Science.gov

Sample records for acid synthesis rates

  1. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.

    1986-05-01

    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  2. Rates of synthesis and degradation of ribosomal ribonucleic acid during differentiation of Dictyostelium discoideum.

    PubMed Central

    Mangiarotti, G; Altruda, F; Lodish, H F

    1981-01-01

    Synthesis of ribosomes and ribosomal ribonucleic acid (RNA) continued during differentiation of Dictyostelium discoideum concurrently with extensive turnover of ribosomes synthesized during both growth and developmental stages. We show here that the rate of synthesis of 26S and 17S ribosomal RNA during differentiation was less than 15% of that in growing cells, and by the time of sorocarp formation only about 25% of the cellular ribosomes had been synthesized during differentiation. Ribosomes synthesized during growth and differentiation were utilized in messenger RNA translation to the same extent; about 50% of each class were on polyribosomes. Ribosome degradation is apparently an all-or-nothing process, since virtually all 80S monosomes present in developing cells could be incorporated into polysomes when growth conditions were restored. By several criteria, ribosomes synthesized during growth and differentiation were functionally indistinguishable. Our data, together with previously published information on changes in the messenger RNA population during differentiation, indicate that synthesis of new ribosomes is not necessary for translation of developmentally regulated messenger RNA. We also establish that the overall rate of messenger RNA synthesis during differentiation is less than 15% of that in growing cells. PMID:6965093

  3. Rates of synthesis and degradation of ribosomal ribonucleic acid during differentiation of Dictyostelium discoideum.

    PubMed

    Mangiarotti, G; Altruda, F; Lodish, H F

    1981-01-01

    Synthesis of ribosomes and ribosomal ribonucleic acid (RNA) continued during differentiation of Dictyostelium discoideum concurrently with extensive turnover of ribosomes synthesized during both growth and developmental stages. We show here that the rate of synthesis of 26S and 17S ribosomal RNA during differentiation was less than 15% of that in growing cells, and by the time of sorocarp formation only about 25% of the cellular ribosomes had been synthesized during differentiation. Ribosomes synthesized during growth and differentiation were utilized in messenger RNA translation to the same extent; about 50% of each class were on polyribosomes. Ribosome degradation is apparently an all-or-nothing process, since virtually all 80S monosomes present in developing cells could be incorporated into polysomes when growth conditions were restored. By several criteria, ribosomes synthesized during growth and differentiation were functionally indistinguishable. Our data, together with previously published information on changes in the messenger RNA population during differentiation, indicate that synthesis of new ribosomes is not necessary for translation of developmentally regulated messenger RNA. We also establish that the overall rate of messenger RNA synthesis during differentiation is less than 15% of that in growing cells.

  4. Measurement of Rates of Cholesterol and Fatty Acid Synthesis In Vivo Using Tritiated Water.

    PubMed

    Lopez, Adam M; Chuang, Jen-Chieh; Turley, Stephen D

    2017-01-01

    Every organ in the body is capable of synthesizing cholesterol de novo but at rates that vary with a constellation of factors. A significant proportion of the hydrogen atoms present in cholesterol that is synthesized in the body are derived from water. Thus, although water ordinarily makes up the bulk of body mass, the acute enrichment of the body water pool with a sufficiently large amount of tritiated water over a short interval of time (usually 1 h) yields measurable rates of incorporation of the labeled water into newly generated cholesterol and also fatty acids. Such data can provide a quantitative measure of how specific genetic, dietary, and pharmacological manipulations impact not just the rate of cholesterol synthesis in particular organs but also rates of whole-body cholesterol production and turnover.

  5. Whole body synthesis rates of DHA from α-linolenic acid are greater than brain DHA accretion and uptake rates in adult rats[S

    PubMed Central

    Domenichiello, Anthony F.; Chen, Chuck T.; Trepanier, Marc-Olivier; Stavro, P. Mark; Bazinet, Richard P.

    2014-01-01

    Docosahexaenoic acid (DHA) is important for brain function, however, the exact amount required for the brain is not agreed upon. While it is believed that the synthesis rate of DHA from α-linolenic acid (ALA) is low, how this synthesis rate compares with the amount of DHA required to maintain brain DHA levels is unknown. The objective of this work was to assess whether DHA synthesis from ALA is sufficient for the brain. To test this, rats consumed a diet low in n-3 PUFAs, or a diet containing ALA or DHA for 15 weeks. Over the 15 weeks, whole body and brain DHA accretion was measured, while at the end of the study, whole body DHA synthesis rates, brain gene expression, and DHA uptake rates were measured. Despite large differences in body DHA accretion, there was no difference in brain DHA accretion between rats fed ALA and DHA. In rats fed ALA, DHA synthesis and accretion was 100-fold higher than brain DHA accretion of rats fed DHA. Also, ALA-fed rats synthesized approximately 3-fold more DHA than the DHA uptake rate into the brain. This work indicates that DHA synthesis from ALA may be sufficient to supply the brain. PMID:24212299

  6. Correlation Between the Rate of Ribonucleic Acid Synthesis and the Level of Valyl Transfer Ribonucleic Acid in Mutants of Escherichia coli

    PubMed Central

    Kaplan, Sam

    1969-01-01

    By use of a mutant of Escherichia coli with a partially thermolabile transfer ribonucleic acid (tRNA) synthase, it was possible to regulate the rate of RNA synthesis over a 10-fold range. The addition of chloramphenicol to cultures kept at the nonpermissive temperature stimulated RNA synthesis. The longer the culture was kept at the nonpermissive temperature prior to addition of chloramphenicol, the lower was the resulting rate of RNA synthesis. The decrease in the rate of incorporation of labeled uracil into RNA was correlated with the decrease in the level of valyl tRNA. Additional experiments provided evidence which may be interpreted as indicating that valyl tRNA does not, by itself, react with the RNA-forming system. PMID:4891259

  7. Suppression of brain cholesterol synthesis in male Mecp2-deficient mice is age dependent and not accompanied by a concurrent change in the rate of fatty acid synthesis.

    PubMed

    Lopez, Adam M; Chuang, Jen-Chieh; Posey, Kenneth S; Turley, Stephen D

    2017-01-01

    Mutations in the X-linked gene methyl-CpG-binding protein 2 (MECP2) are the principal cause of Rett syndrome, a progressive neurodevelopmental disorder afflicting 1 in 10,000 to 15,000 females. Studies using hemizygous Mecp2 mouse models have revealed disruptions to some aspects of their lipid metabolism including a partial suppression of cholesterol synthesis in the brains of mature Mecp2 mutants. The present studies investigated whether this suppression is evident from early neonatal life, or becomes manifest at a later stage of development. We measured the rate of cholesterol synthesis, in vivo, in the brains of male Mecp2(-)(/y) and their Mecp2(+/y) littermates at 7, 14, 21, 28, 42 and 56 days of age. Brain weight was consistently lower in the Mecp2(-/y) mice than in their Mecp2(+/y) controls except at 7 days of age. In the 7- and 14-day-old mice there was no genotypic difference in the rate of brain cholesterol synthesis but, from 21 days and later, it was always marginally lower in the Mecp2(-/y) mice than in age-matched Mecp2(+/y) littermates. At no age was a genotypic difference detected in either the rate of fatty acid synthesis or cholesterol concentration in the brain. Cholesterol synthesis rates in the liver and lungs of 56-day-old Mecp2(-/y) mice were normal. The onset of lower rates of brain cholesterol synthesis at about the time closure of the blood brain barrier purportedly occurs might signify a disruption to mechanism(s) that dictate intracellular levels of cholesterol metabolites including oxysterols known to exert a regulatory influence on the cholesterol biosynthetic pathway.

  8. Metabolism of Nonessential N15-Labeled Amino Acids and the Measurement of Human Whole-Body Protein Synthesis Rates

    NASA Technical Reports Server (NTRS)

    Stein, T. P.; Settle, R. G.; Albina, J. A.; Dempsey, D. T.; Melnick, G.

    1991-01-01

    Eight N-15 labeled nonessential amino acids plus (15)NH4Cl were administered over a 10 h period to four healthy adult males using a primed-constant dosage regimen. The amount of N-15 excreted in the urine and the urinary ammonia, hippuric acid, and plasma alanine N-15 enrichments were measured. There was a high degree of consistency across subjects in the ordering of the nine compounds based on the fraction of N-15 excreted (Kendall coefficient of concordance W = 0.83, P is less than 0.01). Protein synthesis rates were calculated from the urinary ammonia plateau enrichment and the cumulative excretion of N-15. Glycine was one of the few amino acids that gave similar values by both methods.

  9. Influence of peptides and amino acids on fermentation rate and de novo synthesis of amino acids by mixed micro-organisms from the sheep rumen.

    PubMed

    Atasoglu, C; Valdés, C; Newbold, C J; Wallace, R J

    1999-04-01

    The influence of different N sources on fermentation rate and de novo amino acid synthesis by rumen micro-organisms was investigated in vitro using rumen fluid taken from four sheep receiving a mixed diet comprising (g/kg DM): grass hay 500, barley 299.5, molasses 100, fish meal 91, minerals and vitamins 9.5. Pancreatic casein hydrolysate (P; comprising mainly peptides with some free amino acids; 10 g/l), free amino acids (AA; casein acid hydrolysate + added cysteine and tryptophan; 10 g/l), or a mixture of L-proline, glycine, L-valine and L-threonine (M; 0.83 g/l each) were added to diluted (1:3, v/v), strained rumen fluid along with 15NH4Cl (A; 1.33 g/l) and 6.7 g/l of a mixture of starch, cellobiose and xylose (1:1:1, by weight). P and AA, but not M, stimulated net gas production after 4 and 8 h incubation (P < 0.05) in comparison with A alone. P increased microbial-protein synthesis (P < 0.05) compared with the other treatments. All of the microbial-N formed after 10 h was synthesized de novo from 15NH3 in treatment A, and the addition of pre-formed amino acids decreased the proportion to 0.37, 0.55, and 0.86 for P, AA, and M respectively. De novo synthesis of amino acids (0.29, 0.42 and 0.69 respectively) was lower than cell-N. Enrichment of alanine, glutamate and aspartate was slightly higher than that of other amino acids, while enrichment in proline was much lower, such that 0.83-0.95 of all proline incorporated into particulate matter was derived from pre-formed proline. Glycine, methionine, lysine, valine and threonine tended to be less enriched than other amino acids. The form in which the amino acids were supplied, as P or AA, had little influence on the pattern of de novo synthesis. When the concentration of peptides was decreased, the proportion of microbial-N formed from NH3 increased, so that at an initial concentration of 1 g peptides/l, similar to the highest reported ruminal peptide concentrations, 0.68 of cell-N was formed from NH3. Decreasing

  10. Dietary omega-3 fatty acid supplementation increases the rate of muscle protein synthesis in older adults: a randomized controlled trial123

    PubMed Central

    Smith, Gordon I; Atherton, Philip; Reeds, Dominic N; Mohammed, B Selma; Rankin, Debbie; Rennie, Michael J; Mittendorfer, Bettina

    2011-01-01

    Background: Loss of muscle mass with aging is a major public health concern. Omega-3 (n–3) fatty acids stimulate protein anabolism in animals and might therefore be useful for the treatment of sarcopenia. However, the effect of omega-3 fatty acids on human protein metabolism is unknown. Objective: The objective of this study was to evaluate the effect of omega-3 fatty acid supplementation on the rate of muscle protein synthesis in older adults. Design: Sixteen healthy, older adults were randomly assigned to receive either omega-3 fatty acids or corn oil for 8 wk. The rate of muscle protein synthesis and the phosphorylation of key elements of the anabolic signaling pathway were evaluated before and after supplementation during basal, postabsorptive conditions and during a hyperaminoacidemic-hyperinsulinemic clamp. Results: Corn oil supplementation had no effect on the muscle protein synthesis rate and the extent of anabolic signaling element phosphorylation in muscle. Omega-3 fatty acid supplementation had no effect on the basal rate of muscle protein synthesis (mean ± SEM: 0.051 ± 0.005%/h compared with 0.053 ± 0.008%/h before and after supplementation, respectively; P = 0.80) but augmented the hyperaminoacidemia-hyperinsulinemia–induced increase in the rate of muscle protein synthesis (from 0.009 ± 0.005%/h above basal values to 0.031 ± 0.003%/h above basal values; P < 0.01), which was accompanied by greater increases in muscle mTORSer2448 (P = 0.08) and p70s6kThr389 (P < 0.01) phosphorylation. Conclusion: Omega-3 fatty acids stimulate muscle protein synthesis in older adults and may be useful for the prevention and treatment of sarcopenia. This trial was registered at clinical trials.gov as NCT00794079. PMID:21159787

  11. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  12. Determining synthesis rates of individual proteins in zebrafish (Danio rerio) with low levels of a stable isotope labelled amino acid.

    PubMed

    Geary, Bethany; Magee, Kieran; Cash, Phillip; Young, Iain S; Whitfield, Phillip D; Doherty, Mary K

    2016-05-01

    The zebrafish is a powerful model organism for the analysis of human cardiovascular development and disease. Understanding these processes at the protein level not only requires changes in protein concentration to be determined but also the rate at which these changes occur on a protein-by-protein basis. The ability to measure protein synthesis and degradation rates on a proteome-wide scale, using stable isotope labelling in conjunction with mass spectrometry is now a well-established experimental approach. With the advent of more selective and sensitive mass spectrometers, it is possible to accurately measure lower levels of stable isotope incorporation, even when sample is limited. In order to challenge the sensitivity of this approach, we successfully determined the synthesis rates of over 600 proteins from the cardiac muscle of the zebrafish using a diet where either 30% or 50% of the L-leucine was replaced with a stable isotope labelled analogue ([(2) H7 ]L-leucine]. It was possible to extract sufficient protein from individual zebrafish hearts to determine the incorporation rate of the label into hundreds of proteins simultaneously, with the two labelling regimens showing a good correlation of synthesis rates.

  13. Amino Acid Synthesis in Photosynthesizing Spinach Cells: Effects of Ammonia on Pool Sizes and Rates of Labeling from 14CO2

    SciTech Connect

    Larsen, Peder Olesen; Cornwell, Karen L.; Gee, Sherry L.; Bassham, James A.

    1981-08-01

    In this paper, isolated cells from leaves of Spinacia oleracea have been maintained in a state capable of high rates of photosynthetic CO2 fixation for more than 60 hours. The incorporation of 14CO2 under saturating CO2 conditions into carbohydrates, carboxylic acids, and amino acids, and the effect of ammonia on this incorporation have been studied. Total incorporation, specific radioactivity, and pool size have been determined as a function of time for most of the protein amino acids and for γ-aminobutyric acid. The measurements of specific radio-activities and of the approaches to 14C “saturation” of some amino acids indicate the presence and relative sizes of metabolically active and passive pools of these amino acids. Added ammonia decreased carbon fixation into carbohydrates and increased fixation into carboxylic acids and amino acids. Different amino acids were, however, affected in different and highly specific ways. Ammonia caused large stimulatory effects in incorporation of 14C into glutamine (a factor of 21), aspartate, asparagine, valine, alanine, arginine, and histidine. No effect or slight decreases were seen in glycine, serine, phenylalanine, and tyrosine labeling. In the case of glutamate, 14C labeling decreased, but specific radioactivity increased. The production of labeled γ-aminobutyric acid was virtually stopped by ammonia. The results indicate that added ammonia stimulates the reactions mediated by pyruvate kinase and phosphoenolpyruvate carboxylase, as seen with other plant systems. Finally, the data on the effects of added ammonia on total labeling, pool sizes, and specific radioactivities of several amino acids provides a number of indications about the intracellular sites of principal synthesis from carbon skeletons of these amino acids and the selective nature of effects of increased intracellular ammonia concentration on such synthesis.

  14. Borinic acid catalysed peptide synthesis.

    PubMed

    El Dine, Tharwat Mohy; Rouden, Jacques; Blanchet, Jérôme

    2015-11-18

    The catalytic synthesis of peptides is a major challenge in the modern organic chemistry hindered by the well-established use of stoichiometric coupling reagents. Herein, we describe for the first time that borinic acid is able to catalyse this reaction under mild conditions with an improved activity compared to our recently developed thiophene-based boronic acid. This catalyst is particularly efficient for peptide bond synthesis affording dipeptides in good yields without detectable racemization.

  15. Bile acids: regulation of synthesis.

    PubMed

    Chiang, John Y L

    2009-10-01

    Bile acids are physiological detergents that generate bile flow and facilitate intestinal absorption and transport of lipids, nutrients, and vitamins. Bile acids also are signaling molecules and inflammatory agents that rapidly activate nuclear receptors and cell signaling pathways that regulate lipid, glucose, and energy metabolism. The enterohepatic circulation of bile acids exerts important physiological functions not only in feedback inhibition of bile acid synthesis but also in control of whole-body lipid homeostasis. In the liver, bile acids activate a nuclear receptor, farnesoid X receptor (FXR), that induces an atypical nuclear receptor small heterodimer partner, which subsequently inhibits nuclear receptors, liver-related homolog-1, and hepatocyte nuclear factor 4alpha and results in inhibiting transcription of the critical regulatory gene in bile acid synthesis, cholesterol 7alpha-hydroxylase (CYP7A1). In the intestine, FXR induces an intestinal hormone, fibroblast growth factor 15 (FGF15; or FGF19 in human), which activates hepatic FGF receptor 4 (FGFR4) signaling to inhibit bile acid synthesis. However, the mechanism by which FXR/FGF19/FGFR4 signaling inhibits CYP7A1 remains unknown. Bile acids are able to induce FGF19 in human hepatocytes, and the FGF19 autocrine pathway may exist in the human livers. Bile acids and bile acid receptors are therapeutic targets for development of drugs for treatment of cholestatic liver diseases, fatty liver diseases, diabetes, obesity, and metabolic syndrome.

  16. Metabolism of nonessential N-15-labeled amino acids and the measurement of human whole-body protein synthesis rates

    NASA Technical Reports Server (NTRS)

    Stein, T. P.; Settle, R. G.; Albina, J. A.; Melnick, G.; Dempsey, D. T.

    1991-01-01

    Eight N-15-labeled nonessential amino acids plus (N-15)H4Cl were administered over a 10-h period to four healthy adult males using a primed-constant dosage regimen. The amount of N-15 excreted in the urine and the urinary ammonia, hippuric acid, and plasma alanine N-15 enrichments were measured. There was a high degree of consistency across subjects in the ordering of the nine compounds based on the fraction of N-15 excreted.

  17. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  18. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  19. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  20. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  1. SYNTHESIS OF RIBONUCLEIC ACID BY X-IRRADIATED BACTERIA1

    PubMed Central

    Frampton, E. W.

    1964-01-01

    Frampton, E. W. (The University of Texas M. D. Anderson Hospital and Tumor Institute, Houston). Synthesis of ribonucleic acid by X-irradiated bacteria. J. Bacteriol. 87:1369–1376. 1964.—Postirradiation synthesis of total ribonucleic acid (RNA) and of RNA components was measured after exposure of Escherichia coli B/r to X rays. Net synthesis of RNA measured by the orcinol reaction and by the incorporation of uridine-2-C14 was depressed in irradiated cells, but paralleled the period of postirradiation growth (30 to 40 min). Incorporation of uridine-2-C14, added after net synthesis of RNA had ceased, detected an apparent turnover in a portion of the RNA. Irradiated cells retained their ability to adjust RNA synthesis to growth rate. After a shift-down in growth rate, irradiated cells incorporated radioactive uridine, while the net synthesis of RNA ceased—presumptive evidence for a continued synthesis of messenger RNA. Chloramphenicol addition (100 μg/ml) did not influence the total amount of RNA synthesized. Synthesis of ribosomes and transfer RNA preceded by 0, 5, 10, and 15 min of postirradiation incubation was observed by the resolution of cell-free extracts on sucrose density gradients. Little immediate influence of irradiation could be detected on the synthesis of 50S and 30S ribosomes. A decline was observed in the synthesis of 50S ribosomes with continued postirradiation incubation; 30S ribosomes, ribosomal precursors, and 4S RNA continued to be synthesized. PMID:14188715

  2. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  3. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  4. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  5. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  6. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

  7. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  8. Binary population synthesis and SNIa rates

    NASA Astrophysics Data System (ADS)

    Toonen, S.; Nelemans, G.; Bours, M.; Portegies Zwart, S.

    2013-01-01

    Despite the significance of type Ia supernovae (SNeIa) in many fields in astrophysics, SNeIa lack a theoretical explanation. We investigate the potential contribution to the SNeIa rate from the most common progenitor channels using the binary population synthesis (BPS) code SeBa. Using SeBa, we aim constrain binary processes such as the common envelope phase and the efficiency of mass retention of white dwarf accretion. We find that the simulated rates are not sufficient to explain the observed rates. Further, we find that the mass retention efficiency of white dwarf accretion significantly influences the rates, but does not explain all the differences between simulated rates from different BPS codes.

  9. Synthesis of Pulcherriminic Acid by Bacillus subtilis

    PubMed Central

    Uffen, Robert L.; Canale-Parola, E.

    1972-01-01

    The pathway of pulcherriminic acid synthesis in Bacillus subtilis strains AM and AM-L11 (a leucine-requiring auxotroph) was investigated. Determinations of radioactivity in pulcherriminic acid synthesized by cells growing in media containing 14C-labeled amino acids indicated that B. subtilis produced pulcherriminic acid from l-leucine. The organism utilized the carbon skeletons of two l-leucine molecules to synthesize one molecule of pulcherriminic acid. Similar results were obtained with starved cell suspensions. Growing cells formed significant amounts of pulcherriminic acid only in media including a carbohydrate such as starch. However, carbohydrate carbon was not required for the synthesis of pulcherriminic acid molecules. Data obtained with cell suspensions supported the hypothesis that cyclo-l-leucyl-l-leucyl is an intermediate in pulcherriminic acid biosynthesis and indicated that molecular oxygen is required for the conversion of cyclo-l-leucyl-l-leucyl to pulcherriminic acid. A pathway for the synthesis of pulcherrimin from l-leucine in B. subtilis is proposed. PMID:4204912

  10. Nitrated fatty acids: synthesis and measurement.

    PubMed

    Woodcock, Steven R; Bonacci, Gustavo; Gelhaus, Stacy L; Schopfer, Francisco J

    2013-06-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia/reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis and sample extraction from complex biological matrices and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by liquid chromatography-mass spectrometry. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed.

  11. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  12. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  13. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  14. [Total synthesis of nordihydroguaiaretic acid].

    PubMed

    Wu, A X; Zhao, Y R; Chen, N; Pan, X F

    1997-04-01

    beta-Keto ester(5) was obtained from vanilin through etherification, oxidation and condensation with acetoacetic ester, (5) on oxidative coupling reaction by NaOEt/I2 produced dimer (6) in high yield. Acid catalyzed cyclodehydration of (6) gave the furan derivative(7), and by a series of selective hydrogenation nordihydroguaiaretic acid, furoguaiacin dimethyl ether and dihydroguaiaretic acid dimethyl ether were synthesized.

  15. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  16. Effect of rate of weight gain of steers during the stocker phase. IV. Rumen fermentation characteristics and expression of genes involved in substrate utilization for fatty acid synthesis in adipose tissues of growing-finishing beef cattle.

    PubMed

    Lancaster, P A; Sharman, E D; Horn, G W; Krehbiel, C R; Dillwith, J W; Starkey, J D

    2015-06-01

    The objective of this study was to determine the impact of stocker production systems differing in growth rate on rumen fermentation characteristics and utilization of substrates for fatty acid synthesis in intramuscular (IM), subcutaneous (SC), and perirenal (PR) adipose tissues. Angus steers were assigned to 4 stocker cattle production systems in 2 consecutive years: 1) 1.0 kg/d of 40% CP cottonseed meal–based supplement while grazing dormant native range (CON), 2) ground corn/soybean meal–based supplement while grazing dormant native range fed at 1% of BW (CORN), 3) grazing wheat pasture at a high stocking rate to achieve a low rate of BW gain (LGWP), and 4) grazing wheat pasture at a low stocking rate for a high rate of BW gain (HGWP). Eight ruminally cannulated steers were used to determine rumen fermentation characteristics. Steers were harvested during the stocker phase at similar age (different carcass weight) in Exp. 1 (3 steers/treatment) or at similar carcass weight in Exp. 2 (4 steers/treatment). Adipose tissues were analyzed for mRNA expression of genes involved in glucose (solute carrier family 2, member 4 [GLUT4], glucose-6-phosphate dehydrogenase [G6PDH], phosphofructokinase, muscle [PFKM], and pyruvate kinase 2, muscle [PK2]), lactate (lactate dehydrogenase B [LDHB]), and acetate (acetyl-CoA synthetase, cytosol [ACSS2]) utilization for fatty acid synthesis. The acetate:propionate ratio was least (P < 0.05) for HGWP steers, intermediate for CORN and LGWP steers, and greatest for CON steers. At similar age, LGWP and HGWP steers tended (F-test; P < 0.15) to have greater (P < 0.10) G6PDH and ACSS2 mRNA expression than CON and CORN steers in SC and PR but not IM adipose tissue. Expression of PFKM and PK2 mRNA tended (F-test; P < 0.15) to be greater (P < 0.10) in HGWP than CON and LGWP steers in IM but not SC or PR adipose tissue. At similar HCW, expression of GLUT4 and G6PDH mRNA were greater (P < 0.10) in SC adipose tissue of LGWP and HGWP steers

  17. A plausibly prebiotic synthesis of phosphonic acids.

    PubMed

    de Graaf, R M; Visscher, J; Schwartz, A W

    1995-11-30

    The insolubility of calcium phosphate in water is a significant stumbling block in the chemistry required for the origin of life. The discovery of alkyl phosphonic acids in the Murchison meteorite suggests the possibility of delivery of these water-soluble, phosphorus-containing molecules by meteorites or comets to the early Earth. This could have provided a supply of organic phosphorus for the earliest stages of chemical evolution; although probably not components of early genetic systems, phosphonic acids may have been precursors to the first nucleic acids. Here we report the synthesis of several phosphonic acids, including the most abundant found in the Murchison meteorite, by ultraviolet irradiation of orthophosphorous acid in the presence of formaldehyde, primary alcohols, or acetone. We argue that similar reactions might explain the presence of phosphonic acids in Murchison, and could also have occurred on the prebiotic Earth.

  18. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  19. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  20. Benzene-free synthesis of adipic acid.

    PubMed

    Niu, Wei; Draths, K M; Frost, J W

    2002-01-01

    Strains of Escherichia coli were constructed and evaluated that synthesized cis,cis-muconic acid from D-glucose under fed-batch fermentor conditions. Chemical hydrogenation of the cis,cis-muconic acid in the resulting fermentation broth has also been examined. Biocatalytic synthesis of adipic acid from glucose eliminates two environmental concerns characteristic of industrial adipic acid manufacture: use of carcinogenic benzene and benzene-derived chemicals as feedstocks and generation of nitrous oxide as a byproduct of a nitric acid catalyzed oxidation. While alternative catalytic syntheses that eliminate the use of nitric acid have been developed, most continue to rely on petroleum-derived benzene as the ultimate feedstock. In this study, E. coli WN1/pWN2.248 was developed that synthesized 36.8 g/L of cis,cis-muconic acid in 22% (mol/mol) yield from glucose after 48 h of culturing under fed-batch fermentor conditions. Optimization of microbial cis,cis-muconic acid synthesis required expression of three enzymes not typically found in E. coli. Two copies of the Klebsiella pneumoniae aroZ gene encoding DHS dehydratase were inserted into the E. coli chromosome, while the K. pneumoniae aroY gene encoding PCA decarboxylase and the Acinetobacter calcoaceticus catA gene encoding catechol 1,2-dioxygenase were expressed from an extrachromosomal plasmid. After fed-batch culturing of WN1/pWN2.248 was complete, the cells were removed from the broth, which was treated with activated charcoal and subsequently filtered to remove soluble protein. Hydrogenation of the resulting solution with 10% Pt on carbon (5% mol/mol) at 3400 kPa of H2 pressure for 2.5 h at ambient temperature afforded a 97% (mol/mol) conversion of cis,cis-muconic acid into adipic acid.

  1. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  2. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  3. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  4. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  5. ORAL AND INTRAVENOUSLY ADMINISTERED AMINO ACIDS PRODUCE SIMILAR EFFECTS ON MUSCLE PROTEIN SYNTHESIS IN THE ELDERLY

    PubMed Central

    Rasmussen, B.B.; Wolfe, R.R.; Volpi, E.

    2011-01-01

    BACKGROUND Muscle protein synthesis is stimulated in the elderly when amino acid availability is increased. OBJECTIVE To determine which mode of delivery of amino acids (intravenous vs. oral ingestion) is more effective in stimulating the rate of muscle protein synthesis in elderly subjects. DESIGN Fourteen elderly subjects were assigned to one of two groups. Following insertion of femoral arterial and venous catheters, subjects were infused with a primed, continuous infusion of L-[ring-2H5] phenylalanine. Blood samples and muscle biopsies were obtained to measure muscle protein fractional synthesis rate (FSR) with the precursor-product model, phenylalanine kinetics across the leg with the three-pool model, and whole body phenylalanine kinetics. Protein metabolism parameters were measured in the basal period, and during the administration of oral amino acids (n=8) or a similar amount of intravenous amino acids (n=6). RESULTS Enteral and parenteral amino acid administration increased amino acid arterial concentrations and delivery to the leg to a similar extent in both groups. Muscle protein synthesis as measured by both FSR, and the three-pool model, increased during amino acid administration (P < 0.05 vs. basal) in both groups with no differences between groups. Whole body proteolysis did not change with the oral amino acids whereas it increased slightly during parenteral amino acid administration. CONCLUSIONS Increased amino acid availability stimulates the rate of muscle protein synthesis independent of the route of administration (enteral vs. parenteral). PMID:12459885

  6. Pyrazinoic acid decreases peritoneal transfer rates.

    PubMed

    Grzegorzewska, A E; Czyzewska, K; Szary, B

    1995-01-01

    It was shown elsewhere that in a peritoneally dialyzed woman with pulmonary tuberculosis, oral treatment with rifampicin and pyrazinamide (11 and 25 mg/kg/day, respectively) caused a decrease in the peritoneal transport of sodium, potassium, urea, uric acid, protein, and ultrafiltration rate by 48% to 75% compared to the pretreatment values. Pyrazinoic acid (PA), a metabolite of pyrazinamide, may account for these changes, because rifampicin was also previously used in this patient without peritoneal function impairment. Thus in the present study the influence of PA on the human peritoneum is examined using the modified Ussing-type chamber. PA (1 mg/dL) was introduced into the medium on the interstitial side of the membrane. After the introduction of PA, uric acid transfer from the interstitial to the mesothelial side decreased by about 50%. There were no significant changes in the urea and albumin transfer rates. In conclusion, PA induces changes in uric acid transfer acting directly on mesothelial cells, whereas a decrease in the peritoneal transfer of other solutes may be caused by a decrease in convective transfer rates due to impaired ultrafiltration.

  7. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  8. In Vivo Measurement of Muscle Protein Synthesis Rate Using the Flooding Dose Technique

    PubMed Central

    Fiorotto, Marta L.; Sosa, Horacio A.; Davis, Teresa A.

    2017-01-01

    Skeletal muscle mass is determined by the balance between rates of protein synthesis and degradation. Protein synthesis rates can be measured in vivo by administering an amino acid as a tracer that is labeled with an isotope (radioactive or stable) of C, H, or N. The rate at which the labeled amino acid is incorporated into muscle protein, as a function of the amount of labeled amino acid in the precursor pool at the site of translation, reflects the rate of protein synthesis. There are a number of approaches for performing this measurement depending on the question being addressed and the experimental system being studied. In this chapter, we describe the “flooding dose” approach using L-[3H]-phenylalanine as the tracer and that is suitable for determining the rate of skeletal muscle protein synthesis (total and myofibrillar proteins) over an acute period (ideally less than 30 min) in any size animal; details for working with mice are presented. The method describes how to administer the tracer without anesthesia, the tissue collection, and the preparation of muscle and blood samples for analysis of the tracer and tracee amino acids in the precursor pool and in muscle proteins. PMID:22130841

  9. Phospholipid synthesis rates in the eastern subtropical South Pacific Ocean

    NASA Astrophysics Data System (ADS)

    van Mooy, B. A. S.; Moutin, T.; Duhamel, S.; Rimmelin, P.; van Wambeke, F.

    2008-02-01

    Membrane lipid molecules are a major component of planktonic organisms and this is particularly true of the microbial picoplankton that dominate the open ocean; with their high surface-area to volume ratios, the synthesis of membrane lipids places a major demand on their overall cell metabolism. Specifically, the synthesis of cell membrane phospholipids creates a demand for the nutrient phosphorus, and we sought to refine our understanding of the role of phospholipids in the upper ocean phosphorus cycle. We measured the rates of phospholipid synthesis in a transect of the eastern subtropical South Pacific from Easter Island to Concepcion, Chile as part of the BIOSOPE program. Our approach combined standard phosphorus radiotracer incubations and lipid extraction methods. We found that phospholipid synthesis rates varied from less than 1 to greater than 200 pmol P L-1 h-1, and that phospholipid synthesis contributed between less than 5% to greater than 22% of the total PO43- incorporation rate. Changes in the percentage that phospholipid synthesis contributed to total PO43- uptake were strongly correlated with the ratio of primary production to bacterial production, which supported our hypothesis that heterotrophic bacteria were the primary agents of phospholipid synthesis. The spatial variation in phospholipid synthesis rates underscored the importance of heterotrophic bacteria in the phosphorus cycle of the eastern subtropical South Pacific, particularly the hyperoligotrophic South Pacific subtropical gyre.

  10. Phospholipid synthesis rates in the eastern subtropical South Pacific Ocean

    NASA Astrophysics Data System (ADS)

    van Mooy, B. A. S.; Moutin, T.; Duhamel, S.; Rimmelin, P.; van Wambeke, F.

    2007-08-01

    Membrane lipid molecules are a major component of planktonic organisms and this is particularly true of the microbial picoplankton that dominate the open ocean; with their high surface-area to volume ratios, the synthesis of membrane lipids places a major demand on their overall cell metabolism. The synthesis of one class of membrane lipids, the phospholipids, also creates a demand for the nutrient phosphorus, and we sought to refine our understanding of the role of phospholipids in the upper ocean phosphorus cycle. We measured the rates of phospholipid synthesis in a transect of the eastern subtropical South Pacific from Easter Island to Concepcion, Chile as part of the BIOSOPE program. Our approach combined standard phosphorus radiotracer incubations and lipid extraction methods. We found that phospholipid synthesis rates varied from less than 1 to greater than 200 pmol P L-1 h-1, and that phospholipid synthesis contributed between less than 5% to greater than 22% of the total PO43- incorporation rate. Changes in the percentage that phospholipid synthesis contributed to total PO43- incorporation were strongly correlated with the ratio of primary production to bacterial production, which supported our hypothesis that heterotrophic bacteria were the primary agents of phospholipid synthesis. The spatial variation in phospholipid synthesis rates underscored the importance of heterotrophic bacteria in the phosphorus cycle of the eastern subtropical South Pacific, particularly the hyperoligotrophic South Pacific subtropical gyre.

  11. Protein Synthesis Rate Assessment by Fluorescence Recovery after Photobleaching (FRAP)

    PubMed Central

    Kourtis, Nikos; Tavernarakis, Nektarios

    2017-01-01

    Currently available biochemical methods cannot be applied to monitor protein synthesis in specific cells or tissues, in live specimens. Here, we describe a non-invasive method for monitoring protein synthesis in single cells or tissues with intrinsically different translation rates, in live Caenorhabditis elegans animals. PMID:28286807

  12. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  13. Chemoenzymatic synthesis of surfactants from carbohydrates, amino acids, and fatty acids.

    PubMed

    Bellahouel, S; Rolland, V; Roumestant, M L; Viallefont, P; Martinez, J

    2001-02-01

    The chemoenzymatic synthesis of new surfactants is reported; they were prepared from unprotected carbohydrates, amino acids, and fatty acids. This study pointed out the factors that govern the possibility to enzymatically bind the carbohydrate to the amino acid.

  14. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  15. The effect of elevated plasma phenylalanine levels on protein synthesis rates in adult rat brain.

    PubMed Central

    Dunlop, D S; Yang, X R; Lajtha, A

    1994-01-01

    Increasing the plasma phenylalanine concentration to levels as high as 0.560-0.870 mM (over ten times normal levels) had no detectable effect on the rate of brain protein synthesis in adult rats. The average rates for 7-week-old rats were: valine, 0.58 +/- 0.05%/h, phenylalanine, 0.59 +/- 0.06%/h, and tyrosine, 0.60 +/- 0.09%/h, or 0.59 +/- 0.06%/h overall. Synthesis rates calculated on the basis of the specific activity of the tRNA-bound amino acid were slightly lower (4% lower for phenylalanine) than those based on the brain free amino acid pool. Similarly, the specific activities of valine and phenylalanine in microdialysis fluid from striatum were practically the same as those in the brain free amino acid pool. Thus the specific activities of the valine and phenylalanine brain free pools are good measures of the precursor specific activity for protein synthesis. In any event, synthesis rates, whether based on the specific activities of the amino acids in the brain free pool or those bound to tRNA, were unaffected by elevated levels of plasma phenylalanine. Brain protein synthesis rates measured after the administration of quite large doses of phenylalanine (> 1.5 mumol/g) or valine (15 mumol/g) were in agreement (0.62 +/- 0.01 and 0.65 +/- 0.01%/h respectively) with the rates determined with infusions of trace amounts of amino acids. Thus the technique of stabilizing precursor-specific activity, and pushing values in the brain close to those of the plasma, by the administration of large quantities of precursor, appears to be valid. PMID:8093014

  16. Amino acids augment muscle protein synthesis in neonatal pigs during acute endotoxemia by stimulating mTOR-dependent translation initiation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...

  17. Cooperative Brønsted Acid-Type Organocatalysis for the Stereoselective Synthesis of Deoxyglycosides

    PubMed Central

    2016-01-01

    A practical approach for the α-stereoselective synthesis of deoxyglycosides using cooperative Brønsted acid-type organocatalysis has been developed. The method is tolerant of a wide range of glycoside donors and acceptors, and its versatility is exemplified in the one-pot synthesis of a trisaccharide. Mechanistic studies suggest that thiourea-induced acid amplification of the chiral acid via H-bonding is key for the enhancement in reaction rate and yield, while stereocontrol is dependent on the chirality of the acid. PMID:28004941

  18. Role of fatty-acid synthesis in dendritic cell generation and function.

    PubMed

    Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George

    2013-05-01

    Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.

  19. Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function

    PubMed Central

    Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George

    2013-01-01

    Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633

  20. Pyrazinoic acid decreases the proton motive force, respiratory ATP synthesis activity, and cellular ATP levels.

    PubMed

    Lu, Ping; Haagsma, Anna C; Pham, Hoang; Maaskant, Janneke J; Mol, Selena; Lill, Holger; Bald, Dirk

    2011-11-01

    Pyrazinoic acid, the active form of the first-line antituberculosis drug pyrazinamide, decreased the proton motive force and respiratory ATP synthesis rates in subcellular mycobacterial membrane assays. Pyrazinoic acid also significantly lowered cellular ATP levels in Mycobacterium bovis BCG. These results indicate that the predominant mechanism of killing by this drug may operate by depletion of cellular ATP reserves.

  1. Escherichia coli Unsaturated Fatty Acid Synthesis

    PubMed Central

    Feng, Youjun; Cronan, John E.

    2009-01-01

    Although the unsaturated fatty acid (UFA) synthetic pathway of Escherichia coli is the prototype of such pathways, several unresolved issues have accumulated over the years. The key players are the fabA and fabB genes. Earlier studies of fabA transcription showed that the gene was transcribed from two promoters, with one being positively regulated by the FadR protein. The other weaker promoter (which could not be mapped with the technology then available) was considered constitutive because its function was independent of FadR. However, the FabR negative regulator was recently shown to represses fabA transcription. We report that the weak promoter overlaps the FadR-dependent promoter and is regulated by FabR. This promoter is strictly conserved in all E. coli and Salmonella enterica genomes sequenced to date and is thought to provide insurance against inappropriate regulation of fabA transcription by exogenous saturated fatty acids. Also, the fabAup promoter, a mutant promoter previously isolated by selection for increased FabA activity, was shown to be a promoter created de novo by a four-base deletion within the gene located immediately upstream of fabA. Demonstration of the key UFA synthetic reaction catalyzed by FabB has been elusive, although it was known to catalyze an elongation reaction. Strains lacking FabB are UFA auxotrophs indicating that the enzyme catalyzes an essential step in UFA synthesis. Using thioesterases specific for hydrolysis of short chain acyl-ACPs, the intermediates of the UFA synthetic pathway have been followed in vivo for the first time. These experiments showed that a fabB mutant strain accumulated less cis-5-dodecenoic acid than the parental wild-type strain. These data indicate that the key reaction in UFA synthesis catalyzed by FabB is elongation of the cis-3-decenoyl-ACP produced by FabA. PMID:19679654

  2. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  3. Synthesis of Nucleic Acid and Protein in L Cells Infected with the Agent of Meningopneumonitis

    PubMed Central

    Schechter, Esther M.

    1966-01-01

    Schechter, Esther M. (The University of Chicago, Chicago, Ill.). Synthesis of nucleic acid and protein in L cells infected with the agent of meningopneumonitis. J. Bacteriol. 91:2069–2080. 1966.—Synthesis of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and protein in uninfected L cells and in L cells infected with the meningopneumonitis agent was compared by measuring rates of incorporation of H3-cytidine and C14-lysine into nuclear, cytoplasmic, and agent fractions in successive 5-hr periods during the meningopneumonitis growth cycle. Synthesis of meningopneumonitis DNA, RNA, and protein was first clearly evident in the labeling period 15 to 20 hr after infection, soon after initiation of agent multiplication. The rates of synthesis of agent DNA, RNA, and protein increased logarithmically for a brief period and then declined. However, rates of isotope incorporation into all three meningopneumonitis macromolecules were sustained at near maximal values throughout the remainder of the meningopneumonitis growth cycle. These data are most readily interpreted in terms of multiplication of the meningopneumonitis agent by binary fission. The L cell response to infection was a decreased rate of DNA and RNA synthesis and an accelerated rate of cell death. Host protein synthesis was unaffected. The inhibition of nucleic acid synthesis in infected L cells probably involved competition between host and parasite for nucleic acid precursors. Different sublines of L cells varied greatly in the degree to which their nucleic acid-synthesizing mechanisms were damaged by infection. The cytoplasm of infected L cells contained newly synthesized DNA and RNA that could not be accounted for as intact meningopneumonitis cells. This nucleic acid probably arose from disintegration of the fragile intracellular forms of the meningopneumonitis agent. Images PMID:5937251

  4. Synthesis of new kojic acid based unnatural α-amino acid derivatives.

    PubMed

    Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Devi, P Uma; Behera, Manoranjan

    2015-11-01

    An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond.

  5. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  6. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  7. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-06-28

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise.

  8. Role of malic enzyme during fatty acid synthesis in the oleaginous fungus Mortierella alpina.

    PubMed

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2014-05-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi.

  9. High-deposition-rate ceramics synthesis

    SciTech Connect

    Allendorf, M.D.; Osterheld, T.H.; Outka, D.A.

    1995-05-01

    Parallel experimental and computational investigations are conducted in this project to develop validated numerical models of ceramic synthesis processes. Experiments are conducted in the High-Temperature Materials Synthesis Laboratory in Sandia`s Combustion Research Facility. A high-temperature flow reactor that can accommodate small preforms (1-3 cm diameter) generates conditions under which deposition can be observed, with flexibility to vary both deposition temperature (up to 1500 K) and pressure (as low as 10 torr). Both mass spectrometric and laser diagnostic probes are available to provide measurements of gas-phase compositions. Experiments using surface analytical techniques are also applied to characterize important processes occuring on the deposit surface. Computational tools developed through extensive research in the combustion field are employed to simulate the chemically reacting flows present in typical industrial reactors. These include the CHEMKIN and Surface-CHEMKIN suites of codes, which permit facile development of complex reaction mechanisms and vastly simplify the implementation of multi-component transport and thermodynamics. Quantum chemistry codes are also used to estimate thermodynamic and kinetic data for species and reactions for which this information is unavailable.

  10. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  11. Exogenous amino acids stimulate net muscle protein synthesis in the elderly.

    PubMed Central

    Volpi, E; Ferrando, A A; Yeckel, C W; Tipton, K D; Wolfe, R R

    1998-01-01

    We have investigated the response of amino acid transport and protein synthesis in healthy elderly individuals (age 71+/-2 yr) to the stimulatory effect of increased amino acid availability. Muscle protein synthesis and breakdown, and amino acid transport were measured in the postabsorptive state and during the intravenous infusion of an amino acid mixture. Muscle-free amino acid kinetics were calculated by means of a three compartment model using data obtained by femoral arterio-venous catheterization and muscle biopsies from the vastus lateralis during the infusion of stable isotope tracers of amino acids. In addition, muscle protein fractional synthetic rate (FSR) was measured. Peripheral amino acid infusion significantly increased amino acid delivery to the leg, amino acid transport, and muscle protein synthesis when measured either with the three compartment model (P < 0.05) or with the traditional precursor-product approach (FSR increased from 0. 0474+/-0.0054 to 0.0940+/-0.0143%/h, P < 0.05). Because protein breakdown did not change during amino acid infusion, a positive net balance of amino acids across the muscle was achieved. We conclude that, although muscle mass is decreased in the elderly, muscle protein anabolism can nonetheless be stimulated by increased amino acid availability. We thus hypothesize that muscle mass could be better maintained with an increased intake of protein or amino acids. PMID:9576765

  12. Motualevic Acids and Analogs: Synthesis and Antimicrobial Structure Activity Relationships

    PubMed Central

    Cheruku, Pradeep; Keffer, Jessica L.; Dogo-Isonagie, Cajetan; Bewley, Carole A.

    2010-01-01

    Synthesis of the marine natural products motualevic acids A, E, and analogs in which modifications have been made to the ω-brominated lipid (E)-14,14-dibromotetra-deca-2,13-dienoic acid or amino acid unit are reported, together with antimicrobial activities against Staphylococcus aureus, methicillin-resistant S. aureus, Enterococcus faecium, and vancomycin-resistant Enterococcus. PMID:20538459

  13. Protein synthesis rates in atrophied gastrocnemius muscles after limb immobilization

    NASA Technical Reports Server (NTRS)

    Tucker, K. R.; Seider, M. J.; Booth, F. W.

    1981-01-01

    Noting that protein synthesis declines in the gastrocnemius 6 hr after immobilization, the study sought to detect an increase of protein synthesis when the limb was freed, and to examine the effects of exercise on the rate of increase. Rats were used as subjects, with their hind legs in plaster of Paris in plantar flexion to eliminate strain on the gastrocnemius. Periods of immobilization were varied and samples of blood from the muscle were taken to track protein synthesis rates for different groups in immobilization and exercise regimens (running and weightlifting). Synthesis rates declined 3.6% during time in the cast, then increased 6.3%/day after the casts were removed. Both running and weightlifting were found to increase the fractional rate of protein formation in the gastrocnemius muscle when compared with contralateral muscles that were not exercised and were used as controls, suggesting that the mechanism controlling protein synthesis in skeletal muscles is rapidly responsive to changes in muscular contractile activity.

  14. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  15. Derivatives of diphosphonic acids: synthesis and biological activity

    NASA Astrophysics Data System (ADS)

    Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.

    1993-07-01

    The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.

  16. Transaminases for the synthesis of enantiopure beta-amino acids

    PubMed Central

    2012-01-01

    Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122

  17. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  18. Inadequacy of prebiotic synthesis as origin of proteinous amino acids.

    PubMed

    Wong, J T; Bronskill, P M

    1979-07-18

    The production of some nonproteinous, and lack of production of other proteinous, amino acids in model prebiotic synthesis, along with the instability of glutamine and asparagine, suggest that not all of the 20 present day proteinous amino acids gained entry into proteins directly from the primordial soup. Instead, a process of active co-evolution of the genetic code and its constituent amino acids would have to precede the final selection of these proteinous amono acids.

  19. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  20. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    SciTech Connect

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

    1989-04-01

    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  1. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  2. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  3. Stimulation of Ribonucleic Acid Synthesis by Chloramphenicol in a rel+ Aminoacyl-Transfer Ribonucleic Acid Synthetase Mutant of Escherichia coli

    PubMed Central

    Yegian, Charles D.; Vanderslice, Rebecca W.

    1971-01-01

    Escherichia coli strain 9D3 possesses a highly temperature-sensitive valyl-transfer ribonucleic acid (tRNA) synthetase (EC 6.1.1.9). Since 9D3 is a rel+ strain, it cannot carry out net RNA synthesis at high temperature. A 100-μg amount of chloramphenicol (CAP) per ml added in the absence of valine cannot stimulate RNA synthesis. Either 300 μg of CAP or 100 μg of CAP plus 50 μg of valine per ml, however, promotes nearly maximal RNA synthesis. These results can be understood as follows. (i) Valyl-tRNA is required for net RNA synthesis, (ii) the synthetase lesion is incomplete, (iii) the rate of mutant acylation of tRNAval at high temperature is valine-dependent, and (iv) the CAP concentration determines the rate of residual protein synthesis. Data are also presented which demonstrate that the rate of net RNA synthesis can greatly increase long after the addition of CAP, if the amount of valyl-tRNA increases. PMID:4942766

  4. Resistance of lung fatty acid synthesis to inhibition by dietary fat in the meal-fed rat.

    PubMed

    Clarke, S D; Wilson, M D; Ibnoughazala, T

    1984-03-01

    One-half of the palmitate utilized by the lung for production of the surfactant phospholipid, dipalmitoyl phosphatidylcholine, originates from de novo palmitate synthesis in the lung. In this report the lung was examined for the influence of dietary fat on the lung de novo fatty acid synthesis pathway. Lung lipogenesis was reduced by fasting and accelerated by carbohydrate refeeding or insulin injection. However, in general lung fatty acid synthesis was unaffected by dietary fat. Supplementing one meal (high glucose diet) with as much as 36% additional fat kilocalories did not suppress lung fatty acid synthesis. An inhibition of fatty acid synthesis resulted from a fat supplement of +60 and +120% of meal kilocalories, but this inhibition was likely due to an attenuated rate of glucose absorption. Ingestion of a high carbohydrate diet supplemented with 10, 17, or 30% added kilocalories as safflower oil or palmitate had no effect on lipogenesis after 10 days. On the other hand, liver fatty acid synthesis and acetyl-CoA carboxylase were selectively suppressed by safflower oil, whereas dietary palmitate was ineffective as an inhibitor of lipogenesis. These data clearly demonstrate that the well-characterized preferential suppression of liver lipogenesis by dietary polyunsaturated fats does not extend to lung tissue, and, more importantly, the inhibition of liver lipogenesis is not secondary to an essential fatty acid deficiency. The marked resistance of lung fatty acid synthesis to inhibition by dietary fat might be a biological protective mechanism to ensure adequate palmitate for dipalmitoyl phosphatidylcholine synthesis.

  5. Ribonucleic acid synthesis in yeast. The effect of cycloheximide on the synthesis of ribonucleic acid in Saccharomyces carlsbergensis

    PubMed Central

    de Kloet, S. R.

    1966-01-01

    1. Cycloheximide causes the release of the control amino acids have over RNA synthesis in Saccharomyces carlsbergensis N.C.T.C. 74. 2. The antibiotic causes a gradual deceleration of RNA formation. After incubation for 60min. at 30° RNA synthesis usually proceeds at a rate only a few per cent of that of the untreated control. 3. In the presence of cycloheximide two types of RNA accumulate in the cell: soluble RNA and a high-molecular-weight RNA. The latter has a base composition intermediate between those of yeast DNA and yeast ribosomal RNA, and sediments in a sucrose gradient at a rate faster than that of the 23s ribosomal RNA component. 4. Yeast ribosomal RNA contains methylated bases. Judged from the incorporation of [Me-14C]methionine, the extent of methylation of ribosomal RNA is about 20% of that of the `soluble' RNA fraction. The high-molecular-weight RNA formed in the presence of cycloheximide is less methylated than normal RNA. In this case the sucrose-density-gradient sedimentation patterns of newly methylated and newly synthesized RNA do not coincide. 5. In the presence of cycloheximide, polysomal material accumulates, indicating that messenger RNA is formed. 6. The effect of the antibiotic on protein and RNA synthesis can be abolished by washing of the cells. The RNA that has accumulated during incubation of the cells with the antibiotic is not stable on removal of cycloheximide. 7. The results presented in this study are discussed in relation to the regulation of RNA formation in yeast. PMID:5964958

  6. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  7. The enxymatic synthesis and characterization of disolketal iminodiacetic acid (DSIDA)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Esterifications between iminodiacetic acid and its methyl and ethyl derivatives with glycerol or solketal have been studied. The synthesis of IDA with solketal was unsuccessful under experimental conditions of 70 degrees C and 200 torr for 24h. However, using dimethyl iminodiacetic acid with solke...

  8. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  9. Calcite crystal growth rate inhibition by polycarboxylic acids

    USGS Publications Warehouse

    Reddy, M.M.; Hoch, A.R.

    2001-01-01

    Calcite crystal growth rates measured in the presence of several polycarboxyclic acids show that tetrahydrofurantetracarboxylic acid (THFTCA) and cyclopentanetetracarboxylic acid (CPTCA) are effective growth rate inhibitors at low solution concentrations (0.01 to 1 mg/L). In contrast, linear polycarbocylic acids (citric acid and tricarballylic acid) had no inhibiting effect on calcite growth rates at concentrations up to 10 mg/L. Calcite crystal growth rate inhibition by cyclic polycarboxyclic acids appears to involve blockage of crystal growth sites on the mineral surface by several carboxylate groups. Growth morphology varied for growth in the absence and in the presence of both THFTCA and CPTCA. More effective growth rate reduction by CPTCA relative to THFTCA suggests that inhibitor carboxylate stereochemical orientation controls calcite surface interaction with carboxylate inhibitors. ?? 20O1 Academic Press.

