiment

ERIC Educational Resources Information Center

Cesare, Victor; Sadarangani, Ishwar; Rollins, Janet; Costello, Dennis

2004-01-01

The facile, high yielding synthesis of phenylsuccinamic acids is described and one of these syntheses, the reaction of phenylsuccinic anhydride with tert-butylamine, is successfully modified and adapted for use in the second-semester organic chemistry laboratory at St. John's University. Succinamic acids are compounds that contain both the amide…

Myxospore Coat Synthesis in Myxococcus xanthus: In Vivo Incorporation of Acetate and Glycine

PubMed Central

Filer, D.; White, D.; Kindler, S. H.; Rosenberg, E.

1977-01-01

Myxospore coat synthesis in Myxococcus xanthus was studied by incorporation of [14C]acetate into intermediates in the biosynthesis of coat polysaccharide and into acid-insoluble material during vegetative growth and after glycerol induction of myxospores. During short labeling periods at 27°C, the radioactivity was shown to be located primarily in N-acetyl groups rather than sugar moieties. Two hours after glycerol induction, the pools of N-acetylglucosamine 6-phosphate and uridine 5′-diphosphate-N-acetylgalactosamine (UDPGalNAc) plus uridine 5′-diphosphate-N-glucosamine increased about twofold and were labeled at twice the rate measured for vegetative cells. The increased rate of synthesis of UDPGalNAc and its precursors could be correlated with increased enzyme activities measured in vitro. Controlled acid hydrolysis revealed that the galactosamine portion of the myxospore coat was N-acetylated. After glycerol induction, the incorporation of acetate into acid-insoluble material increased threefold. This enhanced incorporation was sensitive to neither penicillin nor d-cycloserine. In contrast, bacitracin inhibited the incorporation of [14C]acetate into acid-insoluble material more effectively 2 h after myxospore induction than during vegetative growth. Chloramphenicol added to cells 90 min after induction blocked further increase in the rate of [14C]acetate incorporation. Since the myxospore coat contains glycine, polymer synthesis was also measured by chloramphenicol-insensitive [14C]glycine incorporation into acid-insoluble material. Although protein synthesis decreased after glycerol induction, glycine incorporation increased. Two hours after induction, glycine incorporation was only 75% inhibited by chloramphenicol and rifampin. The chloramphenicol-insensitive rate of incorporation of [14C]glycine increased during the first hour after myxospore induction and reached a peak rate after 2 to 3 h. The chloramphenicol-resistant incorporation of [14C

FabQ, a Dual-Function Dehydratase/Isomerase, Circumvents the Last Step of the Classical Fatty Acid Synthesis Cycle

PubMed Central

Bi, Hongkai; Wang, Haihong; Cronan, John E.

2015-01-01

SUMMARY In the classical anaerobic pathway of unsaturated fatty acid biosynthesis, that of Escherichia coli, the double bond is introduced into the growing acyl chain by the FabA dehydratase/isomerase. Another dehydratase, FabZ, functions in the chain elongation cycle. In contrast, Aerococcus viridans has only a single FabA/FabZ homolog we designate FabQ. FabQ can not only replace the function of E. coli FabZ in vivo, but it also catalyzes the isomerization required for unsaturated fatty acid biosynthesis. Most strikingly, FabQ in combination with E. coli FabB imparts the surprising ability to bypass reduction of the trans-2-acyl-ACP intermediates of classical fatty acid synthesis. FabQ allows elongation by progressive isomerization reactions to form the polyunsaturated fatty acid, 3-hydroxy-cis-5, 7-hexadecadienoic acid, both in vitro and in vivo. FabQ therefore provides a potential pathway for bacterial synthesis of polyunsaturated fatty acids. PMID:23972938

How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

PubMed Central

Yao, Jiangwei; Rock, Charles O.

2015-01-01

Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

Five Decades with Polyunsaturated Fatty Acids: Chemical Synthesis, Enzymatic Formation, Lipid Peroxidation and Its Biological Effects

PubMed Central

Catalá, Angel

2013-01-01

I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074

Activation of the Constitutive Androstane Receptor Inhibits Gluconeogenesis without Affecting Lipogenesis or Fatty Acid Synthesis in Human Hepatocytes

PubMed Central

Lynch, Caitlin; Pan, Yongmei; Li, Linhao; Heyward, Scott; Moeller, Timothy; Swaan, Peter W.; Wang, Hongbing

2014-01-01

Objective Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods Ligand-based structure-activity models were used for virtual screening of the Specs database (www.specs.net) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluated in HPH. Results Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. PMID:24878338

Intensification of esterification of acids for synthesis of biodiesel using acoustic and hydrodynamic cavitation.

PubMed

Kelkar, Mandar A; Gogate, Parag R; Pandit, Aniruddha B

2008-03-01

Cavitation results in conditions of turbulence and liquid circulation in the reactor which can aid in eliminating mass transfer resistances. The present work illustrates the use of cavitation for intensification of biodiesel synthesis (esterification) reaction, which is mass transfer limited reaction considering the immiscible nature of the reactants, i.e., fatty acids and alcohol. Esterification of fatty acid (FA) odour cut (C(8)-C(10)) with methanol in the presence of concentrated H(2)SO(4) as a catalyst has been studied in hydrodynamic cavitation reactor as well as in the sonochemical reactor. The different reaction operating parameters such as molar ratio of acid to alcohol, catalyst quantity have been optimized under acoustic as well as hydrodynamic cavitating conditions in addition to the optimization of the geometry of the orifice plate in the case of hydrodynamic cavitation reactors. Few experiments have also been carried out with other acid (lower and higher)/methanol combination viz. caprylic acid and capric acids with methanol with an aim of investigating the efficacy of cavitation for giving the desired yields and also to quantify the degree of process intensification that can be achieved using the same. It has been observed that ambient operating conditions of temperature and pressure and reaction times of <3h, for all the different combinations of acid (lower and higher)/methanol studied in the present work, was sufficient for giving >90% conversion (mol%). This clearly establishes the efficacy of cavitation as an excellent way to achieve process intensification of the biodiesel synthesis process.

Synthesis of goethite in solutions of artificial seawater and amino acids: a prebiotic chemistry study

NASA Astrophysics Data System (ADS)

Carneiro, Cristine E. A.; Ivashita, Flávio F.; de Souza, Ivan Granemann; de Souza, Cláudio M. D.; Paesano, Andrea; da Costa, Antonio C. S.; di Mauro, Eduardo; de Santana, Henrique; Zaia, Cássia T. B. V.; Zaia, Dimas A. M.

2013-04-01

This study investigated the synthesis of goethite under conditions resembling those of the prebiotic Earth. The artificial seawater used contains all the major elements as well as amino acids (α-Ala, β-Ala, Gly, Cys, AIB) that could be found on the prebiotic Earth. The spectroscopic methods (FT-IR, EPR, Raman), scanning electron microscopy (SEM) and X-ray diffraction showed that in any condition Gly and Cys favoured the formation of goethite, artificial seawater plus β-Ala and distilled water plus AIB favoured the formation of hematite and for the other synthesis a mixture of goethite and hematite were obtained. Thus in general no protein amino acids (β-Ala, AIB) favoured the formation of hematite. As shown by surface enhanced Raman spectroscopy (SERS) spectra the interaction between Cys and Fe3+ of goethite is very complex, involving decomposition of Cys producing sulphur, as well as interaction of carboxylic group with Fe3+. SERS spectra also showed that amino/CN and C-CH3 groups of α-Ala are interacting with Fe3+ of goethite. For the other samples the shifting of several bands was observed. However, it was not possible to say which amino acid groups are interacting with Fe3+. The pH at point of zero charge of goethites increased with artificial seawater and decreased with amino acids. SEM images showed when only goethite was synthesized the images of the samples were acicular and when only hematite was synthesized the images of the samples were spherical. SEM images for the synthesis of goethite with Cys were spherical crystal aggregates with radiating acicular crystals. The highest resonance line intensities were obtained for the samples where only hematite was obtained. Electron paramagnetic resonance (EPR) and Mössbauer spectra showed for the synthesis of goethite with artificial seawater an isomorphic substitution of iron by seawater cations. Mössbauer spectra also showed that for the synthesis goethite in distilled water plus Gly only goethite was

Abc Amino Acids: Design, Synthesis, and Properties of New Photoelastic Amino Acids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Standaert, Robert F; Park, Dr Seung Bum

2006-01-01

Photoisomerizable amino acids provide a direct avenue to the experimental manipulation of bioactive polypeptides, potentially allowing real-time, remote control of biological systems and enabling useful applications in nanobiotechnology. Herein, we report a new class of photoisomerizable amino acids intended to cause pronounced expansion and contraction in the polypeptide backbone, i.e., to be photoelastic. These compounds, termed Abc amino acids, employ a photoisomerizable azobiphenyl chromophore to control the relative disposition of aminomethyl and carboxyl substituents. Molecular modeling of nine Abc isomers led to the identification of one with particularly attractive properties, including the ability to induce contractions up to 13A inmore » the backbone upon transa?cis photoisomerization. This isomer, designated mpAbc, has substituents at meta and para positions on the inner (azo-linked) and outer rings, respectively. An efficient synthesis of Fmoc-protected mpAbc was executed in which the biaryl components were formed via Suzuki couplings and the azo linkage was formed via amine/nitroso condensation; protected forms of three other Abc isomers were prepared similarly. A decapeptide incorporating mpAbc was synthesized by conventional solid-phase methods and displayed characteristic azobenzene photochemical behavior with optimal conversion to the cis isomer at 360 nm and a thermal cisa?trans half life of 100 min. at 80 AoC.« less

The Hypothesis that the Genetic Code Originated in Coupled Synthesis of Proteins and the Evolutionary Predecessors of Nucleic Acids in Primitive Cells

PubMed Central

Francis, Brian R.

