Science.gov

Sample records for acid transport mechanisms

  1. Alternate mechanism for amino acid entry into Neurospora crassa: extracellular deamination and subsequent keto acid transport.

    PubMed Central

    DeBusk, R M; Brown, D T; DeBusk, A G; Penderghast, R D

    1981-01-01

    The growth of the pm nbg mutant strain of Neurospora crassa was inhibited by the amino acid analog para-fluorophenylalanine despite the fact that none of the three constitutive amino acid permeases is functional in this strain. This observation led to the detection of both a deaminase which was released into the growth medium in response to para-fluorophenylalanine and a keto acid transport system which allowed entry of the resulting keto acid into the cell. The transported keto acid was recovered in cellular protein, suggesting its regeneration as the amino acid. The cooperative activity of these two systems represents an additional mechanism for the intracellular accumulation of amino acids, which is distinct from the known amino acid permeases. Images PMID:6452443

  2. Unraveling fatty acid transport and activation mechanisms in Yarrowia lipolytica.

    PubMed

    Dulermo, Rémi; Gamboa-Meléndez, Heber; Ledesma-Amaro, Rodrigo; Thévenieau, France; Nicaud, Jean-Marc

    2015-09-01

    Fatty acid (FA) transport and activation have been extensively studied in the model yeast species Saccharomyces cerevisiae but have rarely been examined in oleaginous yeasts, such as Yarrowia lipolytica. Because the latter begins to be used in biodiesel production, understanding its FA transport and activation mechanisms is essential. We found that Y. lipolytica has FA transport and activation proteins similar to those of S. cerevisiae (Faa1p, Pxa1p, Pxa2p, Ant1p) but mechanism of FA peroxisomal transport and activation differs greatly with that of S. cerevisiae. While the ScPxa1p/ScPxa2p heterodimer is essential for growth on long-chain FAs, ΔYlpxa1 ΔYlpxa2 is not impaired for growth on FAs. Meanwhile, ScAnt1p and YlAnt1p are both essential for yeast growth on medium-chain FAs, suggesting they function similarly. Interestingly, we found that the ΔYlpxa1 ΔYlpxa2 ΔYlant1 mutant was unable to grow on short-, medium-, or long-chain FAs, suggesting that YlPxa1p, YlPxa2p, and YlAnt1p belong to two different FA degradation pathways. We also found that YlFaa1p is involved in FA storage in lipid bodies and that FA remobilization largely depended on YlFat1p, YlPxa1p and YlPxa2p. This study is the first to comprehensively examine FA intracellular transport and activation in oleaginous yeast. PMID:25887939

  3. Structural insights into thyroid hormone transport mechanisms of the L-type amino acid transporter 2.

    PubMed

    Hinz, Katrin M; Meyer, Katja; Kinne, Anita; Schülein, Ralf; Köhrle, Josef; Krause, Gerd

    2015-06-01

    Thyroid hormones (THs) are transported across cell membranes by different transmembrane transporter proteins. In previous studies, we showed marked 3,3'-diiodothyronine (3,3'-T2) but moderate T3 uptake by the L-type amino acid transporter 2 (Lat2). We have now studied the structure-function relationships of this transporter and TH-like molecules. Our Lat2 homology model is based on 2 crystal structures of the homologous 12-transmembrane helix transporters arginine/agmatine antiporter and amino acid/polyamine/organocation transporter. Model-driven mutagenesis of residues lining an extracellular recognition site and a TH-traversing channel identified 9 sensitive residues. Using Xenopus laevis oocytes as expression system, we found that side chain shortening (N51S, N133S, N248S, and Y130A) expanded the channel and increased 3,3'-T2 transport. Side chain enlargements (T140F, Y130R, and I137M) decreased 3,3'-T2 uptake, indicating channel obstructions. The opposite results with mutations maintaining (F242W) or impairing (F242V) uptake suggest that F242 may have a gating function. Competitive inhibition studies of 14 TH-like compounds revealed that recognition by Lat2 requires amino and carboxylic acid groups. The size of the adjacent hydrophobic group is restricted. Bulky substituents in positions 3 and 5 of the tyrosine ring are allowed. The phenolic ring may be enlarged, provided that the whole molecule is flexible enough to fit into the distinctly shaped TH-traversing channel of Lat2. Taken together, the next Lat2 features were identified 1) TH recognition site; 2) TH-traversing channel in the center of Lat2; and 3) switch site that potentially facilitates intracellular substrate release. Together with identified substrate features, these data help to elucidate the molecular mechanisms and role of Lat2 in T2 transport. PMID:25945809

  4. Integration of computational modeling with membrane transport studies reveals new insights into amino acid exchange transport mechanisms

    PubMed Central

    Widdows, Kate L.; Panitchob, Nuttanont; Crocker, Ian P.; Please, Colin P.; Hanson, Mark A.; Sibley, Colin P.; Johnstone, Edward D.; Sengers, Bram G.; Lewis, Rohan M.; Glazier, Jocelyn D.