  10. Phosphoric Acid-Mediated Synthesis of Vinyl Sulfones through Decarboxylative Coupling Reactions of Sodium Sulfinates with Phenylpropiolic Acids.

    PubMed

    Rong, Guangwei; Mao, Jincheng; Yan, Hong; Zheng, Yang; Zhang, Guoqi

    2015-08-07

    A novel phosphoric acid -mediated synthesis of vinyl sulfones through decarboxylative coupling reactions of sodium sulfinates with phenylpropiolic acids is described. This transformation is efficient and environmentally friendly.

  11. Fractional synthesis rates of DNA and protein in rabbit skin are not correlated.

    PubMed

    Zhang, Xiao-jun; Chinkes, David L; Wu, Zhanpin; Martini, Wenjun Z; Wolfe, Robert R

    2004-09-01

    We developed a method for measurement of skin DNA synthesis, reflecting cell division, in conscious rabbits by infusing D-[U-(13)C(6)]glucose and L-[(15)N]glycine. Cutaneous protein synthesis was simultaneously measured by infusion of L-[ring-(2)H(5)]phenylalanine. Rabbits were fitted with jugular venous and carotid arterial catheters, and were studied during the infusion of an amino acid solution (10% Travasol). The fractional synthetic rate (FSR) of DNA from the de novo nucleotide synthesis pathway, a reflection of total cell division, was 3.26 +/- 0.59%/d in whole skin and 3.08 +/- 1.86%/d in dermis (P = 0.38). The de novo base synthesis pathway accounted for 76 and 60% of the total DNA FSR in whole skin and dermis, respectively; the contribution from the base salvage pathway was 24% in whole skin and 40% in dermis. The FSR of protein in whole skin was 5.35 +/- 4.42%/d, which was greater (P < 0.05) than that in dermis (2.91 +/- 2.52%/d). The FSRs of DNA and protein were not correlated (P = 0.33), indicating that cell division and protein synthesis are likely regulated by different mechanisms. This new approach enables investigations of metabolic disorders of skin diseases and regulation of skin wound healing by distinguishing the 2 principal components of skin metabolism, which are cell division and protein synthesis.

  12. Aromatic amino acids are utilized and protein synthesis is stimulated during amino acid infusion in the ovine fetus.

    PubMed

    Liechty, E A; Boyle, D W; Moorehead, H; Auble, L; Denne, S C

    1999-06-01

    The purpose of this study was to determine whether the ovine fetus is capable of increased disposal of an amino acid load; if so, would it respond by increased protein synthesis, amino acid catabolism or both? A further purpose of the study was to determine whether the pathways of aromatic amino acid catabolism are functional in the fetus. Late gestation ovine fetuses of well-nourished ewes received an infusion of Aminosyn PF alone (APF), and Aminosyn PF + glycyl-L-tyrosine (APF+GT) at rates estimated to double the intake of these amino acids. The initial study, using APF, was performed at 126 +/- 1.4 d; the APF+GT study was performed at 132 +/- 1.7 d (term = 150 d). Phenylalanine and tyrosine kinetics were determined using both stable and radioactive isotopes. Plasma concentrations of most amino acids, but not tyrosine, increased during both studies; tyrosine concentration increased only during the APF+GT study. Phenylalanine rate of appearance and phenylalanine hydroxylation increased during both studies. Tyrosine rate of appearance increased only during the APF+GT study; tyrosine oxidation did not increase during either study. Fetal protein synthesis increased significantly during both studies, producing a significant increase in fetal protein accretion. Fetal proteolysis was unchanged in response to either amino acid infusion. These results indicate that the fetus responds to an acute increase in amino acid supply primarily by increasing protein synthesis and accretion, with a smaller but significant increase in amino acid catabolism also. Both phenylalanine hydroxylation and tyrosine oxidation are active in the fetus, and the fetus is able to increase phenylalanine hydroxylation rapidly in response to increased supply.

  13. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  14. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  15. Total Synthesis of (±)- and (−)-Actinophyllic Acid

    PubMed Central

    Martin, Connor L.; Overman, Larry E.; Rohde, Jason M.

    2010-01-01

    Development of efficient sequences for the total syntheses of (±)-actinophyllic acid (rac-1) and (−)-actinophyllic acid (1) are described. The central step in these syntheses is the aza-Cope/Mannich reaction, which constructs the previously unknown hexacyclic ring system of actinophyllic acid in one step from much simpler tetracyclic precursors. The tetracyclic hexahydro-1,5-methano-1H-azocino[4,3-b]indole ketone rac-37 is assembled from o-nitrophenylacetic acid in four steps, with oxidative cyclization of a dienolate derivative of tricyclic precursor rac-35 being the central step. In the first-generation synthesis, this intermediate is transformed in two steps to homoallyl amine rac-43, whose formaldiminium derivative undergoes efficient aza-Cope/Mannich reaction to give pentacyclic ketone rac-44. In four additional steps, this intermediate is advanced to (±)-actinophyllic acid. The synthesis is streamlined by elaborating ketone rac-37 to β-hydroxyester intermediate rac-53, which is directly transformed to (±)-actinophyllic acid upon exposure to HCl and paraformaldehyde. This concise second-generation total synthesis of (±)-actinophyllic acid is realized in 22% overall yield from commercially available di-tert-butylmalonate and o-nitrophenylacetic acid by a sequence that proceeds by way of only six isolated intermediates. The first enantioselective total synthesis of (−)-actinophyllic acid (1) is accomplished by this direct sequence from tricyclic keto malonate (S)-35. Catalytic enantioselective reduction of α,β-unsaturated ketone 66 is the key step in the preparation of intermediate (S)-35 from the commercially available Boc-amino acid 65. Discussed also is the possibility that the aza-Cope/Mannich reaction might be involved in the biosynthesis of (−)-actinophyllic acid. PMID:20218696

  16. Physiological effects of γ-linolenic acid and sesamin on hepatic fatty acid synthesis and oxidation.

    PubMed

    Ide, Takashi; Iwase, Haruka; Amano, Saaya; Sunahara, Saki; Tachihara, Ayuka; Yagi, Minako; Watanabe, Tsuyoshi

    2017-03-01

    Interrelated effects of γ-linolenic acid (GLA) and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin) and containing 100 g/kg of palm oil (saturated fat), safflower oil rich in linoleic acid, or oil of evening primrose origin containing 43% GLA (GLA oil) for 18 days. In rats fed sesamin-free diets, GLA oil, compared with other oils, increased the activity and mRNA levels of various enzymes involved in fatty acid oxidation, except for some instances. Sesamin greatly increased these parameters, and the enhancing effects of sesamin on peroxisomal fatty acid oxidation rate and acyl-CoA oxidase, enoyl-CoA hydratase and acyl-CoA thioesterase activities were more exaggerated in rats fed GLA oil than in the animals fed other oils. The combination of sesamin and GLA oil also synergistically increased the mRNA levels of some peroxisomal fatty acid oxidation enzymes and of several enzymes involved in fatty acid metabolism located in other cell organelles. In the groups fed sesamin-free diets, GLA oil, compared with other oils, markedly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin reduced all these parameters, except for malic enzyme, in rats fed palm and safflower oils, but the effects were attenuated in the animals fed GLA oil. These changes by sesamin and fat type accompanied profound alterations in serum lipid levels. This may be ascribable to the changes in apolipoprotein-B-containing lipoproteins.

  17. Induction of collagen synthesis by ascorbic acid. A possible mechanism.

    PubMed

    Pinnel, S R; Murad, S; Darr, D

    1987-12-01

    L-Ascorbic acid stimulates procollagen synthesis in cultured human skin fibroblasts without appreciably altering noncollagen protein synthesis. The effect is unrelated to intracellular degradation of newly synthesized procollagen. Levels of mRNA for pro alpha 1(I), pro alpha 2(I), and pro alpha 1(III), measured by hybridization with the corresponding cDNA probes, are elevated in the presence of ascorbic acid, whereas the level of mRNA for fibronectin is unchanged. Levels of functional mRNA for procollagen, measured in a cell-free translation assay, are specifically increased in the presence of ascorbic acid. Thus, ascorbic acid appears to control the expression of three different procollagen genes, each of which is located on a separate chromosome. It is proposed that intracellularly accumulated procollagen in ascorbate deficiency may lead to a translational repression of procollagen synthesis. Ascorbic acid may relieve this block by promoting hydroxyproline formation and, consequently, secretion of procollagen from the cell. The increased level of procollagen mRNA under the influence of ascorbic acid may be secondary to increased synthesis of procollagen polypeptides; the control point may be gene transcription or mRNA degradation.

  18. Pyrophosphate-condensing activity linked to nucleic acid synthesis.

    PubMed Central

    Volloch, V Z; Rits, S; Tumerman, L

    1979-01-01

    In some preparations of DNA dependent RNA polymerase a new enzymatic activity has been found which catalyzes the condensation of two pyrophosphate molecules, liberated in the process of RNA synthesis, to one molecule of orthophosphate and one molecule of Mg (or Mn) - chelate complex with trimetaphosphate. This activity can also cooperate with DNA-polymerase, on condition that both enzymes originate from the same cells. These results point to two general conclusions. First, energy is conserved in the overall process of nucleic acid synthesis and turnover, so that the process does not require an energy influx from the cell's general resources. Second, the synthesis of nucleic acids is catalyzed by a complex enzyme system which contains at least two separate enzymes, one responsible for nucleic acid polymerization and the other for energy conservation via pyrophosphate condensation. Images PMID:88040

  19. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  20. The control of ribonucleic acid synthesis in bacteria. The synthesis and stability of ribonucleic acids in relaxed and stringent amino acid auxotrophs of Escherichia coli.

    PubMed

    Gray, W J; Midgley, J E

    1972-08-01

    The biosynthesis and stability of various RNA fractions was studied in RC(str) and RC(rel) multiple amino acid auxotrophs of Escherichia coli. In conditions of amino acid deprivation, RC(str) mutants were labelled with exogenous nucleotide bases at less than 1% of the rate found in cultures growing normally in supplemented media. Studies by DNA-RNA hybridization and by other methods showed that, during a period of amino acid withdrawal, not more than 60-70% of the labelled RNA formed in RC(str) mutants had the characteristics of mRNA. Evidence was obtained for some degradation of newly formed 16S and 23S rRNA species to heterogeneous material of lower molecular weight. This led to overestimations of the mRNA content of rapidly labelled RNA from such methods as simple examination of sucrose-density-gradient profiles. In RC(rel) strains the absolute and relative rates of synthesis of the various RNA fractions were not greatly affected. However, the stability of about half of the mRNA fraction was increased in RC(rel) strains during amino acid starvation, giving kinetics of mRNA labelling and turnover that were identical with those found in either RC(str) or RC(rel) strains inhibited by high concentrations of chloramphenicol. Coincidence hybridization techniques showed that the mRNA content of amino acid-starved RC(str) auxotrophs was unchanged from that found in normally growing cells. In contrast, RC(rel) strains deprived of amino acids increased their mRNA content about threefold. In such cultures the mRNA content of accumulating newly formed RNA was a constant 16% by wt.

  1. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  2. Loss of Nuclear Receptor SHP Impairs but Does Not Eliminate Negative Feedback Regulation of Bile Acid Synthesis

    PubMed Central

    Kerr, Thomas A.; Saeki, Shigeru; Schneider, Manfred; Schaefer, Karen; Berdy, Sara; Redder, Thadd; Shan, Bei; Russell, David W.; Schwarz, Margrit

    2014-01-01

    Summary The in vivo role of the nuclear receptor SHP in feedback regulation of bile acid synthesis was examined. Loss of SHP in mice caused abnormal accumulation and increased synthesis of bile acids due to derepression of rate-limiting CYP7A1 and CYP8B1 hydroxylase enzymes in the biosynthetic pathway. Dietary bile acids induced liver damage and restored feedback regulation. A synthetic agonist of the nuclear receptor FXR was not hepatotoxic and had no regulatory effects. Reduction of the bile acid pool with cholestyramine enhanced CYP7A1 and CYP8B1 expression. We conclude that input from three negative regulatory pathways controls bile acid synthesis. One is mediated by SHP, and two are SHP independent and invoked by liver damage and changes in bile acid pool size. PMID:12062084

  3. Hypophosphatemia promotes lower rates of muscle ATP synthesis

    PubMed Central

    Pesta, Dominik H.; Tsirigotis, Dimitrios N.; Befroy, Douglas E.; Caballero, Daniel; Jurczak, Michael J.; Rahimi, Yasmeen; Cline, Gary W.; Dufour, Sylvie; Birkenfeld, Andreas L.; Rothman, Douglas L.; Carpenter, Thomas O.; Insogna, Karl; Petersen, Kitt Falk; Bergwitz, Clemens; Shulman, Gerald I.

    2016-01-01

    Hypophosphatemia can lead to muscle weakness and respiratory and heart failure, but the mechanism is unknown. To address this question, we noninvasively assessed rates of muscle ATP synthesis in hypophosphatemic mice by using in vivo saturation transfer [31P]-magnetic resonance spectroscopy. By using this approach, we found that basal and insulin-stimulated rates of muscle ATP synthetic flux (VATP) and plasma inorganic phosphate (Pi) were reduced by 50% in mice with diet-induced hypophosphatemia as well as in sodium-dependent Pi transporter solute carrier family 34, member 1 (NaPi2a)-knockout (NaPi2a−/−) mice compared with their wild-type littermate controls. Rates of VATP normalized in both hypophosphatemic groups after restoring plasma Pi concentrations. Furthermore, VATP was directly related to cellular and mitochondrial Pi uptake in L6 and RC13 rodent myocytes and isolated muscle mitochondria. Similar findings were observed in a patient with chronic hypophosphatemia as a result of a mutation in SLC34A3 who had a 50% reduction in both serum Pi content and muscle VATP. After oral Pi repletion and normalization of serum Pi levels, muscle VATP completely normalized in the patient. Taken together, these data support the hypothesis that decreased muscle ATP synthesis, in part, may be caused by low blood Pi concentrations, which may explain some aspects of muscle weakness observed in patients with hypophosphatemia.—Pesta, D. H., Tsirigotis, D. N., Befroy, D. E., Caballero, D., Jurczak, M. J., Rahimi, Y., Cline, G. W., Dufour, S., Birkenfeld, A. L., Rothman, D. L., Carpenter, T. O., Insogna, K., Petersen, K. F., Bergwitz, C., Shulman, G. I. Hypophosphatemia promotes lower rates of muscle ATP synthesis. PMID:27338702

  4. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  5. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  6. Effects of pyrazinamide on fatty acid synthesis by whole mycobacterial cells and purified fatty acid synthase I.

    PubMed

    Boshoff, Helena I; Mizrahi, Valerie; Barry, Clifton E

    2002-04-01

    The effects of low extracellular pH and intracellular accumulation of weak organic acids were compared with respect to fatty acid synthesis by whole cells of Mycobacterium tuberculosis and Mycobacterium smegmatis. The profile of fatty acids synthesized during exposure to benzoic, nicotinic, or pyrazinoic acids, as well as that observed during intracellular hydrolysis of the corresponding amides, was not a direct consequence of modulation of fatty acid synthesis by these compounds but reflected the response to inorganic acid stress. Analysis of fatty acid synthesis in crude mycobacterial cell extracts demonstrated that pyrazinoic acid failed to directly modulate the fatty acid synthase activity catalyzed by fatty acid synthase I (FAS-I). However, fatty acid synthesis was irreversibly inhibited by 5-chloro-pyrazinamide in a time-dependent fashion. Moreover, we demonstrate that pyrazinoic acid does not inhibit purified mycobacterial FAS-I, suggesting that this enzyme is not the immediate target of pyrazinamide.

  7. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  8. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  9. Indole-3-acetic Acid Synthesis in Tumorous and Nontumorous Species of Nicotiana 1

    PubMed Central

    Liu, Shih-Tung; Katz, Charles D.; Knight, C. Arthur

    1978-01-01

    The synthesis of indole-3-acetic acid (IAA) in the enzyme extracts of Nicotiana glauca, Nicotiana langsdorffii, their F1 hybrid, their amphidiploid hybrid, and the nontumorous mutant of the hybrid was investigated. Tryptamine, a possible precursor of IAA biosynthesis in Nicotiana tabacum, was not found in the callus tissue of N. glauca, N. langsdorffii, and their F1 hybrid. In petiole slices, the synthesis of IAA progressively increased during 5 hours of incubation in [14C]tryptophan. The rate of synthesis was about equal in the hybrid and N. langsdorffii but lower in N. glauca on either a cell or fresh weight basis. It was also found that tryptophan was about 25 times more efficient than tryptamine in promoting synthesis of IAA in petiole slices. It was found that indoleacetaldehyde oxidase, indoleacetaldehyde reductase, and tryptophan aminotransferase activities were present in all of the species examined; however, tryptophan decarboxylase activity was not found. The tryptophan aminotransferase activity in N. glauca, N. langsdorffii, and the nontumorous mutant required α-ketoglutaric acid and pyridoxal 5-phosphate whereas the addition of pyridoxal 5-phosphate seemed not to increase the enzyme activity in tumor plants. The tryptophan aminotransferase in the amphidiploid hybrid was partially purified by acetone precipitation. The enzyme activity had a temperature optimum at 49 C and a pH optimum at 8.9. It is suggested that there is an indolepyruvic acid pathway in the synthesis of IAA in the Nicotiana species examined. PMID:16660376

  10. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  11. Orthogonal Synthesis of Xeno Nucleic Acids.

    PubMed

    Fiers, Guillaume; Chouikhi, Dalila; Oswald, Laurence; Al Ouahabi, Abdelaziz; Chan-Seng, Delphine; Charles, Laurence; Lutz, Jean-François

    2016-12-12

    Sequence-defined peptide triazole nucleic acids (PTzNA) were synthesized by means of a solid-phase orthogonal "AB+CD" iterative strategy. In this approach, AB and CD building blocks containing carboxylic acid (A), azide (B), alkyne (C), and primary amine (D) functions are assembled together by successive copper-catalyzed azide-alkyne cycloaddition (CuAAC) and acid-amine coupling steps. Different PTzNA genetic sequences were prepared using a library of eight building blocks (i.e., four AB and four CD building blocks).

  12. Protein and Ribonucleic Acid Synthesis During the Diploid Life Cycle of Allomyces arbuscula

    PubMed Central

    Burke, Daniel J.; Seale, Thomas W.; McCarthy, Brian J.

    1972-01-01

    The diploid life cycle of Allomyces arbuscula may be divided into four parts: spore induction, germination, vegetative growth, and mitosporangium formation. Spore induction, germination, and mitosporangium formation are insensitive to inhibition of actinomycin D, probably indicating that stable, pre-existing messenger ribonucleic acid (RNA) is responsible for these developmental events. Protein synthesis is necessary during the entire life cycle except for cyst formation. A system for obtaining synchronous germination of mitospores is described. During germination there is a characteristic increase in the rate of synthesis of RNA and protein although none of the other morphogenetic changes occurring during the life cycle are necessarily accompanied by an appreciable change in the rate of macromolecular synthesis. PMID:4113121

  13. Amino acid synthesis in a supercritical carbon dioxide - water system.

    PubMed

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-06-15

    Mars is a CO(2)-abundant planet, whereas early Earth is thought to be also CO(2)-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO(2)/liquid H(2)O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life's origin.

  14. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  15. [Possible route for thiamine participation in fatty acid synthesis].

    PubMed

    Buko, V U; Larin, F S

    1976-01-01

    The possibility of thiamine partaking in the synthesis of fatty acids through the functions unrelated to the catalytic properties of thiamine-diphosphate was studied. Rats kept on a fat-free ration devoid of thiamine were given thiamine of thiochrome with no vitaminic properties. The total fatty acids content in different tissues and incorporation therein of tagged acetate and pyruvate was determined, while the fatty acids composition of the liver was investigated by using gas chromatography. Thiamine and thiochrome produced a similar effect on a number of the study factors, i.e. they forced down the total acids level in the spleen, intensified incorporation of tagged acetate and pyruvate in fatty acids of the heart and uniformly changed the fatty acids composition in the liver. It is suggested that the unindirectional effects of thiamine and thiochrome is due to the oxidative transformation of thiamine into thiochrome.

  16. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  17. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  18. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  19. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  20. Heart Rate Response and Lactic Acid Concentration in Squash Players.

    ERIC Educational Resources Information Center

    Beaudin, Paula; And Others

    1978-01-01

    It was concluded that playing squash is an activity that results in heart rate responses of sufficient intensity to elicit aerobic training effects without producing high lactic acid concentration in the blood. (MM)

  1. ESTIMATION OF CARBOXYLIC ACID ESTER HYDROLYSIS RATE CONSTANTS

    EPA Science Inventory

    SPARC chemical reactivity models were extended to calculate hydrolysis rate constants for carboxylic acid esters from molecular structure. The energy differences between the initial state and the transition state for a molecule of interest are factored into internal and external...

  2. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  3. Choroidal retinoic acid synthesis: a possible mediator between refractive error and compensatory eye growth.

    PubMed

    Mertz, J R; Wallman, J

    2000-04-01

    Research over the past two decades has shown that the growth of young eyes is guided by vision. If near- or far-sightedness is artificially imposed by spectacle lenses, eyes of primates and chicks compensate by changing their rate of elongation, thereby growing back to the pre-lens optical condition. Little is known about what chemical signals might mediate between visual effects on the retina and alterations of eye growth. We present five findings that point to choroidal retinoic acid possibly being such a mediator. First, the chick choroid can convert retinol into all-trans-retinoic acid at the rate of 11 +/- 3 pmoles mg protein(-1) hr(-1), compared to 1.3 +/- 0.3 for retina/RPE and no conversion for sclera. Second, those visual conditions that cause increased rates of ocular elongation (diffusers or negative lens wear) produce a sharp decrease in all-trans-retinoic acid synthesis to levels barely detectable with our assay. In contrast, visual conditions which result in decreased rates of ocular elongation (recovery from diffusers or positive lens wear) produce a four- to five-fold increase in the formation of all-trans-retinoic acid. Third, the choroidal retinoic acid is found bound to a 28-32 kD protein. Fourth, a large fraction of the choroidal retinoic acid synthesized in culture is found in a nucleus-enriched fraction of sclera. Finally, application of retinoic acid to cultured sclera at physiological concentrations produced an inhibition of proteoglycan production (as assessed by measuring sulfate incorporation) with a EC50 of 8 x 10(-7) M. These results show that the synthesis of choroidal retinoic acid is modulated by those visual manipulations that influence ocular elongation and that this retinoic acid may reach the sclera in concentrations adequate to modulate scleral proteoglycan formation.

  4. Synthesis and in vitro Evaluation of Polymeric Prodrug of Ibuprofen with Amino Acid Spacer.

    PubMed

    Redasani, Vivekkumar K; Bari, Sanjay B

    2015-01-01

    The present work is an agreement with simple and efficient method of improving the therapeutic efficacy of ibuprofen by masking its acidic moiety. It aims to reduce gastrointestinal side effects by controlling the rate, duration and site of release. This is achieved by synthesis and evaluation of polymeric prodrug of ibuprofen with natural polymer sodium alginate. The synthesis was supported by N-protected serine as spacer due to chemical incompatibility of drug and polymer. Synthesized prodrug was characterized for confirmation of said structures. The in-vitro dissolution profile of ibuprofen-alginate prodrug showed that the release of the drug is significantly higher in case of pH 7.2 buffer as compared to ibuprofen, which might be due to ester group adjacent to drug get hydrolyzed. The hydrolysis was found to be with faster rate in alkaline media than that of in acidic media.

  5. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis

    PubMed Central

    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing

    2015-01-01

    N-Acetylneuraminic acid lyase (NAL, E.C. number 4.1.3.3) is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a “GRAS” (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  6. Insulin accelerates global and mitochondrial protein synthesis rates in neonatal muscle during sepsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In neonatal pigs, sepsis decreases protein synthesis in skeletal muscle by decreasing translation initiation. However, insulin stimulates muscle protein synthesis despite persistent repression of translation initiation signaling. To determine whether the insulin-induced increase in global rates of m...

  7. The Rate-limiting Enzyme in Phosphatidylcholine Synthesis Regulates Proliferation of the Nucleoplasmic ReticulumD⃞

    PubMed Central

    Lagace, Thomas A.; Ridgway, Neale D.

    2005-01-01

    The nucleus contains a network of tubular invaginations of the nuclear envelope (NE), termed the nucleoplasmic reticulum (NR), implicated in transport, gene expression, and calcium homeostasis. Here, we show that proliferation of the NR, measured by the frequency of NE invaginations and tubules, is regulated by CTP:phosphocholine cytidylyltransferase-α (CCTα), the nuclear and rate-limiting enzyme in the CDP–choline pathway for phosphatidylcholine (PtdCho) synthesis. In Chinese hamster ovary (CHO)-K1 cells, fatty acids triggered activation and translocation of CCTα onto intranuclear tubules characteristic of the NR. This was accompanied by a twofold increase in NR tubules quantified by immunostaining for lamin A/C or the NE. CHO MT58 cells expressing a temperature-sensitive CCTα allele displayed reduced PtdCho synthesis and CCTα expression and minimal proliferation of the NR in response to oleate compared with CHO MT58 cells stably expressing CCTα. Expression of CCTα mutants in CHO58 cells revealed that both enzyme activity and membrane binding promoted NR proliferation. In support of a direct role for membrane binding in NR tubule formation, recombinant CCTα caused the deformation of liposomes into tubules in vitro. This demonstrates that a key nuclear enzyme in PtdCho synthesis coordinates lipid synthesis and membrane deformation to promote formation of a dynamic nuclear-cytoplasmic interface. PMID:15635091

  8. Selective synthesis of thioethers in the presence of a transition-metal-free solid Lewis acid.

    PubMed

    Santoro, Federica; Mariani, Matteo; Zaccheria, Federica; Psaro, Rinaldo; Ravasio, Nicoletta

    2016-01-01

    The synthesis of thioethers starting from alcohols and thiols in the presence of amorphous solid acid catalysts is reported. A silica alumina catalyst with a very low content in alumina gave excellent results in terms of both activity and selectivity also under solvent-free conditions. The reaction rate follows the electron density of the carbinol atom in the substrate alcohol and yields up to 99% and can be obtained for a wide range of substrates under mild reaction conditions.

  9. Selective synthesis of thioethers in the presence of a transition-metal-free solid Lewis acid

    PubMed Central

    Santoro, Federica; Mariani, Matteo; Zaccheria, Federica; Psaro, Rinaldo

    2016-01-01

    The synthesis of thioethers starting from alcohols and thiols in the presence of amorphous solid acid catalysts is reported. A silica alumina catalyst with a very low content in alumina gave excellent results in terms of both activity and selectivity also under solvent-free conditions. The reaction rate follows the electron density of the carbinol atom in the substrate alcohol and yields up to 99% and can be obtained for a wide range of substrates under mild reaction conditions. PMID:28144333

  10. Synthesis of Phenolics and Flavonoids in Ginger (Zingiber officinale Roscoe) and Their Effects on Photosynthesis Rate

    PubMed Central

    Ghasemzadeh, Ali; Jaafar, Hawa Z. E.; Rahmat, Asmah

    2010-01-01

    The relationship between phenolics and flavonoids synthesis/accumulation and photosynthesis rate was investigated for two Malaysian ginger (Zingiber officinale) varieties grown under four levels of glasshouse light intensity, namely 310, 460, 630 and 790 μmol m−2s−1. High performance liquid chromatography (HPLC) was employed to identify and quantify the polyphenolic components. The results of HPLC analysis indicated that synthesis and partitioning of quercetin, rutin, catechin, epicatechin and naringenin were high in plants grown under 310 μmol m−2s−1. The average value of flavonoids synthesis in leaves for both varieties increased (Halia Bentong 26.1%; Halia Bara 19.5%) when light intensity decreased. Photosynthetic rate and plant biomass increased in both varieties with increasing light intensity. More specifically, a high photosynthesis rate (12.25 μmol CO2 m−2s−1 in Halia Bara) and plant biomass (79.47 g in Halia Bentong) were observed at 790 μmol m−2s−1. Furthermore, plants with the lowest rate of photosynthesis had highest flavonoids content. Previous studies have shown that quercetin inhibits and salicylic acid induces the electron transport rate in photosynthesis photosystems. In the current study, quercetin was an abundant flavonoid in both ginger varieties. Moreover, higher concentration of quercetin (1.12 mg/g dry weight) was found in Halia Bara leaves grown under 310 μmol m−2s−1 with a low photosynthesis rate. Furthermore, a high content of salicylic acid (0.673 mg/g dry weight) was detected in Halia Bara leaves exposed under 790 μmol m−2s−1 with a high photosynthesis rate. No salicylic acid was detected in gingers grown under 310 μmol m−2s−1. Ginger is a semi-shade loving plant that does not require high light intensity for photosynthesis. Different photosynthesis rates at different light intensities may be related to the absence or presence of some flavonoid and phenolic compounds. PMID:21151455

  11. Synthesis of phenolics and flavonoids in ginger (Zingiber officinale Roscoe) and their effects on photosynthesis rate.

    PubMed

    Ghasemzadeh, Ali; Jaafar, Hawa Z E; Rahmat, Asmah

    2010-11-15

    The relationship between phenolics and flavonoids synthesis/accumulation and photosynthesis rate was investigated for two Malaysian ginger (Zingiber officinale) varieties grown under four levels of glasshouse light intensity, namely 310, 460, 630 and 790 μmol m(-2)s(-1). High performance liquid chromatography (HPLC) was employed to identify and quantify the polyphenolic components. The results of HPLC analysis indicated that synthesis and partitioning of quercetin, rutin, catechin, epicatechin and naringenin were high in plants grown under 310 μmol m(-2)s(-1). The average value of flavonoids synthesis in leaves for both varieties increased (Halia Bentong 26.1%; Halia Bara 19.5%) when light intensity decreased. Photosynthetic rate and plant biomass increased in both varieties with increasing light intensity. More specifically, a high photosynthesis rate (12.25 μmol CO(2) m(-2)s(-1) in Halia Bara) and plant biomass (79.47 g in Halia Bentong) were observed at 790 μmol m(-2)s(-1). Furthermore, plants with the lowest rate of photosynthesis had highest flavonoids content. Previous studies have shown that quercetin inhibits and salicylic acid induces the electron transport rate in photosynthesis photosystems. In the current study, quercetin was an abundant flavonoid in both ginger varieties. Moreover, higher concentration of quercetin (1.12 mg/g dry weight) was found in Halia Bara leaves grown under 310 μmol m(-2)s(-1) with a low photosynthesis rate. Furthermore, a high content of salicylic acid (0.673 mg/g dry weight) was detected in Halia Bara leaves exposed under 790 μmol m(-2)s(-1) with a high photosynthesis rate. No salicylic acid was detected in gingers grown under 310 μmol m(-2)s(-1). Ginger is a semi-shade loving plant that does not require high light intensity for photosynthesis. Different photosynthesis rates at different light intensities may be related to the absence or presence of some flavonoid and phenolic compounds.

  12. Factors influencing the rate of non-enzymatic activation of carboxylic and amino acids by ATP

    NASA Technical Reports Server (NTRS)

    Mullins, D. W., Jr.; Lacey, J. C., Jr.

    1981-01-01

    The nonenzymatic formation of adenylate anhydrides of carboxylic and amino acids is discussed as a necessary step in the origin of the genetic code and protein biosynthesis. Results of studies are presented which have shown the rate of activation to depend on the pKa of the carboxyl group, the pH of the medium, temperature, the divalent metal ion catalyst, salt concentration, and the nature of the amino acid. In particular, it was found that of the various amino acids investigated, phenylalanine had the greatest affinity for the adenine derivatives adenosine and ATP. Results thus indicate that selective affinities between amino acids and nucleotides were important during prebiotic chemical evolution, and may have played a major role in the origin of protein synthesis and genetic coding.

  13. Arginine depletion by arginine deiminase does not affect whole protein metabolism or muscle fractional protein synthesis rate in mice.

    PubMed

    Marini, Juan C; Didelija, Inka Cajo

    2015-01-01

    Due to the absolute need for arginine that certain cancer cells have, arginine depletion is a therapy in clinical trials to treat several types of cancers. Arginine is an amino acids utilized not only as a precursor for other important molecules, but also for protein synthesis. Because arginine depletion can potentially exacerbate the progressive loss of body weight, and especially lean body mass, in cancer patients we determined the effect of arginine depletion by pegylated arginine deiminase (ADI-PEG 20) on whole body protein synthesis and fractional protein synthesis rate in multiple tissues of mice. ADI-PEG 20 successfully depleted circulating arginine (<1 μmol/L), and increased citrulline concentration more than tenfold. Body weight and body composition, however, were not affected by ADI-PEG 20. Despite the depletion of arginine, whole body protein synthesis and breakdown were maintained in the ADI-PEG 20 treated mice. The fractional protein synthesis rate of muscle was also not affected by arginine depletion. Most tissues (liver, kidney, spleen, heart, lungs, stomach, small and large intestine, pancreas) were able to maintain their fractional protein synthesis rate; however, the fractional protein synthesis rate of brain, thymus and testicles was reduced due to the ADI-PEG 20 treatment. Furthermore, these results were confirmed by the incorporation of ureido [14C]citrulline, which indicate the local conversion into arginine, into protein. In conclusion, the intracellular recycling pathway of citrulline is able to provide enough arginine to maintain protein synthesis rate and prevent the loss of lean body mass and body weight.

  14. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  15. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  16. Fixed metabolic costs for highly variable rates of protein synthesis in sea urchin embryos and larvae.

    PubMed

    Pace, Douglas A; Manahan, Donal T

    2006-01-01

    Defining the physiological mechanisms that set metabolic rates and the 'cost of living' is important for understanding the energy costs of development. Embryos and larvae of the sea urchin Lytechinus pictus (Verrill) were used to test hypotheses regarding differential costs of protein synthesis in animals differing in size, rates of protein synthesis, and physiological feeding states. For embryos, the rate of protein synthesis was 0.22+/-0.014 ng protein embryo(-1) h(-1) (mean +/- s.e.m.) and decreased in unfed larvae to an average rate of 0.05+/-0.001 ng protein larva(-1) h(-1). Fed larvae had rates of synthesis that were up to 194 times faster than unfed larvae (9.7+/-0.81 ng protein larva(-1) h(-1)). There was no significant difference, however, in the cost of protein synthesis between these larvae with very different physiological states. Furthermore, the cost of synthesis in the larval stages was also similar to costs measured for blastula and gastrula embryos of 8.4+/-0.99 J mg(-1) protein synthesized. The cost of protein synthesis was obtained using both direct ('inhibitor') and indirect ('correlative') measurements; both methods gave essentially identical results. Protein synthesis accounted for up to 54+/-8% of metabolic rate in embryos. Percent of metabolism accounted for by protein synthesis in larvae was dependent on their physiological feeding state, with protein synthesis accounting for 16+/-4% in unfed larvae and 75+/-11% in fed larvae. This regulation of metabolic rate was due to differential rates of synthesis for a fixed energy cost per unit mass of protein synthesized. The cost of synthesizing a unit of protein did not change with increasing rates of protein synthesis. We conclude that the cost of protein synthesis is independent of the rate of synthesis, developmental stage, size and physiological feeding state during sea urchin development.

  17. A Concise Synthesis of Berkelic Acid Inspired by Combining the Natural Products Spicifernin and Pulvilloric Acid

    PubMed Central

    Bender, Christopher F.; Yoshimoto, Francis K.; Paradise, Christopher L.; De Brabander, Jef K.

    2009-01-01

    We describe a concise synthesis of the structurally novel fungal extremophile metabolite berkelic acid – an effort leading to an unambiguous assignment of C22 stereochemistry. Our synthetic approach was inspired by the recognition that berkelic acid displays structural characteristics reminiscent of two other fungal metabolites, spicifernin and pulvilloric acid. Based on this notion, we executed a synthesis that features a Ag-catalyzed cascade dearomatization-cycloisomerization-cycloaddition sequence to couple two natural product inspired fragments. Notably, a spicifernin-like synthon was prepared with defined C22 stereochemistry in seven steps and three purifications (24–28% overall yield). A potentially useful anti-selective conjugate propargylation reaction was developed to introduce the vicinal stereodiad. An enantioconvergent synthesis of the other coupling partner, the aromatic precursor to pulvilloric acid methyl ester, was achieved in eight steps and 48% overall yield. The total synthesis of berkelic acid and its C22 epimer was thus completed in 10 steps longest linear sequence and 11–27% overall yield. PMID:19722648

  18. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  19. Inhibition of in vitro cholesterol synthesis by fatty acids.

    PubMed

    Kuroda, M; Endo, A

    1976-01-18

    Inhibitory effect of 44 species of fatty acids on cholesterol synthesis has been examined with a rat liver enzyme system. In the case of saturated fatty acids, the inhibitory activity increased with chain length to a maximum at 11 to 14 carbons, after which activity decreased rapidly. The inhibition increased with the degree of unsaturation of fatty acids. Introduction of a hydroxy group at the alpha-position of fatty acids abolished the inhibition, while the inhibition was enhanced by the presence of a hydroxy group located in an intermediate position of the chain. Branched chain fatty acids having a methyl group at the terminal showed much higher activity than the corresponding saturated straight chain fatty acids with the same number of carbons. With respect to the mechanism for inhibition, tridecanoate was found to inhibit acetoacetyl-CoA thiolase specifically without affecting the other reaction steps in the cholesterol synthetic pathway. The highly unsaturated fatty acids, arachidonate and linoleate, were specific inhibitors of 3-hydroxy-3-methyl-glutaryl-CoA synthase. On the other hand, ricinoleate (hydroxy acid) and phytanate (branched-chain acid) diminished the conversion of mevalonate to sterols by inhibiting a step or steps between squalene and lanosterol.

  20. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-02

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

  1. Effects of Abscisic Acid and Ethylene on the Gibberellic Acid-Induced Synthesis of α-Amylase by Isolated Wheat Aleurone Layers 1

    PubMed Central

    Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.

    1983-01-01

    Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284

  2. Inhibition of fatty acid and cholesterol synthesis by stimulation of AMP-activated protein kinase.

    PubMed

    Henin, N; Vincent, M F; Gruber, H E; Van den Berghe, G

    1995-04-01

    AMP-activated protein kinase is a multisubstrate protein kinase that, in liver, inactivates both acetyl-CoA carboxylase, the rate-limiting enzyme of fatty acid synthesis, and 3-hydroxy-3-methyl-glutaryl-CoA reductase, the rate-limiting enzyme of cholesterol synthesis. AICAR (5-amino 4-imidazolecarboxamide ribotide, ZMP) was found to stimulate up to 10-fold rat liver AMP-activated protein kinase, with a half-maximal effect at approximately 5 mM. In accordance with previous observations, addition to suspensions of isolated rat hepatocytes of 50-500 microM AICAriboside, the nucleoside corresponding to ZMP, resulted in the accumulation of millimolar concentrations of the latter. This was accompanied by a dose-dependent inactivation of both acetyl-CoA carboxylase and 3-hydroxy-3-methylglutaryl-CoA reductase. Addition of 50-500 microM AICAriboside to hepatocyte suspensions incubated in the presence of various substrates, including glucose and lactate/pyruvate, caused a parallel inhibition of both fatty acid and cholesterol synthesis. With lactate/pyruvate (10/1 mM), half-maximal inhibition was obtained at approximately 100 microM, and near-complete inhibition at 500 microM AICAriboside. These findings open new perspectives for the simultaneous control of triglyceride and cholesterol synthesis by pharmacological stimulators of AMP-activated protein kinase.

  3. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

  4. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  5. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  6. A rodent model of protein turnover used to design an experiment for measuring the rates of channeling, recycling and protein synthesis.

    PubMed

    Johnson, H A; Baldwin, R L; Klasing, K C; France, J; Calvert, C C

    2000-12-01

    We described previously a mechanistic model of whole-body protein turnover in rodents. Channeling was defined as the flow of amino acids from the extracellular compartment to aminoacyl tRNA and protein synthesis. Recycling was defined as the flow of amino acids from protein degradation to aminoacyl tRNA (protein synthesis) without mixing with the intracellular pool of amino acids. In this paper, the model is applied to tissues and whole body and is used to develop an experimental protocol for estimating protein fractional synthesis rate, recycling and channeling. Channeling, recycling and protein synthesis must be estimated simultaneously because changes in specific radioactivities over time are highly dependent on the rate of protein synthesis. Injection-specific radioactivities, body weights and experimental variation were used with the model to generate data at different rates of recycling and channeling. The data generated were then used to determine the best time points and experimental method to estimate percentages of recycling, channeling and protein synthesis rate by the iterative Method of Maximum Likelihood. Specific radioactivity at each time point was based on simulated data from three rodents at each of six time points. Predicted protein synthesis rates were within 5%/d of observed rates for all methods. Predicted rates of recycling and channeling were generally within 15% of observed rates except recycling in muscle at high channeling and high recycling. Standard deviations of the predictions of percentages of channeling and recycling were between 0.148 and 44.5% for the pulse dose method, 0.0655 and 197% for the continuous infusion method and 0.351 and 962% for the flooding dose method. The experimental design that yields the best estimates of channeling, recycling and protein synthesis is the pulse dose. Changes in amino acid specific radioactivities in the extracellular, aminoacyl tRNA and protein pools were greatest and should be measured at 2, 6

  7. Near-Critical Behavior of Aminoacyl-tRNA Pools in E. coli at Rate-Limiting Supply of Amino Acids

    PubMed Central

    Elf, Johan; Ehrenberg, Måns

    2005-01-01

    The rates of consumption of different amino acids in protein synthesis are in general stoichiometrically coupled with coefficients determined by codon usage frequencies on translating ribosomes. We show that when the rates of synthesis of two or more amino acids are limiting for protein synthesis and exactly matching their coupled rates of consumption on translating ribosomes, the pools of aminoacyl-tRNAs in ternary complex with elongation factor Tu and GTP are hypersensitive to a variation in the rate of amino acid supply. This high sensitivity makes a macroscopic analysis inconclusive, because it is accompanied by almost free and anticorrelated diffusion in copy numbers of ternary complexes. This near-critical behavior is relevant for balanced growth of Escherichia coli cells in media that lack amino acids and for adaptation of E. coli cells after downshifts from amino-acid-containing to amino-acid-lacking growth media. The theoretical results are used to discuss transcriptional control of amino acid synthesis during multiple amino acid limitation, the recovery of E. coli cells after nutritional downshifts and to propose a robust mechanism for the regulation of RelA-dependent synthesis of the global effector molecule ppGpp. PMID:15501947

  8. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  9. Relationships between pyruvate decarboxylation and branched-chain volatile acid synthesis in Ascaris mitochondria.

    PubMed

    Komuniecki, R; Komuniecki, P R; Saz, H J

    1981-10-01

    The rate of 14CO2 evolution from 1-[14C]pyruvate by intact Ascaris mitochondria was very slow, but increased with increasing concentrations of pyruvate. At all concentrations of pyruvate, in an aerobic environment, pyruvate decarboxylation was stimulated greatly by the addition of fumarate, malate, or succinate. However, under anaerobic conditions, only malate and fumarate stimulated pyruvate decarboxylation; succinate had no effect. This implies that the aerobic metabolism of succinate, presumably to other dicarboxylic acids, may be required for the stimulation. Incubation of sonicated mitochondria with pyruvate plus fumarate, under rate-limiting concentrations of NAD+, resulted in approximately equal quantities of pyruvate utilized and succinate formed, suggesting that pyruvate oxidation and fumarate reduction may be linked. Branched-chain, volatile fatty acids were not formed during incubations with either malate or succinate, or succinate plus acetate. However, incubations of intact Ascaris mitochondria with pyruvate plus succinate yielded 2-methylbutyrate and 2-methylvalerate, whereas incubations with pyruvate plus propionate yielded almost exclusively 2-methylvalerate. Oxygen dramatically inhibited the synthesis of the branched-chain acids from succinate plus pyruvate, attesting to the apparent anaerobic nature of Ascaris mitochondrial metabolism. Significantly, the addition of glucose plus ADP stimulated the formation of all volatile fatty acids. Therefore, the synthesis of branched-chain acids may be related directly to increased energy generation. Alternatively, they may function in the regulatory role of maintaining the mitochondrial redox balance.

  10. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  11. Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.

    PubMed

    Matsuno, Koya; Fujimura, Tatsuhito

    2014-03-01

    A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis.

  12. Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid

    NASA Technical Reports Server (NTRS)

    Nakashima, T.; Fox, S. W.

    1980-01-01

    The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.

  13. Haematopoietic stem cells require a highly regulated protein synthesis rate.

    PubMed

    Signer, Robert A J; Magee, Jeffrey A; Salic, Adrian; Morrison, Sean J

    2014-05-01

    Many aspects of cellular physiology remain unstudied in somatic stem cells, for example, there are almost no data on protein synthesis in any somatic stem cell. Here we set out to compare protein synthesis in haematopoietic stem cells (HSCs) and restricted haematopoietic progenitors. We found that the amount of protein synthesized per hour in HSCs in vivo was lower than in most other haematopoietic cells, even if we controlled for differences in cell cycle status or forced HSCs to undergo self-renewing divisions. Reduced ribosome function in Rpl24(Bst/+) mice further reduced protein synthesis in HSCs and impaired HSC function. Pten deletion increased protein synthesis in HSCs but also reduced HSC function. Rpl24(Bst/+) cell-autonomously rescued the effects of Pten deletion in HSCs; blocking the increase in protein synthesis, restoring HSC function, and delaying leukaemogenesis. Pten deficiency thus depletes HSCs and promotes leukaemia partly by increasing protein synthesis. Either increased or decreased protein synthesis impairs HSC function.

  14. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  15. Lipid metabolism during bacterial growth, sporulation, and germination: differential synthesis of individual branched- and normal-chain fatty acids during spore germination and outgrowth of Bacillus thuringiensis.

    PubMed

    Nickerson, K W; Bulla, L A; Mounts, T L

    1975-12-01

    The biosynthesis of individual branched- and normal-chain fatty acids during Bacillus thuringiensis spore germination and outgrowth was studied by comparing pulsed and continuous labeling of these fatty acids with [U-14C]acetate. The relative specific activity of each fatty acid varies with time as the cell progresses through outgrowth. However, fatty acid synthesis does occur in two distinct phases. Upon germination, acetate is incorporated only into the iso-isomers i-C13, i-C14, and i-C16; no normal or anteiso synthesis occurs. Subsequent to T30, the full complement of branched- and normal-chain homologues is formed and there is a dramatic enhancement in the overall rate of fatty acid synthesis. Significantly, this rate increase coincides with a marked shift from the synthesis of short-chain to long-chain fatty acids. These findings illustrate a dichotomy in synthesis that may result from initial fatty acid formation by preexisting spore fatty acid biosynthetic enzymes in the absence of de novo protein synthesis. Elucidation of the timing and kinetics of individual fatty acid formation provides a biochemical profile of activities directly related to membrane differentiation and cellular development.

  16. Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.

    PubMed

    Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M

    2012-03-27

    In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages.

  17. Human muscle protein synthesis is modulated by extracellular, not intramuscular amino acid availability: a dose-response study.

    PubMed

    Bohé, Julien; Low, Aili; Wolfe, Robert R; Rennie, Michael J

    2003-10-01

    To test the hypothesis that muscle protein synthesis (MPS) is regulated by the concentration of extracellular amino acids, we investigated the dose-response relationship between the rate of human MPS and the concentrations of blood and intramuscular amino acids. We increased blood mixed amino acid concentrations by up to 240 % above basal levels by infusion of mixed amino acids (Aminosyn 15, 44-261 mg kg-1 h-1) in 21 healthy subjects, (11 men 10 women, aged 29 +/- 2 years) and measured the rate of incorporation of D5-phenylalanine or D3-leucine into muscle protein and blood and intramuscular amino acid concentrations. The relationship between the fold increase in MPS and blood essential amino acid concentration ([EAA], mM) was hyperbolic and fitted the equation MPS = (2.68 x [EAA])/(1.51 + [EAA]) (P < 0.01). The pattern of stimulation of myofibrillar, sarcoplasmic and mitochondrial protein was similar. There was no clear relationship between the rate of MPS and the concentration of intramuscular EAAs; indeed, when MPS was increasing most rapidly, the concentration of intramuscular EAAs was below basal levels. We conclude that the rates of synthesis of all classes of muscle proteins are acutely regulated by the blood [EAA] over their normal diurnal range, but become saturated at high concentrations. We propose that the stimulation of protein synthesis depends on the sensing of the concentration of extracellular, rather than intramuscular EAAs.

  18. Human Muscle Protein Synthesis is Modulated by Extracellular, Not Intramuscular Amino Acid Availability: A Dose-Response Study

    PubMed Central

    Bohé, Julien; Low, Aili; Wolfe, Robert R; Rennie, Michael J

    2003-01-01

    To test the hypothesis that muscle protein synthesis (MPS) is regulated by the concentration of extracellular amino acids, we investigated the dose-response relationship between the rate of human MPS and the concentrations of blood and intramuscular amino acids. We increased blood mixed amino acid concentrations by up to 240 % above basal levels by infusion of mixed amino acids (Aminosyn 15, 44-261 mg kg−1 h−1) in 21 healthy subjects, (11 men 10 women, aged 29 ± 2 years) and measured the rate of incorporation of D5-phenylalanine or D3-leucine into muscle protein and blood and intramuscular amino acid concentrations. The relationship between the fold increase in MPS and blood essential amino acid concentration ([EAA], mM) was hyperbolic and fitted the equation MPS = (2.68 × [EAA])/(1.51 + [EAA]) (P < 0.01). The pattern of stimulation of myofibrillar, sarcoplasmic and mitochondrial protein was similar. There was no clear relationship between the rate of MPS and the concentration of intramuscular EAAs; indeed, when MPS was increasing most rapidly, the concentration of intramuscular EAAs was below basal levels. We conclude that the rates of synthesis of all classes of muscle proteins are acutely regulated by the blood [EAA] over their normal diurnal range, but become saturated at high concentrations. We propose that the stimulation of protein synthesis depends on the sensing of the concentration of extracellular, rather than intramuscular EAAs. PMID:12909668

  19. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  20. Differential modulation of citrate synthesis and release by fatty acids in perfused working rat hearts.

    PubMed

    Vincent, Genevieve; Bouchard, Bertrand; Khairallah, Maya; Des Rosiers, Christine

    2004-01-01

    The objective of this study was to test the effect of increasing fatty acid concentrations on substrate fluxes through pathways leading to citrate synthesis and release in the heart. This was accomplished using semirecirculating work-performing rat hearts perfused with substrate mixtures mimicking the in situ milieu (5.5 mM glucose, 8 nM insulin, 1 mM lactate, 0.2 mM pyruvate, and 0.4 mM oleate-albumin) and 13C methods. Raising the fatty acid concentration from 0.4 to 1 mM with long-chain oleate or medium-chain octanoate resulted in a lowering ( approximately 20%) of cardiac output and efficiency with unaltered O2 consumption. At the metabolic level, beyond the expected effects of high fatty acid levels on the contribution of pyruvate decarboxylation (reduced >3-fold) and beta-oxidation (enhanced approximately 3-fold) to citrate synthesis, there was also a 2.4-fold lowering of anaplerotic pyruvate carboxylation. Despite the dual inhibitory effect of high fatty acids on pyruvate decarboxylation and carboxylation, tissue citrate levels were twofold higher, but citrate release rates remained unchanged at 11-14 nmol/min, representing <0.5% of citric acid cycle flux. A similar trend was observed for most metabolic parameters after oleate or octanoate addition. Together, these results emphasize a differential modulation of anaplerotic pyruvate carboxylation and citrate release in the heart by fatty acids. We interpret the lack of effects of high fatty acid concentrations on citrate release rates as suggesting that, under physiological conditions, this process is maximal, probably limited by the activity of its mitochondrial or plasma membrane transporter. Limited citrate release at high fatty acid concentrations may have important consequences for the heart's fuel metabolism and function.

  1. High-yield synthesis of bioactive ethyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Zhang, Jiang-Yan; Chen, Na; Zhi, Gao-Ying

    2016-01-01

    In this paper, Lipozyme TLIM-catalyzed synthesis of ethyl cinnamate through esterification of cinnamic acid with ethanol was studied. In order to increase the yield of ethyl cinnamate, several media, including acetone, isooctane, DMSO and solvent-free medium, were investigated in this reaction. The reaction showed a high yield by using isooctane as reaction medium, which was found to be much higher than the yields reported previously. Furthermore, several parameters such as shaking rate, water activity, reaction temperature, substrate molar ratio and enzyme loading had important influences on this reaction. For instance, when temperature increased from 10 to 50 °C, the initial reaction rate increased by 18 times and the yield of ethyl cinnamate increased by 6.2 times. Under the optimum conditions, lipase-catalyzed synthesis of ethyl cinnamate gave a maximum yield of 99%, which was of general interest for developing industrial processes for the preparation of ethyl cinnamate.

  2. SYNTHESIS AND CHARACTERIZATION OF SUBSTITUTED POLY(STYRENE)-b-POLY(ACRYLIC ACID) BLOCK COPOLYMER MICELLES

    SciTech Connect

    Pickel, Deanna L; Pickel, Joseph M; Devenyi, Jozsef; Britt, Phillip F

    2009-01-01

    Block copolymer micelle synthesis and characterization has been extensively studied. In particular, most studies have focused on the properties of the hydrophilic corona due to the micelle corona structure s impact on the biodistribution and biocompatibility. Unfortunately, less attention has been given to the effect of the core block on the micelle stability, morphology, and the rate of diffusion of small molecules from the core. This investigation is focused on the synthesis of block copolymers composed of meta-substituted styrenes and acrylic acid by Atom Transfer Radical Polymerization. Micelles with cores composed of substituted styrenes having Tgs ranging from -30 to 100 oC have been prepared and the size and shape of these micelles were characterized by Static and Dynamic Light Scattering and TEM. In addition, the critical micelle concentration and rate of diffusion of small molecules from the core were determined by fluorimetry using pyrene as the probe.