2015-01-01

Although analysis of the genetic code has allowed explanations for its evolution to be proposed, little evidence exists in biochemistry and molecular biology to offer an explanation for the origin of the genetic code. In particular, two features of biology make the origin of the genetic code difficult to understand. First, nucleic acids are highly complicated polymers requiring numerous enzymes for biosynthesis. Secondly, proteins have a simple backbone with a set of 20 different amino acid side chains synthesized by a highly complicated ribosomal process in which mRNA sequences are read in triplets. Apparently, both nucleic acid and protein syntheses have extensive evolutionary histories. Supporting these processes is a complex metabolism and at the hub of metabolism are the carboxylic acid cycles. This paper advances the hypothesis that the earliest predecessor of the nucleic acids was a β-linked polyester made from malic acid, a highly conserved metabolite in the carboxylic acid cycles. In the β-linked polyester, the side chains are carboxylic acid groups capable of forming interstrand double hydrogen bonds. Evolution of the nucleic acids involved changes to the backbone and side chain of poly(β-d-malic acid). Conversion of the side chain carboxylic acid into a carboxamide or a longer side chain bearing a carboxamide group, allowed information polymers to form amide pairs between polyester chains. Aminoacylation of the hydroxyl groups of malic acid and its derivatives with simple amino acids such as glycine and alanine allowed coupling of polyester synthesis and protein synthesis. Use of polypeptides containing glycine and l-alanine for activation of two different monomers with either glycine or l-alanine allowed simple coded autocatalytic synthesis of polyesters and polypeptides and established the first genetic code. A primitive cell capable of supporting electron transport, thioester synthesis, reduction reactions, and synthesis of polyesters and

Synthesis and Pro-Apoptotic Activity of Novel Glycyrrhetinic Acid Derivatives

PubMed Central

Logashenko, Evgeniya B; Salomatina, Oksana V; Markov, A V; Korchagina, Dina V; Salakhutdinov, Nariman F; Tolstikov, Genrikh A; Vlassov, Valentin V; Zenkova, Marina A

2011-01-01

Triterpenoids are used for medicinal purposes in many countries. Some, such as oleanolic and glycyrrhetinic acids, are known to be anti-inflammatory and anticarcinogenic. However, the biological activities of these naturally occurring molecules against their particular targets are weak, so the synthesis of new synthetic analogues with enhanced potency is needed. By combining modifications to both the A and C rings of 18βH-glycyrrhetinic acid, the novel synthetic derivative methyl 2-cyano-3,12-dioxo-18βH-olean-9(11),1(2)-dien-30-oate was obtained. This derivative displays high antiproliferative activity in cancer cells, including a cell line with a multidrug-resistance phenotype. It causes cell death by inducing the intrinsic caspase-dependent apoptotic pathway. PMID:21328513

Clinical Relevance of Type II Fatty Acid Synthesis Bypass in Staphylococcus aureus

PubMed Central

Guillemet, Mélanie; Soler, Charles; Morvan, Claire; Halpern, David; Pourcel, Christine; Vu Thien, Hoang; Lamberet, Gilles

2017-01-01

ABSTRACT The need for new antimicrobials to treat bacterial infections has led to the use of type II fatty acid synthesis (FASII) enzymes as front-line targets. However, recent studies suggest that FASII inhibitors may not work against the opportunist pathogen Staphylococcus aureus, as environmental fatty acids favor emergence of multi-anti-FASII resistance. As fatty acids are abundant in the host and one FASII inhibitor, triclosan, is widespread, we investigated whether fatty acid pools impact resistance in clinical and veterinary S. aureus isolates. Simple addition of fatty acids to the screening medium led to a 50% increase in triclosan resistance, as tested in 700 isolates. Moreover, nonculturable triclosan-resistant fatty acid auxotrophs, which escape detection under routine conditions, were uncovered in primary patient samples. FASII bypass in selected isolates correlated with polymorphisms in the acc and fabD loci. We conclude that fatty-acid-dependent strategies to escape FASII inhibition are common among S. aureus isolates and correlate with anti-FASII resistance and emergence of nonculturable variants. PMID:28193654

Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

NASA Technical Reports Server (NTRS)

Lin, B. L.; Raghavan, V.

1991-01-01

The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

Supply of fatty acid is one limiting factor in the accumulation of triacylglycerol in developing embryos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bao, X.; Ohlrogge, J.

1999-08-01

The metabolic factors that determine oil yield in seeds are still not well understood. To begin to examine the limits on triacylglycerol (TAG) production, developing Cuphea lanceolata, Ulmus carpinifolia, and Ulmus parvifolia embryos were incubated with factors whose availability might limit oil accumulation. The addition of glycerol or sucrose did not significantly influence the rate of TAG synthesis. However, the rate of {sup 14}C-TAG synthesis upon addition of 2.1 mM {sup 14}C-decanoic acid (10:0) was approximately four times higher than the in vivo rate of TAG accumulation in C. lanceolata and two times higher than the in vivo rate inmore » U. carpinifolia and U. parvifolia. In C. lanceolata embryos, the highest rate of {sup 14}C-TAG synthesis (14.3 nmol h{sup {minus}1} embryo {sup {minus}1}) was achieved with the addition of 3.6 mM decanoic acid. {sup 14}C-Decanoic acid was incorporated equally well in all three acyl positions of TAG. The results suggest that C. lancelata, U. Carpinifolia, and U. parvifolia embryos have sufficient acyltransferase activities and glycerol-3-phosphate levels to support rates of TAG synthesis in excess of those found in vivo. Consequently, the amount of TAG synthesized in these oilseeds may be in part determined by the amount of fatty acid produced in plastids.« less

Regulation of Intestinal Mucosal Growth by Amino Acids

PubMed Central

Ray, Ramesh M.; Johnson, Leonard R.

2013-01-01

Amino acids, especially glutamine (GLN) have been known for many years to stimulate the growth of small intestinal mucosa. Polyamines are also required for optimal mucosal growth, and the inhibition of ornithine decarboxylase (ODC), the first rate-limiting enzyme in polyamine synthesis, blocks growth. Certain amino acids, primarily asparagine (ASN) and GLN stimulate ODC activity in a solution of physiological salts. More importantly, their presence is also required before growth factors and hormones such as EGF and insulin are able to increase ODC activity. ODC activity is inhibited by antizyme-1 (AZ) whose synthesis is stimulated by polyamines, thus, providing a negative feedback regulation of the enzyme. In the absence of amino acids mammalian target of rapamycin complex 1 (mTORC1) is inhibited, whereas, mTORC2 is stimulated leading to the inhibition of global protein synthesis but increasing the synthesis of AZ via a cap-independent mechanism. These data, therefore, explain why ASN or GLN is essential for the activation of ODC. Interestingly, in a number of papers, AZ has been shown to inhibit cell proliferation, stimulate apoptosis or increase autophagy. Each of these activities results in decreased cellular growth. AZ binds to and accelerates the degradation of ODC and other proteins shown to regulate proliferation and cell death, such as Aurora-A, Cyclin D1 and Smad1. The correlation between the stimulation of ODC activity and the absence of AZ as influenced by amino acids is high. Not only do amino acids such as ASN and GLN stimulate ODC while inhibiting AZ synthesis, but also amino acids such as lysine, valine and ornithine, which inhibit ODC activity, increase the synthesis of AZ. The question remaining to be answered is whether AZ inhibits growth directly or whether it acts by decreasing the availability of polyamines to the dividing cells. In either case, evidence strongly suggests that the regulation of AZ synthesis is the mechanism through which amino

Regulation of intestinal mucosal growth by amino acids.

PubMed

Ray, Ramesh M; Johnson, Leonard R

2014-03-01

Amino acids, especially glutamine (GLN) have been known for many years to stimulate the growth of small intestinal mucosa. Polyamines are also required for optimal mucosal growth, and the inhibition of ornithine decarboxylase (ODC), the first rate-limiting enzyme in polyamine synthesis, blocks growth. Certain amino acids, primarily asparagine (ASN) and GLN stimulate ODC activity in a solution of physiological salts. More importantly, their presence is also required before growth factors and hormones such as epidermal growth factor and insulin are able to increase ODC activity. ODC activity is inhibited by antizyme-1 (AZ) whose synthesis is stimulated by polyamines, thus, providing a negative feedback regulation of the enzyme. In the absence of amino acids mammalian target of rapamycin complex 1 (mTORC1) is inhibited, whereas, mTORC2 is stimulated leading to the inhibition of global protein synthesis but increasing the synthesis of AZ via a cap-independent mechanism. These data, therefore, explain why ASN or GLN is essential for the activation of ODC. Interestingly, in a number of papers, AZ has been shown to inhibit cell proliferation, stimulate apoptosis, or increase autophagy. Each of these activities results in decreased cellular growth. AZ binds to and accelerates the degradation of ODC and other proteins shown to regulate proliferation and cell death, such as Aurora-A, Cyclin D1, and Smad1. The correlation between the stimulation of ODC activity and the absence of AZ as influenced by amino acids is high. Not only do amino acids such as ASN and GLN stimulate ODC while inhibiting AZ synthesis, but also amino acids such as lysine, valine, and ornithine, which inhibit ODC activity, increase the synthesis of AZ. The question remaining to be answered is whether AZ inhibits growth directly or whether it acts by decreasing the availability of polyamines to the dividing cells. In either case, evidence strongly suggests that the regulation of AZ synthesis is the

Inhibition of fatty acid synthesis decreases very low density lipoprotein secretion in the hamster.

PubMed

Arbeeny, C M; Meyers, D S; Bergquist, K E; Gregg, R E

1992-06-01

The hamster was developed as a model to study very low density lipoprotein (VLDL) metabolism, since, as is the case in humans, the hamster liver was found to synthesize apoB-100 and not apoB-48. The effect of inhibiting fatty acid synthesis on the hepatic secretion of VLDL triglyceride (TG) and apolipoprotein (apo) B-100 in this model was then investigated. In an in vivo study, hamsters were fed a chow diet containing 0.15% TOFA (5-tetradecyloxy-2-furancarboxylic acid), an inhibitor of acetyl-CoA carboxylase. After 6 days of treatment, plasma triglyceride and cholesterol levels were decreased by 30.2% and 11.6%, respectively. When the secretion of VLDL-TG by the liver was measured in vivo after injection of Triton WR 1339, TOFA treatment was found to decrease VLDL-TG secretion by 40%. In subsequent in vitro studies utilizing cultured primary hamster hepatocytes, incubation with 20 microM TOFA for 4 h resulted in 98% and 76% inhibition in fatty acid and triglyceride synthesis, respectively; VLDL-TG secretion was decreased by 90%. When hepatocytes were pulsed with [3H]leucine, incubation with TOFA resulted in a 50% decrease in the incorporation of radiolabel into secreted VLDL apoB-100. The results of this study indicate that inhibition of intracellular triglyceride synthesis decreases the secretion of VLDL-TG and apoB-100, and does not result in the secretion of a dense, triglyceride-depleted lipoprotein.

Green synthesis of gold nanoparticles using chlorogenic acid and their enhanced performance for inflammation.

PubMed

Hwang, Su Jung; Jun, Sang Hui; Park, Yohan; Cha, Song-Hyun; Yoon, Minho; Cho, Seonho; Lee, Hyo-Jong; Park, Youmie

2015-10-01

Here we developed a novel green synthesis method for gold nanoparticles (CGA-AuNPs) using chlorogenic acid (CGA) as reductants without the use of other chemicals and validated the anti-inflammatory efficacy of CGA-AuNPs in vitro and in vivo. The resulting CGA-AuNPs appeared predominantly spherical in shape with an average diameter of 22.25±4.78nm. The crystalline nature of the CGA-AuNPs was confirmed by high-resolution X-ray diffraction and by selected-area electron diffraction analyses. High-resolution liquid chromatography/electrospray ionization mass spectrometry revealed that the caffeic acid moiety of CGA forms quinone structure through a two-electron oxidation causing the reduction of Au(3+) to Au(0). When compared to CGA, CGA-AuNPs exhibited enhanced anti-inflammatory effects on NF-κB-mediated inflammatory network, as well as cell adhesion. Collectively, green synthesis of CGA-AuNPs using bioactive reductants and mechanistic studies based on mass spectrometry may open up new directions in nanomedicine and CGA-AuNPs can be an anti-inflammatory nanomedicine for future applications. Gold nanoparticles (Au NPs) have been shown to be very useful in many applications due to their easy functionalization capability. In this article, the authors demonstrated a novel method for the synthesis of gold nanoparticles using chlorogenic acid (CGA) as reductants. In-vitro experiments also confirmed biological activity of the resultant gold nanoparticles. Further in-vivo studies are awaited. Copyright © 2015 Elsevier Inc. All rights reserved.

