Domenichiello, Anthony F; Chen, Chuck T; Trepanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P
2014-01-01
Docosahexaenoic acid (DHA) is important for brain function, however, the exact amount required for the brain is not agreed upon. While it is believed that the synthesis rate of DHA from α-linolenic acid (ALA) is low, how this synthesis rate compares with the amount of DHA required to maintain brain DHA levels is unknown. The objective of this work was to assess whether DHA synthesis from ALA is sufficient for the brain. To test this, rats consumed a diet low in n-3 PUFAs, or a diet containing ALA or DHA for 15 weeks. Over the 15 weeks, whole body and brain DHA accretion was measured, while at the end of the study, whole body DHA synthesis rates, brain gene expression, and DHA uptake rates were measured. Despite large differences in body DHA accretion, there was no difference in brain DHA accretion between rats fed ALA and DHA. In rats fed ALA, DHA synthesis and accretion was 100-fold higher than brain DHA accretion of rats fed DHA. Also, ALA-fed rats synthesized approximately 3-fold more DHA than the DHA uptake rate into the brain. This work indicates that DHA synthesis from ALA may be sufficient to supply the brain.
Domenichiello, Anthony F.; Chen, Chuck T.; Trepanier, Marc-Olivier; Stavro, P. Mark; Bazinet, Richard P.
2014-01-01
Docosahexaenoic acid (DHA) is important for brain function, however, the exact amount required for the brain is not agreed upon. While it is believed that the synthesis rate of DHA from α-linolenic acid (ALA) is low, how this synthesis rate compares with the amount of DHA required to maintain brain DHA levels is unknown. The objective of this work was to assess whether DHA synthesis from ALA is sufficient for the brain. To test this, rats consumed a diet low in n-3 PUFAs, or a diet containing ALA or DHA for 15 weeks. Over the 15 weeks, whole body and brain DHA accretion was measured, while at the end of the study, whole body DHA synthesis rates, brain gene expression, and DHA uptake rates were measured. Despite large differences in body DHA accretion, there was no difference in brain DHA accretion between rats fed ALA and DHA. In rats fed ALA, DHA synthesis and accretion was 100-fold higher than brain DHA accretion of rats fed DHA. Also, ALA-fed rats synthesized approximately 3-fold more DHA than the DHA uptake rate into the brain. This work indicates that DHA synthesis from ALA may be sufficient to supply the brain. PMID:24212299
Regulation of protein synthesis by amino acids in muscle of neonates
Suryawan, Agus; Davis, Teresa A.
2011-01-01
The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed. PMID:21196241
Role of fatty-acid synthesis in dendritic cell generation and function.
Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George
2013-05-01
Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.
Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function
Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George
2013-01-01
Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633
Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine
2016-01-01
Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725
NASA Technical Reports Server (NTRS)
Stein, T. P.; Settle, R. G.; Albina, J. A.; Dempsey, D. T.; Melnick, G.
1991-01-01
Eight N-15 labeled nonessential amino acids plus (15)NH4Cl were administered over a 10 h period to four healthy adult males using a primed-constant dosage regimen. The amount of N-15 excreted in the urine and the urinary ammonia, hippuric acid, and plasma alanine N-15 enrichments were measured. There was a high degree of consistency across subjects in the ordering of the nine compounds based on the fraction of N-15 excreted (Kendall coefficient of concordance W = 0.83, P is less than 0.01). Protein synthesis rates were calculated from the urinary ammonia plateau enrichment and the cumulative excretion of N-15. Glycine was one of the few amino acids that gave similar values by both methods.
Changes in isoprenoid lipid synthesis by gemfibrozil and clofibric acid in rat hepatocytes.
Hashimoto, F; Taira, S; Hayashi, H
2000-05-15
We studied whether gemfibrozil and clofibric acid alter isoprenoid lipid synthesis in rat hepatocytes. After incubation of the cells with the agent for 74 hr, [(14)C]acetate or [(3)H]mevalonate was added, and the cells were further incubated for 4 hr. Gemfibrozil and clofibric acid increased ubiquinone synthesis from [(14)C]acetate and [(3)H]mevalonate. The effect of gemfibrozil was greater than that of clofibric acid. Also, gemfibrozil decreased dolichol synthesis from [(14)C]acetate and [(3)H]mevalonate. However, clofibric acid increased dolichol synthesis from [(3)H]mevalonate. Gemfibrozil decreased cholesterol synthesis from [(14)C]acetate and [(3)H]mevalonate. Clofibric acid decreased cholesterol synthesis from [(14)C]acetate, but did not affect synthesis from [(3)H]mevalonate. These results suggest that both agents, at different rates, activate the synthetic pathway of ubiquinone, at least from mevalonate. Gemfibrozil may inhibit the synthetic pathway of dolichol, at least from mevalonate. Contrary to gemfibrozil, clofibric acid may activate the synthetic pathway of dolichol from mevalonate. Gemfibrozil may inhibit the synthetic pathway of cholesterol from mevalonate in addition to the pathway from acetate to mevalonate inhibited by both agents.
Synthesis of acid-soluble spore proteins by Bacillus subtilis.
Leventhal, J M; Chambliss, G H
1982-12-01
The major acid-soluble spore proteins (ASSPs) of Bacillus subtilis were detected by immunoprecipitation of radioactively labeled in vitro- and in vivo-synthesized proteins. ASSP synthesis in vivo began 2 h after the initiation of sporulation (t2) and reached its maximum rate at t7. This corresponded to the time of synthesis of mRNA that stimulated the maximum rate of ASSP synthesis in vitro. Under the set of conditions used in these experiments, protease synthesis began near t0, alkaline phosphatase synthesis began at about t2, and refractile spores were first observed between t7 and t8. In vivo- and in vitro-synthesized ASSPs comigrated in sodium dodecyl sulfate-polyacrylamide gels. Their molecular weights were 4,600 (alpha and beta) and 11,000 (gamma). The average half-life of the ASSP messages was 11 min when either rifampin (10 micrograms/ml) or actinomycin D (1 microgram/ml) was used to inhibit RNA synthesis.
Content and synthesis of nucleic acids in the cartilage in chondromalacia patellae.
Lund, F; Telhag, H
1978-12-01
The content and the synthesis of nucleic acids in chondromalacian, osteoarthritis and normal cartilage was compared. The chondromalacian cartilage differed from osteoarthritis in that the content of nucleic acids was less. Also, the cell density was less in chondromalacian than in normal cartilage as opposed to previous findings in osteoarthritis. The synthesis of DNA was greater in chondromalacian than in normal cartilage but less than in osteoarthritis. With regard to the RNA synthesis, however, the chondromalacian cartilage showed a higher rate than both normal and osteoarthritic cartilage.
Manandhar, Miglena; Cronan, John E
2017-05-01
Biotin synthetic pathways are readily separated into two stages, synthesis of the seven carbon α, ω-dicarboxylic acid pimelate moiety and assembly of the fused heterocyclic rings. The biotin pathway genes responsible for pimelate moiety synthesis vary widely among bacteria whereas the ring synthesis genes are highly conserved. Bacillus subtilis seems to have redundant genes, bioI and bioW, for generation of the pimelate intermediate. Largely consistent with previous genetic studies it was found that deletion of bioW caused a biotin auxotrophic phenotype whereas deletion of bioI did not. BioW is a pimeloyl-CoA synthetase that converts pimelic acid to pimeloyl-CoA. The essentiality of BioW for biotin synthesis indicates that the free form of pimelic acid is an intermediate in biotin synthesis although this is not the case in E. coli. Since the origin of pimelic acid in Bacillus subtilis is unknown, 13 C-NMR studies were carried out to decipher the pathway for its generation. The data provided evidence for the role of free pimelate in biotin synthesis and the involvement of fatty acid synthesis in pimelate production. Cerulenin, an inhibitor of the key fatty acid elongation enzyme, FabF, markedly decreased biotin production by B. subtilis resting cells whereas a strain having a cerulenin-resistant FabF mutant produced more biotin. In addition, supplementation with pimelic acid fully restored biotin production in cerulenin-treated cells. These results indicate that pimelic acid originating from fatty acid synthesis pathway is a bona fide precursor of biotin in B. subtilis. © 2017 John Wiley & Sons Ltd.
Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester
NASA Technical Reports Server (NTRS)
Weber, A. L.
1986-01-01
The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.
Lopez, Adam M; Chuang, Jen-Chieh; Posey, Kenneth S; Turley, Stephen D
2017-01-01
Mutations in the X-linked gene methyl-CpG-binding protein 2 (MECP2) are the principal cause of Rett syndrome, a progressive neurodevelopmental disorder afflicting 1 in 10,000 to 15,000 females. Studies using hemizygous Mecp2 mouse models have revealed disruptions to some aspects of their lipid metabolism including a partial suppression of cholesterol synthesis in the brains of mature Mecp2 mutants. The present studies investigated whether this suppression is evident from early neonatal life, or becomes manifest at a later stage of development. We measured the rate of cholesterol synthesis, in vivo, in the brains of male Mecp2 - /y and their Mecp2 +/y littermates at 7, 14, 21, 28, 42 and 56 days of age. Brain weight was consistently lower in the Mecp2 -/y mice than in their Mecp2 +/y controls except at 7 days of age. In the 7- and 14-day-old mice there was no genotypic difference in the rate of brain cholesterol synthesis but, from 21 days and later, it was always marginally lower in the Mecp2 -/y mice than in age-matched Mecp2 +/y littermates. At no age was a genotypic difference detected in either the rate of fatty acid synthesis or cholesterol concentration in the brain. Cholesterol synthesis rates in the liver and lungs of 56-day-old Mecp2 -/y mice were normal. The onset of lower rates of brain cholesterol synthesis at about the time closure of the blood brain barrier purportedly occurs might signify a disruption to mechanism(s) that dictate intracellular levels of cholesterol metabolites including oxysterols known to exert a regulatory influence on the cholesterol biosynthetic pathway. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Engineering Sialic Acid Synthesis Ability in Insect Cells.
Viswanathan, Karthik; Narang, Someet; Betenbaugh, Michael J
2015-01-01
Insect cells lack the ability to synthesize the sialic acid donor molecule CMP-sialic acid or its precursor, sialic acid. In this chapter, we describe a method to engineer CMP-sialic acid synthesis capability into Spodoptera frugiperda (Sf9) cells, a prototypical insect cell line, by recombinant expression of sialic acid synthesis pathway genes using baculovirus technology. Co-expression of a sialuria mutant UDP-GlcNAc-2-epimerase/ManNAc kinase (EKR263L), wild-type sialic acid 9-phosphate synthase (SAS), and wild-type CMP-sialic acid synthetase (CSAS) in the presence of GlcNAc leads to synthesis of CMP-sialic acids synthesis to support sialylation of N-glycans on glycoproteins.
Suryawan, Agus; O’Connor, Pamela M. J.; Bush, Jill A.; Nguyen, Hanh V.
2009-01-01
The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and visceral tissues of the neonate by performing pancreatic glucose–amino acid clamps in overnight-fasted 7-day-old pigs. We infused pigs (n = 8–12/group) with insulin at 0, 10, 22, and 110 ng kg−0.66 min−1 to achieve ~0, 2, 6 and 30 μU ml−1 insulin so as to simulate below fasting, fasting, intermediate, and fed insulin levels, respectively. At each insulin dose, amino acids were maintained at the fasting or fed level. In conjunction with the highest insulin dose, amino acids were also allowed to fall below the fasting level. Tissue protein synthesis was measured using a flooding dose of L-[4-3H] phenylalanine. Both insulin and amino acids increased fractional rates of protein synthesis in longissimus dorsi, gastrocnemius, masseter, and diaphragm muscles. Insulin, but not amino acids, increased protein synthesis in the skin. Amino acids, but not insulin, increased protein synthesis in the liver, pancreas, spleen, and lung and tended to increase protein synthesis in the jejunum and kidney. Neither insulin nor amino acids altered protein synthesis in the stomach. The results suggest that the stimulation of protein synthesis by feeding in most tissues of the neonate is regulated by the post-prandial rise in amino acids. However, the feeding-induced stimulation of protein synthesis in skeletal muscles is independently mediated by insulin as well as amino acids. PMID:18683020
Orellana, Renán A; Jeyapalan, Asumthia; Escobar, Jeffery; Frank, Jason W; Nguyen, Hanh V; Suryawan, Agus; Davis, Teresa A
2007-11-01
In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study, we determined the effect of amino acids on protein synthesis in skeletal muscle and other tissues in septic neonates. Overnight-fasted neonatal pigs were infused with endotoxin (LPS, 0 and 10 microg.kg(-1).h(-1)), whereas glucose and insulin were maintained at fasting levels; amino acids were clamped at fasting or fed levels. In the presence of fasting insulin and amino acids, LPS reduced protein synthesis in longissimus dorsi (LD) and gastrocnemius muscles and increased protein synthesis in the diaphragm, but had no effect in masseter and heart muscles. Increasing amino acids to fed levels accelerated muscle protein synthesis in LD, gastrocnemius, masseter, and diaphragm. LPS stimulated protein synthesis in liver, lung, spleen, pancreas, and kidney in fasted animals. Raising amino acids to fed levels increased protein synthesis in liver of controls, but not LPS-treated animals. The increase in muscle protein synthesis in response to amino acids was associated with increased mTOR, 4E-BP1, and S6K1 phosphorylation and eIF4G-eIF4E association in control and LPS-infused animals. These findings suggest that amino acids stimulate skeletal muscle protein synthesis during acute endotoxemia via mTOR-dependent ribosomal assembly despite reduced basal protein synthesis rates in neonatal pigs. However, provision of amino acids does not further enhance the LPS-induced increase in liver protein synthesis.
High-rate synthesis of Cu-BTC metal-organic frameworks.
Kim, Ki-Joong; Li, Yong Jun; Kreider, Peter B; Chang, Chih-Hung; Wannenmacher, Nick; Thallapally, Praveen K; Ahn, Ho-Geun
2013-12-21
The reaction conditions for the synthesis of Cu-BTC (BTC = benzene-1,3,5-tricarboxylic acid) were elucidated using a continuous-flow microreactor-assisted solvothermal system to achieve crystal size and phase control. A high-rate synthesis of Cu-BTC metal-organic frameworks with a BET surface area of more than 1600 m(2) g(-1) (Langmuir surface area of more than 2000 m(2) g(-1)) and with a 97% production yield could be achieved with a total reaction time of 5 minutes.
WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN
Browse, John
2016-01-01
Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047
NASA Technical Reports Server (NTRS)
Weber, Arthur L.
1998-01-01
Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.
Donini, Pierluigi
1970-01-01
Starvation for a required amino acid of normal or RCstrEscherichia coli infected with T-even phages arrests further synthesis of phage deoxyribonucleic acid (DNA). This amino acid control over phage DNA synthesis does not occur in RCrelE. coli mutants. Heat inactivation of a temperature-sensitive aminoacyl-transfer ribonucleic acid (RNA) synthetase similarly causes an arrest of phage DNA synthesis in infected cells of RCstr phenotype but not in cells of RCrel phenotype. Inhibition of phage DNA synthesis in amino acid-starved RCstr host cells can be reversed by addition of chloramphenicol to the culture. Thus, the general features of amino acid control over T-even phage DNA synthesis are entirely analogous to those known for amino acid control over net RNA synthesis of uninfected bacteria. This analogy shows that the bacterial rel locus controls a wider range of macromolecular syntheses than had been previously thought. PMID:4914067
Energetics of amino acid synthesis in hydrothermal ecosystems
NASA Technical Reports Server (NTRS)
Amend, J. P.; Shock, E. L.
1998-01-01
Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Larsen, Peder Olesen; Cornwell, Karen L.; Gee, Sherry L.
1981-08-01
In this paper, isolated cells from leaves of Spinacia oleracea have been maintained in a state capable of high rates of photosynthetic CO 2 fixation for more than 60 hours. The incorporation of 14CO 2 under saturating CO 2 conditions into carbohydrates, carboxylic acids, and amino acids, and the effect of ammonia on this incorporation have been studied. Total incorporation, specific radioactivity, and pool size have been determined as a function of time for most of the protein amino acids and for γ-aminobutyric acid. The measurements of specific radio-activities and of the approaches to 14C “saturation” of some amino acidsmore » indicate the presence and relative sizes of metabolically active and passive pools of these amino acids. Added ammonia decreased carbon fixation into carbohydrates and increased fixation into carboxylic acids and amino acids. Different amino acids were, however, affected in different and highly specific ways. Ammonia caused large stimulatory effects in incorporation of 14C into glutamine (a factor of 21), aspartate, asparagine, valine, alanine, arginine, and histidine. No effect or slight decreases were seen in glycine, serine, phenylalanine, and tyrosine labeling. In the case of glutamate, 14C labeling decreased, but specific radioactivity increased. The production of labeled γ-aminobutyric acid was virtually stopped by ammonia. The results indicate that added ammonia stimulates the reactions mediated by pyruvate kinase and phosphoenolpyruvate carboxylase, as seen with other plant systems. Finally, the data on the effects of added ammonia on total labeling, pool sizes, and specific radioactivities of several amino acids provides a number of indications about the intracellular sites of principal synthesis from carbon skeletons of these amino acids and the selective nature of effects of increased intracellular ammonia concentration on such synthesis.« less
Effect of the quality of dietary amino acids composition on the urea synthesis in rats.
Tujioka, Kazuyo; Ohsumi, Miho; Hayase, Kazutoshi; Yokogoshi, Hidehiko
2011-01-01
We have shown that urinary urea excretion increased in rats given a lower quality protein. The purpose of present study was to determine whether the composition of dietary amino acids affects urea synthesis. Experiments were done on three groups of rats given diets containing a 10% gluten amino acid mix diet or 10% casein amino acid mix diet or 10% whole egg protein amino acids mix diet for 10 d. The urinary excretion of urea, the liver concentration of N-acetylglutamate, and the liver concentration of free serine, glutamic acids and alanine were greater in the group given the amino acid mix diet of lower quality. The fractional and absolute rates of protein synthesis in tissues declined with a decrease in quality of dietary amino acids. The hepatic concentration of ornithine and the activities of hepatic urea-cycle enzymes were not related to the urea excretion. These results suggest that the increased concentrations of amino acids and N-acetylglutamate seen in the liver of rats given the amino acid mix diets of lower quality are likely among the factors stimulating urea synthesis. The protein synthesis in tissues is at least partly related to hepatic concentrations of amino acids. The composition of dietary amino acids is likely to be one of the factors regulating urea synthesis when the quality of dietary protein is manipulated.
Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.
1983-01-01
Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284
Chuang, Jen-Chieh; Lopez, Adam M; Turley, Stephen D
2017-07-01
Esterified cholesterol (EC) and triglycerides, contained within lipoproteins taken up by cells, are hydrolysed by lysosomal acid lipase (LAL) in the late endosomal/lysosomal (E/L) compartment. The resulting unesterified cholesterol (UC) is transported via Niemann-Pick type C2 and C1 into the cytosolic compartment where it enters a putative pool of metabolically active cholesterol that is utilized in accordance with cellular needs. Loss-of-function mutations in LIPA, the gene encoding LAL, result in dramatic increases in tissue concentrations of EC, a hallmark feature of Wolman disease and cholesteryl ester storage disease (CESD). The lysosomal sequestration of EC causes cells to respond to a perceived deficit of sterol by increasing their rate of cholesterol synthesis, particularly in the liver. A similar compensatory response occurs with treatments that disrupt the enterohepatic movement of cholesterol or bile acids. Here we measured rates of cholesterol synthesis in vivo in the liver and small intestine of a mouse model for CESD given the cholesterol absorption inhibitor ezetimibe from weaning until early adulthood. Consistent with previous findings, this treatment significantly reduced the amount of EC sequestered in the liver (from 132.43±7.35 to 70.07±6.04mg/organ) and small intestine (from 2.78±0.21 to 1.34±0.09mg/organ) in the LAL-deficient mice even though their rates of hepatic and intestinal cholesterol synthesis were either comparable to, or exceeded those in matching untreated Lal -/- mice. These data reveal the role of intestinal cholesterol absorption in driving the expansion of tissue EC content and disease progression in LAL deficiency. Copyright © 2017 Elsevier Inc. All rights reserved.
Rate in template-directed polymer synthesis.
Saito, Takuya
2014-06-01
We discuss the temporal efficiency of template-directed polymer synthesis, such as DNA replication and transcription, under a given template string. To weigh the synthesis speed and accuracy on the same scale, we propose a template-directed synthesis (TDS) rate, which contains an expression analogous to that for the Shannon entropy. Increasing the synthesis speed accelerates the TDS rate, but the TDS rate is lowered if the produced sequences are diversified. We apply the TDS rate to some production system models and investigate how the balance between the speed and the accuracy is affected by changes in the system conditions.
Davis, J.W. Jr.
1979-09-21
A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Dabkowski, Erinne R.; Shekar, Kadambari Chandra; Li, Ling; Ribeiro, Rogerio F.; Walsh, Kenneth; Previs, Stephen F.; Sadygov, Rovshan G.; Willard, Belinda; Stanley, William C.
2013-01-01
Traditional proteomics provides static assessment of protein content, but not synthetic rates. Recently, proteome dynamics with heavy water (2H2O) was introduced, where 2H labels amino acids that are incorporated into proteins, and the synthesis rate of individual proteins is calculated using mass isotopomer distribution analysis. We refine this approach with a novel algorithm and rigorous selection criteria that improve the accuracy and precision of the calculation of synthesis rates and use it to measure protein kinetics in spatially distinct cardiac mitochondrial subpopulations. Subsarcolemmal mitochondria (SSM) and interfibrillar mitochondria (IFM) were isolated from adult rats, which were given 2H2O in the drinking water for up to 60 days. Plasma 2H2O and myocardial 2H-enrichment of amino acids were stable throughout the experimental protocol. Multiple tryptic peptides were identified from 28 proteins in both SSM and IFM and showed a time-dependent increase in heavy mass isotopomers that was consistent within a given protein. Mitochondrial protein synthesis was relatively slow (average half-life of 30 days, 2.4% per day). Although the synthesis rates for individual proteins were correlated between IFM and SSM (R2 = 0.84; P < 0.0001), values in IFM were 15% less than SSM (P < 0.001). In conclusion, administration of 2H2O results in stable enrichment of the cardiac precursor amino acid pool, with the use of refined analytical and computational methods coupled with cell fractionation one can measure synthesis rates for cardiac proteins in subcellular compartments in vivo, and protein synthesis is slower in mitochondria located among the myofibrils than in the subsarcolemmal region. PMID:23457012
USDA-ARS?s Scientific Manuscript database
In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...
Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.
Awasthi, Neeraj Praphulla; Singh, R P
2007-01-01
Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.
[Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].
Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua
2016-03-01
Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.
Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko
2014-09-01
Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.
ERIC Educational Resources Information Center
Simmonds, Richard J.
1987-01-01
Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)
Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.
Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko
2016-09-01
Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
ERIC Educational Resources Information Center
Forster, Denis; DeKleva, Thomas W.
1986-01-01
Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chander, A.; Gullo, J.; Reicherter, J.
1987-05-01
Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased onlymore » by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.« less
Wilson, Fiona A; Suryawan, Agus; Orellana, Renán A; Nguyen, Hanh V; Jeyapalan, Asumthia S; Gazzaneo, Maria C; Davis, Teresa A
2008-10-01
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 microg x kg(-1) x day(-1)) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P<0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P<0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1.eIF4E complex association, and increased active eIF4E.eIF4G complex formation (P<0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex.
Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid
NASA Technical Reports Server (NTRS)
Nakashima, T.; Fox, S. W.
1980-01-01
The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.
Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M
2012-03-27
In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages. © 2012 American Chemical Society
Kojima, Yuzo; Sakuradani, Eiji; Shimizu, Sakayu
2006-09-01
Enzymatic acidolysis and glyceride synthesis using polyunsaturated fatty acids (PUFAs) with lipases from Pseudomonas fluorescens HU380 (HU-lipase), P. fluorescens AK102 (AK-lipase), and Candida rugosa (CR-lipase) were studied. The acidolysis of triolein with eicosapentaenoic acid (EPA) or docosahexaenoic acid (DHA) in n-hexane was evaluated with lipases immobilized on Celite 545. HU-lipase showed the highest incorporation rate at a low temperature (10 degrees C) with either EPA or DHA as the acyl donor, and the rate decreased with increasing reaction temperature. At 45 degrees C, the rates for EPA and DHA were 7.1 and 0.5 relative to those at 10 degrees C, respectively. The EPA incorporation rate was even higher at a low temperature (10 degrees C), and the DHA incorporation rate increased with decreasing temperature. Although AK-lipase showed the reverse tendency for incorporation rate, the DHA incorporation rate increased with increasing reaction temperature with both PUFAs. HU-lipase reacted well with PUFAs such as DHA, EPA, arachidonic acid (AA), mead acid (MA), and dihomo-gamma-linolenic acid (DGLA) on acidolysis and glyceride synthesis. The reactivities of AK-lipase toward these PUFAs except for DGLA, i.e., MA, AA, EPA, and DHA, were low for both reactions. The unique substrate specificities of the lipases from the Pseudomonas strains will enable us to use these lipases for the modification of fats and oils containing PUFAs such as fish oil.
Synthesis of new kojic acid based unnatural α-amino acid derivatives.
Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Uma Devi, P; Behera, Manoranjan
2015-11-01
An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond. Copyright © 2015 Elsevier Ltd. All rights reserved.
Effect of Thymine Starvation on Messenger Ribonucleic Acid Synthesis in Escherichia coli
Luzzati, Denise
1966-01-01
Luzzati, Denise (Institut de Biologie Physico-Chimique, Paris, France). Effect of thymine starvation on messenger ribonucleic acid synthesis in Escherichia coli. J. Bacteriol. 92:1435–1446. 1966.—During the course of thymine starvation, the rate of synthesis of messenger ribonucleic acid (mRNA, the rapidly labeled fraction of the RNA which decays in the presence of dinitrophenol or which hybridizes with deoxyribonucleic acid) decreases exponentially, in parallel with the viability of the thymine-starved bacteria. The ability of cell-free extracts of starved bacteria to incorporate ribonucleoside triphosphates into RNA was determined; it was found to be inferior to that of extracts from control cells. The analysis of the properties of cell-free extracts of starved cells shows that their decreased RNA polymerase activity is the consequence of a modification of their deoxyribonucleic acid, the ability of which to serve as a template for RNA polymerase decreases during starvation. PMID:5332402
Deerberg, S; von Twickel, J; Förster, H H; Cole, T; Fuhrmann, J; Heise, K P
1990-02-01
During their rapid maturation period, seeds of Cuphea wrightii A. Gray mainly accumulate medium-chain fatty acids (C8 to C14) in their storage lipids. The rate of lipid deposition (40-50 mg·d(-1)·(g fresh weight)(-1)) is fourfold higher than in seeds of Cuphea racemosa (L. f.) Spreng, which accumulate long-chain fatty acids (C16 to C18). Measurements of the key enzymes of fatty-acid synthesis in cell-free extracts of seeds of different maturities from Cuphea wrightii show that malonyl-CoA synthesis may be a triggering factor for the observed high capacity for fatty-acid synthesis. Experiments on the incorporation of [1-(14)C]acetate into fatty acids by purified plastid preparations from embryos of Cuphea wrightii have demonstrated that the biosynthesis of medium-chain fatty acids (C8 to C14) is localized in the plastid. Thus, in the presence of cofactors for lipid synthesis (ATP, NADPH, NADH, acyl carrier protein, and sn-glycerol-3-phosphate), purified plastid fractions predominantly synthesized free fatty acids, 30% of which were of medium chain length. Transesterification of the freshly synthesized fatty acids to coenzyme A and recombination with the microsomal fraction of the embryo homogenate induced triacylglycerol synthesis. It also stimulated fatty-acid synthesis by a factor 2-3 and increased the relative amount of medium-chain fatty acids bound to triacylglycerols, which corresponded to about 60-80% in this lipid fraction.
Rewiring protein synthesis: From natural to synthetic amino acids.
Fan, Yongqiang; Evans, Christopher R; Ling, Jiqiang
2017-11-01
The protein synthesis machinery uses 22 natural amino acids as building blocks that faithfully decode the genetic information. Such fidelity is controlled at multiple steps and can be compromised in nature and in the laboratory to rewire protein synthesis with natural and synthetic amino acids. This review summarizes the major quality control mechanisms during protein synthesis, including aminoacyl-tRNA synthetases, elongation factors, and the ribosome. We will discuss evolution and engineering of such components that allow incorporation of natural and synthetic amino acids at positions that deviate from the standard genetic code. The protein synthesis machinery is highly selective, yet not fixed, for the correct amino acids that match the mRNA codons. Ambiguous translation of a codon with multiple amino acids or complete reassignment of a codon with a synthetic amino acid diversifies the proteome. Expanding the genetic code with synthetic amino acids through rewiring protein synthesis has broad applications in synthetic biology and chemical biology. Biochemical, structural, and genetic studies of the translational quality control mechanisms are not only crucial to understand the physiological role of translational fidelity and evolution of the genetic code, but also enable us to better design biological parts to expand the proteomes of synthetic organisms. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.
Transaminases for the synthesis of enantiopure beta-amino acids
2012-01-01
Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122
Genetics Home Reference: congenital bile acid synthesis defect type 1
... type 1 Congenital bile acid synthesis defect type 1 Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 1 ...
Synthesis of alpha-amino acids
Davis, J.W. Jr.
1983-01-25
A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings
Antimycobacterial action of thiolactomycin: an inhibitor of fatty acid and mycolic acid synthesis.
Slayden, R A; Lee, R E; Armour, J W; Cooper, A M; Orme, I M; Brennan, P J; Besra, G S
1996-01-01
Thiolactomycin (TLM) possesses in vivo antimycobacterial activity against the saprophytic strain Mycobacterium smegmatis mc2155 and the virulent strain M. tuberculosis Erdman, resulting in complete inhibition of growth on solid media at 75 and 25 micrograms/ml, respectively. Use of an in vitro murine macrophage model also demonstrated the killing of viable intracellular M. tuberculosis in a dose-dependent manner. Through the use of in vivo [1,2-14C]acetate labeling of M. smegmatis, TLM was shown to inhibit the synthesis of both fatty acids and mycolic acids. However, synthesis of the shorter-chain alpha'-mycolates of M. smegmatis was not inhibited by TLM, whereas synthesis of the characteristic longer-chain alpha-mycolates and epoxymycolates was almost completely inhibited at 75 micrograms/ml. The use of M. smegmatis cell extracts demonstrated that TLM specifically inhibited the mycobacterial acyl carrier protein-dependent type II fatty acid synthase (FAS-II) but not the multifunctional type I fatty acid synthase (FAS-I). In addition, selective inhibition of long-chain mycolate synthesis by TLM was demonstrated in a dose-response manner in purified, cell wall-containing extracts of M. smegmatis cells. The in vivo and in vitro data and knowledge of the mechanism of TLM resistance in Escherichia coli suggest that two distinct TLM targets exist in mycobacteria, the beta-ketoacyl-acyl carrier protein synthases involved in FAS-II and the elongation steps leading to the synthesis of the alpha-mycolates and oxygenated mycolates. The efficacy of TLM against M. smegmatis and M. tuberculosis provides the prospects of identifying fatty acid and mycolic acid biosynthetic genes and revealing a novel range of chemotherapeutic agents directed against M. tuberculosis. PMID:9124847
Higgins, Michael L.; Daneo-Moore, Lolita
1972-01-01
The application of quantitative electron microscopy to thin sections of cells of Streptococcus faecalis specifically inhibited for deoxyribonucleic acid (DNA), ribonucleic acid, and protein synthesis shows that septal mesosomes (i) increase in size when protein synthesis is inhibited by at least 80% while DNA synthesis proceeds at no less than 50% of the control rate and (ii) decrease in size when DNA synthesis is inhibited 50% or more during the initial 10 min of treatment. This indicates that fluctuations in mesosome size are dependent on the extent of DNA synthesis. The fluctuations in mesosome areas observed on treatment do not correlate with the kinetics of glycerol incorporation per milliliter of a culture. However, when glycerol incorporation is placed on a per cell basis, a strong correlation is observed between increases in (i) the thickness of the electron-transparent layer of the cytoplasmic membrane and (ii) the amount of glycerol incorporated per cell. It seems that the electron-transparent membrane layer may thicken to accommodate changes in lipid content when protein and lipid synthesis are uncoupled. Images PMID:4110926
Ledinko, Nada; Fong, Caroline K. Y.
1969-01-01
Infection of human embryonic kidney (HEK) cell cultures with adenovirus types 2 or 12 resulted in an initial drop in the rate of incorporation of 3H-thymidine into deoxyribonucleic acid (DNA) during the early latent period of virus growth, followed by a marked rise in label uptake. It was shown by cesium chloride isopycnic centrifugation that, after adenovirus 2 infection, there was a decrease in the rate of incorporation of thymidine into cellular DNA. Moreover, DNA-DNA hybridization experiments revealed that, by 28 to 32 hr after infection with either adenovirus 2 or 12, the amount of isolated pulse-labeled DNA capable of hybridizing with HEK cell DNA was reduced by approximately 60 to 70%. Autoradiographic measurements showed that the inhibition of cellular DNA synthesis was due to a decrease in the ability of an infected cell to synthesize DNA. The adenovirus-induced inhibition of host cell DNA synthesis was not due to degradation of cellular DNA. 3H-thymidine incorporated into cellular DNA at the time of infection remained acid-precipitable, and labeled material was not incorporated into viral DNA. Furthermore, when zone sedimentation through neutral or alkaline sucrose density gradients was employed, no detectable change was observed in the sedimentation rate of this cellular DNA at various times after infection with adenovirus 2 or 12. In addition, there was no increase in deoxyribonuclease activity in cells infected with either virus. Cultures infected for 38 hr with adenovirus 2 or 12 incorporated three to four times as much 3H-uridine into ribonucleic acid (RNA) as did non-infected cultures. Furthermore, the net RNA synthesized by infected cultures substantially exceeded that of control cultures. The activity of thymidine kinase was induced, but there was no stimulation of uridine kinase. PMID:5806981
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-Ascorbic Acid
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-01-01
Background Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L- ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. Results 5,6-O-Isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. Conclusion An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance. PMID:17147830
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-ascorbic acid.
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-12-06
Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L-ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. 5,6-O-isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.
1989-04-01
We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that inmore » control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.« less
Mertz, J R; Wallman, J
2000-04-01
Research over the past two decades has shown that the growth of young eyes is guided by vision. If near- or far-sightedness is artificially imposed by spectacle lenses, eyes of primates and chicks compensate by changing their rate of elongation, thereby growing back to the pre-lens optical condition. Little is known about what chemical signals might mediate between visual effects on the retina and alterations of eye growth. We present five findings that point to choroidal retinoic acid possibly being such a mediator. First, the chick choroid can convert retinol into all-trans-retinoic acid at the rate of 11 +/- 3 pmoles mg protein(-1) hr(-1), compared to 1.3 +/- 0.3 for retina/RPE and no conversion for sclera. Second, those visual conditions that cause increased rates of ocular elongation (diffusers or negative lens wear) produce a sharp decrease in all-trans-retinoic acid synthesis to levels barely detectable with our assay. In contrast, visual conditions which result in decreased rates of ocular elongation (recovery from diffusers or positive lens wear) produce a four- to five-fold increase in the formation of all-trans-retinoic acid. Third, the choroidal retinoic acid is found bound to a 28-32 kD protein. Fourth, a large fraction of the choroidal retinoic acid synthesized in culture is found in a nucleus-enriched fraction of sclera. Finally, application of retinoic acid to cultured sclera at physiological concentrations produced an inhibition of proteoglycan production (as assessed by measuring sulfate incorporation) with a EC50 of 8 x 10(-7) M. These results show that the synthesis of choroidal retinoic acid is modulated by those visual manipulations that influence ocular elongation and that this retinoic acid may reach the sclera in concentrations adequate to modulate scleral proteoglycan formation.
Sundram, Kalyana; French, Margaret A; Clandinin, M Thomas
2003-08-01
Partial hydrogenation of oil results in fats containing unusual isomeric fatty acids characterized by cis and trans configurations. Hydrogenated fats containing trans fatty acids increase plasma total cholesterol (TC) and LDL-cholesterol while depressing HDL-cholesterol levels. Identifying the content of trans fatty acids by food labeling is overshadowed by a reluctance of health authorities to label saturates and trans fatty acids separately. Thus, it is pertinent to compare the effects of trans to saturated fatty acids using stable isotope methodology to establish if the mechanism of increase in TC and LDL-cholesterol is due to the increase in the rate of endogenous synthesis of cholesterol. Ten healthy normocholesterolemic female subjects consumed each of two diets containing approximately 30% of energy as fat for a fourweek period. One diet was high in palmitic acid (10.6% of energy) from palm olein and the other diet exchanged 5.6% of energy as partially hydrogenated fat for palmitic acid. This fat blend resulted in monounsaturated fatty acids decreasing by 4.9 % and polyunsaturated fats increasing by 2.7%. The hydrogenated fat diet treatment provided 3.1% of energy as elaidic acid. For each dietary treatment, the fractional synthesis rates for cholesterol were measured using deuterium-labeling procedures and blood samples were obtained for blood lipid and lipoprotein measurements. Subjects exhibited a higher total cholesterol and LDL-cholesterol level when consuming the diet containing trans fatty acids while also depressing the HDL-cholesterol level. Consuming the partially hydrogenated fat diet treatment increased the fractional synthesis rate of free cholesterol. Consumption of hydrogenated fats containing trans fatty acids in comparison to a mixtur e of palmitic and oleic acids increase plasma cholesterol levels apparently by increasing endogenous synthesis of cholesterol.
Synthesis and properties of fatty acid starch esters.
Winkler, Henning; Vorwerg, Waltraud; Wetzel, Hendrik
2013-10-15
Being completely bio-based, fatty acid starch esters (FASEs) are attractive materials that represent an alternative to crude oil-based plastics. In this study, two synthesis methods were compared in terms of their efficiency, toxicity and, especially, product solubility with starch laurate (C12) as model compound. Laurates (DS>2) were obtained through transesterification of fatty acid vinylesters in DMSO or reaction with fatty acid chlorides in pyridine. The latter lead to higher DS-values in a shorter reaction time. But due to the much better solubility of the products compared to lauroyl chloride esterified ones, vinylester-transesterification was preferred to optimize reaction parameters, where reaction time could be shortened to 2h. FASEs C6-C18 were also successfully prepared via transesterification. To determine the DS of the resulting starch laurates, the efficient ATR-IR method was compared with common methods (elementary analysis, (1)H NMR). Molar masses (Mw) of the highly soluble starch laurates were analyzed using SEC-MALLS (THF). High recovery rates (>80%) attest to the outstanding solubility of products obtained through transesterification, caused by a slight disintegration during synthesis. Particle size distributions (DLS) demonstrated stable dissolutions in CHCl3 of vinyl laurate esterified - contrary to lauroyl chloride esterified starch. For all highly soluble FASEs (C6-C18), formation of concentrated solutions (10 wt%) is feasible. Copyright © 2013 Elsevier Ltd. All rights reserved.
Wilson, Fiona A.; Suryawan, Agus; Orellana, Renán A.; Nguyen, Hanh V.; Jeyapalan, Asumthia S.; Gazzaneo, Maria C.; Davis, Teresa A.
2008-01-01
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 μg·kg−1·day−1) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P < 0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P < 0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1·eIF4E complex association, and increased active eIF4E·eIF4G complex formation (P < 0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex. PMID:18682537
Effect of tannic acid on the synthesis of protein and nucleic acid by rat liver
Badawy, A. A.-B.; White, Audrey E.; Lathe, G. H.
1969-01-01
1. As early as 1hr. after the intraperitoneal administration of tannic acid to rats, it could be demonstrated in the liver. At 3hr. the nuclear fraction contained the largest amount of tannic acid. 2. Nuclear RNA synthesis was inhibited in vivo 2hr. after the administration of tannic acid. Induction by cortisol of tryptophan pyrrolase was 90% inhibited at 24hr. 3. Incorporation of [1-14C]leucine into protein by liver slices from treated rats was decreased by 50% after 24hr. Its incorporation into postmitochondrial supernatant from treated animals was not inhibited. Incorporation into slices and postmitochondrial supernatants were inhibited in vitro by tannic acid. 4. The sequence of events: concentration of tannic acid in nuclei, inhibition of nuclear RNA synthesis, inhibition of protein synthesis and production of necrosis, is discussed. PMID:5808319
Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles
NASA Astrophysics Data System (ADS)
Berti, Lorenzo; Burley, Glenn A.
2008-02-01
Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.
The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis
NASA Technical Reports Server (NTRS)
Morowitz, Harold; Peterson, Eta; Chang, Sherwood
1995-01-01
This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.
Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen
2017-04-01
Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis. Copyright © 2017 Elsevier Inc. All rights reserved.
Kinetics of photoirradiation-induced synthesis of soy oil-conjugated linoleic acid isomers.
Jain, Vishal P; Proctor, Andrew
2007-02-07
Photoirradiation of soy oil with UV/visible light has been shown to produce significant amounts of trans,trans conjugated linoleic acid (CLA) isomers through conversion of various synthesized intermediate cis,trans isomers. The objective of this study was to determine the kinetics of CLA isomers synthesis to better understand the production of various isomers. Soy oil was irradiated with UV/visible light for 144 h in the presence of an iodine catalyst and CLA isomers analyzed by gas chromatography (GC). Arrhenius plots were developed for the conversion of soy oil linoleic acid (A) to form cis-, trans/trans-, cis-CLA (B), conversion of cis-, trans/trans-, cis-CLA to form trans,trans-CLA (C) with respect to B, and formation of trans,trans-CLA isomers with respect to C. The kinetics of consumption of linoleic acid (LA) to form cis-, trans/trans-, cis-CLA was found to be of second-order with a rate constant of 9.01 x 10-7 L/mol s. The rate of formation of cis-, trans/trans-, cis-CLA isomers depends on the rate of formation from LA and its rate of consumption to form trans,trans-CLA isomers. The conversion of cis-, trans/trans-, cis-CLA isomers to trans,trans-CLA isomers was found to be of first-order with a rate constant of 2.75 x 10-6 s-1. However, the formation of thermodynamically stable trans,trans-CLA isomers (C) with respect to C was found to be a zero-order reaction with a rate constant of 10.66 x 10-7 mol/L s. The consumption of LA was found to be the rate-determining step in the CLA isomers formation reaction mechanism. The findings provide a better understanding of the mechanism of CLA isomers synthesis by photoirradiation and the factors controlling the ratio of various isomers.
Sensitivity of whole body protein synthesis to amino acid administration during short-term bed rest.
Biolo, Gianni; Ciocchi, Beniamino; Lebenstedt, Marion; Heer, Martina; Guarnieri, Gianfranco
2002-07-01
We tested the hypothesis that a reduced stimulation of whole-body protein synthesis by amino acid administration represents a major mechanism for the bed rest-induced loss of lean body mass. Healthy young subjects and matched controls were studied on the last day of a 14-day bed rest or ambulatory period, as part of the overall protocol "Short-term Bed Rest - Integrated Physiology" set up by the German Aerospace Centre (DLR) in co-operation with the European Space Agency. A balanced mixture of essential and non-essential amino acids was intravenously infused in the postabsorptive state for 3 hours at the rate of 0.1 g/kg/hour. The oxidative and non-oxidative (i.e., to protein synthesis) disposal of the infused leucine was determined by stable isotope and mass spectrometry techniques. The clearance of total infused amino acids tended to be greater (P=0.07) in the ambulatory group than in the bed rest group. When leucine clearance was partitioned between its oxidative and non-oxidative (i.e., to protein synthesis) components, the results indicated that the oxidative disposal was not statistically different in the bed rest and in the ambulatory groups. In contrast, the non-oxidative leucine disposal (i.e., to protein synthesis) was about 20% greater (P<0.01) in the ambulatory group than in the bed rest group. In conclusion, these preliminary data suggest that 14-day bed rest impairs the ability to utilise exogenous amino acids for protein synthesis.
The spark discharge synthesis of amino acids from various hydrocarbons
NASA Technical Reports Server (NTRS)
Ring, D.; Miller, S. L.
1984-01-01
The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).
Montoya, A; Gómez-Lechón, M J; Castell, J V
1989-04-01
Supplementation of Ham's F12 culture medium with essential amino acids (EAA) up to the rat plasma levels increased the rates of synthesis of albumin and transferrin by cultured rat hepatocytes by 1.3 and 1.7, respectively. Fifty percent of this increase could be attributed to three of the EAA: the branched-chain amino acids (BCAA: Leu Ile and Val). Non-branched-chain essential amino acids (non-BC-EAA) stimulated only 25% of the increase produced by the whole EAA mixture. When each EAA was tested individually, none of them caused an appreciable increase in albumin and transferrin in culture medium. When the concentrations of all EAA were raised to rat postprandial portal levels, albumin and transferrin synthesis rates reached a maximum, increasing by 3.2 and 3.5, respectively. Supplementation with BCAA at postprandial portal concentrations increased albumin and transferrin synthesis rates by 2.2 and 2.0, respectively, and had no noteworthy effect on the synthesis of cellular proteins. Non-BC-EAA at their postprandial portal concentrations increased albumin and transferrin synthesis rates by 1.7 and 1.9, respectively. Supplementation with alanine to reach a nitrogen content equal to that of the modified EAA-enriched medium had no stimulatory effect. Our results show that EAA have a specific effect on the synthesis of plasma proteins by cultured hepatocytes, and that BCAA at physiologic concentrations account for the major part of this stimulatory effect. Consequently, EAA and particularly BCAA concentration should be elevated in serum-free nutrient media to sustain maximum plasma protein synthesis.
Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.
Matsuno, Koya; Fujimura, Tatsuhito
2014-03-01
A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.
Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?
Parsons, Joshua B.; Rock, Charles O.
2011-01-01
The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391
A Key Role for Lipoic Acid Synthesis During Plasmodium Liver stage Development
Falkard, Brie; Santha Kumar, T. R.; Hecht, Leonie-Sophie; Matthews, Krista A.; Henrich, Philipp P.; Gulati, Sonia; Lewis, Rebecca E.; Manary, Micah J.; Winzeler, Elizabeth A.; Sinnis, Photini; Prigge, Sean T.; Heussler, Volker; Deschermeier, Christina; Fidock, David
2013-01-01
SUMMARY The successful navigation of malaria parasites through their life cycle, which alternates between vertebrate hosts and mosquito vectors, requires a complex interplay of metabolite synthesis and salvage pathways. Using the rodent parasite Plasmodium berghei, we have explored the synthesis and scavenging pathways for lipoic acid, a short-chain fatty acid derivative that regulates the activity of α-ketoacid dehydrogenases including pyruvate dehydrogenase. In Plasmodium, lipoic acid is either synthesized de novo in the apicoplast or is scavenged from the host into the mitochondrion. Our data show that sporozoites lacking the apicoplast lipoic acid protein ligase LipB are markedly attenuated in their infectivity for mice, and in vitro studies document a very late liver stage arrest shortly before the final phase of intra-hepatic parasite maturation. LipB-deficient asexual blood stage parasites show unimpaired rates of growth in normal in vitro or in vivo conditions. However, these parasites showed reduced growth in lipid-restricted conditions induced by treatment with the lipoic acid analog 8-bromo-octanoate or with the lipid-reducing agent clofibrate. This finding has implications for understanding Plasmodium pathogenesis in malnourished children that bear the brunt of malarial disease. This study also highlights the potential of exploiting lipid metabolism pathways for the design of genetically attenuated sporozoite vaccines. PMID:23490300
Biotin and Lipoic Acid: Synthesis, Attachment and Regulation
Cronan, John E.
2014-01-01
Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses
Distribution, industrial applications, and enzymatic synthesis of D-amino acids.
Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang
2015-04-01
D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.
Ghasemzadeh, Ali; Jaafar, Hawa Z. E.; Rahmat, Asmah
2010-01-01
The relationship between phenolics and flavonoids synthesis/accumulation and photosynthesis rate was investigated for two Malaysian ginger (Zingiber officinale) varieties grown under four levels of glasshouse light intensity, namely 310, 460, 630 and 790 μmol m−2s−1. High performance liquid chromatography (HPLC) was employed to identify and quantify the polyphenolic components. The results of HPLC analysis indicated that synthesis and partitioning of quercetin, rutin, catechin, epicatechin and naringenin were high in plants grown under 310 μmol m−2s−1. The average value of flavonoids synthesis in leaves for both varieties increased (Halia Bentong 26.1%; Halia Bara 19.5%) when light intensity decreased. Photosynthetic rate and plant biomass increased in both varieties with increasing light intensity. More specifically, a high photosynthesis rate (12.25 μmol CO2 m−2s−1 in Halia Bara) and plant biomass (79.47 g in Halia Bentong) were observed at 790 μmol m−2s−1. Furthermore, plants with the lowest rate of photosynthesis had highest flavonoids content. Previous studies have shown that quercetin inhibits and salicylic acid induces the electron transport rate in photosynthesis photosystems. In the current study, quercetin was an abundant flavonoid in both ginger varieties. Moreover, higher concentration of quercetin (1.12 mg/g dry weight) was found in Halia Bara leaves grown under 310 μmol m−2s−1 with a low photosynthesis rate. Furthermore, a high content of salicylic acid (0.673 mg/g dry weight) was detected in Halia Bara leaves exposed under 790 μmol m−2s−1 with a high photosynthesis rate. No salicylic acid was detected in gingers grown under 310 μmol m−2s−1. Ginger is a semi-shade loving plant that does not require high light intensity for photosynthesis. Different photosynthesis rates at different light intensities may be related to the absence or presence of some flavonoid and phenolic compounds. PMID:21151455
Sano, Katsura; Gotoh, Mari; Dodo, Kyoko; Tajima, Noriaki; Shimizu, Yoshibumi; Murakami-Murofushi, Kimiko
2018-01-01
Hyaluronic acid is a major component of the extracellular matrix, which is important for skin hydration. As aging brings skin dehydration, we aimed to clarify the mRNA expression of hyaluronic acid-related proteins in human skin fibroblasts from donors of various ages (range 0.7-69 years). Previously, we reported that cyclic phosphatidic acid (cPA), a unique phospholipid mediator, stimulated the expression of HAS2 and increased hyaluronic acid synthesis in human skin fibroblasts (donor age: 3 days). In this study, we measured the mRNA expression of hyaluronic acid-related proteins: hyaluronan synthase (HAS) 1-3, hyaluronidase-1, -2, and hyaluronic acid-binding protein (versican). In addition, we tested whether cPA could increase hyaluronic acid synthesis in skin fibroblasts derived from donors of various ages. The expression of HAS1, 3, hyaluronidase-1, and -2 did not change with aging. However, the mRNA expression of versican decreased with aging. Although it is thought that the amount of hyaluronic acid in the dermis decreases with aging, the mRNA expression of HAS2 was increased. But the amount of hyaluronic acid secreted by fibroblasts did not increase with aging. This suggests that the activity and/or protein expression of HAS2 decrease with aging. Furthermore, we observed that cPA caused the increase of hyaluronic acid synthesis at any age, and this effect was increased with aging. These results suggest that aging made the fibroblasts more sensitive to cPA treatment. Therefore, cPA represents a suitable candidate for the health maintenance and improvement of the skin by increasing the level of hyaluronic acid in the dermis.
Derivatives of diphosphonic acids: synthesis and biological activity
NASA Astrophysics Data System (ADS)
Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.
1993-07-01
The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.
Hellstern, Gerald; Kaempf-Rotzoll, Daisy; Linderkamp, Otwin; Langhans, Klaus-Dieter; Rating, Dietz
2002-09-01
Early administration of parenteral amino acids increases whole body nitrogen retention in premature infants. Tracer kinetic studies suggest an increase in whole body protein synthesis as a possible mechanism for this increase in nitrogen retention. However, the effect of early parenteral amino acids on synthesis of specific proteins remains uncertain. Using premature newborn minipigs as a model for human premature newborns, we investigated the effects of parenterally administered amino acids on albumin and skeletal muscle protein fractional synthetic rates. Fifteen Yucatan minipigs were delivered by cesarean section 6 days before the mean expected delivery date (day 106 of gestation; expected gestation, 111-113 days) and randomized to two groups immediately after birth: 7 piglets received a mixture of amino acids (0.4 g. kg. h ) and glucose (0.8 g. kg. h ) for 5 hours, and 8 piglets (control group) received glucose only. All piglets received a continuous primed infusion of 1-[ C]valine. Arterial plasma free C-valine enrichment was measured by gas chromatography/mass spectrometry, and protein synthetic rates were determined by measuring incorporation of C-valine into albumin and skeletal muscle protein using gas chromatography/combustion/isotope ratio mass spectrometry. Administration of amino acids increased albumin (87.0% +/- 42.1% [mean +/- SD] vs. 37.6% +/- 6.8% per 24 hours; < 0.05) and skeletal muscle fractional synthetic rates (11.60% +/- 6.9% vs. 6.5% +/- 1.5% per 24 hours; < 0.05). We conclude that parenteral amino acids increase albumin and skeletal muscle fractional synthetic rates in premature piglets on the first day of life.
Kent, R S; Diedrich, S L; Whorton, A R
1983-01-01
To address the hypothesis that metabolites of arachidonic acid are important regulators of prostaglandin (PG) synthesis in intact vascular tissue, we studied arachidonate metabolism in rabbit aortas in response to a continuous infusion of arachidonic acid, 10 micrograms/ml. Prostacyclin (PGI2; measured as 6-keto-PGF1 alpha) production rate accelerated during the first 2 min, reached peak velocity at 2 min, and then progressively decelerated. The velocity profile of PGI2 production was similar to that previously reported for cyclooxygenase holoenzyme assayed in vitro, and was consistent with progressive inactivation of the enzymes leading to PGI2 synthesis. We determined the specific inhibition of cyclooxygenase and prostacyclin synthetase by measuring PGI2 and PGE2 production rates and by infusing cyclic endoperoxides. Our results indicate preferential inactivation of cyclooxygenase during arachidonate metabolism, most likely due to cyclooxygenase-derived oxidative intermediates. This was a dose-dependent response and resulted in a progressive decrease in the 6-keto-PGF1 alpha/PGE2 ratio. Exogenously added 15-hydroperoxy eicosatetraenoic acid, on the other hand, actually stimulated cyclooxygenase activity at low doses, while markedly inhibiting prostacyclin synthetase. This finding, along with the accelerating nature of arachidonate metabolism, is consistent with the concept of "peroxide tone" as a mediator of cyclooxygenase activity in this system. These results demonstrate that arachidonate metabolites regulate PG synthesis in intact blood vessels. The progressive enzymatic inhibition intrinsic to arachidonate metabolism may be a model for similar changes occurring in states of enhanced lipid peroxidation. These metabolic alterations might greatly influence the numerous vascular functions known to involve arachidonic acid metabolism. PMID:6409932
Ishihara, Hirofumi; Obata, Toshihiro; Sulpice, Ronan; Fernie, Alisdair R; Stitt, Mark
2015-05-01
Protein synthesis and degradation represent substantial costs during plant growth. To obtain a quantitative measure of the rate of protein synthesis and degradation, we supplied (13)CO2 to intact Arabidopsis (Arabidopsis thaliana) Columbia-0 plants and analyzed enrichment in free amino acids and in amino acid residues in protein during a 24-h pulse and 4-d chase. While many free amino acids labeled slowly and incompletely, alanine showed a rapid rise in enrichment in the pulse and a decrease in the chase. Enrichment in free alanine was used to correct enrichment in alanine residues in protein and calculate the rate of protein synthesis. The latter was compared with the relative growth rate to estimate the rate of protein degradation. The relative growth rate was estimated from sequential determination of fresh weight, sequential images of rosette area, and labeling of glucose in the cell wall. In an 8-h photoperiod, protein synthesis and cell wall synthesis were 3-fold faster in the day than at night, protein degradation was slow (3%-4% d(-1)), and flux to growth and degradation resulted in a protein half-life of 3.5 d. In the starchless phosphoglucomutase mutant at night, protein synthesis was further decreased and protein degradation increased, while cell wall synthesis was totally inhibited, quantitatively accounting for the inhibition of growth in this mutant. We also investigated the rates of protein synthesis and degradation during leaf development, during growth at high temperature, and compared synthesis rates of Rubisco large and small subunits of in the light and dark. © 2015 American Society of Plant Biologists. All Rights Reserved.
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.
Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G
2016-04-01
Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans.
Abiotic synthesis of fatty acids
NASA Technical Reports Server (NTRS)
Leach, W. W.; Nooner, D. W.; Oro, J.
1978-01-01
The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.
Maniscalco, W M; Finkelstein, J N; Parkhurst, A B
1989-05-01
De novo fatty acid synthesis may be an important source of saturated fatty acids for fetal lung disaturated phosphatidylcholine (DSPC) production. To investigate the roles of de novo fatty acid synthesis and exogenous fatty acids, we incubated dispersed fetal lung cells and freshly isolated adult type II cells with exogenous palmitate and oleate and measured DSPC synthesis. Unlike adult type II cells, fetal lung cells did not increase DSPC synthesis when exogenous palmitate was available; adult type II cells increased DSPC synthesis by 70% in the presence of palmitate. Exogenous oleate decreased DSPC synthesis by 48% in fetal cells but not in adult type II cells. Incubation of fetal lung cells with TOFA [2-furancarboxylate, 5-(tetradecyloxy)-sodium], a metabolic inhibitor of fatty acid synthesis, decreased fatty acid synthesis by 65%. There was a simultaneous 56% inhibition of DSPC production, but no effect on protein, DNA, or glyceride-glycerol production, measured by precursor incorporation. The inhibition of DSPC synthesis associated with TOFA was partially prevented by exogenous palmitate but not oleate. Fetal cells prepared from explants that had been cultured in dexamethasone also had TOFA-associated inhibition of DSPC synthesis that was similar to non-dexamethasone-exposed cells. These studies suggest that under baseline conditions of low fatty acid availability, such as in the fetus, de novo fatty acid synthesis in fetal cells, but not in adult type II cells, provides sufficient saturated fatty acids to support maximal DSPC production. Inhibition of de novo fatty acid synthesis resulting in decreased DSPC production in fetal lung cells in conditions of low fatty acid availability suggests that fatty acid synthesis may be central to maintain DSPC synthesis in the fetus.
Gaal, T; Gourse, R L
1990-01-01
rRNA synthesis in Escherichia coli is subject to at least two regulation systems, growth rate-dependent control and stringent control. The inverse correlation between rRNA synthesis rates and guanosine 3'-diphosphate 5'-diphosphate (ppGpp) levels under various physiological conditions has led to the supposition that ppGpp is the mediator of both control mechanisms by inhibiting transcription from rrn P1 promoters. Recently, relA- spoT- strains have been constructed in which both ppGpp synthesis pathways most likely have been removed (M. Cashel, personal communication). We have confirmed that such strains produce no detectable ppGpp and therefore offer a direct means for testing the involvement of ppGpp in the regulation of rRNA synthesis in vivo. Stringent control was determined by measurement of rRNA synthesis after amino acid starvation, while growth rate control was determined by measurement of rRNA synthesis under different nutritional conditions. As expected, the relA- spoT- strain is relaxed for stringent control. However, growth rate-dependent regulation is unimpaired. These results indicate that growth rate regulation can occur in the absence of ppGpp and imply that ppGpp is not the mediator, or at least is not the sole mediator, of growth rate-dependent control. Therefore, growth rate-dependent control and stringent control may utilize different mechanisms for regulating stable RNA synthesis. PMID:2196571
Patel, Unisha; Chauhan, Kishor; Gupte, Shilpa
2018-04-01
In the present work, magnetic nanoparticles (MNPs) were prepared by chemical precipitation of trivalent and divalent iron ions which were functionalized using citric acid. The bacterial isolate Staphylococcus epidermidis KX781317 was isolated from oil-contaminated site. The isolate produced lipase, which was purified and immobilized on magnetic nanoparticles (MNPs) for ester synthesis from waste frying oil (WFO). The characterization of MNPs employed conventional TEM, XRD and FTIR techniques. TEM analysis of MNPs showed the particle size in the range of 20-50 nm. FTIR spectra revealed the binding of citric acid to Fe 3 O 4 and lipase on citric acid-coated MNPs. The citric acid-coated MNPs and lipase-conjugated citric acid-coated MNPs had similar XRD patterns which indicate MNPs could preserve their magnetic properties. The maximum immobilization efficiency 98.21% of lipase-containing citric acid-coated MNPs was observed at ratio 10:1 of Cit-MNPs:lipase. The pH and temperature optima for lipase conjugated with Cit-MNPs were 7 and 35 °C, respectively. Isobutanol was found to be an effective solvent for ester synthesis and 1:2 ratio of oil:alcohol observed significant for ester formation. The ester formation was determined using TLC and the % yield of ester conversion was calculated. The rate of ester formation is directly proportional to the enzyme load. Formed esters were identified as isobutyl laurate ester and isobutyl myristate ester through GC-MS analysis.