  3. Vitamin B-6 restriction impairs fatty acid synthesis in cultured human hepatoma (HepG2) cells

    PubMed Central

    Zhao, Mei; Ralat, Maria A.; da Silva, Vanessa; Garrett, Timothy J.; Melnyk, Stephan; James, S. Jill

    2013-01-01

    Vitamin B-6 deficiency has been reported to alter n-6 and n-3 fatty acid profiles in plasma and tissue lipids; however, the mechanisms underlying such metabolic changes remain unclear. The objective of this study was to determine the effects of vitamin B-6 restriction on fatty acid profiles and fatty acid synthesis in HepG2 cells. Cells were cultured for 6 wk in media with four different vitamin B-6 concentrations (10, 20, 50, and 2,000 nM added pyridoxal, representing deficient, marginal, adequate, and supraphysiological conditions) that induced a range of steady-state cellular concentrations of pyridoxal phosphate. Total cellular lipid content was greatest in the deficient (10 nM pyridoxal) medium. The percentage of arachidonic acid and the ratio of arachidonic acid to linoleic acid in the total lipid fraction were ∼15% lower in vitamin B-6-restricted cells, which suggests that vitamin B-6 restriction affects n-6 fatty acid interconversions. Metabolic flux studies indicated significantly lower fractional synthesis rate of oleic acid and arachidonic acid at 10, 20, and 50 nM pyridoxal, whereas that of eicosapentaenoic acid was lower in the cells cultured in 10 nM pyridoxal. Additionally, relative mRNA expressions of Δ5 and Δ6 desaturases were 40–50% lower in vitamin B-6-restricted cells. Overall, these findings suggest that vitamin B-6 restriction alters unsaturated fatty acid synthesis, particularly n-6 and n-3 polyunsaturated fatty acid synthesis. These results and observations of changes in human plasma fatty acid profiles caused by vitamin B-6 restriction suggest a mechanism by which vitamin B-6 inadequacy influences the cardiovascular risk. PMID:23211517

  4. Evidence for transport intermediates in aromatic amino acid synthesis of non-green tissues

    SciTech Connect

    Leuschner, C.; Schultz, G. )

    1990-05-01

    Quinate (QA) is the predominant pre-aromatic compound formed at high rates in leaves of many plants at the early vegetation stage and transported through the phloem. The transfer of 3-dehydroquinate, 3-dehydroshikimate and (SkA) across the plastidial membranes has been evidenced. The question was whether the rate of QA uptake is comparable to that of the 3 SkA-pathway intermediates. To demonstrate this, /U-{sup 14}C/QA and /U-{sup 14}C/SkA were applied to Brassica rapa roots. Both compounds were uptaken at considerable rates and incorporated into aromatic amino acids (Phe + Tyr + Trp formation, in nmol/g fresh wt x h: applying 145 {mu}mol QA: 21.2; applying 156 {mu}mol Ska: 31.8). Thus, QA is a possible candidate for transport into non-green tissues for aromatic amino acid synthesis.

  5. Synthesis of benzyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Chen, Na; Zhi, Gao-Ying

    2015-12-01

    In this study, lipase catalysis was successfully applied in synthesis of benzyl cinnamate through esterification of cinnamic acid with benzyl alcohol. Lipozyme TLIM was found to be more efficient for catalyzing this reaction than Novozym 435. In order to increase the yield of benzyl cinnamate, several media, including acetone, trichloromethane, methylbenzene, and isooctane, were used in this reaction. The reaction showed a high yield using isooctane as medium. Furthermore, the effects of several parameters such as water activity, reaction temperature, etc, on this reaction were analyzed. It was pointed out that too much benzyl alcohol would inhibit lipase activity. Under the optimum conditions, lipase-catalyzed synthesis of benzyl cinnamate gave a maximum yield of 97.3%. Besides, reusable experiment of enzyme demonstrated that Lipozyme TLIM retained 63% of its initial activity after three cycles. These results were of general interest for developing industrial processes for the preparation of benzyl cinnamate.

  6. Xenograft Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer

    DTIC Science & Technology

    2000-08-01

    Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer PRINCIPAL INVESTIGATOR: Francis P. Kuhajda, M.D. CONTRACTING ORGANIZATION...SUBTITLE 5. FUNDING NUMBERS Xenograft Studies of Fatty Acid Synthesis DAMD17-96-1-6235 Inhibition as Novel Therapy for Breast Cancer 6. AUTHOR(S...5012. 13. ABSTRACT (Maximum 200 Words) This grant proposed to study the effect of fatty acid synthesis inhibition in human breast cancer xenografts

  7. Synthesis of amino Derivatives of Dithio Acids as Potential Radiation Protective Agents

    DTIC Science & Technology

    1984-08-01

    ation Management S SI ____ K> AD Synthesis of Amino Derivatives of Dithio Acids as Potential Radiation Protective Agents * 0 Annual Report "TIi: o DTIC...Sftcuntiy Clatuftcatio") Synthesis of Amino Derivatives of Dithio Acids as PotentitI- Radiation Protective Agents 12l PERISONAL. Ak.TI4OR(S) * William...methyl- picoline derivatives was accomplished. Use of N-mthyl-2,6-dimethylpyridine also allowed the synthesis of a bis(dithioacetic acid) function not

  8. A synthesis of growth rates in marine epipelagic invertebrate zooplankton.

    PubMed

    Hirst, A G; Roff, J C; Lampitt, R S

    2003-01-01

    We present the most extensive study to date of globally compiled and analysed weight-specific growth rates in marine epi-pelagic invertebrate metazoan zooplankton. Using specified selection criteria, we analyse growth rates from a variety of zooplanktonic taxa, including both holo- and mero-planktonic forms, from over 110 published studies. Nine principal taxonomic groups are considered, the copepods (number of individual data points (n) = 2,528); crustaceans other than copepods (n = 253); cnidarians (n = 77); ctenophores (n = 27); chaetognaths (n = 87); pteropods (n = 8); polychaetes (n = 12); thaliaceans (n = 88); and larvaceans (n = 91). The copepods are further examined by subdividing them into broadcasters or sac-spawning species, and as nauplii (N1-N6), copepodites (C1-C5) and adults (C6). For each taxonomic group relationships between growth, temperature and body weight are examined using a variety of methods. Weight-specific growth tends to increase with increasing temperature and with decreasing body weight in the crustacean group. Growth does not relate to body weight in the case of chaetognaths and larvaceans, but does increase with temperature. In the cnidarian and ctenophore groups growth does not relate to temperature, but is negatively related to body size. For the thaliceans growth increases with both increasing body weight and temperature. In the entire broadcasting copepod data set, weight-specific growth increases with increasing temperature and decreasing body weight. In sac-spawners, growth increases with increasing temperature, and increases with decreasing body weight at temperatures below 20 degrees C, but decreases with body weight at temperatures above this. Comparison between the different taxa shows important differences and similarities. Our extensive synthesis of data generally confirms that larvaceans, pteropods, cnidarians and ctenophores have rates of weight-specific growth that are typically greater than the copepods, chaetognaths

  9. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  10. Synthesis and characterization of copolyanhydrides of carbohydrate-based galactaric acid and adipic acid.

    PubMed

    Mehtiö, Tuomas; Nurmi, Leena; Rämö, Virpi; Mikkonen, Hannu; Harlin, Ali

    2015-01-30

    A series of copolyanhydrides, consisting of 2,3,4,5-tetra-O-acetylgalactaric acid (AGA) and adipic acid (AA) as monomer units, was polymerized. Synthesis of AGA monomer consisted of two steps. First, O-acetylation of galactaric acid secondary hydroxyl groups was performed using acetic anhydride as a reagent. Acetic anhydride was then further used as a reagent in the synthesis of diacetyl mixed anhydride of AGA. Polymerizations were conducted as bulk condensation polymerization at 150 °C. Thermal properties of the copolymers varied depending on monomer composition. Increase in the AGA content had a clear increasing effect on the Tg. A similar increasing effect was observed in Tm. The degree of crystallinity decreased as AGA content increased. There was a slightly lowering tendency in the molecular weights of the obtained polymers when the AGA content in the polymerization mixtures increased. The described synthesis route shows that bio-based aldaric acid monomers are potential candidates for the adjustment of thermal properties of polyanhydrides.

  11. Amino acid metabolism and protein synthesis in lactating rats fed on a liquid diet.

    PubMed Central

    Barber, T; García de la Asunción, J; Puertes, I R; Viña, J R

    1990-01-01

    1. Amino acid metabolism was studied in control virgin rats, lactating rats and virgin rats protein-pair-fed with the lactating rats (high-protein virgin rats). 2. Urinary excretion of nitrogen and urea was higher in lactating than in control virgin rats, and in high-protein virgin rats it was higher than in lactating rats. 3. The activities of urea-cycle enzymes (units/g) were higher in high-protein virgin than in lactating rats, except for arginase. In lactating rats the activities of carbamoyl-phosphate synthase, ornithine carbamoyltransferase and argininosuccinate synthase were lower than in control virgin rats. When the liver size is considered, the activities in lactating rats were similar to those in high-protein virgin rats, except for arginase. 4. N-Acetylglutamate content was higher in high-protein virgin rats than in the other two groups. 5. The rate of urea synthesis from precursors by isolated hepatocytes was higher in high-protein virgin rats than in the other two groups. 6. The flooding-dose method (L-[4-3H]phenylalanine) for measuring protein synthesis was used. The absolute synthesis rates of mammary gland, liver and small-intestinal mucosa were higher in lactating rats than in the other two groups, and in high-protein virgin rats than in control virgin rats 7. These results show that the increased needs for amino acids during lactation are met by hyperphagia and by a nitrogen-sparing mechanism. PMID:2396994

  12. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  13. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  14. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  15. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  16. Synthesis and characterization of carboxylic acid functionalized silicon nanoparticles

    NASA Astrophysics Data System (ADS)

    Shaner, Ted V.

    Silicon nanoparticles are of great interest in a great number of fields. Silicon nanoparticles show great promise particularly in the field of bioimaging. Carboxylic acid functionalized silicon nanoparticles have the ability to covalently bond to biomolecules through the conjugation of the carboxylic acid to an amine functionalized biomolecule. This thesis explores the synthesis of silicon nanoparticles functionalized by both carboxylic acids and alkenes and their carboxylic acid functionality. Also discussed is the characterization of the silicon nanoparticles by the use of x-ray spectroscopy. Finally, the nature of the Si-H bond that is observed on the surface of the silicon nanoparticles will be investigated using photoassisted exciton mediated hydrosilation reactions. The silicon nanoparticles are synthesized from both carboxylic acids and alkenes. However, the lack of solubility of diacids is a significant barrier to carboxylic acid functionalization by a mixture of monoacids and diacids. A synthesis route to overcome this obstacle is to synthesize silicon nanoparticles with terminal vinyl group. This terminal vinyl group is distal to the surface of the silicon nanoparticle. The conversion of the vinyl group to a carboxylic acid is accomplished by oxidative cleavage using ozonolysis. The carboxylic acid functionalized silicon nanoparticles were then successfully conjugated to amine functionalized DNA strand through an n-hydroxy succinimide ester activation step, which promotes the formation of the amide bond. Conjugation was characterized by TEM and polyacrylamide gel electrophoresis (PAGE). The PAGE results show that the silicon nanoparticle conjugates move slower through the polyacrylamide gel, resulting in a significant separation from the nonconjugated DNA. The silicon nanoparticles were then characterized by the use of x-ray absorption near edge spectroscopy (Xanes) and x-ray photoelectron spectroscopy (XPS) to investigate the bonding and chemical

  17. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  18. Administration of balanced or BCAA-enriched amino acid solution in septic rats. Effects on protein synthesis in the liver.

    PubMed Central

    Pedersen, P; Li, S J; Hasselgren, P O; LaFrance, R; Fischer, J E

    1988-01-01

    Total hepatic protein synthesis was measured in vivo with a flooding-dose technique, and the production of total secreted proteins, albumin, complement component C3, and seromucoid fraction was measured in perfused livers of septic rats that received one of three different solutions infused intravenously; Group 1 received 16.4% dextrose; Group 2 received Aminosyn (25% BCAA) in 10.6% dextrose, and Group 3 received Freamine HBC (45% BCAA) in 10.6% dextrose. All solutions were isocaloric, and the amino acid solutions were isonitrogenous. The solutions were administered for 18 or 48 hours after the induction of sepsis. There were no significant differences in mortality rates in the three treatment groups. The negative nitrogen balance seen in the dextrose-infused animals was reversed to the same degree by the two different amino acid solutions. There were no significant differences in hepatic protein synthesis rates in vivo between the three groups of rats. Synthesis rates of secreted proteins in perfused liver were similar in the different treatment groups in the 18-hour experiments, whereas in the 48-hour experiments, synthesis rates of total secreted proteins, C3, and the serumucoid fraction were higher in Group 1 than in Groups 2 and 3. The results suggest that administration of an amino acid solution improves nitrogen balance in sepsis, but that this effect is not caused by stimulated hepatic protein synthesis. The nitrogen-sparing effect during sepsis of a branched chain amino acid (BCAA)-enriched solution does not seem to be superior to that of a balanced amino acid solution. PMID:3143320

  19. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

    PubMed

    Hansen, Alexandar L; Behrman, Edward J

    2016-08-05

    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid.

  20. Synthesis and characterization of acetic acid and ethanoic acid (based)-maleimide

    NASA Astrophysics Data System (ADS)

    Poad, Siti Nashwa Mohd; Hassan, Nurul Izzaty; Hassan, Nur Hasyareeda

    2016-11-01

    A new route to the synthesis of maleimide is described. 2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)acetic acid maleimide (1) and 2-(4-(2,5-Dioxo-2,5-dihydro- 1H-pyrrol-1-yl)phenyl)ethanoic acid maleimide (2) have been synthesized by the reaction of maleic anhydride with glycine and 4-aminophenyl acetic aicd. Maleimide (1) was synthesized by conventional technique while maleimide (2) was synthesized by microwave method. The compounds were characterized using FT-Infrared (FT-IR), 1H and 13C Nuclear Magnetic Resonance (NMR) spectroscopies and Mass Spectrometry.

  1. Glutamate dehydrogenase (RocG) in Bacillus licheniformis WX-02: Enzymatic properties and specific functions in glutamic acid synthesis for poly-γ-glutamic acid production.

    PubMed

    Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen

    2017-04-01

    Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis.

  2. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  3. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  4. recA gene product is responsible for inhibition of deoxyribonucleic acid synthesis after ultraviolet irradiation.

    PubMed Central

    Trgovcević, Z; Petranović, D; Petranović, M; Salaj-Smic, E

    1980-01-01

    Deoxyribonucleic acid synthesis after ultraviolet irradiation was studied in wild-type, uvrA, recB, recA recB, and recA Escherichia coli strains. Inhibition of deoxyribonucleic acid synthesis, which occurs almost immediately after exposing the cells to ultraviolet radiation, depends on the functional gene recA. PMID:6997276

  5. Reduction Rates for Higher Americium Oxidation States in Nitric Acid

    SciTech Connect

    Grimes, Travis Shane; Mincher, Bruce Jay; Schmitt, Nicholas C

    2015-09-30

    The stability of hexavalent americium was measured using multiple americium concentrations and nitric acid concentrations after contact with the strong oxidant sodium bismuthate. Contrary to our hypotheses Am(VI) was not reduced faster at higher americium concentrations, and the reduction was only zero-order at short time scales. Attempts to model the reduction kinetics using zero order kinetic models showed Am(VI) reduction in nitric acid is more complex than the autoreduction processes reported by others in perchloric acid. The classical zero-order reduction of Am(VI) was found here only for short times on the order of a few hours. We did show that the rate of Am(V) production was less than the rate of Am(VI) reduction, indicating that some Am(VI) undergoes two electron-reduction to Am(IV). We also monitored the Am(VI) reduction in contact with the organic diluent dodecane. A direct comparison of these results with those in the absence of the organic diluent showed the reduction rates for Am(VI) were not statistically different for both systems. Additional americium oxidations conducted in the presence of Ce(IV)/Ce(III) ions showed that Am(VI) is reduced without the typical growth of Am(V) observed in the systems sans Ce ion. This was an interesting result which suggests a potential new reduction/oxidation pathway for Am in the presence of Ce; however, these results were very preliminary, and will require additional experiments to understand the mechanism by which this occurs. Overall, these studies have shown that hexavalent americium is fundamentally stable enough in nitric acid to run a separations process. However, the complicated nature of the reduction pathways based on the system components is far from being rigorously understood.

  6. Induction of fatty acid synthesis by pravastatin sodium in rat liver and primary hepatocytes.

    PubMed

    Fujioka, T; Tsujita, Y; Shimotsu, H

    1997-06-11

    We examined the effect of pravastatin sodium (pravastatin), a 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitor, on fatty acid synthesis in rat liver. The repeated administration of pravastatin to rats at 250 mg/kg for 7 days led to a 2.8-fold increase in fatty acid synthesis in the liver. The diurnal change of fatty acid synthesis was not affected by the treatment. Hepatic fatty acid synthase activity was increased 3.2-fold, while acetyl-CoA carboxylase activity was not changed by the repeated administration of pravastatin. In rat hepatocytes, the incubation with 2 microg/ml pravastatin for 24 h increased fatty acid synthase activity 1.5-fold, as well as HMG-CoA reductase activity 2.8-fold. These results suggest that HMG-CoA reductase inhibitors might increase fatty acid synthesis in vivo through the induction of hepatic fatty acid synthase.

  7. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  8. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    PubMed

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved.

  9. Planetary Population Synthesis: the importance of the solids accretion rate

    NASA Astrophysics Data System (ADS)

    Fortier, A.; Alibert, Y.; Carron, F.; Mordasini, C.; Benz, W.

    2011-10-01

    In the framework of the nucleated instability model, the formation time-scale of giant planets is very sensitive to the time it takes to build the solid core. The accretion of solids can be described by two different, consecutive regimes: it first proceeds in a very fast fashion, known as runaway growth, and later on in a much slower regime, the so-called oligarchic growth. The transition between the runaway and the oligarchic growth depends on many parameters (e.g. the isolation mass and the size of the accreted planetesimals), but as a general rule we can assume that an embryo of a Lunar mass is already an oligarch. Then, the timescale to build a 10 Earth masses (M⊙) core is regulated by the oligarchic regime, as the previous runaway stage proceeds in a negligible amount of time compared to the oligarchic timescale. In this work we show the results of adopting the oligarchic growth for the core in planetary population synthesis calculations. In previous works (see [1], [2]) a fast solids accretion rate was prescribed, leading to a very fast formation of massive solid embryos. Here we show that when considering the oligarchic growth, the formation of giant planets is more difficult, especially in the outer parts of the disk, where the formation of big planets is almost impossible under these hypothesis. On the other hand, many Earth to Super- Earth sized planets are found in the very innermost parts of the disk. However, if the size of the accreted planetesimals is reduced, the formation of giant planets is more likely, preserving also a large amount of smaller planets. We also consider the formation of planetary systems, including the N-body interaction between the forming planets and the collisions that may occur among them during their migration. In the case of many planets forming in the same disk, we find that the final masses of the planets are smaller (but not too small) than in the case of a single planet per star.

  10. Iodide-catalyzed reductions: development of a synthesis of phenylacetic acids.

    PubMed

    Milne, Jacqueline E; Storz, Thomas; Colyer, John T; Thiel, Oliver R; Dilmeghani Seran, Mina; Larsen, Robert D; Murry, Jerry A

    2011-11-18

    A new convenient and scalable synthesis of phenylacetic acids has been developed via the iodide catalyzed reduction of mandelic acids. The procedure relies on in situ generation of hydroiodic acid from catalytic sodium iodide, employing phosphorus acid as the stoichiometric reductant.

  11. Synthesis of Site-Specifically (13)C Labeled Linoleic Acids.

    PubMed

    Offenbacher, Adam R; Zhu, Hui; Klinman, Judith P

    2016-10-12

    Soybean lipoxygenase-1 (SLO-1) catalyzes the C-H abstraction from the reactive carbon (C-11) in linoleic acid as the first and rate-determining step in the formation of alkylhydroperoxides. While previous labeling strategies have focused on deuterium labeling to ascertain the primary and secondary kinetic isotope effects for this reaction, there is an emerging interest and need for selectively enriched (13)C isotopologues. In this report, we present synthetic strategies for site-specific (13)C labeled linoleic acid substrates. We take advantage of a Corey-Fuchs formyl to terminal (13)C-labeled alkyne conversion, using (13)CBr4 as the labeling source, to reduce the number of steps from a previous fatty acid (13)C synthetic labeling approach. The labeled linoleic acid substrates are useful as nuclear tunneling markers and for extracting active site geometries of the enzyme-substrate complex in lipoxygenase.

  12. Polyamines are essential for the synthesis of 2-ricinoleoyl phosphatidic acid in developing seeds of castor.

    PubMed

    Tomosugi, Mitsuhiro; Ichihara, Ken'ichi; Saito, Kazumi

    2006-01-01

    The major fatty acid component of castor (Ricinus communis L.) oil is ricinoleic acid (12-hydroxy-cis-9-octadecenoic acid), and unsaturated hydroxy acid accounts for >85% of the total fatty acids in triacylglycerol (TAG). TAG had a higher ricinoleate content at position 2 than at positions 1 and 3. Although lysophosphatidic acid (LPA) acyltransferase (EC 2.3.1.51), which catalyzes acylation of LPA at position 2, was expected to utilize ricinoleoyl-CoA preferentially over other fatty acyl-CoAs, no activity was found for ricinoleoyl-CoA in vitro at concentrations at which other unsaturated acyl-CoAs were incorporated rapidly. However, activity for ricinoleoyl-CoA appeared with addition of polyamines (putrescine, spermidine, and spermine), while polyamines decreased the rates of incorporation of other acyl-CoAs into position 2. The order of effect of polyamines on LPA acyltransferase activity was spermine > spermidine > putrescine. At concentrations of spermine and spermidine of >0.1 mM, ricinoleoyl-CoA served as an effective substrate for LPA acyltransferase reaction. The concentrations of spermine and spermidine in the developing seeds were estimated at approximately 0.09 and approximately 0.63 mM, respectively. These stimulatory effects for incorporation of ricinoleate were specific to polyamines, but basic amino acids were ineffective as cations. In contrast, in microsomes from safflower seeds that do not contain ricinoleic acid, spermine and spermidine stimulated the LPA acyltransferase reaction for all acyl-CoAs tested, including ricinoleoyl-CoA. Although the fatty acid composition of TAG depends on both acyl-CoA composition in the cell and substrate specificity of acyltransferases, castor bean polyamines are crucial for incorporation of ricinoleate into position 2 of LPA. Polyamines are essential for synthesis of 2-ricinoleoyl phosphatidic acid in developing castor seeds.

  13. Quantifying protein synthesis and degradation in Arabidopsis by dynamic 13CO2 labeling and analysis of enrichment in individual amino acids in their free pools and in protein.

    PubMed

    Ishihara, Hirofumi; Obata, Toshihiro; Sulpice, Ronan; Fernie, Alisdair R; Stitt, Mark

    2015-05-01

    Protein synthesis and degradation represent substantial costs during plant growth. To obtain a quantitative measure of the rate of protein synthesis and degradation, we supplied (13)CO2 to intact Arabidopsis (Arabidopsis thaliana) Columbia-0 plants and analyzed enrichment in free amino acids and in amino acid residues in protein during a 24-h pulse and 4-d chase. While many free amino acids labeled slowly and incompletely, alanine showed a rapid rise in enrichment in the pulse and a decrease in the chase. Enrichment in free alanine was used to correct enrichment in alanine residues in protein and calculate the rate of protein synthesis. The latter was compared with the relative growth rate to estimate the rate of protein degradation. The relative growth rate was estimated from sequential determination of fresh weight, sequential images of rosette area, and labeling of glucose in the cell wall. In an 8-h photoperiod, protein synthesis and cell wall synthesis were 3-fold faster in the day than at night, protein degradation was slow (3%-4% d(-1)), and flux to growth and degradation resulted in a protein half-life of 3.5 d. In the starchless phosphoglucomutase mutant at night, protein synthesis was further decreased and protein degradation increased, while cell wall synthesis was totally inhibited, quantitatively accounting for the inhibition of growth in this mutant. We also investigated the rates of protein synthesis and degradation during leaf development, during growth at high temperature, and compared synthesis rates of Rubisco large and small subunits of in the light and dark.

  14. Effect of penicillin on fatty acid synthesis and excretion in Streptococcus mutans BHT

    SciTech Connect

    Brissette, J.L.; Pieringer, R.A.

    1985-03-01

    Treatment of exponentially growing cultures of Streptococcus mutans BHT with growth-inhibitory concentrations (0.2 microgram/ml) of benzylpenicillin stimulates the incorporation of (2-/sup 14/C) acetate into lipids excreted by the cells by as much as 69-fold, but does not change the amount of /sup 14/C incorporated into intracellular lipids. At this concentration of penicillin cellular lysis does not occur. The radioactive label is incorporated exclusively into the fatty acid moieties of the glycerolipids. During a 4-hr incubation in the presence of penicillin, the extracellular fatty acid ester concentration increases 1.5 fold, even though there is no growth or cellular lysis. An indication of the relative rate of fatty acid synthesis was most readily obtained by placing S. mutans BHT in a buffer containing /sup 14/C-acetate. Under these nongrowing conditions free fatty acids are the only lipids labeled, a factor which simplifies the assay. The addition of glycerol to the buffer causes all of the nonesterified fatty acids to be incorporated into glycerolipid. The cells excrete much of the lipid whether glycerol is present or not. Addition of penicillin to the nongrowth supporting buffer system does not stimulate the incorporation of (/sup 14/C)-acetate into fatty acids.

  15. Hyaluronic acid synthesis is required for zebrafish tail fin regeneration

    PubMed Central

    Ouyang, Xiaohu; Panetta, Nicholas J.; Talbott, Maya D.; Payumo, Alexander Y.; Halluin, Caroline; Longaker, Michael T.

    2017-01-01

    Using genome-wide transcriptional profiling and whole-mount expression analyses of zebrafish larvae, we have identified hyaluronan synthase 3 (has3) as an upregulated gene during caudal fin regeneration. has3 expression is induced in the wound epithelium within hours after tail amputation, and its onset and maintenance requires fibroblast growth factor, phosphoinositide 3-kinase, and transforming growth factor-ß signaling. Inhibition of hyaluronic acid (HA) synthesis by the small molecule 4-methylumbelliferone (4-MU) impairs tail regeneration in zebrafish larvae by preventing injury-induced cell proliferation. In addition, 4-MU reduces the expression of genes associated with wound epithelium and blastema function. Treatment with glycogen synthase kinase 3 inhibitors rescues 4-MU-induced defects in cell proliferation and tail regeneration, while restoring a subset of wound epithelium and blastema markers. Our findings demonstrate a role for HA biosynthesis in zebrafish tail regeneration and delineate its epistatic relationships with other regenerative processes. PMID:28207787

  16. Total Synthesis of Five Lipoteichoic acids of Clostridium difficile.

    PubMed

    Hogendorf, Wouter F J; Gisch, Nicolas; Schwudke, Dominik; Heine, Holger; Bols, Mikael; Pedersen, Christian Marcus

    2014-10-13

    The emergence of hypervirulent resistant strains have made Clostridium difficile a notorious nosocomial pathogen and has resulted in a renewed interest in preventive strategies, such as vaccines based on (synthetic) cell wall antigens. Recently, the structure of the lipoteichoic acid (LTA) of this species has been elucidated. Additionally, this LTA was found to induce the formation of protective antibodies against C. difficile in rabbits and mice. The LTA from C. difficile is isolated as a microheterogenous mixture, differing in size and composition, impeding any structure-activity relationship studies. To ensure reliable biological results, pure and well-defined synthetic samples are required. In this work the total synthesis of LTAs from C. difficile with defined chain length is described and the initial biological results are presented.

  17. Synthesis and characterization of 2-mercaptoethanesulfonic acid albumin.

    PubMed

    Bauer, H H; Ehmig, S; Engels, J W; Voelcker, G

    1998-06-01

    Autoimmune patients treated with ifosfamide (CAS 3778-73-2) and mesna (2-mercaptoethanesulfonic acid, CAS 3375-50-6) in some cases suffered from severe allergic reactions that were proposed to be due to mesna linked to serum albumin by a disulfide bond. To prove the existence of the hypothetic mesna albumin adduct in vivo it was synthesized: The free thiol group of albumin (molecular mass determined by MALDI spectroscopy: 67009 Da) was converted to S-phenylsulfonyl albumin and reacted with mesna to albumin mesna (molecular mass: 67159 Da). In an alternative synthesis albumin was incubated with mesna at pH 8, 40 degrees C (molecular mass of the adduct: 67166 Da).

  18. The rate of synthesis and decomposition of tissue proteins in hypokinesia and increased muscular activity

    NASA Technical Reports Server (NTRS)

    Fedorov, I. V.; Chernyy, A. V.; Fedorov, A. I.

    1978-01-01

    During hypokinesia and physical loading (swimming) of rats, the radioactivity of skeletal muscle, liver, kidney, heart, and blood proteins was determined after administration of radioactive amino acids. Tissue protein synthesis decreased during hypokinesia, and decomposition increased. Both synthesis and decomposition increased during physical loading, but anabolic processes predominated in the total tissue balance. The weights of the animals decreased in hypokinesia and increased during increased muscle activity.

  19. Competition for transport of amino acids into rat heart: effect of competitors on protein synthesis and degradation.

    PubMed

    Tovar, A R; Tews, J K; Torres, N; Madsen, D C; Harper, A E

    1992-09-01

    Transport of the neutral amino acids, 2-(methylamino)isobutyrate (MeAIB) and Phe, was examined in isolated rat hearts perfused by the Langendorff method. Hearts were perfused by recirculating for various time periods buffer containing [14C]-MeAIB or [14C]-Phe plus desired additions. Uptake of MeAIB was linear for approximately 30 minutes; Phe uptake was linear for a maximum of 5 minutes, and reached a steady state after 15 minutes. Km and Vmax for MeAIB were 1.1 +/- 0.03 mmol/L and 37.7 +/- 0.4 pmol/microL intracellular fluid (ICF)/min; values for Phe were 1.8 +/- 0.02 mmol/L and 364 +/- 5 pmol/microL ICF/minute. Uptake of MeAIB (0.2 mmol/L) was reduced 95% in the presence of Ser (10 mmol/L), and less severely by large neutral amino acids ([LNAA], 10 mmol/L) such as Phe and Leu (by 46% and 54%, respectively). Uptake of Phe (0.2 mmol/L) was reduced by LNAA such as Val, Leu, and Ile (by 51%, 78%, and 81%, respectively), or by commercial preparations used in parenteral nutrition, eg, Travasol or Travasol plus extra branched-chain amino acids (BCAA) (Branchamin); Ser had little effect (8% reduction). Insulin in the perfusion medium increased the fractional rate of protein synthesis. Individual BCAA at physiological concentrations (0.2 mmol/L) did not alter the rate of protein synthesis. Branchamin or Travasol plus Branchamin also had no effect on the rate of protein synthesis in heart, but did depress the rate of degradation. These studies suggest that amino acid transport into heart may be affected by normal levels of plasma amino acids, whereas protein synthesis is not.

  20. Dietary crude protein intake influences rates of whole-body protein synthesis in weanling horses.

    PubMed

    Tanner, S L; Wagner, A L; Digianantonio, R N; Harris, P A; Sylvester, J T; Urschel, K L

    2014-11-01

    The objective of this study was to measure whole-body protein kinetics in weanling horses receiving forage and one of two different concentrates: (1) commercial crude protein (CCP) concentrate, which with the forage provided 4.1 g CP/kg bodyweight (BW)/day (189 mg lysine (Lys)/kg BW/day), and (2) recommended crude protein (RCP) concentrate which, with the same forage, provided 3.1 g CP/kg BW/day (194 mg Lys/kg BW/day). Blood samples were taken to determine the response of plasma amino acid concentrations to half the daily concentrate allocation. The next day, a 2 h-primed, constant infusion of [(13)C]sodium bicarbonate and a 4 h-primed, constant infusion of [1-(13)C]phenylalanine were used with breath and blood sampling to measure breath (13)CO2 and blood [(13)C]phenylalanine enrichment. Horses on the CCP diet showed an increase from baseline in plasma isoleucine, leucine, lysine, threonine, valine, alanine, arginine, asparagine, glutamine, ornithine, proline, serine, and tyrosine at 120 min post-feeding. Baseline plasma amino acid concentrations were greater with the CCP diet for histidine, isoleucine, leucine, threonine, valine, asparagine, proline, and serine. Phenylalanine, lysine, and methionine were greater in the plasma of horses receiving the RCP treatment at 0 and 120 min. Phenylalanine intake was standardized between groups; however, horses receiving the RCP diet had greater rates of phenylalanine oxidation (P = 0.02) and lower rates of non-oxidative phenylalanine disposal (P = 0.04). Lower whole-body protein synthesis indicates a limiting amino acid in the RCP diet.

  1. Ribosomal analysis of rapid rates of protein synthesis in the Antarctic sea urchin Sterechinus neumayeri.

    PubMed

    Pace, Douglas A; Maxson, Robert; Manahan, Donal T

    2010-02-01

    Previous research has shown that developing stages of the Antarctic sea urchin Sterechinus neumayeri have high rates of protein synthesis that are comparable to those of similar species living in much warmer waters. Direct measurements of the biosynthetic capacities of isolated ribosomes have not been reported for marine organisms living in the extreme-cold environment of Antarctica. Such measurements are required for a mechanistic understanding of how the critical and highly complex processes involved in protein synthesis are regulated in animals living in the coldest marine environment on Earth (< -1 degrees C). We tested the hypothesis that high rates of protein synthesis in the cold are a direct result of high biosynthetic capacities of ribosomes engaged in protein synthesis. Our results show that the rate at which ribosomes manufacture proteins (i.e., the peptide elongation rate) at -1 degrees C is surprisingly similar to rates measured in other sea urchin species at temperatures that are over 15 degrees C warmer. Average peptide elongation rates for a range of developmental stages of the Antarctic sea urchin were 0.36 codons s(-1) (+/- 0.05, SE). On the basis of subcellular rate determinations of ribosomal activity, we calculated stage-specific rates of protein synthesis for blastulae and gastrulae to be 3.7 and 6.5 ng protein h(-1), respectively. These findings support the conclusion that the high rates of biosynthesis previously reported for the Antarctic sea urchin are an outcome of high ribosomal activities.

  2. Synthesis of some glucose-fatty acid esters by lipase from Candida antarctica and their emulsion functions.

    PubMed

    Ren, Kangzi; Lamsal, Buddhi P

    2017-01-01

    The synthesis of glucose esters with palmitic acid, lauric acid and hexanoic acid using lipase enzyme was studied and their emulsion functionality in oil-in-water system were compared. Reactions at 3:1M ratio of fatty acids-to-glucose had the highest conversion percentages (over 90% for each of the fatty acid). Initial conversion rate increased as substrate solubility increased. Ester bond formation was confirmed by nuclear magnetic resonance technique that the chemical shifts of glucose H-6 and α-carbon protons of fatty acids in the ester molecules shifted to the higher fields. Contact angle of water on esters' pelleted surface increased as the hydrophobicity increased. Glucose esters' and commercial sucrose esters' functionality as emulsifiers were compared. Glucose esters delayed, but did not prevent coalescence, because the oil droplets diameter doubled during 7days. Sucrose esters prevented coalescence during 7days since the droplets diameter did not have significant change.

  3. Senescence in isolated carnation petals : effects of indoleacetic Acid and inhibitors of protein synthesis.

    PubMed

    Wulster, G; Sacalis, J; Janes, H W

    1982-10-01

    Indoleacetic acid induces senescence in isolated carnation (Dianthus caryophyllus, cv. White Sim) petals, increasing the duration and amount of ethylene production. This effect is inhibited by Actinomycin D, an inhibitor of RNA synthesis, and cycloheximide, a translational inhibitor of protein synthesis. The ability of petals to respond to indoleacetic acid appears to be a function of physiological age. Indoleacetic acid is capable of enhancing ethylene evolution and senescence only in specific portions of the petal.

  4. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  5. Enantiospecific Synthesis of a Genetically Encodable Fluorescent Unnatural Amino Acid L-3-(6-Acetylnaphthalen-2-ylamino)-2-aminopropanoic Acid

    PubMed Central

    Xiang, Zheng; Wang, Lei

    2011-01-01

    Fluorescent unnatural amino acids (Uaas), when genetically incorporated into proteins, can provide unique advantages for imaging biological processes in vivo. Synthesis of optically pure L-enantiomer of fluorescent Uaas is crucial for their effective application in live cells. An efficient six-step synthesis of L-3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (L-Anap), a genetically encodable and polarity-sensitive fluorescent Uaa, has been developed. The synthesis takes advantage of a high-yield and enantiospecific Fukuyama-Mitsunobu reaction as the key transformation. PMID:21732687

  6. Synthesis and photochromic property of nanosized amino acid polyoxometalate compounds

    NASA Astrophysics Data System (ADS)

    Sun, Dehui; Zhang, Jilin; Ren, Huijuan; Cui, Zhenfeng

    2009-07-01

    A series of novel nanosized amino acid-polyoxometalate compounds were successfully synthesized using a low temperature solid-state chemical reaction method. Their compositions, structures, morphologies, photochromic properties were characterized by ICP-AES/MS, TG/DTA, FTIR, XRD, SEM and UV-Vis diffuse reflectance spectra (DRS), respectively. The elemental analysis results showed that the compounds ((HThr)7PMo12O42•4H2O, (HTyr)7PMo12O42Â.5H2O, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O) were obtained. The analyses of the TG/DTA, XRD and FTIR confirmed that the four compounds are new phases different from the corresponding reactants and they are composed of the polyoxometalate anions and the corresponding protonated amino acids, respectively. Observation of the SEM revealed that the particle shape (e.g. (HThr)7PMo12O42Â.4H2O nanoplates, (HTyr)7PMo12O42•5H2O nanorods, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O nanoparticles) depended strongly on the structures of amino acids. This implied that the amino acids can play a structural template agent role in synthesis of the Silverton-type polyoxometalate compounds. After irradiated with ultraviolet light, these samples all exhibited photochromism. Their photochromic mechanism may be explained based on Yamase's photochromic model. These photochromic compounds could be applied to the field of photosensitive materials.

  7. Excessive energy intake does not modify fed-state tissue protein synthesis rates in adult rats.

    PubMed

    Adéchian, Solange; Giardina, Silvana; Rémond, Didier; Papet, Isabelle; Buonocore, Daniela; Gaudichon, Claire; Dardevet, Dominique; Marzatico, Fulvio; Mosoni, Laurent

    2009-07-01

    The impact of chronic excessive energy intake on protein metabolism is still controversial. Male Wistar rats were fed ad libitum during 5 weeks with either a high-fat high-sucrose diet (HF: n = 9) containing 45% of total energy as lipids (protein 14%; carbohydrate 40% with 83.5% sucrose) or a standard diet (controls: n = 10). Energy intake and body weight were recorded. At the end of the experiment, we measured body composition, metabolic parameters (plasma amino acid, lipid, insulin, and glucose levels), inflammatory parameter (plasma alpha2-macroglobulin), oxidative stress parameters (antioxidant enzyme activities, lipoperoxidation (LPO), protein carbonyl content in liver and muscle), and in vivo fed-state fractional protein synthesis rates (FSRs) in muscle and liver. Energy intake was significantly higher in HF compared with control rats (+28%). There were significant increases in body weight (+8%), body fat (+21%), renal (+41%), and epidydimal (+28%) fat pads in HF compared with control rats. No effect was observed in other tissue weights (liver, muscle, spleen, kidneys, intestine). Liver and muscle FSRs, plasma levels of lipids, glucose, insulin and alpha2-macroglobulin, soleus and liver glutathione reductase and peroxidase activities, MnSOD activity, LPO, and protein carbonyl content were not altered by the HF diet. Only soleus muscle and liver Cu/ZnSOD activity and soleus muscle catalase activities were reduced in HF rats compared with control rats. Thus, chronic excessive energy intake and increased adiposity, in the absence of other metabolic alterations, do not stimulate fed-state tissue protein synthesis rates.

  8. The control of fatty acid and triglyceride synthesis in rat epididymal adipose tissue. Roles of coenzyme A derivatives, citrate and l-glycerol 3-phosphate

    PubMed Central

    Denton, R. M.; Halperin, M. L.

    1968-01-01

    1. Methods are described for the extraction and assay of acetyl-CoA and of total acid-soluble and total acid-insoluble CoA derivatives in rat epididymal adipose tissue. 2. The concentration ranges of the CoA derivatives in fat pads incubated in vitro under various conditions were: total acid-soluble CoA, 0·20–0·59mm; total acid-insoluble CoA, 0·08–0·23mm; acetyl-CoA, 0·03–0·14mm. 3. An investigation was made of some postulated mechanisms of control of fatty acid and triglyceride synthesis in rat epididymal fat pads incubated in vitro. The concentrations of intermediates of possible regulatory significance were measured at various rates of fatty acid and triglyceride synthesis produced by the addition to the incubation medium (Krebs bicarbonate buffer containing glucose) of insulin, adrenaline, albumin, palmitate or acetate. 4. The whole-tissue concentrations of glucose 6-phosphate, l-glycerol 3-phosphate, citrate, acetyl-CoA, total acid-soluble CoA and total acid-insoluble CoA were assayed after 30 or 60min. incubation. The rates of fatty acid and triglyceride synthesis, calculated from the incorporation of [U-14C]glucose into fatty acids and glyceride glycerol respectively, and the rates of glucose uptake, lactate plus pyruvate output and glycerol output were measured over a 60min. incubation. 5. The rate of triglyceride synthesis could not be correlated with the concentrations of either l-glycerol 3-phosphate or long-chain fatty acyl-CoA (measured as total acid-insoluble CoA). Factor(s) other than the whole-tissue concentrations of these recognized precursors appear to be involved in the determination of the rate of triglyceride synthesis. 6. No relationship was found between the rate of fatty acid synthesis and the whole-tissue concentrations of the intermediates, citrate or acetyl-CoA, or with the two proposed effectors of acetyl-CoA carboxylase, citrate (as activator) or long-chain fatty acyl-CoA (as inhibitor). The control of fatty acid synthesis

  9. Skeletal Muscle Myofibrillar and Sarcoplasmic Protein Synthesis Rates Are Affected Differently by Altitude-Induced Hypoxia in Native Lowlanders

    PubMed Central

    Holm, Lars; Haslund, Mads Lyhne; Robach, Paul; van Hall, Gerrit; Calbet, Jose A. L.; Saltin, Bengt; Lundby, Carsten

    2010-01-01

    As a consequence to hypobaric hypoxic exposure skeletal muscle atrophy is often reported. The underlying mechanism has been suggested to involve a decrease in protein synthesis in order to conserve O2. With the aim to challenge this hypothesis, we applied a primed, constant infusion of 1-13C-leucine in nine healthy male subjects at sea level and subsequently at high-altitude (4559 m) after 7–9 days of acclimatization. Physical activity levels and food and energy intake were controlled prior to the two experimental conditions with the aim to standardize these confounding factors. Blood samples and expired breath samples were collected hourly during the 4 hour trial and vastus lateralis muscle biopsies obtained at 1 and 4 hours after tracer priming in the overnight fasted state. Myofibrillar protein synthesis rate was doubled; 0.041±0.018 at sea-level to 0.080±0.018%⋅hr−1 (p<0.05) when acclimatized to high altitude. The sarcoplasmic protein synthesis rate was in contrast unaffected by altitude exposure; 0.052±0.019 at sea-level to 0.059±0.010%⋅hr−1 (p>0.05). Trends to increments in whole body protein kinetics were seen: Degradation rate elevated from 2.51±0.21 at sea level to 2.73±0.13 µmol⋅kg−1⋅min−1 (p = 0.05) at high altitude and synthesis rate similar; 2.24±0.20 at sea level and 2.43±0.13 µmol⋅kg−1⋅min−1 (p>0.05) at altitude. We conclude that whole body amino acid flux is increased due to an elevated protein turnover rate. Resting skeletal muscle myocontractile protein synthesis rate was concomitantly elevated by high-altitude induced hypoxia, whereas the sarcoplasmic protein synthesis rate was unaffected by hypoxia. These changed responses may lead to divergent adaptation over the course of prolonged exposure. PMID:21187972

  10. Experimental particle formation rates spanning tropospheric sulfuric acid and ammonia abundances, ion production rates, and temperatures

    NASA Astrophysics Data System (ADS)

    Kürten, Andreas; Bianchi, Federico; Almeida, Joao; Kupiainen-Määttä, Oona; Dunne, Eimear M.; Duplissy, Jonathan; Williamson, Christina; Barmet, Peter; Breitenlechner, Martin; Dommen, Josef; Donahue, Neil M.; Flagan, Richard C.; Franchin, Alessandro; Gordon, Hamish; Hakala, Jani; Hansel, Armin; Heinritzi, Martin; Ickes, Luisa; Jokinen, Tuija; Kangasluoma, Juha; Kim, Jaeseok; Kirkby, Jasper; Kupc, Agnieszka; Lehtipalo, Katrianne; Leiminger, Markus; Makhmutov, Vladimir; Onnela, Antti; Ortega, Ismael K.; Petäjä, Tuukka; Praplan, Arnaud P.; Riccobono, Francesco; Rissanen, Matti P.; Rondo, Linda; Schnitzhofer, Ralf; Schobesberger, Siegfried; Smith, James N.; Steiner, Gerhard; Stozhkov, Yuri; Tomé, António; Tröstl, Jasmin; Tsagkogeorgas, Georgios; Wagner, Paul E.; Wimmer, Daniela; Ye, Penglin; Baltensperger, Urs; Carslaw, Ken; Kulmala, Markku; Curtius, Joachim

    2016-10-01

    Binary nucleation of sulfuric acid and water as well as ternary nucleation involving ammonia are thought to be the dominant processes responsible for new particle formation (NPF) in the cold temperatures of the middle and upper troposphere. Ions are also thought to be important for particle nucleation in these regions. However, global models presently lack experimentally measured NPF rates under controlled laboratory conditions and so at present must rely on theoretical or empirical parameterizations. Here with data obtained in the European Organization for Nuclear Research CLOUD (Cosmics Leaving OUtdoor Droplets) chamber, we present the first experimental survey of NPF rates spanning free tropospheric conditions. The conditions during nucleation cover a temperature range from 208 to 298 K, sulfuric acid concentrations between 5 × 105 and 1 × 109 cm-3, and ammonia mixing ratios from zero added ammonia, i.e., nominally pure binary, to a maximum of 1400 parts per trillion by volume (pptv). We performed nucleation studies under pure neutral conditions with zero ions being present in the chamber and at ionization rates of up to 75 ion pairs cm-3 s-1 to study neutral and ion-induced nucleation. We found that the contribution from ion-induced nucleation is small at temperatures between 208 and 248 K when ammonia is present at several pptv or higher. However, the presence of charges significantly enhances the nucleation rates, especially at 248 K with zero added ammonia, and for higher temperatures independent of NH3 levels. We compare these experimental data with calculated cluster formation rates from the Atmospheric Cluster Dynamics Code with cluster evaporation rates obtained from quantum chemistry.

  11. Hydrothermal synthesis spherical TiO2 and its photo-degradation property on salicylic acid

    NASA Astrophysics Data System (ADS)

    Guo, Wenlu; Liu, Xiaolin; Huo, Pengwei; Gao, Xun; Wu, Di; Lu, Ziyang; Yan, Yongsheng

    2012-07-01

    Anatase TiO2 spheres have been prepared using hydrothermal synthesis. The prepared spheres were characterized by X-ray diffraction (XRD), scanning electron microscope (SEM) and UV-vis diffuse reflectance spectra (UV-vis DRS). The TiO2 consisted of well-defined spheres with size of 3-5 μm. The photocatalytic activity of spherical TiO2 was determined by degradation of salicylic acid under visible light irradiation. It was revealed that the degradation rate of the spherical TiO2 which was processed at 150 °C for 48 h could reach 81.758%. And the kinetics of photocatalytic degradation obeyed first-order kinetic, which the rate constant value was 0.01716 S-1 of the salicylic acid onto TiO2 (temperature: 150, time: 48 h). The kinetics of adsorption followed the pseudo-second-order model and the rate constant was 1.2695 g mg-1 of the salicylic acid onto TiO2 (temperature: 150, time: 48 h).

  12. RIBONUCLEIC ACID SYNTHESIS DURING MITOSIS AND MEIOSIS IN THE MOUSE TESTIS

    PubMed Central

    Monesi, Valerio

    1964-01-01

    The pattern of ribonucleic acid synthesis during germ cell development, from the stem cell to the mature spermatid, was studied in the mouse testis, by using uridine-H3 or cytidine-H3 labeling and autoradiography. Incorporation of tritiated precursors into the RNA occurs in spermatogonia, resting primary spermatocytes (RPS), throughout the second half of pachytene stage up to early diplotene, and in the Sertoli cells. Cells in leptotene, zygotene, and in the first half of pachytene stage do not synthesize RNA. No RNA synthesis was detected in meiotic stages later than diplotene, with the exception of a very low rate of incorporation in a fraction of secondary spermatocytes and very early spermatids. At long intervals after administration of the tracer, as labeled cells develop to more mature stages, late stages of spermatogenesis also become labeled. The last structures to become labeled are the residual bodies of Regaud. Thus, the RNA synthesized during the active meiotic stages is partially retained within the cell during further development. The rate of RNA synthesis declines gradually with the maturation from type A to intermediate to type B spermatogonia and to resting primary spermatocytes. "Dormant" type A spermatogonia synthesize little or no RNA. The incorporation of RNA precursors occurs exclusively within the nucleus: at later postinjection intervals the cytoplasm also becomes labeled. In spermatogonia all mitotic stages, except metaphase and anaphase, were shown to incorporate uridine-H3. RNA synthesis is then a continuous process throughout the cell division cycle in spermatogonia (generation time about 30 hours), and stops only for a very short interval (1 hour) during metaphase and anaphase. PMID:14206420

  13. Synthesis of hybrid hydrazino peptides: protected vs unprotected chiral α-hydrazino acids.

    PubMed

    Suć, Josipa; Jerić, Ivanka

    2015-01-01

    Peptidomimetics based on hydrazino derivatives of α-amino acids represent an important class of peptidic foldamers with promising biological activities, like protease inhibition and antimicrobial activity. However, the lack of straightforward method for the synthesis of optically pure hydrazino acids and efficient incorporation of hydrazino building blocks into peptide sequence hamper wider exploitation of hydrazino peptidomimetics. Here we described the utility of N (α)-benzyl protected and unprotected hydrazino derivatives of natural α-amino acids in synthesis of peptidomimetics. While incorporation of N (α)-benzyl-hydrazino acids into peptide chain and deprotection of benzyl moiety proceeded with difficulties, unprotected hydrazino acids allowed fast and simple construction of hybrid peptidomimetics.

  14. A convenient synthesis of anthranilic acids by Pd-catalyzed direct intermolecular ortho-C-H amidation of benzoic acids.

    PubMed

    Ng, Ka-Ho; Ng, Fo-Ning; Yu, Wing-Yiu

    2012-12-11

    An efficient method for synthesis of anthranilic acids by Pd-catalyzed ortho-C-H amidation of benzoic acids is disclosed. The amidation is proposed to proceed by carboxylate-assisted ortho-C-H palladation to form an arylpalladium(II) complex, followed by nitrene insertion to the Pd-C bond.

  15. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  16. DFT study of the Lewis acid mediated synthesis of 3-acyltetramic acids.

    PubMed

    Mikula, Hannes; Svatunek, Dennis; Skrinjar, Philipp; Horkel, Ernst; Hametner, Christian; Fröhlich, Johannes

    2014-05-01

    The synthesis of 3-acyltetramic acids by C-acylation of pyrrolidine-2,4-diones was studied by density functional theory (DFT). DFT was applied to the mycotoxin tenuazonic acid (TeA), an important representative of these bioactive natural compounds. Lewis acid mediated C-acylation in combination with previous pH-neutral domino N-acylation-Wittig cyclization can be used for the efficient preparation of 3-acyltetramic acids. Nevertheless, quite harsh conditions are still required to carry out this synthetic step, leading to unwanted isomerization of stereogenic centers in some cases. In the presented study, the reaction pathway for the C-acetylation of (5S,6S-5-s-butylpyrrolidine-2,4-dione was studied in terms of mechanism, solvent effects, and Lewis acid activation, in order to obtain an appropriate theoretical model for further investigations. Crucial steps were identified that showed rather high activation barriers and rationalized previously reported experimental discoveries. After in silico optimization, aluminum chlorides were found to be promising Lewis acids that promote the C-acylation of pyrrolidine-2,4-diones, whereas calculations performed in various organic solvents showed that the solvent had only a minor effect on the energy profiles of the considered mechanisms. This clearly indicates that further synthetic studies should focus on the Lewis-acidic mediator rather than other reaction parameters. Additionally, given the results obtained for different reaction routes, the stereochemistry of this C-acylation is discussed. It is assumed that the formation of Z-configured TeA is favored, in good agreement with our previous studies.

  17. On the Rate of Synthesis of Individual Proteins within and between Different Striated Muscles of the Rat

    PubMed Central

    Hesketh, Stuart; Srisawat, Kanchana; Sutherland, Hazel; Jarvis, Jonathan; Burniston, Jatin

    2016-01-01

    The turnover of muscle protein is responsive to different (patho)-physiological conditions but little is known about the rate of synthesis at the level of individual proteins or whether this varies between different muscles. We investigated the synthesis rate of eight proteins (actin, albumin, ATP synthase alpha, beta enolase, creatine kinase, myosin essential light chain, myosin regulatory light chain and tropomyosin) in the extensor digitorum longus, diaphragm, heart and soleus of male Wistar rats (352 ± 30 g body weight). Animals were assigned to four groups (n = 3, in each), including a control and groups that received deuterium oxide (2H2O) for 4 days, 7 days or 14 days. Deuterium labelling was initiated by an intraperitoneal injection of 10 μL/g body weight of 99.9% 2H2O-saline, and was maintained by administration of 5% (v/v) 2H2O in drinking water provided ad libitum. Homogenates of the isolated muscles were analysed by 2-dimensional gel electrophoresis and matrix-assisted laser desorption ionisation time of flight mass spectrometry. Proteins were identified against the SwissProt database using peptide mass fingerprinting. For each of the eight proteins investigated, the molar percent enrichment (MPE) of 2H and rate constant (k) of protein synthesis was calculated from the mass isotopomer distribution of peptides based on the amino acid sequence and predicted number of exchangeable C–H bonds. The average MPE (2.14% ± 0.2%) was as expected and was consistent across muscles harvested at different times (i.e., steady state enrichment was achieved). The synthesis rate of individual proteins differed markedly within each muscle and the rank-order of synthesis rates differed among the muscles studied. After 14 days the fraction of albumin synthesised (23% ± 5%) was significantly (p < 0.05) greater than for other muscle proteins. These data represent the first attempt to study the synthesis rates of individual proteins across a number of different striated

  18. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  19. CHLORINATION OF AMINO ACIDS: REACTION PATHWAYS AND REACTION RATES.