Variation in Leaf Respiration Rates at Night Correlates with Carbohydrate and Amino Acid Supply1[OPEN

PubMed Central

Lee, Chun Pong; Cheng, Riyan

2017-01-01

Plant respiration can theoretically be fueled by and dependent upon an array of central metabolism components; however, which ones are responsible for the quantitative variation found in respiratory rates is unknown. Here, large-scale screens revealed 2-fold variation in nighttime leaf respiration rate (RN) among mature leaves from an Arabidopsis (Arabidopsis thaliana) natural accession collection grown under common favorable conditions. RN variation was mostly maintained in the absence of genetic variation, which emphasized the low heritability of RN and its plasticity toward relatively small environmental differences within the sampling regime. To pursue metabolic explanations for leaf RN variation, parallel metabolite level profiling and assays of total protein and starch were performed. Within an accession, RN correlated strongly with stored carbon substrates, including starch and dicarboxylic acids, as well as sucrose, major amino acids, shikimate, and salicylic acid. Among different accessions, metabolite-RN correlations were maintained with protein, sucrose, and major amino acids but not stored carbon substrates. A complementary screen of the effect of exogenous metabolites and effectors on leaf RN revealed that (1) RN is stimulated by the uncoupler FCCP and high levels of substrates, demonstrating that both adenylate turnover and substrate supply can limit leaf RN, and (2) inorganic nitrogen did not stimulate RN, consistent with limited nighttime nitrogen assimilation. Simultaneous measurements of RN and protein synthesis revealed that these processes were largely uncorrelated in mature leaves. These results indicate that differences in preceding daytime metabolic activities are the major source of variation in mature leaf RN under favorable controlled conditions. PMID:28615345

Glycerine and levulinic acid: renewable co-substrates for the fermentative synthesis of short-chain poly(hydroxyalkanoate) biopolymers

USDA-ARS?s Scientific Manuscript database

Glycerine and levulinic acid were used alone and in combination for the fermentative synthesis of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHB/V) biopolymers. Shake-flask cultures of Pseudomonas oleovorans NRRL B-14682 containing different glycerine:levulinic acid ratios (1%, w/v total carbon ...

DECOUPLING OF PROTEIN AND RNA SYNTHESIS DURING DEUTERIUM PARTHENOGENESIS IN SEA URCHIN EGGS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gross, P.R.; Spindel, W.; Cousineau, G.H.

1963-10-29

The parthenogenetic activation of cell division and suppression of nucleic acid synthesis by deuterium in eggs of sea urchins was investigated. D/ sub 2/O treatment was found to evoke a high rate of protein synthesis in the eggs that was maintained for several hours. However, eggs whose protein synthesis was activated and that were making labeled cytasters showed no increment in RNA synthesis over controls. (P.C.H.)

Direct Synthesis of 5-Aryl Barbituric Acids by Rhodium(II)-Catalyzed Reactions of Arenes with Diazo Compounds**

PubMed Central

Best, Daniel; Burns, David J; Lam, Hon Wai

2015-01-01

A commercially available rhodium(II) complex catalyzes the direct arylation of 5-diazobarbituric acids with arenes, allowing straightforward access to 5-aryl barbituric acids. Free N—H groups are tolerated on the barbituric acid, with no complications arising from N—H insertion processes. This method was applied to the concise synthesis of a potent matrix metalloproteinase (MMP) inhibitor. PMID:25959544

Synthesis of molecular imprinting polymers for extraction of gallic acid from urine.

PubMed

Bhawani, Showkat Ahmad; Sen, Tham Soon; Ibrahim, Mohammad Nasir Mohammad

2018-02-21

The molecularly imprinted polymers for gallic acid were synthesized by precipitation polymerization. During the process of synthesis a non-covalent approach was used for the interaction of template and monomer. In the polymerization process, gallic acid was used as a template, acrylic acid as a functional monomer, ethylene glycol dimethacrylate as a cross-linker and 2,2'-azobisisobutyronitrile as an initiator and acetonitrile as a solvent. The synthesized imprinted and non-imprinted polymer particles were characterized by using Fourier-transform infrared spectroscopy and scanning electron microscopy. The rebinding efficiency of synthesized polymer particles was evaluated by batch binding assay. The highly selective imprinted polymer for gallic acid was MIPI1 with a composition (molar ratio) of 1:4:20, template: monomer: cross-linker, respectively. The MIPI1 showed highest binding efficiency (79.50%) as compared to other imprinted and non-imprinted polymers. The highly selective imprinted polymers have successfully extracted about 80% of gallic acid from spiked urine sample.

Enhanced rates of enzymatic saccharification and catalytic synthesis of biofuel substrates in gelatinized cellulose generated by trifluoroacetic acid

DOE PAGES

Shiga, Tânia M.; Xiao, Weihua; Yang, Haibing; ...

2017-12-27

The crystallinity of cellulose is a principal factor limiting the efficient hydrolysis of biomass to fermentable sugars or direct catalytic conversion to biofuel components. We evaluated the impact of TFA-induced gelatinization of crystalline cellulose on enhancement of enzymatic digestion and catalytic conversion to biofuel substrates. Low-temperature swelling of cotton linter cellulose in TFA at subzero temperatures followed by gentle heating to 55 degrees C dissolves the microfibril structure and forms composites of crystalline and amorphous gels upon addition of ethanol. The extent of gelatinization of crystalline cellulose was determined by reduction of birefringence in darkfield microscopy, loss of X-ray diffractability,more » and loss of resistance to acid hydrolysis. Upon freeze-drying, an additional degree of crystallinity returned as mostly cellulose II. Both enzymatic digestion with a commercial cellulase cocktail and maleic acid/AlCl3-catalyzed conversion to 5-hydroxymethylfurfural and levulinic acid were markedly enhanced with the low-temperature swollen cellulose. Only small improvements in rates and extent of hydrolysis and catalytic conversion were achieved upon heating to fully dissolve cellulose. Low-temperature swelling of cellulose in TFA substantially reduces recalcitrance of crystalline cellulose to both enzymatic digestion and catalytic conversion. In a closed system to prevent loss of fluorohydrocarbons, the relative ease of recovery and regeneration of TFA by distillation makes it a potentially useful agent in large-scale deconstruction of biomass, not only for enzymatic depolymerization but also for enhancing rates of catalytic conversion to biofuel components and useful bio-products.« less

Enhanced rates of enzymatic saccharification and catalytic synthesis of biofuel substrates in gelatinized cellulose generated by trifluoroacetic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shiga, Tânia M.; Xiao, Weihua; Yang, Haibing

The crystallinity of cellulose is a principal factor limiting the efficient hydrolysis of biomass to fermentable sugars or direct catalytic conversion to biofuel components. We evaluated the impact of TFA-induced gelatinization of crystalline cellulose on enhancement of enzymatic digestion and catalytic conversion to biofuel substrates. Low-temperature swelling of cotton linter cellulose in TFA at subzero temperatures followed by gentle heating to 55 degrees C dissolves the microfibril structure and forms composites of crystalline and amorphous gels upon addition of ethanol. The extent of gelatinization of crystalline cellulose was determined by reduction of birefringence in darkfield microscopy, loss of X-ray diffractability,more » and loss of resistance to acid hydrolysis. Upon freeze-drying, an additional degree of crystallinity returned as mostly cellulose II. Both enzymatic digestion with a commercial cellulase cocktail and maleic acid/AlCl3-catalyzed conversion to 5-hydroxymethylfurfural and levulinic acid were markedly enhanced with the low-temperature swollen cellulose. Only small improvements in rates and extent of hydrolysis and catalytic conversion were achieved upon heating to fully dissolve cellulose. Low-temperature swelling of cellulose in TFA substantially reduces recalcitrance of crystalline cellulose to both enzymatic digestion and catalytic conversion. In a closed system to prevent loss of fluorohydrocarbons, the relative ease of recovery and regeneration of TFA by distillation makes it a potentially useful agent in large-scale deconstruction of biomass, not only for enzymatic depolymerization but also for enhancing rates of catalytic conversion to biofuel components and useful bio-products.« less

Suppression of muscle protein turnover and amino acid degradation by dietary protein deficiency

NASA Technical Reports Server (NTRS)

Tawa, N. E. Jr; Goldberg, A. L.

1992-01-01

To define the adaptations that conserve amino acids and muscle protein when dietary protein intake is inadequate, rats (60-70 g final wt) were fed a normal or protein-deficient (PD) diet (18 or 1% lactalbumin), and their muscles were studied in vitro. After 7 days on the PD diet, both protein degradation and synthesis fell 30-40% in skeletal muscles and atria. This fall in proteolysis did not result from reduced amino acid supply to the muscle and preceded any clear decrease in plasma amino acids. Oxidation of branched-chain amino acids, glutamine and alanine synthesis, and uptake of alpha-aminoisobutyrate also fell by 30-50% in muscles and adipose tissue of PD rats. After 1 day on the PD diet, muscle protein synthesis and amino acid uptake decreased by 25-40%, and after 3 days proteolysis and leucine oxidation fell 30-45%. Upon refeeding with the normal diet, protein synthesis also rose more rapidly (+30% by 1 day) than proteolysis, which increased significantly after 3 days (+60%). These different time courses suggest distinct endocrine signals for these responses. The high rate of protein synthesis and low rate of proteolysis during the first 3 days of refeeding a normal diet to PD rats contributes to the rapid weight gain ("catch-up growth") of such animals.

Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.

2013-01-01

Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes wemore » successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.« less

The synthesis and structure of a potential immunosuppressant: N-mycophenoyl malonic acid dimethyl ester

NASA Astrophysics Data System (ADS)

Siebert, Agnieszka; Cholewiński, Grzegorz; Garwolińska, Dorota; Olejnik, Adrian; Rachoń, Janusz; Chojnacki, Jarosław

2018-01-01

The synthesis of a potential immunosuppressant, i.e. dimethyl ester of N-mycophenoyl malonic acid was optimized in the reaction of mycophenolic acid (MPA) with amino malonic dimethyl ester in the presence of propanephosphonic anhydride (T3P) as a coupling reagent. The structural properties of the obtained MPA derivative were investigated by NMR, MS and single crystal X-ray diffraction methods. Theoretical considerations of conformational flexibility based on DFT calculations are presented.

Demonstration of diet-induced decoupling of fatty acid and cholesterol synthesis by combining gene expression array and 2H2O quantification.