Enzymatic routes for the synthesis of ursodeoxycholic acid.
Eggert, Thorsten; Bakonyi, Daniel; Hummel, Werner
2014-12-10
Ursodeoxycholic acid, a secondary bile acid, is used as a drug for the treatment of various liver diseases, the optimal dose comprises the range of 8-10mg/kg/day. For industrial syntheses, the structural complexity of this bile acid requires the use of an appropriate starting material as well as the application of regio- and enantio-selective enzymes for its derivatization. Most strategies for the synthesis start from cholic acid or chenodeoxycholic acid. The latter requires the conversion of the hydroxyl group at C-7 from α- into β-position in order to obtain ursodeoxycholic acid. Cholic acid on the other hand does not only require the same epimerization reaction at C-7 but the removal of the hydroxyl group at C-12 as well. There are several bacterial regio- and enantio-selective hydroxysteroid dehydrogenases (HSDHs) to carry out the desired reactions, for example 7α-HSDHs from strains of Clostridium, Bacteroides or Xanthomonas, 7β-HSDHs from Clostridium, Collinsella, or Ruminococcus, or 12α-HSDH from Clostridium or from Eggerthella. However, all these bioconversion reactions need additional steps for the regeneration of the coenzymes. Selected multi-step reaction systems for the synthesis of ursodeoxycholic acid are presented in this review. Copyright © 2014 Elsevier B.V. All rights reserved.
Yu, Yong-Ming; Ryan, Colleen M; Fei, Zhe-Wei; Lu, Xiao-Ming; Castillo, Leticia; Schultz, John T; Tompkins, Ronald G; Young, Vernon R
2002-02-01
Compromised glutathione homeostasis is associated with increased morbidity in various disease states. We evaluated the kinetics of L-5-oxoproline, an intermediate in the gamma-glutamyl cycle of glutathione production, in fourteen severely burned adults by use of a primed, constant intravenous infusion of L-5-[1-(13)C]oxoproline. In nine of these patients, whole blood glutathione synthesis and plasma kinetics of glycine and leucine were also measured with [(15)N]glycine and L-[(2)H(3)]leucine tracers. Patients were studied under a "basal" condition that provided a low dose of glucose and total parenteral nutrition. For comparison with control subjects, whole blood glutathione synthesis was estimated in six healthy adults. Burn patients in a basal condition showed significantly higher rates of plasma oxoproline clearance and urinary D- and L-oxoproline excretion compared with fasting healthy control subjects. Whole blood glutathione concentration and absolute synthesis rate in the basal state were lower than for control subjects. Total parenteral feeding without cysteine but with generous methionine did not affect oxoproline kinetics or whole blood glutathione synthesis. The estimated rate of glycine de novo synthesis was also lower in burn patients, suggesting a possible change in glycine availability for glutathione synthesis. The roles of precursor amino acid availability, as well as alterations in metabolic capacity, in modulating whole blood glutathione production in burns now require investigation.
Fernie, Alisdair R.; Stitt, Mark
2015-01-01
Protein synthesis and degradation represent substantial costs during plant growth. To obtain a quantitative measure of the rate of protein synthesis and degradation, we supplied 13CO2 to intact Arabidopsis (Arabidopsis thaliana) Columbia-0 plants and analyzed enrichment in free amino acids and in amino acid residues in protein during a 24-h pulse and 4-d chase. While many free amino acids labeled slowly and incompletely, alanine showed a rapid rise in enrichment in the pulse and a decrease in the chase. Enrichment in free alanine was used to correct enrichment in alanine residues in protein and calculate the rate of protein synthesis. The latter was compared with the relative growth rate to estimate the rate of protein degradation. The relative growth rate was estimated from sequential determination of fresh weight, sequential images of rosette area, and labeling of glucose in the cell wall. In an 8-h photoperiod, protein synthesis and cell wall synthesis were 3-fold faster in the day than at night, protein degradation was slow (3%–4% d−1), and flux to growth and degradation resulted in a protein half-life of 3.5 d. In the starchless phosphoglucomutase mutant at night, protein synthesis was further decreased and protein degradation increased, while cell wall synthesis was totally inhibited, quantitatively accounting for the inhibition of growth in this mutant. We also investigated the rates of protein synthesis and degradation during leaf development, during growth at high temperature, and compared synthesis rates of Rubisco large and small subunits of in the light and dark. PMID:25810096
Inhibition of fatty acid synthesis in isolated adipocytes by 5-(tetradecyloxy)-2-furoic acid.
Halvorson, D L; McCune, S A
1984-11-01
The compound 5-(tetradecyloxy)-2-furoic acid (TOFA), a hypolipidemic agent, inhibits fatty acid synthesis, lactate and pyruvate accumulation and CO2 release in isolated rat adipocytes. TOFA stimulates the accumulation of citrate. ATP levels are not lowered by TOFA. In comparison with the natural fatty acid, oleate, TOFA exhibited a much greater inhibitory effect on lipogenesis. TOFyl-CoA formation within intact adipocytes was demonstrated. Although not inhibited by TOFA, acetyl-CoA carboxylase is inhibited by TOFyl-CoA. It is proposed that many of the metabolic effects of TOFA in isolated adipocytes can be explained by TOFyl-CoA inhibition of acetyl-CoA carboxylase. TOFA inhibits glycolysis as a secondary event with the primary event of inhibition of fatty acid synthesis causing an accumulation of citrate which is an inhibitor of phosphofructokinase.
Glutamic Acid as Enhancer of Protein Synthesis Kinetics in Hepatocytes from Old Rats.
Brodsky, V Y; Malchenko, L A; Butorina, N N; Lazarev Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2017-08-01
Dense cultures of hepatocytes from old rats (~2 years old, body weight 530-610 g) are different from similar cultures of hepatocytes from young rats by the low amplitude of protein synthesis rhythm. Addition of glutamic acid (0.2, 0.4, or 0.6 mg/ml) into the culture medium with hepatocytes of old rats resulted in increase in the oscillation amplitudes of the protein synthesis rhythm to the level of young rats. A similar action of glutamic acid on the protein synthesis kinetics was observed in vivo after feeding old rats with glutamic acid. Inhibition of metabotropic receptors of glutamic acid with α-methyl-4-carboxyphenylglycine (0.01 mg/ml) abolished the effect of glutamic acid. The amplitude of oscillation of the protein synthesis rhythm in a cell population characterizes synchronization of individual oscillations caused by direct cell-cell communications. Hence, glutamic acid, acting as a receptor-dependent transmitter, enhanced direct cell-cell communications of hepatocytes that were decreased with aging. As differentiated from other known membrane signaling factors (gangliosides, norepinephrine, serotonin, dopamine), glutamic acid can penetrate into the brain and thus influence the communications and protein synthesis kinetics that are disturbed with aging not only in hepatocytes, but also in neurons.
Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2016-08-01
Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.
Bentz, Emilie L; Goswami, Rajesh; Moloney, Mark G; Westaway, Susan M
2005-08-07
Bicyclic lactams derived from pyroglutamic acid provide a useful scaffold for synthesis of conformationally restricted analogues of lysine, ornithine and glutamine, as well as an Ala-Ala dipeptide analogue. Amino alcohol and carboxylic acid derivatives are accessible from a common intermediate. In this strategy, the bicyclic lactam system not only controls, but also facilitates the determination of the stereochemistry of the synthetic intermediates.
Ribonucleic Acid Synthesis and Glutamate Excretion in Escherichia coli
Broda, Paul
1968-01-01
Cultures of Escherichia coli excreted glutamate into the medium when protein synthesis was blocked in RCrel strains or when it was blocked with chloramphenicol in either RCstr or RCrel strains. Both of these conditions resulted in continued ribonucleic acid (RNA) synthesis in the absence of protein synthesis. Glutamate was also excreted by both RCstr and RCrel strains when RNA synthesis was inhibited by uracil starvation or by treatment with actinomycin D. It is proposed that, in each of these cases, glutamate excretion resulted from an increase in the permeability of the cell membrane. PMID:4973126
A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.
Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L
2015-04-01
The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.
Synthesis and chirality of amino acids under interstellar conditions.
Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J
2013-01-01
Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.
Marini, Juan C; Didelija, Inka Cajo
2015-01-01
Due to the absolute need for arginine that certain cancer cells have, arginine depletion is a therapy in clinical trials to treat several types of cancers. Arginine is an amino acids utilized not only as a precursor for other important molecules, but also for protein synthesis. Because arginine depletion can potentially exacerbate the progressive loss of body weight, and especially lean body mass, in cancer patients we determined the effect of arginine depletion by pegylated arginine deiminase (ADI-PEG 20) on whole body protein synthesis and fractional protein synthesis rate in multiple tissues of mice. ADI-PEG 20 successfully depleted circulating arginine (<1 μmol/L), and increased citrulline concentration more than tenfold. Body weight and body composition, however, were not affected by ADI-PEG 20. Despite the depletion of arginine, whole body protein synthesis and breakdown were maintained in the ADI-PEG 20 treated mice. The fractional protein synthesis rate of muscle was also not affected by arginine depletion. Most tissues (liver, kidney, spleen, heart, lungs, stomach, small and large intestine, pancreas) were able to maintain their fractional protein synthesis rate; however, the fractional protein synthesis rate of brain, thymus and testicles was reduced due to the ADI-PEG 20 treatment. Furthermore, these results were confirmed by the incorporation of ureido [14C]citrulline, which indicate the local conversion into arginine, into protein. In conclusion, the intracellular recycling pathway of citrulline is able to provide enough arginine to maintain protein synthesis rate and prevent the loss of lean body mass and body weight.
Salicylic acid derivatives: synthesis, features and usage as therapeutic tools.
Ekinci, Deniz; Sentürk, Murat; Küfrevioğlu, Ömer İrfan
2011-12-01
In the field of medicinal chemistry, there is a growing interest in the use of small molecules. Although acetyl salicylic acid is well known for medical applications, little is known about other salicylic acid derivatives, and there is serious lack of data and information on the effects and biological evaluation that connect them. This review covers the synthesis and drug potencies of salicylic acid derivatives. After a brief overview of the information on salicylic acid and its features, a detailed review of salicylic acids as drugs and prodrugs, usage as cyclooxygenase inhibitors, properties in plants, synthesis and recent patents, is developed. Salicylic acid research is still an important area and innovations continue to arise, which offer hope for new therapeutics in related fields. It is anticipated that this review will guide the direction of long-term drug/nutraceutical safety trials and stimulate ideas for future research.
Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P
2016-09-01
Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Trommelen, Jorn; Groen, Bart B L; Hamer, Henrike M; de Groot, Lisette C P G M; van Loon, Luc J C
2015-07-01
Though it is well appreciated that insulin plays an important role in the regulation of muscle protein metabolism, there is much discrepancy in the literature on the capacity of exogenous insulin administration to increase muscle protein synthesis rates in vivo in humans. To assess whether exogenous insulin administration increases muscle protein synthesis rates in young and older adults. A systematic review of clinical trials was performed and the presence or absence of an increase in muscle protein synthesis rate was reported for each individual study arm. In a stepwise manner, multiple models were constructed that excluded study arms based on the following conditions: model 1, concurrent hyperaminoacidemia; model 2, insulin-induced hypoaminoacidemia; model 3, supraphysiological insulin concentrations; and model 4, older, more insulin resistant, subjects. From the presented data in the current systematic review, we conclude that: i) exogenous insulin and amino acid administration effectively increase muscle protein synthesis, but this effect is attributed to the hyperaminoacidemia; ii) exogenous insulin administered systemically induces hypoaminoacidemia which obviates any insulin-stimulatory effect on muscle protein synthesis; iii) exogenous insulin resulting in supraphysiological insulin levels exceeding 50, 000 pmol/l may effectively augment muscle protein synthesis; iv) exogenous insulin may have a diminished effect on muscle protein synthesis in older adults due to age-related anabolic resistance; and v) exogenous insulin administered systemically does not increase muscle protein synthesis in healthy, young adults. © 2015 European Society of Endocrinology.
Circulating protein synthesis rates reveal skeletal muscle proteome dynamics
Shankaran, Mahalakshmi; King, Chelsea L.; Angel, Thomas E.; Holmes, William E.; Li, Kelvin W.; Colangelo, Marc; Price, John C.; Turner, Scott M.; Bell, Christopher; Hamilton, Karyn L.; Miller, Benjamin F.; Hellerstein, Marc K.
2015-01-01
Here, we have described and validated a strategy for monitoring skeletal muscle protein synthesis rates in rodents and humans over days or weeks from blood samples. We based this approach on label incorporation into proteins that are synthesized specifically in skeletal muscle and escape into the circulation. Heavy water labeling combined with sensitive tandem mass spectrometric analysis allowed integrated synthesis rates of proteins in muscle tissue across the proteome to be measured over several weeks. Fractional synthesis rate (FSR) of plasma creatine kinase M-type (CK-M) and carbonic anhydrase 3 (CA-3) in the blood, more than 90% of which is derived from skeletal muscle, correlated closely with FSR of CK-M, CA-3, and other proteins of various ontologies in skeletal muscle tissue in both rodents and humans. Protein synthesis rates across the muscle proteome generally changed in a coordinate manner in response to a sprint interval exercise training regimen in humans and to denervation or clenbuterol treatment in rodents. FSR of plasma CK-M and CA-3 revealed changes and interindividual differences in muscle tissue proteome dynamics. In human subjects, sprint interval training primarily stimulated synthesis of structural and glycolytic proteins. Together, our results indicate that this approach provides a virtual biopsy, sensitively revealing individualized changes in proteome-wide synthesis rates in skeletal muscle without a muscle biopsy. Accordingly, this approach has potential applications for the diagnosis, management, and treatment of muscle disorders. PMID:26657858
Abscisic acid negatively regulates elicitor-induced synthesis of capsidiol in wild tobacco.
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-07-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8'-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8'-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants.
New hydrazones of ferulic acid: synthesis, characterization and biological activity.
Wolszleger, Maria; Stan, Cătălina Daniela; Apotrosoaei, Maria; Vasincu, Ioana; Pânzariu, Andreea; Profire, Lenuţa
2014-01-01
The ferulic acid (4-hydroxy-3-methoxy-cinnamic acid) is a phenolic compound with important antioxidant effects and which nowadays is being extensively studied for his potential indications in inflammatory and neurodegenerative diseases, hypertension, atherosclerosis, etc. The synthesis of new ferulic acid compounds with potential antioxidant activity. The synthesis of the designed compounds was performed in several steps: (i) the obtaining of ferulic acid chloride by reacting of ferulic acid with thionyl chloride; (ii) the reaction between the ferulic acid chloride and hydrazine hydrate 98% to obtain the ferulic acid hydrazide; (iii) the condensation of ferrulic acid hydrazide with various benzaldehydes (2-hydroxy/3-hydroxy/4-hydroxy/2-nitro/3-nitro/4-nitro/2-methoxi/ 4-chloro/4-fluoro/4-bromo-benzaldehyde) resulting the correspond- ing hydrazones. The structure of the synthesized compounds was confirmed by FT-IR spectroscopy and the evaluation of antioxidant potential was achieved by determining the total antioxidant capacity and reducing power. In this study new hydrazones of ferulic acid have been synthesized, physic-chemical and spectral characterized. The evaluation of antioxidant potential using in vitro methods showed the favorable influence of the structural modulation on the antioxidant effects of ferulic acid.
Expeditious Synthesis of Dianionic-Headed 4-Sulfoalkanoic Acid Surfactants.
Jiang, Jianghui; Xu, Jiaxi
2017-04-16
4-Sulfoalkanoic acids are a class of important dianionic-headed surfactants. Various 4-sulfoalkanoic acids with straight C8, C10, C12, C14, C16, and C18 chains were synthesized expeditiously through the radical addition of methyl 2-((ethoxycarbonothioyl)thio)acetate to linear terminal olefins and subsequent oxidation with peroxyformic acid. This is a useful and convenient strategy for the synthesis of dianionic-headed surfactants with a carboxylic acid and sulfonic acid functionalities in the head group region.
Synthesis of monomethyl 5,5'-dehydrodiferulic acid
USDA-ARS?s Scientific Manuscript database
Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...
Carballeira, Néstor M.; Sanabria, David; Oyola, Delise
2006-01-01
An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032
Total amino acid stabilization during cell-free protein synthesis reactions.
Calhoun, Kara A; Swartz, James R
2006-05-17
Limitations in amino acid supply have been recognized as a substantial problem in cell-free protein synthesis reactions. Although enzymatic inhibitors and fed-batch techniques have been beneficial, the most robust way to stabilize amino acids is to remove the responsible enzymatic activities by genetically modifying the source strain used for cell extract preparation. Previous work showed this was possible for arginine, serine, and tryptophan, but cysteine degradation remained a major limitation in obtaining high protein synthesis yields. Through radiolabel techniques, we confirmed that cysteine degradation was caused by the activity of glutamate-cysteine ligase (gene gshA) in the cell extract. Next, we created Escherichia coli strain KC6 that combines a gshA deletion with previously described deletions for arginine, serine, and tryptophan stabilization. Strain KC6 grows well, and active cell extract can be produced from it for cell-free protein synthesis reactions. The extract from strain KC6 maintains stable amino acid concentrations of all 20 amino acids in a 3-h batch reaction. Yields for three different proteins improved 75-250% relative to cell-free expression using the control extract.
Geary, Bethany; Magee, Kieran; Cash, Phillip; Young, Iain S; Whitfield, Phillip D; Doherty, Mary K
2016-05-01
The zebrafish is a powerful model organism for the analysis of human cardiovascular development and disease. Understanding these processes at the protein level not only requires changes in protein concentration to be determined but also the rate at which these changes occur on a protein-by-protein basis. The ability to measure protein synthesis and degradation rates on a proteome-wide scale, using stable isotope labelling in conjunction with mass spectrometry is now a well-established experimental approach. With the advent of more selective and sensitive mass spectrometers, it is possible to accurately measure lower levels of stable isotope incorporation, even when sample is limited. In order to challenge the sensitivity of this approach, we successfully determined the synthesis rates of over 600 proteins from the cardiac muscle of the zebrafish using a diet where either 30% or 50% of the L-leucine was replaced with a stable isotope labelled analogue ([(2) H7 ]L-leucine]. It was possible to extract sufficient protein from individual zebrafish hearts to determine the incorporation rate of the label into hundreds of proteins simultaneously, with the two labelling regimens showing a good correlation of synthesis rates. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Protein synthesis rates in atrophied gastrocnemius muscles after limb immobilization
NASA Technical Reports Server (NTRS)
Tucker, K. R.; Seider, M. J.; Booth, F. W.
1981-01-01
Noting that protein synthesis declines in the gastrocnemius 6 hr after immobilization, the study sought to detect an increase of protein synthesis when the limb was freed, and to examine the effects of exercise on the rate of increase. Rats were used as subjects, with their hind legs in plaster of Paris in plantar flexion to eliminate strain on the gastrocnemius. Periods of immobilization were varied and samples of blood from the muscle were taken to track protein synthesis rates for different groups in immobilization and exercise regimens (running and weightlifting). Synthesis rates declined 3.6% during time in the cast, then increased 6.3%/day after the casts were removed. Both running and weightlifting were found to increase the fractional rate of protein formation in the gastrocnemius muscle when compared with contralateral muscles that were not exercised and were used as controls, suggesting that the mechanism controlling protein synthesis in skeletal muscles is rapidly responsive to changes in muscular contractile activity.
Stereoselective synthesis of unsaturated α-amino acids.
Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine
2015-06-01
Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.
Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.
Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie
2016-04-01
The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.
Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D
2014-05-20
Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies. Copyright © 2014 Elsevier B.V. All rights reserved.
Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.
Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip
2016-07-02
Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.
Brunton, Janet A; Baldwin, Mark P; Hanna, Rodney A; Bertolo, Robert F
2012-06-01
Proline and arginine are each indispensable during parenteral feeding due to limited interconversion by an atrophied gut. Commercial amino acid parenteral products designed for neonates contain proline concentrations that differ by almost 4-fold. To assess the adequacy of the lowest concentration of proline provided in commercial total parenteral nutrition (TPN) products, we compared rates of tissue-specific protein synthesis and nitrogen balance in neonatal piglets provided TPN at 2 different proline concentrations. Yucatan miniature piglets (9-11 d old, n = 12) were randomized to complete isonitrogenous TPN diets with low proline (LP; L-proline as 3% of amino acids) or proline supplemented (PS; 9%). After 7 d of receiving TPN, rates of protein synthesis in liver, gastrocnemius muscle, jejunal mucosa, and skin were determined by the flooding dose technique and tissue free amino acids were measured. Nitrogen balance was assessed during the last 3 d. The LP TPN resulted in lower free proline concentrations in plasma, muscle, and skin (P < 0.05) and lower rates of protein synthesis in the jejunum (by 25%; P = 0.02), muscle (by 45%; P = 0.015), and skin (by 60%; P = 0.01); there was no difference in liver. Nitrogen retention was 20% lower in the LP group (P = 0.01). In conclusion, muscle and skin protein synthesis was profoundly sensitive to parenteral proline supply and the reduced protein synthesis in the intestine could affect intestinal integrity. Low-proline TPN solutions that are currently in wide use in neonatal care may result in impaired tissue growth.
Everman, Sarah; Meyer, Christian; Tran, Lee; Hoffman, Nyssa; Carroll, Chad C; Dedmon, William L; Katsanos, Christos S
2016-10-01
Insulin stimulates muscle protein synthesis when the levels of total amino acids, or at least the essential amino acids, are at or above their postabsorptive concentrations. Among the essential amino acids, branched-chain amino acids (BCAA) have the primary role in stimulating muscle protein synthesis and are commonly sought alone to stimulate muscle protein synthesis in humans. Fourteen healthy young subjects were studied before and after insulin infusion to examine whether insulin stimulates muscle protein synthesis in relation to the availability of BCAA alone. One half of the subjects were studied in the presence of postabsorptive BCAA concentrations (control) and the other half in the presence of increased plasma BCAA (BCAA). Compared with that prior to the initiation of the insulin infusion, fractional synthesis rate of muscle protein (%/h) did not change (P > 0.05) during insulin in either the control (0.04 ± 0.01 vs 0.05 ± 0.01) or the BCAA (0.05 ± 0.02 vs. 0.05 ± 0.01) experiments. Insulin decreased (P < 0.01) whole body phenylalanine rate of appearance (μmol·kg -1 ·min -1 ), indicating suppression of muscle proteolysis, in both the control (1.02 ± 0.04 vs 0.76 ± 0.04) and the BCAA (0.89 ± 0.07 vs 0.61 ± 0.03) experiments, but the change was not different between the two experiments (P > 0.05). In conclusion, insulin does not stimulate muscle protein synthesis in the presence of increased circulating levels of plasma BCAA alone. Insulin's suppressive effect on proteolysis is observed independently of the levels of circulating plasma BCAA. Copyright © 2016 the American Physiological Society.
Everman, Sarah; Meyer, Christian; Tran, Lee; Hoffman, Nyssa; Carroll, Chad C.; Dedmon, William L.
2016-01-01
Insulin stimulates muscle protein synthesis when the levels of total amino acids, or at least the essential amino acids, are at or above their postabsorptive concentrations. Among the essential amino acids, branched-chain amino acids (BCAA) have the primary role in stimulating muscle protein synthesis and are commonly sought alone to stimulate muscle protein synthesis in humans. Fourteen healthy young subjects were studied before and after insulin infusion to examine whether insulin stimulates muscle protein synthesis in relation to the availability of BCAA alone. One half of the subjects were studied in the presence of postabsorptive BCAA concentrations (control) and the other half in the presence of increased plasma BCAA (BCAA). Compared with that prior to the initiation of the insulin infusion, fractional synthesis rate of muscle protein (%/h) did not change (P > 0.05) during insulin in either the control (0.04 ± 0.01 vs 0.05 ± 0.01) or the BCAA (0.05 ± 0.02 vs. 0.05 ± 0.01) experiments. Insulin decreased (P < 0.01) whole body phenylalanine rate of appearance (μmol·kg−1·min−1), indicating suppression of muscle proteolysis, in both the control (1.02 ± 0.04 vs 0.76 ± 0.04) and the BCAA (0.89 ± 0.07 vs 0.61 ± 0.03) experiments, but the change was not different between the two experiments (P > 0.05). In conclusion, insulin does not stimulate muscle protein synthesis in the presence of increased circulating levels of plasma BCAA alone. Insulin's suppressive effect on proteolysis is observed independently of the levels of circulating plasma BCAA. PMID:27530230
Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo
2015-01-01
We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.
Phosphatidic Acid Synthesis in Bacteria
Yao, Jiangwei; Rock, Charles O.
2012-01-01
Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714
Myrtle, J D; Beekman, A M; Barrow, R A
2016-09-21
A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1).
Batistela, Emanuele; Pereira, Mayara Peron; Siqueira, Juliany Torres; Paula-Gomes, Silvia; Zanon, Neusa Maria; Oliveira, Eduardo Brandt; Navegantes, Luiz Carlos Carvalho; Kettelhut, Isis C; Andrade, Claudia Marlise Balbinotti; Kawashita, Nair Honda; Baviera, Amanda Martins
2014-06-01
The aim of this study was to investigate the changes in the rates of both protein synthesis and breakdown, and the activation of intracellular effectors that control these processes in soleus muscles from growing rats fed a low-protein, high-carbohydrate (LPHC) diet for 15 days. The mass and the protein content, as well as the rate of protein synthesis, were decreased in the soleus from LPHC-fed rats. The availability of amino acids was diminished, since the levels of various essential amino acids were decreased in the plasma of LPHC-fed rats. Overall rate of proteolysis was also decreased, explained by reductions in the mRNA levels of atrogin-1 and MuRF-1, ubiquitin conjugates, proteasome activity, and in the activity of caspase-3. Soleus muscles from LPHC-fed rats showed increased insulin sensitivity, with increased levels of insulin receptor and phosphorylation levels of AKT, which probably explains the inhibition of both the caspase-3 activity and the ubiquitin-proteasome system. The fall of muscle proteolysis seems to represent an adaptive response that contributes to spare proteins in a condition of diminished availability of dietary amino acids. Furthermore, the decreased rate of protein synthesis may be the driving factor to the lower muscle mass gain in growing rats fed the LPHC diet.
Duodenal prostaglandin synthesis and acid load in health and in duodenal ulcer disease
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahlquist, D.A.; Dozois, R.R.; Zinsmeister, A.R.
1983-09-01
We sought to test the hypothesis that duodenal ulcer disease results from an imbalance between duodenal acid load, an injurious force, and mucosal prostaglandin generation, a protective factor. Ten patients with duodenal ulcer and 8 healthy controls were studied. The duodenal acid load after an amino acid soup was quantified by a double-marker technique. Mucosal biopsy specimens were taken endoscopically from the duodenal bulb before and after the test meal. Prostaglandin synthesis activity was measured by incubating biopsy homogenates in excess (/sup 14/C)arachidonic acid. Although mean duodenal acid load was higher in duodenal ulcer, ranges overlapped. Neither the qualitative normore » quantitative profile of mucosal prostaglandin synthesis activities differed significantly between test groups. Prostaglandin synthesis activities, however, tended to increase post cibum in controls, but change little or decrease in duodenal ulcer. Only by comparing the responses with a meal of both parameters together (duodenal acid load and the change in prostaglandin synthesis activities) was there complete or nearly complete separation of duodenal ulcer from controls. Greatest discrimination was observed with prostacyclin (6-keto-PGF1 alpha). We conclude that in health, mucosal prostaglandin generation in the duodenum is induced post cibum in relation to duodenal acid load; this may be a physiologic example of adaptive cytoprotection. In duodenal ulcer there may be a defect in such a mechanism.« less
Ishak, Nurazwa; Lajis, Ahmad Firdaus B; Mohamad, Rosfarizan; Ariff, Arbakariya B; Mohamed, Mohd Shamzi; Halim, Murni; Wasoh, Helmi
2018-02-24
The synthesis of kojic acid derivative (KAD) from kojic and palmitic acid (C16:0) in the presence of immobilized lipase from Rhizomucor miehei (commercially known as Lipozyme RMIM), was studied using a shake flask system. Kojic acid is a polyfunctional heterocycles that acts as a source of nucleophile in this reaction allowing the formation of a lipophilic KAD. In this study, the source of biocatalyst, Lipozyme RMIM, was derived from the lipase of Rhizomucor miehei immobilized on weak anion exchange macro-porous Duolite ES 562 by the adsorption technique. The effects of solvents, enzyme loading, reaction temperature, and substrate molar ratio on the reaction rate were investigated. In one-factor-at-a-time (OFAT) experiments, a high reaction rate (30.6 × 10 -3 M·min -1 ) of KAD synthesis was recorded using acetone, enzyme loading of 1.25% ( w / v ), reaction time of 12 h, temperature of 50 °C and substrate molar ratio of 5:1. Thereafter, a yield of KAD synthesis was optimized via the response surface methodology (RSM) whereby the optimized molar ratio (fatty acid: kojic acid), enzyme loading, reaction temperature and reaction time were 6.74, 1.97% ( w / v ), 45.9 °C, and 20 h respectively, giving a high yield of KAD (64.47%). This condition was reevaluated in a 0.5 L stirred tank reactor (STR) where the agitation effects of two impellers; Rushton turbine (RT) and pitch-blade turbine (PBT), were investigated. In the STR, a very high yield of KAD synthesis (84.12%) was achieved using RT at 250 rpm, which was higher than the shake flask, thus indicating better mixing quality in STR. In a rheological study, a pseudoplastic behavior of KAD mixture was proposed for potential application in lotion formulation.
Fukuda, N; Ontko, J A
1984-08-01
In a series of experiments with male rat livers perfused with or without 5-tetradecyloxy-2-furoic acid (TOFA) in the presence and absence of oleate, the relationships between fatty acid synthesis, oxidation, and esterification from newly synthesized and exogenous fatty acid substrates have been examined. When livers from fed rats were perfused without exogenous fatty acid substrate, 20% of the triglyceride secreted was derived from de novo fatty acid synthesis. Addition of TOFA caused immediate and nearly complete inhibition of fatty acid synthesis, measured by incorporation of 3H2O into fatty acids. Concurrently, ketone body production increased 140% and triglyceride secretion decreased 84%. These marked reciprocal alterations in fatty acid synthesis and oxidation in the liver almost completely abolished the production of very low density lipoproteins (VLDL). Cholesterol synthesis was also depressed by TOFA, suggesting that this drug also inhibited lipid synthesis at a site other than acetyl-CoA carboxylase. When livers from fed rats were supplied with a continuous infusion of [1-14C]oleate as exogenous substrate, similar proportions, about 45-47%, of both ketone bodies and triglyceride in the perfusate were derived from the infused [1-14C]oleate. The production of ketone bodies was markedly increased by TOFA; the secretion of triglyceride and cholesterol were decreased. Altered conversion of [1-14C]oleate into these products occurred in parallel. While TOFA decreased esterification of oleate into triglyceride, incorporation of [1-14C]oleate into liver phospholipid was increased, indicating that TOFA also affected glycerolipid synthesis at the stage of diglyceride processing. The decreased secretion of triglyceride and cholesterol following TOFA treatment was localized almost exclusively in VLDL. The specific activities of 3H and of 14C fatty acids in triglyceride of the perfusate were greater than those of liver triglyceride, indicating preferential secretion of
By-products of electrochemical synthesis of suberic acid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.
By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.
Fatty acid synthesis in Escherichia coli
Knivett, V. A.; Cullen, Julia
1967-01-01
1. Fatty acid formation by cells of a strain of Escherichia coli has been studied in the exponential, post-exponential and stationary phases of growth. 2. During the exponential phase of growth, the metabolic quotient (mμmoles of fatty acid synthesized/mg. dry wt. of cells/hr.) for each fatty acid in the extractable lipid was constant. 3. The newly synthesized fatty acid mixtures produced during this phase contained hexadecanoic acid (41%), hexadecenoic acid (31%), octadecenoic acid (21%) and the C17-cyclopropane acid, methylenehexadecanoic acid (4%). 4. As the proportion of newly synthesized material increased, changes in the fatty acid composition of the cells during this period were towards this constant composition. 5. Abrupt changes in fatty acid synthesis occurred when exponential growth ceased. 6. In media in which glycerol, or SO42− or Mg2+, was growth-limiting there was a small accumulation of C17-cyclopropane acid in cells growing in the post-exponential phase of growth. 7. Where either NH4+ or PO43− was growth-limiting and there were adequate supplies of glycerol, Mg2+ and SO42−, there was a marked accumulation of C17-cyclopropane acid and C19-cyclopropane acid appeared. 8. Under appropriate conditions the metabolic quotient for C17-cyclopropane acid increased up to sevenfold at the end of exponential growth. Simultaneously the metabolic quotients of the other acids fell. 9. A mixture of glycerol, Mg2+ and SO42− stimulated cyclopropane acid formation in resting cells. PMID:5340364
Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R
2014-07-01
The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.
Synthesis of guanidinoacetate and creatine from amino acids by rat pancreas.
da Silva, Robin P; Clow, Kathy; Brosnan, John T; Brosnan, Margaret E
2014-02-01
Creatine is an important molecule involved in cellular energy metabolism. Creatine is spontaneously converted to creatinine at a rate of 1·7% per d; creatinine is lost in the urine. Creatine can be obtained from the diet or synthesised from endogenous amino acids via the enzymes arginine:glycine amidinotransferase (AGAT) and guanidinoacetate N-methyltransferase (GAMT). The liver has high GAMT activity and the kidney has high AGAT activity. Although the pancreas has both AGAT and GAMT activities, its possible role in creatine synthesis has not been characterised. In the present study, we examined the enzymes involved in creatine synthesis in the pancreas as well as the synthesis of guanidinoacetate (GAA) and creatine by isolated pancreatic acini. We found significant AGAT activity and somewhat lower GAMT activity in the pancreas and that pancreatic acini had measurable activities of both AGAT and GAMT and the capacity to synthesise GAA and creatine from amino acids. Creatine supplementation led to a decrease in AGAT activity in the pancreas, though it did not affect its mRNA or protein abundance. This was in contrast with the reduction of AGAT activity and mRNA and protein abundance in the kidney, suggesting that the regulatory mechanisms that control the expression of this enzyme in the pancreas are different from those in the kidney. Dietary creatine increased the concentrations of GAA, creatine and phosphocreatine in the pancreas. Unexpectedly, creatine supplementation decreased the concentrations of S-adenosylmethionine, while those of S-adenosylhomocysteine were not altered significantly.
Inhibition of rotavirus replication by downregulation of fatty acid synthesis.
Gaunt, Eleanor R; Cheung, Winsome; Richards, James E; Lever, Andrew; Desselberger, Ulrich
2013-06-01
Recently the recruitment of lipid droplets (LDs) to sites of rotavirus (RV) replication was reported. LDs are polymorphic organelles that store triacylglycerols, cholesterol and cholesterol esters. The neutral fats are derived from palmitoyl-CoA, synthesized via the fatty acid biosynthetic pathway. RV-infected cells were treated with chemical inhibitors of the fatty acid biosynthetic pathway, and the effects on viral replication kinetics were assessed. Treatment with compound C75, an inhibitor of the fatty acid synthase enzyme complex (FASN), reduced RV infectivity 3.2-fold (P = 0.07) and modestly reduced viral RNA synthesis (1.2-fold). Acting earlier in the fatty acid synthesis pathway, TOFA [5-(Tetradecyloxy)-2-furoic acid] inhibits the enzyme acetyl-CoA carboxylase 1 (ACC1). TOFA reduced the infectivity of progeny RV 31-fold and viral RNA production 6-fold. The effect of TOFA on RV infectivity and RNA replication was dose-dependent, and infectivity was reduced by administering TOFA up to 4 h post-infection. Co-treatment of RV-infected cells with C75 and TOFA synergistically reduced viral infectivity. Knockdown by siRNA of FASN and ACC1 produced findings similar to those observed by inhibiting these proteins with the chemical compounds. Inhibition of fatty acid synthesis using a range of approaches uniformly had a more marked impact on viral infectivity than on viral RNA yield, inferring a role for LDs in virus assembly and/or egress. Specific inhibitors of fatty acid metabolism may help pinpoint the critical structural and biochemical features of LDs that are essential for RV replication, and facilitate the development of antiviral therapies.
Effect of synthesis parameters on polymethacrylic acid xerogel structures and equilibrium swelling
NASA Astrophysics Data System (ADS)
Panić, V.; Jovanović, J.; Adnadjević, B.; Velicković, S.
2009-09-01
Hydrogels based on crosslinked polymethacrylic acid were synthesized via free-radical polymerization in aqueous solution, using N,N'-methylene bisacrylamide as a crosslinking agent and 2,2'-azobis-[2-(2-imidazolin-2-yl)propane] dihydrochloride as an initiator. The influence of the reaction parameters (the neutralization degree of methacrylic acid and the initial monomer concentration) on the equilibrium swelling degree, the swelling kinetic parameters and the basic structural properties of xerogels was investigated. The change of synthesis parameters leads to the change of the basic structural parameters of xerogel, as well as the equilibrium swelling degree and the initial swelling rate of the hydrogels. It is found that there are power form relationships between the equilibrium swelling degree, the initial swelling rate and the structural xerogel’s properties and the change of the neutralization degree of monomer, i.e. the monomer concentration. The examined correlations proved that the crosslinking density is the crucial parameter which determines all the other investigated structural and swelling parameters.
Gorissen, Stefan Hm; Horstman, Astrid Mh; Franssen, Rinske; Crombag, Julie Jr; Langer, Henning; Bierau, Jörgen; Respondek, Frederique; van Loon, Luc Jc
2016-09-01
Muscle mass maintenance is largely regulated by basal muscle protein synthesis and the capacity to stimulate muscle protein synthesis after food intake. The postprandial muscle protein synthetic response is modulated by the amount, source, and type of protein consumed. It has been suggested that plant-based proteins are less potent in stimulating postprandial muscle protein synthesis than animal-derived proteins. However, few data support this contention. We aimed to assess postprandial plasma amino acid concentrations and muscle protein synthesis rates after the ingestion of a substantial 35-g bolus of wheat protein hydrolysate compared with casein and whey protein. Sixty healthy older men [mean ± SEM age: 71 ± 1 y; body mass index (in kg/m(2)): 25.3 ± 0.3] received a primed continuous infusion of l-[ring-(13)C6]-phenylalanine and ingested 35 g wheat protein (n = 12), 35 g wheat protein hydrolysate (WPH-35; n = 12), 35 g micellar casein (MCas-35; n = 12), 35 g whey protein (Whey-35; n = 12), or 60 g wheat protein hydrolysate (WPH-60; n = 12). Plasma and muscle samples were collected at regular intervals. The postprandial increase in plasma essential amino acid concentrations was greater after ingesting Whey-35 (2.23 ± 0.07 mM) than after MCas-35 (1.53 ± 0.08 mM) and WPH-35 (1.50 ± 0.04 mM) (P < 0.01). Myofibrillar protein synthesis rates increased after ingesting MCas-35 (P < 0.01) and were higher after ingesting MCas-35 (0.050% ± 0.005%/h) than after WPH-35 (0.032% ± 0.004%/h) (P = 0.03). The postprandial increase in plasma leucine concentrations was greater after ingesting Whey-35 than after WPH-60 (peak value: 580 ± 18 compared with 378 ± 10 μM, respectively; P < 0.01), despite similar leucine contents (4.4 g leucine). Nevertheless, the ingestion of WPH-60 increased myofibrillar protein synthesis rates above basal rates (0.049% ± 0.007%/h; P = 0.02). The myofibrillar protein synthetic response to the ingestion of 35 g casein is greater than after an
Synthesis and characterization of an anomeric sulfur analogue of CMP-sialic acid.
Cohen, S B; Halcomb, R L
2000-09-22
alpha-2,3-Sialyltransferase catalyzes the transfer of sialic acid from CMP-sialic acid (1) to a lactose acceptor. An analogue of 1 was synthesized in which the anomeric oxygen atom was replaced with a sulfur atom (1S). The key step in the synthesis of 1S was a tetrazole-promoted coupling of a cytidine-5'-phosphoramidite with a glycosyl thiol of a protected sialic acid. Compounds 1 and 1S were characterized for their activity in a sialyl transfer assay. The rate of solvolysis in aqueous buffer of analogue 1S was 50-fold slower than that of 1. Analogue 1S was found to be substrate for alpha-2,3-sialyltransferase. The K(m) of 1S was just 3-fold higher than that of 1, while the k(cat) of 1S was 2 orders of magnitude lower compared to 1.
Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.
Dacquin, J P; Lee, A F; Pirez, C; Wilson, K
2012-01-07
Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. This journal is © The Royal Society of Chemistry 2012
NASA Astrophysics Data System (ADS)
Botta, Lorenzo; Mattia Bizzarri, Bruno; Piccinino, Davide; Fornaro, Teresa; Robert Brucato, John; Saladino, Raffaele
2017-07-01
The photochemical transformation of formamide in the presence of a mixture of TiO2 and ZnO metal oxides as catalysts afforded a large panel of molecules of biological relevance, including carboxylic acids, amino acids and nucleic acid bases. The reaction was less effective when performed in the presence of only one mineral, highlighting the role of synergic effects between the photoactive catalysts. Taken together, these results suggest that the synthesis of chemical precursors for both the genetic and the metabolic apparatuses might have occurred in a simple environment, consisting of formamide, photoactive metal oxides and UV-radiation.
Lindner, Scott E.; Sartain, Mark J.; Hayes, Kiera; Harupa, Anke; Moritz, Robert L.; Kappe, Stefan H. I.; Vaughan, Ashley M.
2014-01-01
SUMMARY Malaria parasites scavenge nutrients from their host but also harbor enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbor genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic synthesis. Our research shows that apicoplast-targeted P. yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver stage development and deletion of the encoding genes resulted in late liver stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite lifecycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver stage maturation. PMID:24330260
Factors influencing the rate of non-enzymatic activation of carboxylic and amino acids by ATP
NASA Technical Reports Server (NTRS)
Mullins, D. W., Jr.; Lacey, J. C., Jr.
1981-01-01
The nonenzymatic formation of adenylate anhydrides of carboxylic and amino acids is discussed as a necessary step in the origin of the genetic code and protein biosynthesis. Results of studies are presented which have shown the rate of activation to depend on the pKa of the carboxyl group, the pH of the medium, temperature, the divalent metal ion catalyst, salt concentration, and the nature of the amino acid. In particular, it was found that of the various amino acids investigated, phenylalanine had the greatest affinity for the adenine derivatives adenosine and ATP. Results thus indicate that selective affinities between amino acids and nucleotides were important during prebiotic chemical evolution, and may have played a major role in the origin of protein synthesis and genetic coding.
Lindner, Scott E; Sartain, Mark J; Hayes, Kiera; Harupa, Anke; Moritz, Robert L; Kappe, Stefan H I; Vaughan, Ashley M
2014-02-01
Malaria parasites scavenge nutrients from their host but also harbour enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver-stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbour genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic acid synthesis. Our research shows that apicoplast-targeted Plasmodium yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver-stage development and deletion of the encoding genes resulted in late liver-stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite life cycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver-stage maturation. © 2013 John Wiley & Sons Ltd.
Synthesis of new Cα-tetrasubstituted α-amino acids
Grauer, Andreas A
2009-01-01
Summary Cα-Tetrasubstituted α-amino acids are important building blocks for the synthesis of peptidemimetics with stabilized secondary structure, because of their ability to rigidify the peptide backbone. Recently our group reported a new class of cyclic Cα-tetrasubstituted tetrahydrofuran α-amino acids prepared from methionine and aromatic aldehydes. We now report the extension of this methodology to aliphatic aldehydes. Although such aldehydes are prone to give aldol products under the reaction conditions used, we were able to obtain the target cyclic amino acids in low to moderate yields and in some cases with good diastereoselectivity. PMID:19259341
ERIC Educational Resources Information Center
Barrelle, M.; And Others
1983-01-01
Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)
Synthesis of Amino Acid Precursors with Organic Solids in Planetesimals with Liquid Water
NASA Technical Reports Server (NTRS)
Kebukawa, Y; Misawa, S.; Matsukuma, J.; Chan, Q. H. S.; Kobayashi, J.; Tachibana, S.; Zolensky, M. E.
2017-01-01
Amino acids are important ingredients of life that would have been delivered to Earth by extraterrestrial sources, e.g., comets and meteorites. Amino acids are found in aqueously altered carbonaceous chondrites in good part in the form of precursors that release amino acids after acid hydrolysis. Meanwhile, most of the organic carbon (greater than 70 weight %) in carbonaceous chondrites exists in the form of solvent insoluble organic matter (IOM) with complex macromolecular structures. Complex macromolecular organic matter can be produced by either photolysis of interstellar ices or aqueous chemistry in planetesimals. We focused on the synthesis of amino acids during aqueous alteration, and demonstrated one-pot synthesis of a complex suite of amino acids simultaneously with IOM via hydrothermal experiments simulating the aqueous processing
Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam
2015-01-01
Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623
Synthesis of novel acid electrolytes for phosphoric acid fuel cells
NASA Astrophysics Data System (ADS)
Adcock, James L.
1988-11-01
A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.
Crown, Scott B; Marze, Nicholas; Antoniewicz, Maciek R
2015-01-01
The branched chain amino acids (BCAA) valine, leucine and isoleucine have been implicated in a number of diseases including obesity, insulin resistance, and type 2 diabetes mellitus, although the mechanisms are still poorly understood. Adipose tissue plays an important role in BCAA homeostasis by actively metabolizing circulating BCAA. In this work, we have investigated the link between BCAA catabolism and fatty acid synthesis in 3T3-L1 adipocytes using parallel 13C-labeling experiments, mass spectrometry and model-based isotopomer data analysis. Specifically, we performed parallel labeling experiments with four fully 13C-labeled tracers, [U-13C]valine, [U-13C]leucine, [U-13C]isoleucine and [U-13C]glutamine. We measured mass isotopomer distributions of fatty acids and intracellular metabolites by GC-MS and analyzed the data using the isotopomer spectral analysis (ISA) framework. We demonstrate that 3T3-L1 adipocytes accumulate significant amounts of even chain length (C14:0, C16:0 and C18:0) and odd chain length (C15:0 and C17:0) fatty acids under standard cell culture conditions. Using a novel GC-MS method, we demonstrate that propionyl-CoA acts as the primer on fatty acid synthase for the production of odd chain fatty acids. BCAA contributed significantly to the production of all fatty acids. Leucine and isoleucine contributed at least 25% to lipogenic acetyl-CoA pool, and valine and isoleucine contributed 100% to lipogenic propionyl-CoA pool. Our results further suggest that low activity of methylmalonyl-CoA mutase and mass action kinetics of propionyl-CoA on fatty acid synthase result in high rates of odd chain fatty acid synthesis in 3T3-L1 cells. Overall, this work provides important new insights into the connection between BCAA catabolism and fatty acid synthesis in adipocytes and underscores the high capacity of adipocytes for metabolizing BCAA.
Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L. Ashley; Lopes-Virella, Maria F.
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages. PMID:29474492
Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L Ashley; Lopes-Virella, Maria F; Huang, Yan
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages.
Holm, Lars; Haslund, Mads Lyhne; Robach, Paul; van Hall, Gerrit; Calbet, Jose A. L.; Saltin, Bengt; Lundby, Carsten
2010-01-01
As a consequence to hypobaric hypoxic exposure skeletal muscle atrophy is often reported. The underlying mechanism has been suggested to involve a decrease in protein synthesis in order to conserve O2. With the aim to challenge this hypothesis, we applied a primed, constant infusion of 1-13C-leucine in nine healthy male subjects at sea level and subsequently at high-altitude (4559 m) after 7–9 days of acclimatization. Physical activity levels and food and energy intake were controlled prior to the two experimental conditions with the aim to standardize these confounding factors. Blood samples and expired breath samples were collected hourly during the 4 hour trial and vastus lateralis muscle biopsies obtained at 1 and 4 hours after tracer priming in the overnight fasted state. Myofibrillar protein synthesis rate was doubled; 0.041±0.018 at sea-level to 0.080±0.018%⋅hr−1 (p<0.05) when acclimatized to high altitude. The sarcoplasmic protein synthesis rate was in contrast unaffected by altitude exposure; 0.052±0.019 at sea-level to 0.059±0.010%⋅hr−1 (p>0.05). Trends to increments in whole body protein kinetics were seen: Degradation rate elevated from 2.51±0.21 at sea level to 2.73±0.13 µmol⋅kg−1⋅min−1 (p = 0.05) at high altitude and synthesis rate similar; 2.24±0.20 at sea level and 2.43±0.13 µmol⋅kg−1⋅min−1 (p>0.05) at altitude. We conclude that whole body amino acid flux is increased due to an elevated protein turnover rate. Resting skeletal muscle myocontractile protein synthesis rate was concomitantly elevated by high-altitude induced hypoxia, whereas the sarcoplasmic protein synthesis rate was unaffected by hypoxia. These changed responses may lead to divergent adaptation over the course of prolonged exposure. PMID:21187972
McCune, S A; Durant, P J; Jenkins, P A; Harris, R A
1981-12-01
Hepatocytes isolated from genetically obese female Zucker rats and lean female Zucker rats were compared. Hepatocytes from fed obese rats exhibited greater rates of fatty acid synthesis, more extensive accumulation of lactate and pyruvate from their glycogen stores, increased rates of net glucose utilization but produced less ketone bodies from exogenous fatty acids and had lower citrate levels than hepatocytes from lean rats. Lipogenesis was not as sensitive to dibutyryl cyclic AMP (DBcAMP) inhibition in hepatocytes from obese rats but glycogenolysis was stimulated to the same extent by this nucleotide in both preparations. Ketogenesis was less sensitive to stimulation by DBcAMP in hepatocytes from obese rats. A difference in sensitivity of lipogenesis to DBcAMP was not found when lactate plus pyruvate was added to the incubation medium, suggesting that a greater rate of glycolysis by hepatocytes from obese rats accounts for their relative insensitivity to DBcAMP. Citrate levels were elevated by DBcAMP to a greater extent in hepatocytes from obese rats. Hepatocytes prepared from lean rats starved for 48 hr were glycogen depleted and lacked significant capacity for lipogenesis and glycogen synthesis. In contrast, hepatocytes isolated from starved obese rats retained considerable amounts of liver glycogen and exhibited detectable rates of lipogenesis and glycogen synthesis. Hepatocytes prepared from starved lean rats gave faster apparent rates of lactate gluconeogenesis than hepatocytes prepared from starved obese rats. Thus, hepatocytes prepared from obese Zucker rats are more glycogenic, glycolytic, and lipogenic but less ketogenic and glucogenic than hepatocytes prepared from lean rats.
PROTEASOME INHIBITOR TREATMENT REDUCED FATTY ACID, TRIACYLGLYCEROL AND CHOLESTEROL SYNTHESIS
Oliva, Joan; French, Samuel W.; Li, Jun; Bardag-Gorce, Fawzia
2014-01-01
In the present study, the beneficial effects of proteasome inhibitor treatment in reducing ethanol-induced steatosis were investigated. A microarray analysis was performed on the liver of rats injected with PS-341 (Bortezomib, Velcade®), and the results showed that proteasome inhibitor treatment significantly reduced the mRNA expression of SREBP-1c, and the downstream lipogenic enzymes, such as fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC), which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ELOVL6, which is responsible for fatty acids long chain elongation, was also significantly down regulated by proteasome inhibitor treatment. Moreover, PS-341 administration significantly reduced the expression of acyl-glycerol-3-phosphate acyltransferase (AGPAT), and diacylglycerol acyltransferase (DGAT), enzyme involved in triacylglycerol (TAG) synthesis. Finally, PS-341 was found to down regulate the enzymes 3-hydroxy-3-methylglutaryl-CoenzymeA synthase (HMG-CoA synthase) that is responsible for cholesterol synthesis. Proteasome inhibitor was also found to play a role in intestinal lipid adsorption because apolipoproteins A (apoA-I, apoAII, apoA-IV and ApoCIII) were down regulated by proteasome inhibitor treatment, especially ApoA-II that is known to be a marker of alcohol consumption. Proteasome inhibitor treatment also decreased apobec-1 complementation factor (ACF) leading to lower level of editing and production of ApoB protein. Moreover apolipoprotein C-III, a major component of chylomicrons was significantly down regulated. However, lipoprotein lipase (Lpl) and High density lipoprotein binding protein (Hdlbp) mRNA levels were increased by proteasome inhibitor treatment. These results suggested that proteasome inhibitor treatment could be used to reduce the alcohol-enhanced lipogenesis and alcohol-induced liver steatosis. A morphologic analysis, performed on the liver of rats fed ethanol for one
Synthesis and antituberculosis activity of new fatty acid amides.
D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes
2010-09-01
This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains. Copyright 2010 Elsevier Ltd. All rights reserved.
Pulmonary fatty acid synthesis. I. Mitochondrial acetyl transfer by rat lung in vitro.
Evans, R M; Scholz, R W
1977-04-01
Incorporation of tritiated water into fatty acids by rat adipose tissue and lung tissue slices incubated with 5 mM glucose indicated a level of fatty acid synthesis in rat lung approximately 15% that observed in adipose tissue in vitro. (-)-Hydroxycitrate, and inhibitor of ATP citrate lyase, markedly reduced tritiated water incorporation into fatty acids by lung tissue slices. The effects of (-)-hydroxycitrate and n-butymalonate on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate suggested that citrate is a major acetyl carrier for de novo fatty acid synthesis in lung tissue. Alternative mechanisms to citrate as an acetyl carrier were also considered. Lung mitochondrial preparations formed significant levels of acetylcarnitine in the presence of pyruvate and carnitine. However, the effect of carnitine on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate into fatty acids by lung tissue slices indicated that acetylcarnitine may not be a significant acetyl carrier for fatty acid synthesis but may serve as an acetyl "buffer" in the control of mitochondrial acetyl-CoA levels. Additionally, it appears unlikely that either acetylaspartate or acetoacetate are of major importance in acetyl transfer in lung tissue.
Synthesis of the sulfur amino acids: cysteine and methionine.
Wirtz, Markus; Droux, Michel
2005-12-01
This review will assess new features reported for the molecular and biochemical aspects of cysteine and methionine biosynthesis in Arabidopsis thaliana with regards to early published data from other taxa including crop plants and bacteria (Escherichia coli as a model). By contrast to bacteria and fungi, plant cells present a complex organization, in which the sulfur network takes place in multiple sites. Particularly, the impact of sulfur amino-acid biosynthesis compartmentalization will be addressed in respect to localization of sulfur reduction. To this end, the review will focus on regulation of sulfate reduction by synthesis of cysteine through the cysteine synthase complex and the synthesis of methionine and its derivatives. Finally, regulatory aspects of sulfur amino-acid biosynthesis will be explored with regards to interlacing processes such as photosynthesis, carbon and nitrogen assimilation.
Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-01-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326
Peng, Yingyun; Zhang, Tao; Mu, Wanmeng; Miao, Ming; Jiang, Bo
2016-01-15
Bacillus methylotrophicus SK19.001 is a glutamate-independent strain that produces poly(γ-glutamic acid) (γ-PGA), a polymer of D- and L-glutamic acids that possesses applications in food, the environment, agriculture, etc. This study was undertaken to explore the synthetic pathway of intracellular L- and D-glutamic acid in SK19.001 by investigating the effects of tricarboxylic acid cycle intermediates and different amino acids as metabolic precursors on the production of γ-PGA and analyzing the activities of the enzymes involved in the synthesis of L- and D-glutamate. Tricarboxylic acid cycle intermediates and amino acids could participate in the synthesis of γ-PGA via independent pathways in SK19.001. L-Aspartate aminotransferase, L-glutaminase and L-glutamate synthase were the enzymatic sources of L-glutamate. Glutamate racemase was responsible for the formation of D-glutamate for the synthesis of γ-PGA, and the synthetase had stereoselectivity for glutamate substrate. The enzymatic sources of L-glutamate were investigated for the first time in the glutamate-independent γ-PGA-producing strain, and multiple enzymatic sources of L-glutamate were verified in SK19.001, which will benefit efforts to improve production of γ-PGA with metabolic engineering strategies. © 2015 Society of Chemical Industry.
Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.
Hansen, Alexandar L; Behrman, Edward J
2016-08-05
We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. Copyright © 2016 Elsevier Ltd. All rights reserved.
Hu, Q; Agarwal, U; Bequette, B J
2017-02-01
We aimed to quantify the rate of gluconeogenesis (GNG), non-essential amino-acid (NEAA) synthesis, and substrate partitioning to the Krebs cycle in embryonic (e) day e14 and e19 chicken embryos. An in ovo continuous tracer infusion approach was employed to test the hypotheses that GNG and NEAA synthesis in developing chicken embryo increases from e14 to e19. [ 13 C 6 ]Glucose or [ 13 C 3 ]glycerol was continuously infused (8 h) into the chorio-allantoic compartment of eggs on e14 and e19. Glucose entry rate, Cori cycling, and GNG were higher (P < 0.05) in e19 compared to e14 embryos, presumably to support higher glycogen deposition in liver and muscle. Whereas de novo synthesis of alanine, aspartate, and glutamate via glycolysis and the Krebs cycle was higher (P < 0.01) in e14 embryos, synthesis of these NEAA from glycerol was higher (P < 0.05) in e19 compared to e14 embryos. These patterns of glucose and glycerol utilization suggest a metabolic shift to conserve glucose for glycogen synthesis and an increased utilization of yolk glycerol (from triacylglyceride) after e14. Although the contribution of glycerol to GNG in e19 embryos was higher (P < 0.05) than that in e14 embryos, the contribution of glycerol to GNG (1.3 to 6.0%) was minor. Based on [ 13 C 6 ]glucose tracer kinetics, the activities of both pyruvate carboxylase (PC) and pyruvate dehydrogenase (PDH) in the liver were higher (P < 0.05) in e19 embryos; whereas the higher (P < 0.01) relative activity of liver PC compared to PDH in e14 embryos suggests a greater anaplerotic flux into the Krebs cycle. In summary, the in ovo continuous tracer infusion approach allowed for a measurement of chicken embryo whole body and liver metabolism over a shorter window of development. This study provided quantitative estimates of the developmental shifts in substrate utilization, GNG, and NEAA synthesis by chicken embryos, as well as qualitative estimates of the activities of enzymes central to the Krebs cycle
Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.
Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos
2016-08-29
α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed.
Jones, J A; Blecher, M
1966-05-01
The chemical synthesis and characterization of three intermediates in the Beta oxidation of palmitic acid-1-(14)C by rat liver mitochondria, namely, 3-ketohexadecanoic acid-1-(14)C, DL-3-hydroxyhexadecanoic acid-1-(14)C, and trans-2-hexadecenoic acid-1-(14)C, are described.
α-Ketophosphonic Acid Esters — Synthesis, Structure, and Reactions
NASA Astrophysics Data System (ADS)
Zhdanov, Yu A.; Uzlova, L. A.; Glebova, Z. I.