    2015-01-01

    Uptake of system L amino acid substrates into isolated placental plasma membrane vesicles in the absence of opposing side amino acid (zero-trans uptake) is incompatible with the concept of obligatory exchange, where influx of amino acid is coupled to efflux. We therefore hypothesized that system L amino acid exchange transporters are not fully obligatory and/or that amino acids are initially present inside the vesicles. To address this, we combined computational modeling with vesicle transport assays and transporter localization studies to investigate the mechanisms mediating [14C]l-serine (a system L substrate) transport into human placental microvillous plasma membrane (MVM) vesicles. The carrier model provided a quantitative framework to test the 2 hypotheses that l-serine transport occurs by either obligate exchange or nonobligate exchange coupled with facilitated transport (mixed transport model). The computational model could only account for experimental [14C]l-serine uptake data when the transporter was not exclusively in exchange mode, best described by the mixed transport model. MVM vesicle isolates contained endogenous amino acids allowing for potential contribution to zero-trans uptake. Both L-type amino acid transporter (LAT)1 and LAT2 subtypes of system L were distributed to MVM, with l-serine transport attributed to LAT2. These findings suggest that exchange transporters do not function exclusively as obligate exchangers.—Widdows, K. L., Panitchob, N., Crocker, I. P., Please, C. P., Hanson, M. A., Sibley, C. P., Johnstone, E. D., Sengers, B. G., Lewis, R. M., Glazier, J. D. Integration of computational modeling with membrane transport studies reveals new insights into amino acid exchange transport mechanisms. PMID:25761365

  5. Structural basis of the alternating-access mechanism in a bile acid transporter

    NASA Astrophysics Data System (ADS)

    Zhou, Xiaoming; Levin, Elena J.; Pan, Yaping; McCoy, Jason G.; Sharma, Ruchika; Kloss, Brian; Bruni, Renato; Quick, Matthias; Zhou, Ming

    2014-01-01

    Bile acids are synthesized from cholesterol in hepatocytes and secreted through the biliary tract into the small intestine, where they aid in absorption of lipids and fat-soluble vitamins. Through a process known as enterohepatic recirculation, more than 90% of secreted bile acids are then retrieved from the intestine and returned to the liver for resecretion. In humans, there are two Na+-dependent bile acid transporters involved in enterohepatic recirculation, the Na+-taurocholate co-transporting polypeptide (NTCP; also known as SLC10A1) expressed in hepatocytes, and the apical sodium-dependent bile acid transporter (ASBT; also known as SLC10A2) expressed on enterocytes in the terminal ileum. In recent years, ASBT has attracted much interest as a potential drug target for treatment of hypercholesterolaemia, because inhibition of ASBT reduces reabsorption of bile acids, thus increasing bile acid synthesis and consequently cholesterol consumption. However, a lack of three-dimensional structures of bile acid transporters hampers our ability to understand the molecular mechanisms of substrate selectivity and transport, and to interpret the wealth of existing functional data. The crystal structure of an ASBT homologue from Neisseria meningitidis (ASBTNM) in detergent was reported recently, showing the protein in an inward-open conformation bound to two Na+ and a taurocholic acid. However, the structural changes that bring bile acid and Na+ across the membrane are difficult to infer from a single structure. To understand the structural changes associated with the coupled transport of Na+ and bile acids, here we solved two structures of an ASBT homologue from Yersinia frederiksenii (ASBTYf) in a lipid environment, which reveal that a large rigid-body rotation of a substrate-binding domain gives the conserved `crossover' region, where two discontinuous helices cross each other, alternating accessibility from either side of the cell membrane. This result has implications