    PubMed

    How, Zuo Tong; Linge, Kathryn; Busetti, Francesco; Joll, Cynthia A

    2017-03-15

    Chlorination of amino acids can result in the formation of organic monochloramines or organic dichloramines, depending on the chlorine to amino acid ratio (Cl:AA). After formation, organic chloramines degrade into aldehydes, nitriles and N-chloraldimines. In this paper, the formation of organic chloramines from chlorination of lysine, tyrosine and valine were investigated. Chlorination of tyrosine and lysine demonstrated that the presence of a reactive secondary group can increase the Cl:AA ratio required for the formation of N,N-dichloramines, and potentially alter the reaction pathways between chlorine and amino acids, resulting in the formation of unexpected by-products. In a detailed investigation, we report rate constants for all reactions in the chlorination of valine, for the first time, using experimental results and modelling. At Cl:AA = 2.8, the chlorine was found to first react quickly with valine (5.4x104 M-1 s-1) to form N-monochlorovaline, with a slower subsequent reaction with N-monochlorovaline to form N,N-dichlorovaline (4.9x102 M-1 s-1), although some N-monochlorovaline degraded into isobutyraldehyde (1.0x10-4 s-1). The N,N-dichlorovaline then competitively degraded into isobutyronitrile (1.3x10-4 s-1) and N-chloroisobutyraldimine (1.2x10-4 s-1). In conventional drinking water disinfection, N-chloroisobutyraldimine can potentially be formed in concentrations higher than its odour threshold concentration, resulting in aesthetic challenges and an unknown health risk.

  20. Nitrogen mineralization rates of the acidic, xeric soils of the New Jersey Pinelands: field rates

    SciTech Connect

    Poovarodom, S.; Tate, R.L. III; Bloom, R.A.

    1988-04-01

    Using the buried-bag procedure, the authors quantified nitrogen mineralization rates in the xeric, acidic Lakehurst, and Atsion sands of the New Jersey Pine Barrens. Average annual nitrogen yields in the upper 15 cm for the Lakehurst and the Atsion sands were 38.4 and 53.0 kg N/ha, corresponding to 4.5 and 2.5% of the total nitrogen, respectively. Net nitrogen mineralization in both soils exhibited distinct seasonal patterns with maxima in summer and minimum rates in the winter. Nitrification accounted for only 5% of the total N mineralized in both soils. This is consistent with the finding of low populations of autotrophic nitrifiers in these soils.

  1. Synthesis and cytotoxic activity of new betulin and betulinic acid esters with conjugated linoleic acid (CLA).

    PubMed

    Tubek, Barbara; Mituła, Paweł; Niezgoda, Natalia; Kempińska, Katarzyna; Wietrzyk, Joanna; Wawrzeńczyk, Czesław

    2013-04-01

    The synthesis of new ester derivatives of betulin (3a-c) and betulinic acid (4) with conjugated linoleic acid isomers (CLA; in a mixture of 43.4% 9c, 11t; 49.5% 10t, 12c; 7.1% other isomers) is presented. Esterification was carried out with N,N'-dicyclohexylcarbodiimide (DCC) as the coupling agent in the presence of 4-dimethylamino-pyridine (DMAP) in dichloromethane (or pyridine). The in vitro cytotoxic effect of betulin (1), betulinic acid (2), a mixture of CLA isomers and their derivatives (3a-c, 4) was examined using the MTT assay against four cancer cell lines (P388, CEM/C2, CCRF/CEM and HL-60) and the SRB assay on the HT-29 cell line. Ester 4 was the most active among the esters synthesized against the CEM/C2 cell line with an ID50 value 16.9 +/- 6.5 microg/mL. Betulin (1), betulinic acid (2) and CLA were the most active agents against the cancer cell lines studied.

  2. Antitumor effects of a drug combination targeting glycolysis, glutaminolysis and de novo synthesis of fatty acids.

    PubMed

    Cervantes-Madrid, Diana; Dueñas-González, Alfonso

    2015-09-01

    There is a strong rationale for targeting the metabolic alterations of cancer cells. The most studied of these are the higher rates of glycolysis, glutaminolysis and de novo synthesis of fatty acids (FAs). Despite the availability of pharmacological inhibitors of these pathways, no preclinical studies targeting them simultaneously have been performed. In the present study it was determined whether three key enzymes for glycolysis, glutaminolysis and de novo synthesis of FAs, hexokinase-2, glutaminase and fatty acid synthase, respectively, were overexpressed as compared to primary fibroblasts. In addition, we showed that at clinically relevant concentrations lonidamine, 6-diazo-5-oxo-L-norleucine and orlistat, known inhibitors of the mentioned enzymes, exerted a cell viability inhibitory effect. Genetic downregulation of the three enzymes also reduced cell viability. The three drugs were highly synergistic when administered as a triple combination. Of note, the cytotoxicity of the triple combination was low in primary fibroblasts and was well tolerated when administered into healthy BALB/c mice. The results suggest the feasibility and potential clinical utility of the triple metabolic targeting which merits to be further studied by using either repositioned old drugs or newer, more selective inhibitors.

  3. The Synthesis and Evaluation of Arctigenin Amino Acid Ester Derivatives.

    PubMed

    Cai, En-Bo; Yang, Li-Min; Jia, Cai-Xia; Zhang, Wei-Yuan; Zhao, Yan; Li, Wei; Song, Xing-Zhuo; Zheng, Man-Ling

    2016-10-01

    The use of arctigenin (ARG), a traditional medicine with many pharmacological activities, has been restricted due to its poor solubility in water. Five amino acid derivatives of ARG have been synthesized using glycine, o-alanine, valine, leucine, and isoleucine, which have t-butyloxy carbonyl (BOC) as a protective group. In this study, we examined the effects of removing these protective groups. The results showed that the amino acid derivatives have better solubility and nitrite-clearing ability than ARG. Among the compounds tested, the amino acid derivatives without protective group were the best. Based on these results, ARG and its two amino acid derivatives without protective group (ARG8, ARG10) were selected to evaluate their anti-tumor activity in vivo at a dosage of 40 mg/kg. The results indicated that ARG8 and ARG10 both exhibit more anti-tumor activity than ARG in H22 tumor-bearing mice. The tumor inhibition rates of ARG8 and ARG10 were 69.27 and 43.58%, which was much higher than ARG. Furthermore, the mice treated with these compounds exhibited less damage to the liver, kidney and immune organs compared with the positive group. Furthermore, ARG8 and ARG10 improved the serum cytokine levels significantly compared to ARG. In brief, this study provides a method to improve the water solubility of drugs, and we also provide a reference basis for new drug development.

  4. Synthesis of copper sulphide nanoparticles in carboxylic acids as solvent.

    PubMed

    Armelao, Lidia; Camozzo, Daniele; Gross, Silvia; Tondello, Eugenio

    2006-02-01

    A novel method for the preparation of CuS nanoparticles based on the fast nucleation of the sulphide has been developed. The particles have been synthesized by reaction of thioacetic acid with water and copper carboxylates (acetate, propionate) in the corresponding carboxylic acid (acetic, propionic) as a solvent. The use of carboxylic acids presents several advantages: (i) the hydrolysis of the C-S bond is favoured thus producing a fast CuS supersaturation and a high nucleation rate; (ii) the mobility of the precursor molecules is limited so that nucleation events are favoured with respect to particle growth; (iii) the low dielectric constant of the medium stabilises the nanoparticles dispersion by reducing the critical coagulation concentration. The prepared nanoparticles were investigated by UV-Vis spectroscopy, X-ray photoelectron spectroscopy, atomic force microscopy and dynamic light scattering. The nanoparticle suspensions are clear and characterized by a blue-shifted adsorption edge with respect to bulk CuS. Light scattering measurements performed on acetic acid suspensions evidence the formation of monodispersed nanoparticles with an average diameter of about 5 nm.

  5. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  6. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  7. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  8. Synthesis of monoacylglycerol containing pinolenic acid via stepwise esterification using a cold active lipase.

    PubMed

    Pyo, Young-Gil; Hong, Seung In; Kim, Yangha; Kim, Byung Hee; Kim, In-Hwan

    2012-01-01

    High purity monoacylglycerol (MAG) containing pinolenic acid was synthesized via stepwise esterification of glycerol and fatty acids from pine nut oil using a cold active lipase from Penicillium camembertii as a biocatalyst. Effects of temperature, molar ratio, water content, enzyme loading, and vacuum on the synthesis of MAG by lipase-catalyzed esterification of glycerol and fatty acid from pine nut oil were investigated. Diacylglycerol (DAG) as well as MAG increased significantly when temperature was increased from 20 to 40 °C. At a molar ratio of 1:1, MAG content decreased because of the significant increase in DAG content. Water has a profound influence on both MAG and DAG content through the entire course of reaction. The reaction rate increased significantly as enzyme loading increased up to 600 units. Vacuum was an effective method to reduce DAG content. The optimum temperature, molar ratio, water content, enzyme loading, vacuum, and reaction time were 20 °C, 1:5 (fatty acid to glycerol), 2%, 600 units, 5 torr, and 24 h, respectively. MAG content further increased via lipase-catalyzed second step esterification at subzero temperature. P. camembertii lipase exhibited esterification activity up to -30 °C.

  9. Synthesis of unnatural amino acids from serine derivatives by beta-fragmentation of primary alkoxyl radicals.

    PubMed

    Boto, Alicia; Gallardo, Juan A; Hernández, Dacil; Hernández, Rosendo

    2007-09-14

    The fragmentation of primary alkoxyl radicals has been scarcely used in synthesis since other competing processes (such as oxidation or hydrogen abstraction) usually predominate. However, when serine derivatives were used as substrates, the scission took place in excellent yields. Tandem scission-allylation, -alkylation, or -arylation reactions were subsequently developed. This one-pot methodology was applied to the synthesis of unnatural amino acids, which are useful synthetic blocks or amino acid surrogates in peptidomimetics.

  10. Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.

    PubMed

    Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide

    2012-05-18

    A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.

  11. Synthesis of stable C-linked ferrocenyl amino acids and their use in solution-phase peptide synthesis.

    PubMed

    Philip, Anijamol T; Chacko, Shibin; Ramapanicker, Ramesh

    2015-12-01

    Incorporation of ferrocenyl group to peptides is an efficient method to alter their hydrophobicity. Ferrocenyl group can also act as an electrochemical probe when incorporated onto functional peptides. Most often, ferrocene is incorporated onto peptides post-synthesis via amide, ester or triazole linkages. Stable amino acids containing ferrocene as a C-linked side chain are potentially useful building units for the synthesis of ferrocene-containing peptides. We report here an efficient route to synthesize ferrocene-containing amino acids that are stable and can be used in peptide synthesis. Coupling of 2-ferrocenyl-1,3-dithiane and iodides derived from aspartic acid or glutamic acid using n-butyllithium leads to the incorporation of a ferrocenyl unit to the δ-position or ε-position of an α-amino acid. The reduction or hydrolysis of the dithiane group yields an alkyl or an oxo derivative. The usability of the synthesized amino acids is demonstrated by incorporating one of the amino acids in both C-terminus and N-terminus of tripeptides in solution phase.

  12. Distribution, synthesis, and absorption of kynurenic acid in plants.

    PubMed

    Turski, Michal P; Turska, Monika; Zgrajka, Wojciech; Bartnik, Magdalena; Kocki, Tomasz; Turski, Waldemar A

    2011-05-01

    Kynurenic acid (KYNA) is an endogenous antagonist of the ionotropic glutamate receptors and the α7 nicotinic acetylcholine receptor as well as an agonist of the G-protein-coupled receptor GPR35. In this study, KYNA distribution and synthesis in plants as well as its absorption was researched. KYNA level was determined by means of the high-performance liquid chromatography with fluorescence detection. KYNA was found in leaves, flowers, and roots of tested medicinal herbs: dandelion (Taraxacum officinale), common nettle (Urtica dioica), and greater celandine (Chelidoniummajus). The highest concentration of this compound was detected in leaves of dandelion--a mean value of 0.49 µg/g wet weight. It was shown that KYNA can be synthesized enzymatically in plants from its precursor, L-kynurenine, or absorbed by plants from the soil. Finally, the content of KYNA was investigated in 21 herbal tablets, herbal tea, herbs in sachets, and single herbs in bags. The highest content of KYNA in a maximum daily dose of herbal medicines appeared in St. John's wort--33.75 µg (tablets) or 32.60 µg (sachets). The pharmacological properties of KYNA and its presence in high concentrations in medicinal herbs may suggest that it possesses therapeutic potential, especially in the digestive system and should be considered a new valuable dietary supplement.

  13. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  14. Evolution of abscisic acid synthesis and signaling mechanisms.

    PubMed

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I

    2011-05-10

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized.

  15. Is bacterial fatty acid synthesis a valid target for antibacterial drug discovery?

    PubMed

    Parsons, Joshua B; Rock, Charles O

    2011-10-01

    The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there is not a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements.

  16. A global synthesis of plant extinction rates in urban areas.

    PubMed

    Hahs, Amy K; McDonnell, Mark J; McCarthy, Michael A; Vesk, Peter A; Corlett, Richard T; Norton, Briony A; Clemants, Steven E; Duncan, Richard P; Thompson, Ken; Schwartz, Mark W; Williams, Nicholas S G

    2009-11-01

    Plant extinctions from urban areas are a growing threat to biodiversity worldwide. To minimize this threat, it is critical to understand what factors are influencing plant extinction rates. We compiled plant extinction rate data for 22 cities around the world. Two-thirds of the variation in plant extinction rates was explained by a combination of the city's historical development and the current proportion of native vegetation, with the former explaining the greatest variability. As a single variable, the amount of native vegetation remaining also influenced extinction rates, particularly in cities > 200 years old. Our study demonstrates that the legacies of landscape transformations by agrarian and urban development last for hundreds of years, and modern cities potentially carry a large extinction debt. This finding highlights the importance of preserving native vegetation in urban areas and the need for mitigation to minimize potential plant extinctions in the future.

  17. The inhibitory effect of glycolic acid and lactic acid on melanin synthesis in melanoma cells.

    PubMed

    Usuki, Akiko; Ohashi, Akiko; Sato, Hirofumi; Ochiai, Yasunobu; Ichihashi, Masamitsu; Funasaka, Yoko

    2003-01-01

    Alpha-hydroxy acids (AHAs) such as glycolic acid (GA) and lactic acid (LA) have been reported to be effective in treating pigmentary lesions such as melasma, solar lentigines, and postinflammatory hyperpigmentation. The mechanism of this effect might be due to epidermal remodeling and accelerated desquamation, which would result in quick pigment dispersion. However, the direct effect of AHAs on melanin synthesis has not yet been well studied. To elucidate such a direct effect of AHAs on melanogenesis, we performed melanin assays, growth curve determinations, Northern and Western blotting for melanogenic proteins [tyrosinase, tyrosinase related protein (TRP)-1 and TRP-2], and tyrosinase and, 4-dihydroxyphenylalaninechrome tautomerase enzyme activity assays using mouse B16 and human melanoma cells. GA or LA (at doses of 300 or 500 microg/ml) inhibited melanin formation in similar dose-dependent manner, without affecting cell growth. Although the mRNA and protein expression or molecular size of tyrosinase, TRP-1 and TRP-2 were not affected, tyrosinase activity was inhibited. To see whether GA and/or LA directly inhibit tyrosinase catalytic function, the effect of GA and LA on human tyrosinase purified from the melanosome-rich large granule fraction of human melanoma cells was performed. GA or LA were shown to inhibit tyrosinase enzyme activity directly, but this effect was not due to the acidity of GA or LA, because adjusting the pH to 5.6 (the pH of GA and LA at concentrations of 2500 microg/ml), did not affect tyrosinase activity. Taken together, these results show that GA and LA suppress melanin formation by directly inhibiting tyrosinase activity, an effect independent of their acidic nature. GA and LA might work on pigmentary lesions not only by accelerating the turnover of the epidermis but also by directly inhibiting melanin formation in melanocytes.

  18. Compendium and synthesis of bacterial manganese reduction rates

    NASA Astrophysics Data System (ADS)

    Bandstra, Joel Z.; Ross, Daniel E.; Brantley, Susan L.; Burgos, William D.

    2011-01-01

    We have compiled time-series concentration data for the biological reduction of manganese(III/IV) published between 1985 and 2004 and fit these data with a simple hyperbolic rate expression or, when appropriate, one of its limiting forms. The compiled data and rate constants are available in Electronic Annex EA-1. The zero- and first-order rate constants appear to follow a log-normal distribution that could be used, for example, in predictive modeling of Mn-oxide reduction in a reactive transport scenario. We have also included details of the experimental procedures used to generate each time-series data-set in our compilation. These meta-data—mostly pertaining to the type and concentration of micro-organism, electron donor, and electron acceptor—enable us to examine the rate data for trends. We have computed a number of rudimentary, mono-variate statistics on the compiled data with the hope of stimulating both more detailed statistical analyses of the data and new experiments to fill gaps in the existing data-set. We have also analyzed the data with parametric models based on the log-normal distribution and rate equations that are hyperbolic in the concentration of cells and Mn available for reduction. This parametric analysis allows us to provide best estimates of zero- and first-order rate constants both ignoring and accounting for the meta-data.

  19. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  20. β-Adrenergic receptor blockade blunts postexercise skeletal muscle mitochondrial protein synthesis rates in humans

    PubMed Central

    Robinson, Matthew M.; Bell, Christopher; Peelor, Frederick F.

    2011-01-01

    β-Adrenergic receptor (AR) signaling is a regulator of skeletal muscle protein synthesis and mitochondrial biogenesis in mice. We hypothesized that β-AR blockade blunts postexercise skeletal muscle mitochondrial protein synthesis rates in adult humans. Six healthy men (mean ± SD: 26 ± 6 yr old, 39.9 ± 4.9 ml·kg−1·min−1 peak O2 uptake, 26.7 ± 2.0 kg/m2 body mass index) performed 1 h of stationary cycle ergometer exercise (60% peak O2 uptake) during 1) β-AR blockade (intravenous propranolol) and 2) administration of saline (control). Skeletal muscle mitochondrial, myofibrillar, and sarcoplasmic protein synthesis rates were assessed using [2H5]phenylalanine incorporation into skeletal muscle proteins after exercise. The mRNA content of signals for mitochondrial biogenesis was determined using real-time PCR. β-AR blockade decreased mitochondrial (from 0.217 ± 0.076 to 0.135 ± 0.031%/h, P < 0.05), but not myofibrillar or sarcoplasmic, protein synthesis rates. Peroxisome proliferator-activated receptor-γ coactivator-1α mRNA was increased ∼2.5-fold (P < 0.05) at 5 h compared with 1 h postexercise but was not influenced by β-AR blockade. We conclude that decreased β-AR signaling during cycling can blunt the postexercise increase in mitochondrial protein synthesis rates without affecting mRNA content. PMID:21613574

  1. Eicosanoid synthesis in cardiomyocytes: influence of hypoxia, reoxygenation, and polyunsaturated fatty acids.

    PubMed

    Oudot, F; Grynberg, A; Sergiel, J P

    1995-01-01

    The synthesis of eicosanoids was investigated in cultured rat ventricular myocytes. Under normoxia, the cardiomyocytes released 6-ketoprostaglandin F1 alpha (6-keto-PGF1 alpha) and prostaglandin (PG) E2 and smaller amounts of PGF2 alpha and thromboxane B2. Hypoxia enhanced the production of PGE2 and PGF2 alpha, whereas the synthesis of 6-keto-PGF1 alpha was not affected. Conversely, posthypoxic reoxygenation greatly increased the synthesis of 6-keto-PGF1 alpha, whereas the synthesis of PGF2 alpha, was not affected and that of PGE2 was reduced. The cardiomyocyte polyunsaturated fatty acid (PUFA) profile was altered by arachidonic acid or eicosapentaenoic acid and docosahexaenoic acid. Under normoxia, the eicosanoid production appeared to be roughly related to the cell phospholipid arachidonic acid content. Conversely, during posthypoxic reoxygenation, the production of eicosanoids was related to the cell phospholipid n-3 PUFA content, with the n-3-rich cells displaying a marked inhibition of the synthesis. This inhibition was mainly attributed to eicosapentaenoic acid and/or docosapentaenoic acid. Whether this inhibition occurs in vivo during postischemic reperfusion, it may contribute to the beneficial effect of n-3 PUFA on the heart.

  2. Omega-3 Polyunsaturated Fatty Acids and Heart Rate Variability

    PubMed Central

    Christensen, Jeppe Hagstrup

    2011-01-01

    Omega-3 polyunsaturated fatty acids (PUFA) may modulate autonomic control of the heart because omega-3 PUFA is abundant in the brain and other nervous tissue as well as in cardiac tissue. This might partly explain why omega-3 PUFA offer some protection against sudden cardiac death (SCD). The autonomic nervous system is involved in the pathogenesis of SCD. Heart rate variability (HRV) can be used as a non-invasive marker of cardiac autonomic control and a low HRV is a predictor for SCD and arrhythmic events. Studies on HRV and omega-3 PUFA have been performed in several populations such as patients with ischemic heart disease, patients with diabetes mellitus, patients with chronic renal failure, and in healthy subjects as well as in children. The studies have demonstrated a positive association between cellular content of omega-3 PUFA and HRV and supplementation with omega-3 PUFA seems to increase HRV which could be a possible explanation for decreased risk of arrhythmic events and SCD sometimes observed after omega-3 PUFA supplementation. However, the results are not consistent and further research is needed. PMID:22110443

  3. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  4. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  5. Metabolic rates associated with membrane fatty acids in mice selected for increased maximal metabolic rate

    PubMed Central

    Wone, Bernard W. M.; Donovan, Edward R.; Cushman, John C.; Hayes, Jack P.

    2014-01-01

    Aerobic metabolism of vertebrates is linked to membrane fatty acid (FA) composition. Although the membrane pacemaker hypothesis posits that desaturation of FAs accounts for variation in resting or basal metabolic rate (BMR), little is known about the FA profiles that underpin variation in maximal metabolic rate (MMR). We examined membrane FA composition of liver and skeletal muscle in mice after seven generations of selection for increased MMR. In both liver and skeletal muscle, unsaturation index did not differ between control and high-MMR mice. We also examined membrane FA composition at the individual-level of variation. In liver, 18:0, 20:3 n-6, 20:4 n-6, and 22:6 n-3 FAs were significant predictors of MMR. In gastrocnemius muscle, 18:2 n-6, 20:4 n-6, and 22:6 n-3 FAs were significant predictors of MMR. In addition, muscle 16:1 n-7, 18:1 n-9, and 22:5 n-3 FAs were significant predictors of BMR, whereas no liver FAs were significant predictors of BMR. Our findings indicate that (i) individual variation in MMR and BMR appear to be linked to membrane FA composition in the skeletal muscle and liver, and (ii) FAs that differ between selected and control lines are involved in pathways that can affect MMR or BMR. PMID:23422919

  6. Leucine disposal rate for assessment of amino acid metabolism in maintenance hemodialysis patients

    PubMed Central

    Denny, Gerald B.; Deger, Serpil M.; Chen, Guanhua; Bian, Aihua; Sha, Feng; Booker, Cindy; Kesler, Jaclyn T.; David, Sthuthi; Ellis, Charles D.; Ikizler, T. Alp

    2016-01-01

    Background Protein energy wasting (PEW) is common in patients undergoing maintenance hemodialysis (MHD) and closely associated with poor outcomes. Insulin resistance and associated alterations in amino acid metabolism are potential pathways leading to PEW. We hypothesized that the measurement of leucine disposal during a hyperinsulinemic- euglycemic-euaminoacidemic clamp (HEAC) procedure would accurately measure the sensitivity to insulin for its actions on concomitant carbohydrate and protein metabolism in MHD patients. Methods We examined 35 MHD patients and 17 control subjects with normal kidney function by hyperinsulinemic-euglycemic clamp (HEGC) followed by HEAC clamp procedure to obtain leucine disposal rate (LDR) along with isotope tracer methodology to assess whole body protein turnover. Results The glucose disposal rate (GDR) by HEGC was 5.1 ± 2.1 mg/kg/min for the MHD patients compared to 6.3 ± 3.9 mg/kg/min for the controls (p = 0.38). The LDR during HEAC was 0.09 ± 0.03 mg/kg/min for the MHD patients compared to 0.11 ± 0.05 mg/kg/min for the controls (p = 0.009). The LDR level was correlated with whole body protein synthesis (r = 0.25; p = 0.08), with whole body protein breakdown (r = −0.38 p = 0.01) and net protein balance (r = 0.85; p < 0.001) in the overall study population. Correlations remained significant in subgroup analysis. The GDR derived by HEGC and LDR correlated well in the controls (r = 0.79, p < 0.001), but less so in the MHD patients (r = 0.58, p < 0.001). Conclusions Leucine disposal rate reliably measures amino acid utilization in MHD patients and controls in response to high dose insulin. PMID:27413537

  7. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  8. Decreased rate of protein synthesis, caspase-3 activity, and ubiquitin-proteasome proteolysis in soleus muscles from growing rats fed a low-protein, high-carbohydrate diet.

    PubMed

    Batistela, Emanuele; Pereira, Mayara Peron; Siqueira, Juliany Torres; Paula-Gomes, Silvia; Zanon, Neusa Maria; Oliveira, Eduardo Brandt; Navegantes, Luiz Carlos Carvalho; Kettelhut, Isis C; Andrade, Claudia Marlise Balbinotti; Kawashita, Nair Honda; Baviera, Amanda Martins

    2014-06-01

    The aim of this study was to investigate the changes in the rates of both protein synthesis and breakdown, and the activation of intracellular effectors that control these processes in soleus muscles from growing rats fed a low-protein, high-carbohydrate (LPHC) diet for 15 days. The mass and the protein content, as well as the rate of protein synthesis, were decreased in the soleus from LPHC-fed rats. The availability of amino acids was diminished, since the levels of various essential amino acids were decreased in the plasma of LPHC-fed rats. Overall rate of proteolysis was also decreased, explained by reductions in the mRNA levels of atrogin-1 and MuRF-1, ubiquitin conjugates, proteasome activity, and in the activity of caspase-3. Soleus muscles from LPHC-fed rats showed increased insulin sensitivity, with increased levels of insulin receptor and phosphorylation levels of AKT, which probably explains the inhibition of both the caspase-3 activity and the ubiquitin-proteasome system. The fall of muscle proteolysis seems to represent an adaptive response that contributes to spare proteins in a condition of diminished availability of dietary amino acids. Furthermore, the decreased rate of protein synthesis may be the driving factor to the lower muscle mass gain in growing rats fed the LPHC diet.

  9. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  10. Prolonged stimulation of protein synthesis by leucine is dependent on amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Leucine is unique among the amino acids in its ability to enhance protein synthesis by activating translation initiation (Kimball and Jefferson, 2005). Our laboratory has shown that raising leucine to postprandial levels, whilst keeping all other amino acids at the post absorptive, level acutely st...

  11. Facile synthesis of nucleic acid-polymer amphiphiles and their self-assembly.

    PubMed

    Jia, Fei; Lu, Xueguang; Tan, Xuyu; Zhang, Ke

    2015-05-07

    A solid-phase synthesis for nucleic acid-polymer amphiphiles is developed. Using this strategy, several DNA-b-polymer amphiphiles are synthesized, and their self-assembly in aqueous solution is investigated. This general method can in principle be extended to nearly all polymers synthesized by atom transfer radical polymerization to produce a variety of nucleic acid-polymer conjugates.

  12. Total synthesis of racemic and (R) and (S)-4-methoxyalkanoic acids and their antifungal activity.

    PubMed

    Das, Biswanath; Shinde, Digambar Balaji; Kanth, Boddu Shashi; Kamle, Avijeet; Kumar, C Ganesh

    2011-07-01

    The total synthesis of 4-methoxydecanoic acid and 4-methoxyundecanoic acid in racemic and stereoselective [(R) and (S)] forms has been accomplished. For stereoselective synthesis of the compounds (S) and (R)-BINOL complexes have been used to generate the required chiral centres. The antifungal activity of these compounds has been studied against different organisms and the results were found to be impressive. The activity of the compounds in racemic and in stereoselective forms was compared. (R)-4-Methoxydecanoic acid was found to be most potent (MIC: 0.019 mg/mL against Candida albicans MTCC 227, C. albicans MTCC 4748, Aspergillus brasiliensis (niger) MTCC 281 and Issatchenkia orientalis MTCC 3020).

  13. Final Step of Phosphatidic Acid Synthesis in Pea Chloroplasts Occurs in the Inner Envelope Membrane 1

    PubMed Central

    Andrews, Jaen; Ohlrogge, John B.; Keegstra, Kenneth

    1985-01-01

    The second enzyme of phosphatidic acid synthesis from glycerol-3-phosphate, 1-acylglycerophospate acyltransferase, was localized to the inner envelope membrane of pea chloroplasts. The activity of this enzyme was measured by both a coupled enzyme assay and a direct enzyme assay. Using the coupled enzyme assay, phosphatidic acid phosphatase was also localized to the inner envelope membrane, although this enzyme has very low activity in pea chloroplasts. The addition of UDP-galactose to unfractionated pea chloroplast envelope preparations did not result in significant conversion of newly synthesized diacylglycerol to monogalactosyldiacylglycerol. Thus, the envelope synthesized phosphatidic acid may not be involved in galactolipid synthesis in pea chloroplasts. PMID:16664266

  14. Selective inhibition of leukotriene C/sub 4/ synthesis in human neutrophils by ethacrynic acid

    SciTech Connect

    Leung, K.H.

    1986-05-29

    Addition of glutathione S-transferase inhibitors, ethyacrynic acid (ET), caffeic acid (CA), and ferulic acid (FA) to human neutrophils led to inhibition of leukotriene C/sub 4/ (LTC/sub 4/) synthesis induced by calcium ionophore A23187. ET is the most specific of these inhibitors for it had little effect on LTB/sub 4/, PGE/sub 2/, and 5-HETE synthesis. The inhibition of LTC/sub 4/ was irreversible and time dependent. ET also had little effect on /sup 3/H-AA release from A23187-stimulated neutrophils.

  15. Formamide Synthesis through Borinic Acid Catalysed Transamidation under Mild Conditions.

    PubMed

    Dine, Tharwat Mohy El; Evans, David; Rouden, Jacques; Blanchet, Jérôme

    2016-04-18

    A highly efficient and mild transamidation of amides with amines co-catalysed by borinic acid and acetic acid has been reported. A wide range of functionalised formamides was synthesized in excellent yields, including important chiral α-amino acid derivatives, with minor racemisation being observed. Experiments suggested that the reaction rely on a cooperative catalysis involving an enhanced boron-derived Lewis acidity rather than an improved Brønsted acidity of acetic acid.

  16. Inositol induces a profound alteration in the pattern and rate of synthesis and turnover of membrane lipids in Saccharomyces cerevisiae.

    PubMed

    Gaspar, Maria L; Aregullin, Manuel A; Jesch, Stephen A; Henry, Susan A

    2006-08-11

    The addition of inositol to actively growing yeast cultures causes a rapid increase in the rate of synthesis of phosphatidylinositol and, simultaneously, triggers changes in the expression of hundreds of genes. We now demonstrate that the addition of inositol to yeast cells growing in the presence of choline leads to a dramatic reprogramming of cellular lipid synthesis and turnover. The response to inositol includes a 5-6-fold increase in cellular phosphatidylinositol content within a period of 30 min. The increase in phosphatidylinositol content appears to be dependent upon fatty acid synthesis. Phosphatidylcholine turnover increased rapidly following inositol addition, a response that requires the participation of Nte1p, an endoplasmic reticulum-localized phospholipase B. Mass spectrometry revealed that the acyl species composition of phosphatidylinositol is relatively constant regardless of supplementation with inositol or choline, whereas phosphatidylcholine acyl species composition is influenced by both inositol and choline. In medium containing inositol, but lacking choline, high levels of dimyristoylphosphatidylcholine were detected. Within 60 min following the addition of inositol, dimyristoylphosphatidylcholine levels had decreased from approximately 40% of total phosphatidylcholine to a basal level of less than 5%. nte1Delta cells grown in the absence of inositol and in the presence of choline exhibited lower levels of dimyristoylphosphatidylcholine than wild type cells grown under these same conditions, but these levels remained largely constant after the addition of inositol. These results are discussed in relationship to transcriptional regulation known to be linked to lipid metabolism in yeast.

  17. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.

    1972-01-01

    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  18. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity.

  19. Low Phytic Acid Barley Responses to Phosphorus Rates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Low phytic acid (LPA) barley (Hordeum vulgare L.) cultivars partition phosphorus in seed tissue differently than conventional barley cultivars through a reduction in seed phytic acid (myo-inositol-1,2,3,4,5,6-hexkisphosphate) coupled with an increase in inorganic phosphorus. The response of the LPA...

  20. Kinetics of enzymatic synthesis of liquid wax ester from oleic acid and oleyl alcohol.

    PubMed

    Radzi, Salina Mat; Mohamad, Rosfarizan; Basri, Mahiran; Salleh, Abu Bakar; Ariff, Arbakariya; Rahman, Mohammad Basyaruddin Abdul; Rahman, Raja Noor Zaliha Raja Abdul

    2010-01-01

    The kinetics of wax ester synthesis from oleic acid and oleyl alcohol using immobilized lipase from Candida antartica as catalyst was studied with different types of impeller (Rushton turbine and AL-hydrofoil) to create different mixing conditions in 2l stirred tank reactor. The effects of catalyst concentration, reaction temperature, and impeller tip speed on the synthesis were also evaluated. Rushton turbine impeller exhibited highest conversion rate at lower impeller tip speed as compared to AL-hydrofoil impeller. A second-order reversible kinetic model from single progress curve for the prediction of fractional conversion at given reaction time was proposed and the corresponding kinetic parameter values were calculated by non-linear regression method. The results from the simulation using the proposed model showed satisfactory agreement with the experimental data. Activation energy shows a value of 21.77 Kcal/mol. The thermodynamic parameters of the process, enthalpy and entropy, were 21.15 Kcal/mol and 52.07 cal/mol.K, respectively.

  1. Effect of frequency of dosing of plant sterols on plasma cholesterol levels and synthesis rate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective was to compare the effects of plant sterols (PS) consumed as a single dose (single) at breakfast or as three doses consumed with breakfast, lunch and dinner (divided) on plasma lipoprotien levels and cholesterol endogenous fractional synthesis rate (FSR). A randomized, placebo-controll...

  2. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  3. Catabolism of Branched Chain Amino Acids Contributes Significantly to Synthesis of Odd-Chain and Even-Chain Fatty Acids in 3T3-L1 Adipocytes

    PubMed Central

    Crown, Scott B.; Marze, Nicholas; Antoniewicz, Maciek R.

    2015-01-01

    The branched chain amino acids (BCAA) valine, leucine and isoleucine have been implicated in a number of diseases including obesity, insulin resistance, and type 2 diabetes mellitus, although the mechanisms are still poorly understood. Adipose tissue plays an important role in BCAA homeostasis by actively metabolizing circulating BCAA. In this work, we have investigated the link between BCAA catabolism and fatty acid synthesis in 3T3-L1 adipocytes using parallel 13C-labeling experiments, mass spectrometry and model-based isotopomer data analysis. Specifically, we performed parallel labeling experiments with four fully 13C-labeled tracers, [U-13C]valine, [U-13C]leucine, [U-13C]isoleucine and [U-13C]glutamine. We measured mass isotopomer distributions of fatty acids and intracellular metabolites by GC-MS and analyzed the data using the isotopomer spectral analysis (ISA) framework. We demonstrate that 3T3-L1 adipocytes accumulate significant amounts of even chain length (C14:0, C16:0 and C18:0) and odd chain length (C15:0 and C17:0) fatty acids under standard cell culture conditions. Using a novel GC-MS method, we demonstrate that propionyl-CoA acts as the primer on fatty acid synthase for the production of odd chain fatty acids. BCAA contributed significantly to the production of all fatty acids. Leucine and isoleucine contributed at least 25% to lipogenic acetyl-CoA pool, and valine and isoleucine contributed 100% to lipogenic propionyl-CoA pool. Our results further suggest that low activity of methylmalonyl-CoA mutase and mass action kinetics of propionyl-CoA on fatty acid synthase result in high rates of odd chain fatty acid synthesis in 3T3-L1 cells. Overall, this work provides important new insights into the connection between BCAA catabolism and fatty acid synthesis in adipocytes and underscores the high capacity of adipocytes for metabolizing BCAA. PMID:26710334

  4. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan

    2016-08-01

    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  5. Determination of deoxycholic acid pool size and input rate using (24-/sup 13/C)deoxycholic acid and serum sampling

    SciTech Connect

    Stellard, F.; Paumgartner, G.; van Berge Henegouwen, G.P.; van der Werf, S.D.

    1986-11-01

    We have developed an isotope dilution method for determination of deoxycholic acid pool size and input rate which employs oral administration of 50 mg of (24-/sup 13/C)deoxycholic acid and serum sampling. The method has been validated by classical isotope dilution technique using (24-/sup 14/C)deoxycholic acid and bile sampling in five patients with colonic adenomas. Excellent agreement between pool sizes and input rates determined with /sup 13/C/12C isotope ratio measurements in serum and /sup 14/C measurements in bile was obtained when isotope ratios were measured in the conjugated fraction of deoxycholic acid in serum. We conclude that pool size and input rate of deoxycholic acid can accurately be determined by blood sampling after oral administration of (24-/sup 13/C)deoxycholic acid, therewith eliminating the use of radioactive tracers and the need for bile sampling.

  6. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  7. Synthesis of bile acid monosulphates by the isolated perfused rat kidney.

    PubMed Central

    Summerfield, J A; Gollan, J L; Billing, B H

    1976-01-01

    Perfusion of an isolated rat kidney with labelled bile acids, in a protein-free medium, resulted in the urinary excretion of the labelled bile acid, 3% being converted into polar metabolities in 1h. These metabolities were neither glycine nor taurine conjugates, nor bile acid glucuronides, and on solovolysis yielded the free bile acid. On t.l.c. the metabolite of [24-14C]lithocholic acid had the mobility of lithocholate 3-sulphate. The principal metabolite of [24-14C]chenodeoxycholic acid had the mobility of chenodeoxycholate 7-sulphate; trace amounts appeared as chenodeoxycholate 3-sulphate. [35S]sulphate was incorporated in chenodeoxycholic acid by the kidney, resulting in a similar pattern of sulphation. No disulphate salt of chenodeoxycholic acid was detected. These findings lend support to the hypothesis that renal synthesis may account for some of the bile acid sulphates present in urine in the cholestatic syndrome in man. PMID:942413

  8. Effects of growth rate on cell extract performance in cell-free protein synthesis.

    PubMed

    Zawada, James; Swartz, James

    2006-07-05

    Cell-free protein synthesis is a useful research tool and now stands poised to compete with in vivo expression for commercial production of proteins. However, both the extract preparation and protein synthesis procedures must be scaled up. A key challenge is producing the required amount of biomass that also results in highly active cell-free extracts. In this work, we show that the growth rate of the culture dramatically affects extract performance. Extracts prepared from cultures with a specific growth rate of 0.7/h or higher produced approximately 0.9 mg/mL of chloramphenicol acetyl transferase (CAT) in a batch reaction. In contrast, when the source culture growth rate was 0.3/h, the resulting extract produced only 0.5 mg/mL CAT. Examination of the ribosome content in the extracts revealed that the growth rate of the source cells strongly influenced the final ribosome concentration. Polysome analysis of cell-free protein synthesis reactions indicated that about 22% of the total 70S ribosomes are in polysomes for all extracts regardless of growth rate. Furthermore, the overall specific production from the 70S ribosomes is about 22 CAT proteins per ribosome over the course of the reaction in all cases. It appears that rapid culture growth rates are essential for producing a productive extract. However, growth rate does not seem to influence specific ribosome activity. Rather, the increase in extract productivity is a result of a higher ribosome concentration. These results are important for cell-free technology and also suggest an assay for intrinsic in vivo protein synthesis activity.

  9. Lewis Acid Promoted Oxonium Ion Driven Carboamination of Alkynes for the Synthesis of 4-Alkoxy Quinolines.

    PubMed

    Gharpure, Santosh J; Nanda, Santosh K; Adate, Priyanka A; Shelke, Yogesh G

    2017-02-17

    Lewis acid mediated multisegment coupling cascade is designed for the synthesis of densely substituted 4-alkoxy quinolines via an oxonium ion triggered alkyne carboamination sequence involving C-C and C-N bond formations. Cyclic ether fused-quinolines could also be accessed using this fast, operationally simple, high yielding, chemoselective and functional group tolerant method. Versatility and utility of this methodology is demonstrated by postfunctionalization of products obtained and its use in synthesis of potent drug molecules.

  10. Copper-mediated arylation with arylboronic acids: Facile and modular synthesis of triarylmethanes

    PubMed Central

    Rao, A Veera Bhadra

    2016-01-01

    Summary A facile and modular synthesis of triarylmethanes was achieved in good yield via a two-step sequence in which the final step is the copper(II)-catalyzed arylation of diarylmethanols with arylboronic acids. By using this protocol a variety of symmetrical and unsymmetrical triarylmethanes were synthesized. As an application of the newly developed methodology, we demonstrate a high-yielding synthesis of the triarylmethane intermediate towards an anti-breast-cancer drug candidate. PMID:27340442

  11. Regional intelligence and suicide rate: new data for Australia and a synthesis of research.

    PubMed

    Voracek, Martin

    2007-08-01

    Previous research has shown for the most part positive correlations between intelligence and suicide prevalence on the national level. However, this study found proxies for regional intelligence in Australia (international average domain scores from the PISA 2000 study) to be significantly negatively correlated with the total, male, and female suicide rates of the different administrative divisions of Australia, and this finding was independent of regional wealth. A research synthesis of the current results and those from similar studies of other countries (positive correlations for Austria, Belarus, The British Isles, Denmark, and The Netherlands; inconclusive findings for France, Germany, and the USA) was conducted. This synthesis of research findings showed that positive ecological correlations of intelligence with suicide rate were more likely observed for nations with higher suicide rates and poorer general living conditions, whereas there was no relation with national IQ.

  12. Recharge Rates and Chemistry Beneath Playas of the High Plains Aquifer - A Literature Review and Synthesis

    USGS Publications Warehouse

    Gurdak, Jason J.; Roe, Cassia D.

    2009-01-01

    Playas are ephemeral, closed-basin wetlands that are important zones of recharge to the High Plains (or Ogallala) aquifer and critical habitat for birds and other wildlife in the otherwise semiarid, shortgrass prairie and agricultural landscape. The ephemeral nature of playas, low regional recharge rates, and a strong reliance on ground water from the High Plains aquifer has prompted many questions regarding the contribution of recharge from playas to the regional aquifer. To address these questions and concerns, the U.S. Geological Survey, in cooperation with the Playa Lakes Joint Venture, present a review and synthesis of the more than 175 publications about recharge rates and chemistry beneath playas and interplaya settings. Although a number of questions remain regarding the controls on recharge rates and chemistry beneath playas, the results from most published studies indicate that recharge rates beneath playas are substantially (1 to 2 orders of magnitude) higher than recharge rates beneath interplaya settings. The synthesis presented here supports the conceptual model that playas are important zones of recharge to the High Plains aquifer and are not strictly evaporative pans. The major findings of this synthesis yield science-based implications for the protection and management of playas and ground-water resources of the High Plains aquifer and directions for future research.

  13. Size control by rate control in colloidal PbSe quantum dot synthesis

    NASA Astrophysics Data System (ADS)

    Čapek, Richard Karel; Yanover, Dianna; Lifshitz, Efrat

    2015-03-01

    A recently demonstrated approach to control the size of colloidal nanoparticles, ``size control by rate control'', which was validated on the examples of colloidal CdSe- and CdS-quantum dot (CQD) synthesis, appears to be a general strategy for designing technically applicable CQD-syntheses. The ``size control by rate control'' concept allows full-yield syntheses of ensembles of CQDs with different sizes by tuning the solute formation rate. In this work, we extended this strategy to dialkylphosphine enhanced hot-injection synthesis of PbSe-CQDs. Furthermore, we provide new insight into the reaction mechanism of dialkylphosphine enhancement in TOPSe based CQD-syntheses.A recently demonstrated approach to control the size of colloidal nanoparticles, ``size control by rate control'', which was validated on the examples of colloidal CdSe- and CdS-quantum dot (CQD) synthesis, appears to be a general strategy for designing technically applicable CQD-syntheses. The ``size control by rate control'' concept allows full-yield syntheses of ensembles of CQDs with different sizes by tuning the solute formation rate. In this work, we extended this strategy to dialkylphosphine enhanced hot-injection synthesis of PbSe-CQDs. Furthermore, we provide new insight into the reaction mechanism of dialkylphosphine enhancement in TOPSe based CQD-syntheses. Electronic supplementary information (ESI) available: Additional data about the reaction and growth kinetics, NMR-data and exemplary TEM images of PbSe-CQDs prepared by the procedure described in this publication. See DOI: 10.1039/c5nr00028a

  14. Rh(III)-catalyzed synthesis of sultones through C-H activation directed by a sulfonic acid group.

    PubMed

    Qi, Zisong; Wang, Mei; Li, Xingwei

    2014-09-04

    A new rhodium-catalyzed synthesis of sultones via the oxidative coupling of sulfonic acids with internal alkynes is described. The reaction proceeds via aryl C-H activation assisted by a sulfonic acid group.

  15. Orthogonally Protected Furanoid Sugar Diamino Acids for Solid-Phase Synthesis of Oligosaccharide Mimetics.

    PubMed

    John, Franklin; Wittmann, Valentin

    2015-08-07

    Sugar diamino acids (SDAs), which differ from the widely used sugar amino acids in the presence of a second amino group connected to the carbohydrate core, share structural features of both amino acids and carbohydrates. They can be used for the preparation of linear and branched amide-linked oligosaccharide mimetics. Such oligomers carry free amino groups, which are positively charged at neutral pH, in a spatially defined way and, thus, represent a potential class of aminoglycoside mimetics. We report here the first examples of orthogonally protected furanoid SDAs and their use in solid-phase synthesis. Starting from d-glucose, we developed a divergent synthetic route to three derivatives of 3,5-diamino-3,5-dideoxy-d-ribofuranose. These building blocks are compatible with solid-phase peptide synthesis following the 9-fluorenylmethoxycarbonyl (Fmoc) strategy, which we demonstrate by the synthesis of an SDA tetramer.

  16. New hydroxamic acid derivatives of fluoroquinolones: synthesis and evaluation of antibacterial and anticancer properties.

    PubMed

    Rajulu, Gavara Govinda; Bhojya Naik, Halehatty Seephya; Viswanadhan, Abhilash; Thiruvengadam, Jayaraman; Rajesh, Kondodiyil; Ganesh, Sambasivam; Jagadheshan, Hiriyan; Kesavan, Poonimangadu Koppolu

    2014-01-01

    A series of new hydroxamic acid derivatives (6a-f) at C-3 position of fluoroquinolones were designed and synthesized through multistep synthesis. The design concept involved replacement of the 3-carboxylic acid in fluoquinolones with hydroxamic acid as an acid mimicking group. The synthetic work employed in this work provides a good example for the synthesis of pure hydroxamic acid based fluoroquinolones. The synthesized compounds were characterized by (1)H-NMR, electrospray ionization (ESI)-MS and IR. The new compounds were tested for their in vitro antimicrobial and anti-proliferative activity. Out of the six derivatives, compound 6e exhibited moderate antibacterial activity by inhibiting the growth of Escherichia coli and Klebsiella pneumoniae (MIC: 4.00-8.00 µg/mL). Compounds 6b and 6f displayed good growth inhibition against A549 Lung adenocarcinoma and HCT-116 Colon carcinoma cell lines.

  17. Synthesis of 5,9-hexacosadienoic acid phospholipids. 11. Phospholipid studies of marine organisms.

    PubMed

    Mena, P L; Djerassi, C

    1985-01-01

    The synthesis of phosphatidylcholines (PC), phosphatidylethanolamines (PE) and phosphatidylserines (PS) containing two acyl chains of the naturally occurring sponge fatty acid (5Z,9Z)-5,9-hexacosadienoic acid as well as its hitherto unknown geometrical isomers is described. The PCs were prepared by deacylation of natural lecithins, followed by reacylation with fatty acid anhydrides. The synthesis of mixed-acid PCs is also reported: a diacyl product was converted to the lyso-PC by treatment with phospholipase A2 and subsequent acylation of the secondary hydroxyl group to give the desired mixed-acid PCs. The PEs and the PSs were prepared from the corresponding PCs by enzymatic transphosphatidylation catalyzed by phospholipase D. Structural assignments of the compounds were confirmed by spectroscopy (1H-NMR and MS). Ammonia chemical ionization mass spectrometry provided molecular ion and significant fragment peaks for PCs and PEs.

  18. Synthesis and biological properties of amino acids and peptides containing a tetrazolyl moiety

    NASA Astrophysics Data System (ADS)

    Popova, E. A.; Trifonov, R. E.

    2015-09-01

    Literature data published mainly in the last 15 years on the synthesis and biological properties of amino acid analogues and derivatives containing tetrazolyl moieties are analyzed. Tetrazolyl analogues and derivatives of amino acids and peptides are shown to be promising for medicinal chemistry. Being polynitrogen heterocyclic systems comprising four endocyclic nitrogen atoms, tetrazoles can behave as acids and bases and form strong hydrogen bonds with proton donors (more rarely, with acceptors). They have high metabolic stability and are able to penetrate biological membranes. The review also considers the synthesis and properties of linear and cyclic peptides based on modified amino acids incorporating a tetrazolyl moiety. A special issue is the discussion of the biological properties of tetrazole-containing amino acids and peptides, which exhibit high biological activity and can be used to design new drugs. The bibliography includes 200 references.

  19. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis.

    PubMed

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C; García-Ruiz, Carmen

    2015-12-08

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy.

  20. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen

    2015-01-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  1. Elevated cholesterol and bile acid synthesis in an adult patient with homozygous familial hypercholesterolemia. Reduction by a high glucose diet.

    PubMed

    Stacpoole, P W; Grundy, S M; Swift, L L; Greene, H L; Slonim, A E; Burr, I M

    1981-11-01

    Elevated levels of cholesterol synthesis are reported for several young children with homozygous familial hypercholesterolemia (HFH) and are considered to contribute directly to their hypercholesterolemia. In contrast, increased cholesterol production has not previously been found in adult patients with HFH. Using the fecal steroid balance technique, we studied rates of cholesterol and bile acid synthesis in a 24-yr-old man who had severe hypercholesterolemia typical of HFH and who lacked skin fibroblast low density lipoprotein (LDL) receptor activity. On an average diet (45% carbohydrate, 40% fat, 15% protein) mean +/- SEM cholesterol (24.8 +/- 1.4 mg/kg per d) and bile acid (11.1 +/- 1.6 mg/kg per d) excretion were approximately threefold higher than normal. When an isocaloric high carbohydrate, low fat diet (90.5% glucose oligosaccharides, 1.3% safflower oil, 8.2% crystalline amino acids was substituted, mean cholesterol (13.0 +/- 0.5 mg/kg per d) and bile acid (8.6 +/- 0.4 mg/kg per d) fell markedly. The decline in fecal steroid excretion was accompanied by modest reductions in plasma total and LDL cholesterol concentrations and by a softening of cutaneous xanthomata. Although the patient phenotypically and biochemically resembled the HFH state, his family pedigree was not noteable for hypercholesterolemia. While the patient's father had premature cardiovascular disease, his mother had no evidence of heart disease, had normal plasma total and LDL cholesterol levels, and had normal fibroblast LDL receptor activity. Likewise, the plasma cholesterol levels of three other members of the patient's family were normal. Despite the unusual genotypic background of this individual, however, the fecal balance data shows that elevated cholesterol and bile acid synthesis may occur in adult, as well as juvenile, patients with HFH and may be responsive to dietary control.

  2. Insulin rapidly increases diacylglycerol by activating de novo phosphatidic acid synthesis.

    PubMed

    Farese, R V; Konda, T S; Davis, J S; Standaert, M L; Pollet, R J; Cooper, D R

    1987-05-01

    The mechanisms whereby insulin increases diacylglycerol in BC3H-1 myocytes were examined. When [3H]arachidonate labeling of phospholipids was used as an indicator of phospholipase C activation, transient increases in [3H]diacylglycerol were observed between 0.5 and 10 minutes after the onset of insulin treatment. With [3H]glycerol labeling as an indicator of de novo phospholipid synthesis, [3H]diacylglycerol was increased maximally at 1 minute and remained elevated for 20 minutes. [3H]Glycerol-labeled diacylglycerol was largely derived directly from phosphatidic acid. Insulin increased de novo phosphatidic acid synthesis within 5 to 10 seconds; within 1 minute, this synthesis was 60 times greater than that of controls. Thus, the initial increase in diacylglycerol is due to both increased hydrolysis of phospholipids and a burst of de novo phosphatidic acid synthesis. After 5 to 10 minutes, de novo phosphatidic acid synthesis continues as a major source of diacylglycerol. Both phospholipid effects of insulin seem important for generating diacylglycerol and other phospholipid-derived intracellular signaling substances.