1980-09-01
Studies on the synthesis and properties of α-ketophosphonic acid esters (KPE) — a class of highly reactive organophosphorus compounds — are surveyed. Data are presented concerning instances of the anomalous course of the process in the synthesis of KPE by the Arbuzov reaction. The reactions of KPE with nucleophiles, including those which lead to the rupture of the phosphorus-carbon bond, are examined in detail. The problems of the stereochemistry of KPE are dealt with briefly. The bibliography includes 162 references.
Physiological effects of γ-linolenic acid and sesamin on hepatic fatty acid synthesis and oxidation.
Ide, Takashi; Iwase, Haruka; Amano, Saaya; Sunahara, Saki; Tachihara, Ayuka; Yagi, Minako; Watanabe, Tsuyoshi
2017-03-01
Interrelated effects of γ-linolenic acid (GLA) and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin) and containing 100 g/kg of palm oil (saturated fat), safflower oil rich in linoleic acid, or oil of evening primrose origin containing 43% GLA (GLA oil) for 18 days. In rats fed sesamin-free diets, GLA oil, compared with other oils, increased the activity and mRNA levels of various enzymes involved in fatty acid oxidation, except for some instances. Sesamin greatly increased these parameters, and the enhancing effects of sesamin on peroxisomal fatty acid oxidation rate and acyl-CoA oxidase, enoyl-CoA hydratase and acyl-CoA thioesterase activities were more exaggerated in rats fed GLA oil than in the animals fed other oils. The combination of sesamin and GLA oil also synergistically increased the mRNA levels of some peroxisomal fatty acid oxidation enzymes and of several enzymes involved in fatty acid metabolism located in other cell organelles. In the groups fed sesamin-free diets, GLA oil, compared with other oils, markedly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin reduced all these parameters, except for malic enzyme, in rats fed palm and safflower oils, but the effects were attenuated in the animals fed GLA oil. These changes by sesamin and fat type accompanied profound alterations in serum lipid levels. This may be ascribable to the changes in apolipoprotein-B-containing lipoproteins. Copyright © 2016 Elsevier Inc. All rights reserved.
Synthesis, characterization and reactivity of 3-mercaptopyruvic acid.
Galardon, Erwan; Lec, Jean-Chrstophe
2018-05-20
A synthesis of the sulfur metabolic compound 3-mercaptopyruvic acid (3-MPH) is reported and allowed its isolation and characterization for the first time. Detailed kinetic, thermodynamic and spectroscopic studies of its complex behaviour in solution are discussed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Glass-ionomer cement formulations. II. The synthesis of novel polycarobxylic acids.
Crisp, S; Kent, B E; Lewis, B G; Ferner, A J; Wilson, A D
1980-06-01
The synthesis of many polycarboxylic acids is reported. An account is given of their stability in aqueous solution and the properties of cements formed by their reaction with ion-leachable glasses. A copolymer of acrylic and itaconic acids was found to combine several favorable characteristics.
Synthesis and Hydrolytic Degradation of Substituted Poly(DL-Lactic Acid)s
Tsuji, Hideto; Eto, Takehiko; Sakamoto, Yuzuru
2011-01-01
Non-substituted racemic poly(DL-lactic acid) (PLA) and substituted racemic poly(DL-lactic acid)s or poly(DL-2-hydroxyalkanoic acid)s with different side-chain lengths, i.e., poly(DL-2-hydroxybutanoic acid) (PBA), poly(DL-2-hydroxyhexanoic acid) (PHA), and poly(DL-2-hydroxydecanoic acid) (PDA) were synthesized by acid-catalyzed polycondensation of DL-lactic acid (LA), DL-2-hydroxybutanoic acid (BA), DL-2-hydroxyhexanoic acid (HA), and DL-2-hydroxydecanoic acid (DA), respectively. The hydrolytic degradation behavior was investigated in phosphate-buffered solution at 80 and 37 °C by gravimetry and gel permeation chromatography. It was found that the reactivity of monomers during polycondensation as monitored by the degree of polymerization (DP) decreased in the following order: LA > DA > BA > HA. The hydrolytic degradation rate traced by DP and weight loss at 80 °C decreased in the following order: PLA > PDA > PHA > PBA and that monitored by DP at 37 °C decreased in the following order: PLA > PDA > PBA > PHA. LA and PLA had the highest reactivity during polymerization and hydrolytic degradation rate, respectively, and were followed by DA and PDA. BA, HA, PBA, and PHA had the lowest reactivity during polymerization and hydrolytic degradation rate. The findings of the present study strongly suggest that inter-chain interactions play a major role in the reactivity of non-substituted and substituted LA monomers and degradation rate of the non-substituted and substituted PLA, along with steric hindrance of the side chains as can be expected. PMID:28824149
Metabolism of trans-3-hexadecenoic acid in broad bean.
Harwood, J L; James, A T
1975-01-02
1. Broad bean (Vicia faba) leaves contain rather high concentrations (about 4% of total fatty acids) of the trans-3-hexadecenoic acid. 2. Amounts of the acid increase with the age of the leaves and are absent from etiolated tissue. 3. Changes in the levels of trans-delta-4-hexadecenoic acid can be produced by subjecting the intact plants to various light/dark periods. 4. Chloroplasts isolated from broad-bean leaves show high rates of fatty acid synthesis from [1-14C]acetate. Synthesis is dependent on coenzyme A and ATP but is insensitive to the addition of exogenous acyl carrier protein. 5. The pattern of acids made includes about 20% palmitic, 5% hexadeconoic, 10% stearic and 60% oleic. trans-3-Hexadecenoic acid synthesis was most active in chloroplasts from plants exposed to the dark for 5 days and light for 3 days. 6. Arsenite addition inhibited stearate formation by isolated chloroplasts but resulted in a two-fold stimulation of overall synthesis. 7. The rate of fatty acid synthesis by isolated chloroplasts paralleled the changes in endogenous trans-3-hexadecenoic acid levels in the leaves from which they were isolated.
Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.
Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide
2012-05-18
A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.
Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid
Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A.; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A.
2017-01-01
mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein–12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. PMID:28223357
Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid.
Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A
2017-04-14
mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein-12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G 1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Synthesis and characterization of bis-thiourea having amino acid derivatives
NASA Astrophysics Data System (ADS)
Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah
2016-11-01
In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.
Berini, Christophe; Pelloux-Léon, Nadia; Minassian, Frédéric; Denis, Jean-Noël
2009-11-07
The stereoselective synthesis of penmacric acid, an optically active C-4 substituted pyroglutamic acid, has been efficiently achieved through an unusual 11-step sequence starting from simple N-triisopropylsilylpyrrole. The key-steps are the initial addition of the pyrrole nucleus onto a chiral nitrone and the obtention of the pyroglutamic acid moiety by reductive hydrogenation of the pyrrole followed by oxidation of the corresponding pyrrolidine into pyrrolidinone.
USDA-ARS?s Scientific Manuscript database
The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...
Chemoselective synthesis of sialic acid 1,7-lactones.
Allevi, Pietro; Rota, Paola; Scaringi, Raffaella; Colombo, Raffaele; Anastasia, Mario
2010-08-20
The chemoselective synthesis of the 1,7-lactones of N-acetylneuraminic acid, N-glycolylneuraminic acid, and 3-deoxy-d-glycero-d-galacto-nononic acid is accomplished in two steps: a simple treatment of the corresponding free sialic acid with benzyloxycarbonyl chloride and a successive hydrogenolysis of the formed 2-benzyloxycarbonyl 1,7-lactone. The instability of the 1,7-lactones to protic solvents has been also evidenced together with the rationalization of the mechanism of their formation under acylation conditions. The results permit to dispose of authentic 1,7-sialolactones to be used as reference standards and of a procedure useful for the preparation of their isotopologues to be used as inner standards in improved analytical procedures for the gas liquid chromatography-mass spectrometry (GLC-MS) analysis of 1,7-sialolactones in biological media.
Liu, Shaoyu; Sun, Aixia; Zhang, Zhanwen; Tang, Xiaolan; Nie, Dahong; Ma, Hui; Jiang, Shende; Tang, Ganghua
2017-06-15
N-(2-[ 18 F]Fluoropropionyl)-l-glutamic acid ([ 18 F]FPGLU) is a potential amino acid tracer for tumor imaging with positron emission tomography. However, due to the complicated multistep synthesis, the routine production of [ 18 F]FPGLU presents many challenging laboratory requirements. To simplify the synthesis process of this interesting radiopharmaceutical, an efficient automated synthesis of [ 18 F]FPGLU was performed on a modified commercial fluorodeoxyglucose synthesizer via a 2-step on-column hydrolysis procedure, including 18 F-fluorination and on-column hydrolysis reaction. [ 18 F]FPGLU was synthesized in 12 ± 2% (n = 10, uncorrected) radiochemical yield based on [ 18 F]fluoride using the tosylated precursor 2. The radiochemical purity was ≥98%, and the overall synthesis time was 35 minutes. To further optimize the radiosynthesis conditions of [ 18 F]FPGLU, a brominated precursor 3 was also used for the preparation of [ 18 F]FPGLU, and the improved radiochemical yield was up to 20 ± 3% (n = 10, uncorrected) in 35 minutes. Moreover, all these results were achieved using the similar on-column hydrolysis procedure on the modified fluorodeoxyglucose synthesis module. Copyright © 2017 John Wiley & Sons, Ltd.
Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis.
Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki; Dever, Thomas E
2017-08-21
Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
Synthesis of Triamino Acid Building Blocks with Different Lipophilicities
Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger
2015-01-01
To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040
Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment
NASA Technical Reports Server (NTRS)
Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.
2011-01-01
Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.
NASA Astrophysics Data System (ADS)
Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng
2014-03-01
MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lake, April D.; Novak, Petr; Shipkova, Petia
2013-04-15
Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BAmore » profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile
Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams
2016-01-01
Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817
Thyroid hormone reduces PCSK9 and stimulates bile acid synthesis in humans[S
Bonde, Ylva; Breuer, Olof; Lütjohann, Dieter; Sjöberg, Stefan; Angelin, Bo; Rudling, Mats
2014-01-01
Reduced plasma LDL-cholesterol is a hallmark of hyperthyroidism and is caused by transcriptional stimulation of LDL receptors in the liver. Here, we investigated whether thyroid hormone (TH) actions involve other mechanisms that may also account for the reduction in LDL-cholesterol, including effects on proprotein convertase subtilisin/kexin type 9 (PCSK9) and bile acid synthesis. Twenty hyperthyroid patients were studied before and after clinical normalization, and the responses to hyperthyroidism were compared with those in 14 healthy individuals after 14 days of treatment with the liver-selective TH analog eprotirome. Both hyperthyroidism and eprotirome treatment reduced circulating PCSK9, lipoprotein cholesterol, apoB and AI, and lipoprotein(a), while cholesterol synthesis was stable. Hyperthyroidism, but not eprotirome treatment, markedly increased bile acid synthesis and reduced fibroblast growth factor (FGF) 19 and dietary cholesterol absorption. Eprotirome treatment, but not hyperthyroidism, reduced plasma triglycerides. Neither hyperthyroidism nor eprotirome treatment altered insulin, glucose, or FGF21 levels. TH reduces circulating PSCK9, thereby likely contributing to lower plasma LDL-cholesterol in hyperthyroidism. TH also stimulates bile acid synthesis, although this response is not critical for its LDL-lowering effect. PMID:25172631
Mitochondrial fatty acid synthesis, fatty acids and mitochondrial physiology.
Kastaniotis, Alexander J; Autio, Kaija J; Kerätär, Juha M; Monteuuis, Geoffray; Mäkelä, Anne M; Nair, Remya R; Pietikäinen, Laura P; Shvetsova, Antonina; Chen, Zhijun; Hiltunen, J Kalervo
2017-01-01
Mitochondria and fatty acids are tightly connected to a multiplicity of cellular processes that go far beyond mitochondrial fatty acid metabolism. In line with this view, there is hardly any common metabolic disorder that is not associated with disturbed mitochondrial lipid handling. Among other aspects of mitochondrial lipid metabolism, apparently all eukaryotes are capable of carrying out de novo fatty acid synthesis (FAS) in this cellular compartment in an acyl carrier protein (ACP)-dependent manner. The dual localization of FAS in eukaryotic cells raises the questions why eukaryotes have maintained the FAS in mitochondria in addition to the "classic" cytoplasmic FAS and what the products are that cannot be substituted by delivery of fatty acids of extramitochondrial origin. The current evidence indicates that mitochondrial FAS is essential for cellular respiration and mitochondrial biogenesis. Although both β-oxidation and FAS utilize thioester chemistry, CoA acts as acyl-group carrier in the breakdown pathway whereas ACP assumes this role in the synthetic direction. This arrangement metabolically separates these two pathways running towards opposite directions and prevents futile cycling. A role of this pathway in mitochondrial metabolic sensing has recently been proposed. This article is part of a Special Issue entitled: Lipids of Mitochondria edited by Guenther Daum. Copyright © 2016 Elsevier B.V. All rights reserved.
Tujioka, Kazuyo; Lyou, Sunok; Sano, Atushi; Hayase, Kazutoshi; Yokogoshi, Hidehiko
2004-10-01
The purpose of present study was to determine whether the regulation of urea synthesis is mediated through changes in supply of amino acids by protein synthesis and whether the concentration of ammonia, or activities of amino acid catabolizing enzymes, regulate urea synthesis when the dietary protein quality is manipulated. Experiments were done on three groups of rats given diets containing 10 g gluten, 10 g casein or 10 g whole egg protein/100 g for 10 d. The urinary excretion of urea, and the liver concentrations of glutamate, serine and alanine increased with a decrease in quality of dietary protein. The fractional and absolute rates of protein synthesis in tissues declined with the decrease in quality of dietary protein quality. The ammonia concentration in plasma and liver, and activities of hepatic amino acid catabolizing enzymes was not related to urea excretion under these conditions. These results suggest that the lower protein synthesis seen in tissues of rats given the lower quality of protein is likely to be one of the factors to increasing the supply of amino acids and stimulating urea synthesis.
Calcite crystal growth rate inhibition by polycarboxylic acids
Reddy, M.M.; Hoch, A.R.
2001-01-01
Calcite crystal growth rates measured in the presence of several polycarboxyclic acids show that tetrahydrofurantetracarboxylic acid (THFTCA) and cyclopentanetetracarboxylic acid (CPTCA) are effective growth rate inhibitors at low solution concentrations (0.01 to 1 mg/L). In contrast, linear polycarbocylic acids (citric acid and tricarballylic acid) had no inhibiting effect on calcite growth rates at concentrations up to 10 mg/L. Calcite crystal growth rate inhibition by cyclic polycarboxyclic acids appears to involve blockage of crystal growth sites on the mineral surface by several carboxylate groups. Growth morphology varied for growth in the absence and in the presence of both THFTCA and CPTCA. More effective growth rate reduction by CPTCA relative to THFTCA suggests that inhibitor carboxylate stereochemical orientation controls calcite surface interaction with carboxylate inhibitors. ?? 20O1 Academic Press.
Synthesis of Rosin Acid Starch Catalyzed by Lipase
Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin
2014-01-01
Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156
Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis
Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki
2017-01-01
Abstract Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. PMID:28637321
Control of the Protein Turnover Rates in Lemna minor
Trewavas, A.
1972-01-01
The control of protein turnover in Lemna minor has been examined using a method described in the previous paper for determining the rate constants of synthesis and degradation of protein. If Lemna is placed on water, there is a reduction in the rate constants of synthesis of protein and an increase (3- to 6-fold) in the rate constant of degradation. The net effect is a loss of protein from the tissue. Omission of nitrate, phosphate, sulfate, magnesium, or calcium results in increases in the rate constant of degradation of protein. An unusual dual effect of benzyladenine on the turnover constants has been observed. Treatment of Lemna grown on sucrose-mineral salts with benzyladenine results in alterations only in the rate constant of synthesis. Treatment of Lemna grown on water with benzyladenine alters only the rate constant of degradation. Abscisic acid on the other hand alters both rate constants of synthesis and degradation of protein together. Inclusion of growth-inhibiting amino acids in the medium results in a reduction in the rate constants of synthesis and increases in the rate constant of degradation of protein. It is concluded that the rate of turnover of protein in Lemna is very dependent on the composition of the growth medium. Conditions which reduce growth rates also reduce the rates of synthesis of protein and increase those of degradation. PMID:16657895
Effect of penicillin on fatty acid synthesis and excretion in Streptococcus mutans BHT
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brissette, J.L.; Pieringer, R.A.
Treatment of exponentially growing cultures of Streptococcus mutans BHT with growth-inhibitory concentrations (0.2 microgram/ml) of benzylpenicillin stimulates the incorporation of (2-/sup 14/C) acetate into lipids excreted by the cells by as much as 69-fold, but does not change the amount of /sup 14/C incorporated into intracellular lipids. At this concentration of penicillin cellular lysis does not occur. The radioactive label is incorporated exclusively into the fatty acid moieties of the glycerolipids. During a 4-hr incubation in the presence of penicillin, the extracellular fatty acid ester concentration increases 1.5 fold, even though there is no growth or cellular lysis. An indicationmore » of the relative rate of fatty acid synthesis was most readily obtained by placing S. mutans BHT in a buffer containing /sup 14/C-acetate. Under these nongrowing conditions free fatty acids are the only lipids labeled, a factor which simplifies the assay. The addition of glycerol to the buffer causes all of the nonesterified fatty acids to be incorporated into glycerolipid. The cells excrete much of the lipid whether glycerol is present or not. Addition of penicillin to the nongrowth supporting buffer system does not stimulate the incorporation of (/sup 14/C)-acetate into fatty acids.« less
Macromolecular Synthesis During the Germination of Saccharomyces cerevisiae Spores
Rousseau, Paul; Halvorson, Harlyn O.
1973-01-01
After the dormancy of Saccharomyces cerevisiae ascospores had been broken, the synthesis of proteins was observed first, followed rapidly by synthesis of ribonucleic acid (RNA) and much later by deoxyribonucleic acid (DNA) synthesis. Phosphoglucomutase activity increased in a periodic (step) fashion, whereas the activity of five other enzymes increased linearly during germination and outgrowth. The rate of synthesis of these enzymes was highest at about the period of DNA replication. The amino acid pools of dormant spores contained high levels of proline, glutamic acid, and histidine. At 2 h after onset of germination, the pools of phenylalanine and methionine had disappeared and the other components had decreased significantly. By 3.5 h, with the exception of proline and cystine, most amino acid pool components had significantly increased. PMID:4570780
Li, Junqi; Grillo, Anthony S; Burke, Martin D
2015-08-18
The study and optimization of small molecule function is often impeded by the time-intensive and specialist-dependent process that is typically used to make such compounds. In contrast, general and automated platforms have been developed for making peptides, oligonucleotides, and increasingly oligosaccharides, where synthesis is simplified to iterative applications of the same reactions. Inspired by the way natural products are biosynthesized via the iterative assembly of a defined set of building blocks, we developed a platform for small molecule synthesis involving the iterative coupling of haloboronic acids protected as the corresponding N-methyliminodiacetic acid (MIDA) boronates. Here we summarize our efforts thus far to develop this platform into a generalized and automated approach for small molecule synthesis. We and others have employed this approach to access many polyene-based compounds, including the polyene motifs found in >75% of all polyene natural products. This platform further allowed us to derivatize amphotericin B, the powerful and resistance-evasive but also highly toxic last line of defense in treating systemic fungal infections, and thereby understand its mechanism of action. This synthesis-enabled mechanistic understanding has led us to develop less toxic derivatives currently under evaluation as improved antifungal agents. To access more Csp(3)-containing small molecules, we gained a stereocontrolled entry into chiral, non-racemic α-boryl aldehydes through the discovery of a chiral derivative of MIDA. These α-boryl aldehydes are versatile intermediates for the synthesis of many Csp(3) boronate building blocks that are otherwise difficult to access. In addition, we demonstrated the utility of these types of building blocks in accessing pharmaceutically relevant targets via an iterative Csp(3) cross-coupling cycle. We have further expanded the scope of the platform to include stereochemically complex macrocyclic and polycyclic molecules
Arunima, Sakunthala; Rajamohan, Thankappan
2014-05-28
The present study was carried out to evaluate the effects of virgin coconut oil (VCO) compared with copra oil, olive oil and sunflower-seed oil on the synthesis and oxidation of fatty acids and the molecular regulation of fatty acid metabolism in normal rats. Male Sprague-Dawley rats were fed the test oils at 8 % for 45 d along with a synthetic diet. Dietary supplementation of VCO decreased tissue lipid levels and reduced the activity of the enzymes involved in lipogenesis, namely acyl CoA carboxylase and fatty acid synthase (FAS) (P< 0·05). Moreover, VCO significantly (P< 0·05) reduced the de novo synthesis of fatty acids by down-regulating the mRNA expression of FAS and its transcription factor, sterol regulatory element-binding protein-1c, compared with the other oils. VCO significantly (P< 0·05) increased the mitochondrial and peroxisomal β-oxidation of fatty acids, which was evident from the increased activities of carnitine palmitoyl transferase I, acyl CoA oxidase and the enzymes involved in mitochondrial β-oxidation; this was accomplished by up-regulating the mRNA expression of PPARα and its target genes involved in fatty acid oxidation. In conclusion, the present results confirmed that supplementation of VCO has beneficial effects on lipid parameters by reducing lipogenesis and enhancing the rate of fatty acid catabolism; this effect was mediated at least in part via PPARα-dependent pathways. Thus, dietary VCO reduces the risk for CHD by beneficially modulating the synthesis and degradation of fatty acids.
One-pot synthesis of bioactive cyclopentenones from α-linolenic acid and docosahexaenoic acid.
Maynard, Daniel; Müller, Sara Mareike; Hahmeier, Monika; Löwe, Jana; Feussner, Ivo; Gröger, Harald; Viehhauser, Andrea; Dietz, Karl-Josef
2018-04-01
Oxidation products of the poly-unsaturated fatty acids (PUFAs) arachidonic acid, α-linolenic acid and docosahexaenoic acid are bioactive in plants and animals as shown for the cyclopentenones prostaglandin 15d-PGJ 2 and PGA 2 , cis-(+)-12-oxophytodienoic acid (12-OPDA), and 14-A-4 neuroprostane. In this study an inexpensive and simple enzymatic multi-step one-pot synthesis is presented for 12-OPDA, which is derived from α-linolenic acid, and the analogous docosahexaenoic acid (DHA)-derived cyclopentenone [(4Z,7Z,10Z)-12-[[-(1S,5S)-4-oxo-5-(2Z)-pent-2-en-1yl]-cyclopent-2-en-1yl] dodeca-4,7,10-trienoic acid, OCPD]. The three enzymes utilized in this multi-step cascade were crude soybean lipoxygenase or a recombinant lipoxygenase, allene oxide synthase and allene oxide cyclase from Arabidopsis thaliana. The DHA-derived 12-OPDA analog OCPD is predicted to have medicinal potential and signaling properties in planta. With OCPD in hand, it is shown that this compound interacts with chloroplast cyclophilin 20-3 and can be metabolized by 12-oxophytodienoic acid reductase (OPR3) which is an enzyme relevant for substrate bioactivity modulation in planta. Copyright © 2017 Elsevier Ltd. All rights reserved.
Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent
USDA-ARS?s Scientific Manuscript database
Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...
SYNTHESIS OF MIXED FULL AND SEMIESTERS OF PHOSPHOROUS ACID AS ORGANIC MOTOR OIL ADDITIVES,
The synthesis of mixed full and semiesters of phosphonic acid was effected using alkylphenols produced by the chemical industry. By condensation of...industrial alkylphenol or the condensation of acid chloride of di-(alkylphenyl)-phosphorous acid with diethylamine, the corresponding mixed full and semiesters
Kanoh, H.; Lindsay, D. B.
1972-01-01
1. Mitochondrial and microsomal fractions of rat epididymal adipose tissue incorporated [1-14C]acetyl-CoA equally well into various fatty acids by a chain-elongation mechanism. C18 and C20 fatty acids were the two major products, and comprised about 80% of the total fatty acids synthesized in both particles. 2. When incubated in air, mitochondria synthesized stearic acid, octadecenoic acid and eicosamonoenoic acid in almost equal amounts (about 20% each), whereas in microsomal fractions, the synthesis of octadecenoic acid was more than fivefold the stearic acid formation. In both fractions, major components of synthesized monoenoic fatty acids were the Δ11:12 isomers. Hexadecenoic acid and octadecenoic acid from whole adipose tissue contained approx. 11 and 14% of the Δ11:12 isomer respectively. 3. When mitochondria or microsomal fractions were incubated in nitrogen, there was increased synthesis of stearic acid and palmitic acid and less of C16 and C18 monoenoic acids; synthesis of C20 acids remained predominantly of the monoenoic acids. Determination of the position of the double bond in the monoenoic acids supported the view that the synthesis of hexadecenoic acid and octadecenoic acid involves a desaturase activity, whereas eicosamonoenoic acid and eicosadienoic acid are formed only by elongation of endogenous fatty acids. 4. Most of the radioactivity was found in free fatty acids (63%) and the phospholipid (26%) fraction. In phospholipids, phosphatidylcholine and phosphatidylethanolamine were the two major components. 5. Most of the fatty acids synthesized, including those not normally found in particle lipids (arachidic acid, eicosamonoenoic acid and eicosadienoic acid) were distributed fairly evenly in the phospholipid and free fatty acid fractions. However, stearic acid was found predominantly in the phospholipid fraction. PMID:4638795
Dirks, Marlou L; Groen, Bart B L; Franssen, Rinske; van Kranenburg, Janneau; van Loon, Luc J C
2017-01-01
Short periods of muscle disuse result in substantial skeletal muscle atrophy. Recently, we showed that both neuromuscular electrical stimulation (NMES) as well as presleep dietary protein ingestion represent effective strategies to stimulate muscle protein synthesis rates. In this study, we test our hypothesis that NMES can augment the use of presleep protein-derived amino acids for overnight muscle protein synthesis in older men. Twenty healthy, older [69 ± 1 (SE) yr] men were subjected to 24 h of bed rest, starting at 8:00 AM. In the evening, volunteers were subjected to 70-min 1-legged NMES, while the other leg served as nonstimulated control (CON). Immediately following NMES, 40 g of intrinsically l-[1- 13 C]-phenylalanine labeled protein was ingested prior to sleep. Blood samples were taken throughout the night, and muscle biopsies were obtained from both legs in the evening and the following morning (8 h after protein ingestion) to assess dietary protein-derived l-[1- 13 C]-phenylalanine enrichments in myofibrillar protein. Plasma phenylalanine concentrations and plasma l-[1- 13 C]-phenylalanine enrichments increased significantly following protein ingestion and remained elevated for up to 6 h after protein ingestion (P < 0.05). During overnight sleep, myofibrillar protein-bound l-[1- 13 C]-phenylalanine enrichments (MPE) increased to a greater extent in the stimulated compared with the control leg (0.0344 ± 0.0019 vs. 0.0297 ± 0.0016 MPE, respectively; P < 0.01), representing 18 ± 6% greater incorporation of presleep protein-derived amino acids in the NMES compared with CON leg. In conclusion, application of NMES prior to presleep protein feeding stimulates the use of dietary protein-derived amino acids for overnight muscle protein synthesis in older men. Neuromuscular electrical stimulation (NMES) as well as presleep dietary protein ingestion represent effective strategies to stimulate muscle protein synthesis rates. Here we demonstrate that in older
Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.
Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra
2016-09-01
α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.
Fatty acid carbon is essential for dNTP synthesis in endothelial cells
Missiaen, Rindert; Queiroz, Karla CS; Borgers, Gitte; Elia, Ilaria; Zecchin, Annalisa; Cantelmo, Anna Rita; Christen, Stefan; Goveia, Jermaine; Heggermont, Ward; Goddé, Lucica; Vinckier, Stefan; Van Veldhoven, Paul P.; Eelen, Guy; Schoonjans, Luc; Gerhardt, Holger; Dewerchin, Mieke; Baes, Myriam; De Bock, Katrien; Ghesquière, Bart; Lunt, Sophia Y.; Fendt, Sarah-Maria; Carmeliet, Peter
2015-01-01
The metabolism of endothelial cells (ECs) during vessel sprouting remains poorly studied. Here, we report that endothelial loss of CPT1a, a rate-limiting enzyme of fatty acid oxidation (FAO), caused vascular sprouting defects due to impaired proliferation, not migration of ECs. Reduction of FAO in ECs did not cause energy depletion or disturb redox homeostasis, but impaired de novo nucleotide synthesis for DNA replication. Isotope labeling studies in control ECs showed that fatty acid carbons substantially replenished the Krebs cycle, and were incorporated into aspartate (a nucleotide precursor), uridine monophosphate (a precursor of pyrimidine nucleoside triphosphates) and DNA. CPT1a silencing reduced these processes and depleted EC stores of aspartate and deoxyribonucleoside triphosphates. Acetate (metabolized to acetyl-CoA, thereby substituting for the depleted FAO-derived acetyl-CoA) or a nucleoside mix rescued the phenotype of CPT1a-silenced ECs. Finally, CPT1 blockade inhibited pathological ocular angiogenesis, suggesting a novel strategy for blocking angiogenesis. PMID:25830893
Aparecida de França, Suélem; Pavani Dos Santos, Maísa; Nunes Queiroz da Costa, Roger Vinícius; Froelich, Mendalli; Buzelle, Samyra Lopes; Chaves, Valéria Ernestânia; Giordani, Morenna Alana; Pereira, Mayara Peron; Colodel, Edson Moleta; Marlise Balbinotti Andrade, Cláudia; Kawashita, Nair Honda
2014-04-01
The aim of this study was to evaluate glucose uptake and the contribution of glucose to fatty acid (FA) synthesis and the glycerol-3-phosphate (G3P) of triacylglycerol synthesis by interscapular brown adipose tissue (IBAT) of low-protein, high-carbohydrate (LPHC) diet-fed rats. LPHC (6% protein; 74% carbohydrate) or control (17% protein; 63% carbohydrate) diets were administered to rats (∼ 100 g) for 15 d. Total FA and G3P synthesis and the synthesis of FA and G3P from glucose were evaluated in vivo by (3)H2O and (14)C-glucose. Sympathetic neural contribution for FA synthesis was evaluated by comparing the synthesis in denervated (7 d before) IBAT with that of the contralateral innervated side. The insulin signaling and β3 adrenergic receptor (β3-AR) contents, as well as others, were determined by Western blot (Student's t test or analysis of variance; P ≤ 0.05). Total FA synthesis in IBAT was 133% higher in the LPHC group and was reduced 85% and 70% by denervation for the LPHC and control groups, respectively. Glucose uptake was 3.5-fold higher in the IBAT of LPHC rats than in that of the control rats, and the contribution of glucose to the total FA synthesis increased by 12% in control rats compared with 18% in LPHC rats. The LPHC diet increased the G3P generation from glucose by 270% and the insulin receptor content and the p-AKT insulin stimulation in IBAT by 120% and reduced the β3-AR content by 50%. The LPHC diet stimulated glucose uptake, both the total rates and the rates derived from glucose-dependent FA and G3P synthesis, by increasing the insulin sensitivity and the sympathetic flux, despite a reduction in the β3-AR content. Copyright © 2014 Elsevier Inc. All rights reserved.
A comparison of the metabolic fate of Fatty acids of different chain lengths in developing oilseeds.
Battey, J F; Ohlrogge, J B
1989-07-01
To determine if medium and long chain fatty acids can be appropriately metabolized by species that normally produce 16 and 18 carbon fatty acids, homogenates of developing Cuphea wrightii, Carthamus tinctorius, and Crambe abyssinica seeds were incubated with radiolabeled lauric, palmitic, oleic, and erucic acids. In all three species, acyl-CoA synthetase showed broad substrate specificity in synthesis of acyl-coenzyme A (CoA) from any of the fatty acids presented. In Carthamus, two- to fivefold less of the foreign FAs, lauric, and erucic acid was incorporated into acyl-CoAs than palmitic and oleic acid. Lauric and erucic acid also supported less glycerolipid synthesis in Carthamus than palmitic and oleic acid, but the rate of acyl-CoA synthesis did not control rate of glycerolipid synthesis. In all species examined, medium and long chain fatty acids were incorporated predominantly into triacylglycerols and were almost excluded from phospholipid synthesis, whereas palmitic and oleic acid were found predominantly in polar lipids. However, the rate of esterification of unusual fatty acids to triacylglycerol is slow in species that do not normally synthesize these acyl substrates.
A Comparison of the Metabolic Fate of Fatty Acids of Different Chain Lengths in Developing Oilseeds
Battey, James F.; Ohlrogge, John B.
1989-01-01
To determine if medium and long chain fatty acids can be appropriately metabolized by species that normally produce 16 and 18 carbon fatty acids, homogenates of developing Cuphea wrightii, Carthamus tinctorius, and Crambe abyssinica seeds were incubated with radiolabeled lauric, palmitic, oleic, and erucic acids. In all three species, acyl-CoA synthetase showed broad substrate specificity in synthesis of acyl-coenzyme A (CoA) from any of the fatty acids presented. In Carthamus, two- to fivefold less of the foreign FAs, lauric, and erucic acid was incorporated into acyl-CoAs than palmitic and oleic acid. Lauric and erucic acid also supported less glycerolipid synthesis in Carthamus than palmitic and oleic acid, but the rate of acyl-CoA synthesis did not control rate of glycerolipid synthesis. In all species examined, medium and long chain fatty acids were incorporated predominantly into triacylglycerols and were almost excluded from phospholipid synthesis, whereas palmitic and oleic acid were found predominantly in polar lipids. However, the rate of esterification of unusual fatty acids to triacylglycerol is slow in species that do not normally synthesize these acyl substrates. PMID:16666885
In vitro synthesis of 9,10-dihydroxyhexadecanoic acid using recombinant Escherichia coli.
Kaprakkaden, Anees; Srivastava, Preeti; Bisaria, Virendra Swarup
2017-05-18
Hydroxy fatty acids are widely used in food, chemical and cosmetic industries. A variety of dihydroxy fatty acids have been synthesized so far; however, no studies have been done on the synthesis of 9,10-dihydroxyhexadecanoic acid. In the present study recombinant E. coli has been used for the heterologous expression of fatty acid hydroxylating enzymes and the whole cell lysate of the induced culture was used for in vitro production of 9,10-dihydroxyhexadecanoic acid. A first of its kind proof of principle has been successfully demonstrated for the production of 9,10-dihydroxyhexadecanoic acid using three different enzymes viz. fatty acid desaturase (FAD) from Saccharomyces cerevisiae, epoxide hydrolase (EH) from Caenorhabditis elegance and epoxygenase (EPOX) from Stokasia laevis. The genes for these proteins were codon-optimised, synthesised and cloned in pET 28a (+) vector. The culture conditions for induction of these three proteins in E. coli were optimised in shake flask. The induced cell lysates were used both singly and in combination along with the trans-supply of hexadecanoic acid and 9-hexadecenoic acid, followed by product profiling by GC-MS. Formation of 9,10-dihydroxyhexadecanoic acid was successfully achieved when combination of induced cell lysates of recombinant E. coli containing FAD, EH, and EPOX were incubated with 9-hexadecenoic acid. The in vitro production of 9,10-dihydroxyhexadecanoic acid synthesis using three fatty acid modification genes from different sources has been successfully demonstrated. The strategy adopted can be used for the production of similar compounds.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reich, I.L.; Reich, H.J.; Menahan, L.A.
1987-01-01
Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.
Synthesis oftrans-3-hexadecenoic acid and oftrans-3-hexadecenoic-1-C(14) acid.
Knipprath, W G; Stein, R A
1966-01-01
Thetrans-3-hexadecenoic acid has been synthesized. Physical properties and chemical degradation prove its identity with the acid earlier isolated from several plant lipids. In the sequence of the synthesis, the introduction of a terminal triple bond into commercially available 1-tetradecene was performed by bromination and debromination with KOH and NaNH(2). Chain elongation by a Grignard reaction with CO(2) gave a carboxylic acid with a triple bond in the 2-position. Reduction with LiAlH(4) yielded the corresponding alcohol, and reduction of the triple to thetrans double bond was accomplished with Na in ethanol. Bromination of the alcohol with PBr(3) and conversion of the bromide to the nitrile with KCN or KC(14)N elongated the carbon chain to the desired length. Methanolysis with HCl in methanol and saponification with KOH formed the acid with acceptable yields, and in the case of the C(14)-labeled carboxyl, group, with high specific activity.
Raj, Hans; Szymanski, Wiktor; de Villiers, Jandré; Puthan Veetil, Vinod; Quax, Wim J; Shimamoto, Keiko; Janssen, Dick B; Feringa, Ben L; Poelarends, Gerrit J
2013-08-19
Enzymatic amino acid synthesis: Kinetic resolution and asymmetric synthesis of various valuable 3-substituted aspartic acids, which were obtained in fair to good yields with diastereomeric ratio values of up to >98:2 and enantiomeric excess values of up to >99 %, by using engineered methylaspartate ammonia lyases are described. These biocatalytic methodologies for the selective preparation of aspartic acid derivatives appear to be attractive alternatives for existing chemical methods. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.
Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij
2016-08-01
The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively).
Spin labeled amino acid nitrosourea derivatives--synthesis and antitumour activity.
Zheleva, A; Raikov, Z; Ilarionova, M; Todorov, D
1995-01-01
The synthesis of three spin labeled derivatives of N-[N'-(chloroethyl)-N'-nitrosocarbamoyl] amino acids is reported. The new nitrosoureas are obtained by condensation of the corresponding N-[N'-(2-chloroethyl)-N'-nitrosocarbamoyl] amino acid with 2,2,6,6-tetramethyl-1-oxyl-4-aminopiperidine using dicyclohexylcarbodiimide. Their chemical structures are confirmed by elemental analysis, IR, MS, and EPR spectroscopy. All newly synthesized compounds showed high antitumour activity against the lymphoid leukemia L1210 in BDF1 mice.
Gao, Xin; Zhu, Qiaoqiao; Gu, Weiyong
2015-02-26
The glycosaminoglycan (GAG) plays an important role in cartilaginous tissues to support and transmit mechanical loads. Many extracellular biophysical stimuli could affect GAG synthesis by cells. It has been hypothesized that the change of cell volume is a primary mechanism for cells to perceive the stimuli. Experimental studies have shown that the maximum synthesis rate of GAG is achieved at an optimal cell volume, larger or smaller than this level the GAG synthesis rate decreases. Based on the hypothesis and experimental findings in the literature, we proposed a mathematical model to quantitatively describe the cell volume dependent GAG synthesis rate in the cartilaginous tissues. Using this model, we investigated the effects of osmotic loading and mechanical loading on GAG synthesis rate. It is found our proposed mathematical model is able to well describe the change of GAG synthesis rate in isolated cells or in cartilage with variations of the osmotic loading or mechanical loading. This model is important for evaluating the GAG synthesis activity within cartilaginous tissues as well as understanding the role of mechanical loading in tissue growth or degeneration. It is also important for designing a bioreactor system with proper extracellular environment or mechanical loading for growing tissue at the maximum synthesis rate of the extracellular matrix. Copyright © 2015 Elsevier Ltd. All rights reserved.
Pynn, Christopher J.; Henderson, Neil G.; Clark, Howard; Koster, Grielof; Bernhard, Wolfgang; Postle, Anthony D.
2011-01-01
Phosphatidylcholine (PC) synthesis by the direct cytidine diphosphate choline (CDP-choline) pathway in rat liver generates predominantly mono- and di-unsaturated molecular species, while polyunsaturated PC species are synthesized largely by the phosphatidylethanolamine-N-methyltransferase (PEMT) pathway. Although altered PC synthesis has been suggested to contribute to development of hepatocarcinoma and nonalcoholic steatohepatitis, analysis of the specificity of hepatic PC metabolism in human patients has been limited by the lack of sensitive and safe methodologies. Here we incorporated a deuterated methyl-d9-labled choline chloride, to quantify biosynthesis fluxes through both of the PC synthetic pathways in vivo in human volunteers and compared these fluxes with those in mice. Rates and molecular specificities of label incorporated into mouse liver and plasma PC were very similar and strongly suggest that label incorporation into human plasma PC can provide a direct measure of hepatic PC synthesis in human subjects. Importantly, we demonstrate for the first time that the PEMT pathway in human liver is selective for polyunsaturated PC species, especially those containing docosahexaenoic acid. Finally, we present a multiple isotopomer distribution analysis approach, based on transfer of deuterated methyl groups to S-adenosylmethionine and subsequent sequential methylations of PE, to quantify absolute flux rates through the PEMT pathway that are applicable to studies of liver dysfunction in clinical studies. PMID:21068006
Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-Ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang
2015-09-01
Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. Copyright © 2015 Elsevier B.V. All rights reserved.
Chen, Nanhua; LaCrue, Alexis N.; Teuscher, Franka; Waters, Norman C.; Gatton, Michelle L.; Kyle, Dennis E.
2014-01-01
Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment. PMID:24913167
Chen, Nanhua; LaCrue, Alexis N; Teuscher, Franka; Waters, Norman C; Gatton, Michelle L; Kyle, Dennis E; Cheng, Qin
2014-08-01
Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Growth and Synthesis of Nucleic Acid and Protein by Excised Radish Cotyledons 1
Nieman, R. H.; Poulsen, L. L.
1967-01-01
Nutritional and light requirements for growth and synthesis of RNA, DNA, and protein by cotyledons excised from 5-day-old seedlings of Raphanus sativus L. were investigated, and the course of synthesis was followed through the cell cycle. The minimum requirements for a net increase in nucleic acid and protein were sugar, nitrate, and light. The cotyledons used nitrite at low concentration, but not ammonium ion. Light was required for preliminary steps in synthesis of RNA, DNA, and protein, but the actual polymerization reactions occurred in the dark. The cotyledons contained sufficient endogenous growth factors for about half of the cells to complete 1 cycle on a medium of 1% sucrose, 80 mm KNO3. The increase in DNA was limited to about 50% and was accompanied by a comparable increase in cell number. Fresh weight, RNA, and protein tended to increase in proportion to DNA. Growth of the isolated cotyledons commenced with cell enlargement. RNA began to increase after about 4 hours, DNA after about 12. The major increase in protein also began at about 12 hours. The maximum rate of increase for all 3 occurred between 12 and 16 hours. Cell counts indicated that by 28 hours most of the cells which had replicated DNA had also completed cell division. PMID:16656601
USDA-ARS?s Scientific Manuscript database
Chronic somatotropin (pST) treatment in pigs increases skeletal muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin alone could not account for the pST-induced increase in protein synthesis. This study...
Knudsen, J
1979-01-01
The concentration of medium-chain acyl thioester hydrolase and of fatty acid synthetase was determined by rocket immunoelectrophoresis in nine different particle-free supernatant fractions from lactating-rabbit mammary gland. The molar ratio of the hydrolase to fatty acid synthetase was 1.99 +/- 0.66 (mean +/- S.D.). A rate-limiting concentration of malonyl-CoA was required to ensure the predominant synthesis of medium-chain fatty acids when 2 mol of the hydrolase was added per mol of fatty acid synthetase. The interaction of the hydrolase with fatty acid synthetase was concentration-dependent, though an optimum concentration of hydrolase to synthetase could not be obtained. The lactating-rabbit mammary gland hydrolase altered the pattern of fatty acids synthesized by fatty acid synthetases prepared from cow, goat, sheep and rabbit lactating mammary glands, rabbit liver and cow adipose tissue. PMID:574008
Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata
2014-04-01
Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Tuning of acyl-ACP thioesterase activity directed for tailored fatty acid synthesis.
Feng, Yanbin; Zhang, Yunxiu; Wang, Yayue; Liu, Jiao; Liu, Yinghui; Cao, Xupeng; Xue, Song
2018-04-01
Medium-chain fatty acids have attracted significant attention as sources of biofuels in recent years. Acyl-ACP thioesterase, which is considered as the key enzyme to determine the carbon chain length, catalyzes the termination of de novo fatty acid synthesis. Although recombinant medium-chain acyl-ACP thioesterase (TE) affects the fatty acid profile in heterologous cells, tailoring of the fatty acid composition merely by engineering a specific TE is still intractable. In this study, the activity of a C8-C10-specific thioesterase FatB2 from Cuphea hookeriana on C10-ACP was quantified twice as high as that on C8-ACP based on a synthetic C8-C16 acyl-ACP pool in vitro. Whereas in vivo, it was demonstrated that ChFatB2 preferred to accumulate C8 fatty acids with 84.9% composition in the ChFatB2-engineered E. coli strain. To achieve C10 fatty acid production, ChFatB2 was rationally tuned based on structural investigation and enzymatic analysis. An I198E mutant was identified to redistribute the C8-ACP flow, resulting in C10 fatty acid being produced as the principal component at 57.6% of total fatty acids in vivo. It was demonstrated that the activity of TE relative to β-ketoacyl-ACP synthases (KAS) directly determined the fatty acid composition. Our results provide a prospective strategy in tailoring fatty acid synthesis by tuning of TE activities based on TE-ACP interaction.
Kinetics of enzymatic synthesis of liquid wax ester from oleic acid and oleyl alcohol.
Radzi, Salina Mat; Mohamad, Rosfarizan; Basri, Mahiran; Salleh, Abu Bakar; Ariff, Arbakariya; Rahman, Mohammad Basyaruddin Abdul; Rahman, Raja Noor Zaliha Raja Abdul
2010-01-01
The kinetics of wax ester synthesis from oleic acid and oleyl alcohol using immobilized lipase from Candida antartica as catalyst was studied with different types of impeller (Rushton turbine and AL-hydrofoil) to create different mixing conditions in 2l stirred tank reactor. The effects of catalyst concentration, reaction temperature, and impeller tip speed on the synthesis were also evaluated. Rushton turbine impeller exhibited highest conversion rate at lower impeller tip speed as compared to AL-hydrofoil impeller. A second-order reversible kinetic model from single progress curve for the prediction of fractional conversion at given reaction time was proposed and the corresponding kinetic parameter values were calculated by non-linear regression method. The results from the simulation using the proposed model showed satisfactory agreement with the experimental data. Activation energy shows a value of 21.77 Kcal/mol. The thermodynamic parameters of the process, enthalpy and entropy, were 21.15 Kcal/mol and 52.07 cal/mol.K, respectively.
Dipeptide derivative synthesis catalyzed by Pseudomonas aeruginosa elastase.
Rival, S; Besson, C; Saulnier, J; Wallach, J
1999-02-01
Pseudomonas aeruginosa elastase was used to synthesize various N-protected dipeptide amides. The identity of the products was confirmed by FAB(+)-MS. After recrystallization, the yield of their synthesis was calculated, their purity was checked by RP-HPLC and their melting point was measured. With regard to the hydrolysis, it is well-established that the enzyme prefers hydrophobic amino acids in P'1 position and it has a wide specificity for the P1 position. This specificity was demonstrated to be quite unchanged when comparing the initial rates of peptide bond formation between different carboxyl donors (Z-aa) and nucleophiles (aa-NH2). The elastase, but not the thermolysin, was notably able to incorporate tyrosine and tryptophan in P'1 position. Furthermore, synthesis initial rates were at least 100 times faster with the elastase. To overcome the problematic condensation of some amino acids during chemical peptide synthesis, it has been previously suggested that enzymatic steps can combine with a chemical strategy. We demonstrated that the elastase readily synthesizes dipeptide derivatives containing various usual N-protecting groups. It was especially able to condense phenylalaninamide to Fmoc- and Boc-alanine. Increasing interest in peptides containing unnatural amino acids led us to try the elastase-catalyzed synthesis of Z-dipeptide amides including those amino acids in the P1 position. A synthesis was demonstrated with alphaAbu, Nle, Nva and Phg.
USDA-ARS?s Scientific Manuscript database
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were...
Formal synthesis of berkelic acid: a lesson in α-alkylation chemistry.
McLeod, Michael C; Wilson, Zoe E; Brimble, Margaret A
2012-01-06
The full details of our enantioselective formal synthesis of the biologically active natural product berkelic acid are described. The insertion of the C-18 methyl group proved challenging, with three different approaches investigated to install the correct stereochemistry. Our initial Horner-Wadsworth-Emmons/oxa-Michael approach to the berkelic acid core proved unsuccessful upon translation to the natural product itself. However, addition of a silyl enol ether to an oxonium ion, followed by a one-pot debenzylation/spiroketalisation/thermodynamic equilibration procedure, afforded the tetracyclic structure of the berkelic acid core as a single diastereoisomer.
Valproate induced hepatic steatosis by enhanced fatty acid uptake and triglyceride synthesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bai, Xupeng; Hong, Weipeng; Cai, Peiheng
Steatosis is the characteristic type of VPA-induced hepatotoxicity and may result in life-threatening hepatic lesion. Approximately 61% of patients treated with VPA have been diagnosed with hepatic steatosis through ultrasound examination. However, the mechanisms underlying VPA-induced intracellular fat accumulation are not yet fully understood. Here we demonstrated the involvement of fatty acid uptake and lipogenesis in VPA-induced hepatic steatosis in vitro and in vivo by using quantitative real-time PCR (qRT-PCR) analysis, western blotting analysis, fatty acid uptake assays, Nile Red staining assays, and Oil Red O staining assays. Specifically, we found that the expression of cluster of differentiation 36 (CD36),more » an important fatty acid transport, and diacylglycerol acyltransferase 2 (DGAT2) were significantly up-regulated in HepG2 cells and livers of C57B/6J mice after treatment with VPA. Furthermore, VPA treatment remarkably enhanced the efficiency of fatty acid uptake mediated by CD36, while this effect was abolished by the interference with CD36-specific siRNA. Also, VPA treatment significantly increased DGAT2 expression as a result of the inhibition of mitogen-activated protein kinase kinase (MEK) – extracellular regulated kinase (ERK) pathway; however, DGAT2 knockdown significantly alleviated VPA-induced intracellular lipid accumulation. Additionally, we also found that sterol regulatory element binding protein-1c (SREBP-1c)-mediated fatty acid synthesis may be not involved in VPA-induced hepatic steatosis. Overall, VPA-triggered over-regulation of CD36 and DGAT2 could be helpful for a better understanding of the mechanisms underlying VPA-induced hepatic steatosis and may offer novel therapeutic strategies to combat VPA-induced hepatotoxicity. - Highlights: • VPA induced hepatic steatosis and modulated genes associated with lipid metabolism. • CD36-mediated fatty acid uptake contributed to VPA-induced lipid accumulation. • PA increased the
Hypophosphatemia promotes lower rates of muscle ATP synthesis.
Pesta, Dominik H; Tsirigotis, Dimitrios N; Befroy, Douglas E; Caballero, Daniel; Jurczak, Michael J; Rahimi, Yasmeen; Cline, Gary W; Dufour, Sylvie; Birkenfeld, Andreas L; Rothman, Douglas L; Carpenter, Thomas O; Insogna, Karl; Petersen, Kitt Falk; Bergwitz, Clemens; Shulman, Gerald I
2016-10-01
Hypophosphatemia can lead to muscle weakness and respiratory and heart failure, but the mechanism is unknown. To address this question, we noninvasively assessed rates of muscle ATP synthesis in hypophosphatemic mice by using in vivo saturation transfer [ 31 P]-magnetic resonance spectroscopy. By using this approach, we found that basal and insulin-stimulated rates of muscle ATP synthetic flux (V ATP ) and plasma inorganic phosphate (P i ) were reduced by 50% in mice with diet-induced hypophosphatemia as well as in sodium-dependent P i transporter solute carrier family 34, member 1 (NaPi2a)-knockout (NaPi2a -/- ) mice compared with their wild-type littermate controls. Rates of V ATP normalized in both hypophosphatemic groups after restoring plasma P i concentrations. Furthermore, V ATP was directly related to cellular and mitochondrial P i uptake in L6 and RC13 rodent myocytes and isolated muscle mitochondria. Similar findings were observed in a patient with chronic hypophosphatemia as a result of a mutation in SLC34A3 who had a 50% reduction in both serum P i content and muscle V ATP After oral P i repletion and normalization of serum P i levels, muscle V ATP completely normalized in the patient. Taken together, these data support the hypothesis that decreased muscle ATP synthesis, in part, may be caused by low blood P i concentrations, which may explain some aspects of muscle weakness observed in patients with hypophosphatemia.-Pesta, D. H., Tsirigotis, D. N., Befroy, D. E., Caballero, D., Jurczak, M. J., Rahimi, Y., Cline, G. W., Dufour, S., Birkenfeld, A. L., Rothman, D. L., Carpenter, T. O., Insogna, K., Petersen, K. F., Bergwitz, C., Shulman, G. I. Hypophosphatemia promotes lower rates of muscle ATP synthesis. © The Author(s).
Hypophosphatemia promotes lower rates of muscle ATP synthesis
Pesta, Dominik H.; Tsirigotis, Dimitrios N.; Befroy, Douglas E.; Caballero, Daniel; Jurczak, Michael J.; Rahimi, Yasmeen; Cline, Gary W.; Dufour, Sylvie; Birkenfeld, Andreas L.; Rothman, Douglas L.; Carpenter, Thomas O.; Insogna, Karl; Petersen, Kitt Falk; Bergwitz, Clemens; Shulman, Gerald I.
2016-01-01
Hypophosphatemia can lead to muscle weakness and respiratory and heart failure, but the mechanism is unknown. To address this question, we noninvasively assessed rates of muscle ATP synthesis in hypophosphatemic mice by using in vivo saturation transfer [31P]-magnetic resonance spectroscopy. By using this approach, we found that basal and insulin-stimulated rates of muscle ATP synthetic flux (VATP) and plasma inorganic phosphate (Pi) were reduced by 50% in mice with diet-induced hypophosphatemia as well as in sodium-dependent Pi transporter solute carrier family 34, member 1 (NaPi2a)-knockout (NaPi2a−/−) mice compared with their wild-type littermate controls. Rates of VATP normalized in both hypophosphatemic groups after restoring plasma Pi concentrations. Furthermore, VATP was directly related to cellular and mitochondrial Pi uptake in L6 and RC13 rodent myocytes and isolated muscle mitochondria. Similar findings were observed in a patient with chronic hypophosphatemia as a result of a mutation in SLC34A3 who had a 50% reduction in both serum Pi content and muscle VATP. After oral Pi repletion and normalization of serum Pi levels, muscle VATP completely normalized in the patient. Taken together, these data support the hypothesis that decreased muscle ATP synthesis, in part, may be caused by low blood Pi concentrations, which may explain some aspects of muscle weakness observed in patients with hypophosphatemia.—Pesta, D. H., Tsirigotis, D. N., Befroy, D. E., Caballero, D., Jurczak, M. J., Rahimi, Y., Cline, G. W., Dufour, S., Birkenfeld, A. L., Rothman, D. L., Carpenter, T. O., Insogna, K., Petersen, K. F., Bergwitz, C., Shulman, G. I. Hypophosphatemia promotes lower rates of muscle ATP synthesis. PMID:27338702
5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group
Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude
1999-01-01
The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.
Chen, Cong; Han, Xiao; Zou, Xuan; Li, Yuan; Yang, Liang; Cao, Ke; Xu, Jie; Long, Jiangang; Liu, Jiankang; Feng, Zhihui
2014-01-01
4-Methylene-2-octyl-5-oxotetrahydrofuran-3-carboxylic acid (C75) is a synthetic fatty-acid synthase (FASN) inhibitor with potential therapeutic effects in several cancer models. Human mitochondrial β-ketoacyl-acyl carrier protein synthase (HsmtKAS) is a key enzyme in the newly discovered mitochondrial fatty acid synthesis pathway that can produce the substrate for lipoic acid (LA) synthesis. HsmtKAS shares conserved catalytic domains with FASN, which are responsible for binding to C75. In our study, we explored the possible effect of C75 on HsmtKAS and mitochondrial function. C75 treatment decreased LA content, impaired mitochondrial function, increased reactive oxygen species content, and reduced cell viability. HsmtKAS but not FASN knockdown had an effect that was similar to C75 treatment. In addition, an LA supplement efficiently inhibited C75-induced mitochondrial dysfunction and oxidative stress. Overexpression of HsmtKAS showed cellular protection against low dose C75 addition, whereas there was no protective effect upon high dose C75 addition. In summary, the mitochondrial fatty acid synthesis pathway has a vital role in mitochondrial function. Besides FASN, C75 might also inhibit HsmtKAS, thereby reducing LA production, impairing mitochondrial function, and potentially having toxic effects. LA supplements sufficiently ameliorated the toxicity of C75, showing that a combination of C75 and LA may be a reliable cancer treatment. PMID:24784139
Lipase-catalyzed synthesis of fattythioic acids from palm oil.
Al-Mulla, Emad A Jaffar
2011-01-01
The present work focuses on the synthesis of fattythioic acids (FTAs) by a one-step lipase catalyzed reaction of palm oil with carbonothioic S,S-acid using Lipozyme. The product was characterized using Fourier transform infrared (FTIR) spectroscopy, proton nuclear magnetic resonance ((1)H NMR) technique and elemental analysis. The effects of various reaction parameters such as reaction time, temperature, amount of enzyme, molar ratio of substrates, and various organic solvents of the reaction system were investigated. The optimum conditions to produce FTAs were respectively, incubation time, 20 h, temperature, 40°C, amount of enzyme, 0.05 g and molar ratio of carbonothioic S,S-acid to palm oil, 5.0:1.0. Hexane was the best solvent for this reaction. The conversion of the products at optimum conditions was around 91%.
Synthesis of glyceryl ferulate by immobilized ferulic acid esterase.
Matsuo, Takemasa; Kobayashi, Takashi; Kimura, Yukitaka; Tsuchiyama, Moriyasu; Oh, Tadanobu; Sakamoto, Tatsuji; Adachi, Shuji
2008-12-01
Glyceryl ferulate was synthesized by the condensation of ferulic acid with glycerol using Pectinase PL "Amano" from Aspergillus niger, which contained ferulic acid esterase, to improve the water-solubility of ferulic acid. The optimum reaction medium was glycerol/0.1 M acetate buffer, pH 4.0, (98:2 v/v). The enzyme immobilized onto Chitopearl BCW3003 exhibited the highest activity among the those immobilized onto various kinds of Chitopearl BCW resins. The optimum temperature for the immobilized enzyme was 50 degrees C, and it could be reused at least five times without a significant loss in activity for the synthesis of glyceryl ferulate in batch reaction. Storage of the reaction mixture at 25 degrees C improved the molar fraction of glyceryl ferulate relative to the dissolved ferulic residues.
Ma, LiWei; Steindal, Arnfinn E; Juzeniene, Asta; Iani, Vladimir; Moan, Johan
2006-08-01
5-Aminolevulinic acid (ALA) or its derivative methyl 5-aminolevulinate (MAL) combined with folic acid was applied in nude mice bearing human colon adenocarcinoma. The aim of the study is to see whether folic acid may increase biosynthesis of porphyrins in tumor tissue after systemic or topical administration of ALA or MAL. The production of porphyrins was determined by spectrofluorometric measurements with an optical fibre probe. It was found that the porphyrin production after i.p injection of 200 mg kg(-1) ALA or MAL was significantly increased by i.p injection of 100 mg kg(-1) folic acid. However, in the case of topically applied 20% ALA, folic acid had no effect. In the case of topically applied 20% MAL, folic acid (i.p or topically applied) reduced the porphyrin synthesis. This might be used for the protection of normal skin against photosensitization. The effects of folic acid were similar in tumors and normal skin. Two mechanisms may explain the results: enhancement of the efficiency of the rate-limiting enzyme porphobilinogen deaminase by folic acid or interference of folic acid with the transport of ALA and MAL to and into the cells synthesizing porphyrins in the tissues. The present data seem to favour the latter mechanism. Folic acid may have a role as an adjuvant in photodynamic therapy with systemically administered ALA and its derivatives.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hempel, K.