  6. Substrate specificity and transport mechanism of amino-acid transceptor Slimfast from Aedes aegypti.

    PubMed

    Boudko, Dmitri Y; Tsujimoto, Hitoshi; Rodriguez, Stacy D; Meleshkevitch, Ella A; Price, David P; Drake, Lisa L; Hansen, Immo A

    2015-01-01

    Anautogenous mosquitoes depend on vertebrate blood as nutrient source for their eggs. A highly efficient set of membrane transporters mediates the massive movement of nutrient amino acids between mosquito tissues after a blood meal. Here we report the characterization of the amino-acid transporter Slimfast (Slif) from the yellow-fever mosquito Aedes aegypti using codon-optimized heterologous expression. Slif is a well-known component of the target-of-rapamycin signalling pathway and fat body nutrient sensor, but its substrate specificity and transport mechanism were unknown. We found that Slif transports essential cationic and neutral amino acids with preference for arginine. It has an unusual dual-affinity mechanism with only the high affinity being Na(+) dependent. Tissue-specific expression and blood meal-dependent regulation of Slif are consistent with conveyance of essential amino acids from gut to fat body. Slif represents a novel transport system and type of transceptor for sensing and transporting essential amino acids during mosquito reproduction. PMID:26449545

  7. Substrate specificity and transport mechanism of amino-acid transceptor Slimfast from Aedes aegypti

    PubMed Central

    Boudko, Dmitri Y.; Tsujimoto, Hitoshi; Rodriguez, Stacy D.; Meleshkevitch, Ella A.; Price, David P.; Drake, Lisa L.; Hansen, Immo A.

    2015-01-01

    Anautogenous mosquitoes depend on vertebrate blood as nutrient source for their eggs. A highly efficient set of membrane transporters mediates the massive movement of nutrient amino acids between mosquito tissues after a blood meal. Here we report the characterization of the amino-acid transporter Slimfast (Slif) from the yellow-fever mosquito Aedes aegypti using codon-optimized heterologous expression. Slif is a well-known component of the target-of-rapamycin signalling pathway and fat body nutrient sensor, but its substrate specificity and transport mechanism were unknown. We found that Slif transports essential cationic and neutral amino acids with preference for arginine. It has an unusual dual-affinity mechanism with only the high affinity being Na+ dependent. Tissue-specific expression and blood meal-dependent regulation of Slif are consistent with conveyance of essential amino acids from gut to fat body. Slif represents a novel transport system and type of transceptor for sensing and transporting essential amino acids during mosquito reproduction. PMID:26449545

  8. Heteromeric amino acid transporters. In search of the molecular bases of transport cycle mechanisms.

    PubMed

    Palacín, Manuel; Errasti-Murugarren, Ekaitz; Rosell, Albert

    2016-06-15

    Heteromeric amino acid transporters (HATs) are relevant targets for structural studies. On the one hand, HATs are involved in inherited and acquired human pathologies. On the other hand, these molecules are the only known examples of solute transporters composed of two subunits (heavy and light) linked by a disulfide bridge. Unfortunately, structural knowledge of HATs is scarce and limited to the atomic structure of the ectodomain of a heavy subunit (human 4F2hc-ED) and distant prokaryotic homologues of the light subunits that share a LeuT-fold. Recent data on human 4F2hc/LAT2 at nanometer resolution revealed 4F2hc-ED positioned on top of the external loops of the light subunit LAT2. Improved resolution of the structure of HATs, combined with conformational studies, is essential to establish the structural bases for light subunit recognition and to evaluate the functional relevance of heavy and light subunit interactions for the amino acid transport cycle. PMID:27284037

  9. Mechanism of Linolenic Acid-induced Inhibition of Photosynthetic Electron Transport 12

    PubMed Central

    Golbeck, John H.; Martin, Iris F.; Fowler, Charles F.