PubMed

Jensen, Kristian K; Previs, Stephen F; Zhu, Lei; Herath, Kithsiri; Wang, Sheng-Ping; Bhat, Gowri; Hu, Guanghui; Miller, Paul L; McLaren, David G; Shin, Myung K; Vogt, Thomas F; Wang, Liangsu; Wong, Kenny K; Roddy, Thomas P; Johns, Douglas G; Hubbard, Brian K

2012-01-15

The liver is a crossroad for metabolism of lipid and carbohydrates, with acetyl-CoA serving as an important metabolic intermediate and a precursor for fatty acid and cholesterol biosynthesis pathways. A better understanding of the regulation of these pathways requires an experimental approach that provides both quantitative metabolic flux measurements and mechanistic insight. Under conditions of high carbohydrate availability, excess carbon is converted into free fatty acids and triglyceride for storage, but it is not clear how excessive carbohydrate availability affects cholesterol biosynthesis. To address this, C57BL/6J mice were fed either a low-fat, high-carbohydrate diet or a high-fat, carbohydrate-free diet. At the end of the dietary intervention, the two groups received (2)H(2)O to trace de novo fatty acid and cholesterol synthesis, and livers were collected for gene expression analysis. Expression of lipid and glucose metabolism genes was determined using a custom-designed pathway focused PCR-based gene expression array. The expression analysis showed downregulation of cholesterol biosynthesis genes and upregulation of fatty acid synthesis genes in mice receiving the high-carbohydrate diet compared with the carbohydrate-free diet. In support of these findings, (2)H(2)O tracer data showed that fatty acid synthesis was increased 10-fold and cholesterol synthesis was reduced by 1.6-fold in mice fed the respective diets. In conclusion, by applying gene expression analysis and tracer methodology, we show that fatty acid and cholesterol synthesis are differentially regulated when the carbohydrate intake in mice is altered.

Propyl gallate synthesis using acidophilic tannase and simultaneous production of tannase and gallic acid by marine Aspergillus awamori BTMFW032.

PubMed

Beena, P S; Basheer, Soorej M; Bhat, Sarita G; Bahkali, Ali H; Chandrasekaran, M

2011-07-01

Marine Aspergillus awamori BTMFW032, recently reported by us, produce acidophilic tannase as extracellular enzyme. Here, we report the application of this enzyme for synthesis of propyl gallate by direct transesterification of tannic acid and in tea cream solubilisation besides the simultaneous production of gallic acid along with tannase under submerged fermentation by this fungus. This acidophilic tannase enabled synthesis of propyl gallate by direct transesterification of tannic acid using propanol as organic reaction media under low water conditions. The identity of the product was confirmed with thin layer chromatography and Fourier transform infrared spectroscopy. It was noted that 699 U/ml of enzyme could give 60% solubilisation of tea cream within 1 h. Enzyme production medium was optimized adopting Box-Behnken design for simultaneous synthesis of tannase and gallic acid. Process variables including tannic acid, sodium chloride, ferrous sulphate, dipotassium hydrogen phosphate, incubation period and agitation were recognized as the critical factors that influenced tannase and gallic acid production. The model obtained predicted 4,824.61 U/ml of tannase and 136.206 μg/ml gallic acid after 48 h of incubation, whereas optimized medium supported 5,085 U/ml tannase and 372.6 μg/ml of gallic acid production after 36 and 84 h of incubation, respectively, with a 15-fold increase in both enzyme and gallic acid production. Results indicated scope for utilization of this acidophilic tannase for transesterification of tannic acid into propyl gallate, tea cream solubilisation and simultaneous production of gallic acid along with tannase.

Carbon flux to growth or polyhydroxyalkanoate synthesis under microaerophilic conditions is affected by fatty acid chain-length in Pseudomonas putida LS46.

PubMed

Blunt, Warren; Dartiailh, Christopher; Sparling, Richard; Gapes, Daniel; Levin, David B; Cicek, Nazim

2018-05-24

Economical production of medium-chain length polyhydroxyalkanoates (mcl-PHA) is dependent on efficient cultivation processes. This work describes growth and mcl-PHA synthesis characteristics of Pseudomonas putida LS46 when grown on medium-chain length fatty acids (octanoic acid) and lower-cost long-chain fatty acids (LCFAs, derived from hydrolyzed canola oil) in microaerophilic environments. Growth on octanoic acid ceased when the oxygen uptake rate was limited by the oxygen transfer rate, and mcl-PHA accumulated to 61.9% of the cell dry mass. From LCFAs, production of non-PHA cell mass continued at a rate of 0.36 g L -1  h -1 under oxygen-limited conditions, while mcl-PHA accumulated simultaneously to 31% of the cell dry mass. The titer of non-PHA cell mass from LCFAs at 14 h post-inoculation was double that obtained from octanoic acid in bioreactors operated with identical feeding and aeration conditions. While the productivity for octanoic acid was higher by 14 h, prolonged cultivation on LCFAs achieved similar productivity but with twice the PHA titer. Simultaneous co-feeding of each substrate demonstrated the continued cell growth under microaerophilic conditions characteristic of LCFAs, and the resulting polymer was dominant in C8 monomers. Furthermore, co-feeding resulted in improved PHA titer and volumetric productivity compared to either substrate individually. These results suggest that LCFAs improve growth of P. putida in oxygen-limited environments and could reduce production costs since more non-PHA cell mass, the cellular factories required to produce mcl-PHA and the most oxygen-intensive cellular process, can be produced for a given oxygen transfer rate.

Aldo-keto reductase family 1 B10 affects fatty acid synthesis by regulating the stability of acetyl-CoA carboxylase-alpha in breast cancer cells.

PubMed

Ma, Jun; Yan, Ruilan; Zu, Xuyu; Cheng, Ji-Ming; Rao, Krishna; Liao, Duan-Fang; Cao, Deliang

2008-02-08

Recent studies have demonstrated that aldo-keto reductase family 1 B10 (AKR1B10), a novel protein overexpressed in human hepatocellular carcinoma and non-small cell lung carcinoma, may facilitate cancer cell growth by detoxifying intracellular reactive carbonyls. This study presents a novel function of AKR1B10 in tumorigenic mammary epithelial cells (RAO-3), regulating fatty acid synthesis. In RAO-3 cells, Sephacryl-S 300 gel filtration and DEAE-Sepharose ion exchange chromatography demonstrated that AKR1B10 exists in two distinct forms, monomers (approximately 40 kDa) bound to DEAE-Sepharose column and protein complexes (approximately 300 kDa) remaining in flow-through. Co-immunoprecipitation with AKR1B10 antibody and protein mass spectrometry analysis identified that AKR1B10 associates with acetyl-CoA carboxylase-alpha (ACCA), a rate-limiting enzyme of de novo fatty acid synthesis. This association between AKR1B10 and ACCA proteins was further confirmed by co-immunoprecipitation with ACCA antibody and pulldown assays with recombinant AKR1B10 protein. Intracellular fluorescent studies showed that AKR1B10 and ACCA proteins co-localize in the cytoplasm of RAO-3 cells. More interestingly, small interfering RNA-mediated AKR1B10 knock down increased ACCA degradation through ubiquitination-proteasome pathway and resulted in >50% decrease of fatty acid synthesis in RAO-3 cells. These data suggest that AKR1B10 is a novel regulator of the biosynthesis of fatty acid, an essential component of the cell membrane, in breast cancer cells.

Photoredox activation of carbon dioxide for amino acid synthesis in continuous flow

NASA Astrophysics Data System (ADS)

Seo, Hyowon; Katcher, Matthew H.; Jamison, Timothy F.

2017-05-01

Although carbon dioxide (CO2) is highly abundant, its low reactivity has limited its use in chemical synthesis. In particular, methods for carbon-carbon bond formation generally rely on two-electron mechanisms for CO2 activation and require highly activated reaction partners. Alternatively, radical pathways accessed via photoredox catalysis could provide new reactivity under milder conditions. Here we demonstrate the direct coupling of CO2 and amines via the single-electron reduction of CO2 for the photoredox-catalysed continuous flow synthesis of α-amino acids. By leveraging the advantages of utilizing gases and photochemistry in flow, a commercially available organic photoredox catalyst effects the selective α-carboxylation of amines that bear various functional groups and heterocycles. The preliminary mechanistic studies support CO2 activation and carbon-carbon bond formation via single-electron pathways, and we expect that this strategy will inspire new perspectives on using this feedstock chemical in organic synthesis.

Leucine disposal rate for assessment of amino acid metabolism in maintenance hemodialysis patients.

PubMed

Denny, Gerald B; Deger, Serpil M; Chen, Guanhua; Bian, Aihua; Sha, Feng; Booker, Cindy; Kesler, Jaclyn T; David, Sthuthi; Ellis, Charles D; Ikizler, T Alp

Protein energy wasting (PEW) is common in patients undergoing maintenance hemodialysis (MHD) and closely associated with poor outcomes. Insulin resistance and associated alterations in amino acid metabolism are potential pathways leading to PEW. We hypothesized that the measurement of leucine disposal during a hyperinsulinemic- euglycemic-euaminoacidemic clamp (HEAC) procedure would accurately measure the sensitivity to insulin for its actions on concomitant carbohydrate and protein metabolism in MHD patients. We examined 35 MHD patients and 17 control subjects with normal kidney function by hyperinsulinemic-euglycemic clamp (HEGC) followed by HEAC clamp procedure to obtain leucine disposal rate (LDR) along with isotope tracer methodology to assess whole body protein turnover. The glucose disposal rate (GDR) by HEGC was 5.1 ± 2.1 mg/kg/min for the MHD patients compared to 6.3 ± 3.9 mg/kg/min for the controls ( p = 0.38). The LDR during HEAC was 0.09 ± 0.03 mg/kg/min for the MHD patients compared to 0.11 ± 0.05 mg/kg/min for the controls ( p = 0.009). The LDR level was correlated with whole body protein synthesis ( r = 0.25; p = 0.08), with whole body protein breakdown ( r = -0.38 p = 0.01) and net protein balance ( r = 0.85; p < 0.001) in the overall study population. Correlations remained significant in subgroup analysis. The GDR derived by HEGC and LDR correlated well in the controls ( r = 0.79, p < 0.001), but less so in the MHD patients ( r = 0.58, p < 0.001). Leucine disposal rate reliably measures amino acid utilization in MHD patients and controls in response to high dose insulin.

The Interpretation of Cholesterol Balance Derived Synthesis Data and Surrogate Noncholesterol Plasma Markers for Cholesterol Synthesis under Lipid Lowering Therapies

PubMed Central

Stellaard, Frans

2017-01-01

The cholesterol balance procedure allows the calculation of cholesterol synthesis based on the assumption that loss of endogenous cholesterol via fecal excretion and bile acid synthesis is compensated by de novo synthesis. Under ezetimibe therapy hepatic cholesterol is diminished which can be compensated by hepatic de novo synthesis and hepatic extraction of plasma cholesterol. The plasma lathosterol concentration corrected for total cholesterol concentration (R_Lath) as a marker of de novo cholesterol synthesis is increased during ezetimibe treatment but unchanged under treatment with ezetimibe and simvastatin. Cholesterol balance derived synthesis data increase during both therapies. We hypothesize the following. (1) The cholesterol balance data must be applied to the hepatobiliary cholesterol pool. (2) The calculated cholesterol synthesis value is the sum of hepatic de novo synthesis and the net plasma—liver cholesterol exchange rate. (3) The reduced rate of biliary cholesterol absorption is the major trigger for the regulation of hepatic cholesterol metabolism under ezetimibe treatment. Supportive experimental and literature data are presented that describe changes of cholesterol fluxes under ezetimibe, statin, and combined treatments in omnivores and vegans, link plasma R_Lath to liver function, and define hepatic de novo synthesis as target for regulation of synthesis. An ezetimibe dependent direct hepatic drug effect cannot be excluded. PMID:28321334

Synthesis of mutual azo prodrugs of anti-inflammatory agents and peptides facilitated by α-aminoisobutyric acid.