1962-01-01
New methods for synthesis of tritium-labeled amino acids with high specific activity (1000 mc/m mole and above) are described. Changes in tritium- labeled amino acids during storage are studied. An absorbed BETA energy of 10/ sup 5/ rad results in radiochemical disintegration of 1.5%. Autoradiographic studies were made with several amino acids. It was demonstrated that protein production is 2 to 3 times higher in butter-vellux, tumors than in liver tissue. Synthesis of melanine was studied in vivo with melanineproducing tumors. (Gmelin Inst.)
Carballeira, N M; Emiliano, A; Hernández-Alonso, N; González, F A
1998-12-01
The total synthesis of the naturally occurring (Z)-2-methoxy-5-hexadecenoic acid and (Z)-2-methoxy-6-hexadecenoic acid was accomplished using as a key step Mukaiyama's trimethylsilyl cyanide addition to 4- and 5-pentadecenal, respectively. These syntheses further confirm the structures of the natural marine fatty acids and corroborate their cis double-bond stereochemistry. The title compounds were antimicrobial against the Gram-positive bacteria Staphylococcus aureus (MIC 0.35 micromol/mL) and Streptococcus faecalis (MIC 0.35 micromol/mL).
Li, Yang
2011-01-01
We have accomplished an asymmetric synthesis of each enantiomer of 4,4-difluoroglutamic acid. This α-amino acid has been of interest in medicinal chemistry circles. Key features of the synthesis include highly scalable procedures, a Reformatsky-based coupling reaction, and straightforward functional group manipulations to make the parent amino acid. Enantioenrichment derives from an enzymatic resolution of the synthetic material. Conversion of the optically enriched compounds to orthogonally protected forms allows selective formation of peptide bonds. 4,4- Difluoroglutamic acid, in a suitably protected form, is also shown to exhibit enhanced catalytic activity in both an oxidation reaction and a reduction reaction, in comparison to the analogous glutamic acid derivative. PMID:22039908
Cao, Jing; Dong, Shuding; Jiang, Delu; Zhu, Peiyu; Zhang, Han; Li, Rui; Li, Zhanyi; Wang, Xuanyu; Tang, Weifang; Du, Ding
2017-04-21
β-Functionalization of indolin-2-one-derived aliphatic acids has been applied in formal [3 + 2] annualtions for catalyst-free and divergent synthesis of two series of structurally interesting 3,3'-spirooxindole γ-butyrolactones that may be attractive for potential drug discovery. These findings also pave the way for further diversity-oriented synthesis of spirooxindoles starting from indolin-2-one-derived aliphatic acids or their derivatives.
Höfner, Roswitha; Vazquez-Moreno, Luz; Winter, Klaus; Bohnert, Hans J.; Schmitt, Jürgen M.
1987-01-01
Intact plants of the halophilic species Mesembryanthemum crystallinum were induced to exhibit Crassulacean acid metabolism by irrigation with nutrient solution containing 500 millimolar NaCl. During the induction period, the extractable activity of phosphoenolpyruvate carboxylase (PEPcase) increased approximately 40-fold. This increase was linearly correlated with a mass increase of PEPcase protein as measured by single radial immunodiffusion. De novo synthesis of PEPcase protein was shown by immunoprecipitation of the newly synthesized, radioactively labeled protein in leaf discs from salt-treated plants. Nontreated plants were characterized by a low level of the enzyme and low rates of PEPcase synthesis. Synthesis of this enzyme in leaf discs was correlated with the concentration of NaCl in the nutrient solution during growth. Images Fig. 1 Fig. 2 Fig. 3 PMID:16665363
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T
2012-01-01
Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contentsmore » were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.« less
Laufenberg, Lacee; Kazi, Abid A.; Lang, Charles H.
2014-01-01
Small molecule nonpeptidyl molecules are potentially attractive drug candidates as adjunct therapies in the treatment of sepsis-induced metabolic complications. As such, the current study investigates the use of aurintricarboxylic acid (ATA), which stimulates insulin-like growth factor (IGF)-I receptor and AKT signaling, for its ability to ameliorate the protein metabolic effects of endotoxin (LPS) + interferon (IFN)γ in C2C12 myotubes and sepsis in skeletal muscle. ATA dose- and time-dependently increases mTOR-dependent protein synthesis. Pretreatment with ATA prevents the LPS/IFNγ-induced decrease in protein synthesis at least in part by maintaining mTOR kinase activity, while post-treatment with ATA is able to increase protein synthesis when added up to 6 h after LPS/IFNγ. ATA also reverses the amino acid resistance which is detected in response to nutrient deprivation. Conversely, ATA decreases the basal rate of protein degradation and prevents the LPS/IFNγ-increase in proteolysis, and the latter change is associated reduced atrogin-1 and MuRF1 mRNA. The ability of ATA to antagonize LPS/IFNγ-induced changes in protein metabolism were associated with its ability to prevent the increases in IL-6 and NOS2 and decreases in IGF-I. In vivo studies indicate ATA acutely increases skeletal muscle, but not cardiac, protein synthesis, and attenuates the loss of lean body mass over 5 days. These data suggest ATA and other small molecule agonists of endogenous anabolic hormones may prove beneficial in treating sepsis by decreasing the inflammatory response and improving muscle protein balance. PMID:24430547
Gorissen, Stefan Hm; Horstman, Astrid Mh; Franssen, Rinske; Kouw, Imre Wk; Wall, Benjamin T; Burd, Nicholas A; de Groot, Lisette Cpgm; van Loon, Luc Jc
2017-02-01
of dietary protein-derived amino acids in the circulation and does not lower basal muscle protein synthesis rates or increase postprandial muscle protein synthesis rates after ingestion of 25 g protein in older men. This trial was registered at clinicaltrials.gov as NCT01986842. © 2017 American Society for Nutrition.
Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies
Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa
2014-01-01
In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356
Abscisic Acid Synthesis and Response
Finkelstein, Ruth
2013-01-01
Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463
Chiral Sugars Drive Enantioenrichment in Prebiotic Amino Acid Synthesis.
Wagner, Alexander J; Zubarev, Dmitry Yu; Aspuru-Guzik, Alán; Blackmond, Donna G
2017-04-26
Chiral pentose sugars mediate the enantioselective synthesis of amino acid precursors, with the magnitude of the chiral induction dictated by a subtle cooperativity between sugar hydroxyl groups. Ribose and lyxose give opposite chiral preferences, and theoretical calculations reveal the pseudoenantiomeric nature of transition state structures from the two sugars. Prebiotically plausible mixtures of natural d-sugars lead to enantioenrichment of natural l-amino acid precursors. Temporal monitoring and kinetic modeling of the reaction reveal an unusual dynamic kinetic resolution that shifts toward an enantioselective pathway over time, providing an amplification mechanism for the transfer of chiral information. This work adds to growing evidence for synergy in the etiology of the single chirality of the two most important classes of biological molecules, the sugars that make up DNA and RNA and the amino acids that form proteins.
Chiral Sugars Drive Enantioenrichment in Prebiotic Amino Acid Synthesis
2017-01-01
Chiral pentose sugars mediate the enantioselective synthesis of amino acid precursors, with the magnitude of the chiral induction dictated by a subtle cooperativity between sugar hydroxyl groups. Ribose and lyxose give opposite chiral preferences, and theoretical calculations reveal the pseudoenantiomeric nature of transition state structures from the two sugars. Prebiotically plausible mixtures of natural d-sugars lead to enantioenrichment of natural l-amino acid precursors. Temporal monitoring and kinetic modeling of the reaction reveal an unusual dynamic kinetic resolution that shifts toward an enantioselective pathway over time, providing an amplification mechanism for the transfer of chiral information. This work adds to growing evidence for synergy in the etiology of the single chirality of the two most important classes of biological molecules, the sugars that make up DNA and RNA and the amino acids that form proteins. PMID:28470050
Barrows, Brian R; Timlin, Maureen T; Parks, Elizabeth J
2005-09-01
The present study quantified dietary fatty acid flux in healthy men (n = 6) who were fed a liquid formula through a duodenal feeding tube (continuous feeding group) or who consumed the same formula in meals (meal feeding group). A triacylglycerol (TAG) stable isotope was added to the formula to determine the entry of dietary fatty acids into the serum and its clearance to the liver and resecretion into serum via VLDL. The contribution of dietary fatty acids to serum nonesterified fatty acids (NEFAs) was higher with meal feeding (24.4 +/- 2.6%) compared with continuous feeding (10.8 +/- 2.9%, P < 0.01) and, when multiplied by the NEFA concentration, resulted in similar absolute fatty acid spillover. Diet-derived NEFAs subsequently represented 10.6 +/- 1.2% and 4.7 +/- 1.3% of hepatic VLDL-TAG (meal feeding vs. continuous feeding, respectively, P = 0.004). Chylomicron remnant uptake by the liver contributed 9.3 +/- 1.9% of fatty acids to hepatic VLDL-TAG synthesis with meal feeding compared with continuous feeding (4.4 +/- 0.8%, P < 0.03). These data suggest that the extent of dietary fatty acid recycling via serum NEFAs and VLDL-TAG is determined by the rate of delivery of dietary fat to the intestine. The inefficient removal of dietary fat from the circulation may maintain VLDL-TAG production but may also result in prolonged postprandial lipemia.
St-Onge, Marie-Pierre; Farnworth, Edward R; Savard, Tony; Chabot, Denise; Mafu, Akier; Jones, Peter JH
2002-01-01
Background Fermented milk products have been shown to affect serum cholesterol concentrations in humans. Kefir, a fermented milk product, has been traditionally consumed for its potential health benefits but has to date not been studied for its hypocholesterolemic properties. Methods Thirteen healthy mildly hypercholesterolemic male subjects consumed a dairy supplement in randomized crossover trial for 2 periods of 4 wk each. Subjects were blinded to the dairy supplement consumed. Blood samples were collected at baseline and after 4 wk of supplementation for measurement of plasma total, low-density lipoprotein, and high-density lipoprotein cholesterol and triglyceride concentrations, as well as fatty acid profile and cholesterol synthesis rate. Fecal samples were collected at baseline and after 2 and 4 wk of supplementation for determination of fecal short chain fatty acid level and bacterial content. Results Kefir had no effect on total cholesterol, low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglyceride concentrations nor on cholesterol fractional synthesis rates after 4 wk of supplementation. No significant change on plasma fatty acid levels was observed with diet. However, both kefir and milk increased (p < 0.05) fecal isobutyric, isovaleric and propionic acids as well as the total amount of fecal short chain fatty acids. Kefir supplementation resulted in increased fecal bacterial content in the majority of the subjects. Conclusions Since kefir consumption did not result in lowered plasma lipid concentrations, the results of this study do not support consumption of kefir as a cholesterol-lowering agent. PMID:11825344
Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao
2011-01-01
Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122
Yin, Haisong; Zhang, Renkuan; Xia, Menglei; Bai, Xiaolei; Mou, Jun; Zheng, Yu; Wang, Min
2017-06-15
Acetic acid bacteria (AAB) are widely applied in food, bioengineering and medicine fields. However, the acid stress at low pH conditions limits acetic acid fermentation efficiency and high concentration of vinegar production with AAB. Therefore, how to enhance resistance ability of the AAB remains as the major challenge. Amino acids play an important role in cell growth and cell survival under severe environment. However, until now the effects of amino acids on acetic fermentation and acid stress resistance of AAB have not been fully studied. In the present work the effects of amino acids on metabolism and acid stress resistance of Acetobacter pasteurianus were investigated. Cell growth, culturable cell counts, acetic acid production, acetic acid production rate and specific production rate of acetic acid of A. pasteurianus revealed an increase of 1.04, 5.43, 1.45, 3.30 and 0.79-folds by adding aspartic acid (Asp), and cell growth, culturable cell counts, acetic acid production and acetic acid production rate revealed an increase of 0.51, 0.72, 0.60 and 0.94-folds by adding glutamate (Glu), respectively. For a fully understanding of the biological mechanism, proteomic technology was carried out. The results showed that the strengthening mechanism mainly came from the following four aspects: (1) Enhancing the generation of pentose phosphates and NADPH for the synthesis of nucleic acid, fatty acids and glutathione (GSH) throughout pentose phosphate pathway. And GSH could protect bacteria from low pH, halide, oxidative stress and osmotic stress by maintaining the viability of cells through intracellular redox equilibrium; (2) Reinforcing deamination of amino acids to increase intracellular ammonia concentration to maintain stability of intracellular pH; (3) Enhancing nucleic acid synthesis and reparation of impaired DNA caused by acid stress damage; (4) Promoting unsaturated fatty acids synthesis and lipid transport, which resulted in the improvement of cytomembrane
2010-06-11
the cinnamic acid phenyl ring. Although compound 4c proved to be very cytotoxic in HUVEC over a 24 h period, the toxicity is less apparent over a 5 h...drug development process, as it determines how much of the initial dose actually reaches the target site. Cinnamic acid -derived amides are known to...Synthesis of a series of caffeic acid phenethyl amide (CAPA) fluorinated derivatives: Comparison of cytoprotective effects to caffeic acid phenethyl
Nuclear Synthesis of Cytoplasmic Ribonucleic Acid in Amoeba proteus
Prescott, David M.
1959-01-01
The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells. PMID:14434750
Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.
PRESCOTT, D M
1959-10-01
The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.
Velasco-Lozano, Susana; da Silva, Eunice S; Llop, Jordi; López-Gallego, Fernando
2018-02-16
The enzymatic synthesis of α-amino acids is a sustainable and efficient alternative to chemical processes, through which achieving enantiopure products is difficult. To more address this synthesis efficiently, a hierarchical architecture that irreversibly co-immobilises an amino acid dehydrogenase with polyethyleneimine on porous agarose beads has been designed and fabricated. The cationic polymer acts as an irreversible anchoring layer for the formate dehydrogenase. In this architecture, the two enzymes and polymer colocalise across the whole microstructure of the porous carrier. This multifunctional heterogeneous biocatalyst was kinetically characterised and applied to the enantioselective synthesis of a variety of canonical and noncanonical α-amino acids in both discontinuous (batch) and continuous modes. The co-immobilised bienzymatic system conserves more than 50 % of its initial effectiveness after five batch cycles and 8 days of continuous operation. Additionally, the environmental impact of this process has been semiquantitatively calculated and compared with the state of the art. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Huang, Huan; McIntosh, Avery L.; Martin, Gregory G.; Petrescu, Anca D.; Landrock, Kerstin K.; Landrock, Danilo; Kier, Ann B.; Schroeder, Friedhelm
2013-01-01
While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor-α (PPARα) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPARα transcription of the fatty acid β-oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPARα in the context of high glucose at levels similar to those in uncontrolled diabetes. PMID:23533380
USDA-ARS?s Scientific Manuscript database
The postprandial rise in amino acids, particularly leucine, stimulates muscle protein synthesis in neonates. Previously, we showed that a 1-h infusion of leucine increased protein synthesis, but this response was not sustained for 2 h unless the leucine-induced decrease in amino acids was prevented....
Tannus, Andrea Ferreira S; Darmaun, Dominique; Ribas, Durval F; Oliveira, José Eduardo D; Marchini, Julio Sergio
2009-08-01
It has been demonstrated that glutamine, a conditionally essential amino acid, improves nitrogen balance, acts as a stimulant of protein synthesis, and decreases proteolysis in myopathic children. In contrast, other studies have shown no beneficial effect of glutamine supplementation on burn victims or critically ill patients. Nonetheless, we hypothesized that glutamine supplementation would increase the fractional protein synthesis rate (FSR) in the jejunal mucosa of malnourished male Wistar rats. Thus, the objective of the present study was to test the effect of daily oral glutamine supplementation (0.42 g kg(-1) d(-1) for 14 days) on the FSR of the jejunal mucosa of healthy and malnourished rats. A 4-hour kinetic study with l-[1-(13)C]leucine was subsequently performed, and jejunal biopsies were obtained 1.5 cm from the Treitz angle and analyzed. Malnourished rats showed a 25% weight loss and increased urinary nitrogen excretion. Plasma amino acid concentration did not differ between groups. (13)C enrichment in plasma and jejunal cells was higher in the malnourished groups than in the healthy group. The FSR (percent per hour) was similar for the control and experimental groups (P > .05), with a mean range of 22%/h to 27%/h. Oral glutamine supplementation alone did not induce higher protein incorporation by the jejunal mucosa in malnourished rats, regardless of total food intake or the presence or absence of glutamine supplementation.
Malcher-Lopes, Renato; Franco, Alier; Tasker, Jeffrey G.
2008-01-01
Glucocorticoids are capable of exerting both genomic and non-genomic actions in target cells of multiple tissues, including the brain, which trigger an array of electrophysiological, metabolic, secretory and inflammatory regulatory responses. Here, we have attempted to show how glucocorticoids may generate a rapid anti-inflammatory response by promoting arachidonic acid-derived endocannabinoid biosynthesis. According to our hypothesized model, non-genomic action of glucocorticoids results in the global shift of membrane lipid metabolism, subverting metabolic pathways toward the synthesis of the anti-inflammatory endocannabinoids, anandamide (AEA) and 2-arachidonoyl-glycerol (2-AG), and away from arachidonic acid production. Post-transcriptional inhibition of cyclooxygenase-2 (COX2) synthesis by glucocorticoids assists this mechanism by suppressing the synthesis of pro-inflammatory prostaglandins as well as endocannabinoid-derived prostanoids. In the central nervous system (CNS) this may represent a major neuroprotective system, which may cross-talk with leptin signaling in the hypothalamus allowing for the coordination between energy homeostasis and the inflammatory response. PMID:18295199
Hashim, Puziah
2014-03-01
Centella asiatica (Linn.) Urban is well known in promoting wound healing and provides significant benefits in skin care and therapeutic products formulation. Glycolic acid and vitamins also play a role in the enhancement of collagen and fibronectin synthesis. Here, we evaluate the specific effect of Centella asiatica (CA), vitamins, glycolic acid and their mixture preparations to stimulate collagen and fibronectin synthesis in cultured human fibroblast cells. The fibroblast cells are incubated with CA, glycolic acid, vitamins and their mixture preparations for 48 h. The cell lysates were analyzed for protein content and collagen synthesis by direct binding enzyme immunoassay. The fibronectin of the cultured supernatant was measured by sandwich enzyme immunoassay. The results showed that CA, glycolic acid, vitamins A, E and C significantly stimulate collagen and fibronectin synthesis in the fibroblast. Addition of glycolic acid and vitamins to CA further increased the levels of collagen and fibronectin synthesis to 8.55 and 23.75 μg/100 μg, respectively. CA, glycolic acid, vitamins A, E, and C, and their mixtures demonstrated stimulatory effect on both extra-cellular matrix synthesis of collagen and fibronectin in in vitro studies on human foreskin fibroblasts, which is beneficial to skin care and therapeutic products formulation.
NASA Astrophysics Data System (ADS)
Li, Li; Liu, Jianbo; Yang, Xiaohai; Huang, Jin; He, Dinggeng; Guo, Xi; Wan, Lan; He, Xiaoxiao; Wang, Kemin
2016-03-01
Amino acid-dithiocarbamate (amino acid-DTC) was developed as both the reductant and ligand stabilizer for biomimetic synthesis of gold nanoparticles (AuNPs), which served as an excellent surface-enhanced Raman scattering (SERS) contrast nanoprobe for cell imaging. Glycine (Gly), glutamic acid (Glu), and histidine (His) with different isoelectric points were chosen as representative amino acid candidates to synthesize corresponding amino acid-DTC compounds through mixing with carbon disulfide (CS2), respectively. The pyrogenic decomposition of amino acid-DTC initiated the reduction synthesis of AuNPs, and the strong coordinating dithiocarbamate group of amino acid-DTC served as a stabilizer that grafted onto the surface of the AuNPs, which rendered the as-prepared nanoparticles a negative surface charge and high colloidal stability. MTT cell viability assay demonstrated that the biomimetic AuNPs possessed neglectful toxicity to the human hepatoma cell, which guaranteed them good biocompatibility for biomedical application. Meanwhile, the biomimetic AuNPs showed a strong SERS effect with an enhancement factor of 9.8 × 105 for the sensing of Rhodamine 6G, and two distinct Raman peaks located at 1363 and 1509 cm-1 could be clearly observed in the cell-imaging experiments. Therefore, biomimetic AuNPs can be explored as an excellent SERS contrast nanoprobe for biomedical imaging, and the amino acid-DTC mediated synthesis of the AuNPs has a great potential in bio-engineering and biomedical imaging applications.
NASA Technical Reports Server (NTRS)
Fedorov, I. V.; Chernyy, A. V.; Fedorov, A. I.
1978-01-01
During hypokinesia and physical loading (swimming) of rats, the radioactivity of skeletal muscle, liver, kidney, heart, and blood proteins was determined after administration of radioactive amino acids. Tissue protein synthesis decreased during hypokinesia, and decomposition increased. Both synthesis and decomposition increased during physical loading, but anabolic processes predominated in the total tissue balance. The weights of the animals decreased in hypokinesia and increased during increased muscle activity.
Craig, Sandra
2011-01-01
Carbohydrates in various forms play a vital role in numerous critical biological processes. The detection of such saccharides can give insight into the progression of such diseases such as cancer. Boronic acids react with 1,2 and 1,3 diols of saccharides in non-aqueous or basic aqueous media. Herein, we describe the design, synthesis and evaluation of three bisboronic acid fluorescent probes, each having about ten linear steps in its synthesis. Among these compounds that were evaluated, 9b was shown to selectively label HepG2, liver carcinoma cell line within a concentration range of 0.5–10 μM in comparison to COS-7, a normal fibroblast cell line. PMID:22177855
USDA-ARS?s Scientific Manuscript database
In neonatal pigs, sepsis decreases protein synthesis in skeletal muscle by decreasing translation initiation. However, insulin stimulates muscle protein synthesis despite persistent repression of translation initiation signaling. To determine whether the insulin-induced increase in global rates of m...
Hansen, H O; Grunnet, I; Knudsen, J
1984-01-01
Goat mammary-gland microsomal fraction by itself induces synthesis of medium-chain-length fatty acids by goat mammary fatty acid synthetase and incorporates short- and medium-chain fatty acids into triacylglycerol. Addition of ATP in the absence or presence of Mg2+ totally inhibits triacylglycerol synthesis from short- and medium-chain fatty acids, and severely inhibits synthesis de novo of medium-chain fatty acids. The inhibition by ATP of fatty acid synthesis and triacylglycerol synthesis de novo can be relieved by glycerol 3-phosphate. The effect of ATP could not be mimicked by the non-hydrolysable ATP analogue, adenosine 5'-[beta,gamma-methylene]triphosphate and could not be shown to be caused by inhibition of the diacylglycerol acyltransferase by a phosphorylation reaction. Possible explanations for the mechanism of the inhibition by ATP are discussed, and a hypothetical model for its action is outlined. PMID:6547605
RETINOIC ACID SYNTHESIS AND DEGRADATION
Kedishvili, Natalia Y.
2017-01-01
Retinoic acid was identified as the biologically active form of vitamin A almost 70 years ago, but the exact enzymes and control mechanisms that regulate its biosynthesis and degradation are yet to be fully defined. The currently accepted model postulates that RA is produced in two sequential oxidative steps: first, retinol is oxidized reversibly to retinaldehyde, and then retinaldehyde is oxidized irreversibly to RA, which is inactivated by conversion to hydroxylated derivatives. This chapter describes the history, development and recent advances in our understanding of the enzymatic pathways and mechanisms that control the rate of RA production and degradation. Gene knockout studies provided strong evidence that the members of the short chain dehydrogenase reductase superfamily of proteins play indispensable roles in retinoic acid biosynthesis during development. Furthermore, recent finding that two of these proteins regulate the rate of retinoic acid biosynthesis by mutually activating each other provided a novel insight into the mechanism of this regulation. Despite significant progress made since the middle of the 20th century many unanswered questions still remain, and there is much to be learned, especially about trafficking of the hydrophobic retinoid substrates between membrane bound and cytosolic enzymes and the roles of the retinoid binding proteins. PMID:27830503
Synthesis and antimycobacterial activity of isoniazid derivatives from renewable fatty acids.
Rodrigues, Marieli O; Cantos, Jéssica B; D'Oca, Caroline R Montes; Soares, Karina L; Coelho, Tatiane S; Piovesan, Luciana A; Russowsky, Dennis; da Silva, Pedro A; D'Oca, Marcelo G Montes
2013-11-15
This work describes the synthesis of a series of fatty acid hydrazide derivatives of isoniazid (INH). The compounds were tested against Mycobacterium tuberculosis H37Rv (ATCC 27294) as well as INH-resistant (ATCC 35822 and 1896 HF) and rifampicin-resistant (ATCC 35338) M. tuberculosis strains. The fatty acid derivatives of INH showed high antimycobacterial potency against the studied strains, which is desirable for a pharmaceutical compound, suggesting that the increased lipophilicity of isoniazid plays an important role in its antimycobacterial activity. Copyright © 2013 Elsevier Ltd. All rights reserved.
Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K
2015-10-10
Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale. Copyright © 2015 Elsevier B.V. All rights reserved.
Bell, R M
1974-03-01
sn-Glycerol 3-phosphate (G3P) auxotrophs of Escherichia coli have been selected from a strain which cannot aerobically catabolize G3P. The auxotrophy resulted from loss of the biosynthetic G3P dehydrogenase (EC 1.1.1.8) or from a defective membranous G3P acyltransferase. The apparent K(m) of the acyltransferase for G3P was 11- to 14-fold higher (from about 90 mum to 1,000 to 1,250 mum) in membrane preparations from the mutants than those of the parent. All extracts prepared from revertants of the G3P dehydrogenase mutants showed G3P dehydrogenase activity, but most contained less than 10% of the wild-type level. Membrane preparations from revertants of the acyltransferase mutants had apparent K(m)'s for G3P similar to that of the parent. Strains have been derived in which the G3P requirement can be satisfied with glycerol in the presence of glucose, presumably because the glycerol kinase was desensitized to inhibition by fructose 1,6-diphosphate. Investigations on the growth and macromolecular synthesis in a G3P acyltransferase K(m) mutant revealed that upon glycerol deprivation, net phospholipid synthesis stopped immediately; growth continued for about one doubling; net ribonucleic acid (RNA), deoxyribonucleic acid (DNA), and protein nearly doubled paralleling the growth curve; the rate of phospholipid synthesis assessed by labeling cells with (32)P-phosphate, (14)C-acetate, or (3)H-serine was reduced greater than 90%; the rates of RNA and DNA synthesis increased as the cells grew and then decreased as the cells stopped growing; the rate of protein synthesis showed no increase and declined more slowly than the rates of RNA and DNA synthesis when the cells stopped growing. The cells retained and gained in the capacity to synthesize phospholipids upon glycerol deprivation. These data indicate that net phospholipid synthesis is not required for continued macromolecular synthesis for about one doubling, and that the rates of these processes are not coupled during this
Parsons, Joshua B.; Frank, Matthew W.; Subramanian, Chitra; Saenkham, Panatda; Rock, Charles O.
2011-01-01
The rationale for the pursuit of bacterial type 2 fatty acid synthesis (FASII) as a target for antibacterial drug discovery in Gram-positive organisms is being debated vigorously based on their ability to incorporate extracellular fatty acids. The regulation of FASII by extracellular fatty acids was examined in Staphylococcus aureus and Streptococcus pneumoniae, representing two important groups of pathogens. Both bacteria use the same enzymatic tool kit for the conversion of extracellular fatty acids to acyl-acyl carrier protein, elongation, and incorporation into phospholipids. Exogenous fatty acids completely replace the endogenous fatty acids in S. pneumoniae but support only 50% of phospholipid synthesis in S. aureus. Fatty acids overcame FASII inhibition in S. pneumoniae but not in S. aureus. Extracellular fatty acids strongly suppress malonyl-CoA levels in S. pneumoniae but not in S. aureus, showing a feedback regulatory system in S. pneumoniae that is absent in S. aureus. Fatty acids overcame either a biochemical or a genetic block at acetyl-CoA carboxylase (ACC) in S. aureus, confirming that regulation at the ACC step is the key difference between these two species. Bacteria that possess a stringent biochemical feedback inhibition of ACC and malonyl-CoA formation triggered by environmental fatty acids are able to circumvent FASII inhibition. However, if exogenous fatty acids do not suppress malonyl-CoA formation, FASII inhibitors remain effective in the presence of fatty acid supplements. PMID:21876172
Efficient synthesis of anacardic acid analogues and their antibacterial activities.
Mamidyala, Sreeman K; Ramu, Soumya; Huang, Johnny X; Robertson, Avril A B; Cooper, Matthew A
2013-03-15
Anacardic acid derivatives exhibit a broad range of biological activities. In this report, an efficient method for the synthesis of anacardic acid derivatives was explored, and a small set of salicylic acid variants synthesised retaining a constant hydrophobic element (a naphthyl tail). The naphthyl side chain was introduced via Wittig reaction and the aldehyde installed using directed ortho-metalation reaction of the substituted o-anisic acids. The failure of ortho-metalation using unprotected carboxylic acid group compelled us to use directed ortho-metalation in which a tertiary amide was used as a strong ortho-directing group. In the initial route, tertiary amide cleavage during final step was challenging, but cleaving the tertiary amide before Wittig reaction was beneficial. The Wittig reaction with protected carboxylic group (methyl ester) resulted in side-products whereas using sodium salt resulted in higher yields. The novel compounds were screened for antibacterial activity and cytotoxicity. Although substitution on the salicylic head group enhanced antibacterial activities they also enhanced cytotoxicity. Copyright © 2013 Elsevier Ltd. All rights reserved.
Meganathan, R; Bentley, R
1983-01-01
Cell-free extracts of various strains of Escherichia coli synthesize the menaquinone biosynthetic intermediate o-succinylbenzoic acid (OSB) when supplied with chorismic acid, 2-ketoglutaric acid, and thiamine pyrophosphate (TPP). To assay for OSB synthesis, 2-[U-14C]ketoglutaric acid was used as substrate, and the synthesized OSB was examined by radiogas chromatography (as the dimethyl ester). [U-14C]Shikimic acid also gave rise to radioactive OSB if the cofactors necessary for enzymatic conversion to chorismic acid were added. Use of 2-[1-14C]ketoglutaric acid does not give rise to labeled OSB. In the absence of TPP during the incubations, OSB synthesis was much reduced; these observations are consistent with the proposed role for the succinic semialdehyde-TPP anion as the reagent adding to chorismic acid. Extracts of cells from menC and menD mutants did not form OSB separately, but did so in combination. There was evidence for formation of a product, X, by extracts of a menC mutant incubated with chorismic acid, TPP, and 2-ketoglutaric acid; X was converted to OSB by extracts of a menD mutant. It appears that the intermediate, X, is formed by one gene product and converted to OSB by the second gene product. PMID:6337125
Synthesis and Anti-microbial Activity of Novel Phosphatidylethanolamine-N-amino Acid Derivatives.
Vijeetha, Tadla; Balakrishna, Marrapu; Karuna, Mallampalli Sri Lakshmi; Surya Koppeswara Rao, Bhamidipati Venkata; Prasad, Rachapudi Badari Narayana; Kumar, Koochana Pranay; Surya Narayana Murthy, Upadyaula
2015-01-01
The study involved synthesis of five novel amino acid derivatives of phosphatidylethanolamine isolated from egg yolk lecithin employing a three step procedure i) N-protection of L-amino acids with BOC anhydride in alkaline medium ii) condensation of - CO2H group of N-protected amino acid with free -NH2 of PE by a peptide linkage and iii) deprotection of N-protected group of amino acids to obtain phosphatidylethanolamine-N-amino acid derivatives in 60-75% yield. The five L-amino acids used were L glycine, L-valine, L-leucine, L-isoleucine and L-phenylalanine. The amino acid derivatives were screened for anti-baterial activity against B. subtilis, S. aureus, P. aeroginosa and E. coli taking Streptomycin as reference compound and anti-fungal activity against C. albicans, S. cervisiae, A. niger taking AmphotericinB as reference compound. All the amino acid derivatives exhibited extraordinary anti-bacterial activities about 3 folds or comparable to Streptomycin and moderate or no anti-fungal activity against Amphotericin-B.
Cline, Gary W; Pongratz, Rebecca L; Zhao, Xiaojian; Papas, Klearchos K
2011-11-11
Mechanistic models of glucose stimulated insulin secretion (GSIS) established in minimal media in vitro, may not accurately describe the complexity of coupling metabolism with insulin secretion that occurs in vivo. As a first approximation, we have evaluated metabolic pathways in a typical growth media, DMEM as a surrogate in vivo medium, for comparison to metabolic fluxes observed under the typical experimental conditions using the simple salt-buffer of KRB. Changes in metabolism in response to glucose and amino acids and coupling to insulin secretion were measured in INS-1 832/13 cells. Media effects on mitochondrial function and the coupling efficiency of oxidative phosphorylation were determined by fluorometrically measured oxygen consumption rates (OCRs) combined with (31)P NMR measured rates of ATP synthesis. Substrate preferences and pathways into the TCA cycle, and the synthesis of mitochondrial 2nd messengers by anaplerosis were determined by (13)C NMR isotopomer analysis of the fate of [U-(13)C] glucose metabolism. Despite similar incremental increases in insulin secretion, the changes of OCR in response to increasing glucose from 2.5 to 15mM were blunted in DMEM relative to KRB. Basal and stimulated rates of insulin secretion rates were consistently higher in DMEM, while ATP synthesis rates were identical in both DMEM and KRB, suggesting greater mitochondrial uncoupling in DMEM. The relative rates of anaplerosis, and hence synthesis and export of 2nd messengers from the mitochondria were found to be similar in DMEM to those in KRB. And, the correlation of total PC flux with insulin secretion rates in DMEM was found to be congruous with the correlation in KRB. Together, these results suggest that signaling mechanisms associated with both TCA cycle flux and with anaplerotic flux, but not ATP production, may be responsible for the enhanced rates of insulin secretion in more complex, and physiologically-relevant media. Copyright © 2011 Elsevier Inc. All
Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis
Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet
2011-01-01
Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689
Individual bile acids have differential effects on bile acid signaling in mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Song, Peizhen, E-mail: songacad@gmail.com; Rockwell, Cheryl E., E-mail: rockwelc@msu.edu; Cui, Julia Yue, E-mail: juliacui@uw.edu
2015-02-15
Bile acids (BAs) are known to regulate BA synthesis and transport by the farnesoid X receptor in the liver (FXR-SHP) and intestine (FXR-Fgf15). However, the relative importance of individual BAs in regulating these processes is not known. Therefore, mice were fed various doses of five individual BAs, including cholic acid (CA), chenodeoxycholic acid (CDCA), deoxoycholic acid (DCA), lithocholic acid (LCA), and ursodeoxycholic acid (UDCA) in their diets at various concentrations for one week to increase the concentration of one BA in the enterohepatic circulation. The mRNA of BA synthesis and transporting genes in liver and ileum were quantified. In themore » liver, the mRNA of SHP, which is the prototypical target gene of FXR, increased in mice fed all concentrations of BAs. In the ileum, the mRNA of the intestinal FXR target gene Fgf15 was increased at lower doses and to a higher extent by CA and DCA than by CDCA and LCA. Cyp7a1, the rate-limiting enzyme in BA synthesis, was decreased more by CA and DCA than CDCA and LCA. Cyp8b1, the enzyme that 12-hydroxylates BAs and is thus responsible for the synthesis of CA, was decreased much more by CA and DCA than CDCA and LCA. Surprisingly, neither a decrease in the conjugated BA uptake transporter (Ntcp) nor increase in BA efflux transporter (Bsep) was observed by FXR activation, but an increase in the cholesterol efflux transporter (Abcg5/Abcg8) was observed with FXR activation. Thus in conclusion, CA and DCA are more potent FXR activators than CDCA and LCA when fed to mice, and thus they are more effective in decreasing the expression of the rate limiting gene in BA synthesis Cyp7a1 and the 12-hydroxylation of BAs Cyp8b1, and are also more effective in increasing the expression of Abcg5/Abcg8, which is responsible for biliary cholesterol excretion. However, feeding BAs do not alter the mRNA or protein levels of Ntcp or Bsep, suggesting that the uptake or efflux of BAs is not regulated by FXR at physiological and
Huang, Huan; McIntosh, Avery L; Martin, Gregory G; Petrescu, Anca D; Landrock, Kerstin K; Landrock, Danilo; Kier, Ann B; Schroeder, Friedhelm
2013-01-01
While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor- α (PPAR α ) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPAR α transcription of the fatty acid β -oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPAR α in the context of high glucose at levels similar to those in uncontrolled diabetes.
Modak, Sohan P.; Setlow, Jane K.
1969-01-01
Synthesis of deoxyribonucleic acid (DNA) has been measured as a function of ultraviolet (UV) radiation dose in wild-type and seven UV-sensitive strains of Haemophilus influenzae. At the UV doses used, all strains were able to resume DNA synthesis, even those which are unable to excise pyrimidine dimers from their DNA. These excisionless strains showed longer UV-induced delays in DNA synthesis than all but one of the other strains. The longest delay was shown by DB117, a strain which can excise dimers but which is recombination deficient and unable to rejoin X ray-induced single-strand breaks. All strains showed a progressive decrease in sensitivity as they approached the stationary phase. PMID:5305934
Le, Quang Anh Tuan; Kim, Hee Gon; Kim, Yong Hwan
2018-09-01
The electro-biocatalytic conversion of CO 2 into formic acid using whole-cell and isolated biocatalysts is useful as an alternative route for CO 2 sequestration. In this study, Shewanella oneidensis MR-1 (S. oneidensis MR-1), a facultative aerobic bacterium that has been extensively studied for its utility as biofuel cells as well as for the detoxification of heavy metal oxides (i.e., MnO 2 , uranium), has been applied for the first time as a whole-cell biocatalyst for formic acid synthesis from gaseous CO 2 and electrons supplied from an electrode. S. oneidensis MR-1, when aerobically grown in Luria-Bertani (LB) medium, exhibited its ability as a whole-cell biocatalyst for the conversion of CO 2 into formic acid with moderate productivity of 0.59 mM h -1 for 24 h. In addition, an optimization of growth conditions of S. oneidensis MR-1 resulted in a remarkable increase in productivity. The CO 2 reduction reaction catalyzed by S. oneidensis MR-1, when anaerobically grown in newly optimized LB medium supplemented with fumarate and nitrate, exhibited 3.2-fold higher productivity (1.9 mM h -1 for 72 h) compared to that grown aerobically in only LB medium. Furthermore, the average conversion rate of formic acid synthesis catalyzed by S. oneidensis MR-1 when grown in the optimal medium over a period of 72 h was 3.8 mM h -1 g -1 wet-cell, which is 9.6-fold higher than that catalyzed by Methylobacterium extorquens AM1 whole-cells in our previous study. Copyright © 2018 Elsevier Inc. All rights reserved.
CO- and HCl-free synthesis of acid chlorides from unsaturated hydrocarbons via shuttle catalysis
NASA Astrophysics Data System (ADS)
Fang, Xianjie; Cacherat, Bastien; Morandi, Bill
2017-11-01
The synthesis of carboxylic acid derivatives from unsaturated hydrocarbons is an important process for the preparation of polymers, pharmaceuticals, cosmetics and agrochemicals. Despite its industrial relevance, the traditional Reppe-type carbonylation reaction using pressurized CO is of limited applicability to laboratory-scale synthesis because of: (1) the safety hazards associated with the use of CO, (2) the need for special equipment to handle pressurized gas, (3) the low reactivity of several relevant nucleophiles and (4) the necessity to employ different, often tailor-made, catalytic systems for each nucleophile. Herein we demonstrate that a shuttle-catalysis approach enables a CO- and HCl-free transfer process between an inexpensive reagent, butyryl chloride, and a wide range of unsaturated substrates to access the corresponding acid chlorides in good yields. This new transformation provides access to a broad range of carbonyl-containing products through the in situ transformation of the reactive acid chloride intermediate. In a broader context, this work demonstrates that isodesmic shuttle-catalysis reactions can unlock elusive catalytic reactions.
Fan, Jilian; Yan, Chengshi; Zhang, Xuebin; Xu, Changcheng
2013-01-01
There is growing interest in engineering green biomass to expand the production of plant oils as feed and biofuels. Here, we show that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is a critical enzyme involved in triacylglycerol (TAG) synthesis in leaves. Overexpression of PDAT1 increases leaf TAG accumulation, leading to oil droplet overexpansion through fusion. Ectopic expression of oleosin promotes the clustering of small oil droplets. Coexpression of PDAT1 with oleosin boosts leaf TAG content by up to 6.4% of the dry weight without affecting membrane lipid composition and plant growth. PDAT1 overexpression stimulates fatty acid synthesis (FAS) and increases fatty acid flux toward the prokaryotic glycerolipid pathway. In the trigalactosyldiacylglycerol1-1 mutant, which is defective in eukaryotic thylakoid lipid synthesis, the combined overexpression of PDAT1 with oleosin increases leaf TAG content to 8.6% of the dry weight and total leaf lipid by fourfold. In the plastidic glycerol-3-phosphate acyltransferase1 mutant, which is defective in the prokaryotic glycerolipid pathway, PDAT1 overexpression enhances TAG content at the expense of thylakoid membrane lipids, leading to defects in chloroplast division and thylakoid biogenesis. Collectively, these results reveal a dual role for PDAT1 in enhancing fatty acid and TAG synthesis in leaves and suggest that increasing FAS is the key to engineering high levels of TAG accumulation in green biomass. PMID:24076979
NASA Astrophysics Data System (ADS)
Rahmayetty, Sukirno, Prasetya, Bambang; Gozan, Misri
2017-02-01
Lactide is the monomer for the polymer polylactic acid (PLA) from lactic acid through polycondensation and depolymerization process. The properties of PLA strongly depend on the quality of the lactide monomer from which it is synthesized. Optical purity of lactide produced in depolymerization process confirmed to be L-lactide. The highest yield of crude lactide was 38.5% at temperature 210 °C with average molecular weight (Mn) of oligomer was 2389. Ring opening polymerization of lactide using Candida rugosa lipase as biocatalyst to PLLA synthesis has been achieved to generate useful biomedical materials free from heavy metal.
NASA Astrophysics Data System (ADS)
Huo, Silu; Liu, Mingquan; Wu, Linlin; Liu, Mingjie; Xu, Min; Ni, Wei; Yan, Yi-Ming
2018-05-01
Nitrogen and sulfur co-doped carbons are considered as electrode materials for high performance supercapacitors, while their further development is still limited by complicated synthesis procedure, unsatisfied structure and low energy density. Developing a simple synthetic strategy to obtain rationally structured carbon materials and high supercapacitor performance is remaining a grand challenge. Herein, we describe the synthesis of nitrogen and sulfur co-doped hierarchical porous carbons as high performance supercapacitors electrode by a methanesulfonic acid-assisted one-step carbonization and activation of the freeze-dried precursors mixture. The as-prepared carbon material not only exhibits ideally hierarchical pores, but also realizes uniform nitrogen and sulfur co-doping. In 6.0 M KOH electrolyte, the material can achieve a high specific capacitance of 272 F g-1 at 1.0 A g-1 and a promising rate performance retaining 172 F g-1 even at 100 A g-1. Moreover, a fabricated symmetric supercapacitor based on as-prepared nitrogen and sulfur co-doped hierarchical porous carbon delivers high energy densities of 12.4 W h kg-1 and 8.0 W h kg-1 in 6.0 M KOH liquid and KOH/PVA solid-state electrolytes, respectively. This work presents a simple and effective methanesulfonic acid-assisted approach for mass production of heteroatomic doping hierarchical porous carbons for future energy storage applications.
One-step synthesis of hydrothermally stable mesoporous aluminosilicates with strong acidity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang Dongjiang; School of Physical and Chemical Sciences, Queensland University of Technology, Brisbane, QLD 4001; Xu Yao
2008-09-15
Using tetraethylorthosilicate (TEOS), polymethylhydrosiloxane (PMHS) and aluminium isopropoxide (AIP) as the reactants, through a one-step nonsurfactant route based on PMHS-TEOS-AIP co-polycondensation, hydrothermally stable mesoporous aluminosilicates with different Si/Al molar ratios were successfully prepared. All samples exclusively showed narrow pore size distribution centered at 3.6 nm. To assess the hydrothermal stability, samples were subjected to 100 deg. C distilled water for 300 h. The boiled mesoporous aluminosilicates have nearly the same N{sub 2} adsorption-desorption isotherms and the same pore size distributions as those newly synthesized ones, indicating excellent hydrothermal stability. The {sup 29}Si MAS NMR spectra confirmed that PMHS and TEOSmore » have jointly condensed and CH{sub 3} groups have been introduced into the materials. The {sup 27}Al MAS NMR spectra indicated that Al atoms have been incorporated in the mesopore frameworks. The NH{sub 3} temperature-programmed desorption showed strong acidity. Due to the existence of large amount of CH{sub 3} groups, the mesoporous aluminosilicates obtained good hydrophobicity. Owing to the relatively large pore and the strong acidity provided by the uniform four-coordinated Al atoms, the excellent catalytic performance for 1,3,5-triisopropylbenzene cracking was acquired easily. The materials may be a profitable complement for the synthesis of solid acid catalysts. - Graphical abstract: Based on the nonsurfactant method, a facile one-step synthesis route has been developed to prepare methyl-modified mesoporous aluminosilicates that possessed hydrothermal stability and strong acidity.« less
Sites of abscisic acid synthesis and metabolism in Ricinus communis L
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zeevaart, J.A.D.
1977-05-01
The sites of abscisic acid (ABA) synthesis and metabolism in Ricinus communis L. were investigated by analyzing the levels of ABA and its two metabolites phaseic acid (PA) and dihydrophaseic acid (DPA) in the shoot tips, mature leaves, and phloem sap of stressed and nonstressed plants. Water stress increased the concentration of ABA, PA, and DPA in phloem exudate and also increased the levels of all three compounds in mature leaves and in shoot tips. The latter had a very high DPA content (18.7 ..mu..g/g fresh weight) even in plants not subjected to water stress. When young and mature leavesmore » were excised and allowed to wilt, the level of ABA increased in both, demonstrating that leaves at an early stage of development have the capacity to produce ABA. These results have been interpreted to mean that in mature leaves of nonstressed Ricinus plants, ABA is synthesized and metabolized, and that ABA itself, as well as its metabolites, are translocated in the phloem to the shoot tips (sinks). Since DPA, but not ABA, accumulates in the shoot tips, it follows that ABA is metabolized rapidly in the apical region. To what extent ABA present in young leaves of nonstressed plants is the consequence of synthesis in situ and of import from older leaves remains to be determined.« less
Bao; Ohlrogge
1999-08-01
The metabolic factors that determine oil yield in seeds are still not well understood. To begin to examine the limits on triacylglycerol (TAG) production, developing Cuphea lanceolata, Ulmus carpinifolia, and Ulmus parvifolia embryos were incubated with factors whose availability might limit oil accumulation. The addition of glycerol or sucrose did not significantly influence the rate of TAG synthesis. However, the rate of (14)C-TAG synthesis upon addition of 2.1 mM (14)C-decanoic acid (10:0) was approximately four times higher than the in vivo rate of TAG accumulation in C. lanceolata and two times higher than the in vivo rate in U. carpinifolia and U. parvifolia. In C. lanceolata embryos, the highest rate of (14)C-TAG synthesis (14.3 nmol h(-1) embryo(-1)) was achieved with the addition of 3.6 mM decanoic acid. (14)C-Decanoic acid was incorporated equally well in all three acyl positions of TAG. The results suggest that C. lanceolata, U. carpinifolia, and U. parvifolia embryos have sufficient acyltransferase activities and glycerol-3-phosphate levels to support rates of TAG synthesis in excess of those found in vivo. Consequently, the amount of TAG synthesized in these oilseeds may be in part determined by the amount of fatty acid produced in plastids.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lynch, Caitlin; Pan, Yongmei; Li, Linhao
Objective: Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods: Ligand-based structure–activity models were used for virtual screening of the Specs database ( (www.specs.net)) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluatedmore » in HPH. Results: Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion: Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications: Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. - Highlights: • Novel hCAR activators were identified by computational and biological approaches.
Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids
Cativiela, Carlos; Ordóñez, Mario
2010-01-01
The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486
Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments
NASA Astrophysics Data System (ADS)
Kitadai, Norio
2015-12-01
Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.
Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.
Kitadai, Norio
2015-12-01
Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.
Bile acid synthesis in man. In vivo activity of the 25-hydroxylation pathway
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duane, W.C.; Pooler, P.A.; Hamilton, J.N.
1988-07-01
During biosynthesis of bile acid, carbons 25-26-27 are removed from the cholesterol side-chain. Side-chain oxidation begins either with hydroxylation at the 26-position, in which case the three-carbon fragment is released as propionic acid, or with hydroxylation at the 25-position, in which case the three-carbon fragment is released as acetone. We have previously shown in the rat that the contribution of the 25-hydroxylation pathway can be quantitated in vivo by measuring production of (/sup 14/C)acetone from (/sup 14/C)26-cholesterol. In the present study, we adapted this method to human subjects. 4 d after oral administration of 100 microCi of (/sup 14/C)26-cholesterol andmore » 1 d after beginning a constant infusion of 16.6 mumol/min unlabeled acetone, three men and two women underwent breath collections. Expired acetone was trapped and purified as the 2,4 dinitrophenylhydrazine derivative. /sup 14/CO/sub 2/ was trapped quantitatively using phenethylamine. Specific activity of breath acetone was multiplied by the acetone infusion rate to calculate production of (/sup 14/C)acetone. (/sup 14/C)Acetone production averaged 4.9% of total release of /sup 14/C from (/sup 14/C)26-cholesterol, estimated by /sup 14/CO2 output. The method was validated by showing that (/sup 14/C)acetone production from (/sup 14/C)isopropanol averaged 86.9% of the (/sup 14/C)-isopropanol infusion rate. We conclude that in man, as in the rat, the 25-hydroxylation pathway accounts for less than 5% of bile acid synthesis.« less
Increasing the fidelity of noncanonical amino acid incorporation in cell-free protein synthesis.
Gan, Qinglei; Fan, Chenguang
2017-11-01
Cell-free protein synthesis provides a robust platform for co-translational incorporation of noncanonical amino acid (ncAA) into proteins to facilitate biological studies and biotechnological applications. Recently, eliminating the activity of release factor 1 has been shown to increase ncAA incorporation in response to amber codons. However, this approach could promote mis-incorporation of canonical amino acids by near cognate suppression. We performed a facile protocol to remove near cognate tRNA isoacceptors of the amber codon from total tRNAs, and used the phosphoserine (Sep) incorporation system as validation. By manipulating codon usage of target genes and tRNA species introduced into the cell-free protein synthesis system, we increased the fidelity of Sep incorporation at a specific position. By removing three near cognate tRNA isoacceptors of the amber stop codon [tRNA Lys , tRNA Tyr , and tRNA Gln (CUG)] from the total tRNA, the near cognate suppression decreased by 5-fold without impairing normal protein synthesis in the cell-free protein synthesis system. Mass spectrometry analyses indicated that the fidelity of ncAA incorporation was improved. Removal of near cognate tRNA isoacceptors of the amber codon could increase ncAA incorporation fidelity towards the amber stop codon in release factor deficiency systems. We provide a general strategy to improve fidelity of ncAA incorporation towards stop, quadruplet and sense codons in cell-free protein synthesis systems. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2016 Elsevier B.V. All rights reserved.
Use of the 2-chlorotrityl chloride resin for microwave-assisted solid phase peptide synthesis.
Ieronymaki, Matthaia; Androutsou, Maria Eleni; Pantelia, Anna; Friligou, Irene; Crisp, Molly; High, Kirsty; Penkman, Kirsty; Gatos, Dimitrios; Tselios, Theodore
2015-09-01
A fast and efficient microwave (MW)-assisted solid-phase peptide synthesis protocol using the 2-chlorotrityl chloride resin and the Fmoc/tBu methodology, has been developed. The established protocol combines the advantages of MW irradiation and the acid labile 2-chlorotrityl chloride resin. The effect of temperature during the MW irradiation, the degree of resin substitution during the coupling of the first amino acids and the rate of racemization for each amino acid were evaluated. The suggested solid phase methodology is applicable for orthogonal peptide synthesis and for the synthesis of cyclic peptides. © 2015 Wiley Periodicals, Inc.
Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids
Matthessen, Roman; Fransaer, Jan; Binnemans, Koen
2014-01-01
Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120
Bruni, Giovanna; Maietta, Mariarosa; Berbenni, Vittorio; Mustarelli, Piercarlo; Ferrara, Chiara; Freccero, Mauro; Grande, Vincenzo; Maggi, Lauretta; Milanese, Chiara; Girella, Alessandro; Marini, Amedeo
2014-08-07
Molecular cocrystals are of growing interest in pharmaceutics for their improved physicochemical properties. Their mechanochemical synthesis is very promising, being easy, cheap, and "green". Here, for the first time, we report on cocrystallization of bumetanide, a diuretic and natriuretic active principle, and 4-aminobenzoic acid. The synthesis is performed both by wet and dry grinding. The cocrystal formation was investigated with a wide range of techniques, including solid-state NMR, IR, XRD, microscopy, and thermal analysis. Wet and dry grinding procedures led to different cocrystal polymorphs. In particular, the dry method gave a cocrystal by powder amorphization and subsequent crystallization. DFT calculations at the B3LYP/6-31+G(d,p) level of theory shed light on the H-bond scheme at the basis of cocrystal formation. The cocrystals showed improved solubility and dissolution rate with respect to the drug alone. This could guarantee a faster absorption and a better bioavailability of the active principle.
McCune, S A; Durant, P J; Harris, R A
1984-02-01
Hepatocytes were isolated from 3 and 5 month old female genetically obese Zucker rats and their lean littermate controls. An age-dependent loss in sensitivity of fatty acid synthesis to inhibition by both glucagon and dibutyryl cyclic AMP was observed with hepatocytes from the obese rats. Hepatocytes from lean animals were much more sensitive to these agents, regardless of age. Low concentrations of glucagon and dibutyryl cyclic AMP actually produced some stimulation of fatty acid synthesis with hepatocytes prepared from the older obese rats. 5-Tetradecyloxy-2-furoic acid, a compound which inhibits fatty acid synthesis, was a very effective inhibitor of fatty acid synthesis by hepatocytes isolated from all rats used in the study. An inhibition of lactate plus pyruvate accumulation and a strong stimulation of glycogenolysis occurred in response to both glucagon and dibutyryl cyclic AMP with hepatocytes from both age groups of lean and obese rats. The results suggest that with aging of the obese female Zucker rat some step of hepatic fatty acid synthesis becomes progressively less sensitive to inhibition by glucagon and dibutyryl cyclic AMP. This may play an important role in maintenance of obesity in these animals.
Regulation of Lipid Synthesis in Soybeans by Two Benzoic Acid Herbicides 1
Muslih, Raad K.; Linscott, Dean L.
1977-01-01
The effects of 3-nitro-2,5-dichlorobenzoic acid (dinoben) and 3-amino-2,4-dichlorobenzoic acid (chloramben) on lipid formation and on the incorporation of various substrates into lipids by intact seeds and subcellular fractions of germinating soybean (Glycine max [L.] Merr. `Amsoy') were studied. Dinoben (20 μg/ml) inhibited synthesis of total lipids 67%, neutral lipids 73%, glycolipids 51%, and phospholipids 39% in germinating seeds. When polar lipids were analyzed further, inhibition of individual lipid classes was also observed. Chloramben (20 μg/ml) stimulated total lipid synthesis 25%. With the exception of the mitochondrial fraction where malonate thiokinase was absent, dinoben inhibited up to 99% the incorporation of acetate and malonate into lipids, but did not inhibit acetyl-CoA and malonyl-CoA incorporation. Chloramben stimulated the incorporation of all substrates tested into lipids by all fractions except the mitochondrial fraction when malonate was the substrate. When dinoben and chloramben were used in combinations, chloramben did not reverse the inhibitory effect of dinoben. It is concluded that the dinoben inhibitory effect is specific and is associated with the acetate and malonate thiokinase systems. The chloramben effect is stimulatory to either acetyl-CoA carboxylase or fatty acid synthetase or both. PMID:16660173
USDA-ARS?s Scientific Manuscript database
The branched-chain amino acid, leucine, acts as a nutrient signal to stimulate protein synthesis in skeletal muscle of young pigs. However, the chemical structure responsible for this effect has not been identified. We have shown that the other branched-chain amino acids, isoleucine and valine, are ...
Engineering of Saccharomyces cerevisiae for the synthesis of short chain fatty acids.
Leber, Christopher; Da Silva, Nancy A
2014-02-01
Carbon feedstocks from fossilized sources are being rapidly depleted due to rising demand for industrial and commercial applications. Many petroleum-derived chemicals can be directly or functionally substituted with chemicals derived from renewable feedstocks. Several short chain organic acids may fulfill this role using their functional groups as a target for chemical catalysis. Saccharomyces cerevisiae was engineered to produce short chain carboxylic acids (C6 to C10 ) from glucose using the heterologous Homo sapiens type I fatty acid synthase (hFAS). This synthase was activated by phosphopantetheine transfereases AcpS and Sfp from Escherichia coli and Bacillus subtilis, respectively, both in vitro and in vivo. hFAS was produced in the holo-form and produced carboxylic acids in vitro, confirmed by NADPH and ADIFAB assays. Overexpression of hFAS in a yeast FAS2 knockout strain, deficient in de novo fatty acid synthesis, demonstrated the full functional replacement of the native fungal FAS by hFAS. Two active heterologous short chain thioesterases (TEs) from Cuphea palustris (CpFatB1) and Rattus norvegicus (TEII) were evaluated for short chain fatty acid (SCFA) synthesis in vitro and in vivo. Three hFAS mutants were constructed: a mutant deficient in the native TE domain, a mutant with a linked CpFatB1 TE and a mutant with a linked TEII TE. Using the native yeast fatty acid synthase for growth, the overexpression of the hFAS mutants and the short-chain TEs (linked or plasmid-based) increased in vivo caprylic acid and total SCFA production up to 64-fold (63 mg/L) and 52-fold (68 mg/L), respectively, over the native yeast levels. Combined over-expression of the phosphopantetheine transferase with the hFAS mutant resulted in C8 titers of up to 82 mg/L and total SCFA titers of up to 111 mg/L. © 2013 Wiley Periodicals, Inc.
Garcia, Bibian; Martinez-de-Mena, Raquel; Obregon, Maria-Jesus
2012-10-01
Arachidonic acid (AA) is a polyunsaturated fatty acid that stimulates the proliferation of many cellular types. We studied the mitogenic potential of AA in rat brown preadipocytes in culture and the signaling pathways involved. AA is a potent mitogen which induces 4-fold DNA synthesis in brown preadipocytes. The AA mitogenic effect increases by NE addition. AA also increases the mitogenic action of different growth factor combinations. Other unsaturated and saturated fatty acids do not stimulate DNA synthesis to the same extent as AA. We analyzed the role of PKC and MEK/MAPK signaling pathways. PKC inhibition by bisindolilmaleimide I (BIS) abolishes AA and phorbol ester stimulation of DNA synthesis and reduces the mitogenic activity of different growth factors in brown preadipocytes. Brown preadipocytes in culture express PKC α, δ, ε and ζ isoforms. Pretreatment with high doses of the phorbol ester PDBu, induces downregulation of PKCs ε and δ and reproduces the effect of BIS indicating that AA-dependent induction of DNA synthesis requires PKC activity. AA also activates MEK/MAPK pathway and the inhibition of MEK activity inhibits AA stimulation of DNA synthesis and brown adipocyte proliferation. Inhibition of PKC δ by rottlerin abolishes AA-dependent stimulation of DNA synthesis and MAPK activation, whereas PKC ε inhibition does not produce any effect. In conclusion, our results identify AA as a potent mitogen for brown adipocytes and demonstrate the involvement of the PDBu-sensitive PKC δ isoform and MEK/MAPK pathway in AA-induced proliferation of brown adipocytes. Increased proliferative activity might increase the thermogenic capacity of brown fat. Copyright © 2012 Elsevier B.V. All rights reserved.