    1980-01-01

    The effect of linolenic acid on photosynthetic electron transport reactions in chloroplasts has been localized at a site on the donor side of photosystem I and at two functionally distinct sites in photosystem II. In photosystem I, an increase in the electron transport rate occurs in the presence of 10 to 100 micromolar linolenic acid, followed by a decline in rate from 100 to 200 micromolar linolenic acid. The increase may result from an alteration of membrane structure that allows greater reactivity of the artificial donors 2,6-dichlorophenolindophenol (DPIP) and N,N,N′,N′-tetramethyl-p-phenylenediamine with plastocyanin. The decrease is due to loss of plastocyanin from the membrane since addition of purified plastocyanin to treated and washed chloroplasts leads to the reestablishment of photosystem I rates. In photosystem II, a reversible site and an irreversible site of inhibition have been located. At the irreversible site, there is a time-dependent loss of the loosely bound pool of Mn implicated in the water-splitting mechanism. At the reversible site, the photochemical charge separation is rapidly inhibited as evidenced by the high initial fluorescence yield upon illumination and the inhibition of artificial donor reactions in NH2OH-washed chloroplasts. When chloroplasts are washed after treatment with linolenic acid, the fluorescence returns to its original low value and there is a resumption of artificial donor activity from diphenylcarbazide → DPIP. This reversible inhibition of the photoact is a unique characteristic of linolenic acid and suggests evidence for a new mode of inhibition of photosystem II. PMID:16661266

  10. Bile acid transporters

    PubMed Central

    Dawson, Paul A.; Lan, Tian; Rao, Anuradha

    2009-01-01

    In liver and intestine, transporters play a critical role in maintaining the enterohepatic circulation and bile acid homeostasis. Over the past two decades, there has been significant progress toward identifying the individual membrane transporters and unraveling their complex regulation. In the liver, bile acids are efficiently transported across the sinusoidal membrane by the Na+ taurocholate cotransporting polypeptide with assistance by members of the organic anion transporting polypeptide family. The bile acids are then secreted in an ATP-dependent fashion across the canalicular membrane by the bile salt export pump. Following their movement with bile into the lumen of the small intestine, bile acids are almost quantitatively reclaimed in the ileum by the apical sodium-dependent bile acid transporter. The bile acids are shuttled across the enterocyte to the basolateral membrane and effluxed into the portal circulation by the recently indentified heteromeric organic solute transporter, OSTα-OSTβ. In addition to the hepatocyte and enterocyte, subgroups of these bile acid transporters are expressed by the biliary, renal, and colonic epithelium where they contribute to maintaining bile acid homeostasis and play important cytoprotective roles. This article will review our current understanding of the physiological role and regulation of these important carriers. PMID:19498215

  11. Hydroxyl/bile acid exchange. A new mechanism for the uphill transport of cholate by basolateral liver plasma membrane vesicles.

    PubMed

    Blitzer, B L; Terzakis, C; Scott, K A

    1986-09-15

    In order to characterize the driving forces for the concentrative uptake of unconjugated bile acids by the hepatocyte, the effects of pH gradients on the uptake of [3H]cholate by rat basolateral liver plasma membrane vesicles were studied. In the presence of an outwardly directed hydroxyl gradient (pH 6.0 outside and pH 7.5 inside the vesicle), cholate uptake was markedly stimulated and the bile acid was transiently accumulated at a concentration 1.5- to 2-fold higher than at equilibrium ("overshoot"). In the absence of a pH gradient (pH 6.0 or 7.5 both inside and outside the vesicle), uptake was relatively slower and no overshoot was seen. Reductions in the magnitude of the transmembrane pH gradient were associated with slower initial uptake rates and smaller overshoots. Cholate uptake under pH gradient conditions was inhibited by furosemide and bumetanide but not by 4, 4'-diisothiocyano-2,2'-disulfonic stilbene (SITS), 4-acetamido-4'-isothiocyanostilbene-2,2'-disulfonic acid (DIDS), or probenecid. In the absence of a pH gradient, an inside-positive valinomycin-induced K+ diffusion potential caused a slight increase in cholate uptake which was insensitive to furosemide. Moreover, in the presence of an outwardly directed hydroxyl gradient, uphill cholate transport was observed even under voltage clamped conditions. These findings suggest that pH gradient-driven cholate uptake was not due to associated electrical potentials. Despite an identical pKa to that of cholate, an outwardly directed hydroxyl gradient did not drive uphill transport of three other unconjugated bile acids (deoxycholate, chenodeoxycholate, ursodeoxycholate), suggesting that a non-ionic diffusion mechanism cannot account for uphill cholate transport. In canalicular vesicles, although cholate uptake was relatively faster in the presence of a pH gradient than in the absence of a gradient, peak uptake was only slightly above that found at equilibrium under voltage clamped conditions. These findings

  12. Eicosapentaenoic acid inhibits intestinal β-carotene absorption by downregulation of lipid transporter expression via PPAR-α dependent mechanism.