PubMed

Kennedy, David A; Vembu, Nagarajan; Fronczek, Frank R; Devocelle, Marc

2011-12-02

Reported is the synthesis of azo mutual prodrugs of the nonsteroidal anti-inflammatory agents (NSAIDs) 4-aminophenylacetic acid (4-APAA) or 5-aminosalicylic acid (5-ASA) with peptides, including an antibiotic peptide temporin analogue modified at the amino terminal by an α-aminoisobutyric acid (Aib) residue. These prodrugs are designed for colonic delivery of two agents to treat infection and inflammation by the bacterial pathogen Clostridium difficile . © 2011 American Chemical Society

Synthesis of [ 18F]arenes via the copper-mediated [ 18F]fluorination of boronic acids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mossine, Andrew V.; Brooks, Allen F.; Makaravage, Katarina J.

Here, a copper-mediated radiofluorination of aryl- and vinylboronic acids with K 18F is described. This method exhibits high functional group tolerance and is effective for the radiofluorination of a range of electron-deficient, -neutral, and -rich aryl-, heteroaryl-, and vinylboronic acids. This method has been applied to the synthesis of [ 18F]FPEB, a PET radiotracer for quantifying metabotropic glutamate 5 receptors.

Synthesis of [ 18F]arenes via the copper-mediated [ 18F]fluorination of boronic acids

DOE PAGES

Mossine, Andrew V.; Brooks, Allen F.; Makaravage, Katarina J.; ...

2015-11-14

Here, a copper-mediated radiofluorination of aryl- and vinylboronic acids with K 18F is described. This method exhibits high functional group tolerance and is effective for the radiofluorination of a range of electron-deficient, -neutral, and -rich aryl-, heteroaryl-, and vinylboronic acids. This method has been applied to the synthesis of [ 18F]FPEB, a PET radiotracer for quantifying metabotropic glutamate 5 receptors.

Origin of fatty acid synthesis - Thermodynamics and kinetics of reaction pathways

NASA Technical Reports Server (NTRS)

Weber, Arthur L.

1991-01-01

The primitiveness of contemporary fatty acid biosynthesis was evaluated by using the thermodynamics and kinetics of its component reactions to estimate the extent of its dependence on powerful and selective catalysis by enzymes. Since this analysis indicated that the modern pathway is not primitive because it requires sophisticated enzymatic catalysis, an alternative pathway of primitive fatty acid synthesis is proposed that uses glycolaldehyde as a substrate. In contrast to the modern pathway, this primitive pathway is not dependent on an exogenous source of phosphoanhydride energy. Furthermore, the chemical spontaneity of its reactions suggests that it could have been readily catalyzed by the rudimentary biocatalysts available at an early stage in the origin of life.

New insights into the electrochemical behavior of acid orange 7: Convergent paired electrochemical synthesis of new aminonaphthol derivatives

NASA Astrophysics Data System (ADS)

Momeni, Shima; Nematollahi, Davood

2017-02-01

Electrochemical behavior of acid orange 7 has been exhaustively studied in aqueous solutions with different pH values, using cyclic voltammetry and constant current coulometry. This study has provided new insights into the mechanistic details, pH dependence and intermediate structure of both electrochemical oxidation and reduction of acid orange 7. Surprisingly, the results indicate that a same redox couple (1-iminonaphthalen-2(1H)-one/1-aminonaphthalen-2-ol) is formed from both oxidation and reduction of acid orange 7. Also, an additional purpose of this work is electrochemical synthesis of three new derivatives of 1-amino-4-(phenylsulfonyl)naphthalen-2-ol (3a-3c) under constant current electrolysis via electrochemical oxidation (and reduction) of acid orange 7 in the presence of arylsulfinic acids as nucleophiles. The results indicate that the electrogenerated 1-iminonaphthalen-2(1 H)-one participates in Michael addition reaction with arylsulfinic acids to form the 1-amino-3-(phenylsulfonyl)naphthalen-2-ol derivatives. The synthesis was carried out in an undivided cell equipped with carbon rods as an anode and cathode.

Rate and topography of peptidoglycan synthesis during cell division in Escherichia coli: Concept of a leading edge

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wientjes, F.B.; Nanninga, N.

1989-06-01

The rate at which the peptidoglycan of Escherichia coli is synthesized during the division cycle was studied with two methods. One method involved synchronization of E. coli MC4100 lysA cultures by centrifugal elutriation and subsequent pulse-labeling of the synchronously growing cultures with (meso-{sup 3}H)diaminopimelic acid (({sup 3}H)Dap). The second method was autoradiography of cells pulse-labeled with ({sup 3}H)Dap. It was found that the peptidoglycan is synthesized at a more or less exponentially increasing rate during the division cycle with a slight acceleration in this rate as the cells start to constrict. Apparently, polar cap formation requires synthesis of extra surfacemore » components, presumably to accommodate for a change in the surface-to-volume ratio. Furthermore, it was found that the pool size of Dap was constant during the division cycle. Close analysis of the topography of ({sup 3}H)Dap incorporation at the constriction site revealed that constriction proceeded by synthesis of peptidoglycan at the leading edge of the invaginating cell envelope. During constriction, no reallocation of incorporation occurred, i.e., the incorporation at the leading edge remained high throughout the process of constriction. Impairment of penicillin-binding protein 3 by mutation or by the specific {beta}-lactam antibiotic furazlocillin did not affect ({sup 3}H)Dap incorporation during initiation of constriction. However, the incorporation at the constriction site was inhibited in later stages of the constriction process. It is concluded that during division at least two peptidoglycan-synthesizing systems are operating sequentially.« less

Lipoic acid biosynthesis defects.

PubMed

Mayr, Johannes A; Feichtinger, René G; Tort, Frederic; Ribes, Antonia; Sperl, Wolfgang

2014-07-01

Lipoate is a covalently bound cofactor essential for five redox reactions in humans: in four 2-oxoacid dehydrogenases and the glycine cleavage system (GCS). Two enzymes are from the energy metabolism, α-ketoglutarate dehydrogenase and pyruvate dehydrogenase; and three are from the amino acid metabolism, branched-chain ketoacid dehydrogenase, 2-oxoadipate dehydrogenase, and the GCS. All these enzymes consist of multiple subunits and share a similar architecture. Lipoate synthesis in mitochondria involves mitochondrial fatty acid synthesis up to octanoyl-acyl-carrier protein; and three lipoate-specific steps, including octanoic acid transfer to glycine cleavage H protein by lipoyl(octanoyl) transferase 2 (putative) (LIPT2), lipoate synthesis by lipoic acid synthetase (LIAS), and lipoate transfer by lipoyltransferase 1 (LIPT1), which is necessary to lipoylate the E2 subunits of the 2-oxoacid dehydrogenases. The reduced form dihydrolipoate is reactivated by dihydrolipoyl dehydrogenase (DLD). Mutations in LIAS have been identified that result in a variant form of nonketotic hyperglycinemia with early-onset convulsions combined with a defect in mitochondrial energy metabolism with encephalopathy and cardiomyopathy. LIPT1 deficiency spares the GCS, and resulted in a combined 2-oxoacid dehydrogenase deficiency and early death in one patient and in a less severely affected individual with a Leigh-like phenotype. As LIAS is an iron-sulphur-cluster-dependent enzyme, a number of recently identified defects in mitochondrial iron-sulphur cluster synthesis, including NFU1, BOLA3, IBA57, GLRX5 presented with deficiency of LIAS and a LIAS-like phenotype. As in DLD deficiency, a broader clinical spectrum can be anticipated for lipoate synthesis defects depending on which of the affected enzymes is most rate limiting.

A Novel Pulse-Chase SILAC Strategy Measures Changes in Protein Decay and Synthesis Rates Induced by Perturbation of Proteostasis with an Hsp90 Inhibitor

PubMed Central

Fierro-Monti, Ivo; Racle, Julien; Hernandez, Celine; Waridel, Patrice; Hatzimanikatis, Vassily; Quadroni, Manfredo

2013-01-01

Standard proteomics methods allow the relative quantitation of levels of thousands of proteins in two or more samples. While such methods are invaluable for defining the variations in protein concentrations which follow the perturbation of a biological system, they do not offer information on the mechanisms underlying such changes. Expanding on previous work [1], we developed a pulse-chase (pc) variant of SILAC (stable isotope labeling by amino acids in cell culture). pcSILAC can quantitate in one experiment and for two conditions the relative levels of proteins newly synthesized in a given time as well as the relative levels of remaining preexisting proteins. We validated the method studying the drug-mediated inhibition of the Hsp90 molecular chaperone, which is known to lead to increased synthesis of stress response proteins as well as the increased decay of Hsp90 “clients”. We showed that pcSILAC can give information on changes in global cellular proteostasis induced by treatment with the inhibitor, which are normally not captured by standard relative quantitation techniques. Furthermore, we have developed a mathematical model and computational framework that uses pcSILAC data to determine degradation constants kd and synthesis rates Vs for proteins in both control and drug-treated cells. The results show that Hsp90 inhibition induced a generalized slowdown of protein synthesis and an increase in protein decay. Treatment with the inhibitor also resulted in widespread protein-specific changes in relative synthesis rates, together with variations in protein decay rates. The latter were more restricted to individual proteins or protein families than the variations in synthesis. Our results establish pcSILAC as a viable workflow for the mechanistic dissection of changes in the proteome which follow perturbations. Data are available via ProteomeXchange with identifier PXD000538. PMID:24312217

5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group

DOEpatents

Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.

1999-06-01

The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

Oral branched-chain amino acids decrease whole-body proteolysis

NASA Technical Reports Server (NTRS)

Ferrando, A. A.; Williams, B. D.; Stuart, C. A.; Lane, H. W.; Wolfe, R. R.