Peng, Pai; Xiong, Jin-Feng; Mo, Guang-Zhen; Zheng, Jia-Li; Chen, Ren-Hong; Chen, Xiao-Yun; Wang, Zhao-Yang
2014-10-01
An efficient method for the synthesis of aminomethyl benzimidazoles is developed by using a one-pot batch reaction between amino acids and o-phenylenediamines. This reaction proceeds smoothly in an unmodified household microwave oven, even though scale-up is to 10 g. A desirable method for the quick synthesis of benzimidazoles, which are used as a kind of important intermediates in drug synthesis, is provided by the scale-up utilization of amino acid resource.
Bao, Xiaoming; Ohlrogge, John
1999-01-01
The metabolic factors that determine oil yield in seeds are still not well understood. To begin to examine the limits on triacylglycerol (TAG) production, developing Cuphea lanceolata, Ulmus carpinifolia, and Ulmus parvifolia embryos were incubated with factors whose availability might limit oil accumulation. The addition of glycerol or sucrose did not significantly influence the rate of TAG synthesis. However, the rate of 14C-TAG synthesis upon addition of 2.1 mm 14C-decanoic acid (10:0) was approximately four times higher than the in vivo rate of TAG accumulation in C. lanceolata and two times higher than the in vivo rate in U. carpinifolia and U. parvifolia. In C. lanceolata embryos, the highest rate of 14C-TAG synthesis (14.3 nmol h−1 embryo−1) was achieved with the addition of 3.6 mm decanoic acid. 14C-Decanoic acid was incorporated equally well in all three acyl positions of TAG. The results suggest that C. lanceolata, U. carpinifolia, and U. parvifolia embryos have sufficient acyltransferase activities and glycerol-3-phosphate levels to support rates of TAG synthesis in excess of those found in vivo. Consequently, the amount of TAG synthesized in these oilseeds may be in part determined by the amount of fatty acid produced in plastids. PMID:10444089
Ventura, Maria; Williamson, David; Lobefaro, Francesco; Jones, Matthew D; Mattia, Davide; Nocito, Francesco; Aresta, Michele; Dibenedetto, Angela
2018-03-22
The sustainable chemical industry encompasses a shift from the use of fossil carbon to renewable carbon. The synthesis of chemicals from nonedible biomass (cellulosic or oil) represents one of the key steps for "greening" the chemical industry. In this paper, we report the aerobic oxidative cleavage of C6 polyols (5-HMF, glucose, fructose and sucrose) to oxalic acid (OA) and succinic acid (SA) in water under mild conditions using M@CNT and M@NCNT (M=Fe, V; CNT=carbon nanotubes; NCNT=N-doped CNT), which, under suitable conditions, were recoverable and reusable without any loss of efficiency. The influence of the temperature, O 2 pressure (PO2 ), reaction time and stirring rate are discussed and the best reaction conditions are determined for an almost complete conversion of the starting material and a good OA yield of 48 %. SA and formic acid were the only co-products. The former could be further converted into OA by oxidation in the presence of formic acid, resulting in an overall OA yield of >62 %. This process was clean and did not produce organic waste nor gas emissions. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Peters, A Michael; Walters, Julian R F
2013-10-01
Measurement of the whole body retention of orally administered (75)SeHCAT is used to investigate patients with unexplained diarrhoea. Retention values of <15 % at 7 days post-administration are taken to indicate bile acid malabsorption (BAM). Whilst idiopathic BAM is frequently diagnosed with (75)SeHCAT, functional and morphological studies of the terminal ileum rarely show any abnormality, so the disorder may be more appropriately termed bile acid diarrhoea (BAD). In addition to malabsorption, excess bile acid may reach the colon, where the events leading to diarrhoea take place, as a result firstly of increased bile acid synthesis and secondly of an increased recycling rate of bile acids. Increased recycling has been largely ignored as a cause of BAD, but, as shown in this study, can readily result in excess bile acids reaching the colon even when ileal absorption efficiency is normal (i.e. 95-97 %). There needs to be a re-evaluation of the causes of BAD in patients without a history of previous intestinal resection or evidence of ileal pathology, such as Crohn's disease.
Hashimoto, F; Taira, S; Hayashi, H
1998-11-01
We studied whether the peroxisomal proliferation, induction of 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase) and activation of cholesterol synthesis by gemfibrozil shown in whole body (Hashimoto F., Ishikawa T., Hamada S. and Hayashi H., Biochemical. Pharm., 49, 1213-1221 (1995)) is also detected at a culture cell level, and we made a comparative analysis of the effects of clofibric acid. Gemfibrozil at 0.25 mM increased the activity of some peroxisomal enzymes (catalase and the cyanide-insensitive fatty acyl-CoA oxidizing system) after incubation for 72 h. However, contrary to whole body experiments, gemfibrozil decreased the activity of HMG-CoA reductase and cholesterol synthesis from [14C]acetate. At 1 mM, gemfibrozil decreased not only the activity of HMG-CoA reductase and cholesterol synthesis, but also the protein content of the cells and peroxisomal enzyme activity, indicating nonspecific inhibition at this concentration. Clofibric acid (0.25 and 1 mM) increased the activity of peroxisomal enzymes, but decreased the activity of HMG-CoA reductase and cholesterol synthesis. With respect to the direct effect on HMG-CoA reductase in the cell homogenate, gemfibrozil at 0.25 mm did not affect the activity, but it clearly inhibited the activity at 2 mM and above. Clofibric acid at 2 mM hardly affected the activity, but it clearly decreased the activity at 5 mM and over. That is, gemfibrozil directly inhibited the activity more strongly than clofibric acid. The direct inhibition of the enzyme itself required higher concentrations of both agents than did inhibition at the culture cell level. These results suggest that the cytotoxicity of gemfibrozil is greater than that of clofibric acid, and that gemfibrozil, as well as clofibric acid, can induce peroxisomal enzymes in the culture cell level. In contrast to whole body results, gemfibrozil may suppress cholesterol synthesis from [14C]acetate through the inhibition of HMG-CoA reductase at the culture
ERIC Educational Resources Information Center
Cesare, Victor; Sadarangani, Ishwar; Rollins, Janet; Costello, Dennis
2004-01-01
The facile, high yielding synthesis of phenylsuccinamic acids is described and one of these syntheses, the reaction of phenylsuccinic anhydride with tert-butylamine, is successfully modified and adapted for use in the second-semester organic chemistry laboratory at St. John's University. Succinamic acids are compounds that contain both the amide…
Myxospore Coat Synthesis in Myxococcus xanthus: In Vivo Incorporation of Acetate and Glycine
Filer, D.; White, D.; Kindler, S. H.; Rosenberg, E.
1977-01-01
Myxospore coat synthesis in Myxococcus xanthus was studied by incorporation of [14C]acetate into intermediates in the biosynthesis of coat polysaccharide and into acid-insoluble material during vegetative growth and after glycerol induction of myxospores. During short labeling periods at 27°C, the radioactivity was shown to be located primarily in N-acetyl groups rather than sugar moieties. Two hours after glycerol induction, the pools of N-acetylglucosamine 6-phosphate and uridine 5′-diphosphate-N-acetylgalactosamine (UDPGalNAc) plus uridine 5′-diphosphate-N-glucosamine increased about twofold and were labeled at twice the rate measured for vegetative cells. The increased rate of synthesis of UDPGalNAc and its precursors could be correlated with increased enzyme activities measured in vitro. Controlled acid hydrolysis revealed that the galactosamine portion of the myxospore coat was N-acetylated. After glycerol induction, the incorporation of acetate into acid-insoluble material increased threefold. This enhanced incorporation was sensitive to neither penicillin nor d-cycloserine. In contrast, bacitracin inhibited the incorporation of [14C]acetate into acid-insoluble material more effectively 2 h after myxospore induction than during vegetative growth. Chloramphenicol added to cells 90 min after induction blocked further increase in the rate of [14C]acetate incorporation. Since the myxospore coat contains glycine, polymer synthesis was also measured by chloramphenicol-insensitive [14C]glycine incorporation into acid-insoluble material. Although protein synthesis decreased after glycerol induction, glycine incorporation increased. Two hours after induction, glycine incorporation was only 75% inhibited by chloramphenicol and rifampin. The chloramphenicol-insensitive rate of incorporation of [14C]glycine increased during the first hour after myxospore induction and reached a peak rate after 2 to 3 h. The chloramphenicol-resistant incorporation of [14C
Bi, Hongkai; Wang, Haihong; Cronan, John E.
2015-01-01
SUMMARY In the classical anaerobic pathway of unsaturated fatty acid biosynthesis, that of Escherichia coli, the double bond is introduced into the growing acyl chain by the FabA dehydratase/isomerase. Another dehydratase, FabZ, functions in the chain elongation cycle. In contrast, Aerococcus viridans has only a single FabA/FabZ homolog we designate FabQ. FabQ can not only replace the function of E. coli FabZ in vivo, but it also catalyzes the isomerization required for unsaturated fatty acid biosynthesis. Most strikingly, FabQ in combination with E. coli FabB imparts the surprising ability to bypass reduction of the trans-2-acyl-ACP intermediates of classical fatty acid synthesis. FabQ allows elongation by progressive isomerization reactions to form the polyunsaturated fatty acid, 3-hydroxy-cis-5, 7-hexadecadienoic acid, both in vitro and in vivo. FabQ therefore provides a potential pathway for bacterial synthesis of polyunsaturated fatty acids. PMID:23972938
Yao, Jiangwei; Rock, Charles O.
2015-01-01
Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887
Catalá, Angel
2013-01-01
I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074
Lynch, Caitlin; Pan, Yongmei; Li, Linhao; Heyward, Scott; Moeller, Timothy; Swaan, Peter W.; Wang, Hongbing
2014-01-01
Objective Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods Ligand-based structure-activity models were used for virtual screening of the Specs database (www.specs.net) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluated in HPH. Results Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. PMID:24878338
Kelkar, Mandar A; Gogate, Parag R; Pandit, Aniruddha B
2008-03-01
Cavitation results in conditions of turbulence and liquid circulation in the reactor which can aid in eliminating mass transfer resistances. The present work illustrates the use of cavitation for intensification of biodiesel synthesis (esterification) reaction, which is mass transfer limited reaction considering the immiscible nature of the reactants, i.e., fatty acids and alcohol. Esterification of fatty acid (FA) odour cut (C(8)-C(10)) with methanol in the presence of concentrated H(2)SO(4) as a catalyst has been studied in hydrodynamic cavitation reactor as well as in the sonochemical reactor. The different reaction operating parameters such as molar ratio of acid to alcohol, catalyst quantity have been optimized under acoustic as well as hydrodynamic cavitating conditions in addition to the optimization of the geometry of the orifice plate in the case of hydrodynamic cavitation reactors. Few experiments have also been carried out with other acid (lower and higher)/methanol combination viz. caprylic acid and capric acids with methanol with an aim of investigating the efficacy of cavitation for giving the desired yields and also to quantify the degree of process intensification that can be achieved using the same. It has been observed that ambient operating conditions of temperature and pressure and reaction times of <3h, for all the different combinations of acid (lower and higher)/methanol studied in the present work, was sufficient for giving >90% conversion (mol%). This clearly establishes the efficacy of cavitation as an excellent way to achieve process intensification of the biodiesel synthesis process.
NASA Astrophysics Data System (ADS)
Carneiro, Cristine E. A.; Ivashita, Flávio F.; de Souza, Ivan Granemann; de Souza, Cláudio M. D.; Paesano, Andrea; da Costa, Antonio C. S.; di Mauro, Eduardo; de Santana, Henrique; Zaia, Cássia T. B. V.; Zaia, Dimas A. M.
2013-04-01
This study investigated the synthesis of goethite under conditions resembling those of the prebiotic Earth. The artificial seawater used contains all the major elements as well as amino acids (α-Ala, β-Ala, Gly, Cys, AIB) that could be found on the prebiotic Earth. The spectroscopic methods (FT-IR, EPR, Raman), scanning electron microscopy (SEM) and X-ray diffraction showed that in any condition Gly and Cys favoured the formation of goethite, artificial seawater plus β-Ala and distilled water plus AIB favoured the formation of hematite and for the other synthesis a mixture of goethite and hematite were obtained. Thus in general no protein amino acids (β-Ala, AIB) favoured the formation of hematite. As shown by surface enhanced Raman spectroscopy (SERS) spectra the interaction between Cys and Fe3+ of goethite is very complex, involving decomposition of Cys producing sulphur, as well as interaction of carboxylic group with Fe3+. SERS spectra also showed that amino/CN and C-CH3 groups of α-Ala are interacting with Fe3+ of goethite. For the other samples the shifting of several bands was observed. However, it was not possible to say which amino acid groups are interacting with Fe3+. The pH at point of zero charge of goethites increased with artificial seawater and decreased with amino acids. SEM images showed when only goethite was synthesized the images of the samples were acicular and when only hematite was synthesized the images of the samples were spherical. SEM images for the synthesis of goethite with Cys were spherical crystal aggregates with radiating acicular crystals. The highest resonance line intensities were obtained for the samples where only hematite was obtained. Electron paramagnetic resonance (EPR) and Mössbauer spectra showed for the synthesis of goethite with artificial seawater an isomorphic substitution of iron by seawater cations. Mössbauer spectra also showed that for the synthesis goethite in distilled water plus Gly only goethite was
Abc Amino Acids: Design, Synthesis, and Properties of New Photoelastic Amino Acids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Standaert, Robert F; Park, Dr Seung Bum
2006-01-01
Photoisomerizable amino acids provide a direct avenue to the experimental manipulation of bioactive polypeptides, potentially allowing real-time, remote control of biological systems and enabling useful applications in nanobiotechnology. Herein, we report a new class of photoisomerizable amino acids intended to cause pronounced expansion and contraction in the polypeptide backbone, i.e., to be photoelastic. These compounds, termed Abc amino acids, employ a photoisomerizable azobiphenyl chromophore to control the relative disposition of aminomethyl and carboxyl substituents. Molecular modeling of nine Abc isomers led to the identification of one with particularly attractive properties, including the ability to induce contractions up to 13A inmore » the backbone upon transa?cis photoisomerization. This isomer, designated mpAbc, has substituents at meta and para positions on the inner (azo-linked) and outer rings, respectively. An efficient synthesis of Fmoc-protected mpAbc was executed in which the biaryl components were formed via Suzuki couplings and the azo linkage was formed via amine/nitroso condensation; protected forms of three other Abc isomers were prepared similarly. A decapeptide incorporating mpAbc was synthesized by conventional solid-phase methods and displayed characteristic azobenzene photochemical behavior with optimal conversion to the cis isomer at 360 nm and a thermal cisa?trans half life of 100 min. at 80 AoC.« less
Francis, Brian R.
2015-01-01
Although analysis of the genetic code has allowed explanations for its evolution to be proposed, little evidence exists in biochemistry and molecular biology to offer an explanation for the origin of the genetic code. In particular, two features of biology make the origin of the genetic code difficult to understand. First, nucleic acids are highly complicated polymers requiring numerous enzymes for biosynthesis. Secondly, proteins have a simple backbone with a set of 20 different amino acid side chains synthesized by a highly complicated ribosomal process in which mRNA sequences are read in triplets. Apparently, both nucleic acid and protein syntheses have extensive evolutionary histories. Supporting these processes is a complex metabolism and at the hub of metabolism are the carboxylic acid cycles. This paper advances the hypothesis that the earliest predecessor of the nucleic acids was a β-linked polyester made from malic acid, a highly conserved metabolite in the carboxylic acid cycles. In the β-linked polyester, the side chains are carboxylic acid groups capable of forming interstrand double hydrogen bonds. Evolution of the nucleic acids involved changes to the backbone and side chain of poly(β-d-malic acid). Conversion of the side chain carboxylic acid into a carboxamide or a longer side chain bearing a carboxamide group, allowed information polymers to form amide pairs between polyester chains. Aminoacylation of the hydroxyl groups of malic acid and its derivatives with simple amino acids such as glycine and alanine allowed coupling of polyester synthesis and protein synthesis. Use of polypeptides containing glycine and l-alanine for activation of two different monomers with either glycine or l-alanine allowed simple coded autocatalytic synthesis of polyesters and polypeptides and established the first genetic code. A primitive cell capable of supporting electron transport, thioester synthesis, reduction reactions, and synthesis of polyesters and
Synthesis and Pro-Apoptotic Activity of Novel Glycyrrhetinic Acid Derivatives
Logashenko, Evgeniya B; Salomatina, Oksana V; Markov, A V; Korchagina, Dina V; Salakhutdinov, Nariman F; Tolstikov, Genrikh A; Vlassov, Valentin V; Zenkova, Marina A
2011-01-01
Triterpenoids are used for medicinal purposes in many countries. Some, such as oleanolic and glycyrrhetinic acids, are known to be anti-inflammatory and anticarcinogenic. However, the biological activities of these naturally occurring molecules against their particular targets are weak, so the synthesis of new synthetic analogues with enhanced potency is needed. By combining modifications to both the A and C rings of 18βH-glycyrrhetinic acid, the novel synthetic derivative methyl 2-cyano-3,12-dioxo-18βH-olean-9(11),1(2)-dien-30-oate was obtained. This derivative displays high antiproliferative activity in cancer cells, including a cell line with a multidrug-resistance phenotype. It causes cell death by inducing the intrinsic caspase-dependent apoptotic pathway. PMID:21328513
Clinical Relevance of Type II Fatty Acid Synthesis Bypass in Staphylococcus aureus
Guillemet, Mélanie; Soler, Charles; Morvan, Claire; Halpern, David; Pourcel, Christine; Vu Thien, Hoang; Lamberet, Gilles
2017-01-01
ABSTRACT The need for new antimicrobials to treat bacterial infections has led to the use of type II fatty acid synthesis (FASII) enzymes as front-line targets. However, recent studies suggest that FASII inhibitors may not work against the opportunist pathogen Staphylococcus aureus, as environmental fatty acids favor emergence of multi-anti-FASII resistance. As fatty acids are abundant in the host and one FASII inhibitor, triclosan, is widespread, we investigated whether fatty acid pools impact resistance in clinical and veterinary S. aureus isolates. Simple addition of fatty acids to the screening medium led to a 50% increase in triclosan resistance, as tested in 700 isolates. Moreover, nonculturable triclosan-resistant fatty acid auxotrophs, which escape detection under routine conditions, were uncovered in primary patient samples. FASII bypass in selected isolates correlated with polymorphisms in the acc and fabD loci. We conclude that fatty-acid-dependent strategies to escape FASII inhibition are common among S. aureus isolates and correlate with anti-FASII resistance and emergence of nonculturable variants. PMID:28193654
NASA Technical Reports Server (NTRS)
Lin, B. L.; Raghavan, V.
1991-01-01
The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bao, X.; Ohlrogge, J.
1999-08-01
The metabolic factors that determine oil yield in seeds are still not well understood. To begin to examine the limits on triacylglycerol (TAG) production, developing Cuphea lanceolata, Ulmus carpinifolia, and Ulmus parvifolia embryos were incubated with factors whose availability might limit oil accumulation. The addition of glycerol or sucrose did not significantly influence the rate of TAG synthesis. However, the rate of {sup 14}C-TAG synthesis upon addition of 2.1 mM {sup 14}C-decanoic acid (10:0) was approximately four times higher than the in vivo rate of TAG accumulation in C. lanceolata and two times higher than the in vivo rate inmore » U. carpinifolia and U. parvifolia. In C. lanceolata embryos, the highest rate of {sup 14}C-TAG synthesis (14.3 nmol h{sup {minus}1} embryo {sup {minus}1}) was achieved with the addition of 3.6 mM decanoic acid. {sup 14}C-Decanoic acid was incorporated equally well in all three acyl positions of TAG. The results suggest that C. lancelata, U. Carpinifolia, and U. parvifolia embryos have sufficient acyltransferase activities and glycerol-3-phosphate levels to support rates of TAG synthesis in excess of those found in vivo. Consequently, the amount of TAG synthesized in these oilseeds may be in part determined by the amount of fatty acid produced in plastids.« less
Regulation of Intestinal Mucosal Growth by Amino Acids
Ray, Ramesh M.; Johnson, Leonard R.
2013-01-01
Amino acids, especially glutamine (GLN) have been known for many years to stimulate the growth of small intestinal mucosa. Polyamines are also required for optimal mucosal growth, and the inhibition of ornithine decarboxylase (ODC), the first rate-limiting enzyme in polyamine synthesis, blocks growth. Certain amino acids, primarily asparagine (ASN) and GLN stimulate ODC activity in a solution of physiological salts. More importantly, their presence is also required before growth factors and hormones such as EGF and insulin are able to increase ODC activity. ODC activity is inhibited by antizyme-1 (AZ) whose synthesis is stimulated by polyamines, thus, providing a negative feedback regulation of the enzyme. In the absence of amino acids mammalian target of rapamycin complex 1 (mTORC1) is inhibited, whereas, mTORC2 is stimulated leading to the inhibition of global protein synthesis but increasing the synthesis of AZ via a cap-independent mechanism. These data, therefore, explain why ASN or GLN is essential for the activation of ODC. Interestingly, in a number of papers, AZ has been shown to inhibit cell proliferation, stimulate apoptosis or increase autophagy. Each of these activities results in decreased cellular growth. AZ binds to and accelerates the degradation of ODC and other proteins shown to regulate proliferation and cell death, such as Aurora-A, Cyclin D1 and Smad1. The correlation between the stimulation of ODC activity and the absence of AZ as influenced by amino acids is high. Not only do amino acids such as ASN and GLN stimulate ODC while inhibiting AZ synthesis, but also amino acids such as lysine, valine and ornithine, which inhibit ODC activity, increase the synthesis of AZ. The question remaining to be answered is whether AZ inhibits growth directly or whether it acts by decreasing the availability of polyamines to the dividing cells. In either case, evidence strongly suggests that the regulation of AZ synthesis is the mechanism through which amino
Regulation of intestinal mucosal growth by amino acids.
Ray, Ramesh M; Johnson, Leonard R
2014-03-01
Amino acids, especially glutamine (GLN) have been known for many years to stimulate the growth of small intestinal mucosa. Polyamines are also required for optimal mucosal growth, and the inhibition of ornithine decarboxylase (ODC), the first rate-limiting enzyme in polyamine synthesis, blocks growth. Certain amino acids, primarily asparagine (ASN) and GLN stimulate ODC activity in a solution of physiological salts. More importantly, their presence is also required before growth factors and hormones such as epidermal growth factor and insulin are able to increase ODC activity. ODC activity is inhibited by antizyme-1 (AZ) whose synthesis is stimulated by polyamines, thus, providing a negative feedback regulation of the enzyme. In the absence of amino acids mammalian target of rapamycin complex 1 (mTORC1) is inhibited, whereas, mTORC2 is stimulated leading to the inhibition of global protein synthesis but increasing the synthesis of AZ via a cap-independent mechanism. These data, therefore, explain why ASN or GLN is essential for the activation of ODC. Interestingly, in a number of papers, AZ has been shown to inhibit cell proliferation, stimulate apoptosis, or increase autophagy. Each of these activities results in decreased cellular growth. AZ binds to and accelerates the degradation of ODC and other proteins shown to regulate proliferation and cell death, such as Aurora-A, Cyclin D1, and Smad1. The correlation between the stimulation of ODC activity and the absence of AZ as influenced by amino acids is high. Not only do amino acids such as ASN and GLN stimulate ODC while inhibiting AZ synthesis, but also amino acids such as lysine, valine, and ornithine, which inhibit ODC activity, increase the synthesis of AZ. The question remaining to be answered is whether AZ inhibits growth directly or whether it acts by decreasing the availability of polyamines to the dividing cells. In either case, evidence strongly suggests that the regulation of AZ synthesis is the
Inhibition of fatty acid synthesis decreases very low density lipoprotein secretion in the hamster.
Arbeeny, C M; Meyers, D S; Bergquist, K E; Gregg, R E
1992-06-01
The hamster was developed as a model to study very low density lipoprotein (VLDL) metabolism, since, as is the case in humans, the hamster liver was found to synthesize apoB-100 and not apoB-48. The effect of inhibiting fatty acid synthesis on the hepatic secretion of VLDL triglyceride (TG) and apolipoprotein (apo) B-100 in this model was then investigated. In an in vivo study, hamsters were fed a chow diet containing 0.15% TOFA (5-tetradecyloxy-2-furancarboxylic acid), an inhibitor of acetyl-CoA carboxylase. After 6 days of treatment, plasma triglyceride and cholesterol levels were decreased by 30.2% and 11.6%, respectively. When the secretion of VLDL-TG by the liver was measured in vivo after injection of Triton WR 1339, TOFA treatment was found to decrease VLDL-TG secretion by 40%. In subsequent in vitro studies utilizing cultured primary hamster hepatocytes, incubation with 20 microM TOFA for 4 h resulted in 98% and 76% inhibition in fatty acid and triglyceride synthesis, respectively; VLDL-TG secretion was decreased by 90%. When hepatocytes were pulsed with [3H]leucine, incubation with TOFA resulted in a 50% decrease in the incorporation of radiolabel into secreted VLDL apoB-100. The results of this study indicate that inhibition of intracellular triglyceride synthesis decreases the secretion of VLDL-TG and apoB-100, and does not result in the secretion of a dense, triglyceride-depleted lipoprotein.
Hwang, Su Jung; Jun, Sang Hui; Park, Yohan; Cha, Song-Hyun; Yoon, Minho; Cho, Seonho; Lee, Hyo-Jong; Park, Youmie
2015-10-01
Here we developed a novel green synthesis method for gold nanoparticles (CGA-AuNPs) using chlorogenic acid (CGA) as reductants without the use of other chemicals and validated the anti-inflammatory efficacy of CGA-AuNPs in vitro and in vivo. The resulting CGA-AuNPs appeared predominantly spherical in shape with an average diameter of 22.25±4.78nm. The crystalline nature of the CGA-AuNPs was confirmed by high-resolution X-ray diffraction and by selected-area electron diffraction analyses. High-resolution liquid chromatography/electrospray ionization mass spectrometry revealed that the caffeic acid moiety of CGA forms quinone structure through a two-electron oxidation causing the reduction of Au(3+) to Au(0). When compared to CGA, CGA-AuNPs exhibited enhanced anti-inflammatory effects on NF-κB-mediated inflammatory network, as well as cell adhesion. Collectively, green synthesis of CGA-AuNPs using bioactive reductants and mechanistic studies based on mass spectrometry may open up new directions in nanomedicine and CGA-AuNPs can be an anti-inflammatory nanomedicine for future applications. Gold nanoparticles (Au NPs) have been shown to be very useful in many applications due to their easy functionalization capability. In this article, the authors demonstrated a novel method for the synthesis of gold nanoparticles using chlorogenic acid (CGA) as reductants. In-vitro experiments also confirmed biological activity of the resultant gold nanoparticles. Further in-vivo studies are awaited. Copyright © 2015 Elsevier Inc. All rights reserved.
Lee, Chun Pong; Cheng, Riyan
2017-01-01
Plant respiration can theoretically be fueled by and dependent upon an array of central metabolism components; however, which ones are responsible for the quantitative variation found in respiratory rates is unknown. Here, large-scale screens revealed 2-fold variation in nighttime leaf respiration rate (RN) among mature leaves from an Arabidopsis (Arabidopsis thaliana) natural accession collection grown under common favorable conditions. RN variation was mostly maintained in the absence of genetic variation, which emphasized the low heritability of RN and its plasticity toward relatively small environmental differences within the sampling regime. To pursue metabolic explanations for leaf RN variation, parallel metabolite level profiling and assays of total protein and starch were performed. Within an accession, RN correlated strongly with stored carbon substrates, including starch and dicarboxylic acids, as well as sucrose, major amino acids, shikimate, and salicylic acid. Among different accessions, metabolite-RN correlations were maintained with protein, sucrose, and major amino acids but not stored carbon substrates. A complementary screen of the effect of exogenous metabolites and effectors on leaf RN revealed that (1) RN is stimulated by the uncoupler FCCP and high levels of substrates, demonstrating that both adenylate turnover and substrate supply can limit leaf RN, and (2) inorganic nitrogen did not stimulate RN, consistent with limited nighttime nitrogen assimilation. Simultaneous measurements of RN and protein synthesis revealed that these processes were largely uncorrelated in mature leaves. These results indicate that differences in preceding daytime metabolic activities are the major source of variation in mature leaf RN under favorable controlled conditions. PMID:28615345
USDA-ARS?s Scientific Manuscript database
Glycerine and levulinic acid were used alone and in combination for the fermentative synthesis of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHB/V) biopolymers. Shake-flask cultures of Pseudomonas oleovorans NRRL B-14682 containing different glycerine:levulinic acid ratios (1%, w/v total carbon ...
DECOUPLING OF PROTEIN AND RNA SYNTHESIS DURING DEUTERIUM PARTHENOGENESIS IN SEA URCHIN EGGS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gross, P.R.; Spindel, W.; Cousineau, G.H.
1963-10-29
The parthenogenetic activation of cell division and suppression of nucleic acid synthesis by deuterium in eggs of sea urchins was investigated. D/ sub 2/O treatment was found to evoke a high rate of protein synthesis in the eggs that was maintained for several hours. However, eggs whose protein synthesis was activated and that were making labeled cytasters showed no increment in RNA synthesis over controls. (P.C.H.)
Best, Daniel; Burns, David J; Lam, Hon Wai
2015-01-01
A commercially available rhodium(II) complex catalyzes the direct arylation of 5-diazobarbituric acids with arenes, allowing straightforward access to 5-aryl barbituric acids. Free N—H groups are tolerated on the barbituric acid, with no complications arising from N—H insertion processes. This method was applied to the concise synthesis of a potent matrix metalloproteinase (MMP) inhibitor. PMID:25959544
Synthesis of molecular imprinting polymers for extraction of gallic acid from urine.
Bhawani, Showkat Ahmad; Sen, Tham Soon; Ibrahim, Mohammad Nasir Mohammad
2018-02-21
The molecularly imprinted polymers for gallic acid were synthesized by precipitation polymerization. During the process of synthesis a non-covalent approach was used for the interaction of template and monomer. In the polymerization process, gallic acid was used as a template, acrylic acid as a functional monomer, ethylene glycol dimethacrylate as a cross-linker and 2,2'-azobisisobutyronitrile as an initiator and acetonitrile as a solvent. The synthesized imprinted and non-imprinted polymer particles were characterized by using Fourier-transform infrared spectroscopy and scanning electron microscopy. The rebinding efficiency of synthesized polymer particles was evaluated by batch binding assay. The highly selective imprinted polymer for gallic acid was MIPI1 with a composition (molar ratio) of 1:4:20, template: monomer: cross-linker, respectively. The MIPI1 showed highest binding efficiency (79.50%) as compared to other imprinted and non-imprinted polymers. The highly selective imprinted polymers have successfully extracted about 80% of gallic acid from spiked urine sample.
Shiga, Tânia M.; Xiao, Weihua; Yang, Haibing; ...
2017-12-27
The crystallinity of cellulose is a principal factor limiting the efficient hydrolysis of biomass to fermentable sugars or direct catalytic conversion to biofuel components. We evaluated the impact of TFA-induced gelatinization of crystalline cellulose on enhancement of enzymatic digestion and catalytic conversion to biofuel substrates. Low-temperature swelling of cotton linter cellulose in TFA at subzero temperatures followed by gentle heating to 55 degrees C dissolves the microfibril structure and forms composites of crystalline and amorphous gels upon addition of ethanol. The extent of gelatinization of crystalline cellulose was determined by reduction of birefringence in darkfield microscopy, loss of X-ray diffractability,more » and loss of resistance to acid hydrolysis. Upon freeze-drying, an additional degree of crystallinity returned as mostly cellulose II. Both enzymatic digestion with a commercial cellulase cocktail and maleic acid/AlCl3-catalyzed conversion to 5-hydroxymethylfurfural and levulinic acid were markedly enhanced with the low-temperature swollen cellulose. Only small improvements in rates and extent of hydrolysis and catalytic conversion were achieved upon heating to fully dissolve cellulose. Low-temperature swelling of cellulose in TFA substantially reduces recalcitrance of crystalline cellulose to both enzymatic digestion and catalytic conversion. In a closed system to prevent loss of fluorohydrocarbons, the relative ease of recovery and regeneration of TFA by distillation makes it a potentially useful agent in large-scale deconstruction of biomass, not only for enzymatic depolymerization but also for enhancing rates of catalytic conversion to biofuel components and useful bio-products.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shiga, Tânia M.; Xiao, Weihua; Yang, Haibing
The crystallinity of cellulose is a principal factor limiting the efficient hydrolysis of biomass to fermentable sugars or direct catalytic conversion to biofuel components. We evaluated the impact of TFA-induced gelatinization of crystalline cellulose on enhancement of enzymatic digestion and catalytic conversion to biofuel substrates. Low-temperature swelling of cotton linter cellulose in TFA at subzero temperatures followed by gentle heating to 55 degrees C dissolves the microfibril structure and forms composites of crystalline and amorphous gels upon addition of ethanol. The extent of gelatinization of crystalline cellulose was determined by reduction of birefringence in darkfield microscopy, loss of X-ray diffractability,more » and loss of resistance to acid hydrolysis. Upon freeze-drying, an additional degree of crystallinity returned as mostly cellulose II. Both enzymatic digestion with a commercial cellulase cocktail and maleic acid/AlCl3-catalyzed conversion to 5-hydroxymethylfurfural and levulinic acid were markedly enhanced with the low-temperature swollen cellulose. Only small improvements in rates and extent of hydrolysis and catalytic conversion were achieved upon heating to fully dissolve cellulose. Low-temperature swelling of cellulose in TFA substantially reduces recalcitrance of crystalline cellulose to both enzymatic digestion and catalytic conversion. In a closed system to prevent loss of fluorohydrocarbons, the relative ease of recovery and regeneration of TFA by distillation makes it a potentially useful agent in large-scale deconstruction of biomass, not only for enzymatic depolymerization but also for enhancing rates of catalytic conversion to biofuel components and useful bio-products.« less
Suppression of muscle protein turnover and amino acid degradation by dietary protein deficiency
NASA Technical Reports Server (NTRS)
Tawa, N. E. Jr; Goldberg, A. L.
1992-01-01
To define the adaptations that conserve amino acids and muscle protein when dietary protein intake is inadequate, rats (60-70 g final wt) were fed a normal or protein-deficient (PD) diet (18 or 1% lactalbumin), and their muscles were studied in vitro. After 7 days on the PD diet, both protein degradation and synthesis fell 30-40% in skeletal muscles and atria. This fall in proteolysis did not result from reduced amino acid supply to the muscle and preceded any clear decrease in plasma amino acids. Oxidation of branched-chain amino acids, glutamine and alanine synthesis, and uptake of alpha-aminoisobutyrate also fell by 30-50% in muscles and adipose tissue of PD rats. After 1 day on the PD diet, muscle protein synthesis and amino acid uptake decreased by 25-40%, and after 3 days proteolysis and leucine oxidation fell 30-45%. Upon refeeding with the normal diet, protein synthesis also rose more rapidly (+30% by 1 day) than proteolysis, which increased significantly after 3 days (+60%). These different time courses suggest distinct endocrine signals for these responses. The high rate of protein synthesis and low rate of proteolysis during the first 3 days of refeeding a normal diet to PD rats contributes to the rapid weight gain ("catch-up growth") of such animals.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.
2013-01-01
Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes wemore » successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.« less
NASA Astrophysics Data System (ADS)
Siebert, Agnieszka; Cholewiński, Grzegorz; Garwolińska, Dorota; Olejnik, Adrian; Rachoń, Janusz; Chojnacki, Jarosław
2018-01-01
The synthesis of a potential immunosuppressant, i.e. dimethyl ester of N-mycophenoyl malonic acid was optimized in the reaction of mycophenolic acid (MPA) with amino malonic dimethyl ester in the presence of propanephosphonic anhydride (T3P) as a coupling reagent. The structural properties of the obtained MPA derivative were investigated by NMR, MS and single crystal X-ray diffraction methods. Theoretical considerations of conformational flexibility based on DFT calculations are presented.
Jensen, Kristian K; Previs, Stephen F; Zhu, Lei; Herath, Kithsiri; Wang, Sheng-Ping; Bhat, Gowri; Hu, Guanghui; Miller, Paul L; McLaren, David G; Shin, Myung K; Vogt, Thomas F; Wang, Liangsu; Wong, Kenny K; Roddy, Thomas P; Johns, Douglas G; Hubbard, Brian K
2012-01-15
The liver is a crossroad for metabolism of lipid and carbohydrates, with acetyl-CoA serving as an important metabolic intermediate and a precursor for fatty acid and cholesterol biosynthesis pathways. A better understanding of the regulation of these pathways requires an experimental approach that provides both quantitative metabolic flux measurements and mechanistic insight. Under conditions of high carbohydrate availability, excess carbon is converted into free fatty acids and triglyceride for storage, but it is not clear how excessive carbohydrate availability affects cholesterol biosynthesis. To address this, C57BL/6J mice were fed either a low-fat, high-carbohydrate diet or a high-fat, carbohydrate-free diet. At the end of the dietary intervention, the two groups received (2)H(2)O to trace de novo fatty acid and cholesterol synthesis, and livers were collected for gene expression analysis. Expression of lipid and glucose metabolism genes was determined using a custom-designed pathway focused PCR-based gene expression array. The expression analysis showed downregulation of cholesterol biosynthesis genes and upregulation of fatty acid synthesis genes in mice receiving the high-carbohydrate diet compared with the carbohydrate-free diet. In support of these findings, (2)H(2)O tracer data showed that fatty acid synthesis was increased 10-fold and cholesterol synthesis was reduced by 1.6-fold in mice fed the respective diets. In conclusion, by applying gene expression analysis and tracer methodology, we show that fatty acid and cholesterol synthesis are differentially regulated when the carbohydrate intake in mice is altered.
Beena, P S; Basheer, Soorej M; Bhat, Sarita G; Bahkali, Ali H; Chandrasekaran, M
2011-07-01
Marine Aspergillus awamori BTMFW032, recently reported by us, produce acidophilic tannase as extracellular enzyme. Here, we report the application of this enzyme for synthesis of propyl gallate by direct transesterification of tannic acid and in tea cream solubilisation besides the simultaneous production of gallic acid along with tannase under submerged fermentation by this fungus. This acidophilic tannase enabled synthesis of propyl gallate by direct transesterification of tannic acid using propanol as organic reaction media under low water conditions. The identity of the product was confirmed with thin layer chromatography and Fourier transform infrared spectroscopy. It was noted that 699 U/ml of enzyme could give 60% solubilisation of tea cream within 1 h. Enzyme production medium was optimized adopting Box-Behnken design for simultaneous synthesis of tannase and gallic acid. Process variables including tannic acid, sodium chloride, ferrous sulphate, dipotassium hydrogen phosphate, incubation period and agitation were recognized as the critical factors that influenced tannase and gallic acid production. The model obtained predicted 4,824.61 U/ml of tannase and 136.206 μg/ml gallic acid after 48 h of incubation, whereas optimized medium supported 5,085 U/ml tannase and 372.6 μg/ml of gallic acid production after 36 and 84 h of incubation, respectively, with a 15-fold increase in both enzyme and gallic acid production. Results indicated scope for utilization of this acidophilic tannase for transesterification of tannic acid into propyl gallate, tea cream solubilisation and simultaneous production of gallic acid along with tannase.
Blunt, Warren; Dartiailh, Christopher; Sparling, Richard; Gapes, Daniel; Levin, David B; Cicek, Nazim
2018-05-24
Economical production of medium-chain length polyhydroxyalkanoates (mcl-PHA) is dependent on efficient cultivation processes. This work describes growth and mcl-PHA synthesis characteristics of Pseudomonas putida LS46 when grown on medium-chain length fatty acids (octanoic acid) and lower-cost long-chain fatty acids (LCFAs, derived from hydrolyzed canola oil) in microaerophilic environments. Growth on octanoic acid ceased when the oxygen uptake rate was limited by the oxygen transfer rate, and mcl-PHA accumulated to 61.9% of the cell dry mass. From LCFAs, production of non-PHA cell mass continued at a rate of 0.36 g L -1 h -1 under oxygen-limited conditions, while mcl-PHA accumulated simultaneously to 31% of the cell dry mass. The titer of non-PHA cell mass from LCFAs at 14 h post-inoculation was double that obtained from octanoic acid in bioreactors operated with identical feeding and aeration conditions. While the productivity for octanoic acid was higher by 14 h, prolonged cultivation on LCFAs achieved similar productivity but with twice the PHA titer. Simultaneous co-feeding of each substrate demonstrated the continued cell growth under microaerophilic conditions characteristic of LCFAs, and the resulting polymer was dominant in C8 monomers. Furthermore, co-feeding resulted in improved PHA titer and volumetric productivity compared to either substrate individually. These results suggest that LCFAs improve growth of P. putida in oxygen-limited environments and could reduce production costs since more non-PHA cell mass, the cellular factories required to produce mcl-PHA and the most oxygen-intensive cellular process, can be produced for a given oxygen transfer rate.
Ma, Jun; Yan, Ruilan; Zu, Xuyu; Cheng, Ji-Ming; Rao, Krishna; Liao, Duan-Fang; Cao, Deliang
2008-02-08
Recent studies have demonstrated that aldo-keto reductase family 1 B10 (AKR1B10), a novel protein overexpressed in human hepatocellular carcinoma and non-small cell lung carcinoma, may facilitate cancer cell growth by detoxifying intracellular reactive carbonyls. This study presents a novel function of AKR1B10 in tumorigenic mammary epithelial cells (RAO-3), regulating fatty acid synthesis. In RAO-3 cells, Sephacryl-S 300 gel filtration and DEAE-Sepharose ion exchange chromatography demonstrated that AKR1B10 exists in two distinct forms, monomers (approximately 40 kDa) bound to DEAE-Sepharose column and protein complexes (approximately 300 kDa) remaining in flow-through. Co-immunoprecipitation with AKR1B10 antibody and protein mass spectrometry analysis identified that AKR1B10 associates with acetyl-CoA carboxylase-alpha (ACCA), a rate-limiting enzyme of de novo fatty acid synthesis. This association between AKR1B10 and ACCA proteins was further confirmed by co-immunoprecipitation with ACCA antibody and pulldown assays with recombinant AKR1B10 protein. Intracellular fluorescent studies showed that AKR1B10 and ACCA proteins co-localize in the cytoplasm of RAO-3 cells. More interestingly, small interfering RNA-mediated AKR1B10 knock down increased ACCA degradation through ubiquitination-proteasome pathway and resulted in >50% decrease of fatty acid synthesis in RAO-3 cells. These data suggest that AKR1B10 is a novel regulator of the biosynthesis of fatty acid, an essential component of the cell membrane, in breast cancer cells.
Photoredox activation of carbon dioxide for amino acid synthesis in continuous flow
NASA Astrophysics Data System (ADS)
Seo, Hyowon; Katcher, Matthew H.; Jamison, Timothy F.
2017-05-01
Although carbon dioxide (CO2) is highly abundant, its low reactivity has limited its use in chemical synthesis. In particular, methods for carbon-carbon bond formation generally rely on two-electron mechanisms for CO2 activation and require highly activated reaction partners. Alternatively, radical pathways accessed via photoredox catalysis could provide new reactivity under milder conditions. Here we demonstrate the direct coupling of CO2 and amines via the single-electron reduction of CO2 for the photoredox-catalysed continuous flow synthesis of α-amino acids. By leveraging the advantages of utilizing gases and photochemistry in flow, a commercially available organic photoredox catalyst effects the selective α-carboxylation of amines that bear various functional groups and heterocycles. The preliminary mechanistic studies support CO2 activation and carbon-carbon bond formation via single-electron pathways, and we expect that this strategy will inspire new perspectives on using this feedstock chemical in organic synthesis.
Leucine disposal rate for assessment of amino acid metabolism in maintenance hemodialysis patients.
Denny, Gerald B; Deger, Serpil M; Chen, Guanhua; Bian, Aihua; Sha, Feng; Booker, Cindy; Kesler, Jaclyn T; David, Sthuthi; Ellis, Charles D; Ikizler, T Alp
Protein energy wasting (PEW) is common in patients undergoing maintenance hemodialysis (MHD) and closely associated with poor outcomes. Insulin resistance and associated alterations in amino acid metabolism are potential pathways leading to PEW. We hypothesized that the measurement of leucine disposal during a hyperinsulinemic- euglycemic-euaminoacidemic clamp (HEAC) procedure would accurately measure the sensitivity to insulin for its actions on concomitant carbohydrate and protein metabolism in MHD patients. We examined 35 MHD patients and 17 control subjects with normal kidney function by hyperinsulinemic-euglycemic clamp (HEGC) followed by HEAC clamp procedure to obtain leucine disposal rate (LDR) along with isotope tracer methodology to assess whole body protein turnover. The glucose disposal rate (GDR) by HEGC was 5.1 ± 2.1 mg/kg/min for the MHD patients compared to 6.3 ± 3.9 mg/kg/min for the controls ( p = 0.38). The LDR during HEAC was 0.09 ± 0.03 mg/kg/min for the MHD patients compared to 0.11 ± 0.05 mg/kg/min for the controls ( p = 0.009). The LDR level was correlated with whole body protein synthesis ( r = 0.25; p = 0.08), with whole body protein breakdown ( r = -0.38 p = 0.01) and net protein balance ( r = 0.85; p < 0.001) in the overall study population. Correlations remained significant in subgroup analysis. The GDR derived by HEGC and LDR correlated well in the controls ( r = 0.79, p < 0.001), but less so in the MHD patients ( r = 0.58, p < 0.001). Leucine disposal rate reliably measures amino acid utilization in MHD patients and controls in response to high dose insulin.
Stellaard, Frans
2017-01-01
The cholesterol balance procedure allows the calculation of cholesterol synthesis based on the assumption that loss of endogenous cholesterol via fecal excretion and bile acid synthesis is compensated by de novo synthesis. Under ezetimibe therapy hepatic cholesterol is diminished which can be compensated by hepatic de novo synthesis and hepatic extraction of plasma cholesterol. The plasma lathosterol concentration corrected for total cholesterol concentration (R_Lath) as a marker of de novo cholesterol synthesis is increased during ezetimibe treatment but unchanged under treatment with ezetimibe and simvastatin. Cholesterol balance derived synthesis data increase during both therapies. We hypothesize the following. (1) The cholesterol balance data must be applied to the hepatobiliary cholesterol pool. (2) The calculated cholesterol synthesis value is the sum of hepatic de novo synthesis and the net plasma—liver cholesterol exchange rate. (3) The reduced rate of biliary cholesterol absorption is the major trigger for the regulation of hepatic cholesterol metabolism under ezetimibe treatment. Supportive experimental and literature data are presented that describe changes of cholesterol fluxes under ezetimibe, statin, and combined treatments in omnivores and vegans, link plasma R_Lath to liver function, and define hepatic de novo synthesis as target for regulation of synthesis. An ezetimibe dependent direct hepatic drug effect cannot be excluded. PMID:28321334
Kennedy, David A; Vembu, Nagarajan; Fronczek, Frank R; Devocelle, Marc
2011-12-02
Reported is the synthesis of azo mutual prodrugs of the nonsteroidal anti-inflammatory agents (NSAIDs) 4-aminophenylacetic acid (4-APAA) or 5-aminosalicylic acid (5-ASA) with peptides, including an antibiotic peptide temporin analogue modified at the amino terminal by an α-aminoisobutyric acid (Aib) residue. These prodrugs are designed for colonic delivery of two agents to treat infection and inflammation by the bacterial pathogen Clostridium difficile . © 2011 American Chemical Society
Synthesis of [ 18F]arenes via the copper-mediated [ 18F]fluorination of boronic acids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mossine, Andrew V.; Brooks, Allen F.; Makaravage, Katarina J.
Here, a copper-mediated radiofluorination of aryl- and vinylboronic acids with K 18F is described. This method exhibits high functional group tolerance and is effective for the radiofluorination of a range of electron-deficient, -neutral, and -rich aryl-, heteroaryl-, and vinylboronic acids. This method has been applied to the synthesis of [ 18F]FPEB, a PET radiotracer for quantifying metabotropic glutamate 5 receptors.
Synthesis of [ 18F]arenes via the copper-mediated [ 18F]fluorination of boronic acids
Mossine, Andrew V.; Brooks, Allen F.; Makaravage, Katarina J.; ...
2015-11-14
Here, a copper-mediated radiofluorination of aryl- and vinylboronic acids with K 18F is described. This method exhibits high functional group tolerance and is effective for the radiofluorination of a range of electron-deficient, -neutral, and -rich aryl-, heteroaryl-, and vinylboronic acids. This method has been applied to the synthesis of [ 18F]FPEB, a PET radiotracer for quantifying metabotropic glutamate 5 receptors.
Origin of fatty acid synthesis - Thermodynamics and kinetics of reaction pathways
NASA Technical Reports Server (NTRS)
Weber, Arthur L.
1991-01-01
The primitiveness of contemporary fatty acid biosynthesis was evaluated by using the thermodynamics and kinetics of its component reactions to estimate the extent of its dependence on powerful and selective catalysis by enzymes. Since this analysis indicated that the modern pathway is not primitive because it requires sophisticated enzymatic catalysis, an alternative pathway of primitive fatty acid synthesis is proposed that uses glycolaldehyde as a substrate. In contrast to the modern pathway, this primitive pathway is not dependent on an exogenous source of phosphoanhydride energy. Furthermore, the chemical spontaneity of its reactions suggests that it could have been readily catalyzed by the rudimentary biocatalysts available at an early stage in the origin of life.
NASA Astrophysics Data System (ADS)
Momeni, Shima; Nematollahi, Davood
2017-02-01
Electrochemical behavior of acid orange 7 has been exhaustively studied in aqueous solutions with different pH values, using cyclic voltammetry and constant current coulometry. This study has provided new insights into the mechanistic details, pH dependence and intermediate structure of both electrochemical oxidation and reduction of acid orange 7. Surprisingly, the results indicate that a same redox couple (1-iminonaphthalen-2(1H)-one/1-aminonaphthalen-2-ol) is formed from both oxidation and reduction of acid orange 7. Also, an additional purpose of this work is electrochemical synthesis of three new derivatives of 1-amino-4-(phenylsulfonyl)naphthalen-2-ol (3a-3c) under constant current electrolysis via electrochemical oxidation (and reduction) of acid orange 7 in the presence of arylsulfinic acids as nucleophiles. The results indicate that the electrogenerated 1-iminonaphthalen-2(1 H)-one participates in Michael addition reaction with arylsulfinic acids to form the 1-amino-3-(phenylsulfonyl)naphthalen-2-ol derivatives. The synthesis was carried out in an undivided cell equipped with carbon rods as an anode and cathode.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wientjes, F.B.; Nanninga, N.
1989-06-01
The rate at which the peptidoglycan of Escherichia coli is synthesized during the division cycle was studied with two methods. One method involved synchronization of E. coli MC4100 lysA cultures by centrifugal elutriation and subsequent pulse-labeling of the synchronously growing cultures with (meso-{sup 3}H)diaminopimelic acid (({sup 3}H)Dap). The second method was autoradiography of cells pulse-labeled with ({sup 3}H)Dap. It was found that the peptidoglycan is synthesized at a more or less exponentially increasing rate during the division cycle with a slight acceleration in this rate as the cells start to constrict. Apparently, polar cap formation requires synthesis of extra surfacemore » components, presumably to accommodate for a change in the surface-to-volume ratio. Furthermore, it was found that the pool size of Dap was constant during the division cycle. Close analysis of the topography of ({sup 3}H)Dap incorporation at the constriction site revealed that constriction proceeded by synthesis of peptidoglycan at the leading edge of the invaginating cell envelope. During constriction, no reallocation of incorporation occurred, i.e., the incorporation at the leading edge remained high throughout the process of constriction. Impairment of penicillin-binding protein 3 by mutation or by the specific {beta}-lactam antibiotic furazlocillin did not affect ({sup 3}H)Dap incorporation during initiation of constriction. However, the incorporation at the constriction site was inhibited in later stages of the constriction process. It is concluded that during division at least two peptidoglycan-synthesizing systems are operating sequentially.« less
Lipoic acid biosynthesis defects.
Mayr, Johannes A; Feichtinger, René G; Tort, Frederic; Ribes, Antonia; Sperl, Wolfgang
2014-07-01
Lipoate is a covalently bound cofactor essential for five redox reactions in humans: in four 2-oxoacid dehydrogenases and the glycine cleavage system (GCS). Two enzymes are from the energy metabolism, α-ketoglutarate dehydrogenase and pyruvate dehydrogenase; and three are from the amino acid metabolism, branched-chain ketoacid dehydrogenase, 2-oxoadipate dehydrogenase, and the GCS. All these enzymes consist of multiple subunits and share a similar architecture. Lipoate synthesis in mitochondria involves mitochondrial fatty acid synthesis up to octanoyl-acyl-carrier protein; and three lipoate-specific steps, including octanoic acid transfer to glycine cleavage H protein by lipoyl(octanoyl) transferase 2 (putative) (LIPT2), lipoate synthesis by lipoic acid synthetase (LIAS), and lipoate transfer by lipoyltransferase 1 (LIPT1), which is necessary to lipoylate the E2 subunits of the 2-oxoacid dehydrogenases. The reduced form dihydrolipoate is reactivated by dihydrolipoyl dehydrogenase (DLD). Mutations in LIAS have been identified that result in a variant form of nonketotic hyperglycinemia with early-onset convulsions combined with a defect in mitochondrial energy metabolism with encephalopathy and cardiomyopathy. LIPT1 deficiency spares the GCS, and resulted in a combined 2-oxoacid dehydrogenase deficiency and early death in one patient and in a less severely affected individual with a Leigh-like phenotype. As LIAS is an iron-sulphur-cluster-dependent enzyme, a number of recently identified defects in mitochondrial iron-sulphur cluster synthesis, including NFU1, BOLA3, IBA57, GLRX5 presented with deficiency of LIAS and a LIAS-like phenotype. As in DLD deficiency, a broader clinical spectrum can be anticipated for lipoate synthesis defects depending on which of the affected enzymes is most rate limiting.
Fierro-Monti, Ivo; Racle, Julien; Hernandez, Celine; Waridel, Patrice; Hatzimanikatis, Vassily; Quadroni, Manfredo
2013-01-01
Standard proteomics methods allow the relative quantitation of levels of thousands of proteins in two or more samples. While such methods are invaluable for defining the variations in protein concentrations which follow the perturbation of a biological system, they do not offer information on the mechanisms underlying such changes. Expanding on previous work [1], we developed a pulse-chase (pc) variant of SILAC (stable isotope labeling by amino acids in cell culture). pcSILAC can quantitate in one experiment and for two conditions the relative levels of proteins newly synthesized in a given time as well as the relative levels of remaining preexisting proteins. We validated the method studying the drug-mediated inhibition of the Hsp90 molecular chaperone, which is known to lead to increased synthesis of stress response proteins as well as the increased decay of Hsp90 “clients”. We showed that pcSILAC can give information on changes in global cellular proteostasis induced by treatment with the inhibitor, which are normally not captured by standard relative quantitation techniques. Furthermore, we have developed a mathematical model and computational framework that uses pcSILAC data to determine degradation constants kd and synthesis rates Vs for proteins in both control and drug-treated cells. The results show that Hsp90 inhibition induced a generalized slowdown of protein synthesis and an increase in protein decay. Treatment with the inhibitor also resulted in widespread protein-specific changes in relative synthesis rates, together with variations in protein decay rates. The latter were more restricted to individual proteins or protein families than the variations in synthesis. Our results establish pcSILAC as a viable workflow for the mechanistic dissection of changes in the proteome which follow perturbations. Data are available via ProteomeXchange with identifier PXD000538. PMID:24312217
5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group
Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.
1999-06-01
The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.
Oral branched-chain amino acids decrease whole-body proteolysis
NASA Technical Reports Server (NTRS)
Ferrando, A. A.; Williams, B. D.; Stuart, C. A.; Lane, H. W.; Wolfe, R. R.
1995-01-01
BACKGROUND: This study reports the effects of ingesting branched-chain amino acids (leucine, valine, and isoleucine) on protein metabolism in four men. METHODS: To calculate leg protein synthesis and breakdown, we used a new model that utilized the infusion of L-[ring-13C6]phenylalanine and the sampling of the leg arterial-venous difference and muscle biopsies. In addition, protein-bound enrichments provided for the direct calculation of muscle fractional synthetic rate. Four control subjects ingested an equivalent amount of essential amino acids (threonine, methionine, and histidine) to discern the effects of branched-chain amino acid nitrogen vs the effects of essential amino acid nitrogen. Each drink also included 50 g of carbohydrate. RESULTS: Consumption of the branched-chain and the essential amino acid solutions produced significant threefold and fourfold elevations in their respective arterial concentrations. Protein synthesis and breakdown were unaffected by branched-chain amino acids, but they increased by 43% (p < .05) and 36% (p < .03), respectively, in the group consuming the essential amino acids. However, net leg balance of phenylalanine was unchanged by either drink. Direct measurement of protein synthesis by tracer incorporation into muscle protein (fractional synthetic rate) revealed no changes within or between drinks. Whole-body phenylalanine flux was significantly suppressed by each solution but to a greater extent by the branched-chain amino acids (15% and 20%, respectively) (p < .001). CONCLUSIONS: These results suggest that branched-chain amino acid ingestion suppresses whole-body proteolysis in tissues other than skeletal muscle in normal men.
NASA Astrophysics Data System (ADS)
Kim, Hoon; Lee, Joungphil; Ahn, Hyungmin; Kim, Onnuri; Park, Moon Jeong
2015-06-01
Elemental sulfur is one of the most attractive cathode active materials in lithium batteries because of its high theoretical specific capacity. Despite the positive aspect, lithium-sulfur batteries have suffered from severe capacity fading and limited rate capability. Here we report facile large-scale synthesis of a class of organosulfur compounds that could open a new chapter in designing cathode materials to advance lithium-sulfur battery technologies. Porous trithiocyanuric acid crystals are synthesized for use as a soft template, where the ring-opening polymerization of elemental sulfur takes place along the thiol surfaces to create three-dimensionally interconnected sulfur-rich phases. Our lithium-sulfur cells display discharge capacity of 945 mAh g-1 after 100 cycles at 0.2 C with high-capacity retention of 92%, as well as lifetimes of 450 cycles. Particularly, the organized amine groups in the crystals increase Li+-ion transfer rate, affording a rate performance of 1210, mAh g-1 at 0.1 C and 730 mAh g-1 at 5 C.
Kim, Hoon; Lee, Joungphil; Ahn, Hyungmin; Kim, Onnuri; Park, Moon Jeong
2015-01-01
Elemental sulfur is one of the most attractive cathode active materials in lithium batteries because of its high theoretical specific capacity. Despite the positive aspect, lithium–sulfur batteries have suffered from severe capacity fading and limited rate capability. Here we report facile large-scale synthesis of a class of organosulfur compounds that could open a new chapter in designing cathode materials to advance lithium–sulfur battery technologies. Porous trithiocyanuric acid crystals are synthesized for use as a soft template, where the ring-opening polymerization of elemental sulfur takes place along the thiol surfaces to create three-dimensionally interconnected sulfur-rich phases. Our lithium–sulfur cells display discharge capacity of 945 mAh g−1 after 100 cycles at 0.2 C with high-capacity retention of 92%, as well as lifetimes of 450 cycles. Particularly, the organized amine groups in the crystals increase Li+-ion transfer rate, affording a rate performance of 1210, mAh g−1 at 0.1 C and 730 mAh g−1 at 5 C. PMID:26065407
ERIC Educational Resources Information Center
Young, Paul E.; Campbell, Andrew
1982-01-01
A simple, three-step procedure for synthesizing a dipeptide from its component amino acids is described. The dipeptide synthesized uses inexpensive amino acids having hydrocarbon side-chains and can be observed in E/Z forms by nuclear magnetic resonance spectroscopy. Each step in the synthesis produces white crystalline products using standard…
EVALUATION OF THE SYNTHESIS AND STRUCTURE OF NEW AZETIDIN-2-ONES OF FERULIC ACID.