  3. Promoter strength of folic acid synthesis genes affects sulfa drug resistance in Saccharomyces cerevisiae.

    PubMed

    Iliades, Peter; Berglez, Janette; Meshnick, Steven; Macreadie, Ian

    2003-01-01

    The enzyme dihydropteroate synthase (DHPS) is an important target for sulfa drugs in both prokaryotic and eukaryotic microbes. However, the understanding of DHPS function and the action of antifolates in eukaryotes has been limited due to technical difficulties and the complexity of DHPS being a part of a bifunctional or trifunctional protein that comprises the upstream enzymes involved in folic acid synthesis (FAS). Here, yeast strains have been constructed to study the effects of FOL1 expression on growth and sulfa drug resistance. A DHPS knockout yeast strain was complemented by yeast vectors expressing the FOL1 gene under the control of promoters of different strengths. An inverse relationship was observed between the growth rate of the strains and FOL1 expression levels. The use of stronger promoters to drive FOL1 expression led to increased sulfamethoxazole resistance when para-aminobenzoic acid (pABA) levels were elevated. However, high FOL1 expression levels resulted in increased susceptibility to sulfamethoxazole in pABA free media. These data suggest that up-regulation of FOL1 expression can lead to sulfa drug resistance in Saccharomyces cerevisiae.

  4. Fatty acid synthesis and pyruvate metabolism pathways remain active in dihydroartemisinin-induced dormant ring stages of Plasmodium falciparum.

    PubMed

    Chen, Nanhua; LaCrue, Alexis N; Teuscher, Franka; Waters, Norman C; Gatton, Michelle L; Kyle, Dennis E; Cheng, Qin

    2014-08-01

    Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment.

  5. Synthesis of alpha-hydroxyphosphonic acids from Lesquerella oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella oil has been a substance of growing chemical interest, due to the ease with which it is produced and its similarity in structure to castor oil. The primary fatty acid in Lesquerella oil, lesquerolic acid, is very similar to the principal component of castor oil, ricinoleic acid, and may ...

  6. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines

    2011-01-01

    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  7. Effects of a New Glutamic Acid Derivative on Myocardial Contractility of Stressed Animals under Conditions of Nitric Oxide Synthesis Blockade.

    PubMed

    Tyurenkov, I N; Perfilova, V N; Sadikova, N V; Berestovitskaya, V M; Vasil'eva, O S

    2015-07-01

    Glufimet (glutamic acid derivative) in a dose of 28.7 mg/kg limited the reduction of the cardiac functional reserve in animals subjected to 24-h stress under conditions of nonselective NO synthase blockade with L-NAME (10 mg/kg). Adrenoreactivity and increased afterload tests showed that the increment of myocardial contraction/relaxation rates, left-ventricular pressure, and HR were significantly higher in glufimet-treated stressed animals with NO synthesis blockade than in animals which received no glufimet. The efficiency of glufimet was higher than that of phenibut (the reference drug).

  8. Direct vs. indirect pathway of hepatic glycogen synthesis as a function of glucose infusion rate

    SciTech Connect

    Bagby, G.J.; Lang, C.H.; Johnson, J.L.; Blakesly, H.L.; Spitzer, J.J.

    1986-03-05

    This study was initiated to determine the influence of the rate of exogenous glucose administration on liver glycogen synthesis by the direct (glucose uptake and incorporation into glycogen) vs the indirect pathway (glucose degradation to 3-carbon intermediates, e.g., lactate, prior to incorporation into glycogen). Catheterized rats were fasted 2 days prior to receiving a 3 hr infusion of glucose at rates of 0 to 230 ..mu..mol/min/kg containing tracer (6-/sup 3/H)- and (U-/sup 14/C)-glucose. Plasma glucose (r = 0.80), insulin (r = 0.90) and lactate (r = 0.84) were correlated with glucose infusion rate. The rate of liver glycogen deposition (0.46 +/- 0.03 ..mu..mol/min/g) did not differ between a glucose infusion rate of 20 and 230 ..mu..mol/min/kg. At the lowest and highest glucose infusion rates hepatic glycogenesis accounted for 87 +/- 6 and 9 +/- 1% of the total glucose load, respectively. The percent contribution of the direct pathways to glycogen deposition ((/sup 3/H) specific activity in hepatic glycogen/(/sup 3/H) specific activity in plasma glucose) increased from 16 +/- 3 to 83 +/- 5% from lowest to highest glucose infusion rates (prevailing plasma glucose concentrations: 9 +/- 1 and 21 +/- 2 mM, respectively). The results indicate that the relative contribution of the direct and indirect pathways of glucogen synthesis are dependent upon the glucose load or plasma glucose concentration.

  9. Stimulation of muscle protein synthesis by prolonged parenteral infusion of leucine is dependent on amino acid availability in neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The postprandial rise in amino acids, particularly leucine, stimulates muscle protein synthesis in neonates. Previously, we showed that a 1-h infusion of leucine increased protein synthesis, but this response was not sustained for 2 h unless the leucine-induced decrease in amino acids was prevented....

  10. Leucine-enriched essential amino acids attenuate muscle soreness and improve muscle protein synthesis after eccentric contractions in rats.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Mimura, Masako; Inoue, Yoshiko; Sugita, Mayu; Suzuki, Katsuya; Kobayashi, Hisamine

    2015-06-01

    Eccentric exercise results in prolonged muscle weakness and muscle soreness, which are typical symptoms of muscle damage. Recovery from muscle damage is related to mammalian target of rapamycin (mTOR) activity. Leucine-enriched essential amino acids (LEAAs) stimulate muscle protein synthesis via activation of the mTOR pathway. Therefore, we investigated the effect of LEAAs on muscle protein synthesis and muscle soreness after eccentric contractions (EC). Male Sprague-Dawley rats (9-11 weeks old) were administered an LEAA solution (AminoL40; containing 40 % leucine and 60 % other essential amino acids) at 1 g/kg body weight or distilled water (control) 30 min before and 10 min after EC. Tibialis anterior (TA) muscle was exposed to 500 EC by electrical stimulation under anesthesia. The fractional synthesis rate (FSR; %/h) in the TA muscle was measured by incorporating L-[ring-(2)H5] phenylalanine into skeletal muscle protein. Muscle soreness was evaluated by the paw withdrawal threshold using the Randal-Selitto test with some modifications from 1 to 3 days after EC. The FSR in the EC-control group (0.147 ± 0.016 %/h) was significantly lower than in the sedentary group (0.188 ± 0.016 %/h, p < 0.05). AminoL40 administration significantly mitigated the EC-induced impairment of the FSR (0.172 ± 0.018 %/h). EC decreased the paw withdrawal threshold at 1 and 2 days after EC, which indicated that EC induced muscle soreness. Furthermore, AminoL40 administration alleviated the decreased paw withdrawal threshold. These findings suggest that LEAA supplementation improves the rate of muscle protein synthesis and ameliorates muscle soreness after eccentric exercise.

  11. PHOSPHATIDIC ACID PHOSPHOHYDROLASE1 and 2 Regulate Phospholipid Synthesis at the Endoplasmic Reticulum in Arabidopsis[W

    PubMed Central

    Eastmond, Peter J.; Quettier, Anne-Laure; Kroon, Johan T.M.; Craddock, Christian; Adams, Nicolette; Slabas, Antoni R.

    2010-01-01

    Phospholipid biosynthesis is essential for the construction of most eukaryotic cell membranes, but how this process is regulated in plants remains poorly understood. Here, we show that in Arabidopsis thaliana, two Mg2+-dependent phosphatidic acid phosphohydrolases called PAH1 and PAH2 act redundantly to repress phospholipid biosynthesis at the endoplasmic reticulum (ER). Leaves from pah1 pah2 double mutants contain ~1.8-fold more phospholipid than the wild type and exhibit gross changes in ER morphology, which are consistent with massive membrane overexpansion. The net rate of incorporation of [methyl-14C]choline into phosphatidylcholine (PC) is ~1.8-fold greater in the double mutant, and the transcript abundance of several key genes that encode enzymes involved in phospholipid synthesis is increased. In particular, we show that PHOSPHORYLETHANOLAMINE N-METHYLTRANSFERASE1 (PEAMT1) is upregulated at the level of transcription in pah1 pah2 leaves. PEAMT catalyzes the first committed step of choline synthesis in Arabidopsis and defines a variant pathway for PC synthesis not found in yeasts or mammals. Our data suggest that PAH1/2 play a regulatory role in phospholipid synthesis that is analogous to that described in Saccharomyces cerevisiae. However, the target enzymes differ, and key components of the signal transduction pathway do not appear to be conserved. PMID:20699392

  12. Starch and Sucrose Synthesis in Phaseolus vulgaris as Affected by Light, CO2, and Abscisic Acid 1

    PubMed Central

    Sharkey, Thomas D.; Berry, Joseph A.; Raschke, Klaus

    1985-01-01

    Phaseolus vulgaris L. leaves were subjected to various light, CO2, and O2 levels and abscisic acid, then given a 10 minute pulse of 14CO2 followed by a 5 minute chase with unlabeled CO2. After the chase period, very little label remained in the ionic fractions (presumed to be mostly carbon reduction and carbon oxidation cycle intermediates and amino acids) except at low CO2 partial pressure. Most label was found in the neutral, alcohol soluble fraction (presumed sucrose) or in the insoluble fraction digestable by amyloglucosidase. Sucrose formation was linearly related to assimilation rate (slope = 0.35). Starch formation increased linearly with assimilation rate (slope = 0.56) but did not occur if the assimilation rate was below 4 micromoles per square meter per second. Neither abscisic acid, nor high CO2 in combination with low O2 (thought to disrupt control of carbon metabolism) caused significant perturbations of the sucrose/starch formation ratio. These studies indicate that the pathways for starch and sucrose synthesis both are controlled by the rate of net CO2 assimilation, with sucrose the preferred product at very low assimilation rates. PMID:16664108

  13. Amino Acid Starvation Has Opposite Effects on Mitochondrial and Cytosolic Protein Synthesis

    PubMed Central

    Pearce, Sarah F.; Rorbach, Joanna; He, Jiuya; Brea-Calvo, Gloria; Minczuk, Michal; Reyes, Aurelio; Holt, Ian J.; Spinazzola, Antonella

    2014-01-01

    Amino acids are essential for cell growth and proliferation for they can serve as precursors of protein synthesis, be remodelled for nucleotide and fat biosynthesis, or be burnt as fuel. Mitochondria are energy producing organelles that additionally play a central role in amino acid homeostasis. One might expect mitochondrial metabolism to be geared towards the production and preservation of amino acids when cells are deprived of an exogenous supply. On the contrary, we find that human cells respond to amino acid starvation by upregulating the amino acid-consuming processes of respiration, protein synthesis, and amino acid catabolism in the mitochondria. The increased utilization of these nutrients in the organelle is not driven primarily by energy demand, as it occurs when glucose is plentiful. Instead it is proposed that the changes in the mitochondrial metabolism complement the repression of cytosolic protein synthesis to restrict cell growth and proliferation when amino acids are limiting. Therefore, stimulating mitochondrial function might offer a means of inhibiting nutrient-demanding anabolism that drives cellular proliferation. PMID:24718614

  14. Synthesis and characterization of bis-thiourea having amino acid derivatives

    NASA Astrophysics Data System (ADS)

    Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah

    2016-11-01

    In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.

  15. A note on the prebiotic synthesis of organic acids in carbonaceous meteorites

    NASA Technical Reports Server (NTRS)

    Kerridge, John F.

    1991-01-01

    Strong similarities between monocarboxylic and hydrocarboxylic acids in the Murchison meteorite suggest corresponding similarities in their origins. However, various lines of evidence apparently implicate quite different precursor compounds in the synthesis of the different acids. These seeming inconsistencies can be resolved by postulating that the apparent precursors also share a related origin. Pervasive D enrichment indicates that this origin was in a presolar molecular cloud. The organic acids themselves were probably synthesized in an aqueous environment on an asteroidal parent body, the hydroxy (and amino) acids by means of the Strecker cyanohydrin reaction.

  16. Water evaporation rates across hydrophobic acid monolayers at equilibrium spreading pressure.

    PubMed

    Tsuji, Minami; Nakahara, Hiromichi; Moroi, Yoshikiyo; Shibata, Osamu

    2008-02-15

    The effect of alkanoic acid [CH(3)(CH(2))(n-2)COOH; HCn] and perfluoroalkanoic acid [CF(3)(CF(2))(n-2)COOH; FCn] monolayers on the water evaporation rate was investigated by thermogravimetry tracing the decrease in amount of water with time. The evaporation rate from the surface covered by a monolayer was measured as a function of temperature and hydrophobic chain length of the acids, where the monolayer was under an equilibrium spreading pressure. From thermal behavior of the crystallized acids, their solid states are C-type in crystalline state over the temperature range from 298.2 to 323.2 K. The dry air was flowed through a furnace tube of a thermogravimetry apparatus at the flow rate of 80 mL min(-1), where the evaporation rate becomes almost constant irrespective of the flow rate. The temperature dependence of the evaporation rate was analyzed kinetically to evaluate the activation energy and thermodynamics values for the activated complex, which demonstrated that these values were almost the same for both alkanoic acids and perfluoroalkanoic acids, although the effect of perfluoroalkanoic acids on the evaporation rate was smaller than that of corresponding hydrogenated fatty acids. The difference in the evaporation rate between FCn and HCn was examined by atomic force microscopy (AFM), Brewster angle microscopy (BAM), surface potential (DeltaV) at equilibrium spreading pressure, and Langmuir curve (pi-A isotherm), and their results were consistent and supported the difference.

  17. The Use of Ascorbate as an Oxidation Inhibitor in Prebiotic Amino Acid Synthesis: A Cautionary Note

    NASA Astrophysics Data System (ADS)

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei

    2012-12-01

    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO2-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO2 was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO2-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO2-rich atmosphere under the conditions studied.

  18. The use of ascorbate as an oxidation inhibitor in prebiotic amino acid synthesis: a cautionary note.

    PubMed

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei

    2012-12-01

    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO(2)-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO(2) was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO(2)-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO(2)-rich atmosphere under the conditions studied.

  19. Acyl Meldrum's acid derivatives: application in organic synthesis

    NASA Astrophysics Data System (ADS)

    Janikowska, K.; Rachoń, J.; Makowiec, S.

    2014-07-01

    This review is focused on an important class of Meldrum's acid derivatives commonly known as acyl Meldrum's acids. The preparation methods of these compounds are considered including the recently proposed and rather rarely used ones. The chemical properties of acyl Meldrum's acids are described in detail, including thermal stability and reactions with various nucleophiles. The possible mechanisms of these transformations are analyzed. The bibliography includes 134 references.

  20. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.

    PubMed

    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr

    2016-09-12

    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials.

  1. Synthesis and biological activity of glutamic acid derivatives.

    PubMed

    Receveur, J M; Guiramand, J; Récasens, M; Roumestant, M L; Viallefont, P; Martinez, J

    1998-01-20

    In order to develop new specific glutamate analogues at metabotropic glutamate receptors, Diels-Alder, 1-4 ionic and radical reactions were performed starting from (2S)-4-methyleneglutamic acid. Preliminary pharmacological evaluation by measuring IP accumulation using rat forebrain synaptoneurosomes has shown that (2S)-4-(2-phthalimidoethyl)glutamic acid (3a), (2S)-4-(4-phthalimidobutyl)glutamic acid (3b) and 1-[(S)-2-amino-2-carboxyethyl]-3,4-dimethylcyclohex-3-ene-1-carbox ylic acid (8) presented moderate antagonist activities.

  2. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  3. Synthesis of phosphonic analogues of carnitine and gamma-amino-beta-hydroxybutyric acid.

    PubMed

    Tadeusiak, Elzbieta J

    2004-12-01

    The involvement of carnitine and gamma-amino-beta-hydroxybutyric acid in the biology of mammalian cells, the physiology of the human body, and some important aspects of medicinal treatment has induced many research groups to develop their pharmacologically potent analogues. Among them are the very important phosphonic analogues: phosphocarnitine and gamma-amino-beta-hydroxypropylphosphonic acid. This mini-review describes the various methodologies used for the synthesis of these compounds.

  4. 5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group

    DOEpatents

    Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude

    1999-01-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  5. 5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group

    DOEpatents

    Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.

    1999-06-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  6. Post-exercise whey protein hydrolysate supplementation induces a greater increase in muscle protein synthesis than its constituent amino acid content.

    PubMed

    Kanda, Atsushi; Nakayama, Kyosuke; Fukasawa, Tomoyuki; Koga, Jinichiro; Kanegae, Minoru; Kawanaka, Kentaro; Higuchi, Mitsuru

    2013-09-28

    It is well known that ingestion of a protein source is effective in stimulating muscle protein synthesis after exercise. In addition, there are numerous reports on the impact of leucine and leucine-rich whey protein on muscle protein synthesis and mammalian target of rapamycin (mTOR) signalling. However, there is only limited information on the effects of whey protein hydrolysates (WPH) on muscle protein synthesis and mTOR signalling. The aim of the present study was to compare the effects of WPH and amino acids on muscle protein synthesis and the initiation of translation in skeletal muscle during the post-exercise phase. Male Sprague–Dawley rats swam for 2 h to depress muscle protein synthesis. Immediately after exercise, the animals were administered either carbohydrate (CHO), CHO plus an amino acid mixture (AA) or CHO plus WPH. At 1 h after exercise, the supplements containing whey-based protein (AA and WPH) caused a significant increase in the fractional rate of protein synthesis (FSR) compared with CHO. WPH also caused a significant increase in FSR compared with AA. Post-exercise ingestion of WPH caused a significant increase in the phosphorylation of mTOR levels compared with AA or CHO. In addition, WPH caused greater phosphorylation of ribosomal protein S6 kinase and eukaryotic initiation factor 4E-binding protein 1 than AA and CHO. In contrast, there was no difference in plasma amino acid levels following supplementation with either AA or WPH. These results indicate that WPH may include active components that are superior to amino acids for stimulating muscle protein synthesis and initiating translation.

  7. [Genetic code: codon bases--the symbols of amino acid synthesis and catabolism pathways].

    PubMed

    Konyshev, V A

    1983-01-01

    The correlations between genetic codes of amino acids and pathways of synthesis and catabolism of carbon backbone of amino acids are considered. Codes of amino acids which are synthesized from oxoacids of glycolysis, the Krebs cycle and glyoxalic cycle via transamination without any additional chemical reactions, are initiated with guanine (alanine, glutamic and aspartic acids, glycine). Codons of amino acids which are formed on the branches of glycolysis at the level of compounds with three carbon atoms, begin with uracil (phenylalanine, serine, leucine, tyrosine, cysteine, tryptophan). Codes of amino acids formed from aspartate begin with adenine (methionine, isoleucine, threonine, asparagine, lysine, serine), while those of the amino acids formed from the compounds with five carbon atoms (glutamic acid and phosphoribosyl pyrophosphate) begin with cytosine (arginine, proline, glutamine, histidine). The second letter of codons is linked to catabolic pathways of amino acids: most of amino acids entering glycolysis and the Krebs cycle through even-numbered carbon compounds, have adenine and uracil at the second position of codes (A-U type); most of amino acids entering the glycolysis and the Krebs cycle via odd-numbered carbon compounds, have codons with guanine and cytidine at the second position (G-C type). The usage of purine and pyrimidine as the third letter of weak codones in most of amino acids is linked to the enthropy of amino acid formation. A hypothesis claiming that the linear genetic code was assembled from the purine and pyrimidine derivatives which have acted as participants of primitive control of amino acid synthesis and catabolism, is suggested.

  8. Quantifying Protein Synthesis and Degradation in Arabidopsis by Dynamic 13CO2 Labeling and Analysis of Enrichment in Individual Amino Acids in Their Free Pools and in Protein1[OPEN

    PubMed Central

    Fernie, Alisdair R.; Stitt, Mark

    2015-01-01

    Protein synthesis and degradation represent substantial costs during plant growth. To obtain a quantitative measure of the rate of protein synthesis and degradation, we supplied 13CO2 to intact Arabidopsis (Arabidopsis thaliana) Columbia-0 plants and analyzed enrichment in free amino acids and in amino acid residues in protein during a 24-h pulse and 4-d chase. While many free amino acids labeled slowly and incompletely, alanine showed a rapid rise in enrichment in the pulse and a decrease in the chase. Enrichment in free alanine was used to correct enrichment in alanine residues in protein and calculate the rate of protein synthesis. The latter was compared with the relative growth rate to estimate the rate of protein degradation. The relative growth rate was estimated from sequential determination of fresh weight, sequential images of rosette area, and labeling of glucose in the cell wall. In an 8-h photoperiod, protein synthesis and cell wall synthesis were 3-fold faster in the day than at night, protein degradation was slow (3%–4% d−1), and flux to growth and degradation resulted in a protein half-life of 3.5 d. In the starchless phosphoglucomutase mutant at night, protein synthesis was further decreased and protein degradation increased, while cell wall synthesis was totally inhibited, quantitatively accounting for the inhibition of growth in this mutant. We also investigated the rates of protein synthesis and degradation during leaf development, during growth at high temperature, and compared synthesis rates of Rubisco large and small subunits of in the light and dark. PMID:25810096

  9. Measurement of the rates of oxindole-3-acetic acid turnover, and indole-3-acetic acid oxidation in Zea mays seedlings

    NASA Technical Reports Server (NTRS)

    Nonhebel, H. M.; Bandurski, R. S. (Principal Investigator)

    1986-01-01

    Oxindole-3-acetic acid is the principal catabolite of indole-3-acetic acid in Zea mays seedlings. In this paper measurements of the turnover of oxindole-3-acetic acid are presented and used to calculate the rate of indole-3-acetic acid oxidation. [3H]Oxindole-3-acetic acid was applied to the endosperm of Zea mays seedlings and allowed to equilibrate for 24 h before the start of the experiment. The subsequent decrease in its specific activity was used to calculate the turnover rate. The average half-life of oxindole-3-acetic acid in the shoots was found to be 30 h while that in the kernels had an average half-life of 35h. Using previously published values of the pool sizes of oxindole-3-acetic acid in shoots and kernels from seedlings of the same age and variety, and grown under the same conditions, the rate of indole-3-acetic acid oxidation was calculated to be 1.1 pmol plant-1 h-1 in the shoots and 7.1 pmol plant-1 h-1 in the kernels.

  10. Regulating the Skin Permeation Rate of Escitalopram by Ion-pair Formation with Organic Acids.

    PubMed

    Song, Tian; Quan, Peng; Xiang, Rongwu; Fang, Liang

    2016-12-01

    In order to regulate the skin permeation rate (flux) of escitalopram (ESP), ion-pair strategy was used in our work. Five organic acids with different physicochemical properties, benzoic acid (BA), ibuprofen (IB), salicylic acid (SA), benzenesulfonic acid (BSA), and p-aminobenzoic acid (PABA), were employed as counter-ions to regulate the permeation rate of ESP across the rabbit abdominal skin in vitro. The interaction between ESP and organic acids was characterized by FTIR and (13)C NMR spectroscopy. Results showed that all organic acids investigated in this study performed a controlling effect on ESP flux. To further analyze the factors concerned with the permeation capability of ESP-acid complex, a multiple linear regression model was used. It is concluded that the steady-state flux (J) of ESP-acid complexes had a positive correlation with log K o/w (the n-octanol/water partition coefficient of ion-pair complex) and pK a (the acidity of organic acid counter-ion), but a negative correlation with MW (the molecular weight of ion-pair complex). The logK o/w of ion-pair complex is the primary one in all the factors that influence the skin permeation rate of ESP. The results demonstrated that organic acid with appropriate physicochemical properties can be considered as suitable candidate for the transdermal drug delivery of escitalopram.

  11. Synthesis and characterization of L-lactide and polylactic acid (PLA) from L-lactic acid for biomedical applications

    NASA Astrophysics Data System (ADS)

    Rahmayetty, Sukirno, Prasetya, Bambang; Gozan, Misri

    2017-02-01

    Lactide is the monomer for the polymer polylactic acid (PLA) from lactic acid through polycondensation and depolymerization process. The properties of PLA strongly depend on the quality of the lactide monomer from which it is synthesized. Optical purity of lactide produced in depolymerization process confirmed to be L-lactide. The highest yield of crude lactide was 38.5% at temperature 210 °C with average molecular weight (Mn) of oligomer was 2389. Ring opening polymerization of lactide using Candida rugosa lipase as biocatalyst to PLLA synthesis has been achieved to generate useful biomedical materials free from heavy metal.

  12. Insulin does not stimulate muscle protein synthesis during increased plasma branched-chain amino acids alone but still decreases whole body proteolysis in humans.

    PubMed

    Everman, Sarah; Meyer, Christian; Tran, Lee; Hoffman, Nyssa; Carroll, Chad C; Dedmon, William L; Katsanos, Christos S

    2016-10-01

    Insulin stimulates muscle protein synthesis when the levels of total amino acids, or at least the essential amino acids, are at or above their postabsorptive concentrations. Among the essential amino acids, branched-chain amino acids (BCAA) have the primary role in stimulating muscle protein synthesis and are commonly sought alone to stimulate muscle protein synthesis in humans. Fourteen healthy young subjects were studied before and after insulin infusion to examine whether insulin stimulates muscle protein synthesis in relation to the availability of BCAA alone. One half of the subjects were studied in the presence of postabsorptive BCAA concentrations (control) and the other half in the presence of increased plasma BCAA (BCAA). Compared with that prior to the initiation of the insulin infusion, fractional synthesis rate of muscle protein (%/h) did not change (P > 0.05) during insulin in either the control (0.04 ± 0.01 vs 0.05 ± 0.01) or the BCAA (0.05 ± 0.02 vs. 0.05 ± 0.01) experiments. Insulin decreased (P < 0.01) whole body phenylalanine rate of appearance (μmol·kg(-1)·min(-1)), indicating suppression of muscle proteolysis, in both the control (1.02 ± 0.04 vs 0.76 ± 0.04) and the BCAA (0.89 ± 0.07 vs 0.61 ± 0.03) experiments, but the change was not different between the two experiments (P > 0.05). In conclusion, insulin does not stimulate muscle protein synthesis in the presence of increased circulating levels of plasma BCAA alone. Insulin's suppressive effect on proteolysis is observed independently of the levels of circulating plasma BCAA.

  13. Improved synthesis of isostearic acid using zeolite catalysts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Isostearic acids are unique and important biobased products with superior properties. Unfortunately, they are not widely utilized in industry because they are produced as byproducts from a process called clay-catalyzed oligomerization of tall oil fatty acids. Generally, this clay method results in...

  14. Dietary Medium Chain Fatty Acid Supplementation Leads to Reduced VLDL Lipolysis and Uptake Rates in Comparison to Linoleic Acid Supplementation

    PubMed Central

    van Schalkwijk, Daniël B.; Pasman, Wilrike J.; Hendriks, Henk F. J.; Verheij, Elwin R.; Rubingh, Carina M.; van Bochove, Kees; Vaes, Wouter H. J.; Adiels, Martin; Freidig, Andreas P.; de Graaf, Albert A.

    2014-01-01

    Dietary medium chain fatty acids (MCFA) and linoleic acid follow different metabolic routes, and linoleic acid activates PPAR receptors. Both these mechanisms may modify lipoprotein and fatty acid metabolism after dietary intervention. Our objective was to investigate how dietary MCFA and linoleic acid supplementation and body fat distribution affect the fasting lipoprotein subclass profile, lipoprotein kinetics, and postprandial fatty acid kinetics. In a randomized double blind cross-over trial, 12 male subjects (age 51±7 years; BMI 28.5±0.8 kg/m2), were divided into 2 groups according to waist-hip ratio. They were supplemented with 60 grams/day MCFA (mainly C8:0, C10:0) or linoleic acid for three weeks, with a wash-out period of six weeks in between. Lipoprotein subclasses were measured using HPLC. Lipoprotein and fatty acid metabolism were studied using a combination of several stable isotope tracers. Lipoprotein and tracer data were analyzed using computational modeling. Lipoprotein subclass concentrations in the VLDL and LDL range were significantly higher after MCFA than after linoleic acid intervention. In addition, LDL subclass concentrations were higher in lower body obese individuals. Differences in VLDL metabolism were found to occur in lipoprotein lipolysis and uptake, not production; MCFAs were elongated intensively, in contrast to linoleic acid. Dietary MCFA supplementation led to a less favorable lipoprotein profile than linoleic acid supplementation. These differences were not due to elevated VLDL production, but rather to lower lipolysis and uptake rates. PMID:25049048

  15. Synthesis and characterization of hydrogen-bond acidic functionalized graphene

    NASA Astrophysics Data System (ADS)

    Yang, Liu; Han, Qiang; Pan, Yong; Cao, Shuya; Ding, Mingyu

    2014-05-01

    Hexafluoroisopropanol phenyl group functionalized materials have great potential in the application of gas-sensitive materials for nerve agent detection, due to the formation of strong hydrogen-bonding interactions between the group and the analytes. In this paper, take full advantage of ultra-large specific surface area and plenty of carbon-carbon double bonds and hexafluoroisopropanol phenyl functionalized graphene was synthesized through in situ diazonium reaction between -C=C- and p-hexafluoroisopropanol aniline. The identity of the as-synthesis material was confirmed by transmission electron microscopy, Raman spectroscopy, ultraviolet visible spectroscopy, X-ray photoelectron spectroscopy and thermo gravimetric analysis. The synthesis method is simply which retained the excellent physical properties of original graphene. In addition, the novel material can be assigned as an potential candidate for gas sensitive materials towards organophosphorus nerve agent detection.

  16. Asymmetric synthesis of aromatic β-amino acids using ω-transaminase: Optimizing the lipase concentration to obtain thermodynamically unstable β-keto acids.

    PubMed

    Mathew, Sam; Jeong, Seong-Su; Chung, Taeowan; Lee, Sang-Hyeup; Yun, Hyungdon

    2016-01-01

    Synthesized aromatic β-amino acids have recently attracted considerable attention for their application as precursors in many pharmacologically relevant compounds. Previous studies on asymmetric synthesis of aromatic β-amino acids using ω-transaminases could not be done efficiently due to the instability of β-keto acids. In this study, a strategy to circumvent the instability problem of β-keto acids was utilized to generate β-amino acids efficiently via asymmetric synthesis. In this work, thermodynamically stable β-ketoesters were initially converted to β-keto acids using lipase, and the β-keto acids were subsequently aminated using ω-transaminase. By optimizing the lipase concentration, we successfully overcame the instability problem of β-keto acids and enhanced the production of β-amino acids. This strategy can be used as a general approach to efficiently generate β-amino acids from β-ketoesters.

  17. Total synthesis of (±)-epithuriferic acid methyl ester via Diels-Alder reaction.

    PubMed

    Koprowski, Marek; Bałczewski, Piotr; Owsianik, Krzysztof; Różycka-Sokołowska, Ewa; Marciniak, Bernard

    2016-02-07

    In this paper, we have described the first total synthesis of (±)-epithuriferic acid methyl ester from non-natural sources, in four steps (20% overall yield). The key step involves the Diels-Alder reaction of isobenzofuran with methyl 3-(dimethoxyphosphoryl)acrylate which is controlled by "ortho" regio- and endo stereoselectivities due to the COOMe group.

  18. Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids

    PubMed Central

    Cativiela, Carlos; Ordóñez, Mario

    2010-01-01

    The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486

  19. POLYSTYRENE SULFONIC ACID CATALYZED GREENER SYNTHESIS OF HYDRAZONES IN AQUEOUS MEDIUM USING MICROWAVES

    EPA Science Inventory

    An environmentally benign aqueous protocol for the synthesis of cyclic, bi-cyclic, and heterocyclic hydrazones using polystyrene sulfonic acid (PSSA) as a catalyst has been developed; the simple reaction proceeds efficiently in water in the absence of any organic solvent under mi...

  20. Total synthesis of (−)-dihydroprotolichesterenic acid via diastereoselective conjugate addition to chiral fumarates

    PubMed Central

    Hethcox, J. Caleb; Shanahan, Charles S.; Martin, Stephen F.

    2013-01-01

    A diastereoselective conjugate addition of a variety of monoorganocuprates, Li[RCuI], to chiral fumarates to provide funtionalized succinates has been developed. The utility of this reaction is demonstrated in a concise total synthesis of (−)-dihydroprotolichesterenic acid that required only four steps and proceeded in an overall 31% yield. PMID:23539490

  1. Diastereoselective addition of monoorganocuprates to a chiral fumarate: reaction development and synthesis of (-)-dihydroprotolichesterinic acid.

    PubMed

    Hethcox, J Caleb; Shanahan, Charles S; Martin, Stephen F

    2015-09-16

    Recent studies of diastereoselective conjugate additions of monoorganocuprates, Li[RCuI], to chiral γ-alkoxycrotonates and fumarates are disclosed. This methodology was applied to the shortest total synthesis of (-)-dihydroprotolichesterinic acid to date, but several attempts to prepare other succinate-derived natural products, such as pilocarpine and antrodin E, were unsuccessful.

  2. Stimulation of muscle protein synthesis by leucine is dependent on plasma amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that a physiological increase in plasma leucine increased translation initiation factor activity during 60- and 120-min leucine infusion. Muscle protein synthesis was stimulated at 60 min but not at 120 min, perhaps due to the decrease (-50%) in plasma essential amino acids (AA). ...

  3. An Overview of Stereoselective Synthesis of α-Aminophosphonic Acids and Derivatives

    PubMed Central

    Ordóñez, Mario; Rojas-Cabrera, Haydée; Cativiela, Carlos

    2009-01-01

    An overview of all methodologies published during the last few years focused to the stereoselective (diastereoselective or enantioselective) synthesis of α-aminophosphonic acids and derivatives is reported. The procedures have been classified according a retrosynthetic strategy and taking into account the formation of each one of the bonds connected to the chiral centre. PMID:20871799

  4. Methods for the synthesis of tritium-labelled fatty acids and their derivatives, oxylipins and steroids

    NASA Astrophysics Data System (ADS)

    Shevchenko, Valerii P.; Nagaev, Igor Yu; Myasoedov, Nikolai F.

    1999-10-01

    The achievements in the field of synthesis and application of tritium-labelled oxylipins, steroids, fatty acids, phospho-, sphingo- and other lipids are reviewed. The importance of these studies for the solution of current problems of biochemistry, biology and pharmacology is exemplified in the application of labelled compounds. The bibliography includes 148 references.

  5. A facile synthesis of MPd (M = Co, Cu) nanoparticles and their catalysis for formic acid oxidation.

    PubMed

    Mazumder, Vismadeb; Chi, Miaofang; Mankin, Max N; Liu, Yi; Metin, Önder; Sun, Daohua; More, Karren L; Sun, Shouheng

    2012-02-08

    Monodisperse CoPd nanoparticles (NPs) were synthesized and studied for catalytic formic acid (HCOOH) oxidation (FAO). The NPs were prepared by coreduction of Co(acac)(2) (acac = acetylacetonate) and PdBr(2) at 260 °C in oleylamine and trioctylphosphine, and their sizes (5-12 nm) and compositions (Co(10)Pd(90) to Co(60)Pd(40)) were controlled by heating ramp rate, metal salt concentration, or metal molar ratios. The 8 nm CoPd NPs were activated for HCOOH oxidation by a simple ethanol wash. In 0.1 M HClO(4) and 2 M HCOOH solution, their catalytic activities followed the trend of Co(50)Pd(50) > Co(60)Pd(40) > Co(10)Pd(90) > Pd. The Co(50)Pd(50) NPs had an oxidation peak at 0.4 V with a peak current density of 774 A/g(Pd). As a comparison, commercial Pd catalysts showed an oxidation peak at 0.75 V with peak current density of only 254 A/g(Pd). The synthesis procedure could also be extended to prepare CuPd NPs when Co(acac)(2) was replaced by Cu(ac)(2) (ac = acetate) in an otherwise identical condition. The CuPd NPs were less active catalysts than CoPd or even Pd for FAO in HClO(4) solution. The synthesis provides a general approach to Pd-based bimetallic NPs and will enable further investigation of Pd-based alloy NPs for electro-oxidation and other catalytic reactions.

  6. Regulation of alpha-1 acid glycoprotein synthesis by porcine hepatocytes in monolayer culture.

    PubMed

    Caperna, T J; Shannon, A E; Stoll, M; Blomberg, L A; Ramsay, T G

    2015-07-01

    Alpha-1 acid glycoprotein (AGP, orosomucoid, ORM-1) is a highly glycosylated mammalian acute-phase protein, which is synthesized primarily in the liver and represents the major serum protein in newborn pigs. Recent data have suggested that the pig is unique in that AGP is a negative acute-phase protein in this species, and its circulating concentration appears to be associated with growth rate. The purpose of the present study was to investigate the regulation of AGP synthesis in hepatocytes prepared from suckling piglets and to provide a framework to compare its regulation with that of haptoglobin (HP), a positive acute-phase protein. Hepatocytes were isolated from preweaned piglets and maintained in serum-free monolayer culture for up to 72 h. The influences of hormones, cytokines, and redox modifiers on the expression and secretion of AGP and HP were determined by relative polymerase chain reaction and by measuring the concentration of each protein secreted into culture medium. The messenger RNA abundance and/or secretion of AGP protein was enhanced by interleukin (IL)-17a, IL-1, and resveratrol and inhibited by tumor necrosis factor-α (TNF), oncostatin M, and thyroid hormone (P < 0.05). HP expression and synthesis were upregulated by oncostatin M, IL-6, and dexamethasone and downregulated by TNF (P < 0.01). The overall messenger RNA expression at 24 h was in agreement with the secreted protein patterns confirming that control of these proteins in hepatocytes is largely transcriptional. Moreover, these data support the consideration that AGP is a negative acute-phase reactant and appears to be regulated by cytokines (with the exception of TNF) and hormones primarily in a manner opposite to that of the positive acute-phase protein, HP.

  7. Alteration of the specificity and regulation of fatty acid synthesis of Escherichia coli by expression of a plant medium-chain acyl-acyl carrier protein thioesterase.

    PubMed

    Voelker, T A; Davies, H M

    1994-12-01

    The expression of a plant (Umbellularia californica) medium-chain acyl-acyl carrier protein (ACP) thioesterase (BTE) cDNA in Escherichia coli results in a very high level of extractable medium-chain-specific hydrolytic activity but causes only a minor accumulation of medium-chain fatty acids. BTE's full impact on the bacterial fatty acid synthase is apparent only after expression in a strain deficient in fatty acid degradation, in which BTE increases the total fatty acid output of the bacterial cultures fourfold. Laurate (12:0), normally a minor fatty acid component of E. coli, becomes predominant, is secreted into the medium, and can accumulate to a level comparable to the total dry weight of the bacteria. Also, large quantities of 12:1, 14:0, and 14:1 are made. At the end of exponential growth, the pathway of saturated fatty acids is almost 100% diverted by BTE to the production of free medium-chain fatty acids, starving the cells for saturated acyl-ACP substrates for lipid biosynthesis. This results in drastic changes in membrane lipid composition from predominantly 16:0 to 18:1. The continued hydrolysis of medium-chain ACPs by the BTE causes the bacterial fatty acid synthase to produce fatty acids even when membrane production has ceased in stationary phase, which shows that the fatty acid synthesis rate can be uncoupled from phospholipid biosynthesis and suggests that acyl-ACP intermediates might normally act as feedback inhibitors for fatty acid synthase. As the fatty acid synthesis is increasingly diverted to medium chains with the onset of stationary phase, the rate of C12 production increases relative to C14 production. This observation is consistent with activity of the BTE on free acyl-ACP pools, as opposed to its interaction with fatty acid synthase-bound substrates.

  8. Gene regulation of UDP-galactose synthesis and transport: Potential rate limiting processes in initiation of milk production in humans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lactose synthesis is believed to be rate-limiting for milk production. However, understanding the molecular events controlling lactose synthesis in humans is still rudimentary. We have utilized our established model of the RNA isolated from breast milk fat globule from 7 healthy exclusively breastfe...

  9. Synthesis of mixed acid anhydrides from methane and carbon dioxide in acid solvents.

    PubMed

    Zerella, Mark; Mukhopadhyay, Sudip; Bell, Alexis T

    2003-09-04

    [reaction: see text] The reaction of CH(4) with CO(2) has been performed in anhydrous acids using VO(acac)(2) and K(2)S(2)O(8) as promoters. NMR analysis establishes that the primary product is a mixed anhydride of acetic acid and the acid solvent. In sulfuric acid, the overall reaction is CH(4) + CO(2) + SO(3) --> CH(3)C(O)-O-SO(3)H. Hydrolysis of the mixed anhydride produces acetic acid and the solvent acid. When trifluoroacetic acid is the solvent, acetic acid is primarily formed via the reaction CH(4) + CF(3)COOH --> CH(3)COOH + CHF(3).

  10. Synthesis of polyacrylic-acid-based thermochromic polymers

    NASA Astrophysics Data System (ADS)

    Srivastava, Jyoti; Alam, Sarfaraz; Mathur, G. N.

    2003-10-01

    Smart materials respond to environmental stimuli with particular changes in some variables (for example temperature, pressure and electric field etc), for that reason they are often called responsive materials. In the present work, we have synthesized thermochromic polymer based on poly acrylic acid cobalt chloride (CoCl2) and phosphoric acid (H3PO4) that visually and reversibly changes color in the temperature range (70 - 130°C). These thermochromic materials can be used as visual sensors of temperature. Thermochromic polymers are based on polyacrylic acid and CoCl2 complex.

  11. Microbiologically produced carboxylic acids used as building blocks in organic synthesis.

    PubMed

    Aurich, Andreas; Specht, Robert; Müller, Roland A; Stottmeister, Ulrich; Yovkova, Venelina; Otto, Christina; Holz, Martina; Barth, Gerold; Heretsch, Philipp; Thomas, Franziska A; Sicker, Dieter; Giannis, Athanassios

    2012-01-01

    Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building blocks. Thereby, our biotechnological goal was the development of process fundamentals regarding the variable use of renewable raw materials, the development of a multi purpose bioreactor and application of a pilot plant with standard equipment for organic acid production to minimize the technological effort. Furthermore the development of new product isolation procedures, with the aim of direct product recovery, capture of products or single step operation, was necessary. The application of robust and approved microorganisms, also genetically modified, capable of using a wide range of substrates as well as producing a large spectrum of products, was of special importance. Microbiologically produced acids, like 2-oxo-glutaric acid and 2-oxo-D-gluconic acid, are useful educts for the chemical synthesis of hydrophilic triazines, spiro-connected heterocycles, benzotriazines, and pyranoic amino acids. The chiral intermediate of the tricarboxylic acid cycle, (2R,3S)-isocitric acid, is another promising compound. For the first time our process provides large quantities of enantiopure trimethyl (2R,3S)-isocitrate which was used in subsequent chemical transformations to provide new chiral entities for further usage in total synthesis and pharmaceutical research.Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building

  12. Decreased rates of methionine synthesis by methylene tetrahydrofolate reductase-deficient fibroblasts and lymphoblasts.

    PubMed

    Boss, G R; Erbe, R W

    1981-06-01

    Methionine synthesis from homocysteine was measured in intact human fibroblasts and lymphoblasts using a [14C]formate label. Seven fibroblast lines and two lymphoblast lines derived from patients with 5,10-methylene tetrahydrofolate reductase deficiency had rates of methionine synthesis that were from 4 to 43% of normal. When the patients were divided by clinical status into mildly (two patients), moderately (two patients), and severely (three patients) affected, methionine biosynthesis expressed as a percent of control values was 43 and 33%, 11 and 10%, and 7, 6, and 4%, respectively, in fibroblasts. Similar data for the two lymphoblast lines were 36 and 26% for a mildly and moderately affected patient, respectively. These data are to be contrasted with the measurement of residual enzyme activity in cell extracts which agrees less precisely with the clinical status of the patients. In the presence of normal methionine synthetase activity, the rate of synthesis of methionine from homocysteine is a function of the activity of the enzyme 5,10-methylene tetrahydrofolate reductase, and measurement of the methionine biosynthetic capacity of cells deficient in this enzyme accurately reflects the clinical status of the patient from whom the cells were derived.

  13. Genetic modulation of RNA metabolism in Drosophilia. I. Increased rate of ribosomal RNA synthesis.

    PubMed

    Clark, S H; Strausbaugh, L D; Kiefer, B I

    1977-08-01

    It has been suggested that a particular Y chromosome which is rDNA-deficient (YbbSuVar-5) may be associated with an increased utilization of rDNA template in adult testes (Shermoen and Kiefer 1975). To extend the observations on this chromosome, experiments were designed to determine if the chromosome has an effect on rRNA synthesis in bobbed adults and on classic bobbed phenotypes (shortened and thinner scutellar bristles and delayed development). Specific activity measurements were made on rRNA extracted from adult males of the genotypes car bb/YbbSuVar-5, which are rDNA-deficient to the same extent, and from Samarkand+ isogenic (Sam+ iso), which is a wild-type stock. The resulting data demonstrated that the presence of the YbbSuVar-5 chromosome increases the rate of ribosomal RNA synthesis in adult flies. In addition, it was found that the presence of this particular Y chromosome restores wild-type bristle phenotype and development time. Appropriate genetic crosses indicate that the observed effects (increased rRNA synthesis, restoration of wild-type phenotype) are a function of this particular Y chromosome, and are not due to autosomal factors. The results of these experiments suggest that the rate of rRNA accumulation is under genetic control.

  14. Synthesis of deuterated [D32 ]oleic acid and its phospholipid derivative [D64 ]dioleoyl-sn-glycero-3-phosphocholine.

    PubMed

    Darwish, Tamim A; Luks, Emily; Moraes, Greta; Yepuri, Nageshwar R; Holden, Peter J; James, Michael

    2013-01-01

    Oleic acid and its phospholipid derivatives are fundamental to the structure and function of cellular membranes. As a result, there has been increasing interest in the availability of their deuterated forms for many nuclear magnetic resonance, infrared, mass spectroscopy and neutron scattering studies. Here, we present for the first time a straightforward, large-scale (gram quantities) synthesis of highly deuterated [D32 ]oleic acid by using multiple, yet simple and high yielding reactions. The precursors for the synthesis of [D32 ]oleic acid are [D14 ]azelaic acid and [D17 ]nonanoic acid, which were obtained by complete deuteration (>98% D) of their (1) H forms by using metal catalysed hydrothermal H/D exchange reactions. The oleic acid was produced with ca. 94% D isotopic purity and with no contamination by the trans-isomer (elaidic acid). The subsequent synthesis of [D64 ]dioleoyl-sn-glycero-3-phosphocholine from [D32 ]oleic acid is also described.

  15. Growth rate hypothesis and efficiency of protein synthesis under different sulphate concentrations in two green algae.

    PubMed

    Giordano, Mario; Palmucci, Matteo; Raven, John A

    2015-11-01

    The growth rate hypothesis (GRH) predicts a positive correlation between growth rate and RNA content because growth depends upon the protein synthesis machinery. The application of this hypothesis to photoautotrophic organisms has been questioned. We tested the GRH on one prasinophycean, Tetraselmis suecica, and one chlorophycean, Dunaliella salina, grown at three sulphate concentrations. Sulphate was chosen because its concentration in the oceans increased through geological time and apparently had a role in the evolutionary trajectories of phytoplankton. Cell protein content and P quota were positively related to the RNA content (r = 0.62 and r = 0.74, respectively). The correlation of the RNA content with growth rates (r = 0.95) indicates that the GRH was valid for these species when growth rates were below 0.82 d(-1) .

  16. Effect of microwaves (2450-MHz) on the immune system in mice: studies of nucleic acid and protein synthesis

    SciTech Connect

    Wiktor-Jedrzejczak, W.; Ahmed, A.; Czerski, P.; Leach, W.M.; Sell, K.W.

    1980-01-01

    CBA/J adult male mice were given single or triple exposures to 2450-mHz microwaves in an environmentally controlled wave guide facility. The average absorbed dose rate for a single exposure varied from 12 to 15 mW/g. Sham-exposed mice served as controls. Lymphoid cells were collected and tested for metabolic activity on days 3, 6, and 9 following a single exposure, and on days 9, 12, and 16 following triple exposures on days 0, 3, and 6. Cells were cultured in vitro for four hours to seven days before their metabolic rates were assayed. Under these conditions, microwaves failed to produce any detectable change in deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and protein synthesis, as measured by the incorporation of methyl(3H)-thymidine (3H-TDR) (DNA substrate), 3H-uridine (3H-UR) (RNA substrate), and 3H-leucine (protein substrate) by spleen, bone marrow, and peripheral blood lymphocytes (PBL) in vitro. These data suggest that microwave-induced increases in the frequency of complement-receptor (CR)- or surface-immunoglobulin (sIg)-bearing cells were not associated with a concomitant increase in cell proliferation and/or protein synthesis, and favor the concept that microwaves under these conditions stimulate already existing B-cell precursors for maturation.

  17. Independent repression of bile acid synthesis and activation of c-Jun N-terminal kinase (JNK) by activated hepatocyte fibroblast growth factor receptor 4 (FGFR4) and bile acids.

    PubMed

    Yu, Chundong; Wang, Fen; Jin, Chengliu; Huang, Xinqiang; McKeehan, Wallace L

    2005-05-06

    The fibroblast growth factor (FGF) receptor complex is a regulator of adult organ homeostasis in addition to its central role in embryonic development and wound healing. FGF receptor 4 (FGFR4) is the sole FGFR receptor kinase that is significantly expressed in mature hepatocytes. Previously, we showed that mice lacking mouse FGFR4 (mR4(-/-)) exhibited elevated fecal bile acids, bile acid pool size, and expression of liver cholesterol 7alpha-hydroxylase (CYP7A1), the rate-limiting enzyme for canonical neutral bile acid synthesis. To prove that hepatocyte FGFR4 was a negative regulator of cholesterol metabolism and bile acid synthesis independent of background, we generated transgenic mice overexpressing a constitutively active human FGFR4 (CahR4) in hepatocytes and crossed them with the FGFR4-deficient mice to generate CahR4/mR4(-/-) mice. In mice expressing active FGFR4 in liver, fecal bile acid excretion was 64%, bile acid pool size was 47%, and Cyp7a1 expression was 10-30% of wild-type mice. The repressed level of Cyp7a1 expression was resistant to induction by a high cholesterol diet relative to wild-type mice. Expression of CahR4 in mR4(-/-) mouse livers depressed bile acid synthesis below wild-type levels from the elevated levels observed in mR4(-/-). Levels of phosphorylated c-Jun N-terminal kinase (JNK), which is part of a pathway implicated in bile acid-mediated repression of synthesis, was 30% of wild-type levels in mR4(-/-) livers, whereas CahR4 livers exhibited an average 2-fold increase. However, cholate still strongly induced phospho-JNK in mR4(-/-) livers. These results confirm that hepatocyte FGFR4 regulates bile acid synthesis by repression of Cyp7a1 expression. Hepatocyte FGFR4 may contribute to the repression of bile acid synthesis through JNK signaling but is not required for activation of JNK signaling by bile acids.

  18. [Clarification on publications concerning the synthesis of acetylsalicylic acid].

    PubMed

    Lafont, O

    1996-01-01

    Charles Frédéric Gerhardt (1816-1856) mentioned in his Traité de chimie Organique (1854) a publication, in French (realized in 1852 but published in 1853) entitled "Researches on anhydrous organic acids" in which, was reported the reaction of sodium salicylate with acetyl chloride. He thought that the reaction product was an acid anhydride, but obtained really crude acetylsalicylic acid. Later on, but also in 1853, a publication in german, by the same author related the same experiments. Surprisingly only the second publication has been mentioned in most of the historical studies on the subject. Acetyl salicylic acid was identified and synthesised in 1859 by von Gilm by another method and the product obtained by Gerhardt was identified to it in 1869.

  19. Nalidixic Acid and Macromolecular Metabolism in Tetrahymena pyriformis: Effects on Protein Synthesis

    PubMed Central

    de Castro, J. F.; Carvalho, J. F. O.; Moussatché, N.; de Castro, F. T.

    1975-01-01

    A study on the effect of nalidixic acid on macromolecular metabolism, particularly of protein, in Tetrahymena pyriformis was performed. It was shown that the compound is a potent inhibitor of deoxyribonucleic acid, ribonucleic acid, and protein synthesis for this organism. A conspicuous breakdown of polysomes, accompanied by the accumulation of 80S ribosomes, occurred in cells incubated for 10 min with the drug; polysome formation was prevented. The accumulating 80S particles were shown to be run-off ribosomal units. The incorporation of amino acids by a cell-free system is not affected by nalidixic acid. In nonproliferating cells the incorporation was also not prevented, unless the cells were previously incubated with the drug. These results are discussed in terms of the possible mechanism of action of nalidixic acid in T. pyriformis. PMID:807153

  20. Synthesis of an indole analog of folic acid

    SciTech Connect

    Shengeliya, M.S.; Avramenko, V.G.; Kuleshova, L.N.; Ershova, Yu.A.; Chernov, V.A.; Surorov, N.N.

    1987-06-01

    The authors study the replacement of the p-aminobenzoic acid (PABA) moiety. The authors synthesized an indole analog of folic acid, namely dimethyl N-(5-(2'-amino-4'-oxo-6'-pteridinyl)methylaminoindol-2-yl)glutamate. The physicochemical properties and the chemical shifts in the PMR spectra of the compounds obtained are shown. The examination of the compound for antitumor activity was carried out using rats and mice.

  1. Synthesis and biological activity of alkynoic acids derivatives against mycobacteria

    PubMed Central

    Vilchèze, Catherine; Leung, Lawrence W.; Bittman, Robert; Jacobs, William R.