1995-01-01

BACKGROUND: This study reports the effects of ingesting branched-chain amino acids (leucine, valine, and isoleucine) on protein metabolism in four men. METHODS: To calculate leg protein synthesis and breakdown, we used a new model that utilized the infusion of L-[ring-13C6]phenylalanine and the sampling of the leg arterial-venous difference and muscle biopsies. In addition, protein-bound enrichments provided for the direct calculation of muscle fractional synthetic rate. Four control subjects ingested an equivalent amount of essential amino acids (threonine, methionine, and histidine) to discern the effects of branched-chain amino acid nitrogen vs the effects of essential amino acid nitrogen. Each drink also included 50 g of carbohydrate. RESULTS: Consumption of the branched-chain and the essential amino acid solutions produced significant threefold and fourfold elevations in their respective arterial concentrations. Protein synthesis and breakdown were unaffected by branched-chain amino acids, but they increased by 43% (p < .05) and 36% (p < .03), respectively, in the group consuming the essential amino acids. However, net leg balance of phenylalanine was unchanged by either drink. Direct measurement of protein synthesis by tracer incorporation into muscle protein (fractional synthetic rate) revealed no changes within or between drinks. Whole-body phenylalanine flux was significantly suppressed by each solution but to a greater extent by the branched-chain amino acids (15% and 20%, respectively) (p < .001). CONCLUSIONS: These results suggest that branched-chain amino acid ingestion suppresses whole-body proteolysis in tissues other than skeletal muscle in normal men.

Synthesis of three-dimensionally interconnected sulfur-rich polymers for cathode materials of high-rate lithium-sulfur batteries

NASA Astrophysics Data System (ADS)

Kim, Hoon; Lee, Joungphil; Ahn, Hyungmin; Kim, Onnuri; Park, Moon Jeong

2015-06-01

Elemental sulfur is one of the most attractive cathode active materials in lithium batteries because of its high theoretical specific capacity. Despite the positive aspect, lithium-sulfur batteries have suffered from severe capacity fading and limited rate capability. Here we report facile large-scale synthesis of a class of organosulfur compounds that could open a new chapter in designing cathode materials to advance lithium-sulfur battery technologies. Porous trithiocyanuric acid crystals are synthesized for use as a soft template, where the ring-opening polymerization of elemental sulfur takes place along the thiol surfaces to create three-dimensionally interconnected sulfur-rich phases. Our lithium-sulfur cells display discharge capacity of 945 mAh g-1 after 100 cycles at 0.2 C with high-capacity retention of 92%, as well as lifetimes of 450 cycles. Particularly, the organized amine groups in the crystals increase Li+-ion transfer rate, affording a rate performance of 1210, mAh g-1 at 0.1 C and 730 mAh g-1 at 5 C.

Synthesis of three-dimensionally interconnected sulfur-rich polymers for cathode materials of high-rate lithium–sulfur batteries

PubMed Central

Kim, Hoon; Lee, Joungphil; Ahn, Hyungmin; Kim, Onnuri; Park, Moon Jeong

2015-01-01

Elemental sulfur is one of the most attractive cathode active materials in lithium batteries because of its high theoretical specific capacity. Despite the positive aspect, lithium–sulfur batteries have suffered from severe capacity fading and limited rate capability. Here we report facile large-scale synthesis of a class of organosulfur compounds that could open a new chapter in designing cathode materials to advance lithium–sulfur battery technologies. Porous trithiocyanuric acid crystals are synthesized for use as a soft template, where the ring-opening polymerization of elemental sulfur takes place along the thiol surfaces to create three-dimensionally interconnected sulfur-rich phases. Our lithium–sulfur cells display discharge capacity of 945 mAh g−1 after 100 cycles at 0.2 C with high-capacity retention of 92%, as well as lifetimes of 450 cycles. Particularly, the organized amine groups in the crystals increase Li+-ion transfer rate, affording a rate performance of 1210, mAh g−1 at 0.1 C and 730 mAh g−1 at 5 C. PMID:26065407

The Synthesis of a Dipeptide from its Component Amino Acids: Protecting Groups in the Elementary Organic Laboratory.

ERIC Educational Resources Information Center

Young, Paul E.; Campbell, Andrew

1982-01-01

A simple, three-step procedure for synthesizing a dipeptide from its component amino acids is described. The dipeptide synthesized uses inexpensive amino acids having hydrocarbon side-chains and can be observed in E/Z forms by nuclear magnetic resonance spectroscopy. Each step in the synthesis produces white crystalline products using standard…

EVALUATION OF THE SYNTHESIS AND STRUCTURE OF NEW AZETIDIN-2-ONES OF FERULIC ACID.

PubMed

Stan, Cătălina Daniela; Drăgan, Maria; Pânzariu, Andreea; Profire, Lenuţa

2016-01-01

To synthesize some new azetidin-2-ones of ferulic acid and to evaluate them from physicochemical and spectral point of view. The synthesis was carried out in several steps: (i) obtaining the ferulic acid chloride; (ii) obtaining the ferulic acid hydrazide with hydrazine hydrate (98%); (iii) condensation of ferulic acid hydrazide with different benzaldehydes (2-hydroxy-/2-nitro-/4-chloro-/4- fluoro-/4-bromo-benzaldehyde) in order to obtain the corresponding hydrazones; (iv) cy- clization of ferulic acid hydrazones with chloroacethyl chloride in freshly distilled toluene medium and in the presence of triethylamine, resulting in the corresponding azetidin-2-ones. Six new azetidin-2-ones of ferulic acid were synthesized. They were characterized in terms of their physicochemical properties and their structure was confirmed by IR and 1H-NMR spectroscopy. Six new azetidin-2-ones of ferulic acid were synthesized, physicochemically characterized and validated spectrally. A

Synthesis and characterization of covalent diphenylalanine nanotube-folic acid conjugates

NASA Astrophysics Data System (ADS)

Castillo, John J.; Rindzevicius, Tomas; Wu, Kaiyu; Schmidt, Michael S.; Janik, Katarzyna A.; Boisen, Anja; Svendsen, Winnie; Rozlosnik, Noemi; Castillo-León, Jaime

2014-07-01

Herein, we describe the synthesis and characterization of a covalent nanoscale assembly formed between diphenylalanine micro/nanotubes (PNT) and folic acid (FA). The conjugate was obtained via chemical functionalization through coupling of amine groups of PNTs and carboxylic groups of FA. The surface analysis of PNT-FA indicated the presence of FA aggregates on the surface of PNTs. The covalent interaction between FA and self-assembled PNTs was further investigated using fluorescence microscopy, Raman and surface-enhanced Raman scattering (SERS) spectroscopies. The SERS experiments were performed on a large area silver-capped (diameter of 62 nm) silicon nanopillars with an approximate height of 400 nm and a width of 200 nm. The results showed that the PNT-FA synthesis procedure preserves the molecular structure of FA. The PNT-FA conjugate presented in this study is a promising candidate for applications in the detection and diagnosis of cancer or tropical diseases such as leishmaniasis and as a carrier nanosystem delivering drugs to malignant tumors that overexpress folate receptors.

Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2

PubMed Central

Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

2016-01-01

Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2.

PubMed

Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

2016-05-11

Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru-Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry.

Synthesis and Biological Evaluation of Novel Phosphatidylcholine Analogues Containing Monoterpene Acids as Potent Antiproliferative Agents

PubMed Central

Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna

2016-01-01

The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59–87%) and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts). The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2. PMID:27310666

The bile acid turnover rate assessed with the (75)SeHCAT test is stable in chronic diarrhoea but slightly decreased in healthy subjects after a long period of time.

PubMed

Bajor, Antal; Kilander, Anders; Sjövall, Henrik; Rudling, Mats; Ung, Kjell-Arne

2008-11-01

The stability of bile acid turnover rate was evaluated retrospectively using repeat SeHCAT tests in patients with chronic diarrhoea and prospectively for 16 years in healthy subjects. The SeHCAT values were stable in 39 patients with chronic diarrhoea, as shown by a comparison of the test results [data presented as median and (25th-75th percentile)]: 18% (8-23) in the first test versus 14% (9-21) in the second test [n = 39, P = 0.37, time interval 44 months (16-68), repeatability index >95%]. In contrast, they were reduced after 16 years in healthy subjects: 38% (30-49.5) in the first test versus 31% (21-49.5) in the second test (P < 0.03). In healthy subjects, the body mass index increased by 13% from 23.2 kg/m(2) (21-24.6) to 26.2 kg/m(2) (22.5-27.8) (P < 0.01) during the 16 years. There was a negative correlation between hepatic bile acid synthesis and the SeHCAT values (r = -0.615, P = 0.02, n = 14). In conclusion, the turnover rate of bile acids is stable over a long period of time in patients with chronic diarrhoea irrespective of bile acid malabsorption, suggesting that a repeat SeHCAT test is dispensable. There is a significant negative correlation between bile acid synthesis and SeHCAT test results in healthy subjects. The SeHCAT test values are slightly reduced in healthy subjects after 16 years.

Obeticholic acid, a selective farnesoid X receptor agonist, regulates bile acid homeostasis in sandwich-cultured human hepatocytes.

PubMed

Zhang, Yuanyuan; Jackson, Jonathan P; St Claire, Robert L; Freeman, Kimberly; Brouwer, Kenneth R; Edwards, Jeffrey E

2017-08-01

Farnesoid X receptor (FXR) is a master regulator of bile acid homeostasis through transcriptional regulation of genes involved in bile acid synthesis and cellular membrane transport. Impairment of bile acid efflux due to cholangiopathies results in chronic cholestasis leading to abnormal elevation of intrahepatic and systemic bile acid levels. Obeticholic acid (OCA) is a potent and selective FXR agonist that is 100-fold more potent than the endogenous ligand chenodeoxycholic acid (CDCA). The effects of OCA on genes involved in bile acid homeostasis were investigated using sandwich-cultured human hepatocytes. Gene expression was determined by measuring mRNA levels. OCA dose-dependently increased fibroblast growth factor-19 (FGF-19) and small heterodimer partner (SHP) which, in turn, suppress mRNA levels of cholesterol 7-alpha-hydroxylase (CYP7A1), the rate-limiting enzyme for de novo synthesis of bile acids. Consistent with CYP7A1 suppression, total bile acid content was decreased by OCA (1 μmol/L) to 42.7 ± 20.5% relative to control. In addition to suppressing de novo bile acids synthesis, OCA significantly increased the mRNA levels of transporters involved in bile acid homeostasis. The bile salt excretory pump (BSEP), a canalicular efflux transporter, increased by 6.4 ± 0.8-fold, and the basolateral efflux heterodimer transporters, organic solute transporter α (OST α ) and OST β increased by 6.4 ± 0.2-fold and 42.9 ± 7.9-fold, respectively. The upregulation of BSEP and OST α and OST β, by OCA reduced the intracellular concentrations of d 8 -TCA, a model bile acid, to 39.6 ± 8.9% relative to control. These data demonstrate that OCA does suppress bile acid synthesis and reduce hepatocellular bile acid levels, supporting the use of OCA to treat bile acid-induced toxicity observed in cholestatic diseases. © 2017 Intercept Pharmaceuticals. Pharmacology Research & Perspectives published by John Wiley & Sons Ltd, British Pharmacological Society and

Green Synthesis of Silver Nanoparticles Using Sodium Alginate and Lignosulphonic Acid Blends

NASA Astrophysics Data System (ADS)

Thakur, Amrita; Reddy, Giridhar

2017-08-01

A simple method based on the principles of green chemistry has been developed to synthesize stable silver nanoparticles (AgNP) for possible biomedical applications. Blend of sodium alginate (SA) and lignosulphonic acid (LS) prepared in the ratio of 80/20 mass percent respectively was used as reducing and stabilizing agent. This blend is biocompatible and has shown drug release ability under physiological conditions. Use of blend has an added advantage as LS has the ability to reduce silver while the blend matrix acts as a stabilizing agent. Effect of precursor concentration (AgNO3) and temperature was investigated. Progress of synthesis was monitored using UV-Vis spectroscopy. Higher temperature and lower silver nitrate concentration showed better synthesis of AgNP.