Stan, Cătălina Daniela; Drăgan, Maria; Pânzariu, Andreea; Profire, Lenuţa
2016-01-01
To synthesize some new azetidin-2-ones of ferulic acid and to evaluate them from physicochemical and spectral point of view. The synthesis was carried out in several steps: (i) obtaining the ferulic acid chloride; (ii) obtaining the ferulic acid hydrazide with hydrazine hydrate (98%); (iii) condensation of ferulic acid hydrazide with different benzaldehydes (2-hydroxy-/2-nitro-/4-chloro-/4- fluoro-/4-bromo-benzaldehyde) in order to obtain the corresponding hydrazones; (iv) cy- clization of ferulic acid hydrazones with chloroacethyl chloride in freshly distilled toluene medium and in the presence of triethylamine, resulting in the corresponding azetidin-2-ones. Six new azetidin-2-ones of ferulic acid were synthesized. They were characterized in terms of their physicochemical properties and their structure was confirmed by IR and 1H-NMR spectroscopy. Six new azetidin-2-ones of ferulic acid were synthesized, physicochemically characterized and validated spectrally. A
Synthesis and characterization of covalent diphenylalanine nanotube-folic acid conjugates
NASA Astrophysics Data System (ADS)
Castillo, John J.; Rindzevicius, Tomas; Wu, Kaiyu; Schmidt, Michael S.; Janik, Katarzyna A.; Boisen, Anja; Svendsen, Winnie; Rozlosnik, Noemi; Castillo-León, Jaime
2014-07-01
Herein, we describe the synthesis and characterization of a covalent nanoscale assembly formed between diphenylalanine micro/nanotubes (PNT) and folic acid (FA). The conjugate was obtained via chemical functionalization through coupling of amine groups of PNTs and carboxylic groups of FA. The surface analysis of PNT-FA indicated the presence of FA aggregates on the surface of PNTs. The covalent interaction between FA and self-assembled PNTs was further investigated using fluorescence microscopy, Raman and surface-enhanced Raman scattering (SERS) spectroscopies. The SERS experiments were performed on a large area silver-capped (diameter of 62 nm) silicon nanopillars with an approximate height of 400 nm and a width of 200 nm. The results showed that the PNT-FA synthesis procedure preserves the molecular structure of FA. The PNT-FA conjugate presented in this study is a promising candidate for applications in the detection and diagnosis of cancer or tropical diseases such as leishmaniasis and as a carrier nanosystem delivering drugs to malignant tumors that overexpress folate receptors.
Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2
Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing
2016-01-01
Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850
Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2.
Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing
2016-05-11
Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru-Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry.
Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna
2016-01-01
The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59–87%) and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts). The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2. PMID:27310666
Bajor, Antal; Kilander, Anders; Sjövall, Henrik; Rudling, Mats; Ung, Kjell-Arne
2008-11-01
The stability of bile acid turnover rate was evaluated retrospectively using repeat SeHCAT tests in patients with chronic diarrhoea and prospectively for 16 years in healthy subjects. The SeHCAT values were stable in 39 patients with chronic diarrhoea, as shown by a comparison of the test results [data presented as median and (25th-75th percentile)]: 18% (8-23) in the first test versus 14% (9-21) in the second test [n = 39, P = 0.37, time interval 44 months (16-68), repeatability index >95%]. In contrast, they were reduced after 16 years in healthy subjects: 38% (30-49.5) in the first test versus 31% (21-49.5) in the second test (P < 0.03). In healthy subjects, the body mass index increased by 13% from 23.2 kg/m(2) (21-24.6) to 26.2 kg/m(2) (22.5-27.8) (P < 0.01) during the 16 years. There was a negative correlation between hepatic bile acid synthesis and the SeHCAT values (r = -0.615, P = 0.02, n = 14). In conclusion, the turnover rate of bile acids is stable over a long period of time in patients with chronic diarrhoea irrespective of bile acid malabsorption, suggesting that a repeat SeHCAT test is dispensable. There is a significant negative correlation between bile acid synthesis and SeHCAT test results in healthy subjects. The SeHCAT test values are slightly reduced in healthy subjects after 16 years.
Zhang, Yuanyuan; Jackson, Jonathan P; St Claire, Robert L; Freeman, Kimberly; Brouwer, Kenneth R; Edwards, Jeffrey E
2017-08-01
Farnesoid X receptor (FXR) is a master regulator of bile acid homeostasis through transcriptional regulation of genes involved in bile acid synthesis and cellular membrane transport. Impairment of bile acid efflux due to cholangiopathies results in chronic cholestasis leading to abnormal elevation of intrahepatic and systemic bile acid levels. Obeticholic acid (OCA) is a potent and selective FXR agonist that is 100-fold more potent than the endogenous ligand chenodeoxycholic acid (CDCA). The effects of OCA on genes involved in bile acid homeostasis were investigated using sandwich-cultured human hepatocytes. Gene expression was determined by measuring mRNA levels. OCA dose-dependently increased fibroblast growth factor-19 (FGF-19) and small heterodimer partner (SHP) which, in turn, suppress mRNA levels of cholesterol 7-alpha-hydroxylase (CYP7A1), the rate-limiting enzyme for de novo synthesis of bile acids. Consistent with CYP7A1 suppression, total bile acid content was decreased by OCA (1 μmol/L) to 42.7 ± 20.5% relative to control. In addition to suppressing de novo bile acids synthesis, OCA significantly increased the mRNA levels of transporters involved in bile acid homeostasis. The bile salt excretory pump (BSEP), a canalicular efflux transporter, increased by 6.4 ± 0.8-fold, and the basolateral efflux heterodimer transporters, organic solute transporter α (OST α ) and OST β increased by 6.4 ± 0.2-fold and 42.9 ± 7.9-fold, respectively. The upregulation of BSEP and OST α and OST β, by OCA reduced the intracellular concentrations of d 8 -TCA, a model bile acid, to 39.6 ± 8.9% relative to control. These data demonstrate that OCA does suppress bile acid synthesis and reduce hepatocellular bile acid levels, supporting the use of OCA to treat bile acid-induced toxicity observed in cholestatic diseases. © 2017 Intercept Pharmaceuticals. Pharmacology Research & Perspectives published by John Wiley & Sons Ltd, British Pharmacological Society and
Green Synthesis of Silver Nanoparticles Using Sodium Alginate and Lignosulphonic Acid Blends
NASA Astrophysics Data System (ADS)
Thakur, Amrita; Reddy, Giridhar
2017-08-01
A simple method based on the principles of green chemistry has been developed to synthesize stable silver nanoparticles (AgNP) for possible biomedical applications. Blend of sodium alginate (SA) and lignosulphonic acid (LS) prepared in the ratio of 80/20 mass percent respectively was used as reducing and stabilizing agent. This blend is biocompatible and has shown drug release ability under physiological conditions. Use of blend has an added advantage as LS has the ability to reduce silver while the blend matrix acts as a stabilizing agent. Effect of precursor concentration (AgNO3) and temperature was investigated. Progress of synthesis was monitored using UV-Vis spectroscopy. Higher temperature and lower silver nitrate concentration showed better synthesis of AgNP.
Sheng, Lili; Jena, Prasant Kumar; Hu, Ying; Liu, Hui-Xin; Nagar, Nidhi; Kalanetra, Karen M; French, Samuel William; French, Samuel Wheeler; Mills, David A; Wan, Yu-Jui Yvonne
2017-12-01
Dysregulated bile acid (BA) synthesis or reduced farnesoid X receptor (FXR) levels are found in patients having metabolic diseases, autoimmune hepatitis, and liver cirrhosis or cancer. The objective of this study was to establish the relationship between butyrate and dysregulated BA synthesis-induced hepatitis as well as the effect of butyrate in reversing the liver pathology. Wild-type (WT) and FXR knockout (KO) male mice were placed on a control (CD) or western diet (WD) for 15 months. In the presence or absence of butyrate supplementation, feces obtained from 15-month-old WD-fed FXR KO mice, which had severe hepatitis and liver tumors, were transplanted to 7-month-old WD-fed FXR KO for 3 months. Hepatic phenotypes, microbiota profile, and BA composition were analyzed. Butyrate-generating bacteria and colonic butyrate concentration were reduced due to FXR inactivation and further reduced by WD intake. In addition, WD-fed FXR KO male mice had the highest concentration of hepatic β-muricholic acid (β-MCA) and bacteria-generated deoxycholic acid (DCA) accompanied by serious hepatitis. Moreover, dysregulated BA and reduced SCFA signaling co-existed in both human liver cancers and WD-fed FXR KO mice. Microbiota transplantation using butyrate-deficient feces derived from 15-month-old WD-fed FXR KO mice increased hepatic lymphocyte numbers as well as hepatic β-MCA and DCA concentrations. Furthermore, butyrate supplementation reduced hepatic β-MCA as well as DCA and eliminated hepatic lymphocyte infiltration. In conclusion, reduced butyrate contributes to the development of hepatitis in the FXR KO mouse model. In addition, butyrate reverses dysregulated BA synthesis and its associated hepatitis. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Sabbaghan, Maryam; Yavari, Issa; Hossaini, Zinatossadat
2010-11-01
An efficient synthesis of 4-alkyl-4-methyl-3,4-dihydro-2H,5H-pyrano[3,2-c]chromene-2,5-dione or 4-aryl-3,4-dihydro-2H,5H-pyrano[3,2-c]chromene-2,5-diones via reaction 4-hydroxycoumarin with Meldrum's acid and ketones or aldehydes is described.
Concurrent protein synthesis is required for in vivo chitin synthesis in postmolt blue crabs
DOE Office of Scientific and Technical Information (OSTI.GOV)
Horst, M.N.
1990-12-01
Chitin synthesis in crustaceans involves the deposition of a protein-polysaccharide complex at the apical surface of epithelial cells which secrete the cuticle or exoskeleton. The present study involves an examination of in vivo incorporation of radiolabeled amino acids and amino sugars into the cuticle of postmolt blue crabs, Callinectes sapidus. Rates of incorporation of both 3H leucine and 3H threonine were linear with respect to time of incubation. Incorporation of 3H threonine into the endocuticle was inhibited greater than 90% in the presence of the protein synthesis inhibitor, puromycin. Linear incorporation of 14C glucosamine into the cuticle was also demonstrated;more » a significant improvement of radiolabeling was achieved by using 14C-N-acetylglucosamine as the labeled precursor. Incorporation of 3H-N-acetylglucosamine into the cuticle of postmolt blue crabs was inhibited 89% by puromycin, indicating that concurrent protein synthesis is required for the deposition of chitin in the blue crab. Autoradiographic analysis of control vs. puromycin-treated crabs indicates that puromycin totally blocks labeling of the new endocuticle with 3H glucosamine. These results are consistent with the notion that crustacean chitin is synthesized as a protein-polysaccharide complex. Analysis of the postmolt and intermolt blue crab cuticle indicates that the exoskeleton contains about 60% protein and 40% chitin. The predominant amino acids are arginine, glutamic acid, alanine, aspartic acid, and threonine.« less
Guseva, Natalya V; Rokhlin, Oskar W; Glover, Rebecca A; Cohen, Michael B
2011-07-01
A key player in prostate cancer development and progression is the androgen receptor (AR). Tumor-associated lipogenesis can protect cancer cells from carcinogenic- and therapeutic-associated treatments. Increased synthesis of fatty acids and cholesterol is regulated by androgens through induction of several genes in androgen-responsive cancer cells. Acetyl-CoA-carboxylase-α (ACCA) is a key enzyme in the regulation of fatty acids synthesis. Here we show that AR binds in vivo to intron regions of human ACCA gene. We also show that the level of ACCA protein in LNCaP depends on AR expression and that DHT treatment increases ACCA expression and fatty acid synthesis. Inhibition of ACCA by TOFA (5-tetradecyl-oxy-2-furoic acid) decreases fatty acid synthesis and induces caspase activation and cell death in most PCa cell lines. Our data suggest that TOFA can kill cells via the mitochondrial pathway since we found cytochrome c release after TOFA treatment in androgen sensitive cell lines. The results also imply that the pro-apoptotic effect of TOFA may be mediated via a decrease of neuropilin-1(NRP1) and Mcl-1expression. We have previously reported that Mcl-1 is under AR regulation and plays an important role in resistance to drug-induced apoptosis in prostate cancer cells, and NRP1 is known to regulate Mcl-1 expression. Here, we show for the first time that NRP1 expression is under AR control. Taken together, our data suggest that TOFA is a potent cell death inducing agent in prostate cancer cells.
Liu, Jun; Pu, Huimin; Liu, Shuang; Kan, Juan; Jin, Changhai
2017-10-15
In recent years, increasing attention has been paid to the grafting of phenolic acid onto chitosan in order to enhance the bioactivity and widen the application of chitosan. Here, we present a comprehensive overview on the recent advances of phenolic acid grafted chitosan (phenolic acid-g-chitosan) in many aspects, including the synthetic method, structural characterization, biological activity, physicochemical property and potential application. In general, four kinds of techniques including carbodiimide based coupling, enzyme catalyzed grafting, free radical mediated grafting and electrochemical methods are frequently used for the synthesis of phenolic acid-g-chitosan. The structural characterization of phenolic acid-g-chitosan can be determined by several instrumental methods. The physicochemical properties of chitosan are greatly altered after grafting. As compared with chitosan, phenolic acid-g-chitosan exhibits enhanced antioxidant, antimicrobial, antitumor, anti-allergic, anti-inflammatory, anti-diabetic and acetylcholinesterase inhibitory activities. Notably, phenolic acid-g-chitosan shows potential applications in many fields as coating agent, packing material, encapsulation agent and bioadsorbent. Copyright © 2017 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Infusing leucine for 1 hr increases skeletal muscle protein synthesis in neonatal pigs, but this is not sustained for 2 h unless the leucine-induced fall in amino acids is prevented. We aimed to determine whether continuous leucine infusion can stimulate protein synthesis for a prolonged period whe...
Measurement of Hemoglobin Synthesis Rate in Vivo Using a Stable Isotope Method
Hibbert, Jacqueline M.; Sutherland, George B.; Wright, Luther L.; Wolfe, Luke G.; Wolfe, Kimberly A.; Gao, Shi Ping; Gore, Dennis C.; Abd-Elfattah, Anwar S.
2015-01-01
We developed a method to measure hemoglobin synthesis rate (SynHb) in humans, assuming that free glycine in the red blood cell (RBC) represents free glycine in bone marrow for hemoglobin synthesis. The present rat study examines this assumption of the method and quantifies SynHb in rats. Sprague–Dawley rats (n = 9) were studied, [2-13C]glycine was intravenously infused over 24 h (2.5 mg kg−1 h−1), blood was drawn for glycine and heme isolation, and bone marrow was harvested for glycine isolation. Isotopic enrichments of glycine and heme were measured, fractional hemoglobin synthesis rate (fSynHb% day−1) was calculated, and from this a value for SynHb (mg g−1 day−1) was derived. Mean body weight was 446 ± 10 g (mean ± SE) and hemoglobin concentration was 14 ± 0.5 g dl−1. At 24 h, the mean isotopic enrichment, atom percentage excess (APE), of the RBC free glycine (1.56 ± 0.18 APE) was similar to the bone marrow (1.68 ± 0.15 APE). The rate of incorporation of 13C into heme increased over time from 0.0004 APE/h between 6 and 12 h, to 0.0014 APE/h between 12 and 18 h, and 0.0024 APE/h between 18 and 24 h. Consequently, fSynHb (1.19 ± 0.32, 2.92 ± 0.66, and 4.22 ± 0.56% day−1, respectively) and SynHb (0.11 ± 0.03, 0.28 ± 0.05, and 0.42 ± 0.05 mg g−1 day−1, respectively) showed similar patterns over the 24-h study period. We conclude that (1) enrichment of free glycine in the circulating RBC approximates enrichment of bone marrow free glycine for heme formation and (2) this pattern of hemoglobin synthesis rate is reflecting the characteristic release and gradual maturation of reticulocytes in the circulation. PMID:11262164
Powers, C. D.; Miller, B. A.; Kurtz, H.; Ackermann, W. W.
1969-01-01
Inhibition of HeLa cell deoxyribonucleic acid (DNA) synthesis, which occurred by the 4th to 5th hr after infection with poliovirus, could be blocked completely by guanidine only when it was present before the 2nd hr. At the 2nd hr, there was no significant ribonucleic acid (RNA)-replicase activity, and addition of guanidine inhibited all production of virus but allowed 57% of maximal DNA inhibition to develop. Maximum DNA inhibition developed in cells infected for 4 hr in the presence of guanidine when the guanidine was removed for a 10-min interval. RNA-replicase activity was not enzymatically detectable and viral multiplication did not develop in these cells unless the interval without guanidine was extended to 60 min. The interpretation of the data was that the effect of guanidine on viral-induced inhibition of DNA synthesis was distinct and not a consequence of the inhibition of RNA-replicase. PMID:4305675
Amino acid availability regulates the effect of hyperinsulinemia on skin protein metabolism in pigs
USDA-ARS?s Scientific Manuscript database
The effects of amino acid supply and insulin infusion on skin protein kinetics (fractional synthesis rate (FSR), fractional breakdown rate (FBR), and net balance (NB)) in pigs were investigated. Four-month-old pigs were divided into four groups as follows: control, insulin (INS), amino acid (AA), an...
Heat-enhanced peptide synthesis on Teflon-patterned paper.
Deiss, Frédérique; Yang, Yang; Matochko, Wadim L; Derda, Ratmir
2016-06-14
In this report, we describe the methodology for 96 parallel organic syntheses of peptides on Teflon-patterned paper assisted by heating with an infra-red lamp. SPOT synthesis is an important technology for production of peptide arrays on a paper-based support for rapid identification of peptide ligands, epitope mapping, and identification of bio-conjugation reactions. The major drawback of the SPOT synthesis methodology published to-date is suboptimal reaction conversion due to mass transport limitations in the unmixed reaction spot. The technology developed in this report overcomes these problems by changing the environment of the reaction from static to dynamic (flow-through), and further accelerating the reaction by selective heating of the reaction support in contact with activated amino acids. Patterning paper with Teflon allows for droplets of organic solvents to be confined in a zone on the paper array and flow through the paper at a well-defined rate and provide a convenient, power-free setup for flow-through solid-phase synthesis and efficient assembly of peptide arrays. We employed an infra-red (IR) lamp to locally heat the cellulosic support during the flow-through delivery of the reagents to each zone of the paper-based array. We demonstrate that IR-heating in solid phase peptide synthesis shortened the reaction time necessary for amide bond formation down to 3 minutes; in some couplings of alpha amino acids, conversion rates increased up to fifteen folds. The IR-heating improved the assembly of difficult sequences, such as homo-oligomers of all 20 natural amino acids.
Synthesis of boron nitride powders
NASA Astrophysics Data System (ADS)
Dreissig, Dirk Horst
2002-09-01
In the materials science community there is much interest in the development of new, efficient approaches for preparing ceramic powders having properties or performance characteristics not found with powders produced by traditional metallurgical synthesis methods. In this regard, aerosol-based syntheses are finding general acceptance for the preparation of non-metal and metal oxide powders. In contrast, much less effort has been given to aerosol-type syntheses for non-oxide powders despite potentially useful benefits. This dissertation describes the application of two chemical systems in aerosol assisted vapor phase synthesis (AAVS) for the preparation of spherical morphology boron oxynitride, BNxOy, powders that are subsequently converted to spherical morphology boron nitride in a second nitridation step. Chapter 1 describes the AAVS synthesis of BNxOy powders using a reaction of an aqueous boric acid containing aerosol with ammonia at 1000°C. The effect of reactor tube material, total gas flow rate, ammonia concentration, boric acid concentration, and urea addition to the boric acid aerosol on the percent oxygen composition is described. The resulting BNxOy powders contain significant amounts of oxygen that require replacement in a second stage nitridation reaction at elevated temperature under ammonia. The influences of the reaction temperature profile, crucible geometry and transformation additive on final oxygen composition and powder crystallinity are described. Chapter 2 outlines the formation of BNxOy powders from an AAVS reaction between the boron precursor (MeO)3B and ammonia. The formation of the powders is studied as a function of total gas flow rate and ammonia concentration. In all cases the resulting powders contain lower levels of oxygen compared to powders produced from aqueous boric acid aerosols. The conversion of the BNxOy powders in the second stage nitridation reaction with ammonia is examined as a function of crucible geometry, temperature
Leucine disposal rate for assessment of amino acid metabolism in maintenance hemodialysis patients
Denny, Gerald B.; Deger, Serpil M.; Chen, Guanhua; Bian, Aihua; Sha, Feng; Booker, Cindy; Kesler, Jaclyn T.; David, Sthuthi; Ellis, Charles D.; Ikizler, T. Alp
2016-01-01
Background Protein energy wasting (PEW) is common in patients undergoing maintenance hemodialysis (MHD) and closely associated with poor outcomes. Insulin resistance and associated alterations in amino acid metabolism are potential pathways leading to PEW. We hypothesized that the measurement of leucine disposal during a hyperinsulinemic- euglycemic-euaminoacidemic clamp (HEAC) procedure would accurately measure the sensitivity to insulin for its actions on concomitant carbohydrate and protein metabolism in MHD patients. Methods We examined 35 MHD patients and 17 control subjects with normal kidney function by hyperinsulinemic-euglycemic clamp (HEGC) followed by HEAC clamp procedure to obtain leucine disposal rate (LDR) along with isotope tracer methodology to assess whole body protein turnover. Results The glucose disposal rate (GDR) by HEGC was 5.1 ± 2.1 mg/kg/min for the MHD patients compared to 6.3 ± 3.9 mg/kg/min for the controls (p = 0.38). The LDR during HEAC was 0.09 ± 0.03 mg/kg/min for the MHD patients compared to 0.11 ± 0.05 mg/kg/min for the controls (p = 0.009). The LDR level was correlated with whole body protein synthesis (r = 0.25; p = 0.08), with whole body protein breakdown (r = −0.38 p = 0.01) and net protein balance (r = 0.85; p < 0.001) in the overall study population. Correlations remained significant in subgroup analysis. The GDR derived by HEGC and LDR correlated well in the controls (r = 0.79, p < 0.001), but less so in the MHD patients (r = 0.58, p < 0.001). Conclusions Leucine disposal rate reliably measures amino acid utilization in MHD patients and controls in response to high dose insulin. PMID:27413537
Effects of dietary amino acids, carbohydrates, and choline on neurotransmitter synthesis
NASA Technical Reports Server (NTRS)
Wurtman, Richard J.
1988-01-01
The ability of a meal to increase or decrease brain neurotransmitter synthesis has been studied. It is concluded that brain serotonin synthesis is directly controlled by the proportions of carbohydrate to protein in meals and snacks that increase or decrease brain tryptophan levels, thereby changing the substrate saturation of tryptophan hydroxylase and the rate of serotonin synthesis. The ability of serotoninergic neurons to have their output coupled to dietary macronutrients enables them to function as sensors of peripheral metabolism, and to subserve an important role in the control of appetite. The robust and selective responses of catecholaminergic and cholinergic neurons to supplemental tyrosine and choline suggest that these compounds may become useful as a new type of drug for treating deseases or conditions in which adequate quantities of the transmitter would otherwise be unavailable.
Rapid Synthesis of Flavor Compound 4-Ethyloctanoic Acid under Microwave Irradiation
Liu, Yu-Ping; Yin, De-Cai; Chen, Hai-Tao; Sun, Bao-Guo
2010-01-01
Rapid synthesis of 4-ethyloctanoic acid by means of microwave irradiation is described. Diethyl malonate reacted with 2-ethyl-1-bromohexane in the presence of sodium ethoxide to give diethyl (2-ethylhexyl)malonate (1b). 1b was saponified in the solution of ethanol and potassium hydroxide and then acidified to form (2-ethylhexyl)propanedioic acid (1c), and 1c was heated and decarboxylized to give 4-ethyloctanoic acid (1d). The influence of reaction temperature and reaction time on the yield of 1b and the effect of reaction time on the yield of 1c and 1d were investigated in order to optimize the synthetic conditions. The relative optimal conditions for the synthesis of 1b were a mole ratio of sodium to diethyl malonate to 2-ethylhexyl bromide of 0.1:0.11:0.11, a reaction temperature of 80–85 °C, and a reaction time of 2–2.5 h. The yield of 1b was about 79%. 1b was saponified for 30 min and then acidified to form 1c, and the yield of 1c was 96%. 1c was heated for 16 min at 180°C to give 1d, and the yield of 1d was about 90%. The overall yield of 1d is 70% under microwave irradiation. The reaction time was reduced greatly. In order to compare the result of microwave irradiation with that of an oil bath, the reactions were also performed in an oil bath. The structures of intermediates, product and by-product were confirmed by HRMS, 1H NMR, 13C-NMR and IR. PMID:21152328
2013-01-01
Background The activity of P-glycoprotein (Pgp) and multidrug resistance related protein 1 (MRP1), two membrane transporters involved in multidrug resistance of colon cancer, is increased by high amounts of cholesterol in plasma membrane and detergent resistant membranes (DRMs). It has never been investigated whether omega 3 polyunsatured fatty acids (PUFAs), which modulate cholesterol homeostasis in dyslipidemic syndromes and have chemopreventive effects in colon cancer, may affect the response to chemotherapy in multidrug resistant (MDR) tumors. Methods We studied the effect of omega 3 PUFAs docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) in human chemosensitive colon cancer HT29 cells and in their MDR counterpart, HT29-dx cells. Results MDR cells, which overexpressed Pgp and MRP1, had a dysregulated cholesterol metabolism, due to the lower expression of ubiquitin E3 ligase Trc8: this produced lower ubiquitination rate of 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCoAR), higher cholesterol synthesis, higher cholesterol content in MDR cells. We found that DHA and EPA re-activated Trc8 E3 ligase in MDR cells, restored the ubiquitination rate of HMGCoAR to levels comparable with chemosensitive cells, reduced the cholesterol synthesis and incorporation in DRMs. Omega 3 PUFAs were incorporated in whole lipids as well as in DRMs of MDR cells, and altered the lipid composition of these compartments. They reduced the amount of Pgp and MRP1 contained in DRMs, decreased the transporters activity, restored the antitumor effects of different chemotherapeutic drugs, restored a proper tumor-immune system recognition in response to chemotherapy in MDR cells. Conclusions Our work describes a new biochemical effect of omega 3 PUFAs, which can be useful to overcome chemoresistance in MDR colon cancer cells. PMID:24225025
Synthesis and Agonistic Activity at the GPR35 of 5,6-Dihydroxyindole-2-carboxylic Acid Analogues
2012-01-01
5,6-Dihydroxyindole-2-carboxylic acid (DHICA), an intermediate of melanin synthesis and an eumelanin building block, was recently discovered to be a GPR35 agonist with moderate potency. Here, we report the synthesis and pharmacological characterization of a series of DHICA analogues against GPR35 using both label-free dynamic mass redistribution and Tango β-arrestin translocation assays. This led to identification of novel GPR35 agonists with improved potency and/or having biased agonism. PMID:24900508
Synthesis of glycerol mono-laurate from lauric acid and glycerol for food antibacterial additive
NASA Astrophysics Data System (ADS)
Setianto, W. B.; Wibowo, T. Y.; Yohanes, H.; Illaningtyas, F.; Anggoro, D. D.
2017-05-01
Synthesis of glycerol mono-laurate (GML) has been performed using esterification reaction of glycerol and lauric acid. The reaction was performed at the condition of temperature of 120-140 °C within 7 hour, variation of molar ratio of glycerol - lauric acid, and was using heterogeneous catalyst of zeolist Y. Without catalyst dealumination the maximum acid conversion was 78%, with GML contained in the sample was 38.6%, and it was obtained at the reaction condition of 140 oC, 15wt% catalyst, and 8:1 molar ratio of glycerol - lauric acid. At the same condition, using dealuminated catalyst, the maximum acid conversion was increased up to 98%, with GML contained in the sample was 50.4%. The GML antibacterial activity was examined. It was observed that the GML has antibacterial activity against gram positive bacterial such as B. cereus and S. aureus.
Integrated process of distillation with side reactors for synthesis of organic acid esters
DOE Office of Scientific and Technical Information (OSTI.GOV)
Panchal, Chandrakant B; Prindle, John C; Kolah, Aspri
An integrated process and system for synthesis of organic-acid esters is provided. The method of synthesizing combines reaction and distillation where an organic acid and alcohol composition are passed through a distillation chamber having a plurality of zones. Side reactors are used for drawing off portions of the composition and then recycling them to the distillation column for further purification. Water is removed from a pre-reactor prior to insertion into the distillation column. An integrated heat integration system is contained within the distillation column for further purification and optimizing efficiency in the obtaining of the final product.
An oxazetidine amino acid for chemical protein synthesis by rapid, serine-forming ligations
NASA Astrophysics Data System (ADS)
Pusterla, Ivano; Bode, Jeffrey W.
2015-08-01
Amide-forming ligation reactions allow the chemical synthesis of proteins by the union of unprotected peptide segments, and enable the preparation of protein derivatives not accessible by expression or bioengineering approaches. The native chemical ligation (NCL) of thioesters and N-terminal cysteines is unquestionably the most successful approach, but is not ideal for all synthetic targets. Here we describe the synthesis of an Fmoc-protected oxazetidine amino acid for use in the α-ketoacid-hydroxylamine (KAHA) amide ligation. When incorporated at the N-terminus of a peptide segment, this four-membered cyclic hydroxylamine can be used for rapid serine-forming ligations with peptide α-ketoacids. This ligation operates at low concentration (100 μM-5 mM) and mild temperatures (20-25 °C). The utility of the reaction was demonstrated by the synthesis of S100A4, a 12 kDa calcium-binding protein not easily accessible by NCL or other amide-forming reactions due to its primary sequence and properties.
Zhang, T Y; Huang, J T; Tian, H B; Ma, Y; Chen, Z; Wang, J J; Shi, H P; Luo, J
2018-06-01
The trans-10,cis-12 isomer of conjugated linoleic acid (t10c12-CLA) is a biohydrogenation intermediate in the rumen and has been shown to cause milk fat depression in dairy goats. However, few studies have focused on the in vitro molecular mechanisms involved in the response of the goat mammary gland to t10c12-CLA. In the present study, RNA sequencing technology was used to investigate the effects of t10c12-CLA on goat mammary epithelial cells. From the data, 25,153 annotated transcripts were obtained, and differentially expressed genes were selected based on a false discovery rate <0.05. Candidate genes and potent cellular signaling pathways were identified through Gene Ontology (GO) and pathway analysis. Next, real-time quantitative PCR and Western blot analyses were used to verify the results of the RNA sequencing data. The results indicated that t10c12-CLA inhibits fatty acid synthesis through downregulation of genes involved in de novo fatty acid synthesis, and this process is likely correlated with the activation of the AMP-activated protein kinase signaling pathways. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Mostarda, Serena; Passeri, Daniela; Carotti, Andrea; Cerra, Bruno; Colliva, Carolina; Benicchi, Tiziana; Macchiarulo, Antonio; Pellicciari, Roberto; Gioiello, Antimo
2018-01-20
Glucuronidation is considered an important detoxification pathway of bile acids especially in cholestatic conditions. Glucuronides are less toxic than the parent free forms and are more easily excreted in urine. However, the pathophysiological significance of bile acid glucuronidation is still controversial and debated among the scientific community. Progress in this field has been strongly limited by the lack of appropriate methods for the preparation of pure glucuronides in the amount needed for biological and pharmacological studies. In this work, we have developed a new synthesis of bile acid C3-glucuronides enabling the convenient preparation of gram-scale quantities. The synthesized compounds have been characterized in terms of physicochemical properties and abilities to modulate key nuclear receptors including the farnesoid X receptor (FXR). In particular, we found that C3-glucuronides of chenodeoxycholic acid and lithocholic acid, respectively the most abundant and potentially cytotoxic species formed in patients affected by cholestasis, behave as FXR agonists and positively regulate the gene expression of transporter proteins, the function of which is critical in human conditions related to imbalances of bile acid homeostasis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Facile synthesis of mesoporous lithium titanate spheres for high rate lithium-ion batteries
NASA Astrophysics Data System (ADS)
Lin, Yu-Sheng; Duh, Jenq-Gong
Lithium titanate is synthesized from titanium isopropoxide and lithium acetate solution under hydrothermal environment and calcinations. Introducing acidized carbon black during synthesis can produce mesoporous Li 4Ti 5O 12. The crystalline structure and morphological observation of the as-synthesized mesoporous Li 4Ti 5O 12 are characterized by X-ray diffraction (XRD) and scanning electron microscopy, respectively. The mesoporous structure can be directly observed through BEI images of the cross-section sample. Besides, N 2 adsorption/desorption isotherm also displays a hysteresis loop, implying the beneficial evidence of mesoporous structure. The pore size distribution of mesoporous lithium titanate evaluated by BJH model is narrow, and the average size of voids is around 4 nm. It is demonstrated that the electrochemical performance is significantly improved by the mesoporous structure. The mesoporous lithium titanate exhibits a stable capacity of 140 mAhg -1 at 0.5 C. Besides, the reversible capacity at 30 C remains over half of that at 0.5 C. The superior C-rate performance is associated with the mesoporous structure, facilitating lithium transportation ability during cycling.
Kawasoko, Cristiane Y; Foletto, Patricia; Rodrigues, Oscar E D; Dornelles, Luciano; Schwab, Ricardo S; Braga, Antonio L
2013-08-21
The synthesis of new chiral seleno-, telluro-, and thio-N-Boc-γ-amino acids is described herein. These new compounds were prepared through a simple and short synthetic route, from the inexpensive and commercially-available amino acid L-glutamic acid. The products, with a highly modular character, were obtained in good to excellent yields, via hydrolysis of chalcogen pyroglutamic derivatives with overall retention of the L-glutamic acid stereochemistry. Also, an L-diselenide-N-Boc-γ-amino acid was prepared in good yield. This new synthetic route represents an efficient method for preparing new L-chalcogen- and L-diselenide-γ-amino acids with biological potential.
Bridging bioinorganic chemistry with asymmetric synthesis: a naturally occurring metalloprotein is used for the structure-based evolution of chiral auxiliaries that prove to be effective in the synthesis of Fmoc-L-γ-carboxyglutamic acid.
Synthesis of boron suboxide from boron and boric acid under mild pressure and temperature conditions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiao, Xiaopeng; Jin, Hua; Ding, Zhanhui
2011-05-15
Graphical abstract: Well-crystallized and icosahedral B{sub 6}O crystals were prepared by reacting boron and boric acid at milder reaction conditions (1 GPa and 1300 {sup o}C for 2 h) as compared to previous work.. Research highlights: {yields} Well-crystallized icosahedral B{sub 6}O was synthesized by reacting boric acid and boron. {yields} The synthesis conditions (1 GPa and 1300 {sup o}C for 2 h) are milder in comparison with previous work. {yields} The more practical synthesis method may make B{sub 6}O as a potential substitute for diamond in industry. -- Abstract: Boron suboxide (B{sub 6}O) was synthesized by reacting boron and boricmore » acid (H{sub 3}BO{sub 3}) at pressures between 1 and 10 GPa, and at temperatures between 1300 and 1400 {sup o}C. The B{sub 6}O samples prepared were icosahedral with diameters ranging from 20 to 300 nm. Well-crystallized and icosahedral crystals with an average size of {approx}100 nm can be obtained at milder reaction conditions (1 GPa and 1300 {sup o}C for 2 h) as compared to previous work. The bulk B{sub 6}O sample was stable in air at 600 {sup o}C and then slowly oxidized up to 1000 {sup o}C. The relatively mild synthetic conditions developed in this study provide a more practical synthesis of B{sub 6}O, which may potentially be used as a substitute for diamond in industry as a new superhard material.« less
Coats, Erik R; Watson, Benjamin S; Brinkman, Cynthia K
2016-12-01
Polyhydroxyalkanoates (PHAs) are biodegradable polymers that can substitute for petroleum-based plastics in a variety of applications. One avenue to commercial PHA production involves coupling waste-based synthesis with the use of mixed microbial consortia (MMC). In this regard, production requires maximizing the enrichment of a MMC capable of feast-famine PHA synthesis, with the metabolic response induced through imposition of aerobic-dynamic feeding (ADF) conditions. However, the concept of PHA production in complex matrices remains unrefined; process operational improvements are needed, along with an enhanced understanding of the MMC. Research presented herein investigated the effect of aeration on feast-famine PHA synthesis, with four independent aeration state systems studied; MMC were fed volatile fatty acid (VFA)-rich fermented dairy manure. Regardless of the aeration state, all MMC exhibited a feast-famine response based on observed carbon cycling. Moreover, there was no statistical difference in PHA synthesis rates, with q PHA ranging from 0.10 to 0.19 CmmolPHA gVSS -1 min -1 ; VFA uptake rates exhibited similar statistical indifferences. PHA production assessments on the enriched MMC resulted in maximum intracellular concentrations ranging from 22.5 to 90.7% (mgPHA mgVSS -1 ); at maximum concentration, the mean hydroxyvalerate mol content was 73 ± 0.6%. While a typical feast-famine dissolved oxygen (DO) pattern was observed at maximum aeration, less resolution was observed at decreasing aeration rates, suggesting that DO may not be an optimal process monitoring parameter. At lower aeration states, nitrogen cycling patterns, supported by molecular investigations targeting AOBs and NOBs, indicate that NO 2 and NO 3 sustained feast-famine PHA synthesis. Next-generation sequencing analysis of the respective MMC revealed numerous and diverse genera exhibiting the potential to achieve PHA synthesis, suggesting functional redundancy embedded in the diverse
Piazzon, A; Vrhovsek, U; Masuero, D; Mattivi, F; Mandoj, F; Nardini, M
2012-12-19
The main metabolites of caffeic and ferulic acids (ferulic acid-4'-O-sulfate, caffeic acid-4'-O-sulfate, and caffeic acid-3'-O-sulfate), the most representative phenolic acids in fruits and vegetables, and the acyl glucuronide of ferulic acid were synthesized, purified, and tested for their antioxidant activity in comparison with those of their parent compounds and other related phenolics. Both the ferric reducing antioxidant power (FRAP) assay and the 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) radical scavenging method were used. Ferulic acid-4'-O-sulfate and ferulic acid-4'-O-glucuronide exhibited very low antioxidant activity, while the monosulfate derivatives of caffeic acid were 4-fold less efficient as the antioxidant than caffeic acid. The acyl glucuronide of ferulic acid showed strong antioxidant action. The antioxidant activity of caffeic acid-3'-O-glucuronide and caffeic acid-4'-O-glucuronide was also studied. Our results demonstrate that some of the products of phenolic acid metabolism still retain strong antioxidant properties. Moreover, we first demonstrate the ex vivo synthesis of the acyl glucuronide of ferulic acid by mouse liver microsomes, in addition to the phenyl glucuronide.
Fox, Simon R.; Rawsthorne, Stephen; Hills, Matthew J.
2001-01-01
The uptake in vitro of glucose (Glc)-6-phosphate (Glc-6-P) into plastids from the roots of 10- to 14-d-old pea (Pisum sativum L. cv Puget) plants was inhibited by oleoyl-coenzyme A (CoA) concentrations in the low micromolar range (1–2 μm). The IC50 (the concentration of inhibitor that reduces enzyme activity by 50%) for the inhibition of Glc-6-P uptake was approximately 750 nm; inhibition was reversed by recombinant rapeseed (Brassica napus) acyl-CoA binding protein. In the presence of ATP (3 mm) and CoASH (coenzyme A; 0.3 mm), Glc-6-P uptake was inhibited by 60%, due to long-chain acyl-CoA synthesis, presumably from endogenous sources of fatty acids present in the preparations. Addition of oleoyl-CoA (1 μm) decreased carbon flux from Glc-6-P into the synthesis of starch and through the oxidative pentose phosphate (OPP) pathway by up to 73% and 40%, respectively. The incorporation of carbon from Glc-6-P into fatty acids was not detected under any conditions. Oleoyl-CoA inhibited the incorporation of acetate into fatty acids by 67%, a decrease similar to that when ATP was excluded from incubations. The oleoyl-CoA-dependent inhibition of fatty acid synthesis was attributable to a direct inhibition of the adenine nucleotide translocator by oleoyl-CoA, which indirectly reduced fatty acid synthesis by ATP deprivation. The Glc-6-P-dependent stimulation of acetate incorporation into fatty acids was reversed by the addition of oleoyl-CoA. PMID:11457976
Synthesis of New Organic Semiconducting Polymer Materials Having High Radiowave Absorption Rate
2008-11-01
ISTC Project No. #1571P Synthesis of New Organic Semiconducting Polymer Materials Having High Radiowave Absorption Rate Final Project Technical...Technology Center ( ISTC ), Moscow. REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188 Public reporting burden for this collection of information...polymer materials having high radiowave absorption rate 5a. CONTRACT NUMBER ISTC Registration No: A-1571p 5b. GRANT NUMBER 5c. PROGRAM ELEMENT
Nikoloski, Zoran
2015-01-01
Plants as sessile organisms cannot escape their environment and have to adapt to any changes in the availability of sunlight and nutrients. The quantification of synthesis costs of metabolites, in terms of consumed energy, is a prerequisite to understand trade-offs arising from energetic limitations. Here, we examine the energy consumption of amino acid synthesis in Arabidopsis thaliana. To quantify these costs in terms of the energy equivalent ATP, we introduce an improved cost measure based on flux balance analysis and apply it to three state-of-the-art metabolic reconstructions to ensure robust results. We present the first systematic in silico analysis of the effect of nitrogen supply (nitrate/ammonium) on individual amino acid synthesis costs as well as of the effect of photoautotrophic and heterotrophic growth conditions, integrating day/night-specific regulation. Our results identify nitrogen supply as a key determinant of amino acid costs, in agreement with experimental evidence. In addition, the association of the determined costs with experimentally observed growth patterns suggests that metabolite synthesis costs are involved in shaping regulation of plant growth. Finally, we find that simultaneous uptake of both nitrogen sources can lead to efficient utilization of energy source, which may be the result of evolutionary optimization. PMID:25706533
Arnold, Anne; Sajitz-Hermstein, Max; Nikoloski, Zoran
2015-01-01
Plants as sessile organisms cannot escape their environment and have to adapt to any changes in the availability of sunlight and nutrients. The quantification of synthesis costs of metabolites, in terms of consumed energy, is a prerequisite to understand trade-offs arising from energetic limitations. Here, we examine the energy consumption of amino acid synthesis in Arabidopsis thaliana. To quantify these costs in terms of the energy equivalent ATP, we introduce an improved cost measure based on flux balance analysis and apply it to three state-of-the-art metabolic reconstructions to ensure robust results. We present the first systematic in silico analysis of the effect of nitrogen supply (nitrate/ammonium) on individual amino acid synthesis costs as well as of the effect of photoautotrophic and heterotrophic growth conditions, integrating day/night-specific regulation. Our results identify nitrogen supply as a key determinant of amino acid costs, in agreement with experimental evidence. In addition, the association of the determined costs with experimentally observed growth patterns suggests that metabolite synthesis costs are involved in shaping regulation of plant growth. Finally, we find that simultaneous uptake of both nitrogen sources can lead to efficient utilization of energy source, which may be the result of evolutionary optimization.
Hayashi, Nobuyoshi; Sugawara, Tohru; Shintani, Motoaki; Kato, Shinji
1989-01-01
A versatile automated apparatus, equipped with an artificial intelligence has been developed which may be used to prepare and isolate a wide variety of compounds. The prediction of the optimum reaction conditions and the reaction control in real time, are accomplished using novel kinetic equations and substituent effects in an artificial intelligence software which has already reported [1]. This paper deals with the design and construction of the fully automated system, and its application to the synthesis of a substituted N-(carboxyalkyl)amino acid. The apparatus is composed of units for perfoming various tasks, e.g. reagent supply, reaction, purification and separation, each linked to a control system. All synthetic processes including washing and drying of the apparatus after each synthetic run were automatically performed from the mixing of the reactants to the isolation of the products as powders with purities of greater than 98%. The automated apparatus has been able to run for 24 hours per day, and the average rate of synthesis of substituted N-(carboxyalkyl)amino acids has been three compounds daily. The apparatus is extremely valuable for synthesizing many derivatives of one particular compound structure. Even if the chemical yields are low under the optimum conditions, it is still possible to obtain a sufficient amount of the desired product by repetition of the reaction. Moreover it was possible to greatly reduce the manual involvement of the many syntheses which are a necessary part of pharmaceutical research. PMID:18924679
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
The existence of an intricate interplay of nucleic acids and nucleotides in the chain of events leading from free amino acid to completed polypeptide chain has been determined. To this was added another participant to the nucleotides in protein synthesis - diadenosine-5', 5''', p'p/sup 4/-tetraphosphate (Ap4A). Ap/sub 4/A serves as an initiation primer for DNA synthesis in a eukaryotic system catalyzed by DNA polymerase ..cap alpha... Thus the initial step in protein synthesis is linked to the first step in DNA synthesis by a small molecular weight, unique dinucleotide signal. Advances in the methodology of nucleic acid sequencing have mademore » it possible to examine the relationship between specific short segments of DNA and RNA and their function in the metabolism of the living cell. The triester method of synthesizing deoxynucleotide polymers has made it feasible to synthesize and use specific oligomeric deoxynucleotide sequences as probes of genetic function and potential viral inhibitors. The synthesis of ribonucleotide polymers has been more difficult, due almost entirely to the presence of the 2' ribosyl hydroxyl group. The possibility is now emerging, however, of employing ribonucleotide polymers as specific RNA-virus inhibitors.« less
Giustiniano, Mariateresa; Meneghetti, Fiorella; Mercalli, Valentina; Varese, Monica; Giustiniano, Francesco; Novellino, Ettore; Tron, Gian Cesare
2014-10-17
A novel one-pot multicomponent synthesis of α-aminocarbonyl N-acylhydrazones starting from readily available hydrazonoyl chlorides, isocyanides, and carboxylic acids is reported. The strategy exploits the ability of the carboxylic acid as a third component to suppress all competing reactions between nitrile imines and isocyanides, channeling the course of the reaction toward the formation of this novel class of compounds.
Ung, Kjell-Arne; Mottacki, Nima; Rudling, Mats; Bajor, Antal
2009-01-01
Bile acid (BA) malabsorption may occur after cholecystectomy. Bile may flow more freely into the duodenum after endoscopic sphincterotomy (EST), in part resembling the situation after cholecystectomy. The (75)SeCHAT test used to diagnose BA malabsorption correlates inversely with synthesis and faecal excretion of BAs. The BA intermediate 7alpha-hydroxy-4-cholesten-3-one (C4) mirrors BA and lathosterol cholesterol synthesis. The aim was to study whether EST causes BA diarrhoea and alterations in BA synthesis or lipid profiles. Twelve patients underwent the (75)SeHCAT test prior to and 3 months after undergoing EST and a further 22 only after EST. The Gastrointestinal Symptom Rating Scale (GSRS), 1 week daily stool frequency and consistency, C4, lathosterol, cholesterol and triglycerides were investigated. The (75)SeHCAT values of 29 healthy subjects served as controls. Stool frequency (median 1/day, IQR (interquartile range): 0.7) and consistency (median: 3, IQR: 0.65) were normal and none reported diarrhoea after EST (n=34). The GSRS scores were normal. There was no significant change in (75)SeHCAT (median 22%, IQR 29% versus 19.5%, IQR 25, n=12). There was a trend towards lower (75)SeHCAT after EST compared with the controls (median 26%, IQR 32, n=34 versus median 38%, IQR 19.5, n=29, p=0.075) and higher lathosterol (median 47.1 mg/mole, IQR 32.7 versus median 52.5 mg/mole, IQR 35.6, n=14, p=0.055). The C4 and lipids did not change significantly. EST did not induce diarrhoea and in line with this BA synthesis and serum lipids are unaltered.
Smith, Stuart; Witkowski, Andrzej; Moghul, Ayesha; Yoshinaga, Yuko; Nefedov, Michael; de Jong, Pieter; Feng, Dejiang; Fong, Loren; Tu, Yiping; Hu, Yan; Young, Stephen G.; Pham, Thomas; Cheung, Carling; Katzman, Shana M.; Brand, Martin D.; Quinlan, Casey L.; Fens, Marcel; Kuypers, Frans; Misquitta, Stephanie; Griffey, Stephen M.; Tran, Son; Gharib, Afshin; Knudsen, Jens; Hannibal-Bach, Hans Kristian; Wang, Grace; Larkin, Sandra; Thweatt, Jennifer; Pasta, Saloni
2012-01-01
A mouse model with compromised mitochondrial fatty acid synthesis has been engineered in order to assess the role of this pathway in mitochondrial function and overall health. Reduction in the expression of mitochondrial malonyl CoA-acyl carrier protein transacylase, a key enzyme in the pathway encoded by the nuclear Mcat gene, was achieved to varying extents in all examined tissues employing tamoxifen-inducible Cre-lox technology. Although affected mice consumed more food than control animals, they failed to gain weight, were less physically active, suffered from loss of white adipose tissue, reduced muscle strength, kyphosis, alopecia, hypothermia and shortened lifespan. The Mcat-deficient phenotype is attributed primarily to reduced synthesis, in several tissues, of the octanoyl precursors required for the posttranslational lipoylation of pyruvate and α-ketoglutarate dehydrogenase complexes, resulting in diminished capacity of the citric acid cycle and disruption of energy metabolism. The presence of an alternative lipoylation pathway that utilizes exogenous free lipoate appears restricted to liver and alone is insufficient for preservation of normal energy metabolism. Thus, de novo synthesis of precursors for the protein lipoylation pathway plays a vital role in maintenance of mitochondrial function and overall vigor. PMID:23077570
Pirali, Tracey; Mossetti, Riccardo; Galli, Simona; Tron, Gian Cesare
2011-07-15
A stereospecific multicomponent reaction among isocyanides, syn-chlorooximes, and carboxylic acids provides an efficient synthesis of biologically relevant syn-α-oximinoamides. © 2011 American Chemical Society
Gumel, Ahmad Mohammed; Annuar, M S M
2016-06-01
Enzymatic catalysis is considered to be among the most environmental friendly processes for the synthesis of fine chemicals. In this study, lipase from Thermomyces lanuginosus (Lecitase Ultra™) was used to catalyze the synthesis of flavor esters, i.e., methyl butanoate and methyl benzoate by esterification of the acids with methanol in a microfluidic system. Maximum reaction rates of 195 and 115 mM min -1 corresponding to catalytic efficiencies (k cat /K M ) of 0.30 and 0.24 min -1 mM -1 as well as yield conversion of 54 and 41 % were observed in methyl butanoate and methyl benzoate synthesis, respectively. Catalytic turnover (k cat ) was higher for methyl butanoate synthesis. Rate of synthesis and yield decreased with increasing flow rates. For both esters, increase in microfluidic flow rate resulted in increased advective transport over molecular diffusion and reaction rate, thus lower conversion. In microfluidic synthesis using T. lanuginosus lipase, the following reaction conditions were 40 °C, flow rate 0.1 mL min -1 , and 123 U g -1 enzyme loading found to be the optimum operating limits. The work demonstrated the application of enzyme(s) in a microreactor system for the synthesis of industrially important esters.
Enantioselective Synthesis of α-Oxy Amides via Umpolung Amide Synthesis
Leighty, Matthew W.; Shen, Bo
2012-01-01
α-Oxy amides are prepared through enantioselective synthesis using a sequence beginning with a Henry addition of bromonitromethane to aldehydes, and finishing with Umpolung Amide Synthesis (UmAS). Key to high enantioselection is the finding that ortho-iodo benzoic acid salts of the chiral copper(II) bis(oxazoline) catalyst deliver both diastereomers of the Henry adduct with high enantiomeric excess, homochiral at the oxygen-bearing carbon. Overall, this approach to α-oxy amides provides an innovative complement to alternatives that focus almost entirely on the enantioselective synthesis of α-oxy carboxylic acids. PMID:22967461
Enantioselective synthesis of α-oxy amides via Umpolung amide synthesis.
Leighty, Matthew W; Shen, Bo; Johnston, Jeffrey N
2012-09-19
α-Oxy amides are prepared through enantioselective synthesis using a sequence beginning with a Henry addition of bromonitromethane to aldehydes and finishing with Umpolung Amide Synthesis (UmAS). Key to high enantioselection is the finding that ortho-iodo benzoic acid salts of the chiral copper(II) bis(oxazoline) catalyst deliver both diastereomers of the Henry adduct with high enantiomeric excess, homochiral at the oxygen-bearing carbon. Overall, this approach to α-oxy amides provides an innovative complement to alternatives that focus almost entirely on the enantioselective synthesis of α-oxy carboxylic acids.
Liu, Q; Wang, C; Guo, G; Huo, W J; Zhang, S L; Pei, C X; Zhang, Y L; Wang, H
2018-02-12
Branched-chain volatile fatty acids (BCVFA) supplements could promote lactation performance and milk quality by improving ruminal fermentation and milk fatty acid synthesis. This study was conducted to evaluate the effects of BCVFA supplementation on milk performance, ruminal fermentation, nutrient digestibility and mRNA expression of genes related to fatty acid synthesis in mammary gland of dairy cows. A total of 36 multiparous Chinese Holstein cows averaging 606±4.7 kg of BW, 65±5.2 day in milk (DIM) with daily milk production of 30.6±0.72 kg were assigned to one of four groups blocked by lactation number, milk yield and DIM. The treatments were control, low-BCVFA (LBCVFA), medium-BCVFA (MBCVFA) and high-BCVFA (HBCVFA) with 0, 30, 60 and 90 g BCVFA per cow per day, respectively. Experimental periods were 105 days with 15 days of adaptation and 90 days of data collection. Dry matter (DM) intake tended to increase, but BW changes were similar among treatments. Yields of actual milk, 4% fat corrected milk, milk fat and true protein linearly increased, but feed conversion ratio (FCR) linearly decreased with increasing BCVFA supplementation. Milk fat content linearly increased, but true protein content tended to increase. Contents of C4:0, C6:0, C8:0, C10:0, C12:0, C14:0 and C15:0 fatty acids in milk fat linearly increased, whereas other fatty acids were not affected with increasing BCVFA supplementation. Ruminal pH, ammonia N concentration and propionate molar proportion linearly decreased, but total VFA production and molar proportions of acetate and butyrate linearly increased with increasing BCVFA supplementation. Consequently, acetate to propionate ratios linearly increased. Digestibilities of DM, organic matter, CP, NDF and ADF also linearly increased. In addition, mRNA expressions of peroxisome proliferator-activated receptor γ, sterol regulatory element-binding factor 1 and fatty acid-binding protein 3 linearly increased, mRNA expressions of acetyl
Lindahl, Lina; Genheden, Samuel; Faria-Oliveira, Fábio; Allard, Stefan; Eriksson, Leif A; Olsson, Lisbeth; Bettiga, Maurizio
2017-12-01
Microbial cell factories with the ability to maintain high productivity in the presence of weak organic acids, such as acetic acid, are required in many industrial processes. For example, fermentation media derived from lignocellulosic biomass are rich in acetic acid and other weak acids. The rate of diffusional entry of acetic acid is one parameter determining the ability of microorganisms to tolerance the acid. The present study demonstrates that the rate of acetic acid diffusion in S. cerevisiae is strongly affected by the alcohols ethanol and n-butanol. Ethanol of 40 g/L and n-butanol of 8 g/L both caused a 65% increase in the rate of acetic acid diffusion, and higher alcohol concentrations caused even greater increases. Molecular dynamics simulations of membrane dynamics in the presence of alcohols demonstrated that the partitioning of alcohols to the head group region of the lipid bilayer causes a considerable increase in the membrane area, together with reduced membrane thickness and lipid order. These changes in physiochemical membrane properties lead to an increased number of water molecules in the membrane interior, providing biophysical mechanisms for the alcohol-induced increase in acetic acid diffusion rate. n-butanol affected S. cerevisiae and the cell membrane properties at lower concentrations than ethanol, due to greater and deeper partitioning in the membrane. This study demonstrates that the rate of acetic acid diffusion can be strongly affected by compounds that partition into the cell membrane, and highlights the need for considering interaction effects between compounds in the design of microbial processes.
Lindahl, Lina; Genheden, Samuel; Faria-Oliveira, Fábio; Allard, Stefan; Eriksson, Leif A.; Olsson, Lisbeth; Bettiga, Maurizio
2017-01-01
Microbial cell factories with the ability to maintain high productivity in the presence of weak organic acids, such as acetic acid, are required in many industrial processes. For example, fermentation media derived from lignocellulosic biomass are rich in acetic acid and other weak acids. The rate of diffusional entry of acetic acid is one parameter determining the ability of microorganisms to tolerance the acid. The present study demonstrates that the rate of acetic acid diffusion in S. cerevisiae is strongly affected by the alcohols ethanol and n-butanol. Ethanol of 40 g/L and n-butanol of 8 g/L both caused a 65% increase in the rate of acetic acid diffusion, and higher alcohol concentrations caused even greater increases. Molecular dynamics simulations of membrane dynamics in the presence of alcohols demonstrated that the partitioning of alcohols to the head group region of the lipid bilayer causes a considerable increase in the membrane area, together with reduced membrane thickness and lipid order. These changes in physiochemical membrane properties lead to an increased number of water molecules in the membrane interior, providing biophysical mechanisms for the alcohol-induced increase in acetic acid diffusion rate. n-butanol affected S. cerevisiae and the cell membrane properties at lower concentrations than ethanol, due to greater and deeper partitioning in the membrane. This study demonstrates that the rate of acetic acid diffusion can be strongly affected by compounds that partition into the cell membrane, and highlights the need for considering interaction effects between compounds in the design of microbial processes. PMID:29354649
NASA Astrophysics Data System (ADS)
Rasappan, Ramesh; Aggarwal, Varinder K.
2014-09-01
In planning organic syntheses, disconnections are most often made adjacent to functional groups, which assist in C-C bond formation. For molecules devoid of obvious functional groups this approach presents a problem, and so functionalities must be installed temporarily and then removed. Here we present a traceless strategy for organic synthesis that uses a boronic ester as such a group in a one-pot lithiation-borylation-protodeboronation sequence. To realize this strategy, we developed a methodology for the protodeboronation of alkyl pinacol boronic esters that involves the formation of a boronate complex with a nucleophile followed by oxidation with Mn(OAc)3 in the presence of the hydrogen-atom donor 4-tert-butylcatechol. Iterative lithiation-borylation-protodeboronation allows the coupling of smaller fragments to build-up long alkyl chains. We employed this strategy in the synthesis of hydroxyphthioceranic acid, a key component of the cell-wall lipid of the virulent Mycobacterium tuberculosis, in just 14 steps (longest linear sequence) with full stereocontrol.