    2015-01-01

    2-alkynoic acids have bactericidal activity against Mycobacterium smegmatis but their activity fall sharply as the length of the carbon chain increased. In this study, derivatives of 2- alkynoic acids were synthesized and tested against fast- and slow-growing mycobacteria. Their activity was first evaluated in M. smegmatis against their parental 2-alkynoic acids, as well as isoniazid, a first-line antituberculosis drug. The introduction of additional unsaturation or heteroatoms into the carbon chain enhanced the antimycobacterial activity of longer chain alkynoic acids (more than 19 carbons long). In contrast, although the modification of the carboxylic group did not improve the antimycobacterial activity, it significantly reduced the toxicity of the compounds against eukaryotic cells. Importantly, 4-(alkylthio)but-2-ynoic acids, had better bactericidal activity than the parental 2-alkynoic acids and on a par with isoniazid against the slow-grower Mycobacterium bovis BCG. These compounds had also low toxicity against eukaryotic cells, suggesting that they could be potential therapeutic agents against other types of topical mycobacterial infections causing skin diseases including Mycobacterium abscessus, Mycobacterium ulcerans, and Mycobacterium leprae. Moreover, they provide a possible scaffold for future drug development. PMID:26256431

  2. Bioengineering of bacterial polymer inclusions catalyzing the synthesis of N-acetylneuraminic acid.

    PubMed

    Hooks, David O; Blatchford, Paul A; Rehm, Bernd H A

    2013-05-01

    N-Acetylneuraminic acid is produced by alkaline epimerization of N-acetylglucosamine to N-acetylmannosamine and then subsequent condensation with pyruvate catalyzed by free N-acetylneuraminic acid aldolase. The high-alkaline conditions of this process result in the degradation of reactants and products, while the purification of free enzymes to be used for the synthesis reaction is a costly process. The use of N-acetylglucosamine 2-epimerase has been seen as an alternative to the alkaline epimerization process. In this study, these two enzymes involved in N-acetylneuraminic acid production were immobilized to biopolyester beads in vivo in a one-step, cost-efficient process of production and isolation. Beads with epimerase-only, aldolase-only, and combined epimerase/aldolase activity were recombinantly produced in Escherichia coli. The enzymatic activities were 32 U, 590 U, and 2.2 U/420 U per gram dry bead weight, respectively. Individual beads could convert 18% and 77% of initial GlcNAc and ManNAc, respectively, at high substrate concentrations and near-neutral pH, demonstrating the application of this biobead technology to fine-chemical synthesis. Beads establishing the entire N-acetylneuraminic acid synthesis pathway were able to convert up to 22% of the initial N-acetylglucosamine after a 50-h reaction time into N-acetylneuraminic acid.

  3. De novo fatty acid synthesis controls the fate between regulatory T and T helper 17 cells.

    PubMed

    Berod, Luciana; Friedrich, Christin; Nandan, Amrita; Freitag, Jenny; Hagemann, Stefanie; Harmrolfs, Kirsten; Sandouk, Aline; Hesse, Christina; Castro, Carla N; Bähre, Heike; Tschirner, Sarah K; Gorinski, Nataliya; Gohmert, Melanie; Mayer, Christian T; Huehn, Jochen; Ponimaskin, Evgeni; Abraham, Wolf-Rainer; Müller, Rolf; Lochner, Matthias; Sparwasser, Tim

    2014-11-01

    Interleukin-17 (IL-17)-secreting T cells of the T helper 17 (TH17) lineage play a pathogenic role in multiple inflammatory and autoimmune conditions and thus represent a highly attractive target for therapeutic intervention. We report that inhibition of acetyl-CoA carboxylase 1 (ACC1) restrains the formation of human and mouse TH17 cells and promotes the development of anti-inflammatory Foxp3(+) regulatory T (Treg) cells. We show that TH17 cells, but not Treg cells, depend on ACC1-mediated de novo fatty acid synthesis and the underlying glycolytic-lipogenic metabolic pathway for their development. Although TH17 cells use this pathway to produce phospholipids for cellular membranes, Treg cells readily take up exogenous fatty acids for this purpose. Notably, pharmacologic inhibition or T cell-specific deletion of ACC1 not only blocks de novo fatty acid synthesis but also interferes with the metabolic flux of glucose-derived carbon via glycolysis and the tricarboxylic acid cycle. In vivo, treatment with the ACC-specific inhibitor soraphen A or T cell-specific deletion of ACC1 in mice attenuates TH17 cell-mediated autoimmune disease. Our results indicate fundamental differences between TH17 cells and Treg cells regarding their dependency on ACC1-mediated de novo fatty acid synthesis, which might be exploited as a new strategy for metabolic immune modulation of TH17 cell-mediated inflammatory diseases.

  4. Synthesis and Bioactivity of (R)-Ricinoleic Acid Derivatives: A Review.

    PubMed

    Pabiś, Sylwia; Kula, Józef

    2016-01-01

    (R)-Ricinoleic acid (RA) [(12R,9Z)-hydroxyoctadecenoic acid], the main compound of castor seed oil, because of its unusual structure readily undergoes multi-directional chemical and biochemical transformations to produce derivatives with the retained carbon skeleton or with its degradation. Many of these are of high biological activity, as documented by an in vitro study, and possess therapeutic potential. This review article provides an overview of the recent developments in the area of synthesis of RA based compounds with anticancer and antimicrobial activities. Moreover, the antiinflammatory and analgesic properties of some ricinoleic acid derivatives are also highlighted.

  5. Gibberellic Acid-Induced Synthesis of Protease by Isolated Aleurone Layers of Barley 1

    PubMed Central

    Jacobsen, John V.; Varner, J. E.

    1967-01-01

    The production of protease by isolated aleurone layers of barley in response to gibberellic acid has been examined. The protease arises in the aleurone layer and is mostly released from the aleurone cells. The courses of release of amylase and protease from aleurone layers, the dose responses to gibberellic acid and the effects of inhibitors on the production of both enzymes are parallel. As is the case for amylase, protease is made de novo in response to the hormone. These data give some credence to the hypothesis that the effect of gibberellic acid is to promote the simultaneous synthesis and secretion of a group of hydrolases. PMID:16656695

  6. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids

    NASA Astrophysics Data System (ADS)

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D. V. S.; Sharma, Rohit K.

    2014-10-01

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  7. Double-helical nucleic acids with cross-linked strands: synthesis and applications in molecular biology

    NASA Astrophysics Data System (ADS)

    Antsypovitch, Sergei I.; Oretskaya, Tat'yana S.

    1998-03-01

    Data on the methods employed for cross-linking of DNA strands and for the synthesis of oligonucleotide duplexes with cross-links between strands are summarised. Existing methods are systematised; their advantages and drawbacks are discussed. The examples of applications of DNA duplexes with covalently cross-linked chains for the study of protein-nucleic acid recognition and mechanisms of action of nucleic acid-binding proteins for gaining information about the spatial structure of nucleic acids, and for the solution of other problems of molecular biology are given. The bibliography includes 131 references.

  8. Recent advances in the synthesis and application of fluorescent α-amino acids.

    PubMed

    Harkiss, Alexander H; Sutherland, Andrew

    2016-09-26

    Fluorescence spectroscopy has become a powerful technique for probing a range of complex biological processes including enzyme mechanisms and protein-protein interactions. While the application of this technique uses a number of strategies, many of these rely on the use of fluorescent α-amino acids. This review highlights the recent synthetic methods developed for the incorporation of highly conjugated chromophores into the side-chain of α-amino acids and the application of these compounds as probes for imaging in medicine and biology. In particular, the design and synthesis of α-amino acids bearing coumarin, flavone and polyaromatic derived chromophores is described.

  9. Enzymatic Synthesis of Nucleic Acids with Defined Regioisomeric 2'-5' Linkages.

    PubMed

    Cozens, Christopher; Mutschler, Hannes; Nelson, Geoffrey M; Houlihan, Gillian; Taylor, Alexander I; Holliger, Philipp

    2015-12-14

    Information-bearing nucleic acids display universal 3'-5' linkages, but regioisomeric 2'-5' linkages occur sporadically in non-enzymatic RNA synthesis and may have aided prebiotic RNA replication. Herein we report on the enzymatic synthesis of both DNA and RNA with site-specific 2'-5' linkages by an engineered polymerase using 3'-deoxy- or 3'-O-methyl-NTPs as substrates. We also report the reverse transcription of the resulting modified nucleic acids back to 3'-5' linked DNA with good fidelity. This enables a fast and simple method for "structural mutagenesis" by the position-selective incorporation of 2'-5' linkages, whereby nucleic acid structure and function may be probed through local distortion by regioisomeric linkages while maintaining the wild-type base sequence as we demonstrate for the 10-23 RNA endonuclease DNAzyme.

  10. Clearance and synthesis rates of beta 2-microglobulin in patients undergoing hemodialysis and in normal subjects

    SciTech Connect

    Floege, J.; Bartsch, A.; Schulze, M.; Shaldon, S.; Koch, K.M.; Smeby, L.C. )

    1991-08-01

    Retention of {beta} 2-microglobulin in patients undergoing hemodialysis is associated with a {beta} 2-microglobulin-derived amyloidosis. Removal of {beta} 2-microglobulin by renal replacement therapy has been proposed for the prevention of this amyloidosis. Currently, however, data on the {beta} 2-microglobulin synthesis rate in patients undergoing hemodialysis are scarce, and consequently it remains speculative how much removal would be necessary to counterbalance synthesis. The plasma kinetics of iodine 131-labeled {beta} 2-microglobulin were therefore examined in 11 patients with anuria who were undergoing long-term hemodialysis. Five healthy persons served as controls. Kinetic modeling of the plasma curves showed that the data fitted a two-pool model (r2 greater than 0.96) consisting of a rapid 2 to 4 hour distribution phase followed by a less steep curve, described by the plasma (metabolic) clearance (Clp). Synthetic rates were calculated from Clp and the {beta} 2-microglobulin steady state plasma concentration (plus {beta} 2-microglobulin removal during hemodialysis in the case of high flux hemodialysis). The results showed a significantly higher Clp in normal controls as compared with patients undergoing hemodialysis (65.5 {plus minus} 12.8 ml/min (mean {plus minus} SD) versus 3.4 {plus minus} 0.7 ml/min). In contrast, the {beta} 2-microglobulin synthesis rate in the patient group (3.10 {plus minus} 0.79 mg/kg/day) was not significantly different from that of normal controls (2.40 {plus minus} 0.67 mg/kg/day), which was due to markedly elevated {beta} 2-microglobulin plasma concentrations in the patients (37.6 {plus minus} 14.1 mg/L vs 1.92 {plus minus} 0.27 mg/L). These findings suggest that the presence of end-stage renal disease does not have a significant impact on the beta 2-microglobulin generation rate.

  11. Influence of Nrf2 activators on subcellular skeletal muscle protein and DNA synthesis rates after 6 weeks of milk protein feeding in older adults.

    PubMed

    Konopka, Adam R; Laurin, Jaime L; Musci, Robert V; Wolff, Christopher A; Reid, Justin J; Biela, Laurie M; Zhang, Qian; Peelor, Fredrick F; Melby, Christopher L; Hamilton, Karyn L; Miller, Benjamin F

    2017-03-10

    In older adults, chronic oxidative and inflammatory stresses are associated with an impaired increase in skeletal muscle protein synthesis after acute anabolic stimuli. Conjugated linoleic acid (CLA) and Protandim have been shown to activate nuclear factor erythroid-derived 2-like 2 (Nrf2), a transcription factor for the antioxidant response element and anti-inflammatory pathways. This study tested the hypothesis that compared to a placebo control (CON), CLA and Protandim would increase skeletal muscle subcellular protein (myofibrillar, mitochondrial, cytoplasmic) and DNA synthesis in older adults after 6 weeks of milk protein feeding. CLA decreased oxidative stress and skeletal muscle oxidative damage with a trend to increase messenger RNA (mRNA) expression of a Nrf2 target, NAD(P)H dehydrogenase quinone 1 (NQO1). However, CLA did not influence other Nrf2 targets (heme oxygenase-1 (HO-1), glutathione peroxidase 1 (Gpx1)) or protein or DNA synthesis. Conversely, Protandim increased HO-1 protein content but not the mRNA expression of downstream Nrf2 targets, oxidative stress, or skeletal muscle oxidative damage. Rates of myofibrillar protein synthesis were maintained despite lower mitochondrial and cytoplasmic protein syntheses after Protandim versus CON. Similarly, DNA synthesis was non-significantly lower after Protandim compared to CON. After Protandim, the ratio of protein to DNA synthesis tended to be greater in the myofibrillar fraction and maintained in the mitochondrial and cytoplasmic fractions, emphasizing the importance of measuring both protein and DNA synthesis to gain insight into proteostasis. Overall, these data suggest that Protandim may enhance proteostatic mechanisms of skeletal muscle contractile proteins after 6 weeks of milk protein feeding in older adults.

  12. Starch and sucrose synthesis in Phaseolus vulgaris as affected by light, CO/sub 2/, and abscisic acid

    SciTech Connect

    Sharkey, T.D.; Berry, J.A.; Raschke, K.

    1985-03-01

    Phaseolus vulgaris L. leaves were subjected to various light, CO/sub 2/, and O/sub 2/ levels and abscisic acid, then given a 10 minute pulse of /sup 14/CO/sub 2/ followed by a 5 minute chase with unlabeled CO/sub 2/. After the chase period, very little label remained in the ionic fractions except at low CO/sub 2/ partial pressure. Most label was found in the neutral, alcohol soluble fraction or in the insoluble fraction digestable by amyloglucosidase. Sucrose formation was linearly related to assimilation rate. Starch formation increased linearly with assimilation rate, but did not occur if the assimilation rate was below 4 micromoles per square meter per second. Neither abscisic acid, nor high CO/sub 2/ in combination with low O/sub 2/ caused significant perturbations of the sucrose/starch formation ratio. These studies indicate that the pathways for starch and sucrose synthesis both are controlled by the rate of net CO/sub 2/ assimilation, with sucrose the preferred product at very low assimilation rates.

  13. CFD investigation of Schizochytrium sp. impeller configurations on cell growth and docosahexaenoic acid synthesis.

    PubMed

    Zhao, Xiaoyan; Ren, Lujing; Guo, Dongsheng; Wu, Wenjia; Ji, Xiaojun; Huang, He

    2016-08-01

    Effects of impeller configurations on docosahexaenoic acid production and flow characteristics were investigated by Schizochytrium sp. in a 15 L bioreactor. 6-straight blade disc turbine (6-SBDT), 6-arrowy-blade disc turbine (6-ABDT) and down-pumping propeller (DPP) were combined to form different impeller configurations. Simulated results showed that configuration SSA consisting of upper two 6-SBDT and one bottom 6-ABDT possessed the worst oxygen supply capacity. But it obtained the highest DHA percentage of 48.17 % and DHA yield of 21.42 g/L, indicating that it was beneficial for DHA synthesis and converting glucose to biomass and lipids. Configuration SAS consisting of one middle 6-ABDT and two 6-SBDT provided better mixing capacity, which resulted in the maximum glucose consumption rate of 2.86 g/L h and the highest biomass of 108.09 g/L. This study would improve insight into understanding the relationship between flow field and the physiology of Schizochytrium sp. for the scale-up of industrial DHA production.

  14. Synthesis of hydroxyeicosatetraenoic acids (HETE's) by adrenal glomerulosa cells and incorporation into cellular lipids

    SciTech Connect

    Campbell, W.B.; Richards, C.F.; Brady, M.T.; Falck, J.R.

    1986-03-05

    The role of lipoxygenase metabolites of arachidonic acid (AA) in the regulation of aldosterone secretion was studied in isolated rat adrenal glomerulosa cells. Cells were incubated with /sup 14/C-AA in the presence of angiotensin (AII). The media was extracted, metabolites isolated by HPLC, and structures of the metabolites determined by UV absorbance and mass spectrometry. The major products were 12- and 15-HETE with lesser amounts of 11- and 5-HETE. When adrenal cells were incubated with 15-, 12- or 5-HPETE or their respective HETE's (0.03-300nM), there was no significant change in basal or AII-stimulated aldosterone release. Cells were incubated with (/sup 3/H)-AA, -5-HETE, -15-HETE, -12-HETE or -LTB. The cellular lipids were extracted and analyzed by TLC. AA was incorporated into phospholipids (22%), cholesterol esters (50%) and triglycerides (21%). Neither the HETE's or LTB/sub 4/ were incorporated into phospholipids. 5-HETE was taken up into di- and mono-glycerides. The rates of incorporation of AA and 5-HETE were similar (+ 1/2 = 10 min). The incorporation of 5-HETE into glycerol esters did not modify the release of aldosterone by the cells. Thus, while adrenal cells synthesize HETE's, these eicosanoids do not appear to alter the synthesis of aldosterone.

  15. Evaluation of the Strecker synthesis as a source of amino acids on carbonaceous chondrites

    NASA Technical Reports Server (NTRS)

    Lerner, N. R.; Peterson, Etta; Chang, S.

    1991-01-01

    The Strecker synthesis (SS) has been proposed as the source of amino acids (AA) formed during aqueous alteration of carbonaceous chondrites. It is postulated that the aldehyde and ketone precursors of the meteoritic AA originated in interstellar syntheses and accreted on the meteorite parent body along with other reactant species in cometesimal ices. The SS has been run with formaldehyde, acetyldehyde, propionaldehyde, acetone, and methyl ketone as starting materials. To study the effect of minerals on the reaction, the SS was run in the presence and absence of dust from the Allende meteorite using deuterated aldehydes and ketones as starting materials. The products were studied by GC/MS. With the exception of glycine, the retention of deuterium in the AA was greater than 90 pct. Some D exchange with water does occur, however, and determination of the rate of exchange as a function of pH and temperature may allow some bounds to be placed on the duration of parent body aqueous alteration. The retention of D by the AA under conditions studied thus far is consistent with the model that a SS starting from interstellar aldehydes and ketones led to the production of meteoritic AA.

  16. Rates of insulin secretion in INS-1 cells are enhanced by coupling to anaplerosis and Kreb's cycle flux independent of ATP synthesis

    SciTech Connect

    Cline, Gary W.; Pongratz, Rebecca L.; Zhao, Xiaojian; Papas, Klearchos K.

    2011-11-11

    Highlights: Black-Right-Pointing-Pointer We studied media effects on mechanisms of insulin secretion of INS-1 cells. Black-Right-Pointing-Pointer Insulin secretion was higher in DMEM than KRB despite identical ATP synthesis rates. Black-Right-Pointing-Pointer Insulin secretion rates correlated with rates of anaplerosis and TCA cycle. Black-Right-Pointing-Pointer Mitochondria metabolism and substrate cycles augment secretion signal of ATP. -- Abstract: Mechanistic models of glucose stimulated insulin secretion (GSIS) established in minimal media in vitro, may not accurately describe the complexity of coupling metabolism with insulin secretion that occurs in vivo. As a first approximation, we have evaluated metabolic pathways in a typical growth media, DMEM as a surrogate in vivo medium, for comparison to metabolic fluxes observed under the typical experimental conditions using the simple salt-buffer of KRB. Changes in metabolism in response to glucose and amino acids and coupling to insulin secretion were measured in INS-1 832/13 cells. Media effects on mitochondrial function and the coupling efficiency of oxidative phosphorylation were determined by fluorometrically measured oxygen consumption rates (OCRs) combined with {sup 31}P NMR measured rates of ATP synthesis. Substrate preferences and pathways into the TCA cycle, and the synthesis of mitochondrial 2nd messengers by anaplerosis were determined by {sup 13}C NMR isotopomer analysis of the fate of [U-{sup 13}C] glucose metabolism. Despite similar incremental increases in insulin secretion, the changes of OCR in response to increasing glucose from 2.5 to 15 mM were blunted in DMEM relative to KRB. Basal and stimulated rates of insulin secretion rates were consistently higher in DMEM, while ATP synthesis rates were identical in both DMEM and KRB, suggesting greater mitochondrial uncoupling in DMEM. The relative rates of anaplerosis, and hence synthesis and export of 2nd messengers from the mitochondria were found

  17. Enantiomeric deoxycholic acid: total synthesis, characterization, and preliminary toxicity toward colon cancer cell lines.

    PubMed

    Katona, Bryson W; Rath, Nigam P; Anant, Shrikant; Stenson, William F; Covey, Douglas F

    2007-11-23

    Deoxycholic acid (DCA) is an endogenous secondary bile acid implicated in numerous pathological conditions including colon cancer formation and progression and cholestatic liver disease. DCA involvement in these disease processes results partly from its ability to modulate signaling cascades within the cell, presumably through both direct receptor activation and general detergent mediated membrane changes. To further explore DCA induced changes in cell signaling, we completed a total synthesis of enantiomeric deoxycholic acid (ent-DCA) from achiral 2-methyl-1,3-cyclopentanedione. Using a modified method of the synthesis of ent-testosterone that proceeds through the (R)-(-)-Hajos-Parrish ketone, we have completed the successful synthesis of ent-DCA in 25 steps with a yield of 0.3% with all stereochemical assignments of the product confirmed by X-ray crystallography. Our studies toward this synthesis also uncovered the methodology for the development of a novel A,B-cis steroidal skeleton system containing a C3-C9 single bond as well as conditions to selectively ketalize the typically less reactive 12-carbonyl in poly-keto A,B-cis androgens. The critical micelle concentration (cmc) of ent-DCA, determined by a dye solubilization method, was identical to the cmc of natural DCA. Toxicity studies toward HT-29 and HCT-116 human colon cancer cell lines demonstrated that ent-DCA had similar effects on proliferation, yet showed a markedly decreased ability to induce apoptosis as compared to natural DCA.

  18. The promoting effects of geniposidic acid and aucubin in Eucommia ulmoides Oliver leaves on collagen synthesis.

    PubMed

    Li, Y; Sato, T; Metori, K; Koike, K; Che, Q M; Takahashi, S

    1998-12-01

    We have reported that collagen synthesis was stimulated by the administration of a hot water extract from the leaves of Eucommia ulmoides OLIVER, Eucommiaceae (Du-Zhong leaves) in false aged model rats. In this paper, we set out to examine the compounds in Du-Zhong leaves that stimulated collagen synthesis in false aged model rats. In experiment 1, a methanol extract of Du-Zhong leaves also stimulated collagen synthesis in aged model rats. An acetone fraction was derived from the methanol extract by silica gel chromatography in experiment 2. The acetone fraction mainly contained iridoides mono-glycosides such as geniposidic acid and aucubin. The administration of geniposidic acid or aucubin stimulated collagen synthesis in aged model rats in experiments 3 and 4 (significance (p<0.05)). The reported pharmacological effects of Du-Zhong leaves, including healing organs and strengthening bone and muscle, are closely related to collagen metabolism. It appears that geniposidic acid and aucubin are the actual compounds in Du-Zhong which caused the effect in our experiments.

  19. Reliability of Urinary Excretion Rate Adjustment in Measurements of Hippuric Acid in Urine

    PubMed Central

    Nicolli, Annamaria; Chiara, Federica; Gambalunga, Alberto; Carrieri, Mariella; Bartolucci, Giovanni Battista; Trevisan, Andrea

    2014-01-01

    The urinary excretion rate is calculated based on short-term, defined time sample collections with a known sample mass, and this measurement can be used to remove the variability in urine concentrations due to urine dilution. Adjustment to the urinary excretion rate of hippuric acid was evaluated in 31 healthy volunteers (14 males and 17 females). Urine was collected as short-term or spot samples and tested for specific gravity, creatinine and hippuric acid. Hippuric acid values were unadjusted or adjusted to measurements of specific gravity, creatinine or urinary excretion rate. Hippuric acid levels were partially independent of urinary volume and urinary flow rate, in contrast to specific gravity and creatinine, which were both highly dependent on the hippuric acid level. Accordingly, hippuric acid was independent on urinary specific gravity and creatinine excretion. Unadjusted and adjusted values for specific gravity or creatinine were generally closely correlated, especially in spot samples. Values adjusted to the urinary excretion rate appeared well correlated to those unadjusted and adjusted to specific gravity or creatinine values. Thus, adjustment of crude hippuric acid values to the urinary excretion rate is a valid procedure but is difficult to apply in the field of occupational medicine and does not improve the information derived from values determined in spot urine samples, either unadjusted or adjusted to specific gravity and creatinine. PMID:25019265

  20. Five Decades with Polyunsaturated Fatty Acids: Chemical Synthesis, Enzymatic Formation, Lipid Peroxidation and Its Biological Effects

    PubMed Central

    Catalá, Angel

    2013-01-01

    I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074

  1. One-Pot synthesis of phosphorylated mesoporous carbon heterogeneous catalysts with tailored surface acidity

    SciTech Connect

    Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T; Bauer, Christopher; Wang, Xiqing; Veith, Gabriel M; Dai, Sheng

    2012-01-01

    Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contents were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.

  2. Novel chemical synthesis of ginkgolic acid (13:0) and evaluation of its tyrosinase inhibitory activity.

    PubMed

    Fu, Yuanqing; Hong, Shan; Li, Duo; Liu, Songbai

    2013-06-05

    A novel efficient synthesis of ginkgolic acid (13:0) from abundant 2,6-dihydroxybenzoic acid was successfully developed through a state-of-the-art palladium-catalyzed cross-coupling reaction and catalytic hydrogenation with an overall yield of 34% in five steps. The identity of the synthesized ginkgolic acid (13:0) was confirmed by nuclear magnetic resonance, mass spectrometry, infrared, and high-performance liquid chromatography. The reaction sequence of this method can be readily extended to the synthesis of other ginkgolic acids. The synthesized ginkgolic acid (13:0) exhibited promising anti-tyrosinase activity (IC₅₀ = 2.8 mg/mL) that was not correlated to antioxidant activity as probed by 1,1-diphenyl-2-picrylhydrazyl, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), ferric reducing ability of plasma, and oxygen radical absorbance capacity assays. The synthetic strategy developed in this work will significantly facilitate biological studies of ginkgolic acids that have great potential applications in food and pharmaceuticals.

  3. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    NASA Technical Reports Server (NTRS)

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

    2011-01-01

    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  4. Optimization of synthesis and peptization steps to obtain iron oxide nanoparticles with high energy dissipation rates

    PubMed Central

    Mérida, Fernando; Chiu-Lam, Andreina; Bohórquez, Ana C.; Maldonado-Camargo, Lorena; Pérez, María-Eglée; Pericchi, Luis; Torres-Lugo, Madeline; Rinaldi, Carlos

    2015-01-01

    Magnetic Fluid Hyperthermia (MFH) uses heat generated by magnetic nanoparticles exposed to alternating magnetic fields to cause a temperature increase in tumors to the hyperthermia range (43–47 °C), inducing apoptotic cancer cell death. As with all cancer nanomedicines, one of the most significant challenges with MFH is achieving high nanoparticle accumulation at the tumor site. This motivates development of synthesis strategies that maximize the rate of energy dissipation of iron oxide magnetic nanoparticles, preferable due to their intrinsic biocompatibility. This has led to development of synthesis strategies that, although attractive from the point of view of chemical elegance, may not be suitable for scale-up to quantities necessary for clinical use. On the other hand, to date the aqueous co-precipitation synthesis, which readily yields gram quantities of nanoparticles, has only been reported to yield sufficiently high specific absorption rates after laborious size selective fractionation. This work focuses on improvements to the aqueous co-precipitation of iron oxide nanoparticles to increase the specific absorption rate (SAR), by optimizing synthesis conditions and the subsequent peptization step. Heating efficiencies up to 1,048 W/gFe (36.5 kA/m, 341 kHz; ILP = 2.3 nH·m2·kg−1) were obtained, which represent one of the highest values reported for iron oxide particles synthesized by co-precipitation without size-selective fractionation. Furthermore, particles reached SAR values of up to 719 W/gFe (36.5 kA/m, 341 kHz; ILP = 1.6 nH·m2·kg−1) when in a solid matrix, demonstrating they were capable of significant rates of energy dissipation even when restricted from physical rotation. Reduction in energy dissipation rate due to immobilization has been identified as an obstacle to clinical translation of MFH. Hence, particles obtained with the conditions reported here have great potential for application in nanoscale thermal cancer therapy. PMID:26273124

  5. Synthesis of asymmetric tetracarboxylic acids and corresponding dianhydrides

    NASA Technical Reports Server (NTRS)

    Chuang, Chun-Hua (Inventor)

    2008-01-01

    This invention relates to processes for preparing asymmetrical biphenyl tetracarboxylic acids and the corresponding asymmetrical dianhydrides, namely 2,3,3',4'-biphenyl dianhydride (a-BPDA), 2,3,3',4'-benzophenone dianhydride (a-BTDA) and 3,4'-methylenediphthalic anhydride (-MDPA). By cross-coupling reactions of reactive metal substituted o-xylenes or by cross-coupling o-xylene derivatives in the presence of catalysts, this invention specifically produces asymmetrical biphenyl intermediates that are subsequently oxidized or hydrolyzed and oxidized to provide asymmetric biphenyl tetracarboxylic acids in comparatively high yields. These asymmetrical biphenyl tetracarboxylic acids are subsequently converted to the corresponding asymmetrical dianhydrides without contamination by symmetrical biphenyl dianhydrides.

  6. The use of supported acidic ionic liquids in organic synthesis.

    PubMed

    Skoda-Földes, Rita

    2014-06-26

    Catalysts obtained by the immobilisation of acidic ionic liquids (ILs) on solid supports offer several advantages compared to the use of catalytically active ILs themselves. Immobilisation may result in an increase in the number of accessible active sites of the catalyst and a reduction of the amount of the IL required. The ionic liquid films on the carrier surfaces provide a homogeneous environment for catalytic reactions but the catalyst appears macroscopically as a dry solid, so it can simply be separated from the reaction mixture. As another advantage, it can easily be applied in a continuous fixed bed reactor. In the present review the main synthetic strategies towards the preparation of supported Lewis acidic and Brønsted acidic ILs are summarised. The most important characterisation methods and structural features of the supported ionic liquids are presented. Their efficiency in catalytic reactions is discussed with special emphasis on their recyclability.

  7. Survival, Deoxyribonucleic Acid Breakdown, and Synthesis in Salmonella typhimurium as Compared with Escherichia coli B Strains

    PubMed Central

    Hudnik-Plevnik, Tamara A.; Djordjević, Nadežda

    1970-01-01

    Salmonella typhimurium LT-2 was compared with radioresistant (B/r) and radiosensitive (Bs−2) strains of Escherichia coli in respect to the survival, deoxyribonucleic acid (DNA) breakdown, and DNA synthesis after X irradiation. It is shown that S. typhimurium LT-2 is about four times more sensitive than E. coli B/r but less sensitive than Bs−2. The DNA breakdown is in S. typhimurium LT-2 lower than the postirradiation breakdown of DNA in both E. coli strains and DNA synthesis proceeds in this bacterium in spite of a much lower survival, as in the radioresistant E. coli B/r. PMID:4916313

  8. Convenient and Scalable Synthesis of Fmoc-Protected Peptide Nucleic Acid Backbone

    PubMed Central

    Feagin, Trevor A.; Shah, Nirmal I.; Heemstra, Jennifer M.

    2012-01-01

    The peptide nucleic acid backbone Fmoc-AEG-OBn has been synthesized via a scalable and cost-effective route. Ethylenediamine is mono-Boc protected, then alkylated with benzyl bromoacetate. The Boc group is removed and replaced with an Fmoc group. The synthesis was performed starting with 50 g of Boc anhydride to give 31 g of product in 32% overall yield. The Fmoc-protected PNA backbone is a key intermediate in the synthesis of nucleobase-modified PNA monomers. Thus, improved access to this molecule is anticipated to facilitate future investigations into the chemical properties and applications of nucleobase-modified PNA. PMID:22848796

  9. Assessing the reproducibility of fractional rates of protein synthesis in muscle tissue measured using the flooding dose technique.

    PubMed

    McCarthy, Ian D; Brown, James

    2016-07-01

    The flooding dose technique of Garlick et al. (1980) has become the main method for measuring tissue and whole-animal rates of protein synthesis in ectotherms. However, single tissue samples are used to determine rates of protein synthesis and no studies have examined the pattern of flooding in large tissues such as the white muscle in fishes, which can comprise up to 55% of the wet body mass of a fish and which is poorly perfused. The present study has examined, for the first time, the patterns of flooding and measured rates of protein synthesis in five different regions of the white muscle in the Arctic charr Salvelinus alpinus ranging in size from 25g to 1.6kg following a flooding dose injection of L-[(3)H]-phenylalanine. The results indicate that the degree of flooding (i.e. free pool specific radioactivity relative to that of the injection solution) and elevation in free phenylalanine concentrations can vary between regions but the calculated fractional rates of protein synthesis were similar in four of the five regions studied. The variability in rates of protein synthesis increased with body size with greater variability observed between regions for fish >1kg in body mass. For consistency between studies, it is recommended that samples are taken from the epaxial muscle in the region below the dorsal fin when measuring fractional rates of white muscle synthesis in fishes.

  10. Hydrothermal synthesis of hollow silica spheres under acidic conditions.

    PubMed

    Yu, Qiyu; Wang, Pengpeng; Hu, Shi; Hui, Junfeng; Zhuang, Jing; Wang, Xun

    2011-06-07

    It is well-known that silica can be etched in alkaline media or in a unique hydrofluoric acid (HF) solution, which is widely used to prepare various kinds of hollow nanostructures (including silica hollow structures) via silica-templating methods. In our experiments, we found that stöber silica spheres could be etched in generic acidic media in a well-controlled way under hydrothermal conditions, forming well-defined hollow/rattle-type silica spheres. Furthermore, some salts such as NaCl and Na(2)SO(4) were found to be favorable for the formation of hollow/rattle-type silica spheres.

  11. At the same hepatic amino acid load, portal infusion of amino acids is more efficient than peripheral infusion in stimulating liver protein synthesis in the dog

    PubMed Central

    Dardevet, Dominique; Kimball, Scot R; Jefferson, Leonard S; Cherrington, Alan D; Rémond, Didier; DiCostanzo, Catherine A; Moore, Mary Courtney

    2009-01-01

    Background Hepatic glucose uptake is enhanced by portal delivery of glucose which creates a negative arterio-portal substrate gradient. Hepatic amino acid (AA) utilization may be regulated by the same phenomenon, but this has not been proven. Objective We aimed to assess hepatic AA balance and protein synthesis with or without a negative arterio-portal AA gradient. Design Somatostatin was infused IV, and insulin and glucagon were replaced intraportally at 4- and 3-fold basal rates, respectively, in 3 groups (n=9 each) of conscious dogs with catheters for hepatic balance measurement. Arterial glucose concentrations were clamped at 9 mM. An AA mixture was infused IV to maintain basal concentrations (EuAA), intraportally to mimic the post-meal AA increase (PoAA), or IV (PeAA) to match the hepatic AA load in PoAA. Protein synthesis was assessed with a primed, continuous [14C]leucine infusion. Results Net hepatic glucose uptake in PoAA was ≤50% of that in EuAA and PeAA (P<0.05). The hepatic intracellular leucine concentration was 2- to 2.5-fold greater in PoAA and PeAA than EuAA (P<0.05); net hepatic leucine uptake and 14C leucine utilization were ≈2-fold greater (P<0.05) and albumin synthesis was 30% greater (P<0.05) in PoAA than EuAA and PeAA, Phosphorylation of ribosomal protein S6 (downstream of the mammalian target of Rapamycin complex 1 [mTORC1]) was significantly increased in PoAA, but not PeAA, vs EuAA. Conclusions Portal, but not peripheral, AA delivery significantly enhanced hepatic protein synthesis under conditions where AA, glucose, insulin and glucagon did not differ at the liver, an effect apparently mediated by mTORC1 signalling. PMID:18842785

  12. Recent Advances in Substrate-Controlled Asymmetric Induction Derived from Chiral Pool α-Amino Acids for Natural Product Synthesis.

    PubMed

    Paek, Seung-Mann; Jeong, Myeonggyo; Jo, Jeyun; Heo, Yu Mi; Han, Young Taek; Yun, Hwayoung

    2016-07-21

    Chiral pool α-amino acids have been used as powerful tools for the total synthesis of structurally diverse natural products. Some common naturally occurring α-amino acids are readily available in both enantiomerically pure forms. The applications of the chiral pool in asymmetric synthesis can be categorized prudently as chiral sources, devices, and inducers. This review specifically examines recent advances in substrate-controlled asymmetric reactions induced by the chirality of α-amino acid templates in natural product synthesis research and related areas.

  13. Synthesis and physical properties of isostearic acids and their esters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Saturated branched-chain fatty acids (sbc-FAs) are found as minor constituents in several natural fats and oils. Sbc-FAs are of interest since they have lower melting points than their linear counterparts and exhibit good oxidative stability; properties that make them ideally suited in a number of ...

  14. Synthesis of 9-oxononanoic acid, a precursor for biopolymers.

    PubMed

    Otte, Konrad B; Kirtz, Marko; Nestl, Bettina M; Hauer, Bernhard

    2013-11-01

    Polymers based on renewable resources have become increasingly important. The natural functionalization of fats and oils enables an easy access to interesting monomeric building blocks, which in turn transform the derivative biopolymers into high-performance materials. Unfortunately, interesting building blocks of medium-chain length are difficult to obtain by traditional chemical means. Herein, a biotechnological pathway is established that could provide an environmentally suitable and sustainable alternative. A multiple enzyme two-step one-pot process efficiently catalyzed by a coupled 9S-lipoxygenase (St-LOX1, Solanum tuberosum) and 9/13-hydroperoxide lyase (Cm-9/13HPL, Cucumis melo) cascade reaction is proposed as a potential route for the conversion of linoleic acid into 9-oxononanoic acid, which is a precursor for biopolymers. Lipoxygenase catalyzes the insertion of oxygen into linoleic acid through a radical mechanism to give 9S-hydroperoxy-octadecadienoic acid (9S-HPODE) as a cascade intermediate, which is subsequently cleaved by the action of Cm-9/13HPL. This one-pot process afforded a yield of 73 % combined with high selectivity. The best reaction performance was achieved when lipoxygenase and hydroperoxide lyase were applied in a successive rather than a simultaneous manner. Green leaf volatiles, which are desired flavor and fragrance products, are formed as by-products in this reaction cascade. Furthermore, we have investigated the enantioselectivity of 9/13-HPLs, which exhibited a strong preference for 9S-HPODE over 9R-HPODE.

  15. First Synthesis of 1,4-Dimethoxy-2-Naphthoxyacetic acid.

    PubMed

    Chinea, Kimberly; Banerjee, Ajoy K

    2015-07-01

    2-Acetyl-1-hydroxynaphthalene was converted into 1,4-dimethoxy-2-naphthoxyacetic acid in seven steps (methylation, Bayer-Villiger oxidation, hydrolysis, bromination, methylation, alkylation and hydrolysis). 2-Hydroxy-1,4-naphthoquinone on acetylation, aromatization, methylation and hydrolysis, respectively, also yielded the title compound.

  16. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes

    PubMed Central

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-01-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  17. An amino acid depleted cell-free protein synthesis system for the incorporation of non-canonical amino acid analogs into proteins.

    PubMed

    Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D

    2014-05-20

    Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies.

  18. Influence of oxygen concentration, fuel composition, and strain rate on synthesis of carbon nanomaterials

    NASA Astrophysics Data System (ADS)

    Hou, Shuhn-Shyurng; Huang, Wei-Cheng

    2015-02-01

    This paper investigates the influence of flame parameters including oxygen concentration, fuel composition, and strain rate on the synthesis of carbon nanomaterials in opposed-jet ethylene diffusion flames with or without rigid-body rotation. In the experiments, a mixture of ethylene and nitrogen was introduced from the upper burner; meanwhile, a mixture of oxygen and nitrogen was supplied from the lower burner. A nascent nickel mesh was used as the catalytic metal substrate to collect deposited materials. With non-rotating opposed-jet diffusion flames, carbon nanotubes (CNTs) were successfully produced for oxygen concentrations in the range of 21-50 % at a fixed ethylene concentration of 20 %, and for ethylene concentrations ranging from 14 to 24 % at a constant oxygen concentration of 40 %. With rotating opposed-jet diffusion flames, the strain rate was varied by adjusting the angular velocities of the upper and lower burners. The strain rate governed by flow rotation greatly affects the synthesis of carbon nanomaterials [i.e., CNTs and carbon nano-onions (CNOs)] either through the residence time or carbon sources available. An increase in the angular velocity lengthened the residence time of the flow and thus caused the diffusion flame to experience a decreased strain rate, which in turn produced more carbon sources. The growth of multi-walled CNTs was achieved for the stretched flames experiencing a higher strain rate [i.e., angular velocity was equal to 0 or 1 rotations per second (rps)]. CNOs were synthesized at a lower strain rate (i.e., angular velocity was in the range of 2-5 rps). It is noteworthy that the strain rate controlled by flow rotation greatly influences the fabrication of carbon nanostructures owing to the residence time as well as carbon source. Additionally, more carbon sources and higher temperature are required for the synthesis of CNOs compared with those required for CNTs (i.e., about 605-625 °C for CNTs and 700-800 °C for CNOs).

  19. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2

    PubMed Central

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

    2016-01-01

    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  20. Synthesis and Biological Evaluation of Novel Phosphatidylcholine Analogues Containing Monoterpene Acids as Potent Antiproliferative Agents

    PubMed Central

    Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna

    2016-01-01

    The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59–87%) and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts). The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2. PMID:27310666

  1. Progressive familial intrahepatic cholestasis and inborn errors of bile acid synthesis.

    PubMed

    Jankowska, Irena; Socha, Piotr

    2012-06-01

    Progressive familial intrahepatic cholestasis (PFIC), types 1, 2 and 3, are due to defects in genes involved in bile secretion (FIC1, BSEP, MDR3). PFIC and inborn errors of bile acid synthesis (IEBAS) often present in infancy with cholestasis. The distinctive feature of PFIC 1 and 2 and IEBAS is a normal level of GGT, while IEBAS are suspected in patients with low plasma bile acids concentration. Molecular testing, urinary bile acid analysis (IEBAS), liver biopsy and immuno-staining are used for the diagnosis. Some patients with PFIC can be successfully treated with ursodeoxycholic acid or partial external biliary diversion. IEBAS is treated with cholic acid. Liver transplantation is required for cirrhosis with liver failure. Hepatocarcinoma has been reported in PFIC2.

  2. Liquid-Phase Heat-Release Rates of the Systems Hydrazine-Nitric Acid and Unsymmetrical Dimethylhydrazine-Nitric Acid

    NASA Technical Reports Server (NTRS)

    Somogyi, Dezso; Feiler, Charles E.

    1960-01-01

    The initial rates of heat release produced by the reactions of hydrazine and unsymmetrical dimethylhydrazine with nitric acid were determined in a bomb calorimeter under conditions of forced mixing. Fuel-oxidant weight ratio and injection velocity were varied. The rate of heat release apparently depended on the interfacial area between the propellants. Above a narrow range of injection velocities representing a critical amount of interfacial area, the rates reached a maximum and were almost constant with injection velocity. The maximum rate for hydrazine was about 70 percent greater than that for unsymmetrical dimethylhydrazine. The total heat released did not vary with mixture ratio over the range studied.

  3. Ascorbic acid formation and profiling of genes expressed in its synthesis and recycling in apple leaves of different ages.

    PubMed

    Li, Mingjun; Ma, Fengwang; Guo, Chunmiao; Liu, Jun

    2010-04-01

    Ascorbic acid (AsA), as a unique antioxidant and enzyme cofactor, has multiple roles in plants. However, there is very limited information on the mechanism of AsA accumulation and controlling in leaves. In this study, we determined AsA accumulation levels, analyzed expression patterns of the genes involved in synthesizing via l-galactose pathway and recycling as well as enzyme activities in apple (Malus domestica Borkh) leaves with different age. AsA content was found to increase with leaf development, reaching the highest level in 20-day-old leaves. This level was maintained in mature leaves until the dropping in senescent leaves. Comparing with young and senescent leaves, mature leaves had higher capability for AsA synthesis with high expression levels and activity of l-galactose dehydrogenase and l-galactono-1,4-lactone dehydrogenase. The mRNA expression of genes involved in AsA synthesis also showed highest abundance in 20-day-old leaves, though GDP-mannose-3',5'-epimerase and l-galactose-1-phosphate phosphatase expression reached the highest levels before 20 days old. These results suggest that AsA accumulation in apple leaves mainly occurs during the transition phase from young to mature leaves with high rates of synthesis and recycling, and that l-galactose-1-phosphate phosphatase could play an important role in regulating AsA biosynthesis via the l-galactose pathway.

  4. Effects of the biologically produced polymer alginic acid on macroscopic and microscopic calcite dissolution rates.

    PubMed

    Perry, Thomas D; Duckworth, Owen W; McNamara, Christopher J; Martin, Scot T; Mitchell, Ralph

    2004-06-01

    Dissolution of carbonate minerals has significant environmental effects. Microorganisms affect carbonate dissolution rates by producing extracellular metabolites, including complex polysaccharides such as alginic acid. Using a combined atomic force microscopy (AFM)/flowthrough reactor apparatus, we investigated the effects of alginic acid on calcite dissolution. Macroscopic dissolution rates, derived from the aqueous metal ion concentrations, are 10(-5.5) mol m(-2) s(-1) for 5 < pH < 12 in the absence of alginic acid compared to 10(-4.8) mol m(-2) s(-1) in its presence. The AFM images demonstrate that alginic acid preferentially attacks the obtuse steps of dissolution pits on the calcite surface. In pure water, the obtuse and acute steps retreat at similar rates, and the pits are nearly isotropic except under highly acidic conditions. In alginic acid, the acute step retreat rate is nearly unchanged in comparison to water, whereas the obtuse step retreat rate increases with decreasing pH values. As a result, the pits remain rhombohedral but propagate faster in the obtuse direction. To explain these observations, we propose that alginic acid preferentially forms dissolution active surface complexes with calcium atoms on the obtuse step, which results in anisotropic ligand-promoted dissolution.

  5. Synthesis of medronic acid monoesters and their purification by high-performance countercurrent chromatography or by hydroxyapatite

    PubMed Central

    Vepsäläinen, Jouko; Turhanen, Petri A

    2016-01-01

    Summary We achieved the synthesis of important medronic acid monoalkyl esters via the dealkylation of mixed trimethyl monoalkyl esters of medronic acid. Two methods were developed for the purification of medronic acid monoesters: 1) small scale (10–20 mg) purification by using hydroxyapatite and 2) large scale (tested up to 140 mg) purification by high-performance countercurrent chromatography (HPCCC). PMID:27829921

  6. Fmoc/Trt-amino acids: comparison to Fmoc/tBu-amino acids in peptide synthesis.

    PubMed

    Barlos, K; Gatos, D; Koutsogianni, S

    1998-03-01

    Model peptides containing the nucleophilic amino acids Trp and Met have been synthesized with the application of Fmoc/Trt- and Fmoc/tBu-amino acids, for comparison. The deprotection of the peptides synthesized using Fmoc/Trt-amino acids in all cases leads to crude peptides of higher purity than that of the same peptides synthesized using Fmoc/tBu-amino acids.

  7. Developmental aspects and factors influencing the synthesis and status of ascorbic Acid in the pig.

    PubMed

    Mahan, D C; Ching, S; Dabrowski, K

    2004-01-01

    Ascorbic acid synthesis in the pig occurs at mid-pregnancy, but activity of the enzyme l-gulono-gamma-lactone oxidase (GLO) declines thereafter during gestation and remains low when the pig nurses the sow. During late gestation the ascorbic acid concentration in the fetus increases, but serum and liver ascorbic acid concentration in the sow declines without affecting the dam's liver GLO activity. It is presumed that as gestation progresses an increased amount of maternal ascorbic acid is transferred to the fetus and to the mammary gland. Colostrum and milk are rich sources of the vitamin and supply the nursing pig with ascorbic acid. The available data suggest that high amounts of ascorbic acid appear to suppress liver GLO activity in the pig. Upon weaning, when exogenous vitamin C is generally not provided, liver GLO activity and serum ascorbic acid increases. During the initial periods postweaning, some reports have indicated growth benefits of supplemental vitamin C. Body tissues differ in their concentrations of ascorbic acid, but tissues of high metabolic need generally have greater concentrations. The corpus luteum in the female, the testis in the male, and the adrenal glands in all pigs contain greater concentrations of the vitamin. Knockout genes preventing ascorbic acid synthesis in pigs have demonstrated poor skeletal and collagen formation and poor antioxidant protection. Under periods of stress ascorbic acid declines in the adrenal, but the pig rapidly recovers to its resting state once the stressor agent is removed. Although there are periods when supplemental vitamin C has been shown to promote pig performance (e.g., during high environmental stress and early postweaning), supplemental vitamin C has not been shown to routinely enhance pig performance.

  8. Synthesis of glycerides containing n-3 fatty acids and conjugated linoleic acid by solvent-free acidolysis of fish oil.

    PubMed

    Garcia, H S; Arcos, J A; Ward, D J; Hill, C G

    2000-12-05

    Menhaden oil, a rich source of n-3 fatty acids, was interesterified with conjugated linoleic acid (CLA) in a reaction medium composed solely of substrates and either free or immobilized commercial lipase preparations. Of five lipases tested, an immobilized preparation from Mucor miehei provided the fastest rate of incorporation of CLA into fish oil acylglycerols; however, and as observed with most of the lipases utilized, a significant proportion of the n-3 fatty acid residues were liberated in the process. A soluble lipase from Candida rugosa converted free CLA to acylglycerol residues while leaving the n-3 fatty acid residues virtually untouched. Even though the reaction rate was slower for this enzyme than for the other four lipase preparations, the specificity of the free C. rugosa lipase gives it the greatest potential for commercial use in preparing fish oils enriched in CLA residues but still retaining their original n-3 fatty acid residues.

  9. Fatty Acid Synthesis Intermediates Represent Novel Noninvasive Biomarkers of Prostate Cancer Chemoprevention by Phenethyl Isothiocyanate.

    PubMed

    Singh, Krishna B; Singh, Shivendra V

    2017-03-14

    Increased de novo synthesis of fatty acids is a distinctive feature of prostate cancer, which continues to be a leading cause of cancer-related deaths among American men. Therefore, inhibition of de novo fatty acid synthesis represents an attractive strategy for chemoprevention of prostate cancer. We have shown previously that dietary feeding of phenethyl isothiocyanate (PEITC), a phytochemical derived from edible cruciferous vegetables such as watercress, inhibits incidence and burden of poorly-differentiated prostate cancer in Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model. The present study was designed to test the hypothesis of whether fatty acid intermediate(s) can serve as noninvasive biomarker(s) of prostate cancer chemoprevention by PEITC using archived plasma and tumor specimens from the TRAMP study as well as cellular models of prostate cancer. Exposure of prostate cancer cells (LNCaP and 22Rv1) to pharmacological concentrations of PEITC resulted in downregulation of key fatty acid metabolism proteins, including acetyl-CoA carboxylase 1 (ACC1), fatty acid synthase (FASN), and carnitine palmitoyltransferase 1A (CPT1A). The mRNA expression of FASN and CPT1A as well as acetyl-CoA levels were decreased by PEITC treatment in both cell lines. PEITC administration to TRAMP mice also resulted in a significant decrease in tumor expression of FASN protein. Consistent with these findings, the levels of total free fatty acids, total phospholipids, triglyceride, and ATP were significantly lower in the plasma and/or prostate tumors of PEITC-treated TRAMP mice compared with controls. The present study is the first to implicate inhibition of fatty acid synthesis in prostate cancer chemoprevention by PEITC.

  10. Changes in alpha-fetoprotein and albumin synthesis rates and their levels during fetal and neonatal development of rat brain.

    PubMed

    Ali, M; Sahib, M K

    1983-02-01

    An attempt was made to find a correlation between AFP and albumin levels in brain and their rates of synthesis in the brain cells during maturation of rat brain. Levels of alpha-fetoprotein (AFP) and albumin in the developing brain were studied by rocket immunoassay. Rate of synthesis of AFP and albumin in brain cell cultures, established from rat brain at various stages of development, were determined by incorporation of [14C]leucine into immuno-precipitable intracellular AFP and albumin. AFP and albumin levels in brain as well as rates of their synthesis by brain cells in culture registered a continuous decline during development. Synthesis of AFP and albumin in the brain is switched off after first week of postnatal life with a concomitant disappearance of these proteins from the brain. Levels of AFP and albumin in brain correlated well with rates of their synthesis by brain cells in vitro at any specific stage of brain maturation implying that levels of AFP and albumin in brain are regulated by controlling rates of their synthesis in the maturing brain cells.

  11. Akt Phosphorylation and Regulation of Transketolase Is a Nodal Point for Amino Acid Control of Purine Synthesis

    PubMed Central

    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T.; Phan, Tony; Pilz, Renate B.; Boss, Gerry R.

    2014-01-01

    SUMMARY The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mTORC2 and IκB kinase regulate Akt activity, and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the non-oxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the non-oxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for two days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a new mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  12. Synthesis of repressible acid phosphatase in Saccharomyces cerevisiae under conditions of enzyme instability.

    PubMed Central

    Bostian, K A; Lemire, J M; Halvorson, H O

    1982-01-01

    The synthesis of repressible acid phosphatase in Saccharomyces cerevisiae was examined under conditions of blocked derepression as described by Toh-e et al. (Mol. Gen. Genet. 162:139-149, 1978). Based on a genetic and biochemical analysis of the phenomenon these authors proposed a new regulatory model for acid phosphatase expression involving a simultaneous interaction of regulatory factors in the control of structural gene transcription. We demonstrate here that under growth conditions that fail to produce acid phosphatase the enzyme is readily inactivated. Furthermore, we demonstrate under these conditions the production of acid phosphatase mRNA which is active both in vitro and in vivo in the synthesis of enzyme. This eliminates any step prior to translation of acid phosphatase polypeptide as an explanation for the phenomenon. We interpret our results for the block in appearance of acid phosphatase as a result of both deaccelerated growth and cellular biosynthesis during derepression, accompanied by an enhanced instability of the enzyme. Images PMID:7050664

  13. Role of ferrocyanides in the prebiotic synthesis of α-amino acids.

    PubMed

    Ruiz-Bermejo, Marta; Osuna-Esteban, Susana; Zorzano, María-Paz

    2013-06-01

    We investigated the synthesis of α-amino acids under possible prebiotic terrestrial conditions in the presence of dissolved iron (II) in a simulated prebiotic ocean. An aerosol-liquid cycle with a prebiotic atmosphere is shown to produce amino acids via Strecker synthesis with relatively high yields. However, in the presence of iron, the HCN was captured in the form of a ferrocyanide, partially inhibiting the formation of amino acids. We showed how HCN captured as Prussian Blue (or another complex compound) may, in turn, have served as the HCN source when exposed to UV radiation, allowing for the sustained production of amino acids in conjunction with the production of oxyhydroxides that precipitate as by-products. We conclude that ferrocyanides and related compounds may have played a significant role as intermediate products in the prebiotic formation of amino acids and oxyhydroxides, such as those that are found in iron-containing soils and that the aerosol cycle of the primitive ocean may have enhanced the yield of the amino acid production.