    PubMed

    Mashurabad, Purna Chandra; Kondaiah, Palsa; Palika, Ravindranadh; Ghosh, Sudip; Nair, Madhavan K; Raghu, Pullakhandam

    2016-01-15

    The involvement of lipid transporters, the scavenger receptor class B, type I (SR-BI) and Niemann-Pick type C1 Like 1 protein (NPC1L1) in carotenoid absorption is demonstrated in intestinal cells and animal models. Dietary ω-3 fatty acids are known to possess antilipidemic properties, which could be mediated by activation of PPAR family transcription factors. The present study was conducted to determine the effect of docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA), on intestinal β-carotene absorption. β-carotene uptake in Caco-2/TC7 cells was inhibited by EPA (p < 0.01) and PPARα agonist (P < 0.01), but not by DHA, PPARγ or PPARδ agonists. Despite unaltered β-carotene uptake, both DHA and PPARδ agonists inhibited the NPC1L1 expression. Further, EPA also induced the expression of carnitine palmitoyl transferase 1A (CPT1A) expression, a PPARα target gene. Interestingly, EPA induced inhibition of β-carotene uptake and SR B1 expression were abrogated by specific PPARα antagonist, but not by PPARδ antagonist. EPA and PPARα agonist also inhibited the basolateral secretion of β-carotene from Caco-2 cells grown on permeable supports. These results suggest that EPA inhibits intestinal β-carotene absorption by down regulation of SR B1 expression via PPARα dependent mechanism and provide an evidence for dietary modulation of intestinal β-carotene absorption. PMID:26577021

  13. Soft structure formation and cancer cell transport mechanisms of a folic acid-dipeptide conjugate.

    PubMed

    Kaur, Gagandeep; Shukla, Akansha; Sivakumar, Sri; Verma, Sandeep

    2015-03-01

    Folic acid (FA) is a low-molecular-weight micronutrient, which plays a critical role in the prevention of birth defects and cancers. It is also essential for biochemical pathways responsible for DNA synthesis and maintenance and for the generation of new red blood cells. Cellular trafficking of FA and folate is based on its high-affinity binding to cognate folate receptor, a protein commonly expressed in several human cancers. Thus, folate conjugates of drugs, plasmids, biosensors, contrast, and radiodiagnostic imaging agents have been used for assisted delivery in folate receptor-positive cancer cells, via endocytosis pathways. This report describes morphologies of soft structures from a fully characterized FA-dipeptide conjugate and detailed mechanistic studies of its cancer cell uptake, as tracked by the inherent fluorescence of the conjugate. PMID:25645907

  14. Sediment transport mechanics

    NASA Astrophysics Data System (ADS)

    Ballio, Francesco; Tait, Simon

    2012-12-01

    The Editor of Acta Geophysica and the Guest Editors wish to dedicate this Topical Issue on Sediment Transport Mechanics to the memory of Stephen Coleman, who died recently. During his career, Stephen had made an outstanding scientific contribution to the topic of Sediment Transport. The level of his contribution is demonstrated in the paper by Aberle, Coleman, and Nikora included in this issue, on which he started working before becoming aware of the illness that led to his untimely death. For scholars and colleagues Stephen remains an example of intellectual honesty and scientific insight.

  15. Molecular Mechanisms of Renal Ammonia Transport

    PubMed Central

    Weiner, I. David; Hamm, L. Lee

    2015-01-01

    Acid-base homeostasis to a great extent relies on renal ammonia metabolism. In the past several years, seminal studies have generated important new insights into the mechanisms of renal ammonia transport. In particular, the theory that ammonia transport occurs almost exclusively through nonionic NH3 diffusion and NH4+ trapping has given way to a model postulating that a variety of proteins specifically transport NH3 and NH4+ and that this transport is critical for normal ammonia metabolism. Many of these proteins transport primarily H+ or K+ but also transport NH4+. Nonerythroid Rh glycoproteins transport ammonia and may represent critical facilitators of ammonia transport in the kidney. This review discusses the underlying aspects of renal ammonia transport as well as specific proteins with important roles in renal ammonia transport. PMID:17002591

  16. [Inherited amino acid transport disorders].