Hepatic inflammation caused by dysregulated bile acid synthesis is reversible by butyrate supplementation.

PubMed

Sheng, Lili; Jena, Prasant Kumar; Hu, Ying; Liu, Hui-Xin; Nagar, Nidhi; Kalanetra, Karen M; French, Samuel William; French, Samuel Wheeler; Mills, David A; Wan, Yu-Jui Yvonne

2017-12-01

Dysregulated bile acid (BA) synthesis or reduced farnesoid X receptor (FXR) levels are found in patients having metabolic diseases, autoimmune hepatitis, and liver cirrhosis or cancer. The objective of this study was to establish the relationship between butyrate and dysregulated BA synthesis-induced hepatitis as well as the effect of butyrate in reversing the liver pathology. Wild-type (WT) and FXR knockout (KO) male mice were placed on a control (CD) or western diet (WD) for 15 months. In the presence or absence of butyrate supplementation, feces obtained from 15-month-old WD-fed FXR KO mice, which had severe hepatitis and liver tumors, were transplanted to 7-month-old WD-fed FXR KO for 3 months. Hepatic phenotypes, microbiota profile, and BA composition were analyzed. Butyrate-generating bacteria and colonic butyrate concentration were reduced due to FXR inactivation and further reduced by WD intake. In addition, WD-fed FXR KO male mice had the highest concentration of hepatic β-muricholic acid (β-MCA) and bacteria-generated deoxycholic acid (DCA) accompanied by serious hepatitis. Moreover, dysregulated BA and reduced SCFA signaling co-existed in both human liver cancers and WD-fed FXR KO mice. Microbiota transplantation using butyrate-deficient feces derived from 15-month-old WD-fed FXR KO mice increased hepatic lymphocyte numbers as well as hepatic β-MCA and DCA concentrations. Furthermore, butyrate supplementation reduced hepatic β-MCA as well as DCA and eliminated hepatic lymphocyte infiltration. In conclusion, reduced butyrate contributes to the development of hepatitis in the FXR KO mouse model. In addition, butyrate reverses dysregulated BA synthesis and its associated hepatitis. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Synthesis of functionalized chromenes from Meldrum's acid, 4-hydroxycoumarin, and ketones or aldehydes.

PubMed

Sabbaghan, Maryam; Yavari, Issa; Hossaini, Zinatossadat

2010-11-01

An efficient synthesis of 4-alkyl-4-methyl-3,4-dihydro-2H,5H-pyrano[3,2-c]chromene-2,5-dione or 4-aryl-3,4-dihydro-2H,5H-pyrano[3,2-c]chromene-2,5-diones via reaction 4-hydroxycoumarin with Meldrum's acid and ketones or aldehydes is described.

Concurrent protein synthesis is required for in vivo chitin synthesis in postmolt blue crabs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Horst, M.N.

1990-12-01

Chitin synthesis in crustaceans involves the deposition of a protein-polysaccharide complex at the apical surface of epithelial cells which secrete the cuticle or exoskeleton. The present study involves an examination of in vivo incorporation of radiolabeled amino acids and amino sugars into the cuticle of postmolt blue crabs, Callinectes sapidus. Rates of incorporation of both 3H leucine and 3H threonine were linear with respect to time of incubation. Incorporation of 3H threonine into the endocuticle was inhibited greater than 90% in the presence of the protein synthesis inhibitor, puromycin. Linear incorporation of 14C glucosamine into the cuticle was also demonstrated;more » a significant improvement of radiolabeling was achieved by using 14C-N-acetylglucosamine as the labeled precursor. Incorporation of 3H-N-acetylglucosamine into the cuticle of postmolt blue crabs was inhibited 89% by puromycin, indicating that concurrent protein synthesis is required for the deposition of chitin in the blue crab. Autoradiographic analysis of control vs. puromycin-treated crabs indicates that puromycin totally blocks labeling of the new endocuticle with 3H glucosamine. These results are consistent with the notion that crustacean chitin is synthesized as a protein-polysaccharide complex. Analysis of the postmolt and intermolt blue crab cuticle indicates that the exoskeleton contains about 60% protein and 40% chitin. The predominant amino acids are arginine, glutamic acid, alanine, aspartic acid, and threonine.« less

TOFA (5-tetradecyl-oxy-2-furoic acid) reduces fatty acid synthesis, inhibits expression of AR, neuropilin-1 and Mcl-1 and kills prostate cancer cells independent of p53 status.

PubMed

Guseva, Natalya V; Rokhlin, Oskar W; Glover, Rebecca A; Cohen, Michael B

2011-07-01

A key player in prostate cancer development and progression is the androgen receptor (AR). Tumor-associated lipogenesis can protect cancer cells from carcinogenic- and therapeutic-associated treatments. Increased synthesis of fatty acids and cholesterol is regulated by androgens through induction of several genes in androgen-responsive cancer cells. Acetyl-CoA-carboxylase-α (ACCA) is a key enzyme in the regulation of fatty acids synthesis. Here we show that AR binds in vivo to intron regions of human ACCA gene. We also show that the level of ACCA protein in LNCaP depends on AR expression and that DHT treatment increases ACCA expression and fatty acid synthesis. Inhibition of ACCA by TOFA (5-tetradecyl-oxy-2-furoic acid) decreases fatty acid synthesis and induces caspase activation and cell death in most PCa cell lines. Our data suggest that TOFA can kill cells via the mitochondrial pathway since we found cytochrome c release after TOFA treatment in androgen sensitive cell lines. The results also imply that the pro-apoptotic effect of TOFA may be mediated via a decrease of neuropilin-1(NRP1) and Mcl-1expression. We have previously reported that Mcl-1 is under AR regulation and plays an important role in resistance to drug-induced apoptosis in prostate cancer cells, and NRP1 is known to regulate Mcl-1 expression. Here, we show for the first time that NRP1 expression is under AR control. Taken together, our data suggest that TOFA is a potent cell death inducing agent in prostate cancer cells.

Synthesis, characterization, bioactivity and potential application of phenolic acid grafted chitosan: A review.

PubMed

Liu, Jun; Pu, Huimin; Liu, Shuang; Kan, Juan; Jin, Changhai

2017-10-15

In recent years, increasing attention has been paid to the grafting of phenolic acid onto chitosan in order to enhance the bioactivity and widen the application of chitosan. Here, we present a comprehensive overview on the recent advances of phenolic acid grafted chitosan (phenolic acid-g-chitosan) in many aspects, including the synthetic method, structural characterization, biological activity, physicochemical property and potential application. In general, four kinds of techniques including carbodiimide based coupling, enzyme catalyzed grafting, free radical mediated grafting and electrochemical methods are frequently used for the synthesis of phenolic acid-g-chitosan. The structural characterization of phenolic acid-g-chitosan can be determined by several instrumental methods. The physicochemical properties of chitosan are greatly altered after grafting. As compared with chitosan, phenolic acid-g-chitosan exhibits enhanced antioxidant, antimicrobial, antitumor, anti-allergic, anti-inflammatory, anti-diabetic and acetylcholinesterase inhibitory activities. Notably, phenolic acid-g-chitosan shows potential applications in many fields as coating agent, packing material, encapsulation agent and bioadsorbent. Copyright © 2017 Elsevier Ltd. All rights reserved.

Stimulation of skeletal muscle protein synthesis in neonatal pigs by long-term infusion of leucine is amino acid dependent

USDA-ARS?s Scientific Manuscript database

Infusing leucine for 1 hr increases skeletal muscle protein synthesis in neonatal pigs, but this is not sustained for 2 h unless the leucine-induced fall in amino acids is prevented. We aimed to determine whether continuous leucine infusion can stimulate protein synthesis for a prolonged period whe...

Measurement of Hemoglobin Synthesis Rate in Vivo Using a Stable Isotope Method

PubMed Central

Hibbert, Jacqueline M.; Sutherland, George B.; Wright, Luther L.; Wolfe, Luke G.; Wolfe, Kimberly A.; Gao, Shi Ping; Gore, Dennis C.; Abd-Elfattah, Anwar S.

2015-01-01

We developed a method to measure hemoglobin synthesis rate (SynHb) in humans, assuming that free glycine in the red blood cell (RBC) represents free glycine in bone marrow for hemoglobin synthesis. The present rat study examines this assumption of the method and quantifies SynHb in rats. Sprague–Dawley rats (n = 9) were studied, [2-13C]glycine was intravenously infused over 24 h (2.5 mg kg−1 h−1), blood was drawn for glycine and heme isolation, and bone marrow was harvested for glycine isolation. Isotopic enrichments of glycine and heme were measured, fractional hemoglobin synthesis rate (fSynHb% day−1) was calculated, and from this a value for SynHb (mg g−1 day−1) was derived. Mean body weight was 446 ± 10 g (mean ± SE) and hemoglobin concentration was 14 ± 0.5 g dl−1. At 24 h, the mean isotopic enrichment, atom percentage excess (APE), of the RBC free glycine (1.56 ± 0.18 APE) was similar to the bone marrow (1.68 ± 0.15 APE). The rate of incorporation of 13C into heme increased over time from 0.0004 APE/h between 6 and 12 h, to 0.0014 APE/h between 12 and 18 h, and 0.0024 APE/h between 18 and 24 h. Consequently, fSynHb (1.19 ± 0.32, 2.92 ± 0.66, and 4.22 ± 0.56% day−1, respectively) and SynHb (0.11 ± 0.03, 0.28 ± 0.05, and 0.42 ± 0.05 mg g−1 day−1, respectively) showed similar patterns over the 24-h study period. We conclude that (1) enrichment of free glycine in the circulating RBC approximates enrichment of bone marrow free glycine for heme formation and (2) this pattern of hemoglobin synthesis rate is reflecting the characteristic release and gradual maturation of reticulocytes in the circulation. PMID:11262164

Specific Effect of Guanidine in the Programming of Poliovirus Inhibition of Deoxyribonucleic Acid Synthesis

PubMed Central

Powers, C. D.; Miller, B. A.; Kurtz, H.; Ackermann, W. W.