  14. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.

    1991-01-01

    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  15. Concise synthesis of the A/BCD-ring fragment of gambieric acid A

    PubMed Central

    Fuwa, Haruhiko; Fukazawa, Ryo; Sasaki, Makoto

    2014-01-01

    Gambieric acid A (GAA) and its congeners belong to the family of marine polycyclic ether natural products. Their highly complex molecular architecture and unique biological activities have been of intense interest within the synthetic community. We have previously reported the first total synthesis, stereochemical reassignment, and preliminary structure–activity relationships of GAA. Here we disclose a concise synthesis of the A/BCD-ring fragment of GAA. The synthesis started from our previously reported synthetic intermediate that represents the A/B-ring. The C-ring was synthesized via an oxiranyl anion coupling and a 6-endo cyclization, and the D-ring was forged by means of an oxidative lactonization and subsequent palladium-catalyzed functionalization of the lactone ring. In this manner, the number of linear synthetic steps required for the construction of the C- and D-rings was reduced from 22 to 11. PMID:25629027

  16. Pyrazinoic acid efflux rate in Mycobacterium tuberculosis is a better proxy of pyrazinamide resistance.

    PubMed

    Zimic, Mirko; Fuentes, Patricia; Gilman, Robert H; Gutiérrez, Andrés H; Kirwan, Daniela; Sheen, Patricia

    2012-01-01

    Pyrazinamide is one of the most important drugs in the treatment of latent Mycobacterium tuberculosis infection. The emergence of strains resistant to pyrazinamide represents an important public health problem, as both first- and second-line treatment regimens include pyrazinamide. The accepted mechanism of action states that after the conversion of pyrazinamide into pyrazinoic acid by the bacterial pyrazinamidase enzyme, the drug is expelled from the bacteria by an efflux pump. The pyrazinoic acid is protonated in the extracellular environment and then re-enters the mycobacterium, releasing the proton and causing a lethal disruption of the membrane. Although it has been shown that mutations causing significant loss of pyrazinamidase activity significantly contribute to pyrazinamide resistance, the mechanism of resistance is not completely understood. The pyrazinoic acid efflux rate may depend on multiple factors, including pyrazinamidase activity, intracellular pyrazinamidase concentration, and the efficiency of the efflux pump. Whilst the importance of the pyrazinoic acid efflux rate to the susceptibility to pyrazinamide is recognized, its quantitative effect remains unknown. Thirty-four M. tuberculosis clinical isolates and a Mycobacterium smegmatis strain (naturally resistant to PZA) were selected based on their susceptibility to pyrazinamide, as measured by Bactec 460TB and the Wayne method. For each isolate, the initial velocity at which pyrazinoic acid is released from the bacteria and the initial velocity at which pyrazinamide enters the bacteria were estimated. The data indicated that pyrazinoic acid efflux rates for pyrazinamide-susceptible M. tuberculosis strains fell within a specific range, and M. tuberculosis strains with a pyrazinoic acid efflux rate below this range appeared to be resistant. This finding contrasts with the high pyrazinoic acid efflux rate for M. smegmatis, which is innately resistant to pyrazinamide: its pyrazinoic acid efflux

  17. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    NASA Astrophysics Data System (ADS)

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-Ichi

    2015-02-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon.

  18. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    PubMed Central

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi

    2015-01-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon. PMID:25648201

  19. Synthesis and verification of biobased terephthalic acid from furfural.

    PubMed

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi

    2015-02-04

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon.

  20. Synthesis and antifungal activity of bile acid-derived oxazoles.

    PubMed

    Fernández, Lucía R; Svetaz, Laura; Butassi, Estefanía; Zacchino, Susana A; Palermo, Jorge A; Sánchez, Marianela

    2016-04-01

    Peracetylated bile acids (1a-g) were used as starting materials for the preparation of fourteen new derivatives bearing an oxazole moiety in their side chain (6a-g, 8a-g). The key step for the synthetic path was a Dakin-West reaction followed by a Robinson-Gabriel cyclodehydration. A simpler model oxazole (12) was also synthesized. The antifungal activity of the new compounds (6a-g) as well as their starting bile acids (1a-g) was tested against Candida albicans. Compounds 6e and 6g showed the highest percentages of inhibition (63.84% and 61.40% at 250 μg/mL respectively). Deacetylation of compounds 6a-g, led to compounds 8a-g which showed lower activities than the acetylated derivatives.

  1. Enzymatic synthesis of palm olein-based fatty thiohydroxamic acids.

    PubMed

    Al-Mulla, Emad A Jaffar; Yunus, Wan Md Zin Wan; Ibrahim, Nor Azowa Bt; Rahman, Mohd Zaki Ab

    2010-01-01

    Fatty thiohydroxamic acids (FTAs) have been successfully synthesized from palm olein and thiohydroxamic acid by a one-step lipase catalyzed reaction. The use of immobilized lipase (Lipozyme RMIM) as the catalyst for the preparation reaction provides an easy isolation of the enzyme from the products and other components in the reaction mixture. The FTAs were characterized using Fourier transform infrared (FTIR) spectroscopy, proton nuclear magnetic resonance ((1)H NMR) technique and elemental analysis. The highest conversion percentage (95 %) was obtained when the process was carried out for 30 hours using urea to palm oil ratio of 6.0: 1.0 at 40 °C. The method employed offers several advantages such as renewable and abundant of the raw material, simple reaction procedure, environmentally friendly process and high yield of the product.

  2. Computer Simulation Model for the Biosynthesis of Galactosyldiacylglycerols and Fatty Acid Desaturation in Plants (Determination of Rates of Desaturase Activity in Monogalactosyldiacylglycerol).

    PubMed Central

    Williams, J. P.; Khan, M. U.; Wong, D.

    1993-01-01

    The level of unsaturation of the constituent fatty acids of many glycerolipids in plant membranes is modified by environmental factors. The measurement of the rate of the desaturation of these fatty acids is essential to an understanding of how plants adapt to changing environments. This is difficult because of the complexity of the system and the problems involved in measuring rates of these enzyme reactions in cell-free preparations. A computer program has been developed that simulates the synthesis of galactosyldiacylglycerols and desaturation of their fatty acids in chloroplasts. The program uses the rate of incorporation and distribution of 14C in fatty acids after 14CO2 feeding to estimate rates of desaturation in the fatty acids of glycerolipids. Data are presented to demonstrate the use of the program in comparing rates of desaturation in the five enzyme reactions associated with monogalactosyldiacylglycerol in the chloroplastic pathway of leaves from Brassica napus. The method represents a quick, reliable, and accurate measure of desaturase activity in vivo and is the only method available to estimate desaturase activity of all five enzymes at the same time. PMID:12231750

  3. First synthesis of thia steroids from cholic acid.

    PubMed

    Ibrahim-Ouali, Malika; Rocheblave, Luc

    2010-10-01

    Heterosteroids remain interesting due to their potential biological activities. This prompted us to synthesize novel thia steroids possessing the heteroatom in the A-ring. We set out to describe a new and versatile method for preparing 3-thia steroids from cholic acid via a selective oxidation of one hydroxyl group, a Baeyer-Villiger oxidation and a photolysis as the key steps. The characteristic (1)H and (13)C NMR spectroscopic features of the synthesized compounds are reported.

  4. An approach for the synthesis of nakamuric acid

    PubMed Central

    Wang, Xiaolei; Chen, Chuo

    2014-01-01

    The biosynthesis of dimeric pyrrole–imidazole alkaloids is likely mediated by enzyme-catalyzed reversible single-electron transfer (SET) cycloaddition. We now show that Ir(ppy)3 can promote SET-mediated formal [2+2] and [4+2] cycloaddition reactions of pyrrole–imidazole alkaloids-related substrates under photolytic conditions. This biomimetic approach is useful for the construction of the core skeleton of nakamuric acid and sceptrin. PMID:25983349

  5. Synthesis and characterization of fatty hydroxamic acids from triacylglycerides.

    PubMed

    Hoidy, Wisam H; Ahmad, Mansor B; Al-Mulla, Emad A Jaffar; Yunus, Wan Md Zin Wan; Ibrahim, Nor azowa Bt

    2010-01-01

    In this study, fatty haydroxamic acids (FHAs), which have biological activities as antibiotics and antifungal, have been synthesized via refluxing of triacylglycrides, palm olein, palm stearin or corn oil with hydroxylamine hydrochloride. The products were characterized using the complex formation test of hydroxamic acid group with zinc(I), copper(II) and iron(III), various technique methods including nuclear magnetic resonance ((1)H NMR) spectroscopy, Fourier transform infrared (FTIR) spectroscopy and elemental analysis. Parameters that may affect the conversion of oils to FHAs including the effect of reaction time, effect of organic solvent and effect of hydro/oil molar issue were also investigated in this study. Results of characterization indicate that FHAs were successfully produced from triacylglycrides. The conversion percentages of palm stearin, palm olein and corn oil into their fatty hydroxamic acids are 82, 81 and 78, respectively. Results also showed that hexane is the best organic solvent to produce the FHAs from the three oils used in this study. The optimum reaction time to achieve the maximum conversion percentage of the oils to FHAs was found to be 10 hours for all the three oils, while the optimum molar ration of hydro/to oil was found to be 7:1 for all the different three oils.

  6. Synthesis, crystal structure and computational studies of 4-nitrobenzylphosphonic acid

    NASA Astrophysics Data System (ADS)

    Wilk, Magdalena; Jarzembska, Katarzyna N.; Janczak, Jan; Hoffmann, Józef; Videnova-Adrabinska, Veneta

    2014-09-01

    4-Nitrobenzylphosphonic acid (1a) has been synthesized and structurally characterized by vibrational spectroscopy (IR and Raman) and single-crystal X-ray diffraction. Additionally, Hirshfeld surface analysis and computational methods have been used to compare the intermolecular interactions in the crystal structures of 1a and its carboxylic analogue, 4-nitrobenzylcarboxylic acid (4-NBCA). The crystal structure analysis of 1a has revealed that the acid molecules are extended into helical chains along the b axis using one of the hydrogen bonds established between phosphonic groups. The second (P)Osbnd H⋯O(P) hydrogen bond cross-links the inversion-related chains to form a thick monolayer with phosphonic groups arranged inwards and aromatic rings outwards. The nitro groups serve to link the neighbouring monolayers by weak Csbnd H⋯O(N) hydrogen bonds. Computations have confirmed the great contribution of electrostatic interactions for the crystal lattice stability. The cohesive energy, computed for the crystal structure of 1a exceeds 200 kJ mol-1 in magnitude and is nearly twice as large as that of 4-NBCA. The calculated cohesive energy values have been further related to the results of thermal analyses.

  7. Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

    PubMed

    Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2016-08-01

    Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.

  8. Cardiac Mitochondrial Proteome Dynamics with Heavy Water Reveals Stable Rate of Mitochondrial Protein Synthesis in Heart Failure Despite Decline in Mitochondrial Oxidative Capacity

    PubMed Central

    Shekar, Kadambari Chandra; Li, Ling; Dabkowski, Erinne R.; Xu, Wenhong; Ribeiro, Rogerio Faustino; Hecker, Peter A.; Recchia, Fabio A.; Sadygov, Rovshan G.; Willard, Belinda; Kasumov, Takhar; Stanley, William C.

    2017-01-01

    We recently developed a method to measure mitochondrial proteome dynamics with heavy water (2H2O)-based metabolic labeling and high resolution mass spectrometry. We reported the half-lives and synthesis rates of several proteins in the two cardiac mitochondrial subpopulations, subsarcolemmal and interfibrillar (SSM and IFM), in Sprague Dawley rats. In the present study, we tested the hypothesis that the mitochondrial protein synthesis rate is reduced in heart failure, with possible differential changes in SSM versus IFM. Six to seven week old male Sprague Dawley rats underwent transverse aortic constriction (TAC) and developed moderate heart failure after 22 weeks. Heart failure and sham rats of the same age received heavy water (5% in drinking water) for up to 80 days. Cardiac SSM and IFM were isolated from both groups and the proteins were separated by 1D gel electrophoresis. Heart failure reduced protein content and increased the turnover rate of several proteins involved in fatty acid oxidation, electron transport chain and ATP synthesis, while it decreased the turnover of other proteins, including pyruvate dehydrogenase subunit in IFM, but not in SSM. Because of these bidirectional changes, the average overall half-life of proteins was not altered by heart failure in both SSM and IFM. The kinetic measurements of individual mitochondrial proteins presented in this study may contribute to a better understanding of the mechanisms responsible for mitochondrial alterations in the failing heart. PMID:24995939

  9. Acid Gradient across Plasma Membrane Can Drive Phosphate Bond Synthesis in Cancer Cells: Acidic Tumor Milieu as a Potential Energy Source

    PubMed Central

    Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam

    2015-01-01

    Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623

  10. What do you mean by transcription rate?: the conceptual difference between nascent transcription rate and mRNA synthesis rate is essential for the proper understanding of transcriptomic analyses.

    PubMed

    Pérez-Ortín, José E; Medina, Daniel A; Chávez, Sebastián; Moreno, Joaquín

    2013-12-01

    mRNA synthesis in all organisms is performed by RNA polymerases, which work as nanomachines on DNA templates. The rate at which their product is made is an important parameter in gene expression. Transcription rate encompasses two related, yet different, concepts: the nascent transcription rate, which measures the in situ mRNA production by RNA polymerase, and the rate of synthesis of mature mRNA, which measures the contribution of transcription to the mRNA concentration. Both parameters are useful for molecular biologists, but they are not interchangeable and they are expressed in different units. It is important to distinguish when and where each one should be used. We propose that for functional genomics the use of nascent transcription rates should be restricted to the evaluation of the transcriptional process itself, whereas mature mRNA synthesis rates should be employed to address the transcriptional input to mRNA concentration balance leading to variation of gene expression.

  11. Lactic acid jet test: in vitro erosion rates of glass ionomer dental cements containing radiopacifying elements.

    PubMed

    Williams, J A; Billington, R W; Pearson, G J

    1993-06-01

    The lactic acid jet test erosion rates were measured for 13 radiopaque glass ionomer dental materials obtained from a number of manufacturing sources. The erosion rate was compared with that found for the non-radiopaque restorative from the same manufacturer to determine whether the addition of an extra element had affected the resistance to erosion. Six materials were not significantly affected, six showed a significant increase in erosion rate. Only one material showed a reduced erosion rate. Materials containing a high proportion of any additive could show an increased erosion rate. Glass ionomer cements with or without radiopacifying elements had low erosion rates compared with other dental materials.

  12. Stimulation of skeletal muscle protein synthesis in neonatal pigs by long-term infusion of leucine is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 hr increases skeletal muscle protein synthesis in neonatal pigs, but this is not sustained for 2 h unless the leucine-induced fall in amino acids is prevented. We aimed to determine whether continuous leucine infusion can stimulate protein synthesis for a prolonged period whe...

  13. Synthesis of a Homologous Series of Side Chain Extended Orthogonally-Protected Aminooxy-Containing Amino Acids

    PubMed Central

    Liu, Fa; Thomas, Joshua; Burke, Terrence R.

    2008-01-01

    Practical methodology is reported for the synthesis of a homologous series of side chain extended amino acids containing aminooxy functionality bearing orthogonal protection suitable for Fmoc peptide synthesis. These reagents may be useful for the preparation of libraries containing fragments joined by peptide linkers. PMID:19122755

  14. In situ synthesis of peptide nucleic acids in porous silicon for drug delivery and biosensing.

    PubMed

    Beavers, Kelsey R; Mares, Jeremy W; Swartz, Caleb M; Zhao, Yiliang; Weiss, Sharon M; Duvall, Craig L

    2014-07-16

    Peptide nucleic acids (PNA) are a unique class of synthetic molecules that have a peptide backbone and can hybridize with nucleic acids. Here, a versatile method has been developed for the automated, in situ synthesis of PNA from a porous silicon (PSi) substrate for applications in gene therapy and biosensing. Nondestructive optical measurements were performed to monitor single base additions of PNA initiated from (3-aminopropyl)triethoxysilane attached to the surface of PSi films, and mass spectrometry was conducted to verify synthesis of the desired sequence. Comparison of in situ synthesis to postsynthesis surface conjugation of the full PNA molecules showed that surface mediated, in situ PNA synthesis increased loading 8-fold. For therapeutic proof-of-concept, controlled PNA release from PSi films was characterized in phosphate buffered saline, and PSi nanoparticles fabricated from PSi films containing in situ grown PNA complementary to micro-RNA (miR) 122 generated significant anti-miR activity in a Huh7 psiCHECK-miR122 cell line. The applicability of this platform for biosensing was also demonstrated using optical measurements that indicated selective hybridization of complementary DNA target molecules to PNA synthesized in situ on PSi films. These collective data confirm that we have established a novel PNA-PSi platform with broad utility in drug delivery and biosensing.

  15. Support Effects on Bronsted acid site densities and alcohol dehydration turnover rates on tungsten oxide domains

    SciTech Connect

    Macht, Josef; Baertsch, Chelsey D.; May-Lozano, Marcos; Soled, Stuart L.; Wang, Yong; Iglesia, Enrique

    2005-03-01

    Initial activity and acid site density of several WAl, WSi (MCM41) and one WSn sample were determined. Trans/cis 2-butene selectivity is dependent on the support. Presumably, these differences are due to subtle differences in base strengths. 2-Butanol dehydration rates (per W-atom) reached maximum values at intermediate WOx surface densities on WAl, as reported for 2-butanol dehydration reactions on WZr. Titration results indicate that Bronsted acid sites are required for 2-butanol dehydration on WAl, WSi and WSn. UV-visible studies suggest that WAl is much more difficult to reduce than WZr. The detection of reduced centers on WAl, the number of which correlates to Bronsted acid site density and catalyst activity, as well as the temperature dependence of Bronsted acid site density indicate the in-situ formation of these active sites. We infer that this mechanism is common among all supported WOx samples described in this study. Turnover rates are a function of Bronsted acid site density only. High acid site densities lead to high turnover rates. Higher active site densities may cause stronger conjugate bases, as a higher electron density has to be stabilized, and thus weaker acidity, enabling a faster rate of product desorption. The maximum achievable active site density is dependent on the support. WZr reaches a higher active site density than WAl.

  16. Stimulation of phosphatidic acid of calcium influx and cyclic GMP synthesis in neuroblastoma cells.

    PubMed

    Ohsako, S; Deguchi, T

    1981-11-10

    Phosphatidic acid added to the medium markedly elevated intracellular cyclic GMP content in cultured neuroblastoma N1E 115 cells. There was a significant elevation of cyclic GMP with 1 micrograms/ml and a maximum (70-fold) elevation with 100 micrograms/ml of phosphatidic acid. Other natural phospholipids did not increase, or increased only slightly, the cyclic GMP content in the cells. The elevation of cyclic GMP content by phosphatidic acid was absolutely dependent on extracellular calcium. Phosphatidic acid stimulated the influx of calcium into neuroblastoma cells 2- to 5-fold. The pattern of the calcium influx induced by phosphatidic acid was comparable to that of cyclic GMP elevation. The stimulation of calcium influx by phosphatidic acid was also observed in cultured heart cells, indicating that phosphatidic acid acts as a calcium ionophore or opens a specific calcium-gate in a variety of cell membranes. Treatment of neuroblastoma cells with phospholipase C increased 32Pi labeling of phosphatidic acid, stimulated the influx of calcium, and elevated the cyclic GMP content in the cells. Thus exogenous as well as endogenous phosphatidic acid stimulates the translocation of calcium across cell membranes and, as a consequence, induces the synthesis of cyclic GMP in the neuroblastoma cells.

  17. Fatty Acid Synthesis and Control of Caspase 2 in Prostate Cancer

    DTIC Science & Technology

    2013-05-01

    July 2011- 30 June 2012 4 . TITLE AND SUBTITLE 5a. CONTRACT NUMBER Fatty Acid Synthesis and control of Caspase 2 in Prostate Cancer 5b. GRANT...Introduction…………………………………………………………….………..….. 4 Body………………………………………………………………………………….. 4 -6 Key Research Accomplishments...combination  with  inhibitors  of  NADPH  production   ( DHEA ),  fatty  acid  synthesis,  (C75,  C93,  cerulenin)  and  CaMKII

  18. Synthesis, biological activity, and bioavailability of moschamine, a safflomide-type phenylpropenoic acid amide found in Centaurea cyanus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Moschamine is a safflomide-type phenylpropenoic acid amide originally isolated from Centaurea cyanus. This paper describes the synthesis, detection of serotoninergic and COX inhibitory activities, and bioavailability of moschamine. Moschamine was chemically synthesized and identified using NMR spect...

  19. Structure and Functional Characterization of a Bile Acid 7α Dehydratase BaiE in Secondary Bile Acid Synthesis

    PubMed Central

    Bhowmik, Shiva; Chiu, Hsien-Po; Jones, David H.; Chiu, Hsiu-Ju; Miller, Mitchell D.; Xu, Qingping; Farr, Carol L.; Ridlon, Jason M.; Wells, James E.; Elsliger, Marc-André; Wilson, Ian A.; Hylemon, Phillip B.; Lesley, Scott A.

    2015-01-01

    Conversion of the primary bile acids cholic acid (CA) and chenodeoxycholic acid (CDCA) to the secondary bile acids deoxycholic acid (DCA) and lithocholic acid (LCA) is performed by a few species of intestinal bacteria in the genus Clostridium through a multistep biochemical pathway that removes a 7α-hydroxyl group. The rate-determining enzyme in this pathway is bile acid 7α-dehydratase (baiE). In this study, we report crystal structures of apo-BaiE and its putative product-bound (3-oxo-Δ4,6- lithocholyl-Coenzyme A (CoA)) complex. BaiE is a trimer with a twisted α+β barrel fold with similarity to the Nuclear Transport Factor 2 (NTF2) superfamily. Tyr30, Asp35 and His83 form a catalytic triad that is conserved across this family. Site-directed mutagenesis of BaiE from Clostridium scindens VPI 12708 confirmed that these residues are essential for catalysis and also confirmed the importance of other conserved residues, Tyr54 and Arg146, which are involved in substrate binding and affect catalytic turnover. Steady state kinetic studies revealed that the BaiE homologs are able to turn over 3-oxo-Δ4-bile acid and CoA-conjugated 3-oxo-Δ4-bile acid substrates with comparable efficiency questioning the role of CoA-conjugation in the bile acid metabolism pathway. PMID:26650892

  20. Strategies to reduce short-chain organic acids and synchronously establish high-rate composting in acidic household waste.

    PubMed

    Bergersen, Ove; Bøen, Anne S; Sørheim, Roald

    2009-01-01

    The aim of this study was to document whether addition of lime or increased amount of bulking agent would ensure, efficiently, a predictable composting process in acidic SSOW applicable in full scale plants. The results show that both lime addition and increasing the amount of bulking agent relative to waste support the development of high-rate respiration in composting. Both strategies are considered efficient in establishing desired microbial composting processes of acid household waste. Reduction in the content of different organic acids and loss on ignition were higher when more bulking agent was used compared with adding 5% lime to the acidic SSOW. Respiration was completely repressed in samples with 10% lime, where pH remained high. In addition fat and protein seem to degrade faster with increasing amount of bulking agent.

  1. Ribonucleic Acid and Protein Synthesis During Germination of Myxococcus xanthus Myxospores

    PubMed Central

    Juengst, Fredrick W.; Dworkin, Martin

    1973-01-01

    Ribonucleic acid (RNA) and protein synthesis during myxospore germination were examined. When RNA synthesis was inhibited more than 90% by either actinomycin D (Act D) or rifampin, germination was prevented. The data were consistent with the interpretation that rifampin did not interfere with protein synthesis in any way other than by inhibition of messenger RNA formation. Act D concentrations as high as 20 μg/ml did not totally inhibit RNA synthesis. In the presence of 8 μg of Act D/ml, germinating myxospores synthesized transfer RNA, 16S RNA, and 23S RNA. Evidence was presented which indicated that messenger RNA was also synthesized early in the germination period both in the presence and absence of 8 μg of Act D/ml. One explanation for the escape synthesis of RNA in germinating myxospores is that Act D exerts a differential effect on the transcription of larger versus smaller cistrons, the latter having a lower probability of binding Act D. We have found that in the presence of 8 μg of Act D/ml, escape RNA synthesis in myxospores was 25% for 23S RNA, 55% for 16S RNA, and more than 90% for 4S RNA. We have shown that germination of myxospores requires both RNA and protein synthesis during the first 25 to 35 min in germination medium. This finding does not support the earlier suggestion by Ramsey and Dworkin that a stable germination messenger RNA is required for germination of the myxospores of Myxococcus xanthus. PMID:4690965

  2. Synthesis, Preliminary Bioevaluation and Computational Analysis of Caffeic Acid Analogues

    PubMed Central

    Liu, Zhiqian; Fu, Jianjun; Shan, Lei; Sun, Qingyan; Zhang, Weidong

    2014-01-01

    A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO) generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification. PMID:24857914

  3. Total synthesis of gracilioether F. Development and application of Lewis acid promoted ketene–alkene [2+2] cycloadditions and late-stage C—H oxidation

    SciTech Connect

    Rasik, Christopher M.; Brown, M. Kevin

    2014-12-22

    The first synthesis of gracilioether F, a polyketide natural product with an unusual tricyclic core and five contiguous stereocenters, is described. Key steps of the synthesis include a Lewis acid promoted ketene–alkene [2+2] cycloaddition and a late-stage carboxylic acid directed C(sp³)—H oxidation. The synthesis requires only eight steps from norbornadiene.

  4. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina

    2015-01-01

    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  5. Aminochlorination in water: first Brønsted acid-promoted synthesis of vicinal chloramines.

    PubMed

    Wu, Xue-Liang; Wang, Guan-Wu

    2007-11-23

    A practical and scaleable route for the regio- and diastereoselective synthesis of vicinal chloramines from electron-deficient olefins and Chloramine-T promoted by Brønsted acids in water has been realized for the first time. This novel protocol is efficient, mild, ecofriendly, and broadly applicable for the aminochlorination of various electron-deficient olefins including alpha,beta-unsaturated ketones, cinnamate, and cinnamide. Water represents as a privileged solvent for the aminochlorination reaction in our system.

  6. Synthesis of 2-(hetero)aryl-5-(trimethylsilylethynyl)oxazoles from (hetero)arylacrylic acids.

    PubMed

    Pankova, Alena S; Stukalov, Alexander Yu; Kuznetsov, Mikhail A

    2015-04-17

    A three-step method for the synthesis of 2-(hetero)aryl-5-(trimethylsilylethynyl)oxazoles is described. Easily accessible bis(trimethylsilyl)acetylene and acrylic acid derivatives are used as starting materials for the preparation of mono- and disubstituted 5-(trimethylsilyl)pent-1-en-4-yn-3-ones. Oxidative phthalimidoaziridination of these enynones provides the key 2-acyl-1-phthalimidoaziridines that are further utilized in the thermal expansion of the three-membered ring to furnish the target functionalizable oxazoles.

  7. Synthesis and biological evaluation of new salvinorin A analogues incorporating natural amino acids.

    PubMed

    Fichna, Jakub; Lewellyn, Kevin; Yan, Feng; Roth, Bryan L; Zjawiony, Jordan K

    2011-01-01

    The synthesis and in vitro evaluation of a new series of salvinorin A analogues substituted at the C(2) position with natural amino acids is reported. Compound 12, containing Val, displayed high affinity and full agonist activity at the kappa-opioid receptor. Analogues with bulky and/or aromatic residues were inactive, showing the importance of size and electronegativity of C(2)-substituents for binding affinity of salvinorin A derivatives.

  8. One-step synthesis of 1-chloro-3-arylacetone derivatives from arylacetic acids.

    PubMed

    Zacuto, Michael J; Dunn, Robert F; Figus, Margaret

    2014-09-19

    A practical one-step method has been developed to prepare α-chloroketones from readily available, inexpensive phenylacetic acid derivatives. The method utilizes the unique reactivity of an intermediate Mg-enolate dianion, which displays selectivity for the carbonyl carbon of chloromethyl carbonyl electrophiles. Decarboxylation of the intermediate occurs spontaneously during the reaction quench. The utility of the reaction products has been demonstrated through the total synthesis of the natural product cimiracemate B.

  9. Morphology Tailoring of Sulfonic Acid Functionalized Organosilica Nanohybrids for the Synthesis of Biomass-Derived Alkyl Levulinates.

    PubMed

    An, Sai; Song, Daiyu; Lu, Bo; Yang, Xia; Guo, Yi-Hang

    2015-07-20

    Morphology evolution of sulfonic acid functionalized organosilica nanohybrids (Si(Et)Si-Pr/ArSO3 H) with a 1D tubular structure (inner diameter of ca. 5 nm), a 2D hexagonal mesostructure (pore diameter of ca. 5 nm), and a 3D hollow spherical structure (shell thickness of 2-3 nm and inner diameter of ca. 15 nm) was successfully realized through P123-templated sol-gel cocondensation strategies and fine-tuning of the acidity followed by aging or a hydrothermal treatment. The Si(Et)Si-Pr/ArSO3 H nanohybrids were applied in synthesis of alkyl levulinates from the esterification of levulinic acid and ethanolysis of furfural alcohol. Hollow spherical Si(Et)Si-Pr/ArSO3 H and hexagonal mesoporous analogues exhibited the highest and lowest catalytic activity, respectively, among three types of nanohybrids; additionally, the activity was influenced by the -SO3 H loading. The activity differences are explained in terms of different Brønsted acid and textural properties, reactant/product diffusion, and mass transfer rate, as well as accessibility of -SO3 H sites to the reactant molecules. The reusability of the nanohybrids was also evaluated.

  10. Synthesis and cytotoxicity of A-homo-lactam derivatives of cholic acid and 7-deoxycholic acid.

    PubMed

    Huang, Yanmin; Chen, Sijing; Cui, Jianguo; Gan, Chunfang; Liu, Zhiping; Wei, Yingliang; Song, Huachan

    2011-06-01

    Using cholic acid and deoxycholic acid as starting materials, a series of 3-aza-A-homo-4-one bile acid and 7-deoxycholic acid derivatives were synthesized by the esterification, oxidation, reduction, oximation and Beckman rearrangement etc. The cytotoxicity of the synthesized compounds against MGC 7901 (human ventriculi carcinoma cell line), hela (human cervical carcinoma cell line), SMMC 7404 (human liver carcinoma cell line) were investigated. The results showed that bile acid and 7-deoxycholic-acid derivatives with 3-aza-A-homo-4-one configuration bearing a 6-hydroximino or 12-hydroximino group displayed a distinct cytotoxicity to Hela tumor cell line. In particular, the IC(50) values of the compounds 6 and 13 were 14.3 and 24.3 μmol/L against Hela human tumor cell line respectively. The information obtained from the studies may be useful for the design of novel chemotherapeutic drugs.

  11. ESTIMATION OF PHOSPHATE ESTER HYDROLYSIS RATE CONSTANTS. II. ACID AND GENERAL BASE CATALYZED HYDROLYSIS

    EPA Science Inventory

    SPARC (SPARC Performs Automated Reasoning in Chemistry) chemical reactivity models were extended to calculate acid and neutral hydrolysis rate constants of phosphate esters in water. The rate is calculated from the energy difference between the initial and transition states of a ...

  12. Oleic acid coated magnetic nano-particles: Synthesis and characterizations

    SciTech Connect

    Panda, Biswajit Goyal, P. S.

    2015-06-24

    Magnetic nano particles of Fe{sub 3}O{sub 4} coated with oleic acid were synthesized using wet chemical route, which involved co-precipitation of Fe{sup 2+} and Fe{sup 3+} ions. The nano particles were characterized using XRD, TEM, FTIR, TGA and VSM. X-ray diffraction studies showed that nano particles consist of single phase Fe{sub 3}O{sub 4} having inverse spinel structure. The particle size obtained from width of Bragg peak is about 12.6 nm. TEM analysis showed that sizes of nano particles are in range of 6 to 17 nm with a dominant population at 12 - 14 nm. FTIR and TGA analysis showed that -COOH group of oleic acid is bound to the surface of Fe{sub 3}O{sub 4} particles and one has to heat the sample to 278° C to remove the attached molecule from the surface. Further it was seen that Fe{sub 3}O{sub 4} particles exhibit super paramagnetism with a magnetization of about 53 emu/ gm.

  13. Synthesis and bioactivity of analogues of the marine antibiotic tropodithietic acid

    PubMed Central

    Rabe, Patrick; Klapschinski, Tim A; Brock, Nelson L; Citron, Christian A; D’Alvise, Paul; Gram, Lone

    2014-01-01

    Summary Tropodithietic acid (TDA) is a structurally unique sulfur-containing antibiotic from the Roseobacter clade bacterium Phaeobacter inhibens DSM 17395 and a few other related species. We have synthesised several structural analogues of TDA and used them in bioactivity tests against Staphylococcus aureus and Vibrio anguillarum for a structure–activity relationship (SAR) study, revealing that the sulfur-free analogue of TDA, tropone-2-carboxylic acid, has an antibiotic activity that is even stronger than the bioactivity of the natural product. The synthesis of this compound and of several analogues is presented and the bioactivity of the synthetic compounds is discussed. PMID:25161739

  14. Integrated process of distillation with side reactors for synthesis of organic acid esters

    DOEpatents

    Panchal, Chandrakant B; Prindle, John C; Kolah, Aspri; Miller, Dennis J; Lira, Carl T

    2015-11-04

    An integrated process and system for synthesis of organic-acid esters is provided. The method of synthesizing combines reaction and distillation where an organic acid and alcohol composition are passed through a distillation chamber having a plurality of zones. Side reactors are used for drawing off portions of the composition and then recycling them to the distillation column for further purification. Water is removed from a pre-reactor prior to insertion into the distillation column. An integrated heat integration system is contained within the distillation column for further purification and optimizing efficiency in the obtaining of the final product.

  15. Oxidation-resistant acidic resins prepared by partial carbonization as cocatalysts in synthesis of adipic acid.

    PubMed

    Wei, Huijuan; Li, Hongbian; Liu, Yangqing; Jin, Peng; Wang, Xiangyu; Li, Baojun

    2012-08-01

    The oxidation-resistant acidic resins are of great importance for the catalytic oxidation systems. In this paper, the oxidatively stable acidic resins are obtained from the cation ion exchange resins (CIERs) through the thermal treatment in N(2) atmosphere. The structure and properties of the thermally treated CIERs were characterized by chemical analysis, Fourier transform infrared (FT-IR) spectra, acid capacity measurement and scanning electron microscope (SEM). The thermally treated CIERs possess high acid capacity up to 4.09 mmol g(-1). A partial carbonization is observed in the thermal treatment process of CIERs, but the morphology of resin spheres maintains well. The as-prepared CIERs are used as solid acids to assist the hydrogen peroxide oxidation of cyclohexene to adipic acid (ADA) with tungstic acid as the catalyst precursor. The improved yields of ADA in the recycling reaction are obtained in the presence of acidic CIERs. Meanwhile, the unproductive decomposition of H(2)O(2) is effectively suppressed. The high yields of ADA (about 81%) are kept by the thermally treated CIERs even after the fifth cycle. The thermally treated CIERs exhibit excellent acid-catalytic performance and possess remarkable oxidation-resistant capability.

  16. A novel and highly regioselective synthesis of new carbamoylcarboxylic acids from dianhydrides.

    PubMed

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N'-disubstituted 4,4'-carbonylbis(carbamoylbenzoic) acids and N,N'-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3',4,4'-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS.

  17. A Novel and Highly Regioselective Synthesis of New Carbamoylcarboxylic Acids from Dianhydrides

    PubMed Central

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A.; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N′-disubstituted 4,4′-carbonylbis(carbamoylbenzoic) acids and N,N′-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3′,4,4′-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS. PMID:24511299

  18. Systems-level metabolic flux profiling identifies fatty acid synthesis as a target for antiviral therapy

    PubMed Central

    Munger, Joshua; Bennett, Bryson D; Parikh, Anuraag; Feng, Xiao-Jiang; McArdle, Jessica; Rabitz, Herschel A; Shenk, Thomas; Rabinowitz, Joshua D

    2010-01-01

    Viruses rely on the metabolic network of their cellular hosts to provide energy and building blocks for viral replication. We developed a flux measurement approach based on liquid chromatography–tandem mass spectrometry to quantify changes in metabolic activity induced by human cytomegalovirus (HCMV). This approach reliably elucidated fluxes in cultured mammalian cells by monitoring metabolome labeling kinetics after feeding cells 13C-labeled forms of glucose and glutamine. Infection with HCMV markedly upregulated flux through much of the central carbon metabolism, including glycolysis. Particularly notable increases occurred in flux through the tricarboxylic acid cycle and its efflux to the fatty acid biosynthesis pathway. Pharmacological inhibition of fatty acid biosynthesis suppressed the replication of both HCMV and influenza A, another enveloped virus. These results show that fatty acid synthesis is essential for the replication of two divergent enveloped viruses and that systems-level metabolic flux profiling can identify metabolic targets for antiviral therapy. PMID:18820684

  19. Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.

    PubMed

    Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij

    2016-08-01

    The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively).

  20. Acid synthesis of luminescent amine-functionalized or erbium-doped silica spheres for biological applications.

    PubMed

    Enrichi, Francesco; Trave, Enrico; Bersani, Marco

    2008-03-01

    In this work we discuss and investigate the morphological and optical properties of luminescent silica spheres which can have interesting applications in bioimaging and biosensing. The spheres are synthesized following an acid route by the hydrolysis and condensation of tetraethylortosilicate (TEOS) and can be functionalized by incorporation of aminopropyl-triethoxysilane (APTES) during the synthesis, inducing a significant luminescence that can be attributed to a recombination mechanism from localized organic defects related to -NH(2) groups. It is shown that the acid synthesis route produces very regular spherical particles, but their diameter vary in the range of 200-4,000 nm. The luminescence properties have been investigated and optimized by variation of the annealing temperature for the functionalized spheres, obtaining the most efficient PL emission after a thermal treatment of 1 h at 600 degrees C in air. Moreover, the possibility to introduce rare earths like erbium in the spheres was also studied and the corresponding Er(3) luminescence emission at 1.53 microm is reported in terms of intensity and lifetime, pointing out that erbium can be easily and efficiently incorporated during the acid synthesis giving high PL intensity with a good lifetime of 3.9 ms.

  1. In vitro synthesis of the unit that links teichoic acid to peptidoglycan.

    PubMed

    Hancock, I; Baddiley, J

    1976-03-01

    The role of cytidine diphosphate (CDP)-glycerol in gram-positive bacteria whose walls lack poly(glycerol phosphate) was investigated. Membrane preparations from Staphylococcus aureus H, Bacillus subtilis W23, and Micrococcus sp. 2102 catalyzed the incorporation of glycerol phosphate residues from radioactive CDP-glycerol into a water-soluble polymer. In toluenized cells of Micrococcus sp. 2102, some of this product became linked to the wall. In each case, maximum incorporation of glycerol phosphate residues required the presence of the nucleotide precursors of wall teichoic acid and of uridine diphosphate-N-acetylglucosamine. In membrane preparations capable of synthesizing peptidoglycan, vancomycin caused a decrease in the incorporation of isotope from CDP-glycerol into polymer. Synthesis of the poly (glycerol phosphate) unit thus depended at an early stage on the concomitant synthesis of wall teichoic acid and later on the synthesis of peptidoglycan. It is concluded that CDP-glycerol is the biosynthetic precursor of the tri(glycerol phosphate) linkage unit between teichoic acid and peptidoglycan that has recently been characterized in S. aureus H.

  2. Δ(9)-Tetrahydrocannabinolic acid synthase production in Pichia pastoris enables chemical synthesis of cannabinoids.

    PubMed

    Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K

    2015-10-10

    Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale.

  3. Novel sol-gel synthesis of acidic MgF(2-x)(OH)(x) materials.

    PubMed

    Wuttke, Stefan; Coman, Simona M; Scholz, Gudrun; Kirmse, Holm; Vimont, Alexandré; Daturi, Maro; Schroeder, Sven L M; Kemnitz, Erhard

    2008-01-01

    Novel magnesium fluorides have been prepared by a new fluorolytic sol-gel synthesis for fluoride materials based on aqueous HF. By changing the amount of water at constant stoichiometric amount of HF, it is possible to tune the surface acidity of the resulting partly hydroxylated magnesium fluorides. These materials possess medium-strength Lewis acid sites and, by increasing the amount of water, Brønsted acid sites as well. Magnesium hydroxyl groups normally have a basic nature and only with this new synthetic route is it possible to create Brønsted acidic magnesium hydroxyl groups. XRD, MAS NMR, TEM, thermal analysis, and elemental analysis have been applied to study the structure, composition, and thermal behaviour of the bulk materials. XPS measurements, FTIR with probe molecules, and the determination of N(2)/Ar adsorption-desorption isotherms have been carried out to investigate the surface properties. Furthermore, activity data have indicated that the tuning of the acidic properties makes these materials versatile catalysts for different classes of reactions, such as the synthesis of (all-rac)-[alpha]-tocopherol through the condensation of 2,3,6-trimethylhydroquinone (TMHQ) with isophytol (IP).

  4. Ionic liquids as novel solvents for the synthesis of sugar fatty acid ester.

    PubMed

    Mai, Ngoc Lan; Ahn, Kihun; Bae, Sang Woo; Shin, Dong Woo; Morya, Vivek Kumar; Koo, Yoon-Mo

    2014-12-01

    Sugar fatty acid esters are bio-surfactants known for their non-toxic, non-ionic, and high biodegradability . With great emulsifying and conditioning effects, sugar fatty acids are widely used in the food, pharmaceutical, and cosmetic industries. Biosynthesis of sugar fatty acid esters has attracted growing attention in recent decades. In this study, the enzymatic synthesis of sugar fatty acid esters in ionic liquids was developed, optimized, and scaled up. Reaction parameters affecting the conversion yield of lipase-catalyzed synthesis of glucose laurate from glucose and vinyl laurate (i.e. temperature, vinyl laurate/glucose molar ratio, and enzyme loads) were optimized by response surface methodology (RSM). In addition, production was scaled up to 2.5 L, and recycling of enzyme and ionic liquids was investigated. The results showed that under optimal reaction conditions (66.86 °C, vinyl laurate/glucose molar ratio of 7.63, enzyme load of 73.33 g/L), an experimental conversion yield of 96.4% was obtained which is close to the optimal value predicted by RSM (97.16%). A similar conversion yield was maintained when the reaction was carried out at 2.5 L. Moreover, the enzymes and ionic liquids could be recycled and reused effectively for up to 10 cycles. The results indicate the feasibility of ionic liquids as novel solvents for the biosynthesis of sugar fatty acid esters.

  5. Synthesis of non-aggregated nicotinic acid coated magnetite nanorods via hydrothermal technique

    NASA Astrophysics Data System (ADS)

    Attallah, Olivia A.; Girgis, E.; Abdel-Mottaleb, Mohamed M. S. A.

    2016-02-01

    Non-aggregated magnetite nanorods with average diameters of 20-30 nm and lengths of up to 350 nm were synthesized via in situ, template free hydrothermal technique. These nanorods capped with different concentrations (1, 1.5, 2 and 2.5 g) of nicotinic acid (vitamin B3); possessed good magnetic properties and easy dispersion in aqueous solutions. Our new synthesis technique maintained the uniform shape of the nanorods even with increasing the coating material concentration. The effect of nicotinic acid on the shape, particle size, chemical structure and magnetic properties of the prepared nanorods was evaluated using different characterization methods. The length of nanorods increased from 270 nm to 350 nm in nicotinic acid coated nanorods. Goethite and magnetite phases with different ratios were the dominant phases in the coated samples while a pure magnetite phase was observed in the uncoated one. Nicotinic acid coated magnetic nanorods showed a significant decrease in saturation magnetization than uncoated samples (55 emu/g) reaching 4 emu/g in 2.5 g nicotinic acid coated sample. The novel synthesis technique proved its potentiality to prepare coated metal oxides with one dimensional nanostructure which can function effectively in different biological applications.

  6. How initiation factors tune the rate of initiation of protein synthesis in bacteria

    PubMed Central

    Antoun, Ayman; Pavlov, Michael Y; Lovmar, Martin; Ehrenberg, Måns

    2006-01-01

    The kinetics of initiator transfer RNA (tRNA) interaction with the messenger RNA (mRNA)-programmed 30S subunit and the rate of 50S subunit docking to the 30S preinitiation complex were measured for different combinations of initiation factors in a cell-free Escherichia coli system for protein synthesis with components of high purity. The major results are summarized by a Michaelis–Menten scheme for initiation. All three initiation factors are required for maximal efficiency (kcat/KM) of initiation and for maximal in vivo rate of initiation at normal concentration of initiator tRNA. Spontaneous release of IF3 from the 30S preinitiation complex is required for subunit docking. The presence of initiator tRNA on the 30S subunit greatly increases the rate of 70S ribosome formation by increasing the rate of IF3 dissociation from the 30S subunit and the rate of 50S subunit docking to the IF3-free 30S preinitiation complex. The reasons why IF1 and IF3 are essential in E. coli are discussed in the light of the present observations. PMID:16724118

  7. Synthesis of side chain N,N'-diaminoalkylated derivatives of basic amino acids for application in solid-phase peptide synthesis.

    PubMed

    Pitteloud, Jean-Philippe; Bionda, Nina; Cudic, Predrag

    2013-01-01

    Despite the enormous therapeutic potential, the clinical use of peptides has been limited by their poor bioavailability and low stability under physiological conditions. Hence, efforts have been undertaken to alter peptide structure in ways to improve their pharmacological properties. Inspired by the importance of basic amino acids in biological systems and the remarkable versatility displayed by lysine during the synthesis of complex peptide scaffolds, this chapter describes a simple procedure that enables rapid access to protected N,N'-diaminoalkylated basic amino acid building blocks suitable for standard solid-phase peptide synthesis. This procedure allows preparation of symmetrical, as well as unsymmetrical, dialkylated amino acid derivatives that can be further modified, enhancing their synthetic utility. The suitability of the synthesized branched basic amino acid building blocks for use in standard solid-phase peptide synthesis has been demonstrated by synthesis of an indolicidin analog in which the lysine residue was substituted with its synthetic polyamino derivate. The substitution provided indolicidin analog with increase net positive charge, more ordered secondary structure in biological membranes mimicking conditions, and enhanced antibacterial activity without altering hemolytic activity. Taking into consideration the increasing interest for peptides with unusual structural features due to their improved biological properties, the described synthesis of polyfunctional amino acid building blocks is of particular practical value.

  8. The effects of borate minerals on the synthesis of nucleic acid bases, amino acids and biogenic carboxylic acids from formamide.

    PubMed

    Saladino, Raffaele; Barontini, Maurizio; Cossetti, Cristina; Di Mauro, Ernesto; Crestini, Claudia

    2011-08-01

    The thermal condensation of formamide in the presence of mineral borates is reported. The products afforded are precursors of nucleic acids, amino acids derivatives and carboxylic acids. The efficiency and the selectivity of the reaction was studied in relation to the elemental composition of the 18 minerals analyzed. The possibility of synthesizing at the same time building blocks of both genetic and metabolic apparatuses, along with the production of amino acids, highlights the interest of the formamide/borate system in prebiotic chemistry.

  9. Arginine depletion by arginine deiminase does not affect whole protein metabolism or muscle fractional protein synthesis rate in mice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Due to the absolute need for arginine that certain cancer cells have, arginine depletion is a therapy in clinical trials to treat several types of cancers. Arginine is an amino acids utilized not only as a precursor for other important molecules, but also for protein synthesis. Because arginine depl...

  10. Synthesis and characterization of agricultural controllable humic acid superabsorbent.

    PubMed

    Gao, Lijuan; Wang, Shiqiang; Zhao, Xuefei

    2013-12-01

    Humic acid superabsorbent polymer (P(AA/AM-HA)) and superabsorbent polymer (P(AA/AM)) were synthesized by aqueous solution polymerization method using acrylic acid (AA), acrylamide (AM) and humic acid (HA) as raw material. The effects of N,N'-methylenebisacrylamide (MBA) crosslinking agent, potassium peroxydisulfate (KPS) initiator, reaction temperature, HA content, ratio of AA to AM, concentration of monomer and neutralization of AA on water absorption were investigated. Absorption and desorption ratios of nitrogen fertilizer and phosphate fertilizer were also investigated by determination of absorption and desorption ratio of NH4(+), PO4(3-) on P(AA/AM-HA) and P(AA/AM). The P(AA/AM-HA) and P(AA/AM) were characterized by Fourier translation infrared spectroscopy, biological photomicroscope and scanning electron microscopy (SEM). The optimal conditions obtained were as follows: the weight ratio of MBA to AA and AM was 0.003; the weight ratio of KPS to AA and AM was 0.008; the weight ratio of HA to AA was 0.1; the mole ratio of AM to AA is 0.1; the mole ratio of NaOH to AA is 0.9; the reaction temperature was 60°C. P(AA/AM-HA) synthesized under optimal conditions, has a good saline tolerance, its water absorbency in distilled water and 0.9 wt.% saline solution is 1180 g/g and 110 g/g, respectively. P(AA/AM-HA) achieves half saturation in 6.5 min. P(AA/AM-HA) is superior to P(AA/AM) on absorption of NH4(+), PO4(3-). The SEM micrograph of P(AA/AM-HA) shows a fine alveolate structure. The biological optical microscope micrograph of P(AA/AM-HA) shows a network structure. Graft polymerization between P(AA/AM) and HA was demonstrated by infrared spectrum. The P(AA/AM-HA) superabsorbent has better absorbing ability of water and fertilizer, electrolytic tolerance and fewer cost than P(AA/AM) superabsorbent.

  11. The Synthesis and Isolation of N-Tert-Butyl-2-Phenylsuccinamic Acid and N-Tert-Butyl-3-Phenylsuccinamic Acid: An Undergraduate Organic Chemistry Laboratory Experiment

    ERIC Educational Resources Information Center

    Cesare, Victor; Sadarangani, Ishwar; Rollins, Janet; Costello, Dennis

    2004-01-01

    The facile, high yielding synthesis of phenylsuccinamic acids is described and one of these syntheses, the reaction of phenylsuccinic anhydride with tert-butylamine, is successfully modified and adapted for use in the second-semester organic chemistry laboratory at St. John's University. Succinamic acids are compounds that contain both the amide…

  12. Synthesis of acid-base bifunctional mesoporous materials by oxidation and thermolysis

    SciTech Connect

    Yu, Xiaofang; Zou, Yongcun; Wu, Shujie; Liu, Heng; Guan, Jingqi; Kan, Qiubin

    2011-06-15

    Graphical abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst. The obtained sample of SO{sub 3}H-MCM-41-NH{sub 2} containing amine and sulfonic acids exhibits excellent catalytic activity in aldol condensation reaction. Research highlights: {yields} Synthesize acid-base bifunctional mesoporous materials SO{sub 3}H-MCM-41-NH{sub 2}. {yields} Oxidation and then thermolysis to generate acidic site and basic site. {yields} Exhibit good catalytic performance in aldol condensation reaction between acetone and various aldehydes. -- Abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst SO{sub 3}H-MCM-41-NH{sub 2}. This method was achieved by co-condensation of tetraethylorthosilicate (TEOS), 3-mercaptopropyltrimethoxysilane (MPTMS) and (3-triethoxysilylpropyl) carbamicacid-1-methylcyclohexylester (3TAME) in the presence of cetyltrimethylammonium bromide (CTAB), followed by oxidation and then thermolysis to generate acidic site and basic site. X-ray diffraction (XRD) and transmission electron micrographs (TEM) show that the resultant materials keep mesoporous structure. Thermogravimetric analysis (TGA), X-ray photoelectron spectra (XPS), back titration, solid-state {sup 13}C CP/MAS NMR and solid-state {sup 29}Si MAS NMR confirm that the organosiloxanes were condensed as a part of the silica framework. The bifunctional sample (SO{sub 3}H-MCM-41-NH{sub 2}) containing amine and sulfonic acids exhibits excellent acid-basic properties, which make it possess high activity in aldol condensation reaction between acetone and various aldehydes.

  13. Synthesis and biological activity of hydroxylated derivatives of linoleic acid and conjugated linoleic acids.

    PubMed

    Li, Zhen; Tran, Van H; Duke, Rujee K; Ng, Michelle C H; Yang, Depo; Duke, Colin C

    2009-03-01

    Allylic hydroxylated derivatives of the C18 unsaturated fatty acids were prepared from linoleic acid (LA) and conjugated linoleic acids (CLAs). The reaction of LA methyl ester with selenium dioxide (SeO(2)) gave mono-hydroxylated derivatives, 13-hydroxy-9Z,11E-octadecadienoic acid, 13-hydroxy-9E,11E-octadecadienoic acid, 9-hydroxy-10E,12Z-octadecadienoic acid and 9-hydroxy-10E,12E-octadecadienoic acid methyl esters. In contrast, the reaction of CLA methyl ester with SeO(2) gave di-hydroxylated derivatives as novel products including, erythro-12,13-dihydroxy-10E-octadecenoic acid, erythro-11,12-dihydroxy-9E-octadecenoic acid, erythro-10,11-dihydroxy-12E-octadecenoic acid and erythro-9,10-dihydroxy-11E-octadecenoic acid methyl esters. These products were purified by normal-phase short column vacuum chromatography followed by high-performance liquid chromatography (HPLC). Their chemical structures were characterized by liquid chromatography-mass spectrometry (LC-MS) and nuclear magnetic resonance spectroscopy (NMR). The allylic hydroxylated derivatives of LA and CLA exhibited moderate in vitro cytotoxicity against a panel of human cancer cell lines including chronic myelogenous leukemia K562, myeloma RPMI8226, hepatocellular carcinoma HepG2 and breast adenocarcinoma MCF-7 cells (IC(50) 10-75 microM). The allylic hydroxylated derivatives of LA and CLA also showed toxicity to brine shrimp with LD(50) values in the range of 2.30-13.8 microM. However these compounds showed insignificant toxicity to honeybee at doses up to 100 microg/bee.