    PubMed

    Igarashi, Y; Tada, K

    1992-07-01

    Disorders due to inherited amino acids transport defect are reviewed. The disorders were categorized into three types of transport defects, namely, brush-border membrane of epithelial cells of small intestine and kidney tubules (Hartnup disease, blue diaper syndrome, cystinuria, iminoglycinuria and lysine malabsorption syndrome), basolateral membrane (lysinuric protein intolerance) and membrane of intracellular organelles (cystinosis and hyperornitinemia-hyperammonemia-homocitrullinuria syndrome). Pathogenesis, clinical feature, laboratory findings, diagnosis, genetics and treatment of these disorders are described, briefly. There is not much data for the transport systems themselves, so that further investigation in molecular and gene levels for transport systems is necessary to clarify the characteristics of the transport and heterogeneity of phenotypes in inherited amino acids transport disorders. PMID:1404888

  17. Vacuolar Transport of Abscisic Acid Glucosyl Ester Is Mediated by ATP-Binding Cassette and Proton-Antiport Mechanisms in Arabidopsis1[W][OPEN

    PubMed Central

    Burla, Bo; Pfrunder, Stefanie; Nagy, Réka; Francisco, Rita Maria; Lee, Youngsook; Martinoia, Enrico

    2013-01-01

    Abscisic acid (ABA) is a key plant hormone involved in diverse physiological and developmental processes, including abiotic stress responses and the regulation of stomatal aperture and seed germination. Abscisic acid glucosyl ester (ABA-GE) is a hydrolyzable ABA conjugate that accumulates in the vacuole and presumably also in the endoplasmic reticulum. Deconjugation of ABA-GE by the endoplasmic reticulum and vacuolar β-glucosidases allows the rapid formation of free ABA in response to abiotic stress conditions such as dehydration and salt stress. ABA-GE further contributes to the maintenance of ABA homeostasis, as it is the major ABA catabolite exported from the cytosol. In this work, we identified that the import of ABA-GE into vacuoles isolated from Arabidopsis (Arabidopsis thaliana) mesophyll cells is mediated by two distinct membrane transport mechanisms: proton gradient-driven and ATP-binding cassette (ABC) transporters. Both systems have similar Km values of approximately 1 mm. According to our estimations, this low affinity appears nevertheless to be sufficient for the continuous vacuolar sequestration of ABA-GE produced in the cytosol. We further demonstrate that two tested multispecific vacuolar ABCC-type ABC transporters from Arabidopsis exhibit ABA-GE transport activity when expressed in yeast (Saccharomyces cerevisiae), which also supports the involvement of ABC transporters in ABA-GE uptake. Our findings suggest that the vacuolar ABA-GE uptake is not mediated by specific, but rather by several, possibly multispecific, transporters that are involved in the general vacuolar sequestration of conjugated metabolites. PMID:24028845

  18. Tape transport mechanism

    DOEpatents

    Groh, Edward F.; McDowell, William; Modjeski, Norbert S.; Keefe, Donald J.; Groer, Peter

    1979-01-01

    A device is provided for transporting, in a stepwise manner, tape between a feed reel and takeup reel. An indexer moves across the normal path of the tape displacing it while the tape on the takeup reel side of the indexer is braked. After displacement, the takeup reel takes up the displaced tape while the tape on the feed reel side of the indexer is braked, providing stepwise tape transport in precise intervals determined by the amount of displacement caused by the indexer.

  19. Intestinal transport and metabolism of bile acids

    PubMed Central

    Dawson, Paul A.; Karpen, Saul J.

    2015-01-01

    In addition to their classical roles as detergents to aid in the process of digestion, bile acids have been identified as important signaling molecules that function through various nuclear and G protein-coupled receptors to regulate a myriad of cellular and molecular functions across both metabolic and nonmetabolic pathways. Signaling via these pathways will vary depending on the tissue and the concentration and chemical structure of the bile acid species. Important determinants of the size and composition of the bile acid pool are their efficient enterohepatic recirculation, their host and microbial metabolism, and the homeostatic feedback mechanisms connecting hepatocytes, enterocytes, and the luminal microbiota. This review focuses on the mammalian intestine, discussing the physiology of bile acid transport, the metabolism of bile acids in the gut, and new developments in our understanding of how intestinal metabolism, particularly by the gut microbiota, affects bile acid signaling. PMID:25210150