Asymmetric synthesis of propargylamines as amino acid surrogates in peptidomimetics
Wünsch, Matthias; Schröder, David; Fröhr, Tanja; Teichmann, Lisa; Hedwig, Sebastian; Janson, Nils; Belu, Clara; Simon, Jasmin; Heidemeyer, Shari; Holtkamp, Philipp; Rudlof, Jens; Klemme, Lennard; Hinzmann, Alessa; Neumann, Beate; Stammler, Hans-Georg
2017-01-01
The amide moiety of peptides can be replaced for example by a triazole moiety, which is considered to be bioisosteric. Therefore, the carbonyl moiety of an amino acid has to be replaced by an alkyne in order to provide a precursor of such peptidomimetics. As most amino acids have a chiral center at Cα, such amide bond surrogates need a chiral moiety. Here the asymmetric synthesis of a set of 24 N-sulfinyl propargylamines is presented. The condensation of various aldehydes with Ellman’s chiral sulfinamide provides chiral N-sulfinylimines, which were reacted with (trimethylsilyl)ethynyllithium to afford diastereomerically pure N-sulfinyl propargylamines. Diverse functional groups present in the propargylic position resemble the side chain present at the Cα of amino acids. Whereas propargylamines with (cyclo)alkyl substituents can be prepared in a direct manner, residues with polar functional groups require suitable protective groups. The presence of particular functional groups in the side chain in some cases leads to remarkable side reactions of the alkyne moiety. Thus, electron-withdrawing substituents in the Cα-position facilitate a base induced rearrangement to α,β-unsaturated imines, while azide-substituted propargylamines form triazoles under surprisingly mild conditions. A panel of propargylamines bearing fluoro or chloro substituents, polar functional groups, or basic and acidic functional groups is accessible for the use as precursors of peptidomimetics. PMID:29234470
Barley β-glucan reduces blood cholesterol levels via interrupting bile acid metabolism.
Wang, Yanan; Harding, Scott V; Thandapilly, Sijo J; Tosh, Susan M; Jones, Peter J H; Ames, Nancy P
2017-11-01
Underlying mechanisms responsible for the cholesterol-lowering effect of β-glucan have been proposed, yet have not been fully demonstrated. The primary aim of this study was to determine whether the consumption of barley β-glucan lowers cholesterol by affecting the cholesterol absorption, cholesterol synthesis or bile acid synthesis. In addition, this study was aimed to assess whether the underlying mechanisms are related to cholesterol 7α hydroxylase (CYP7A1) SNP rs3808607 as proposed by us earlier. In a controlled, randomised, cross-over study, participants with mild hypercholesterolaemia (n 30) were randomly assigned to receive breakfast containing 3 g high-molecular weight (HMW), 5 g low-molecular weight (LMW), 3 g LMW barley β-glucan or a control diet, each for 5 weeks. Cholesterol absorption was determined by assessing the enrichment of circulating 13C-cholesterol over 96 h following oral administration; fractional rate of synthesis for cholesterol was assessed by measuring the incorporation rate of 2H derived from deuterium oxide within the body water pool into the erythrocyte cholesterol pool over 24 h; bile acid synthesis was determined by measuring serum 7α-hydroxy-4-cholesten-3-one concentrations. Consumption of 3 g HMW β-glucan decreased total cholesterol (TC) levels (P=0·029), but did not affect cholesterol absorption (P=0·25) or cholesterol synthesis (P=0·14). Increased bile acid synthesis after consumption of 3 g HMW β-glucan was observed in all participants (P=0·049), and more pronounced in individuals carrying homozygous G of rs3808607 (P=0·033). In addition, a linear relationship between log (viscosity) of β-glucan and serum 7α-HC concentration was observed in homozygous G allele carriers. Results indicate that increased bile acid synthesis rather than inhibition of cholesterol absorption or synthesis may be responsible for the cholesterol-lowering effect of barley β-glucan. The pronounced TC reduction in G allele carriers of rs
Loda, M; Clowes, G H; Dinarello, C A; George, B C; Lane, B; Richardson, W
1984-08-01
Accelerated release of amino acids from muscle and their uptake for protein synthesis by liver and other visceral tissues are characteristic of trauma or sepsis. Experimentally, this response is induced by interleukin-1 (IL-1) generated by activated macrophages in vitro. However, IL-1 has not been demonstrated in human blood. A small 4000-dalton peptide recently isolated from plasma of patients with sepsis and trauma induces muscle proteolysis and is called "proteolysis-inducing factor" (PIF). To test whether this agent has the ability also to induce hepatic protein synthesis, a series of animal experiments and clinical observations were undertaken. The structural and secretory (acute-phase reactants) in vitro protein synthesis in livers of normal rats injected intraperitoneally with IL-1 or PIF was significantly greater than that of normal rats or those injected with Ringer's lactate (p less than 0.01). In patients with sepsis and trauma the central plasma clearance rate of amino acids, a measure of visceral (principally hepatic) amino acid uptake, was elevated and correlated with the rates of protein synthesis in incubated liver slices obtained by biopsy at operation from the same patients (p less than 0.05). Both in vivo measured central plasma clearance rate of amino acids and in vitro measured hepatic protein synthesis correlated with plasma levels of PIF in the same patients (p less than 0.01 and p less than 0.05, respectively). We conclude that since PIF, and not IL-1, is present in human plasma and both are produced by activated macrophages, PIF seems to be the stable circulating cleavage product of IL-1, which induces not only muscle proteolysis but also hepatic protein synthesis, principally in the form of acute-phase reactants during infection and other states in which inflammation is present.
Yan, Rui; Zhang, Yaoyao; Wang, Xiaohui; Xu, Jianxiong; Wang, Da; Zhang, Wangqing
2012-02-15
Synthesis of porous poly(styrene-co-acrylic acid) (PS-co-PAA) microspheres through one-step soap-free emulsion polymerization is reported. Various porous PS-co-PAA microspheres with the particle size ranging from 150 to 240 nm and with the pore size ranging from 4 to 25 nm are fabricated. The porous structure of the microspheres is confirmed by the transmission electron microscopy measurement and Brunauer-Emmett-Teller (BET) analysis. The reason for synthesis of the porous PS-co-PAA microspheres is discussed, and the phase separation between the encapsulated hydrophilic poly(acrylic acid) segment and the hydrophobic polystyrene domain within the PS-co-PAA microspheres is ascribed to the pore formation. The present synthesis of the porous PS-co-PAA microspheres is anticipated to be a new and convenient way to fabricate porous polymeric particles. Copyright © 2011 Elsevier Inc. All rights reserved.
Chaudhari, Pramod S; Pathare, Sagar P; Akamanchi, Krishnacharaya G
2012-04-20
A systematic exploration of thiophilic ability of o-iodoxybenzoic acid (IBX) for oxidative desulfurization to trigger domino reactions leading to new methodologies for synthesis of different azoles is described. A variety of highly substituted oxadiazoles, thiadiazoles, triazoles, and tetrazoles have been successfully synthesized in good to excellent yields, starting from readily accessible thiosemicarbazides, bis-diarylthiourea, 1,3-disubtituted thiourea, and thioamides. © 2012 American Chemical Society
Yajima, Tomoko; Yoshida, Eriko; Hamano, Masako
2013-01-01
The cis- and trans-stereoselective radical additions to α-methylene-γ-alkyl- γ-lactams were investigated and the scope and limitation of the reaction were also revealed. This stereoselective radical reaction was used for synthesis of chiral pyroglutamic acid derivatives starting from a commercially available chiral amino acid.
Carbon Catalyst Synthesis - Sucrose was treated directly with excess sulfuric acid sulfuric acid (9:1 mol/mol, 25°C). A carbon foam (nearly 20 fold increase in bulk volume) was immediately formed. The foam was then washed until no sulfate was dete...
My, L.; Ghandour Achkar, N.; Viala, J. P.
2015-01-01
ABSTRACT In Escherichia coli, the FadR transcriptional regulator represses the expression of fatty acid degradation (fad) genes. However, FadR is also an activator of the expression of fabA and fabB, two genes involved in unsaturated fatty acid synthesis. Therefore, FadR plays an important role in maintaining the balance between saturated and unsaturated fatty acids in the membrane. We recently showed that FadR also activates the promoter upstream of the fabH gene (L. My, B. Rekoske, J. J. Lemke, J. P. Viala, R. L. Gourse, and E. Bouveret, J Bacteriol 195:3784–3795, 2013, doi:10.1128/JB.00384-13). Furthermore, recent transcriptomic and proteomic data suggested that FadR activates the majority of fatty acid (FA) synthesis genes. In the present study, we tested the role of FadR in the expression of all genes involved in FA synthesis. We found that FadR activates the transcription of all tested FA synthesis genes, and we identified the FadR binding site for each of these genes. This necessitated the reassessment of the transcription start sites for accA and accB genes described previously, and we provide evidence for the presence of multiple promoters driving the expression of these genes. We showed further that regulation by FadR impacts the amount of FA synthesis enzymes in the cell. Our results show that FadR is a global regulator of FA metabolism in E. coli, acting both as a repressor of catabolism and an activator of anabolism, two directly opposing pathways. IMPORTANCE In most bacteria, a transcriptional regulator tunes the level of FA synthesis enzymes. Oddly, such a global regulator still was missing for E. coli, which nonetheless is one of the prominent model bacteria used for engineering biofuel production using the FA synthesis pathway. Our work identifies the FadR functional dual regulator as a global activator of almost all FA synthesis genes in E. coli. Because FadR also is the repressor of FA degradation, FadR acts both as a repressor and an activator
Phosphatase synthesis in Klebsiella (Aerobacter) aerogenes growing in continuous culture
Bolton, P. G.; Dean, A. C. R.
1972-01-01
1. Phosphatase synthesis was studied in Klebsiella aerogenes grown in a wide range of continuous-culture systems. 2. Maximum acid phosphatase synthesis was associated with nutrient-limited, particularly carbohydrate-limited, growth at a relatively low rate, glucose-limited cells exhibiting the highest activity. Compared with glucose as the carbon-limiting growth material, other sugars not only altered the activity but also changed the pH–activity profile of the enzyme(s). 3. The affinity of the acid phosphatase in glucose-limited cells towards p-nitrophenyl phosphate (Km 0.25–0.43mm) was similar to that of staphylococcal acid phosphatase but was ten times greater than that of the Escherichia coli enzyme. 4. PO43−-limitation derepressed alkaline phosphatase synthesis but the amounts of activity were largely independent of the carbon source used for growth. 5. The enzymes were further differentiated by the effect of adding inhibitors (F−, PO43−) and sugars to the reaction mixture during the assays. In particular, it was shown that adding glucose, but not other sugars, stimulated the rate of hydrolysis of p-nitrophenyl phosphate by the acid phosphatase in carbohydrate-limited cells at low pH values (<4.6) but inhibited it at high pH values (>4.6). Alkaline phosphatase activity was unaffected. 6. The function of phosphatases in general is discussed and possible mechanisms for the glucose effect are outlined. PMID:4342213
Acid-base chemical reaction model for nucleation rates in the polluted atmospheric boundary layer.
Chen, Modi; Titcombe, Mari; Jiang, Jingkun; Jen, Coty; Kuang, Chongai; Fischer, Marc L; Eisele, Fred L; Siepmann, J Ilja; Hanson, David R; Zhao, Jun; McMurry, Peter H
2012-11-13
Climate models show that particles formed by nucleation can affect cloud cover and, therefore, the earth's radiation budget. Measurements worldwide show that nucleation rates in the atmospheric boundary layer are positively correlated with concentrations of sulfuric acid vapor. However, current nucleation theories do not correctly predict either the observed nucleation rates or their functional dependence on sulfuric acid concentrations. This paper develops an alternative approach for modeling nucleation rates, based on a sequence of acid-base reactions. The model uses empirical estimates of sulfuric acid evaporation rates obtained from new measurements of neutral molecular clusters. The model predicts that nucleation rates equal the sulfuric acid vapor collision rate times a prefactor that is less than unity and that depends on the concentrations of basic gaseous compounds and preexisting particles. Predicted nucleation rates and their dependence on sulfuric acid vapor concentrations are in reasonable agreement with measurements from Mexico City and Atlanta.
NASA Technical Reports Server (NTRS)
Nelson, Kevin E.; Miller, Stanley L.
1992-01-01
The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or
Regional intelligence and suicide rate: new data for Australia and a synthesis of research.
Voracek, Martin
2007-08-01
Previous research has shown for the most part positive correlations between intelligence and suicide prevalence on the national level. However, this study found proxies for regional intelligence in Australia (international average domain scores from the PISA 2000 study) to be significantly negatively correlated with the total, male, and female suicide rates of the different administrative divisions of Australia, and this finding was independent of regional wealth. A research synthesis of the current results and those from similar studies of other countries (positive correlations for Austria, Belarus, The British Isles, Denmark, and The Netherlands; inconclusive findings for France, Germany, and the USA) was conducted. This synthesis of research findings showed that positive ecological correlations of intelligence with suicide rate were more likely observed for nations with higher suicide rates and poorer general living conditions, whereas there was no relation with national IQ.
MS-READ: Quantitative measurement of amino acid incorporation.
Mohler, Kyle; Aerni, Hans-Rudolf; Gassaway, Brandon; Ling, Jiqiang; Ibba, Michael; Rinehart, Jesse
2017-11-01
Ribosomal protein synthesis results in the genetically programmed incorporation of amino acids into a growing polypeptide chain. Faithful amino acid incorporation that accurately reflects the genetic code is critical to the structure and function of proteins as well as overall proteome integrity. Errors in protein synthesis are generally detrimental to cellular processes yet emerging evidence suggest that proteome diversity generated through mistranslation may be beneficial under certain conditions. Cumulative translational error rates have been determined at the organismal level, however codon specific error rates and the spectrum of misincorporation errors from system to system remain largely unexplored. In particular, until recently technical challenges have limited the ability to detect and quantify comparatively rare amino acid misincorporation events, which occur orders of magnitude less frequently than canonical amino acid incorporation events. We now describe a technique for the quantitative analysis of amino acid incorporation that provides the sensitivity necessary to detect mistranslation events during translation of a single codon at frequencies as low as 1 in 10,000 for all 20 proteinogenic amino acids, as well as non-proteinogenic and modified amino acids. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.
Donepudi, Ajay C.; Ferrell, Jessica M.; Boehme, Shannon; Choi, Hueng‐Sik
2017-01-01
Alcoholic fatty liver disease (AFLD) is a major risk factor for cirrhosis‐associated liver diseases. Studies demonstrate that alcohol increases serum bile acids in humans and rodents. AFLD has been linked to cholestasis, although the physiologic relevance of increased bile acids in AFLD and the underlying mechanism of increasing the bile acid pool by alcohol feeding are still unclear. In this study, we used mouse models either deficient of or overexpressing cholesterol 7α‐hydroxylase (Cyp7a1), the rate‐limiting and key regulatory enzyme in bile acid synthesis, to study the effect of alcohol drinking in liver metabolism and inflammation. Mice were challenged with chronic ethanol feeding (10 days) plus a binge dose of alcohol by oral gavage (5 g/kg body weight). Alcohol feeding reduced bile acid synthesis gene expression but increased the bile acid pool size, hepatic triglycerides and cholesterol, and inflammation and injury in wild‐type mice and aggravated liver inflammation and injury in Cyp7a1‐deficient mice. Interestingly, alcohol‐induced hepatic inflammation and injury were ameliorated in Cyp7a1 transgenic mice. Conclusion: Alcohol feeding alters hepatic bile acid and cholesterol metabolism to cause liver inflammation and injury, while maintenance of bile acid and cholesterol homeostasis protect against alcohol‐induced hepatic inflammation and injury. Our findings indicate that CYP7A1 plays a key role in protection against alcohol‐induced steatohepatitis. (Hepatology Communications 2018;2:99–112) PMID:29404516
Yoshida, Eriko; Hamano, Masako
2013-01-01
Summary The cis- and trans-stereoselective radical additions to α-methylene-γ-alkyl- γ-lactams were investigated and the scope and limitation of the reaction were also revealed. This stereoselective radical reaction was used for synthesis of chiral pyroglutamic acid derivatives starting from a commercially available chiral amino acid. PMID:23946839
Barlos, K; Gatos, D; Hatzi, O; Koch, N; Koutsogianni, S
1996-03-01
S-4-methoxytrityl cysteine was synthesized and converted into the corresponding Fmoc-Cys(Mmt)-OH by its reaction with Fmoc-OSu. As compared to the corresponding Fmoc-Cys(Trt)-OH, the S-Mmt-function was found to be considerably more acid labile. Quantitative S-Mmt-removal occurs selectively in the presence of groups of the tert butyl type and S-Trt by treatment with 0.5-1.0% TFA. The new derivative was successfully utilized in the SPPS of Tyr1-somatostatin on 2-chlorotrityl resin. In this synthesis groups of the Trt-type were exclusively used for amino acid side-chain protection. Quantitative cleavage from the resin and complete deprotection was performed by treatment with 3% TFA in DCM-TES (95:5) for 30 min at RT. We observed no reduction of tryptophan under these conditions.
Midzak, Andrew; Papadopoulos, Vassilios
2014-09-01
Steroid hormones, bioactive oxysterols and bile acids are all derived from the biological metabolism of lipid cholesterol. The enzymatic pathways generating these compounds have been an area of intense research for almost a century, as cholesterol and its metabolites have substantial impacts on human health. Owing to its high degree of hydrophobicity and the chemical properties that it confers to biological membranes, the distribution of cholesterol in cells is tightly controlled, with subcellular organelles exhibiting highly divergent levels of cholesterol. The manners in which cells maintain such sterol distributions are of great interest in the study of steroid and bile acid synthesis, as limiting cholesterol substrate to the enzymatic pathways is the principal mechanism by which production of steroids and bile acids is regulated. The mechanisms by which cholesterol moves within cells, however, remain poorly understood. In this review, we examine the subcellular machinery involved in cholesterol metabolism to steroid hormones and bile acid, relating it to both lipid- and protein-based mechanisms facilitating intracellular and intraorganellar cholesterol movement and delivery to these pathways. In particular, we examine evidence for the involvement of specific protein domains involved in cholesterol binding, which impact cholesterol movement and metabolism in steroidogenesis and bile acid synthesis. A better understanding of the physical mechanisms by which these protein- and lipid-based systems function is of fundamental importance to understanding physiological homeostasis and its perturbation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
NASA Astrophysics Data System (ADS)
Dat, Lai Quoc; Ngan, Tran Thi Kim; Nu, Nguyen Thi Xuan
2017-09-01
This research focused on the synthesis of GABA by Lactobacillus bacteria in fermentation of defatted rice bran extract without adding glutamate. Two strains of Lactobacillus were investigated into capacity of GABA synthesis. Result indicates that, Lactobacillus brevis VTCC - B - 454 exhibited the higher capacity of GABA synthesis in fermentation of defatted rice bran extract than that of Lactobacillus plantarum VTCC - B - 890. Total dissolved solid (TDS), free amino acids (AA) and reducing sugar (RS) contents in fermentation of defatted rice bran extract with two strains also significantly decreased. At pH 5 and 9 %w/w of TDS content in defatted rice bran extract, Lactobacillus brevis VTCC - B - 454 accumulated 2,952 ppm of GABA in 24 hours of fermentation. The result implies that fermentation with Lactobacillus brevis VTCC - B - 454 can be applied for GABA production from defatted rice bran extract.
Coulometric Study of Rates of Oxalic Acid Adsorption at a Polycrystalline Platinum Electrode
2012-09-01
Coulometric Study of Rates of Oxalic Acid Adsorption at a Polycrystalline Platinum Electrode by Sol Gilman ARL-TR-6165 September 2012...6165 September 2012 Coulometric Study of Rates of Oxalic Acid Adsorption at a Polycrystalline Platinum Electrode Sol Gilman Sensors and...3. DATES COVERED (From - To) 4. TITLE AND SUBTITLE Coulometric Study of Rates of Oxalic Acid Adsorption at a Polycrystalline Platinum Electrode
NASA Astrophysics Data System (ADS)
Patel, Nipun; Katheriya, Deepak; Dadhania, Harsh; Dadhania, Abhishek
2018-05-01
Magnetic nanoparticle supported phosphotungstic acid (Fe3O4@SiO2-HPW) was applied as a highly efficient catalyst for the synthesis of 14H-dibenzoxanthene derivatives via condensation reaction of 2-naphthol and aryl aldehydes. The catalyst was found highly efficient for the synthesis of xanthene derivatives under solvent free condition. The catalyst showed high activity and stability during the reaction and provided excellent yield of the corresponding products in short reaction time. All the synthesized compounds were characterized through FT-IR, 1H-NMR and 13C-NMR spectroscopic techniques. Furthermore, the catalyst is magnetically recoverable and can be reused several times without significant loss of its catalytic activity.
Gälman, Cecilia; Miquel, Juan Francisco; Pérez, Rosa Maria; Einarsson, Curt; Ståhle, Lars; Marshall, Guillermo; Nervi, Flavio; Rudling, Mats
2004-03-01
Gallstone disease is an important, costly health-care problem in Western societies. It is still unclear whether hepatic lipid regulatory enzymes play primary or secondary roles in gallstone formation. In this study, the aim was to investigate whether the synthesis of bile acids and cholesterol is increased in gallstone disease and to test whether such a metabolic change, if present, might occur before gallstone formation. A total of 125 Chilean Hispanic women (80 without gallstones and 45 with gallstones) matched for age and body mass index were investigated, along with 40 Chilean Mapuche Indian women (20 without gallstones and 20 with gallstones), a population group in which the prevalence for gallstone disease is very high. Fasting blood plasma samples were assayed for 7 alpha-hydroxy-4-cholesten-3-one and lathosterol, 2 strong indicators for hepatic bile acid and body cholesterol synthesis, respectively. Plasma 7 alpha-hydroxy-4-cholesten-3-one levels, corrected for plasma cholesterol, were significantly increased by 50% in Hispanic women with gallstones as compared with gallstone-free Hispanics (P < 0.006). As compared with Hispanic women without gallstones, plasma 7 alpha-hydroxy-4-cholesten-3-one levels were increased by > or =100% (P < 0.002) in Mapuche Indian women, independently of whether gallstones were present. Plasma lathosterol, corrected for plasma cholesterol, was significantly increased by 22% in Hispanic women with gallstones and in Mapuche Indian women compared with Hispanic women. The results indicate that the synthesis of bile acids and cholesterol is induced in gallstone disease and precedes gallstone development. These inductions presumably occur as a response to an increased intestinal loss of bile acids.
NASA Astrophysics Data System (ADS)
Chen, Huide; Liu, Chunxiu; Xia, Yunsheng
2017-03-01
This study is the first to report one-step synthesis of boronic acid functionalized gold nanoclusters (AuNCs) using mixed ligands of 4-mercaptophenylboronic acid (MPBA) and glutathione. Furthermore, the emission color of the products can be fancily tuned from green to near-infrared by simply changing the proportion of the two stabilizers. In basic media, dopamine (DA) molecules themselves polymerize each other and form polydopamine with large amounts of cis-diol groups, which then react with boronic acid groups on the AuNC’s surface based on the formation of boronate esters. As a result, the photoluminescence of the AuNCs is well quenched by the electron transfer effect. Accordingly, DA molecules are assayed from 0.5 to 9 μM, and the detection limit is as low as 0.1 μM. The as-prepared AuNCs exhibit high selectivity; the existing biomolecules including various amino acids, ascorbic acid, uric acid, glucose, etc, do not interfere with the assay. The proposed method is successfully applied to the assay of DA in human serum, indicating its practical potential.
Cosgrove, J W; Brown, I R
1984-05-01
An initiating cell-free protein synthesis system derived from brain was utilized to demonstrate that the intravenous injection of D-lysergic acid diethylamide (LSD) to rabbits resulted in a lesion at the initiation stage of brain protein synthesis. Three inhibitors of initiation, edeine, poly(I), and aurintricarboxylic acid were used to demonstrate a reduction in initiation-dependent amino acid incorporation in the brain cell-free system. One hour after LSD injection, there was also a measurable decrease in the formation of 40S and 80S initiation complexes in vitro, using either [35S]methionine or [35S]Met-tRNAf. Analysis of the methionine pool size after LSD administration indicated there was no change in methionine levels. Analysis of the formation of initiation complexes in the brain cell-free protein synthesis system prepared 6 h after LSD administration indicated that there was a return to control levels at this time. The effects of LSD on steps in the initiation process are thus reversible.
l-Tartaric acid synthesis from vitamin C in higher plants
DeBolt, Seth; Cook, Douglas R.; Ford, Christopher M.
2006-01-01
The biosynthetic pathway of l-tartaric acid, the form most commonly encountered in nature, and its catabolic ties to vitamin C, remain a challenge to plant scientists. Vitamin C and l-tartaric acid are plant-derived metabolites with intrinsic human value. In contrast to most fruits during development, grapes accumulate l-tartaric acid, which remains within the berry throughout ripening. Berry taste and the organoleptic properties and aging potential of wines are intimately linked to levels of l-tartaric acid present in the fruit, and those added during vinification. Elucidation of the reactions relating l-tartaric acid to vitamin C catabolism in the Vitaceae showed that they proceed via the oxidation of l-idonic acid, the proposed rate-limiting step in the pathway. Here we report the use of transcript and metabolite profiling to identify candidate cDNAs from genes expressed at developmental times and in tissues appropriate for l-tartaric acid biosynthesis in grape berries. Enzymological analyses of one candidate confirmed its activity in the proposed rate-limiting step of the direct pathway from vitamin C to tartaric acid in higher plants. Surveying organic acid content in Vitis and related genera, we have identified a non-tartrate-forming species in which this gene is deleted. This species accumulates in excess of three times the levels of vitamin C than comparably ripe berries of tartrate-accumulating species, suggesting that modulation of tartaric acid biosynthesis may provide a rational basis for the production of grapes rich in vitamin C. PMID:16567629
Eusufzai, S; Axelson, M; Angelin, B; Einarsson, K
1993-05-01
The synthesis of bile acids is regulated by a homeostatic mechanism in which bile acids returning to the liver from the intestine inhibit their own synthesis. Serum concentrations of the bile acid intermediate 7 alpha-hydroxy-4-cholesten-3-one reflect the rate of bile acid synthesis whereas bile acid malabsorption can be determined by the SeHCAT test. This study was done to evaluate the correlation between the two tests in humans. Twenty eight patients with chronic diarrhoea were included in the study. Fasting serum was collected for the determination of 7 alpha-hydroxy-4-cholesten-3-one, and on the same day the gamma emitting bile acid analogue SeHCAT was given orally and its fractional catabolic rate assessed by repeated external counting over the upper abdomen during the next seven days. There was a highly significant positive correlation between the two tests (Rs = 0.80, p < 0.001). The results show a close relation between intestinal loss and hepatic synthesis of bile acids and imply that analysis of 7 alpha-hydroxy-4-cholesten-3-one in serum should now be evaluated as a possible convenient method for assessing bile acid malabsorption in patients with diarrhoea.
Schulze, G; Jung, K; Kunze, D; Egger, E
1976-01-01
The preparation of PC with the 14C-fatty acids palmitic, stearic, oleic and linoleic acid at OH-group in position 2 is described. The starting material is egg yolk lecithin. By the attack of snake venom phospholiphase lyso-PC is produced which is reacylated by the appropriate fatty acid anhydride. In comparison with the methods published up to now this preparation has the advantage of higher yields and greater simplicity. By means of in vivo synthesis it is impossible to get PC species with only one fatty acid in a defined position. Working with radioactive fatty acids the specific radioactivity can be adapted to the requirements. The procedure can be made on a semi-technical scale.
Gurdak, Jason J.; Roe, Cassia D.
2009-01-01
Playas are ephemeral, closed-basin wetlands that are important zones of recharge to the High Plains (or Ogallala) aquifer and critical habitat for birds and other wildlife in the otherwise semiarid, shortgrass prairie and agricultural landscape. The ephemeral nature of playas, low regional recharge rates, and a strong reliance on ground water from the High Plains aquifer has prompted many questions regarding the contribution of recharge from playas to the regional aquifer. To address these questions and concerns, the U.S. Geological Survey, in cooperation with the Playa Lakes Joint Venture, present a review and synthesis of the more than 175 publications about recharge rates and chemistry beneath playas and interplaya settings. Although a number of questions remain regarding the controls on recharge rates and chemistry beneath playas, the results from most published studies indicate that recharge rates beneath playas are substantially (1 to 2 orders of magnitude) higher than recharge rates beneath interplaya settings. The synthesis presented here supports the conceptual model that playas are important zones of recharge to the High Plains aquifer and are not strictly evaporative pans. The major findings of this synthesis yield science-based implications for the protection and management of playas and ground-water resources of the High Plains aquifer and directions for future research.
Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng
2016-02-11
An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.
USDA-ARS?s Scientific Manuscript database
Moschamine is a safflomide-type phenylpropenoic acid amide originally isolated from Centaurea cyanus. This paper describes the synthesis, detection of serotoninergic and COX inhibitory activities, and bioavailability of moschamine. Moschamine was chemically synthesized and identified using NMR spect...
Synthesis of (125) I-lamivudine and (125) I-lamivudine-ursodeoxycholic acid codrug.
Motaleb, M A; Abo-Kul, M; Ibrahim, Samy M; Saad, Shokry M; Arafat, Muhammad
2016-09-01
The preparation of (125) I-lamivudine ((125) I-3TC) and (125) I-lamivudine-ursodeoxycholic acid codrug ((125) I-3TC-UDCA), suitable for comparative biodistribution studies, is described. The synthesis of the unlabeled precursor 3TC-UDCA proceeds in an 11.6% yield, and the radiolabelling yields for (125) I-3TC and (125) I-3TC-UDCA were 89 and 92%, respectively. The final products are radiochemically pure (greater than 98%). Copyright © 2016 John Wiley & Sons, Ltd.
Scott, Alison J.; Ford, Lauren A.; Pei, Zhengtong; Watkins, Paul A.; Ernst, Robert K.; Belov, George A.
2013-01-01
All positive strand (+RNA) viruses of eukaryotes replicate their genomes in association with membranes. The mechanisms of membrane remodeling in infected cells represent attractive targets for designing future therapeutics, but our understanding of this process is very limited. Elements of autophagy and/or the secretory pathway were proposed to be hijacked for building of picornavirus replication organelles. However, even closely related viruses differ significantly in their requirements for components of these pathways. We demonstrate here that infection with diverse picornaviruses rapidly activates import of long chain fatty acids. While in non-infected cells the imported fatty acids are channeled to lipid droplets, in infected cells the synthesis of neutral lipids is shut down and the fatty acids are utilized in highly up-regulated phosphatidylcholine synthesis. Thus the replication organelles are likely built from de novo synthesized membrane material, rather than from the remodeled pre-existing membranes. We show that activation of fatty acid import is linked to the up-regulation of cellular long chain acyl-CoA synthetase activity and identify the long chain acyl-CoA syntheatse3 (Acsl3) as a novel host factor required for polio replication. Poliovirus protein 2A is required to trigger the activation of import of fatty acids independent of its protease activity. Shift in fatty acid import preferences by infected cells results in synthesis of phosphatidylcholines different from those in uninfected cells, arguing that the viral replication organelles possess unique properties compared to the pre-existing membranes. Our data show how poliovirus can change the overall cellular membrane homeostasis by targeting one critical process. They explain earlier observations of increased phospholipid synthesis in infected cells and suggest a simple model of the structural development of the membranous scaffold of replication complexes of picorna-like viruses, that may be
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.
The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novomore » assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase Ill increased MCFA synthesis up to fivefold. In conclusion, the level of increase is dependent on promoter strength and culturing conditions.« less
Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; ...
2016-05-26
The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novomore » assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase Ill increased MCFA synthesis up to fivefold. In conclusion, the level of increase is dependent on promoter strength and culturing conditions.« less
Chu, Lingling; Lipshultz, Jeffrey M.
2015-01-01
The direct decarboxylative arylation of α-oxo acids has been achieved via synergistic visible light-mediated photoredox and nickel catalyses. This method offers rapid entry to aryl and alkyl ketone architectures from simple α-oxo acid precursors via an acyl radical intermediate. Significant substrate scope is observed with respect to both the oxo acid and arene coupling partners. This mild decarboxylative arylation can also be utilized to efficiently access medicinal agents, as demonstrated by the rapid synthesis of fenofibrate. PMID:26014029
Autio, Kaija J; Schmitz, Werner; Nair, Remya R; Selkälä, Eija M; Sormunen, Raija T; Miinalainen, Ilkka J; Crick, Peter J; Wang, Yuqin; Griffiths, William J; Reddy, Janardan K; Baes, Myriam; Hiltunen, J Kalervo
2014-07-01
Cholesterol is catabolized to bile acids by peroxisomal β-oxidation in which the side chain of C27-bile acid intermediates is shortened by three carbon atoms to form mature C24-bile acids. Knockout mouse models deficient in AMACR (α-methylacyl-CoA racemase) or MFE-2 (peroxisomal multifunctional enzyme type 2), in which this β-oxidation pathway is prevented, display a residual C24-bile acid pool which, although greatly reduced, implies the existence of alternative pathways of bile acid synthesis. One alternative pathway could involve Mfe-1 (peroxisomal multifunctional enzyme type 1) either with or without Amacr. To test this hypothesis, we generated a double knockout mouse model lacking both Amacr and Mfe-1 activities and studied the bile acid profiles in wild-type, Mfe-1 and Amacr single knockout mouse line and Mfe-1 and Amacr double knockout mouse lines. The total bile acid pool was decreased in Mfe-1-/- mice compared with wild-type and the levels of mature C24-bile acids were reduced in the double knockout mice when compared with Amacr-deficient mice. These results indicate that Mfe-1 can contribute to the synthesis of mature bile acids in both Amacr-dependent and Amacr-independent pathways.
Tetraethylene glycol promoted two-step, one-pot rapid synthesis of indole-3-[1- 11C]acetic acid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Sojeong; Qu, Wenchao; Alexoff, David L.
2014-12-12
An operationally friendly, two-step, one-pot process has been developed for the rapid synthesis of carbon-11 labeled indole-3-acetic acid ([ 11]IAA or [ 11]auxin). By replacing an aprotic polar solvent with tetraethylene glycol, nucleophilic [ 11]cyanation and alkaline hydrolysis reactions were performed consecutively in a single pot without a time-consuming intermediate purification step. The entire production time for this updated procedure is 55 min, which dramatically simplifies the entire synthesis and reduces the starting radioactivity required for a whole plant imaging study.
Dickinson, Jared M; Fry, Christopher S; Drummond, Micah J; Gundermann, David M; Walker, Dillon K; Glynn, Erin L; Timmerman, Kyle L; Dhanani, Shaheen; Volpi, Elena; Rasmussen, Blake B
2011-05-01
The relationship between mammalian target of rapamycin complex 1 (mTORC1) signaling and muscle protein synthesis during instances of amino acid surplus in humans is based solely on correlational data. Therefore, the goal of this study was to use a mechanistic approach specifically designed to determine whether increased mTORC1 activation is requisite for the stimulation of muscle protein synthesis following L-essential amino acid (EAA) ingestion in humans. Examination of muscle protein synthesis and signaling were performed on vastus lateralis muscle biopsies obtained from 8 young (25 ± 2 y) individuals who were studied prior to and following ingestion of 10 g of EAA during 2 separate trials in a randomized, counterbalanced design. The trials were identical except during 1 trial, participants were administered a single oral dose of a potent mTORC1 inhibitor (rapamycin) prior to EAA ingestion. In response to EAA ingestion, an ~60% increase in muscle protein synthesis was observed during the control trial, concomitant with increased phosphorylation of mTOR (Ser(2448)), ribosomal S6 kinase 1 (Thr(389)), and eukaryotic initiation factor 4E binding protein 1 (Thr(37/46)). In contrast, prior administration of rapamycin completely blocked the increase in muscle protein synthesis and blocked or attenuated activation of mTORC1-signaling proteins. The inhibition of muscle protein synthesis and signaling was not due to differences in either extracellular or intracellular amino acid availability, because these variables were similar between trials. These data support a fundamental role for mTORC1 activation as a key regulator of human muscle protein synthesis in response to increased EAA availability. This information will be useful in the development of evidence-based nutritional therapies targeting mTORC1 to counteract muscle wasting associated with numerous clinical conditions.
NASA Astrophysics Data System (ADS)
Gautam, Poonam; Gautam, Deepika; Chaudhary, R. P.
2018-05-01
1-Arylidene-2-tetralone (2), obtained from condensation of 2-tetralone and aromatic aldehydes in acetic acid and HCl, on condensation with thiosemicarbazide in acidic and alkaline medium afforded tetrahydro-2H-benzo[e]indazole-2-carbothioamide as trans (3) and cis (4) diastereoisomers of 1-H and 9b-H respectively. The synthesis of new indazolyl-thiazol-4(5H)-ones (5) from trans isomer (3) and α-halo acids is reported. A DFT study along with single crystal X-ray diffraction data of a representative compound (5a) is presented. The chemistry of the reaction of indazole-2-carbothioamides with methyl iodide, DMAD and acetic anhydride is described. Eight newly synthesised compounds were screened for their antibacterial and antifungal activities. Some of the compounds have shown promising antimicrobial activities.
Dezfulian, Mohammad H; Foreman, Curtis; Jalili, Espanta; Pal, Mrinal; Dhaliwal, Rajdeep K; Roberto, Don Karl A; Imre, Kathleen M; Kohalmi, Susanne E; Crosby, William L
2017-04-07
Branched-chain amino acids (BCAAs) are synthesized by plants, fungi, bacteria, and archaea with plants being the major source of these amino acids in animal diets. Acetolactate synthase (ALS) is the first enzyme in the BCAA synthesis pathway. Although the functional contribution of ALS to BCAA biosynthesis has been extensively characterized, a comprehensive understanding of the regulation of this pathway at the molecular level is still lacking. To characterize the regulatory processes governing ALS activity we utilized several complementary approaches. Using the ALS catalytic protein subunit as bait we performed a yeast two-hybrid (Y2H) screen which resulted in the identification of a set of interacting proteins, two of which (denoted as ALS-INTERACTING PROTEIN1 and 3 [AIP1 and AIP3, respectively]) were found to be evolutionarily conserved orthologues of bacterial feedback-regulatory proteins and therefore implicated in the regulation of ALS activity. To investigate the molecular role AIPs might play in BCAA synthesis in Arabidopsis thaliana, we examined the functional contribution of aip1 and aip3 knockout alleles to plant patterning and development and BCAA synthesis under various growth conditions. Loss-of-function genetic backgrounds involving these two genes exhibited differential aberrant growth responses in valine-, isoleucine-, and sodium chloride-supplemented media. While BCAA synthesis is believed to be localized to the chloroplast, both AIP1 and AIP3 were found to localize to the peroxisome in addition to the chloroplast. Analysis of free amino acid pools in the mutant backgrounds revealed that they differ in the absolute amount of individual BCAAs accumulated and exhibit elevated levels of BCAAs in leaf tissues. Despite the phenotypic differences observed in aip1 and aip3 backgrounds, functional redundancy between these loci was suggested by the finding that aip1/aip3 double knockout mutants are severely developmentally compromised. Taken together the
Impheng, Hathaichanok; Richert, Lysiane; Pekthong, Dumrongsak; Scholfield, C Norman; Pongcharoen, Sutatip; Pungpetchara, Ittipon; Srisawang, Piyarat
2015-01-01
The de novo fatty acid synthesis catalyzed by key lipogenic enzymes, including fatty acid synthase (FASN) has emerged as one of the novel targets of anti-cancer approaches. The present study explored the possible inhibitory efficacy of [6]-gingerol on de novo fatty acid synthesis associated with mitochondrial-dependent apoptotic induction in HepG2 cells. We observed a dissipation of mitochondrial membrane potential accompanied by a reduction of fatty acid levels. [6]-gingerol administration manifested inhibition of FASN expression, indicating FASN is a major target of [6]-gingerol inducing apoptosis in HepG2 cells. Indeed, we found that increased ROS generation could likely be a mediator of the anti-cancer effect of [6]-gingerol. A reduction of fatty acid levels and induction of apoptosis were restored by inhibition of acetyl-CoA carboxylase (ACC) activity, suggesting an accumulation of malonyl-CoA level could be the major cause of apoptotic induction of [6]-gingerol in HepG2 cells. The present study also showed that depletion of fatty acid following [6]-gingerol treatment caused an inhibitory effect on carnitine palmitoyltransferase-1 activity (CPT-1), whereas C75 augmented CPT-1 activity, indicating that [6]-gingerol exhibits the therapeutic benefit on suppression of fatty acid β-oxidation.
Smith, Richard W; Ottema, Colin
2006-03-01
Rapidly growing African catfish yolk sac larvae were investigated during the first 22 h after hatching. Body compartment protein concentration increased fourfold yet oxygen consumption remained constant (mean=21.3 +/- 3.2 nmol O2 mg(-1) protein h(-1)), suggesting fast growth results mainly from yolk sac protein absorption. The protein synthesis rates at 1-2 and 5-6 h also equaled the highest conceivable rates of muscle protein synthesis; 11.6-11.9% and 7.4-7.9% day(-1), respectively. Therefore the corresponding energetic costs of protein synthesis were almost the theoretical minimum; 13.0 +/- 1.7-16.3 +/- 2.8 micromol O2 mg(-1) protein synthesised. Total protein synthesis expenditure (74.5-77.7 micromol O2 g(-1) protein h(-1)) was also less than other yolk sac larvae. These protein synthesis rates resulted from high RNA concentrations (113.2 +/- 3.4 microg RNA mg(-1) protein) and were also correlated with RNA translational efficiency. High translational efficiency (1 h; 1.2+/-0.1 mg protein synthesised microg(-1) RNA day(-1)) equaled high synthesis rate (36.8 +/- 5.4 microg RNA microg(-1) DNA day(-1)) and both declined over 22 h. This investigation suggests rapid growth combines growth efficiency and compensatory energy partitioning. This accommodates the ontogenetic and phylogenetic standpoints imposed by energy budget limitations.
van der Meijden, Maarten W; Balandina, Tatyana; Ivasenko, Oleksandr; De Feyter, Steven; Wurst, Klaus; Kellogg, Richard M
2016-10-04
A convergent synthesis of racemic [6]hexahelicene-7-carboxylic acid by cross-coupling of a bicyclic and a tricyclic component is described. A metal-catalyzed ring-closure is also a fundamental component of the synthetic approach. Scanning tunneling microscopy (STM) measurements of the racemate self-assembled on Au(111) at liquid-solid interface revealed the formation of ordered racemic 2D crystals. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Synthesis of triazole-based unnatural amino acids, triazole bisaminoacids and β-amino triazole has been described via stereo and regioselective one-pot multi-component reaction of sulfamidates, sodium azide, and alkynes under MW irradiation conditions. The developed method is app...
Amino acid metabolism in dairy cows and their regulation in milk synthesis.
Wang, Feiran; Shi, Haitao; Wang, Shuxiang; Wang, Yajing; Cao, Zhijun; Li, Shengli
2018-06-10
Reducing dietary crude protein (CP) and supplementing with certain amino acids (AAs) has been known as a potential solution to improve nitrogen (N) efficiency in dairy production. Thus understanding how AAs are utilized in various sites along the gut is critical. AA flow from the intestine to portal-drained viscera (PDV) and liver then to the mammary gland was elaborated in this article. Recoveries in individual AA in PDV and liver seem to share similar AA pattern with input: output ratio in mammary gland, which subdivides essential AA (EAA) into two groups, lysine (Lys) and branched-chain AA (BCAA) in group 1, input: output ratio > 1; methionine (Met), histidine (His), phenylalanine (Phe) etc. in group 2, input: output ratio close to 1. AAs in the mammary gland are either utilized for milk protein synthesis or retained as body tissue, or catabolized. The fractional removal of AAs and the number and activity of AA transporters together contribute to the ability of AAs going through mammary cells. Mammalian target of rapamycin (mTOR) pathway is closely related to milk protein synthesis and provides alternatives for AA regulation of milk protein synthesis, which connects AA with lactose synthesis via α-lactalbumin (gene: LALBA) and links with milk fat synthesis via sterol regulatory element-binding transcription protein 1 (SREBP1) and peroxisome proliferator-activated receptor (PPAR). Overall, AA flow across various tissues reveal AA metabolism and utilization in dairy cows on one hand. While the function of AA in the biosynthesis of milk protein, fat and lactose at both transcriptional and posttranscriptional level from another angle provides the possibility for us to regulate them for higher efficiency. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Sundblom, Andreas; Palmqvist, Anders E C; Holmberg, Krister
2010-02-02
The interaction between silica and poly(ethylene oxide) (PEO) in water may appear trivial and it is generally stated that hydrogen bonding is responsible for the attraction. However, a literature search shows that there is not a consensus with respect to the mechanism behind the attractive interaction. Several papers claim that only hydrogen bonding is not sufficient to explain the binding. The silica-PEO interaction is interesting from an academic perspective and it is also exploited in the preparation of mesoporous silica, a material of considerable current interest. This study concerns the very early stage of synthesis of mesoporous silica under mild acidic conditions, pH 2-5, and the aim is to shed light on the interaction between silica and the PEO-containing structure directing agent. The synthesis comprises two steps. An organic silica source, tetraethylorthosilicate (TEOS), is first hydrolyzed and Pluronic P123, a poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) (PEO-PPO-PEO) block copolymer, is subsequently added at different time periods following the hydrolysis of TEOS. It is shown that the interaction between the silica and the Pluronic is dependent both on the temperature and on the time between onset of TEOS hydrolysis and addition of the copolymer. The results show that the interaction is mainly driven by entropy. The effect of the synthesis temperature and of the time between hydrolysis and addition of the copolymer on the final material is also studied. The material with the highest degree of mesoorder was obtained when the reaction was performed at 20 degrees C and the copolymer was added 40 h after the start of TEOS hydrolysis. It is claimed that the reason for the good ordering of the silica is that whereas particle formation under these conditions is fast, the rate of silica condensation is relatively low.
Nishi, Kyoko; Mück-Seler, Dorotea; Hasegawa, Shu; Watanabe, Arata; Diksic, Mirko
2006-10-16
Serotonin (5-HT), norepinephrine (NE) and dopamine (DA) released from nerve terminals in the brain are primarily removed from the synaptic cleft by a reuptake mechanism. In part, the homeostasis is maintained by monoamine oxidase (MAO) deamination achieved primarily intracellularly. The present study's aim was to examine the effect of the acute administration of the MAO inhibitors, moclobemide (a MAO-A inhibitor) and deprenyl (a MAO-B inhibitor), on 5-HT synthesis rates, measured in discrete regions of the rat brain by an autoradiographic method, using alpha-[14C]methyl-l-tryptophan as a tracer. MAO inhibitors have different effects on 5-HT synthesis rates in the cell bodies and areas of the nerve terminals. Moclobemide (10 mg/kg, i.p. 30 min before the tracer injection) and deprenyl (3 mg/kg, i.p. 2 h before the tracer injection) decreased the 5-HT synthesis rates in the dorsal (-18% and -22%) and median (-22% and -33%) raphe, respectively. Moclobemide also significantly decreased 5-HT synthesis in the entire nerve terminal areas investigated. The reductions were between 23% (cingulate cortex) and 50% (locus coeruleus). Deprenyl did not significantly affect 5-HT synthesis in the nerve terminals. The present results suggest that MAO-A, and to a lesser extent, MAO-B, are involved in the regulation of 5-HT synthesis in the rat brain. The mechanism(s) of MAO inhibitors' action on 5-HT synthesis in the raphe nuclei are probably related to an increase in the extraneuronal 5-HT concentration and also to the interaction between the serotonergic and catecholaminergic neurons. The reduction of 5-HT synthesis in the raphe nuclei likely occurs by an action of extracellular 5-HT via the dendritic autoreceptors with a possible contribution from the action of extracellular DA and NE. In the terminal regions, the most likely mechanism is via the presynaptic autoreceptors through which elevated extraneuronal 5-HT acts on synthesis control. However, there is also a possibility that
Model of the synthesis of trisporic acid in Mucorales showing bistability.
Werner, S; Schroeter, A; Schimek, C; Vlaic, S; Wöstemeyer, J; Schuster, S
2012-12-01
An important substance in the signalling between individuals of Mucor-like fungi is trisporic acid (TA). This compound, together with some of its precursors, serves as a pheromone in mating between (+)- and (-)-mating types. Moreover, intermediates of the TA pathway are exchanged between the two mating partners. Based on differential equations, mathematical models of the synthesis pathways of TA in the two mating types of an idealised Mucor-fungus are here presented. These models include the positive feedback of TA on its own synthesis. The authors compare three sub-models in view of bistability, robustness and the reversibility of transitions. The proposed modelling study showed that, in a system where intermediates are exchanged, a reversible transition between the two stable steady states occurs, whereas an exchange of the end product leads to an irreversible transition. The reversible transition is physiologically favoured, because the high-production state of TA must come to an end eventually. Moreover, the exchange of intermediates and TA is compared with the 3-way handshake widely used by computers linked in a network.
Catalytic Synthesis of Oxygenates: Mechanisms, Catalysts and Controlling Characteristics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Klier, Kamil; Herman, Richard G
2005-11-30
This research focused on catalytic synthesis of unsymmetrical ethers as a part of a larger program involving oxygenated products in general, including alcohols, ethers, esters, carboxylic acids and their derivatives that link together environmentally compliant fuels, monomers, and high-value chemicals. The catalysts studied here were solid acids possessing strong Brnsted acid functionalities. The design of these catalysts involved anchoring the acid groups onto inorganic oxides, e.g. surface-grafted acid groups on zirconia, and a new class of mesoporous solid acids, i.e. propylsulfonic acid-derivatized SBA-15. The former catalysts consisted of a high surface concentration of sulfate groups on stable zirconia catalysts. Themore » latter catalyst consists of high surface area, large pore propylsulfonic acid-derivatized silicas, specifically SBA-15. In both cases, the catalyst design and synthesis yielded high concentrations of acid sites in close proximity to one another. These materials have been well-characterization in terms of physical and chemical properties, as well as in regard to surface and bulk characteristics. Both types of catalysts were shown to exhibit high catalytic performance with respect to both activity and selectivity for the bifunctional coupling of alcohols to form ethers, which proceeds via an efficient SN2 reaction mechanism on the proximal acid sites. This commonality of the dual-site SN2 reaction mechanism over acid catalysts provides for maximum reaction rates and control of selectivity by reaction conditions, i.e. pressure, temperature, and reactant concentrations. This research provides the scientific groundwork for synthesis of ethers for energy applications. The synthesized environmentally acceptable ethers, in part derived from natural gas via alcohol intermediates, exhibit high cetane properties, e.g. methylisobutylether with cetane No. of 53 and dimethylether with cetane No. of 55-60, or high octane properties, e
McMahon, Vern; Stumpf, P. K.
1966-01-01
The capacity of both developing seeds and germinating seedlings of safflower for the incorporation of acetate-C14 into long-chain fatty acids is examined. Intact tissue of the developing seed shows a low rate of acetate incorporation into fatty acid initially but between the tenth and twenty-fifth day after flowering the tissue has a high rate of synthesis, in particular with respect to the unsaturated fatty acids. Centrifuged fractionation of homogenates of this developmental tissue yielded several active fractions, the most active being the PI fraction consisting mostly of plastids. Cofactor requirements and pH effects are examined. Germinating tissue shows a more uniform capacity for synthesis of fatty acids since there is no marked change in synthetic capacity. The newly synthesized fatty acids are consistently palmitic, stearic, and oleic acid. No linoleic synthesis could be detected. The most active fraction of cell-free preparation of germinating tissue is the plastid fraction (PI), similar to what was formed with developing tissue. PMID:5904587
Green synthesis of carbon dots from pork and application as nanosensors for uric acid detection
NASA Astrophysics Data System (ADS)
Zhao, Chunxi; Jiao, Yang; Hu, Feng; Yang, Yaling
2018-02-01
In this work, a green, simple, economical method was developed in the synthesis of fluorescent carbon dots using pork as carbon source. The as-prepared carbon dots exhibit exceptional advantages including high fluorescent quantum yield (17.3%) and satisfactory chemical stability. The fluorescence of carbon dots based nanosensor can be selectively and efficiently quenched by uric acid. This phenomenon was used to develop a fluorescent method for facile detection of uric acid within a linear range of 0.1-100 μM and 100-500 μM, with a detection limit of 0.05 μM (S/N = 3). Finally, the proposed method was successfully applied in the determination of uric acid in human serum and urine samples with satisfactory recoveries, which suggested that the new nanosensors have great prospect toward the detection of uric acid in human fluids.
Chen, Zhe-Ning; Chan, Kwong-Yu; Pulleri, Jayasree K; Kong, Jing; Hu, Hao
2015-02-16
Because formic acid can be effectively decomposed by catalysis into very pure hydrogen gas, the synthesis of formic acid, especially using CO and H2O as an intermediate of the water gas shift reaction (WGSR), bears important application significance in industrial hydrogen gas production. Here we report a theoretical study on the mechanism of efficient preparation of formic acid using CO and H2O catalyzed by a water-soluble [Ru(3+)]-EDTA complex. To determine the feasibility of using the [Ru(3+)]-EDTA catalyst to produce CO-free hydrogen gas in WGSR, two probable reaction paths have been examined: one synthesizes formic acid, while the other converts the reactants directly into CO2 and H2, the final products of WGSR. Our calculation results provide a detailed mechanistic rationalization for the experimentally observed selective synthesis of HCOOH by the [Ru(3+)]-EDTA catalyst. The results support the applicability of using the [Ru(3+)]-EDTA catalyst to efficiently synthesize formic acid for hydrogen production. Careful analyses of the electronic structure and interactions of different reaction complexes suggest that the selectivity of the reaction processes is achieved through the proper charge/valence state of the metal center of the [Ru(3+)]-EDTA complex. With the catalytic roles of the ruthenium center and the EDTA ligand being carefully understood, the detailed mechanistic information obtained in this study will help to design more efficient catalysts for the preparation of formic acid and further to produce CO-free H2 at ambient temperature.
Optimizing the measurement of mitochondrial protein synthesis in human skeletal muscle.
Burd, Nicholas A; Tardif, Nicolas; Rooyackers, Olav; van Loon, Luc J C
2015-01-01
The measurement of mitochondrial protein synthesis after food ingestion, contractile activity, and/or disease is often used to provide insight into skeletal muscle adaptations that occur in the longer term. Studies have shown that protein ingestion stimulates mitochondrial protein synthesis in human skeletal muscle. Minor differences in the stimulation of mitochondrial protein synthesis occur after a single bout of resistance or endurance exercise. There appear to be no measurable differences in mitochondrial protein synthesis between critically ill patients and aged-matched controls. However, the mitochondrial protein synthetic response is reduced at a more advanced age. In this paper, we discuss the challenges involved in the measurement of human skeletal muscle mitochondrial protein synthesis rates based on stable isotope amino acid tracer methods. Practical guidelines are discussed to improve the reliability of the measurement of mitochondrial protein synthesis rates. The value of the measurement of mitochondrial protein synthesis after a single meal or exercise bout on the prediction of the longer term skeletal muscle mass and performance outcomes in both the healthy and disease populations requires more work, but we emphasize that the measurements need to be reliable to be of any value to the field.
Wang, Huicong; Ma, Fangfang; Cheng, Lailiang
2010-07-01
Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.
NASA Technical Reports Server (NTRS)
Nonhebel, H. M.; Bandurski, R. S. (Principal Investigator)
1986-01-01
Oxindole-3-acetic acid is the principal catabolite of indole-3-acetic acid in Zea mays seedlings. In this paper measurements of the turnover of oxindole-3-acetic acid are presented and used to calculate the rate of indole-3-acetic acid oxidation. [3H]Oxindole-3-acetic acid was applied to the endosperm of Zea mays seedlings and allowed to equilibrate for 24 h before the start of the experiment. The subsequent decrease in its specific activity was used to calculate the turnover rate. The average half-life of oxindole-3-acetic acid in the shoots was found to be 30 h while that in the kernels had an average half-life of 35h. Using previously published values of the pool sizes of oxindole-3-acetic acid in shoots and kernels from seedlings of the same age and variety, and grown under the same conditions, the rate of indole-3-acetic acid oxidation was calculated to be 1.1 pmol plant-1 h-1 in the shoots and 7.1 pmol plant-1 h-1 in the kernels.
Calcium regulates glutamate dehydrogenase and poly-γ-glutamic acid synthesis in Bacillus natto.
Meng, Yonghong; Dong, Guiru; Zhang, Chen; Ren, Yuanyuan; Qu, Yuling; Chen, Weifeng
2016-04-01
To study the effect of Ca(2+) on glutamate dehydrogenase (GDH) and its role in poly-γ-glutamic acid (γ-PGA) synthesis in Bacillus natto HSF 1410. When the concentration of Ca(2+) varied from 0 to 0.1 g/l in the growth medium of B. natto HSF 1410, γ-PGA production increased from 6.8 to 9.7 g/l, while GDH specific activity and NH4Cl consumption improved from 183 to 295 U/mg and from 0.65 to 0.77 g/l, respectively. GDH with α-ketoglutarate as substrate primarily used NADPH as coenzyme with a K m of 0.08 mM. GDH was responsible for the synthesis of endogenous glutamate. The specific activity of GDH remained essentially unchanged in the presence of CaCl2 (0.05-0.2 g/l) in vitro. However, the specific activity of GDH and its expression was significantly increased by CaCl2 in vivo. Therefore, the regulation of GDH and PGA synthesis by Ca(2+) is an intracellular process. Calcium regulation may be an effective approach for producing γ-PGA on an industrial scale.
Synthesis of triazole based unnatural amino acids and β-amino triazole has been described via stereo and regioselective one-pot multi-component reaction of sulfamidates, sodium azide, and alkynes under MW conditions. The developed method is applicable to a broad substrate scope a...
Best, Daniel; Burns, David J; Lam, Hon Wai
2015-06-15
A commercially available rhodium(II) complex catalyzes the direct arylation of 5-diazobarbituric acids with arenes, allowing straightforward access to 5-aryl barbituric acids. Free N-H groups are tolerated on the barbituric acid, with no complications arising from N-H insertion processes. This method was applied to the concise synthesis of a potent matrix metalloproteinase (MMP) inhibitor. © 2015 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.
Furmark, Tomas; Marteinsdottir, Ina; Frick, Andreas; Heurling, Kerstin; Tillfors, Maria; Appel, Lieuwe; Antoni, Gunnar; Hartvig, Per; Fischer, Håkan; Långström, Bengt; Eriksson, Elias; Fredrikson, Mats
2016-10-01
It is disputed whether anxiety disorders, like social anxiety disorder, are characterized by serotonin over- or underactivity. Here, we evaluated whether our recent finding of elevated neural serotonin synthesis rate in patients with social anxiety disorder could be reproduced in a separate cohort, and whether allelic variation in the tryptophan hydroxylase-2 (TPH2) G-703T polymorphism relates to differences in serotonin synthesis assessed with positron emission tomography. Eighteen social anxiety disorder patients and six healthy controls were scanned during 60 minutes in a resting state using positron emission tomography and 5-hydroxy-L-[β -(11)C]tryptophan, [(11)C]5-HTP, a substrate of the second enzymatic step in serotonin synthesis. Parametric images were generated, using the reference Patlak method, and analysed using Statistical Parametric Mapping (SPM8). Blood samples for genotyping of the TPH2 G-703T polymorphism were obtained from 16 social anxiety disorder patients (T carriers: n=5, GG carriers: n=11). A significantly elevated [(11)C]5-HTP accumulation rate, indicative of enhanced decarboxylase activity and thereby serotonin synthesis capacity, was detected in social anxiety disorder patients compared with controls in the hippocampus and basal ganglia nuclei and, at a more lenient (uncorrected) statistical threshold, in the amygdala and anterior cingulate cortex. In patients, the serotonin synthesis rate in the amygdala and anterior cingulate cortex was significantly elevated in TPH2 T carriers in comparison with GG homozygotes. Our results support that social anxiety disorder entails an overactive presynaptic serotonergic system that, in turn, seems functionally influenced by the TPH2 G-703T polymorphism in emotionally relevant brain regions. © The Author(s) 2016.