  14. Synthesis of 11-Thialinoleic Acid and 14-Thialinoleic Acid, Inhibitors of Soybean and Human Lipoxygenases

    PubMed Central

    Jacquot, Cyril; McGinley, Chris M.; Plata, Erik; Holman, Theodore R.

    2010-01-01

    Lipoxygenases catalyse the oxidation of polyunsaturated fatty acids and have been invoked in many diseases including cancer, atherosclerosis and Alzheimer’s disease. Currently, no X-ray structures are available with substrate or substrate analogues bound in a productive conformation. Such structures would be very useful for examining interactions between substrate and active site residues. Reported here are the syntheses of linoleic acid analogues containing a sulphur atom at the 11 or 14 positions. The key steps in the syntheses were the incorporation of sulphur using nucleophilic attack of metallated alkynes on electrophilic sulphur compounds and the subsequent stereospecific tantalum-mediated reduction of the alkynylsulphide to the cis-alkenylsulphide. Kinetic assays performed with soybean lipoxygenase-1 showed that both 11-thialinoleic acid and 14-thialinoleic acid were competitive inhibitors with respect to linoleic acid with Ki values of 22 and 35 µM, respectively. On the other hand, 11-thialinoleic acid was a noncompetitive inhibitor with respect to arachidonic acid with Kis and Kii values of 48 and 36 µM, respectively. 11-Thialinoleic acid was also a noncompetitive inhibitor of human 15-lipoxygenase-1 with arachidonic acid (Kis = 11.4 µM, Kii = 18.1 µM) or linoleic acid as substrate (Kis = 20.1 µM, Kii = 20.0 µM), and a competitive inhibitor of human 12-lipoxygenase with arachidonic acid as substrate (Ki = 2.5 µM). The presence of inhibitor did not change the regioselectivity of soybean lipoxygenase-1, human 12- or 15-lipoxygenase-1. PMID:18972057

  15. Control of the Synthesis of Macromolecules During Amino Acid and Thymine Starvation in Bacillus subtilis

    PubMed Central

    Anraku, Naoyo; Landman, Otto E.

    1968-01-01

    Studies of Maaløe, Lark, and others with amino acid- and thymine-starved cultures revealed successive steps in the biosynthesis of Escherichia coli chromosomes. In this study, the corresponding mechanisms in Bacillus subtilis 168 were examined. Using a strain requiring both thymine and tryptophan, we found that, 3 hr after the start of amino acid starvation, when the deoxyribonucleic acid (DNA) content of the culture had increased 40 to 50%, DNA synthesis ceased. After 4 to 5 hr, 100% of the cells were immune to thymineless death; their chromosomes had presumably been completed. Immune cultures slowly incorporated 3H-thymine. Thymine incorporation increased 20-fold 30 min after readdition of amino acids, indicating reinitiation of chromosome synthesis. Simultaneous presence of amino acids and thymine was required for reinitiation. If 5-bromouracil (5-BU) was added instead of thymine, newly replicated DNA segments could be separated by centrifugation in CsCl. Analysis of the CsCl fractions by a transformation assay showed that the order in which the markers were synthesized was ade-16, thr-5, leu-8, metB5. Less than half the chromosomes started resynthesis synchronously in 5-BU. Nevertheless, chromosome alignment in the amino acid-starved culture is probably very good: marker frequency analysis of its DNA gives the same normalized frequencies as DNA from “perfectly” aligned spores. Full viability is maintained in the chromosome-arrested culture for 10 hr in thymine-free medium in the absence or presence of amino acids. In the latter condition, protein synthesis proceeds, and the cells filament and become more lysozyme-sensitive. Such cells must be incubated and plated on hypertonic or on slow-growth media; otherwise, they undergo “quasiosmotic” thymineless death. This death is thus apparently not directly attributable to any damage of chromosomal DNA. Further, weakening of the teichoic acid portion of the cell wall is not involved, since 32P incorporation

  16. Influence of virgin coconut oil-enriched diet on the transcriptional regulation of fatty acid synthesis and oxidation in rats - a comparative study.

    PubMed

    Arunima, Sakunthala; Rajamohan, Thankappan

    2014-05-28

    The present study was carried out to evaluate the effects of virgin coconut oil (VCO) compared with copra oil, olive oil and sunflower-seed oil on the synthesis and oxidation of fatty acids and the molecular regulation of fatty acid metabolism in normal rats. Male Sprague-Dawley rats were fed the test oils at 8 % for 45 d along with a synthetic diet. Dietary supplementation of VCO decreased tissue lipid levels and reduced the activity of the enzymes involved in lipogenesis, namely acyl CoA carboxylase and fatty acid synthase (FAS) (P< 0·05). Moreover, VCO significantly (P< 0·05) reduced the de novo synthesis of fatty acids by down-regulating the mRNA expression of FAS and its transcription factor, sterol regulatory element-binding protein-1c, compared with the other oils. VCO significantly (P< 0·05) increased the mitochondrial and peroxisomal β-oxidation of fatty acids, which was evident from the increased activities of carnitine palmitoyl transferase I, acyl CoA oxidase and the enzymes involved in mitochondrial β-oxidation; this was accomplished by up-regulating the mRNA expression of PPARα and its target genes involved in fatty acid oxidation. In conclusion, the present results confirmed that supplementation of VCO has beneficial effects on lipid parameters by reducing lipogenesis and enhancing the rate of fatty acid catabolism; this effect was mediated at least in part via PPARα-dependent pathways. Thus, dietary VCO reduces the risk for CHD by beneficially modulating the synthesis and degradation of fatty acids.

  17. Synthesis and cytotoxic evaluation of novel paraconic acid analogs.

    PubMed

    Le Floch, Camille; Le Gall, Erwan; Léonel, Eric; Martens, Thierry; Cresteil, Thierry

    2011-12-01

    A novel class of 2,3-tri- and tetrasubstituted γ-butyrolactones analogous to paraconic acids has been synthesized in one step using a straightforward three-component reaction among aryl bromides, dimethyl itaconate and carbonyl compounds. The in vitro cytotoxic activity of representative compounds has been evaluated against a panel of human cancer cell lines (KB, HCT116, MCF7, HL60). While most molecules exhibit a low to moderate background activity on both KB and HL60 cancer cell lines, one compound shows increased antiproliferative activities against both cell lines with IC(50) values in the 10(-7)-10(-6)mol/L range. An extended evaluation indicated that this compound also inhibits PC3, SK-OV3, MCF7R and HL60R cell growth in the same fashion.

  18. Radiation synthesis of nanosilver nanohydrogels of poly(methacrylic acid)

    NASA Astrophysics Data System (ADS)

    Gupta, Bhuvanesh; Gautam, Deepti; Anjum, Sadiya; Saxena, Shalini; Kapil, Arti

    2013-11-01

    Nanosilver nanohydrogels (nSnH) of poly(methacrylic acid) were synthesized and stabilized using gamma irradiation. The main objective of this study was to develop silver nanoparticles and to evaluate the antimicrobial activity. Radiation helps in the polymerization, crosslinking and reduction of silver nitrate as well. Highly stable and uniformly distributed silver nanoparticles have been obtained within hydrogel network by water in oil nanoemulsion polymerization and were evaluated by dynamic light scattering (DLS) and transmission electron microscopy (TEM) respectively. TEM showed almost spherical and uniform distribution of silver nanoparticles through the hydrogel network. The mean size of silver nanoparticles ranging is 10-50 nm. The nanohydrogels showed good swelling in water. Antibacterial studies of nSnH suggest that it can be a good candidate as coating material in biomedical applications.

  19. Synthesis and cholinesterase inhibition of cativic acid derivatives.

    PubMed

    Alza, Natalia P; Richmond, Victoria; Baier, Carlos J; Freire, Eleonora; Baggio, Ricardo; Murray, Ana Paula

    2014-08-01

    Alzheimer's disease (AD) is a neurodegenerative disorder associated with memory impairment and cognitive deficit. Most of the drugs currently available for the treatment of AD are acetylcholinesterase (AChE) inhibitors. In a preliminary study, significant AChE inhibition was observed for the ethanolic extract of Grindelia ventanensis (IC₅₀=0.79 mg/mL). This result prompted us to isolate the active constituent, a normal labdane diterpenoid identified as 17-hydroxycativic acid (1), through a bioassay guided fractionation. Taking into account that 1 showed moderate inhibition of AChE (IC₅₀=21.1 μM), selectivity over butyrylcholinesterase (BChE) (IC₅₀=171.1 μM) and that it was easily obtained from the plant extract in a very good yield (0.15% w/w), we decided to prepare semisynthetic derivatives of this natural diterpenoid through simple structural modifications. A set of twenty new cativic acid derivatives (3-6) was prepared from 1 through transformations on the carboxylic group at C-15, introducing a C2-C6 linker and a tertiary amine group. They were tested for their inhibitory activity against AChE and BChE and some structure-activity relationships were outlined. The most active derivative was compound 3c, with an IC₅₀ value of 3.2 μM for AChE. Enzyme kinetic studies and docking modeling revealed that this inhibitor targeted both the catalytic active site and the peripheral anionic site of this enzyme. Furthermore, 3c showed significant inhibition of AChE activity in SH-SY5Y human neuroblastoma cells, and was non-cytotoxic.

  20. Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes

    NASA Astrophysics Data System (ADS)

    Iwane, Yoshihiko; Hitomi, Azusa; Murakami, Hiroshi; Katoh, Takayuki; Goto, Yuki; Suga, Hiroaki

    2016-04-01

    In ribosomal polypeptide synthesis the library of amino acid building blocks is limited by the manner in which codons are used. Of the proteinogenic amino acids, 18 are coded for by multiple codons and therefore many of the 61 sense codons can be considered redundant. Here we report a method to reduce the redundancy of codons by artificially dividing codon boxes to create vacant codons that can then be reassigned to non-proteinogenic amino acids and thereby expand the library of genetically encoded amino acids. To achieve this, we reconstituted a cell-free translation system with 32 in vitro transcripts of transfer RNASNN (tRNASNN) (S = G or C), assigning the initiator and 20 elongator amino acids. Reassignment of three redundant codons was achieved by replacing redundant tRNASNNs with tRNASNNs pre-charged with non-proteinogenic amino acids. As a demonstration, we expressed a 32-mer linear peptide that consists of 20 proteinogenic and three non-proteinogenic amino acids, and a 14-mer macrocyclic peptide that contains more than four non-proteinogenic amino acids.

  1. The temperature dependence of the rate constant for the reaction of hydroxyl radicals with nitric acid

    NASA Technical Reports Server (NTRS)

    Kurylo, M. J.; Cornett, K. D.; Murphy, J. L.

    1982-01-01

    The rate constant for the reaction of hydroxyl radicals with nitric acid in the 225-443 K temperature range has been measured by means of the flash photolysis resonance fluorescence technique. Above 300 K, the rate constant levels off in a way that can only be explained by the occurrence of two reaction channels, of which one, operative at low temperatures, proceeds through the formation of an adduct intermediate. The implications of these rate constant values for stratospheric reaction constants is discussed.

  2. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    SciTech Connect

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert

    2010-05-03

    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  3. Oxidative cleavage of erucic acid for the synthesis of brassylic acid

    SciTech Connect

    Mohammed J. Nasrullah; Pooja Thapliyal; Erica N. Pfarr; Nicholas S. Dusek; Kristofer L. Schiele; James A. Bahr

    2010-10-29

    The main focus of this work is to synthesize Brassylic Acid (BA) using oxidative cleavage of Erucic Acid (EA). Crambe (Crambe abyssinica) is an industrial oilseed grown in North Dakota. Crambe has potential as an industrial fatty acid feedstock as a source of Erucic acid (EA). It has approximately 50-60 % of EA, a C{sub 22} monounsaturated fatty acid. Oxidative cleavage of unsaturated fatty acids derived from oilseeds produces long chain (9, 11, and 13 carbon atoms) dibasic and monobasic acids. These acids are known commercial feedstocks for the preparation of nylons, polyesters, waxes, surfactants, and perfumes. Other sources of EA are Rapeseed seed oil which 50-60 % of EA. Rapeseed is grown outside USA. The oxidative cleavage of EA was done using a high throughput parallel pressure reactor system. Kinetics of the reaction shows that BA yields reach a saturation at 12 hours. H{sub 2}WO{sub 4} was found to be the best catalyst for the oxidative cleavage of EA. High yields of BA were obtained at 80 C with bubbling of O{sub 2} or 10 bar of O{sub 2} for 12 hours.

  4. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    1999-01-01

    A process of preparing an acid addition salt of delta-aminolevulinic acid comprising: dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures thereof to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing said alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  5. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, L.

    1999-05-25

    A process is disclosed for preparing an acid addition salt of delta-aminolevulinic acid comprising. The process involves dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing the alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  6. Enzymatic synthesis of theanine from glutamic acid γ-methyl ester and ethylamine by immobilized Escherichia coli cells with γ-glutamyltranspeptidase activity.

    PubMed

    Zhang, Fei; Zheng, Qing-Zhong; Jiao, Qing-Cai; Liu, Jun-Zhong; Zhao, Gen-Hai

    2010-11-01

    Theanine (γ-glutamylethylamide) is the main amino acid component in green tea. The demand for theanine in the food and pharmaceutical industries continues to increase because of its special flavour and multiple physiological effects. In this research, an improved method for enzymatic theanine synthesis is reported. An economical substrate, glutamic acid γ-methyl ester, was used in the synthesis catalyzed by immobilized Escherichia coli cells with γ-glutamyltranspeptidase (GGT) activity. The results show that GGT activity with glutamic acid γ-methyl ester as substrate was about 1.2-folds higher than that with glutamine as substrate. Reaction conditions were optimized by using 300 mmol/l glutamic acid γ-methyl ester, 3,000 mmol/l ethylamine, and 0.1 g/ml of immobilized GGT cells at pH 10 and 50°C. Under these conditions, the immobilized cells were continuously used ten times, yielding an average glutamic acid γ-methyl ester to theanine conversion rate of 69.3%. Bead activity did not change significantly the first six times they were used, and the average conversion rate during the first six instances was 87.2%. The immobilized cells exhibited favourable operational stability.

  7. The effects of walking on heart rate, ventilation rate and acid-base status in the lobster homarus americanus

    PubMed

    Rose; Wilkens; Walker

    1998-09-01

    American lobsters Homarus americanus were exercised on an underwater treadmill at speeds from 1.7 to 8 m min-1 to determine the effects of exercise on heart rate, ventilation rate and acid-base status. Heart and ventilation rates showed almost instantaneous increases at the start of exercise, but the magnitude of the increase was not related to speed. Maximum heart rate was approximately 80-90 beats min-1 and maximum ventilation rate was 175-180 beats min-1 at all speeds tested. Exercise at all speeds caused a decrease in haemolymph pH, with the acidosis after exercise at 8 m min-1 being significantly greater than at the other three speeds. Concomitant with this acidosis was a large increase in partial pressure of carbon dioxide, with the largest increase occurring after exercise at 8 m min-1. The concentration of lactate in the haemolymph increased to similar levels at all speeds of walking. Davenport analysis indicates that the acidosis was predominantly respiratory in nature. Although it was anticipated that heart and ventilation rates would show increases proportional to the speed of exercise, this was not the case. Rather, the responses were fixed regardless of walking speed. The reason for this phenomenon remains unexplained.

  8. Synthesis and Physical Properties of Estolide Ester Using Saturated Fatty Acid and Ricinoleic Acid

    PubMed Central

    Salimon, Jumat; Nallathamby, Neeranjini; Salih, Nadia; Abdullah, Bashar Mudhaffar

    2011-01-01

    A study was conveyed to produce estolide ester using ricinoleic acid as the backbone. The ricinoleic acid reacted with saturated fatty acid from C8–C18. These reactions were conducted under vacuum at 60°C for 24 h without solvent. The reaction used acid catalyst, sulphuric acid. The new saturate ricinoleic estolide esters show superior low-temperature properties (−52 ± 0.08°C) and high flash point (>300°C). The yield of the neat estolide esters ranged from 52% to 96%. The viscosity range was 51 ± 0.08 to 86 ± 0.01 cp. These new saturated estolide esters were also compared with saturated branched estolide esters. PMID:22007150

  9. Role of estrogen receptors and aromatase on brain protein synthesis rates in ovariectomized female rats fed genistein.

    PubMed

    Lyou, Sunok; Kawano, Susumu; Yamada, Takashi; Okuyama, Satoshi; Terashima, Takehiko; Hayase, Kazutoshi; Yokogoshi, Hidehiko

    2008-08-01

    We have reported that the dietary addition of genistein, a phytoestrogen found abundantly in soy products, stimulates brain protein synthesis rates of ovariectomized female rats. In the present study, we determine whether stimulation of brain protein synthesis rates in ovariectomized female rats by the dietary addition of genistein was conducted via estrogen receptors and aromatase-mediating actions. After ovariectomy, Wistar female rats were treated with genistein, the estrogen receptor antagonist ICI 182,780, and/or fadrozole a systemic aromatase inhibitor. In the cerebral cortex, the cerebellum and the hypothalamus, the fractional (Ks) rates of protein synthesis were increased by the dietary addition of genistein. These effects of genistein were inhibited by the administration of ICI 182,780 and fadrozole. However, the degrees to which ICI 182,780 and fadrozole inhibited the effects of genistein differed depending on the brain region. This result suggests that dietary genistein elevates the rate of protein synthesis in the brain of ovariectomized female rats. In addition, the estrogen receptors of the brain and the aromatase of the peripheral tissue and brain are, at least partly, related to the rate of brain protein synthesis caused by genistein.

  10. Enantiopure synthesis of dihydrobenzo[1,4]-oxazine-3-carboxylic acids and a route to benzoxazinyl oxazolidinones.

    PubMed

    Malhotra, Rajesh; Dey, Tushar K; Basu, Sourav; Hajra, Saumen

    2015-03-21

    A two step protocol is developed for the efficient synthesis of enantiopure N-Boc-dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids 4 from serine derived cyclic sulfamidate via intramolecular arylamination. The RuPhos Palladacycle along with additional RuPhos ligand is found to be an efficient catalyst for the arylamination of β-(2-bromoaryloxy)amino acids 3 to provide easy and direct access to a variety of dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids 4 with complete retention of enantiopurity in moderate to high yields. Dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids are not only important unnatural amino acids, but are key precursors for the synthesis of important compounds such as benzoxazinyl oxazolidinones. A general approach for the synthesis of benzoxazinyl oxazolidinone is presented.

  11. Modeling and simulation of titanium dioxide nanoparticle synthesis with finite-rate sintering in planar jets

    NASA Astrophysics Data System (ADS)

    Garrick, Sean C.; Wang, Guanghai

    2011-03-01

    Numerical simulations of titanium dioxide nanoparticle synthesis in planar, non-premixed diffusion flames are performed. Titania is produced by the oxidation of titanium tetrachloride using a methane-air flame. The flow field is obtained using the two-dimensional Navier-Stokes equations. The methane-air flame and oxidation of titanium tetrachloride are modeled via one-step reactions. Evolution of the particle field is obtained via a nodal method which accounts for nucleation, condensation, coagulation, and coalescence with finite-rate sintering. The modeling of finite-rate sintering is accomplished via the use of uniform primary-particle size distribution. Simulations are performed at two different jet-to-co-flow velocity ratios as well as with finite-rate and instantaneous sintering models. In doing so we elucidate the effect of fluid mixing and finite-rate sintering on the particle field. Results show that highly agglomerated particles are found on the periphery of the eddies, where the collisions leading to nanoparticle coagulation occur faster than nanoparticle coalescence.

  12. [Regulation of the reaction rate of ATP synthesis in intact mitochondria].

    PubMed

    Iaguzhinskiĭ, L S; Krasinskaia, I P; Dragunova, S F; Zinchenko, V P; Evtodienko, Iu V

    1979-01-01

    High concentrations of respiration inhibitors are known to sharply decrease the membrane potential in mitochondria. The effect of relatively low concentrations of oxidative phosphorylation inhibitors on the value of membrane potential of intact mitochondria and on the rate of respiration and phosphorylation as well was studied. It has been found that within a certain concentration range the inhibitors of oxidative phsophorylation--malonic acid, sodium cyanide m-chlorophenyl hydrozonecarbonylcyanide, sharply decrease the phosphorylation rate (by 70 divided by 90%) but do not practically a affect the membrane potential value of intact mitochondria in the state 3 according to Chance.

  13. The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.

    PubMed

    Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S

    2015-08-21

    The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties.

  14. Synthesis and characterization of melanins from dihydroxyindole-2-carboxylic acid and dihydroxyindole.

    PubMed

    Orlow, S J; Osber, M P; Pawelek, J M

    1992-09-01

    Several studies have confirmed that a melanocyte-specific enzyme, dopachrome tautomerase (EC 5.3.2.3), catalyzes the isomerization of dopachrome to 5,6-dihydroxyindole-2-carboxylic acid (DHICA) (Pawelek, 1991). Here we report that DHICA, produced either enzymatically with dopachrome tautomerase or through chemical synthesis, spontaneously polymerized to form brown melanin that was soluble in aqueous solutions above pH 5. Under the same reaction conditions, solutions of either DOPA, DOPAchrome, or 5,6-dihydroxyindole (DHI) formed black, insoluble melanin precipitates. When DHICA and DHI were mixed together, with DHICA in molar excess, little or no precipitation of DHI-melanin occurred and the rate and extent of soluble melanin formation was markedly enhanced over that achieved with DHICA alone, suggesting co-polymerization of DHICA and DHI. With or without DHI, DHICA-melanins absorbed throughout the ultraviolet and visible spectra (200-600 nm). The DHICA-melanins precipitated below pH 5, at least in part because of protonation of the carboxyl groups. DHICA-melanins could be passed through 0.22 micron filters but could not be dialyzed through semi-permeable membranes with exclusion limits of 12,000-14,000 daltons. HPLC/molecular sieve analyses revealed apparent molecular weights ranging from 20,000 to 200,000 daltons, corresponding to 100-1,000 DHICA monomers per molecule of melanin. DHICA-melanins were stable to boiling, lyophilization, freezing and thawing, and incubation at room temperature for more than 1 year. The natural occurrence of oligomers of DHICA was first reported by Ito and Nichol (1974) in their studies of the brown tapetal pigment in the eye of the sea catfish (Arius felis L.).(ABSTRACT TRUNCATED AT 250 WORDS)

  15. Effects of dietary amino acids, carbohydrates, and choline on neurotransmitter synthesis

    NASA Technical Reports Server (NTRS)

    Wurtman, Richard J.

    1988-01-01

    The ability of a meal to increase or decrease brain neurotransmitter synthesis has been studied. It is concluded that brain serotonin synthesis is directly controlled by the proportions of carbohydrate to protein in meals and snacks that increase or decrease brain tryptophan levels, thereby changing the substrate saturation of tryptophan hydroxylase and the rate of serotonin synthesis. The ability of serotoninergic neurons to have their output coupled to dietary macronutrients enables them to function as sensors of peripheral metabolism, and to subserve an important role in the control of appetite. The robust and selective responses of catecholaminergic and cholinergic neurons to supplemental tyrosine and choline suggest that these compounds may become useful as a new type of drug for treating deseases or conditions in which adequate quantities of the transmitter would otherwise be unavailable.

  16. Synthesis and Characterization of Hybrid Hyaluronic Acid-Gelatin Hydrogels

    PubMed Central

    Camci-Unal, Gulden; Cuttica, Davide; Annabi, Nasim; Demarchi, Danilo; Khademhosseini, Ali

    2013-01-01

    Biomimetic hybrid hydrogels have generated broad interest in tissue engineering and regenerative medicine. Hyaluronic acid (HA) and gelatin (hydrolyzed collagen) are naturally derived polymers and biodegradable under physiological conditions. Moreover, collagen and HA are major components of the extracellular matrix (ECM) in most of the tissues (e.g. cardiovascular, cartilage, neural). When used as a hybrid material, HA-gelatin hydrogels may enable mimicking the ECM of native tissues. Although HA-gelatin hybrid hydrogels are promising biomimetic substrates, their material properties have not been thoroughly characterized in the literature. Herein, we generated hybrid hydrogels with tunable physical and biological properties by using different concentrations of HA and gelatin. The physical properties of the fabricated hydrogels including swelling ratio, degradation, and mechanical properties were investigated. In addition, in vitro cellular responses in both two and three dimensional (2D and 3D) culture conditions were assessed. It was found that the addition of gelatin methacrylate (GelMA) into HA methacrylate (HAMA) promoted cell spreading in the hybrid hydogels. Moreover, the hybrid hydrogels showed significantly improved mechanical properties compared to their single component analogs. The HAMA-GelMA hydrogels exhibited remarkable tunability behavior and may be useful for cardiovascular tissue engineering applications. PMID:23419055

  17. Template-directed synthesis of oligoguanylic acids - Metal ion catalysis

    NASA Technical Reports Server (NTRS)

    Bridson, P. K.; Fakhrai, H.; Lohrmann, R.; Orgel, L. E.; Van Roode, M.

    1981-01-01

    The effects of Zn(2+), Pb(2+) and other metal ions on the efficiency and stereo-selectivity of the template-directed oligomerization of guanosine 5'-phosphorimidazolide are investigated. Reactions were run in the presence of a polyC template in a 2,6-lutidine buffer, and products analyzed by high-performance liquid chromatography on an RPC-5 column. The presence of the Pb(2+) ion is found to lead to the formation of 2'-5' linked oligomers up to the 40-mer, while Zn(2+) favors the formation of predominantly 3'-5' linked oligomers up to the 35-mer. When amounts of uracil, cytidine or adenosine 5'-phosphorimidazole equal to those of the guanosine derivative are included in the reaction mixture, the incorrect base is incorporated into the oligomer about 10% of the time with a Pb(2+) catalyst, but less than 0.5% of the time with Zn(2+). The Sn(2+), Sb(3+) and Bi(3+) ions are also found to promote the formation of 2'-5' oligomers, although not as effectively as Pb(2+), while no metal ions other than Zn(2+) promote the formation of the 3'-5' oligomers. The results may be important for the understanding of the evolution of nucleic acid replication in the absence of enzymes.

  18. The effects of retinoic acid on immunoglobulin synthesis: Role of interleukin 6

    SciTech Connect

    Ballow, M.; Xiang, Shunan; Wang, Weiping; Brodsky, L. |

    1996-05-01

    Retinoic acid (RA) and its parent compound, retinol (ROH, vitamin A), have been recognized as important immunopotentiating agents. Previous studies from our laboratory have demonstrated that PA can augment formalin-treated Staphylococcus aureus (SAC) stimulated immunoglobulin (Ig) synthesis of cord blood mononuclear cells (CBMC). To determine the mechanism(s) by which RA modulates Ig synthesis, we studied the effects of RA on B cells and cytokine production. The addition of RA (10{sup -5} to 10{sup -10} M) to Epstein-Barr virus (EBV)-transformed B-cell clones derived from either adult or cord blood B cells augmented Ig secretion twofold. In contrast, cell proliferation was inhibited as measured by {sup 3}H-thymidine incorporation. We evaluated two cytokines known to be constitutively produced by EBV cell lines, IL-1 and IL-6. While RA had no effect on IL-1 production, IL-6 synthesis was greatly enhanced (20- to 45-fold), which was also reflected by an increase in steady-state mRNA levels for IL-6 but not TNF-{alpha} or TGF-{beta} on Northern blot analysis. Polyclonal rabbit anti-IL-6 antibodies were used to block the augmenting effects of RA on Ig synthesis of adenoidal B cells. RA-induced augmentation in IgG and IgA synthesis was blocked 58 and 29%, respectively, by anti-IL-6 antibodies. These studies suggest that the enhancing effects of RA on Ig synthesis are mediated, at least in part, by the autocrine or paracrine effects of IL-6 on B-cell differentiation. 37 refs., 5 figs.

  19. Synthesis of tricyclic indole-2-carboxylic [correction of caboxylic] acids as potent NMDA-glycine antagonists.

    PubMed

    Katayama, S; Ae, N; Nagata, R

    2001-05-18

    The practical synthesis of a series of tricyclic indole-2-carboxylic acids, 7-chloro-3-arylaminocarbonylmethyl-1,3,4,5-tetrahydrobenz[cd]indole-2-carboxylic acids, as a new class of potent NMDA-glycine antagonists is described. The synthetic route to the key intermediate 12a comprises a regioselective iodination of 4-chloro-2-nitrotoluene, modified Reissert indole synthesis, Jeffery's Heck-type reaction with allyl alcohol, Wittig-Horner-Emmons reaction, and iodination at the indole C-3 position. The key step in the route is an intramolecular cyclization of 12a to give the tricyclic indole structure. Two methods of cyclization, (1) an intramolecular radical cyclization of 12a and (2) a sequence of intramolecular Heck reaction of 12a followed by a 1,4-reduction, were performed. The resulting tricyclic indole diester 13a was selectively hydrolyzed to afford the desired tricyclic indole monocarboxylic acid 16 on a multihundred gram scale without any chromatographic purifications. Optical resolution of 16 to (-)-isomer 17 and (+)-isomer 18 was carried out, and the resulting isomers were derivatized, respectively. Evaluation of the optically active derivatives for affinity to the NMDA-glycine binding site using the radio ligand binding assay with [(3)H]-5,7-dichlorokynurenic acid revealed that the derivatives of (-)-isomer 17 were more potent than the others and that especially substituted anilide (-)-isomer 24 (K(i) = 0.8 nM) showed high affinity.

  20. Downregulation of de Novo Fatty Acid Synthesis in Subcutaneous Adipose Tissue of Moderately Obese Women.

    PubMed

    Guiu-Jurado, Esther; Auguet, Teresa; Berlanga, Alba; Aragonès, Gemma; Aguilar, Carmen; Sabench, Fàtima; Armengol, Sandra; Porras, José Antonio; Martí, Andreu; Jorba, Rosa; Hernández, Mercè; del Castillo, Daniel; Richart, Cristóbal

    2015-12-16

    The purpose of this work was to evaluate the expression of fatty acid metabolism-related genes in human adipose tissue from moderately obese women. We used qRT-PCR and Western Blot to analyze visceral (VAT) and subcutaneous (SAT) adipose tissue mRNA expression involved in de novo fatty acid synthesis (ACC1, FAS), fatty acid oxidation (PPARα, PPARδ) and inflammation (IL6, TNFα), in normal weight control women (BMI < 25 kg/m², n = 35) and moderately obese women (BMI 30-38 kg/m², n = 55). In SAT, ACC1, FAS and PPARα mRNA expression were significantly decreased in moderately obese women compared to controls. The downregulation reported in SAT was more pronounced when BMI increased. In VAT, lipogenic-related genes and PPARα were similar in both groups. Only PPARδ gene expression was significantly increased in moderately obese women. As far as inflammation is concerned, TNFα and IL6 were significantly increased in moderate obesity in both tissues. Our results indicate that there is a progressive downregulation in lipogenesis in SAT as BMI increases, which suggests that SAT decreases the synthesis of fatty acid de novo during the development of obesity, whereas in VAT lipogenesis remains active regardless of the degree of obesity.

  1. Steroselective synthesis and application of L-( sup 15 N) amino acids

    SciTech Connect

    Unkefer, C.J. ); Lodwig, S.N. . Div. of Science)

    1991-01-01

    We have developed two general approaches to the stereoselective synthesis of {sup 15}N- and {sup 13}C-labeled amino acids. First, labeled serine, biosynthesized using the methylotrophic bacterium M. extorquens AM1, serves as a chiral precursor for the synthesis of other amino acids. For example, pyridoxal phosphate enzymes can be used for the conversion of L-({alpha}-{sup 15}N)serine to L-({alpha}-{sup 15}N)tyrosine, L-({alpha}-{sup 15}N)tryptophan, and L-({alpha}-{sup 15}N)cysteine. In the second approach, developed by Oppolzer and Tamura, an electrophilic amination'' reagent, 1-chloro-1-nitrosocyclohexane, was used to convert chiral enolates into L-{alpha}-amino acids. We prepared 1-chloro-1-({sup 15}N) nitrosocyclohexane and used it to aminate chiral enolates to produce L-({alpha}-{sup 15}N)amino acids. The stereoselectivity of this scheme using the Oppolzer sultam chiral auxiliary is remarkable, producing enantiomer ratios of 200 to 1. 22 refs., 4 figs.

  2. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper

    PubMed Central

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo

    2016-01-01

    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  3. Synthesis of fluorescent D-amino acids (FDAAs) and their use for probing peptidoglycan synthesis and bacterial growth in situ

    PubMed Central

    Kuru, Erkin; Tekkam, Srinivas; Hall, Edward

    2015-01-01

    Fluorescent D-amino acids (FDAAs) are efficiently incorporated into the peptidoglycan of diverse bacterial species at the sites of active peptidoglycan biosynthesis, allowing specific and covalent probing of bacterial growth with minimal perturbation. Here, we provide a protocol for the synthesis of four FDAAs emitting light in blue, green or red and for their use in peptidoglycan labeling of live bacteria. Our modular synthesis protocol gives easy access to a library of different FDAAs made with commercially available fluorophores. FDAAs can be synthesized in a typical chemistry laboratory in 2–3 days. The simple labeling procedure involves addition of the FDAAs to the bacterial sample for the desired labeling duration and stopping further label incorporation by fixation or by washing away excess dye. We discuss several scenarios for the use of these labels including short or long labeling durations, and the combination of different labels in pure culture or complex environmental samples. Depending on the experiment, FDAA labeling can take as little as 30 s for a rapidly growing species such as Escherichia coli. PMID:25474031

  4. Thyroid hormone activation of retinoic acid synthesis in hypothalamic tanycytes

    PubMed Central

    Stoney, Patrick N.; Helfer, Gisela; Rodrigues, Diana; Morgan, Peter J.

    2015-01-01

    Thyroid hormone (TH) is essential for adult brain function and its actions include several key roles in the hypothalamus. Although TH controls gene expression via specific TH receptors of the nuclear receptor class, surprisingly few genes have been demonstrated to be directly regulated by TH in the hypothalamus, or the adult brain as a whole. This study explored the rapid induction by TH of retinaldehyde dehydrogenase 1 (Raldh1), encoding a retinoic acid (RA)‐synthesizing enzyme, as a gene specifically expressed in hypothalamic tanycytes, cells that mediate a number of actions of TH in the hypothalamus. The resulting increase in RA may then regulate gene expression via the RA receptors, also of the nuclear receptor class. In vivo exposure of the rat to TH led to a significant and rapid increase in hypothalamic Raldh1 within 4 hours. That this may lead to an in vivo increase in RA is suggested by the later induction by TH of the RA‐responsive gene Cyp26b1. To explore the actions of RA in the hypothalamus as a potential mediator of TH control of gene regulation, an ex vivo hypothalamic rat slice culture method was developed in which the Raldh1‐expressing tanycytes were maintained. These slice cultures confirmed that TH did not act on genes regulating energy balance but could induce Raldh1. RA has the potential to upregulate expression of genes involved in growth and appetite, Ghrh and Agrp. This regulation is acutely sensitive to epigenetic changes, as has been shown for TH action in vivo. These results indicate that sequential triggering of two nuclear receptor signalling systems has the capability to mediate some of the functions of TH in the hypothalamus. GLIA 2016;64:425–439 PMID:26527258

  5. Synthesis and anticancer activity of novel fluorinated asiatic acid derivatives.

    PubMed

    Gonçalves, Bruno M F; Salvador, Jorge A R; Marín, Silvia; Cascante, Marta

    2016-05-23

    A series of novel fluorinated Asiatic Acid (AA) derivatives were successfully synthesized, tested for their antiproliferative activity against HeLa and HT-29 cell lines, and their structure activity relationships were evaluated. The great majority of fluorinated derivatives showed stronger antiproliferative activity than AA in a concentration dependent manner. The most active compounds have a pentameric A-ring containing an α,β-unsaturated carbonyl group. The compounds with better cytotoxic activity were then evaluated against MCF-7, Jurkat, PC-3, A375, MIA PaCa-2 and BJ cell lines. Derivative 14 proved to be the most active compound among all tested derivatives and its mechanism of action was further investigated in HeLa cell line. The results showed that compound 14 induced cell cycle arrest in G0/G1 stage as a consequence of up-regulation of p21(cip1/waf1) and p27(kip1) and down-regulation of cyclin D3 and Cyclin E. Furthermore, compound 14 was found to induce caspase driven-apoptosis with activation of caspases-8 and caspase-3 and the cleavage of PARP. The cleavage of Bid into t-Bid, the up-regulation of Bax and the down-regulation of Bcl-2 were also observed after treatment of HeLa cells with compound 14. Taken together, these mechanistic studies revealed the involvement of extrinsic and intrinsic pathways in the apoptotic process induced by compound 14. Importantly, the antiproliferative activity of this compound on the non-tumor BJ human fibroblast cell line is weaker than in the tested cancer cell lines. The enhanced potency (between 45 and 90-fold more active than AA in a panel of cancer cell lines) and selectivity of this new AA derivative warrant further preclinical evaluation.

  6. Engineering fungal de novo fatty acid synthesis for short chain fatty acid production

    PubMed Central

    Gajewski, Jan; Pavlovic, Renata; Fischer, Manuel; Boles, Eckhard; Grininger, Martin

    2017-01-01

    Fatty acids (FAs) are considered strategically important platform compounds that can be accessed by sustainable microbial approaches. Here we report the reprogramming of chain-length control of Saccharomyces cerevisiae fatty acid synthase (FAS). Aiming for short-chain FAs (SCFAs) producing baker's yeast, we perform a highly rational and minimally invasive protein engineering approach that leaves the molecular mechanisms of FASs unchanged. Finally, we identify five mutations that can turn baker's yeast into a SCFA producing system. Without any further pathway engineering, we achieve yields in extracellular concentrations of SCFAs, mainly hexanoic acid (C6-FA) and octanoic acid (C8-FA), of 464 mg l−1 in total. Furthermore, we succeed in the specific production of C6- or C8-FA in extracellular concentrations of 72 and 245 mg l−1, respectively. The presented technology is applicable far beyond baker's yeast, and can be plugged into essentially all currently available FA overproducing microorganisms. PMID:28281527

  7. Direct synthesis of formic acid from carbon dioxide by hydrogenation in acidic media

    PubMed Central

    Moret, Séverine; Dyson, Paul J.; Laurenczy, Gábor

    2014-01-01

    The chemical transformation of carbon dioxide into useful products becomes increasingly important as CO2 levels in the atmosphere continue to rise as a consequence of human activities. In this article we describe the direct hydrogenation of CO2 into formic acid using a homogeneous ruthenium catalyst, in aqueous solution and in dimethyl sulphoxide (DMSO), without any additives. In water, at 40 °C, 0.2 M formic acid can be obtained under 200 bar, however, in DMSO the same catalyst affords 1.9 M formic acid. In both solvents the catalysts can be reused multiple times without a decrease in activity. Worldwide demand for formic acid continues to grow, especially in the context of a renewable energy hydrogen carrier, and its production from CO2 without base, via the direct catalytic carbon dioxide hydrogenation, is considerably more sustainable than the existing routes. PMID:24886955

  8. Relative Reaction Rates of Sulfamic Acid and Hydroxylamine with Nitric Acid

    SciTech Connect

    Karraker, D.G.

    2001-03-28

    This report describes a study of comparative reaction rates where the reductant is in excess, as in the 1B bank in the Purex process. The results of this work apply to planned plant tests to partially substitute HAN for the ferrous sulfamate reductant in the Purex 1B bank.

  9. Effect of nitric acid concentrations on synthesis and stability of maghemite nanoparticles suspension.

    PubMed

    Nurdin, Irwan; Johan, Mohd Rafie; Yaacob, Iskandar Idris; Ang, Bee Chin

    2014-01-01

    Maghemite (γ-Fe2O3) nanoparticles have been synthesized using a chemical coprecipitation method at different nitric acid concentrations as an oxidizing agent. Characterization of all samples performed by several techniques including X-ray diffraction (XRD), transmission electron microscopy (TEM), alternating gradient magnetometry (AGM), thermogravimetric analysis (TGA), dynamic light scattering (DLS), and zeta potential. The XRD patterns confirmed that the particles were maghemite. The crystallite size of all samples decreases with the increasing concentration of nitric acid. TEM observation showed that the particles have spherical morphology with narrow particle size distribution. The particles showed superparamagnetic behavior with decreased magnetization values at the increasing concentration of nitric acid. TGA measurement showed that the stability temperature decreases with the increasing concentration of nitric acid. DLS measurement showed that the hydrodynamic particle sizes decrease with the increasing concentration of nitric acid. Zeta potential values show a decrease with the increasing concentration of nitric acid. The increasing concentration of nitric acid in synthesis of maghemite nanoparticles produced smaller size particles, lower magnetization, better thermal stability, and more stable maghemite nanoparticles suspension.

  10. Chemical synthesis and biological evaluation of ω-hydroxy polyunsaturated fatty acids.

    PubMed

    Hwang, Sung Hee; Wagner, Karen; Xu, Jian; Yang, Jun; Li, Xichun; Cao, Zhengyu; Morisseau, Christophe; Lee, Kin Sing Stephen; Hammock, Bruce D

    2017-02-01

    ω-Hydroxy polyunsaturated fatty acids (PUFAs), natural metabolites from arachidonic acid (ARA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) were prepared via convergent synthesis approach using two key steps: Cu-mediated CC bond formation to construct methylene skipped poly-ynes and a partial alkyne hydrogenation where the presence of excess 2-methyl-2-butene as an additive that is proven to be critical for the success of partial reduction of the poly-ynes to the corresponding cis-alkenes without over-hydrogenation. The potential biological function of ω-hydroxy PUFAs in pain was evaluated in naive rats. Following intraplantar injection, 20-hydroxyeicosatetraenoic acid (20-HETE, ω-hydroxy ARA) generated an acute decrease in paw withdrawal thresholds in a mechanical nociceptive assay indicating pain, but no change was observed from rats which received either 20-hydroxyeicosapentaenoic acid (20-HEPE, ω-hydroxy EPA) or 22-hydroxydocosahexaenoic acid (22-HDoHE, ω-hydroxy DHA). We also found that both 20-HEPE and 22-HDoHE are more potent than 20-HETE to activate murine transient receptor potential vanilloid receptor1 (mTRPV1).

  11. Induction of human choriogonadotropin in HeLa-cell cultures by aliphatic monocarboxylates and inhibitors of deoxyribonucleic acid synthesis

    PubMed Central

    Ghosh, Nimai K.; Rukenstein, Adriana; Cox, Rody P.

    1977-01-01

    The ectopic production of the glycopeptide hormone human placental choriogonadotropin by HeLa65 cells was measured by radioimmunoassay with antiserum against the β-subunit of choriogonadotropin and with the 125I-labelled β-subunit as a tracer antigen. Choriogonadotropin synthesis was markedly (500-fold) stimulated by sodium butyrate. Kinetic studies and the use of an inhibitor of protein synthesis, cycloheximide, indicated that protein synthesis was required for this induction. Investigation of the efficiency of 22 aliphatic short-chain fatty acids and derivatives in causing increased choriogonadotropin synthesis by HeLa cells showed stringent structural requirements. Induction of choriogonadotropin synthesis in HeLa cells was not restricted to butyrate. Other aliphatic acids (propionate, isobutyrate, valerate and hexanoate) were also capable of inducing choriogonadotropin synthesis at 10–50% of the efficiency of butyrate. Hydroxy derivatives of monocarboxylate inducers, related mono- and di-carboxylic acids, alcohols, amines, ketones, esters and sulphoxide were ineffective in increasing choriogonadotropin production by HeLa cells. A saturated C4 straight-chain acid without substituent hydroxyl groups but with a methyl group at one end and a carboxyl moiety at the other appeared to be most efficient in activating choriogonadotropin production. A second clonal line of HeLa cells, HeLa71, showed a higher constitutive synthesis of choriogonadotropin than HeLa65 cells, which was also markedly increased by butyrate. Butyrate and other aliphatic monocarboxylate inducers of choriogonadotropin synthesis inhibited HeLa-cell growth and DNA synthesis. This inhibition of DNA replication may be related to the mechanism of choriogonadotropin synthesis, since two well-characterized anti-neoplastic inhibitors of DNA synthesis, hydroxyurea and 1-β-d-arabinofuranosylcytosine, also stimulated a 300-fold increase in choriogonadotropin synthesis in HeLa cells and were synergistic

  12. Synthesis and structural characterisation of amides from picolinic acid and pyridine-2,6-dicarboxylic acid

    PubMed Central

    Devi, Prarthana; Barry, Sarah M.; Houlihan, Kate M.; Murphy, Michael J.; Turner, Peter; Jensen, Paul; Rutledge, Peter J.

    2015-01-01

    Coupling picolinic acid (pyridine-2-carboxylic acid) and pyridine-2,6-dicarboxylic acid with N-alkylanilines affords a range of mono- and bis-amides in good to moderate yields. These amides are of interest for potential applications in catalysis, coordination chemistry and molecular devices. The reaction of picolinic acid with thionyl chloride to generate the acid chloride in situ leads not only to the N-alkyl-N-phenylpicolinamides as expected but also the corresponding 4-chloro-N-alkyl-N-phenylpicolinamides in the one pot. The two products are readily separated by column chromatography. Chlorinated products are not observed from the corresponding reactions of pyridine-2,6-dicarboxylic acid. X-Ray crystal structures for six of these compounds are described. These structures reveal a general preference for cis amide geometry in which the aromatic groups (N-phenyl and pyridyl) are cis to each other and the pyridine nitrogen anti to the carbonyl oxygen. Variable temperature 1H NMR experiments provide a window on amide bond isomerisation in solution. PMID:25954918

  13. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance.

    PubMed

    Kovács, Viktória; Gondor, Orsolya K; Szalai, Gabriella; Darkó, Eva; Majláth, Imre; Janda, Tibor; Pál, Magda

    2014-09-15

    Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress.

  14. Synthesis and anticoagulant activity of bioisosteric sulfonic-Acid analogues of the antithrombin-binding pentasaccharide domain of heparin.

    PubMed

    Herczeg, Mihály; Lázár, László; Bereczky, Zsuzsanna; Kövér, Katalin E; Timári, István; Kappelmayer, János; Lipták, András; Antus, Sándor; Borbás, Anikó

    2012-08-20

    Two pentasaccharide sulfonic acids that were related to the antithrombin-binding domain of heparin were prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic-acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic-acid esters were found to be excellent donors and acceptors in the glycosylation reactions. Throughout the synthesis, the hydroxy groups to be methylated were masked in the form of acetates and the hydroxy groups to be sulfated were masked with benzyl groups. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of these new sulfonic-acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic-acid moiety resulted in a notable decrease in the anti-Xa activity. The difference in the biological activity of the disulfonic- and trisulfonic-acid counterparts could be explained by the different conformation of their L-iduronic-acid residues.

  15. Investigation of phospholipid synthesis and the disposition of amino acid and carbohydrate

    SciTech Connect

    Boehme, D.S.

    1986-01-01

    The synthesis of pulmonary phospholipids by offspring of diabetic female rats was assessed by means of high performance liquid chromatography combined with automated phosphate analysis. No changes in the pool sizes of the major phospholipids or their precursors were observed. However, offspring of both insulin-treated and untreated diabetic mothers displayed increased pulmonary lyso-phosphatidylcholine. The concentration of glycerylphosphorylcholine, the metabolic product of lyso-phosphatidylcholine, was also increased in these offspring, providing further evidence of a reduced reacylation pathway in the offspring of diabetic mothers. The concentration of phosphatidylglycerol was reduced in the lungs from offspring of diabetic mothers. Preliminary investigation suggested that the mechanism of insulin action on lungs from offspring of diabetic rats may be the diversion of substrate from lipid synthetic pathways into protein synthesis. The utilization of (14C)-labeled amino acids and carbohydrates by normal fetal rat lung, however, revealed no direct insulin effect on protein synthesis. The ability of the fetal lung to convert amino acids into Krebs Cycle intermediates was demonstrated.

  16. Synthesis of goethite in solutions of artificial seawater and amino acids: a prebiotic chemistry study

    NASA Astrophysics Data System (ADS)

    Carneiro, Cristine E. A.; Ivashita, Flávio F.; de Souza, Ivan Granemann; de Souza, Cláudio M. D.; Paesano, Andrea; da Costa, Antonio C. S.; di Mauro, Eduardo; de Santana, Henrique; Zaia, Cássia T. B. V.; Zaia, Dimas A. M.

    2013-04-01

    This study investigated the synthesis of goethite under conditions resembling those of the prebiotic Earth. The artificial seawater used contains all the major elements as well as amino acids (α-Ala, β-Ala, Gly, Cys, AIB) that could be found on the prebiotic Earth. The spectroscopic methods (FT-IR, EPR, Raman), scanning electron microscopy (SEM) and X-ray diffraction showed that in any condition Gly and Cys favoured the formation of goethite, artificial seawater plus β-Ala and distilled water plus AIB favoured the formation of hematite and for the other synthesis a mixture of goethite and hematite were obtained. Thus in general no protein amino acids (β-Ala, AIB) favoured the formation of hematite. As shown by surface enhanced Raman spectroscopy (SERS) spectra the interaction between Cys and Fe3+ of goethite is very complex, involving decomposition of Cys producing sulphur, as well as interaction of carboxylic group with Fe3+. SERS spectra also showed that amino/CN and C-CH3 groups of α-Ala are interacting with Fe3+ of goethite. For the other samples the shifting of several bands was observed. However, it was not possible to say which amino acid groups are interacting with Fe3+. The pH at point of zero charge of goethites increased with artificial seawater and decreased with amino acids. SEM images showed when only goethite was synthesized the images of the samples were acicular and when only hematite was synthesized the images of the samples were spherical. SEM images for the synthesis of goethite with Cys were spherical crystal aggregates with radiating acicular crystals. The highest resonance line intensities were obtained for the samples where only hematite was obtained. Electron paramagnetic resonance (EPR) and Mössbauer spectra showed for the synthesis of goethite with artificial seawater an isomorphic substitution of iron by seawater cations. Mössbauer spectra also showed that for the synthesis goethite in distilled water plus Gly only goethite was

  17. A strategy for the solution-phase parallel synthesis of N-(pyrrolidinylmethyl)hydroxamic acids.

    PubMed

    Takayanagi, M; Flessner, T; Wong, C H

    2000-06-16

    Both five- and six-membered iminocyclitols have proven to be useful transition-state analogue inhibitors of glycosidases. They also mimic the transition-state sugar moiety of the nucleoside phosphate sugar in glycosyltransferase-catalyzed reactions. Described here is the development of a general strategy toward the parallel synthesis of a five-membered iminocyclitol linked to a hydroxamic acid group designed to mimic the transition state of GDP-fucose complexed with Mn(II) in fucosyltransferase reactions. The iminocyclitol 8 containing a protected hydroxylamine unit was prepared from D-mannitol. The hydroxamic acid moiety was introduced via the reaction of 8 with various acid chlorides. The strategy is generally applicable to the construction of libraries for identification of glycosyltransferase inhibitors.

  18. Facile synthesis of PtAu alloy nanoparticles with high activity for formic acid oxidation

    SciTech Connect

    Zhang, Sheng; Shao, Yuyan; Yin, Geping; Lin, Yuehe

    2010-02-15

    We report the facile synthesis of carbon supported PtAu alloy nanoparticles with high electrocatalytic activity as the anode catalyst for direct formic acid fuel cells (DFAFCs). PtAu alloy nanopaticles are synthesized by co-reducing HAuCl4 and H2PtCl6 with NaBH4 in the presence of sodium citrate and then the nanoparticles are deposited on Vulcan XC-72R carbon support (PtAu/C). The obtained catalysts are characterized with X-ray diffraction (XRD) and transmission electron microscope (TEM), which reveal PtAu alloy formation with an average diameter of 4.6 nm. PtAu/C exhibits 8 times higher catalytic activity toward formic acid oxidation than Pt/C. The enhanced activity of PtAu/C catalyst is attributed to noncontinuous Pt sites formed in the presence of the neighbored Au sites, which promotes direct oxidation of formic acid by avoiding poison CO.

  19. A plausible simultaneous synthesis of amino acids and simple peptides on the primordial Earth.

    PubMed

    Parker, Eric T; Zhou, Manshui; Burton, Aaron S; Glavin, Daniel P; Dworkin, Jason P; Krishnamurthy, Ramanarayanan; Fernández, Facundo M; Bada, Jeffrey L

    2014-07-28

    Following his seminal work in 1953, Stanley Miller conducted an experiment in 1958 to study the polymerization of amino acids under simulated early Earth conditions. In the experiment, Miller sparked a gas mixture of CH4, NH3, and H2O, while intermittently adding the plausible prebiotic condensing reagent cyanamide. For unknown reasons, an analysis of the samples was not reported. We analyzed the archived samples for amino acids, dipeptides, and diketopiperazines by liquid chromatography, ion mobility spectrometry, and mass spectrometry. A dozen amino acids, 10 glycine-containing dipeptides, and 3 glycine-containing diketopiperazines were detected. Miller's experiment was repeated and similar polymerization products were observed. Aqueous heating experiments indicate that Strecker synthesis intermediates play a key role in facilitating polymerization. These results highlight the potential importance of condensing reagents in generating diversity within the prebiotic chemical inventory.

  20. Phenylalanine ammonia lyase catalyzed synthesis of amino acids by an MIO-cofactor independent pathway.

    PubMed

    Lovelock, Sarah L; Lloyd, Richard C; Turner, Nicholas J

    2014-04-25

    Phenylalanine ammonia lyases (PALs) belong to a family of 4-methylideneimidazole-5-one (MIO) cofactor dependent enzymes which are responsible for the conversion of L-phenylalanine into trans-cinnamic acid in eukaryotic and prokaryotic organisms. Under conditions of high ammonia concentration, this deamination reaction is reversible and hence there is considerable interest in the development of PALs as biocatalysts for the enantioselective synthesis of non-natural amino acids. Herein the discovery of a previously unobserved competing MIO-independent reaction pathway, which proceeds in a non-stereoselective manner and results in the generation of both L- and D-phenylalanine derivatives, is described. The mechanism of the MIO-independent pathway is explored through isotopic-labeling studies and mutagenesis of key active-site residues. The results obtained are consistent with amino acid deamination occurring by a stepwise E1 cB elimination mechanism.