1969-01-01

Inhibition of HeLa cell deoxyribonucleic acid (DNA) synthesis, which occurred by the 4th to 5th hr after infection with poliovirus, could be blocked completely by guanidine only when it was present before the 2nd hr. At the 2nd hr, there was no significant ribonucleic acid (RNA)-replicase activity, and addition of guanidine inhibited all production of virus but allowed 57% of maximal DNA inhibition to develop. Maximum DNA inhibition developed in cells infected for 4 hr in the presence of guanidine when the guanidine was removed for a 10-min interval. RNA-replicase activity was not enzymatically detectable and viral multiplication did not develop in these cells unless the interval without guanidine was extended to 60 min. The interpretation of the data was that the effect of guanidine on viral-induced inhibition of DNA synthesis was distinct and not a consequence of the inhibition of RNA-replicase. PMID:4305675

Amino acid availability regulates the effect of hyperinsulinemia on skin protein metabolism in pigs

USDA-ARS?s Scientific Manuscript database

The effects of amino acid supply and insulin infusion on skin protein kinetics (fractional synthesis rate (FSR), fractional breakdown rate (FBR), and net balance (NB)) in pigs were investigated. Four-month-old pigs were divided into four groups as follows: control, insulin (INS), amino acid (AA), an...

Heat-enhanced peptide synthesis on Teflon-patterned paper.

PubMed

Deiss, Frédérique; Yang, Yang; Matochko, Wadim L; Derda, Ratmir

2016-06-14

In this report, we describe the methodology for 96 parallel organic syntheses of peptides on Teflon-patterned paper assisted by heating with an infra-red lamp. SPOT synthesis is an important technology for production of peptide arrays on a paper-based support for rapid identification of peptide ligands, epitope mapping, and identification of bio-conjugation reactions. The major drawback of the SPOT synthesis methodology published to-date is suboptimal reaction conversion due to mass transport limitations in the unmixed reaction spot. The technology developed in this report overcomes these problems by changing the environment of the reaction from static to dynamic (flow-through), and further accelerating the reaction by selective heating of the reaction support in contact with activated amino acids. Patterning paper with Teflon allows for droplets of organic solvents to be confined in a zone on the paper array and flow through the paper at a well-defined rate and provide a convenient, power-free setup for flow-through solid-phase synthesis and efficient assembly of peptide arrays. We employed an infra-red (IR) lamp to locally heat the cellulosic support during the flow-through delivery of the reagents to each zone of the paper-based array. We demonstrate that IR-heating in solid phase peptide synthesis shortened the reaction time necessary for amide bond formation down to 3 minutes; in some couplings of alpha amino acids, conversion rates increased up to fifteen folds. The IR-heating improved the assembly of difficult sequences, such as homo-oligomers of all 20 natural amino acids.

Synthesis of boron nitride powders

NASA Astrophysics Data System (ADS)

Dreissig, Dirk Horst

2002-09-01

In the materials science community there is much interest in the development of new, efficient approaches for preparing ceramic powders having properties or performance characteristics not found with powders produced by traditional metallurgical synthesis methods. In this regard, aerosol-based syntheses are finding general acceptance for the preparation of non-metal and metal oxide powders. In contrast, much less effort has been given to aerosol-type syntheses for non-oxide powders despite potentially useful benefits. This dissertation describes the application of two chemical systems in aerosol assisted vapor phase synthesis (AAVS) for the preparation of spherical morphology boron oxynitride, BNxOy, powders that are subsequently converted to spherical morphology boron nitride in a second nitridation step. Chapter 1 describes the AAVS synthesis of BNxOy powders using a reaction of an aqueous boric acid containing aerosol with ammonia at 1000°C. The effect of reactor tube material, total gas flow rate, ammonia concentration, boric acid concentration, and urea addition to the boric acid aerosol on the percent oxygen composition is described. The resulting BNxOy powders contain significant amounts of oxygen that require replacement in a second stage nitridation reaction at elevated temperature under ammonia. The influences of the reaction temperature profile, crucible geometry and transformation additive on final oxygen composition and powder crystallinity are described. Chapter 2 outlines the formation of BNxOy powders from an AAVS reaction between the boron precursor (MeO)3B and ammonia. The formation of the powders is studied as a function of total gas flow rate and ammonia concentration. In all cases the resulting powders contain lower levels of oxygen compared to powders produced from aqueous boric acid aerosols. The conversion of the BNxOy powders in the second stage nitridation reaction with ammonia is examined as a function of crucible geometry, temperature

Leucine disposal rate for assessment of amino acid metabolism in maintenance hemodialysis patients

PubMed Central

Denny, Gerald B.; Deger, Serpil M.; Chen, Guanhua; Bian, Aihua; Sha, Feng; Booker, Cindy; Kesler, Jaclyn T.; David, Sthuthi; Ellis, Charles D.; Ikizler, T. Alp

2016-01-01

Background Protein energy wasting (PEW) is common in patients undergoing maintenance hemodialysis (MHD) and closely associated with poor outcomes. Insulin resistance and associated alterations in amino acid metabolism are potential pathways leading to PEW. We hypothesized that the measurement of leucine disposal during a hyperinsulinemic- euglycemic-euaminoacidemic clamp (HEAC) procedure would accurately measure the sensitivity to insulin for its actions on concomitant carbohydrate and protein metabolism in MHD patients. Methods We examined 35 MHD patients and 17 control subjects with normal kidney function by hyperinsulinemic-euglycemic clamp (HEGC) followed by HEAC clamp procedure to obtain leucine disposal rate (LDR) along with isotope tracer methodology to assess whole body protein turnover. Results The glucose disposal rate (GDR) by HEGC was 5.1 ± 2.1 mg/kg/min for the MHD patients compared to 6.3 ± 3.9 mg/kg/min for the controls (p = 0.38). The LDR during HEAC was 0.09 ± 0.03 mg/kg/min for the MHD patients compared to 0.11 ± 0.05 mg/kg/min for the controls (p = 0.009). The LDR level was correlated with whole body protein synthesis (r = 0.25; p = 0.08), with whole body protein breakdown (r = −0.38 p = 0.01) and net protein balance (r = 0.85; p < 0.001) in the overall study population. Correlations remained significant in subgroup analysis. The GDR derived by HEGC and LDR correlated well in the controls (r = 0.79, p < 0.001), but less so in the MHD patients (r = 0.58, p < 0.001). Conclusions Leucine disposal rate reliably measures amino acid utilization in MHD patients and controls in response to high dose insulin. PMID:27413537

Effects of dietary amino acids, carbohydrates, and choline on neurotransmitter synthesis

NASA Technical Reports Server (NTRS)

Wurtman, Richard J.

1988-01-01

The ability of a meal to increase or decrease brain neurotransmitter synthesis has been studied. It is concluded that brain serotonin synthesis is directly controlled by the proportions of carbohydrate to protein in meals and snacks that increase or decrease brain tryptophan levels, thereby changing the substrate saturation of tryptophan hydroxylase and the rate of serotonin synthesis. The ability of serotoninergic neurons to have their output coupled to dietary macronutrients enables them to function as sensors of peripheral metabolism, and to subserve an important role in the control of appetite. The robust and selective responses of catecholaminergic and cholinergic neurons to supplemental tyrosine and choline suggest that these compounds may become useful as a new type of drug for treating deseases or conditions in which adequate quantities of the transmitter would otherwise be unavailable.

Rapid Synthesis of Flavor Compound 4-Ethyloctanoic Acid under Microwave Irradiation

PubMed Central

Liu, Yu-Ping; Yin, De-Cai; Chen, Hai-Tao; Sun, Bao-Guo

2010-01-01

Rapid synthesis of 4-ethyloctanoic acid by means of microwave irradiation is described. Diethyl malonate reacted with 2-ethyl-1-bromohexane in the presence of sodium ethoxide to give diethyl (2-ethylhexyl)malonate (1b). 1b was saponified in the solution of ethanol and potassium hydroxide and then acidified to form (2-ethylhexyl)propanedioic acid (1c), and 1c was heated and decarboxylized to give 4-ethyloctanoic acid (1d). The influence of reaction temperature and reaction time on the yield of 1b and the effect of reaction time on the yield of 1c and 1d were investigated in order to optimize the synthetic conditions. The relative optimal conditions for the synthesis of 1b were a mole ratio of sodium to diethyl malonate to 2-ethylhexyl bromide of 0.1:0.11:0.11, a reaction temperature of 80–85 °C, and a reaction time of 2–2.5 h. The yield of 1b was about 79%. 1b was saponified for 30 min and then acidified to form 1c, and the yield of 1c was 96%. 1c was heated for 16 min at 180°C to give 1d, and the yield of 1d was about 90%. The overall yield of 1d is 70% under microwave irradiation. The reaction time was reduced greatly. In order to compare the result of microwave irradiation with that of an oil bath, the reactions were also performed in an oil bath. The structures of intermediates, product and by-product were confirmed by HRMS, 1H NMR, 13C-NMR and IR. PMID:21152328

Omega 3 fatty acids chemosensitize multidrug resistant colon cancer cells by down-regulating cholesterol synthesis and altering detergent resistant membranes composition

PubMed Central

2013-01-01

Background The activity of P-glycoprotein (Pgp) and multidrug resistance related protein 1 (MRP1), two membrane transporters involved in multidrug resistance of colon cancer, is increased by high amounts of cholesterol in plasma membrane and detergent resistant membranes (DRMs). It has never been investigated whether omega 3 polyunsatured fatty acids (PUFAs), which modulate cholesterol homeostasis in dyslipidemic syndromes and have chemopreventive effects in colon cancer, may affect the response to chemotherapy in multidrug resistant (MDR) tumors. Methods We studied the effect of omega 3 PUFAs docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) in human chemosensitive colon cancer HT29 cells and in their MDR counterpart, HT29-dx cells. Results MDR cells, which overexpressed Pgp and MRP1, had a dysregulated cholesterol metabolism, due to the lower expression of ubiquitin E3 ligase Trc8: this produced lower ubiquitination rate of 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCoAR), higher cholesterol synthesis, higher cholesterol content in MDR cells. We found that DHA and EPA re-activated Trc8 E3 ligase in MDR cells, restored the ubiquitination rate of HMGCoAR to levels comparable with chemosensitive cells, reduced the cholesterol synthesis and incorporation in DRMs. Omega 3 PUFAs were incorporated in whole lipids as well as in DRMs of MDR cells, and altered the lipid composition of these compartments. They reduced the amount of Pgp and MRP1 contained in DRMs, decreased the transporters activity, restored the antitumor effects of different chemotherapeutic drugs, restored a proper tumor-immune system recognition in response to chemotherapy in MDR cells. Conclusions Our work describes a new biochemical effect of omega 3 PUFAs, which can be useful to overcome chemoresistance in MDR colon cancer cells. PMID:24225025

Synthesis and Agonistic Activity at the GPR35 of 5,6-Dihydroxyindole-2-carboxylic Acid Analogues

PubMed Central

2012-01-01

5,6-Dihydroxyindole-2-carboxylic acid (DHICA), an intermediate of melanin synthesis and an eumelanin building block, was recently discovered to be a GPR35 agonist with moderate potency. Here, we report the synthesis and pharmacological characterization of a series of DHICA analogues against GPR35 using both label-free dynamic mass redistribution and Tango β-arrestin translocation assays. This led to identification of novel GPR35 agonists with improved potency and/or having biased agonism. PMID:24900508