NASA Astrophysics Data System (ADS)
Mérida, Fernando; Chiu-Lam, Andreina; Bohórquez, Ana C.; Maldonado-Camargo, Lorena; Pérez, María-Eglée; Pericchi, Luis; Torres-Lugo, Madeline; Rinaldi, Carlos
2015-11-01
Magnetic Fluid Hyperthermia (MFH) uses heat generated by magnetic nanoparticles exposed to alternating magnetic fields to cause a temperature increase in tumors to the hyperthermia range (43-47 °C), inducing apoptotic cancer cell death. As with all cancer nanomedicines, one of the most significant challenges with MFH is achieving high nanoparticle accumulation at the tumor site. This motivates development of synthesis strategies that maximize the rate of energy dissipation of iron oxide magnetic nanoparticles, preferable due to their intrinsic biocompatibility. This has led to development of synthesis strategies that, although attractive from the point of view of chemical elegance, may not be suitable for scale-up to quantities necessary for clinical use. On the other hand, to date the aqueous co-precipitation synthesis, which readily yields gram quantities of nanoparticles, has only been reported to yield sufficiently high specific absorption rates after laborious size selective fractionation. This work focuses on improvements to the aqueous co-precipitation of iron oxide nanoparticles to increase the specific absorption rate (SAR), by optimizing synthesis conditions and the subsequent peptization step. Heating efficiencies up to 1048 W/gFe (36.5 kA/m, 341 kHz; ILP=2.3 nH m2 kg-1) were obtained, which represent one of the highest values reported for iron oxide particles synthesized by co-precipitation without size-selective fractionation. Furthermore, particles reached SAR values of up to 719 W/gFe (36.5 kA/m, 341 kHz; ILP=1.6 nH m2 kg-1) when in a solid matrix, demonstrating they were capable of significant rates of energy dissipation even when restricted from physical rotation. Reduction in energy dissipation rate due to immobilization has been identified as an obstacle to clinical translation of MFH. Hence, particles obtained with the conditions reported here have great potential for application in nanoscale thermal cancer therapy.
Primordial synthesis of amines and amino acids in a 1958 Miller H2S-rich spark discharge experiment
Parker, Eric T.; Cleaves, Henderson J.; Dworkin, Jason P.; Glavin, Daniel P.; Callahan, Michael; Aubrey, Andrew; Lazcano, Antonio; Bada, Jeffrey L.
2011-01-01
Archived samples from a previously unreported 1958 Stanley Miller electric discharge experiment containing hydrogen sulfide (H2S) were recently discovered and analyzed using high-performance liquid chromatography and time-of-flight mass spectrometry. We report here the detection and quantification of primary amine-containing compounds in the original sample residues, which were produced via spark discharge using a gaseous mixture of H2S, CH4, NH3, and CO2. A total of 23 amino acids and 4 amines, including 7 organosulfur compounds, were detected in these samples. The major amino acids with chiral centers are racemic within the accuracy of the measurements, indicating that they are not contaminants introduced during sample storage. This experiment marks the first synthesis of sulfur amino acids from spark discharge experiments designed to imitate primordial environments. The relative yield of some amino acids, in particular the isomers of aminobutyric acid, are the highest ever found in a spark discharge experiment. The simulated primordial conditions used by Miller may serve as a model for early volcanic plume chemistry and provide insight to the possible roles such plumes may have played in abiotic organic synthesis. Additionally, the overall abundances of the synthesized amino acids in the presence of H2S are very similar to the abundances found in some carbonaceous meteorites, suggesting that H2S may have played an important role in prebiotic reactions in early solar system environments. PMID:21422282
Primordial Synthesis of Amines and Amino Acids in a 1958 Miller H2S-Rich Spark Discharge Experiment
NASA Technical Reports Server (NTRS)
Parker, Eric T.; Cleaves, Henderson J.; Dworkin, Jason P.; Glavin, Daniel P.; Callahan, Michael; Aubrey, Andrew; Lazcano, Antonio; Bada, Jeffrey L.
2011-01-01
Archived samples from a previously unreported 1958 Stanley Miller electric discharge experiment containing hydrogen sulfide (H2S) were recently discovered and analyzed using high-performance liquid chromatography and time-of-flight mass spectrometry. We report here the detection and quantification of primary amine-containing compounds in the original sample residues, which were produced via spark discharge using a gaseous mixture of H2S, CH4, NH3, and CO2. A total of 23 amino acids and 4 amines, including 7 organosulfur compounds, were detected in these samples. The major amino acids with chiral centers are racemic within the accuracy of the measurements, indicating that they are not contaminants introduced during sample storage. This experiment marks the first synthesis of sulfur amino acids from spark discharge experiments designed to imitate primordia! environments. The relative yield of some amino acids, in particular the isomers of aminobutyric acid, are the highest ever found in a spark discharge experiment. The simulated primordial conditions used by Miller may serve as a model for early volcanic plume chemistry and provide insight to the possible roles such plumes may have played in abiotic organic synthesis. Additionally, the overall abundances of the synthesized amino acids in the presence of H2S are very similar to the abundances found in some carbonaceous meteorites, suggesting that H2S may have played an important role in prebiotic reactions in early solar system environments.
Synthesis and Characterization of Chitosan-p-t-Butylcalix[4]arene acid
NASA Astrophysics Data System (ADS)
Handayani, D. S.; Frimadasi, W.; Kusumaningsih, T.; Pranoto
2018-03-01
The synthesis of chitosan-p-t-butylcalix[4]arene acid was done with DIC (N, N’-diisopropylcarbodiimide) as the coupling agent. The structural analysis of the chitosan-p-t-butylcalix[4]arene acid was conducted by spectrophotometer Fourier Transform Infra Red (FTIR) and X-Ray Diffraction (XRD). Meanwhile, the surface area was investigated by Surface Area Analysis, the Scanning Electrone Microscope (SEM) analysed the surface morphology, and also the melting point temperature was determined. FTIR analysis on Chitosan-p-t-butylcalix[4]arene provides an overlapped absorption of -OH and -NH groups at 3438.26 cm-1. Meanwhile, a C = C aromatic bond present at 1480.43 cm-1. XRD analysis shows some broaden peaks due to the amorphous phase of the prepared material. The prepared material is a brownish yellow solid, odorless and porous. The melting point, surface area, and the average pore radius are above 300 °C, 9.42 m2 / g, and 52.5938 Å, respectively.
Synthesis and characterization of hydrolysed starch-g-poly(methacrylic acid) composite.
Zahran, Magdy K; Ahmed, Enas M; El-Rafie, Mohamed H
2016-06-01
A novel method for the synthesis of starch-g-poly(methacrylic acid) composite was adopted by graft polymerization of hydrolysed starch (HS) and methacrylic acid (MAA) in aqueous medium using an efficient sodium perborate (SPB)-thiourea (TU) redox initiation system. The parameters influencing the redox system efficiency and thence the polymerization method were considered. These parameters comprehended the concentrations of MAA, SPB, TU and SPB/TU molar ratio as well as the polymerization temperature. The polymerization reaction was scrutinized through calculation of the MAA total conversion percent (TC%). The resultant poly(MAA-HS) composite was assessed by evaluating the polymer criteria (the graft yield, GY%; the grafting efficiency, GE%; the homopolymer, HP%; and the total conversion). The comportment of the apparent viscosity of the cooked poly(MAA)-starch composite paste, obtained under diverse polymerization conditions, was examined. Tentative mechanisms, which depict all occasions that happen amid the entire course of the polymerization reaction, have been proffered. Copyright © 2016 Elsevier B.V. All rights reserved.
Dysregulation of fatty acid synthesis and glycolysis in non-Hodgkin lymphoma
Bhatt, Aadra P.; Jacobs, Sarah R.; Freemerman, Alex J.; Makowski, Liza; Rathmell, Jeffrey C.; Dittmer, Dirk P.; Damania, Blossom
2012-01-01
The metabolic differences between B-NHL and primary human B cells are poorly understood. Among human B-cell non-Hodgkin lymphomas (B-NHL), primary effusion lymphoma (PEL) is a unique subset that is linked to infection with Kaposi's sarcoma-associated herpesvirus (KSHV). We report that the metabolic profiles of primary B cells are significantly different from that of PEL. Compared with primary B cells, both aerobic glycolysis and fatty acid synthesis (FAS) are up-regulated in PEL and other types of nonviral B-NHL. We found that aerobic glycolysis and FAS occur in a PI3K-dependent manner and appear to be interdependent. PEL overexpress the fatty acid synthesizing enzyme, FASN, and both PEL and other B-NHL were much more sensitive to the FAS inhibitor, C75, than primary B cells. Our findings suggest that FASN may be a unique candidate for molecular targeted therapy against PEL and other B-NHL. PMID:22752304
All-trans retinoic acid regulates hepatic bile acid homeostasis
Yang, Fan; He, Yuqi; Liu, Hui-Xin; Tsuei, Jessica; Jiang, Xiaoyue; Yang, Li; Wang, Zheng-Tao; Wan, Yu-Jui Yvonne
2014-01-01
Retinoic acid (RA) and bile acids share common roles in regulating lipid homeostasis and insulin sensitivity. In addition, the receptor for RA (retinoid x receptor) is a permissive partner of the receptor for bile acids, farnesoid x receptor (FXR/NR1H4). Thus, RA can activate the FXR-mediated pathway as well. The current study was designed to understand the effect of all-trans RA on bile acid homeostasis. Mice were fed an all-trans RA-supplemented diet and the expression of 46 genes that participate in regulating bile acid homeostasis was studied. The data showed that all-trans RA has a profound effect in regulating genes involved in synthesis and transport of bile acids. All-trans RA treatment reduced the gene expression levels of Cyp7a1, Cyp8b1, and Akr1d1, which are involved in bile acid synthesis. All-trans RA also decreased the hepatic mRNA levels of Lrh-1 (Nr5a2) and Hnf4α (Nr2a1), which positively regulate the gene expression of Cyp7a1 and Cyp8b1. Moreover, all-trans RA induced the gene expression levels of negative regulators of bile acid synthesis including hepatic Fgfr4, Fxr, and Shp (Nr0b2) as well as ileal Fgf15. All-trans RA also decreased the expression of Abcb11 and Slc51b, which have a role in bile acid transport. Consistently, all-trans RA reduced hepatic bile acid levels and the ratio of CA/CDCA, as demonstrated by liquid chromatography-mass spectrometry. The data suggest that all-trans RA-induced SHP may contribute to the inhibition of CYP7A1 and CYP8B1, which in turn reduces bile acid synthesis and affects lipid absorption in the gastrointestinal tract. PMID:25175738
Konopka, Adam R; Laurin, Jaime L; Musci, Robert V; Wolff, Christopher A; Reid, Justin J; Biela, Laurie M; Zhang, Qian; Peelor, Fredrick F; Melby, Christopher L; Hamilton, Karyn L; Miller, Benjamin F
2017-04-01
In older adults, chronic oxidative and inflammatory stresses are associated with an impaired increase in skeletal muscle protein synthesis after acute anabolic stimuli. Conjugated linoleic acid (CLA) and Protandim have been shown to activate nuclear factor erythroid-derived 2-like 2 (Nrf2), a transcription factor for the antioxidant response element and anti-inflammatory pathways. This study tested the hypothesis that compared to a placebo control (CON), CLA and Protandim would increase skeletal muscle subcellular protein (myofibrillar, mitochondrial, cytoplasmic) and DNA synthesis in older adults after 6 weeks of milk protein feeding. CLA decreased oxidative stress and skeletal muscle oxidative damage with a trend to increase messenger RNA (mRNA) expression of a Nrf2 target, NAD(P)H dehydrogenase quinone 1 (NQO1). However, CLA did not influence other Nrf2 targets (heme oxygenase-1 (HO-1), glutathione peroxidase 1 (Gpx1)) or protein or DNA synthesis. Conversely, Protandim increased HO-1 protein content but not the mRNA expression of downstream Nrf2 targets, oxidative stress, or skeletal muscle oxidative damage. Rates of myofibrillar protein synthesis were maintained despite lower mitochondrial and cytoplasmic protein syntheses after Protandim versus CON. Similarly, DNA synthesis was non-significantly lower after Protandim compared to CON. After Protandim, the ratio of protein to DNA synthesis tended to be greater in the myofibrillar fraction and maintained in the mitochondrial and cytoplasmic fractions, emphasizing the importance of measuring both protein and DNA synthesis to gain insight into proteostasis. Overall, these data suggest that Protandim may enhance proteostatic mechanisms of skeletal muscle contractile proteins after 6 weeks of milk protein feeding in older adults.
NASA Astrophysics Data System (ADS)
Hou, Shuhn-Shyurng; Huang, Wei-Cheng
2015-02-01
This paper investigates the influence of flame parameters including oxygen concentration, fuel composition, and strain rate on the synthesis of carbon nanomaterials in opposed-jet ethylene diffusion flames with or without rigid-body rotation. In the experiments, a mixture of ethylene and nitrogen was introduced from the upper burner; meanwhile, a mixture of oxygen and nitrogen was supplied from the lower burner. A nascent nickel mesh was used as the catalytic metal substrate to collect deposited materials. With non-rotating opposed-jet diffusion flames, carbon nanotubes (CNTs) were successfully produced for oxygen concentrations in the range of 21-50 % at a fixed ethylene concentration of 20 %, and for ethylene concentrations ranging from 14 to 24 % at a constant oxygen concentration of 40 %. With rotating opposed-jet diffusion flames, the strain rate was varied by adjusting the angular velocities of the upper and lower burners. The strain rate governed by flow rotation greatly affects the synthesis of carbon nanomaterials [i.e., CNTs and carbon nano-onions (CNOs)] either through the residence time or carbon sources available. An increase in the angular velocity lengthened the residence time of the flow and thus caused the diffusion flame to experience a decreased strain rate, which in turn produced more carbon sources. The growth of multi-walled CNTs was achieved for the stretched flames experiencing a higher strain rate [i.e., angular velocity was equal to 0 or 1 rotations per second (rps)]. CNOs were synthesized at a lower strain rate (i.e., angular velocity was in the range of 2-5 rps). It is noteworthy that the strain rate controlled by flow rotation greatly influences the fabrication of carbon nanostructures owing to the residence time as well as carbon source. Additionally, more carbon sources and higher temperature are required for the synthesis of CNOs compared with those required for CNTs (i.e., about 605-625 °C for CNTs and 700-800 °C for CNOs).
Ribonucleic Acid Synthesis by Cucumber Chromatin
Johnson, Kenneth D.; Purves, William K.
1970-01-01
When intact etiolated 2-day cucumber (Cucumis sativus) embryos were treated with indoleacetic acid (IAA), gibberellin A7 (GA7), or kinetin, chromatin derived from the embryonic axes exhibited an increased capacity to support RNA synthesis in either the presence or the absence of bacterial RNA polymerase. An IAA effect on cucumber RNA polymerase activity was evident after 4 hours of hormone treatment; the IAA effect on DNA template activity (bacterial RNA polymerase added) occurred after longer treatments (12 hours). GA7 also promoted template activity, but again only after a prior stimulation of endogenous chromatin activity. After 12 hours of kinetin treatment, both endogenous chromatin and DNA template activities were substantially above control values, but longer kinetin treatments caused these activities to decline in magnitude. When chromatin was prepared from hypocotyl segments that were floated on a GA7 solution, a GA-induced increase in endogenous chromatin activity occurred, but only if cotyledon tissue was left attached to the segments during the period of hormone treatment. Age of the seedling tissue had a profound influence on the chromatin characteristics. With progression of development from the 2-day to the 4-day stage, the endogenous chromatin activity declined while the DNA template activity increased. PMID:16657509
Eusufzai, S; Axelson, M; Angelin, B; Einarsson, K
1993-01-01
The synthesis of bile acids is regulated by a homeostatic mechanism in which bile acids returning to the liver from the intestine inhibit their own synthesis. Serum concentrations of the bile acid intermediate 7 alpha-hydroxy-4-cholesten-3-one reflect the rate of bile acid synthesis whereas bile acid malabsorption can be determined by the SeHCAT test. This study was done to evaluate the correlation between the two tests in humans. Twenty eight patients with chronic diarrhoea were included in the study. Fasting serum was collected for the determination of 7 alpha-hydroxy-4-cholesten-3-one, and on the same day the gamma emitting bile acid analogue SeHCAT was given orally and its fractional catabolic rate assessed by repeated external counting over the upper abdomen during the next seven days. There was a highly significant positive correlation between the two tests (Rs = 0.80, p < 0.001). The results show a close relation between intestinal loss and hepatic synthesis of bile acids and imply that analysis of 7 alpha-hydroxy-4-cholesten-3-one in serum should now be evaluated as a possible convenient method for assessing bile acid malabsorption in patients with diarrhoea. PMID:8504974
THE EFFECT OF RATE OF GLAND FUNCTION ON PAROTID FLUID URIC ACID LEVELS.
Paired parotid fluid samples were collected without exogenous stimulation and at 5 different gustation-induced rates of flow. Enzymatic uric acid...diminished as flow rate increased. It is suggested that parotid fluid samples for uric acid analysis should be collected at flow rates of 0.7 ml./min. or more. (Author)
Zhao, Xiaoyan; Ren, Lujing; Guo, Dongsheng; Wu, Wenjia; Ji, Xiaojun; Huang, He
2016-08-01
Effects of impeller configurations on docosahexaenoic acid production and flow characteristics were investigated by Schizochytrium sp. in a 15 L bioreactor. 6-straight blade disc turbine (6-SBDT), 6-arrowy-blade disc turbine (6-ABDT) and down-pumping propeller (DPP) were combined to form different impeller configurations. Simulated results showed that configuration SSA consisting of upper two 6-SBDT and one bottom 6-ABDT possessed the worst oxygen supply capacity. But it obtained the highest DHA percentage of 48.17 % and DHA yield of 21.42 g/L, indicating that it was beneficial for DHA synthesis and converting glucose to biomass and lipids. Configuration SAS consisting of one middle 6-ABDT and two 6-SBDT provided better mixing capacity, which resulted in the maximum glucose consumption rate of 2.86 g/L h and the highest biomass of 108.09 g/L. This study would improve insight into understanding the relationship between flow field and the physiology of Schizochytrium sp. for the scale-up of industrial DHA production.
Konas, D W; Coward, J K
2001-12-28
Electrophilic fluorination of enantiomerically pure 2-pyrrolidinones (4) derived from (L)-glutamic acid has been investigated as a method for the synthesis of single stereoisomers of 4-fluorinated glutamic acids. Reaction of the lactam enolate derived from 9 with NFSi results in a completely diastereoselective monofluorination reaction to yield the monocyclic trans-substituted alpha-fluoro lactam product 21. Unfortunately, a decreased kinetic acidity in 21 and other structurally related monofluorinated products renders them resistant to a second fluorination. In contrast, the bicyclic lactam 12 is readily difluorinated under the standard conditions described to yield the alpha,alpha-difluoro lactam 24. The difference in reactivity between the two types of related lactams is attributed mainly to the presence or lack of a steric interaction between the base used for deprotonation and the protecting group present in the pyrrolidinone substrates. This conclusion was reached based on analysis of the X-ray crystal structure of 21, molecular modeling, and experimental evidence. The key intermediates 21 and 24 are converted to (2S,4R)-4-fluoroglutamic acid and (2S)-4,4-difluoroglutamic acid, respectively.
Conjugated Fatty Acid Synthesis
Rawat, Richa; Yu, Xiao-Hong; Sweet, Marie; Shanklin, John
2012-01-01
Conjugated linolenic acids (CLNs), 18:3 Δ9,11,13, lack the methylene groups found between the double bonds of linolenic acid (18:3 Δ9,12,15). CLNs are produced by conjugase enzymes that are homologs of the oleate desaturases FAD2. The goal of this study was to map the domain(s) within the Momordica charantia conjugase (FADX) responsible for CLN formation. To achieve this, a series of Momordica FADX-Arabidopsis FAD2 chimeras were expressed in the Arabidopsis fad3fae1 mutant, and the transformed seeds were analyzed for the accumulation of CLN. These experiments identified helix 2 and the first histidine box as a determinant of conjugase product partitioning into punicic acid (18:3 Δ9cis,11trans,13cis) or α-eleostearic acid (18:3 Δ9cis,11trans,13trans). This was confirmed by analysis of a FADX mutant containing six substitutions in which the sequence of helix 2 and first histidine box was converted to that of FAD2. Each of the six FAD2 substitutions was individually converted back to the FADX equivalent identifying residues 111 and 115, adjacent to the first histidine box, as key determinants of conjugase product partitioning. Additionally, expression of FADX G111V and FADX G111V/D115E resulted in an approximate doubling of eleostearic acid accumulation to 20.4% and 21.2%, respectively, compared with 9.9% upon expression of the native Momordica FADX. Like the Momordica conjugase, FADX G111V and FADX D115E produced predominantly α-eleostearic acid and little punicic acid, but the FADX G111V/D115E double mutant produced approximately equal amounts of α-eleostearic acid and its isomer, punicic acid, implicating an interactive effect of residues 111 and 115 in punicic acid formation. PMID:22451660
ESTIMATION OF CARBOXYLIC ACID ESTER HYDROLYSIS RATE CONSTANTS
SPARC chemical reactivity models were extended to calculate hydrolysis rate constants for carboxylic acid esters from molecular structure. The energy differences between the initial state and the transition state for a molecule of interest are factored into internal and external...
NASA Astrophysics Data System (ADS)
Swami, Anuradha; Mittal, Sherry; Chopra, Adity; Sharma, Rohit K.; Wangoo, Nishima
2018-03-01
In recent years, the synthesis of gold nanostructures of controllable shapes and dimensions has become a subject of intensive and interesting studies. Especially, anisotropic gold nanostructures such as nanoplates, nanoribbons, nanoprisms and nanorods have attracted much attention due to their striking optical properties and promising applications in electronics, photonics, sensing and biomedicine. Keeping this in mind, in the present report, an unprecedented, facile and one pot synthesis of isotropic (spherical) and anisotropic (triangular, pentagonal, hexagonal, rod shaped) gold nanomaterials via pH controlled shape modulation using hydroxyl moeity containing α-amino acids (Serine, Threonine, Tyrosine) as both reducing and capping agents is reported. The synthesized nanostructures have been further characterized by UV-Vis spectroscopy and transmission electron microscopy. It was deduced from these studies that pH played a key role in the anisotropic growth of gold nanostructures. These gold nanoparticles can be further used for applications in biosensing, plasmonics, and electrocatalysis and others involving surface enhanced raman scattering. This study is therefore, important from the point of view of using amino acids for the synthesis of gold nanoparticles of different shapes and sizes leading towards the development of inventive biosensors and biocompatible nanoconstructs.
Urschel, Kristine L; Evans, Amanda R; Wilkinson, Craig W; Pencharz, Paul B; Ball, Ronald O
2007-03-01
Parenterally fed neonatal piglets cannot synthesize sufficient arginine to maintain arginine status, presumably due to the intestinal atrophy that occurs with parenteral feeding. Parenteral feeding-induced atrophy can be reduced by the infusion of glucagon-like peptide 2 (GLP-2). GLP-2 infusion was hypothesized to increase the rate of endogenous arginine synthesis from proline, the major arginine precursor, in parenterally fed piglets receiving an arginine-deficient diet. Male piglets, fitted with jugular vein catheters for diet and isotope infusion, and femoral vein catheters for blood sampling (d 0), were allocated to a continuous infusion of either GLP-2 (n = 5; 10 nmol x kg(-1) x d(-1)) or saline (n = 5) for 7 d. Piglets received 2 d of a complete diet, followed by 5 d of an arginine-deficient [0.60 g x kg(-1) x d(-1)] diet. Piglets received primed, constant infusions of [guanido-(14)C]arginine to measure arginine flux (d 6) and [U-(14)C]proline (d 7) to measure proline conversion to arginine. Plasma arginine concentrations and arginine fluxes indicated a similar whole-body arginine status. Piglets receiving GLP-2 showed improvements in intestinal variables, including mucosal mass (P < 0.01) and villus height (P < 0.001), and a greater rate of arginine synthesis (micromol x kg(-1) x h(-1)) from proline (11.6 vs. 6.3) (P = 0.03). Mucosal mass (R(2) = 0.71; P = 0.002) and villus height were correlated (R(2) = 0.66; P = 0.004) with arginine synthesis. This study was the first to quantitate arginine synthesis in parenterally fed neonates and showed that although GLP-2 infusion increased arginine synthesis in a manner directly related to mucosal mass, this increased arginine synthesis was insufficient to improve whole-body arginine status in piglets receiving a low arginine diet.
Development of anti-scale poly(aspartic acid-citric acid) dual polymer systems for water treatment.
Nayunigari, Mithil Kumar; Gupta, Sanjay Kumar; Kokkarachedu, Varaprasad; Kanny, K; Bux, F
2014-01-01
The formation of calcium sulphate and calcium carbonate scale poses major problems in heat exchangers and water cooling systems, thereby affecting the performance of these types of equipment. In order to inhibit these scale formations, new types of biodegradable water soluble single polymer and dual poly(aspartic acid-citric acid) polymers were developed and tested. The effectiveness of single polymer and four different compositions of poly aspartic acid and citric acid dual polymer systems as scale inhibitors were evaluated. Details of the synthesis, thermal stability, scale inhibition and the morphological characterization of single and dual polymers are presented in this scientific paper. It was found that the calcium sulphate scale inhibition rate was in the range 76.06-91.45%, while the calcium carbonate scale inhibition rate observed was in the range 23.37-30.0% at 65-70 °C. The finding suggests that the water soluble dual polymers are very effective in sulphate scale inhibition in comparison of calcium carbonate scale inhibition.
Catalytic chemical amide synthesis at room temperature: one more step toward peptide synthesis.
Mohy El Dine, Tharwat; Erb, William; Berhault, Yohann; Rouden, Jacques; Blanchet, Jérôme
2015-05-01
An efficient method has been developed for direct amide bond synthesis between carboxylic acids and amines via (2-(thiophen-2-ylmethyl)phenyl)boronic acid as a highly active bench-stable catalyst. This catalyst was found to be very effective at room temperature for a large range of substrates with slightly higher temperatures required for challenging ones. This methodology can be applied to aliphatic, α-hydroxyl, aromatic, and heteroaromatic acids as well as primary, secondary, heterocyclic, and even functionalized amines. Notably, N-Boc-protected amino acids were successfully coupled in good yields with very little racemization. An example of catalytic dipeptide synthesis is reported.
Palmitic Acid in Early Human Development.
Innis, Sheila M
2016-09-09
Palmitic acid (16:0) is a saturated fatty acid present in the diet and synthesized endogenously. Although often considered to have adverse effects on chronic disease in adults, 16:0 is an essential component of membrane, secretory, and transport lipids, with crucial roles in protein palmitoylation and signal molecules. At birth, the term infant is 13-15% body fat, with 45-50% 16:0, much of which is derived from endogenous synthesis in the fetus. After birth, the infant accumulates adipose tissue at high rates, reaching 25% body weight as fat by 4-5 months age. Over this time, human milk provides 10% dietary energy as 16:0, but in unusual triglycerides with 16:0 on the glycerol center carbon. This paper reviews the synthesis and oxidation of 16:0 and possible reasons why the infant is endowed with large amounts of fat and 16:0. The marked deviations in tissues with displacement of 16:0 that can occur in infants fed vegetable oil formulas is introduced. Assuming fetal fatty acid synthesis and the unusual delivery of 16:0 in human milk evolved to afford survival advantage to the neonate, it is timely to question if 16:0 is an essential component of tissue lipids whereby both deficiency and excess are detrimental.
Wang, Jingxuan; Zhao, Peng; Li, Ying; Xu, Lida; Tian, Pingfang
2018-04-05
Klebsiella pneumoniae is a promising industrial species for bioproduction of bulk chemicals such as 1,3-propanediol, 2,3-butanediol and 3-hydroxypropionic acid (3-HP). However, lactic acid is a troublesome by-product when optimizing for 3-HP production. Therefore, it is highly desirable to minimize lactic acid. Here, we show that lactic acid synthesis can be largely blocked by an engineered CRISPR interference (CRISPRi) system in K. pneumoniae. EGFP was recruited as a reporter of this CRISPRi system. Fluorescence assay of this CRISPRi system showed that enhanced green fluorescent protein (EGFP) expression level was repressed by 85-90%. To further test this CRISPRi system, guide RNAs were designed to individually or simultaneously target four lactate-producing enzyme genes. Results showed that all lactate-producing enzyme genes were significantly repressed. Notably, D-lactate dehydrogenase (ldhA) was shown to be the most influential enzyme for lactic acid formation in micro-aerobic conditions, as inhibiting ldhA alone led to lactic acid level similar to simultaneously repressing four genes. In shake flask cultivation, the strain coexpressing puuC (an aldehyde dehydrogenase catalyzing 3-hydroxypropionaldehyde to 3-HP) and dCas9-sgRNA inhibiting ldhA produced 1.37-fold 3-HP relative to the reference strain. Furthermore, in bioreactor cultivation, this CRISPRi strain inhibiting ldhA produced 36.7 g/L 3-HP, but only generated 1 g/L lactic acid. Clearly, this engineered CRISPRi system largely simplified downstream separation of 3-HP from its isomer lactic acid, an extreme challenge for 3-HP bioprocess. This study offers a deep understanding of lactic acid metabolism in diverse species, and we believe that this CRISPRi system will facilitate biomanufacturing and functional genome studies of K. pneumoniae or beyond.
Gaspar, Maria L; Aregullin, Manuel A; Jesch, Stephen A; Henry, Susan A
2006-08-11
The addition of inositol to actively growing yeast cultures causes a rapid increase in the rate of synthesis of phosphatidylinositol and, simultaneously, triggers changes in the expression of hundreds of genes. We now demonstrate that the addition of inositol to yeast cells growing in the presence of choline leads to a dramatic reprogramming of cellular lipid synthesis and turnover. The response to inositol includes a 5-6-fold increase in cellular phosphatidylinositol content within a period of 30 min. The increase in phosphatidylinositol content appears to be dependent upon fatty acid synthesis. Phosphatidylcholine turnover increased rapidly following inositol addition, a response that requires the participation of Nte1p, an endoplasmic reticulum-localized phospholipase B. Mass spectrometry revealed that the acyl species composition of phosphatidylinositol is relatively constant regardless of supplementation with inositol or choline, whereas phosphatidylcholine acyl species composition is influenced by both inositol and choline. In medium containing inositol, but lacking choline, high levels of dimyristoylphosphatidylcholine were detected. Within 60 min following the addition of inositol, dimyristoylphosphatidylcholine levels had decreased from approximately 40% of total phosphatidylcholine to a basal level of less than 5%. nte1Delta cells grown in the absence of inositol and in the presence of choline exhibited lower levels of dimyristoylphosphatidylcholine than wild type cells grown under these same conditions, but these levels remained largely constant after the addition of inositol. These results are discussed in relationship to transcriptional regulation known to be linked to lipid metabolism in yeast.
NASA Astrophysics Data System (ADS)
Karunakaran, Gopalu; Maduraiveeran, Govindhan; Kolesnikov, Evgeny; Balasingam, Suresh Kannan; Viktorovich, Lysov Dmitry; Ilinyh, Igor; Gorshenkov, Mikhail V.; Sasidharan, Manickam; Kuznetsov, Denis; Kundu, Manab
2018-05-01
We have synthesized NiCo2O4 nanoparticles (NCO NPs) using an ascorbic acid-assisted co-precipitation method for the first time. When NCO NPs are used as an anode material for lithium-ion batteries, the cell exhibits superior lithium storage properties, such as high capacity (700 mA h g-1 after 300 cycles at 200 mA g-1), excellent rate capabilities (applied current density range 100-1200 mA g-1), and impressive cycling stability (at 1200 mA g-1 up to 650 cycles). The enhanced electrochemical properties of NCO NPs are due to the nanometer dimensions which not only offers a smooth charge-transport pathway and short diffusion paths of the lithium ions but also adequate spaces for volume expansion during Li storage. Hence, this eco-friendly synthesis approach will provide a new strategy for the synthesis of various nanostructured metal oxide compounds, for energy conversion and storage systems applications.
Sugahara, Haruna; Meinert, Cornelia; Nahon, Laurent; Jones, Nykola C; Hoffmann, Søren V; Hamase, Kenji; Takano, Yoshinori; Meierhenrich, Uwe J
2018-07-01
Living organisms on the Earth almost exclusively use l-amino acids for the molecular architecture of proteins. The biological occurrence of d-amino acids is rare, although their functions in various organisms are being gradually understood. A possible explanation for the origin of biomolecular homochirality is the delivery of enantioenriched molecules via extraterrestrial bodies, such as asteroids and comets on early Earth. For the asymmetric formation of amino acids and their precursor molecules in interstellar environments, the interaction with circularly polarized photons is considered to have played a potential role in causing chiral asymmetry. In this review, we summarize recent progress in the investigation of chirality transfer from chiral photons to amino acids involving the two major processes of asymmetric photolysis and asymmetric synthesis. We will discuss analytical data on cometary and meteoritic amino acids and their potential impact delivery to the early Earth. The ongoing and future ambitious space missions, Hayabusa2, OSIRIS-REx, ExoMars 2020, and MMX, are scheduled to provide new insights into the chirality of extraterrestrial organic molecules and their potential relation to the terrestrial homochirality. This article is part of a Special Issue entitled: d-Amino acids: biology in the mirror, edited by Dr. Loredano Pollegioni, Dr. Jean-Pierre Mothet and Dr. Molla Gianluca. Copyright © 2018 Elsevier B.V. All rights reserved.
Robinson, Jacob William; Yanke, Dan; Mirza, Jeff; Ballantyne, James Stuart
2011-02-01
To gain insight into the metabolic design of the amino acid carrier systems in fish, we injected a bolus of (15)N amino acids into the dorsal aorta in mature rainbow trout (Oncorhynchus mykiss). The plasma kinetic parameters including concentration, pool size, rate of disappearance (R(d)), half-life and turnover rate were determined for 15 amino acids. When corrected for metabolic rate, the R(d) values obtained for trout for most amino acids were largely comparable to human values, with the exception of glutamine (which was lower) and threonine (which was higher). R(d) values ranged from 0.9 μmol 100 g(-1) h(-1) (lysine) to 22.1 μmol 100 g(-1) h(-1) (threonine) with most values falling between 2 and 6 μmol 100 g(-1) h(-1). There was a significant correlation between R(d) and the molar proportion of amino acids in rainbow trout whole body protein hydrolysate. Other kinetic parameters did not correlate significantly with whole body amino acid composition. This indicates that an important design feature of the plasma-free amino acids system involves proportional delivery of amino acids to tissues for protein synthesis.
NASA Astrophysics Data System (ADS)
Wei, Jing; Liang, Yan; Zhang, Xinyi; Simon, George P.; Zhao, Dongyuan; Zhang, Jin; Jiang, Sanping; Wang, Huanting
2015-03-01
The synthesis of mesoporous carbon nanospheres (MCNs), especially with diameters below 200 nm remains a great challenge due to weak interactions between the carbon precursors and soft templates, as well as the uncontrollable cross-linking rate of carbon precursors. Herein, we demonstrate a simple acid-assisted, hydrothermal synthesis approach to synthesizing such uniform MCNs with well controlled diameters ranging from 20 to 150 nm under highly acidic conditions (2 M HCl). Both the carbon precursor and the template are partly protonated under such conditions and show additional Coulombic interactions with chloride ions (acts as mediators). This kind of enhanced interaction is similar to that of the ``I+X-S+'' mechanism in the synthesis of mesoporous metal oxide, which can effectively retard the cross-linking rate of resol molecules and avoid macroscopic phase separation during the hydrothermal synthesis. Due to their uniform spherical morphology, small diameter, and high surface areas, MCNs can be modified with Fe and N species via impregnation of cheap precursors (ferric nitrate and dicyandiamide), which are further converted into nonprecious electrocatalysts for oxygen reduction reactions. The resulting Fe-N/MCNs exhibit high catalytic activities, long-term stability and improved methanol tolerance under alkaline conditions, which can be potentially used in direct methanol fuel cells and metal-air batteries.The synthesis of mesoporous carbon nanospheres (MCNs), especially with diameters below 200 nm remains a great challenge due to weak interactions between the carbon precursors and soft templates, as well as the uncontrollable cross-linking rate of carbon precursors. Herein, we demonstrate a simple acid-assisted, hydrothermal synthesis approach to synthesizing such uniform MCNs with well controlled diameters ranging from 20 to 150 nm under highly acidic conditions (2 M HCl). Both the carbon precursor and the template are partly protonated under such conditions
The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.
T Banaszak1 A; LaJeunesse; Trench
2000-06-28
We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected.
Ragoussis, Valentine; Giannikopoulos, Alexandros; Skoka, Efthymia; Grivas, Panagiotis
2007-06-27
(+/-)-4-Methyloctanoic acid and its ethyl ester are aggregation pheromones of many rhinoceros beetles of the genus Oryctes and are investigated for the control of these pests by olfactory trapping. A simple, economical, and high-yield (>50%) synthesis of (+/-)-4-methyloctanoic acid and its ethyl ester is presented starting from n-hexanal. The key step in this sequence is an orthoester Claisen rearrangement for the elongation of the carbon chain by two.
Zeolite catalysis in the synthesis of isobutylene from hydrous ethanol
NASA Astrophysics Data System (ADS)
Phillips, Cory Bernard
1999-11-01
This work deals with the synthesis of isobutylene from a hydrous ethanol feedstock over zeolites. The synthesis is accomplished in three steps: (1) low-temperature direct ethanol conversion to ethylene on H-ZSM-5 zeolite, (2) ethylene conversion to butene products over metal-exchanged zeolites, and (3) butene skeletal rearrangement to isobutylene over FER zeolites. The key to understanding and optimizing each synthesis step lies in the ability to control and regulate the zeolite acidity (Bronsted and Lewis)---both strength and number. Therefore, the continuous temperature programmed amine desorption (CTPAD) technique was further developed to simultaneously count the Bronsted acid sites and quantitatively characterize their strength. The adsorption of ethanol, reaction products, amines, coke and ethanol-derived residue (EDR) were monitored gravimetrically using the highly sensitive, novel Tapered Element Oscillating Microreactor (TEOM) apparatus. The TEOM was also used also in conjunction with CTPAD to characterize Bronsted acidity which is a new application for the instrument. For the first synthesis step, a parallel reaction exists which simultaneously produces diethyl ether and ethylene directly over H-ZSM-5. The reaction rates for each pathway were measured directly using a differential reactor operating at low temperatures (<473 K). Water in the ethanol feed enhances the rate of ethylene formation. A mechanism and kinetic expression are proposed for this reaction over H-ZSM-5, with diethyl-ether desorption and ethylene formation as the rate limiting steps. Heat of adsorption values measured from the independent microcalorimetry work reported in the literature are incorporated into the kinetic analysis which reduces the number of regressed parameters. For the remaining synthesis steps, several zeolite structures (ZSM-5, Y, FER) partially exchanged with Pd, Ti, Ni and Au were prepared and tested. It was determined from this screening study that the zeolites
Budesonide treatment is associated with increased bile acid absorption in collagenous colitis.
Bajor, A; Kilander, A; Gälman, C; Rudling, M; Ung, K-A
2006-12-01
Bile acid malabsorption is frequent in collagenous colitis and harmful bile acids may play a pathophysiological role. Glucocorticoids increase ileal bile acid transport. Budesonide have its main effect in the terminal ileum. To evaluate whether the symptomatic effect of budesonide is linked to increased uptake of bile acids. Patients with collagenous colitis were treated with budesonide 9 mg daily for 12 weeks. Prior to and after 8 weeks of treatment, the (75)SeHCAT test, an indirect test for the active uptake of bile acid-s, measurements of serum 7alpha-hydroxy-4-cholesten-3-one, an indicator of hepatic bile acid synthesis, and registration of symptoms were performed. The median (75)SeHCAT retention increased from 18% to 35% (P < 0.001, n = 25) approaching the values of healthy controls (38%). The 7alpha-hydroxy-4-cholesten-3-one values decreased significantly among those with initially high synthesis (from 36 to 23 ng/mL, P = 0.04, n = 9); however, for the whole group the values were not altered (19 ng/mL vs. 13 ng/mL, P = 0.23, N.S., n = 19). The normalization of the (75)SeHCAT test and the reduction of bile acid synthesis in patients with initially high synthetic rate, suggests that the effect of budesonide in collagenous colitis may be in part due to decreased bile acid load on the colon.
Lovelock, Sarah L; Lloyd, Richard C; Turner, Nicholas J
2014-04-25
Phenylalanine ammonia lyases (PALs) belong to a family of 4-methylideneimidazole-5-one (MIO) cofactor dependent enzymes which are responsible for the conversion of L-phenylalanine into trans-cinnamic acid in eukaryotic and prokaryotic organisms. Under conditions of high ammonia concentration, this deamination reaction is reversible and hence there is considerable interest in the development of PALs as biocatalysts for the enantioselective synthesis of non-natural amino acids. Herein the discovery of a previously unobserved competing MIO-independent reaction pathway, which proceeds in a non-stereoselective manner and results in the generation of both L- and D-phenylalanine derivatives, is described. The mechanism of the MIO-independent pathway is explored through isotopic-labeling studies and mutagenesis of key active-site residues. The results obtained are consistent with amino acid deamination occurring by a stepwise E1 cB elimination mechanism. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Brodsky, V Y; Malchenko, L A; Lazarev, D S; Butorina, N N; Dubovaya, T K; Zvezdina, N D
2018-03-01
The kinetics of protein synthesis was investigated in primary cultures of hepatocytes from old rats in serum-free medium. The rats were fed mixed fodder supplemented with glutamic acid and then transferred to a regular mixed fodder. The amplitude of protein synthesis rhythm in hepatocytes isolated from these rats increased on average 2-fold in comparison with the rats not receiving glutamic acid supplement. Based on this indicator reflecting the degree of cell-cell interactions, the cells from old rats were not different from those of young rats. The effect was preserved for 3-4 days. These results are discussed in connection with our previous data on preservation of the effect of single administration of gangliosides, noradrenaline, serotonin, and other synchronizers on various cell populations. In contrast to the other investigated factors, glutamic acid is capable of penetrating the blood-brain barrier, which makes its effect possible not only in the case of hepatocytes and other non-brain cells, but also in neurons.
Regulation of embryonic neurotransmitter and tyrosine hydroxylase protein levels by ascorbic acid
Meredith, M. Elizabeth; May, James M.
2013-01-01
Scope: Ascorbic acid (ascorbate) is required to recycle tetrahydrobiopterin, which is necessary for neurotransmitter synthesis by the rate-limiting enzymes tyrosine and tryptophan hydroxylases. We sought to determine whether ascorbate might regulate embryonic brain cortex monoamine synthesis utilizing transgenic mouse models with varying intracellular ascorbate levels. Methods and Results: In embryos lacking the sodium-dependent vitamin C transporter 2 (SVCT2), very low levels of brain ascorbate decreased cortex levels of norepinephrine and dopamine by approximately 33%, but had no effect on cortex serotonin or its metabolite, 5-hydroxyindole acetic acid. This decrease in ascorbate also led to a decrease in protein levels of tyrosine hydroxylase, but not of tryptophan hydroxylase. Increased cortex ascorbate in embryos carrying extra copies of the SVCT2 resulted in increased levels of dopamine and its metabolite, 3,4-dihydroxyphenylacetic acid (DOPAC), as well as serotonin and 5-hydroxyindole acetic acid. Conclusion: The dependence of embryonic brain cortex neurotransmitter synthesis and tyrosine hydroxylase expression on intracellular ascorbate emphasizes the importance of receiving adequate ascorbate during development. PMID:24095796
Abad, José-Luis; Serra, Montserrat; Camps, Francisco; Fabriàs, Gemma
2007-02-02
The synthesis of two hexadeuterated palmitic acids differing in the position of the diagnostic labels, and their use to decipher the cryptoregiochemistry of a Delta13 desaturation are described. A dithiane and a triple bond functionalities were used to introduce the diagnostic (C13 or C14) and tagging (C8 and C9) labels, respectively, in the palmitic acid skeleton. Using these probes, the cryptoregiochemistry of the Delta13 desaturation involved in the biosynthesis of Thaumetopoea pityocampa sex pheromone was studied by means of kinetic isotope effect determinations. Transformation of both (Z)-11-hexadecenoic and 11-hexadecynoic acids into (Z, Z)-11,13-hexadecadienoic and (Z)-13-hexadecen-11-ynoic acids, respectively, is initiated by abstraction of the hydrogen atom at the C13 position, followed by the fast elimination of the C14 hydrogen to give the double bond.
Photoautotrophic production of D-lactic acid in an engineered cyanobacterium
2013-01-01
Background The world faces the challenge to develop sustainable technologies to replace thousands of products that have been generated from fossil fuels. Microbial cell factories serve as promising alternatives for the production of diverse commodity chemicals and biofuels from renewable resources. For example, polylactic acid (PLA) with its biodegradable properties is a sustainable, environmentally friendly alternative to polyethylene. At present, PLA microbial production is mainly dependent on food crops such as corn and sugarcane. Moreover, optically pure isomers of lactic acid are required for the production of PLA, where D-lactic acid controls the thermochemical and physical properties of PLA. Henceforth, production of D-lactic acid through a more sustainable source (CO2) is desirable. Results We have performed metabolic engineering on Synechocystis sp. PCC 6803 for the phototrophic synthesis of optically pure D-lactic acid from CO2. Synthesis of optically pure D-lactic acid was achieved by utilizing a recently discovered enzyme (i.e., a mutated glycerol dehydrogenase, GlyDH*). Significant improvements in D-lactic acid synthesis were achieved through codon optimization and by balancing the cofactor (NADH) availability through the heterologous expression of a soluble transhydrogenase. We have also discovered that addition of acetate to the cultures improved lactic acid production. More interestingly, 13C-pathway analysis revealed that acetate was not used for the synthesis of lactic acid, but was mainly used for synthesis of certain biomass building blocks (such as leucine and glutamate). Finally, the optimal strain was able to accumulate 1.14 g/L (photoautotrophic condition) and 2.17 g/L (phototrophic condition with acetate) of D-lactate in 24 days. Conclusions We have demonstrated the photoautotrophic production of D-lactic acid by engineering a cyanobacterium Synechocystis 6803. The engineered strain shows an excellent D-lactic acid productivity from CO2. In
Photoautotrophic production of D-lactic acid in an engineered cyanobacterium.
Varman, Arul M; Yu, Yi; You, Le; Tang, Yinjie J
2013-11-25
The world faces the challenge to develop sustainable technologies to replace thousands of products that have been generated from fossil fuels. Microbial cell factories serve as promising alternatives for the production of diverse commodity chemicals and biofuels from renewable resources. For example, polylactic acid (PLA) with its biodegradable properties is a sustainable, environmentally friendly alternative to polyethylene. At present, PLA microbial production is mainly dependent on food crops such as corn and sugarcane. Moreover, optically pure isomers of lactic acid are required for the production of PLA, where D-lactic acid controls the thermochemical and physical properties of PLA. Henceforth, production of D-lactic acid through a more sustainable source (CO2) is desirable. We have performed metabolic engineering on Synechocystis sp. PCC 6803 for the phototrophic synthesis of optically pure D-lactic acid from CO2. Synthesis of optically pure D-lactic acid was achieved by utilizing a recently discovered enzyme (i.e., a mutated glycerol dehydrogenase, GlyDH*). Significant improvements in D-lactic acid synthesis were achieved through codon optimization and by balancing the cofactor (NADH) availability through the heterologous expression of a soluble transhydrogenase. We have also discovered that addition of acetate to the cultures improved lactic acid production. More interestingly, (13)C-pathway analysis revealed that acetate was not used for the synthesis of lactic acid, but was mainly used for synthesis of certain biomass building blocks (such as leucine and glutamate). Finally, the optimal strain was able to accumulate 1.14 g/L (photoautotrophic condition) and 2.17 g/L (phototrophic condition with acetate) of D-lactate in 24 days. We have demonstrated the photoautotrophic production of D-lactic acid by engineering a cyanobacterium Synechocystis 6803. The engineered strain shows an excellent D-lactic acid productivity from CO2. In the late growth phase, the
NASA Technical Reports Server (NTRS)
Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)
1999-01-01
Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.
Cheng, Juanli; Ma, Jincheng; Lin, Jinshui; Fan, Zhen-Chuan; Cronan, John E.
2012-01-01
Ralstonia solanacearum, a major phytopathogenic bacterium, causes a bacterial wilt disease in diverse plants. Although fatty acid analyses of total membranes of R. solanacearum showed that they contain primarily palmitic (C16:0), palmitoleic (C16:1) and cis-vaccenic (C18:1) acids, little is known regarding R. solanacearum fatty acid synthesis. The R. solanacearum GMI1000 genome is unusual in that it contains four genes (fabF1, fabF2, fabF3, and fabF4) annotated as encoding 3-ketoacyl-acyl carrier protein synthase II homologues and one gene (fabB) annotated as encoding 3-ketoacyl-acyl carrier protein synthase I. We have analyzed this puzzling apparent redundancy and found that only one of these genes, fabF1, encoded a long-chain 3-ketoacyl-acyl carrier protein synthase, whereas the other homologues did not play roles in R. solanacearum fatty acid synthesis. Mutant strains lacking fabF1 are nonviable, and thus, FabF1 is essential for R. solanacearum fatty acid biosynthesis. Moreover, R. solanacearum FabF1 has the activities of both 3-ketoacyl-acyl carrier protein synthase II and 3-ketoacyl-acyl carrier protein synthase I. PMID:22194290
Semenenko, S; Tymofiychuk, I; Boreyko, L; Karatieieva, S; Slobodian, K
2017-10-01
The objective of research is to study the peculiarities of melatonin effect on chronorhythmic organization of the kidney acid-regulating function influenced by nitrogen monoxide (NO) synthesis blockade under conditions of pineal gland (PG) hypofunction. The experiments were conducted on 72 mature non-linear albino male rats with their body mass 0,15-0,18 kg. The animals were kept under vivarium conditions at a stable temperature and air humidity fed on a standard dietary intake. The control group included animals (n=36) kept under conditions of usual light regimen (12.00С:12.00Т) during 7 days. The experimental group included animals (n=36) injected with N-nitro-L-arginine (L-NNA) in the dose of 20 mg/kg during 7 days under conditions of continuous light (12.00С:12.00С) and melatonin in the dose of 0,5 mg/kg during 7 days simultaneously. On the 8th day the animals were exposed to 5% water load with heated to room temperature water supplied and the parameters of the kidney acid-regulating function under conditions of forced diuresis were investigated. Kidney functions in the control animals are subordinated to accurate circadian organization. Daily rhythms of the parameters of kidney acid-regulating functions reflect similar changes of the renal processes. Chronorhythmic transformations of the kidney acid-regulating functions in animals with blocked NO synthesis against continuous light and parallel injection of melatonin enable to suggest that NO synthesis blockade under conditions of melatonin correction reduces daily mean pH level as compared to the control. Although, it was higher than that in the animals with blocked NO synthesis against the ground of physiological function of the pineal gland, and animals with PG hypofunction under conditions of NO synthesis blockadeю Therefore, under conditions of L-NNA blockade of NO synthesis and injection of melatonin influenced by PG hypofunction chronorhythmic transformations of architectonics and phase structure of
Yin, Qian; Yin, Lichen; Wang, Hua; Cheng, Jianjun
2015-07-21
Poly(α-hydroxy acids) (PAHAs) are a class of biodegradable and biocompatible polymers that are widely used in numerous applications. One drawback of these conventional polymers, however, is their lack of side-chain functionalities, which makes it difficult to conjugate active moieties to PAHA or to fine-tune the physical and chemical properties of PAHA-derived materials through side-chain modifications. Thus, extensive efforts have been devoted to the development of methodology that allows facile preparation of PAHAs with controlled molecular weights and a variety of functionalities for widespread utilities. However, it is highly challenging to introduce functional groups into conventional PAHAs derived from ring-opening polymerization (ROP) of lactides and glycolides to yield functional PAHAs with favorable properties, such as tunable hydrophilicity/hydrophobicity, facile postpolymerization modification, and well-defined physicochemical properties. Amino acids are excellent resources for functional polymers because of their low cost, availability, and structural as well as stereochemical diversity. Nevertheless, the synthesis of functional PAHAs using amino acids as building blocks has been rarely reported because of the difficulty of preparing large-scale monomers and poor yields during the synthesis. The synthesis of functionalized PAHAs from O-carboxyanhydrides (OCAs), a class of five-membered cyclic anhydrides derived from amino acids, has proven to be one of the most promising strategies and has thus attracted tremendous interest recently. In this Account, we highlight the recent progress in our group on the synthesis of functional PAHAs via ROP of OCAs and their self-assembly and biomedical applications. New synthetic methodologies that allow the facile preparation of PAHAs with controlled molecular weights and various functionalities through ROP of OCAs are reviewed and evaluated. The in vivo stability, side-chain functionalities, and/or trigger
Exogenous fatty acid metabolism in bacteria.
Yao, Jiangwei; Rock, Charles O
2017-10-01
Bacterial type II fatty acid synthesis (FASII) is a target for novel antibiotic development. All bacteria encode for mechanisms to incorporate exogenous fatty acids, and some bacteria can use exogenous fatty acids to bypass FASII inhibition. Bacteria encode three different mechanisms for activating exogenous fatty acids for incorporation into phospholipid synthesis. Exogenous fatty acids are converted into acyl-CoA in Gammaproteobacteria such as E. coli. Acyl-CoA molecules constitute a separate pool from endogenously synthesized acyl-ACP. Acyl-CoA can be used for phospholipid synthesis or broken down by β-oxidation, but cannot be used for lipopolysaccharide synthesis. Exogenous fatty acids are converted into acyl-ACP in some Gram-negative bacteria. The resulting acyl-ACP undergoes the same fates as endogenously synthesized acyl-ACP. Exogenous fatty acids are converted into acyl-phosphates in Gram-positive bacteria, and can be used for phospholipid synthesis or become acyl-ACP. Only the order Lactobacillales can use exogenous fatty acids to bypass FASII inhibition. FASII shuts down completely in presence of exogenous fatty acids in Lactobacillales, allowing Lactobacillales to synthesize phospholipids entirely from exogenous fatty acids. Inhibition of FASII cannot be bypassed in other bacteria because FASII is only partially down-regulated in presence of exogenous fatty acid or FASII is required to synthesize essential metabolites such as β-hydroxyacyl-ACP. Certain selective pressures such as FASII inhibition or growth in biofilms can select for naturally occurring one step mutations that attenuate endogenous fatty acid synthesis. Although attempts have been made to estimate the natural prevalence of these mutants, culture-independent metagenomic methods would provide a better estimate. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kajimoto, Masaki; Priddy, Colleen M.; Ledee, Dolena
2013-08-19
Extracorporeal membrane oxygenation (ECMO) unloads the heart providing a bridge to recovery in children after myocardial stunning. Mortality after ECMO remains high.Cardiac substrate and amino acid requirements upon weaning are unknown and may impact recovery. We assessed the hypothesis that ventricular reloading modulates both substrate entry into the citric acid cycle (CAC) and myocardial protein synthesis. Fourteen immature piglets (7.8-15.6 kg) were separated into 2 groups based on ventricular loading status: 8 hour-ECMO (UNLOAD) and post-wean from ECMO (RELOAD). We infused [2-13C]-pyruvate as an oxidative substrate and [13C6]-L-leucine, as a tracer of amino acid oxidation and protein synthesis into themore » coronary artery. RELOAD showed marked elevations in myocardial oxygen consumption above baseline and UNLOAD. Pyruvate uptake was markedly increased though RELOAD decreased pyruvate contribution to oxidative CAC metabolism.RELOAD also increased absolute concentrations of all CAC intermediates, while maintaining or increasing 13C-molar percent enrichment. RELOAD also significantly increased cardiac fractional protein synthesis rates by >70% over UNLOAD. Conclusions: RELOAD produced high energy metabolic requirement and rebound protein synthesis. Relative pyruvate decarboxylation decreased with RELOAD while promoting anaplerotic pyruvate carboxylation and amino acid incorporation into protein rather than to the CAC for oxidation. These perturbations may serve as therapeutic targets to improve contractile function after ECMO.« less
Urata, Shuzo; Uno, Yukiko; Kurosaki, Yohei; Yasuda, Jiro
2018-06-12
Severe fever with thrombocytopenia syndrome (SFTS) is an emerging infectious disease caused by the SFTS virus (SFTSV), which has a high mortality rate. Currently, no licensed vaccines or therapeutic agents have been approved for use against SFTSV infection. Here, we report that the cholesterol, fatty acid, and triglyceride synthesis pathways regulated by S1P is involved in SFTSV replication, using CHO-K1 cell line (SRD-12B) that is deficient in site 1 protease (S1P) enzymatic activity, PF-429242, a small compound targeting S1P enzymatic activity, and Fenofibrate and Lovastatin, which inhibit triglyceride and cholesterol synthesis, respectively. These results enhance our understanding of the SFTSV replication mechanism and may contribute to the development of novel therapies for SFTSV infection. Copyright © 2018. Published by Elsevier Inc.
Engineer, Anupama S; Dhakephalkar, Anita P; Gaikaiwari, Raghavendra P; Dhakephalkar, Prashant K
2013-12-01
Hydantoinase-mediated enzymatic synthesis of optically pure carbamoyl amino acids was investigated as an environmentally friendly, energy-efficient alternative to the otherwise energy-intensive, polluting chemical synthesis. Hydantoinase-producing bacterial strain was identified as Pseudomonas aeruginosa by 16S rRNA gene sequencing and biochemical profiling using the BIOLOG Microbial Identification System. Hydantoinase activity was assessed using hydantoin analogs and 5-monosubstituted hydantoins as substrates in a colorimetric assay. The hydantoinase gene was PCR amplified using gene-specific primers and sequenced on an automated gene analyzer. Hydantoinase gene sequence of P. aeruginosa MCM B-887 revealed maximum homology of only 87 % with proven hydantoinase gene sequences in GenBank. MCM B-887 resting cells converted >99 % of substrate into N-carbamoyl amino acids under optimized condition at 42 °C, pH 8.0, and 100 mM substrate concentration in <120 min. Hydantoin hydrolyzing activity was D-selective and included broad substrate profile of 5-methyl hydantoin, 5-phenyl hydantoin, 5-hydroxyphenyl hydantoin, o-chlorophenyl hydantoin, as well as hydantoin analogs such as allantoin, dihydrouracil, etc. MCM B-887 resting cells may thus be suitable for bio-transformations leading to the synthesis of optically pure, unnatural carbamoyl amino acids of industrial importance.
Martin, Rey W; Des Soye, Benjamin J; Kwon, Yong-Chan; Kay, Jennifer; Davis, Roderick G; Thomas, Paul M; Majewska, Natalia I; Chen, Cindy X; Marcum, Ryan D; Weiss, Mary Grace; Stoddart, Ashleigh E; Amiram, Miriam; Ranji Charna, Arnaz K; Patel, Jaymin R; Isaacs, Farren J; Kelleher, Neil L; Hong, Seok Hoon; Jewett, Michael C
2018-03-23
Cell-free protein synthesis has emerged as a powerful approach for expanding the range of genetically encoded chemistry into proteins. Unfortunately, efforts to site-specifically incorporate multiple non-canonical amino acids into proteins using crude extract-based cell-free systems have been limited by release factor 1 competition. Here we address this limitation by establishing a bacterial cell-free protein synthesis platform based on genomically recoded Escherichia coli lacking release factor 1. This platform was developed by exploiting multiplex genome engineering to enhance extract performance by functionally inactivating negative effectors. Our most productive cell extracts enabled synthesis of 1,780 ± 30 mg/L superfolder green fluorescent protein. Using an optimized platform, we demonstrated the ability to introduce 40 identical p-acetyl-L-phenylalanine residues site specifically into an elastin-like polypeptide with high accuracy of incorporation ( ≥ 98%) and yield (96 ± 3 mg/L). We expect this cell-free platform to facilitate fundamental understanding and enable manufacturing paradigms for proteins with new and diverse chemistries.
USDA-ARS?s Scientific Manuscript database
Lactose synthesis is believed to be rate-limiting for milk production. However, understanding the molecular events controlling lactose synthesis in humans is still rudimentary. We have utilized our established model of the RNA isolated from breast milk fat globule from 7 healthy exclusively breastfe...