  20. Short-chain fatty acid (SCFA) uptake into Caco-2 cells by a pH-dependent and carrier mediated transport mechanism.

    PubMed

    Stein, J; Zores, M; Schröder, O

    2000-06-01

    The short-chain fatty acids, acetate, propionate, and butyrate, are the most abundant organic anions in the human colon. SCFA play a pivotal role in maintaining homeostasis in the colon. Particularly butyrate induces cell differentiation and regulates growth and proliferation of colonic mucosal epithelial cells, whereas it reduces the growth rate of colorectal cancer cell. Previous studies by several groups, including our own, using isolated membrane vesicles have demonstrated that the uptake of butyrate is at least in part mediated by a non-electrogenic SCFA-/HCO3- antiporter. The purpose of the present study was to determine (1) whether Caco-2 cells could serve as an experimental model to assess the mechanisms of SCFA transport, and (2) whether monocarboxlate transporters could play a role in SCFA transport in these cells. Caco-2 cells were found to transport 14C-butyrate in a concentration and time dependent manner. The uptake was sodium independent, but was stimulated by lowering extracellular pH. The uptake of 500 microM butyrate was reduced by 49.6% +/- 3.3% in the presence of propionate and by 57.2% +/- 4.8% in the presence of 10 mM L-lactate. The addition of 1 mM alpha-cyano-4-hydroxycinnamate and phloretin, both known to be potent inhibitors of MCT1, decreased the uptake of 500 microM 14C-butyrate by 59.4% +/- 4.1% and 48.9% +/- 3.3%, respectively, whereas similar concentrations of DIDS did not have any effect. These data suggest that the uptake of butyrate in Caco-2 cells occurs via a carrier mediated transport system specific for monocarboxylic acids, which is in accordance with characteristics of the MCT 1. PMID:10918994

  1. Compartmentation of malic acid in mesophyll cells of Kalanchoee daigremontiana: indications of a intracellular cytosolic vesicle transport mechanism

    SciTech Connect

    Balsamo, R.A.; Uribe, E.G.

    1987-04-01

    Leaf tissue was harvested over a 24hr period at one to three hour intervals. The malic acid levels in the tissue were assayed spectrophotometrically and the percent cell volume occupied by cytosolic vesicles in replicate samples was determined. The total volume of the cytosolic vesicles fluctuated throughout the photoperiod concommitantly with malic acid concentrations present in the tissue. An intact leaf tissue section (10.2cm/sup 2/) was radiolabeled with /sup 14/CO/sub 2/ seven hours into the dark period for thirty minutes. Two dimensional thin layer chromatography and electrophoresis of the tissue determined that 96% of the label was incorporated into malic acid. A freeze substitution procedure was initiated followed by microautoradiography (Fisher 1971) which allowed for the tracing of intracellular malic acid migration and compartmentation within the mesophyll cells. The results and interpretation of this experiment will be presented.

  2. Novel Lactate Transporters from Carboxylic Acid-Producing Rhizopus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The fungus Rhizopus is frequently used for fermentative production of lactic acid, but little is known about the mechanisms or proteins for transporting this carboxylic acid. Since transport of the lactate anion across the plasma membrane is critical to prevent acidification of the cytoplasm, we ev...

  3. Abscisic Acid Transport in Human Erythrocytes*

    PubMed Central

    Vigliarolo, Tiziana; Guida, Lucrezia; Millo, Enrico; Fresia, Chiara; Turco, Emilia; De Flora, Antonio; Zocchi, Elena

    2015-01-01

    Abscisic acid (ABA) is a plant hormone involved in the response to environmental stress. Recently, ABA has been shown to be present and active also in mammals, where it stimulates the functional activity of innate immune cells, of mesenchymal and hemopoietic stem cells, and insulin-releasing pancreatic β-cells. LANCL2, the ABA receptor in mammalian cells, is a peripheral membrane protein that localizes at the intracellular side of the plasma membrane. Here we investigated the mechanism enabling ABA transport across the plasmamembrane of human red blood cells (RBC). Both influx and efflux of [3H]ABA occur across intact RBC, as detected by radiometric and chromatographic methods. ABA binds specifically to Band 3 (the RBC anion transporter), as determined by labeling of RBC membranes with biotinylated ABA. Proteoliposomes reconstituted with human purified Band 3 transport [3H]ABA and [35S]sulfate, and ABA transport is sensitive to the specific Band 3 inhibitor 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid. Once inside RBC, ABA stimulates ATP release through the LANCL2-mediated activation of adenylate cyclase. As ATP released from RBC is known to exert a vasodilator response, these results suggest a role for plasma ABA in the regulation of vascular tone. PMID:25847240

  4. Transport of amino acids in Lactobacillus casei by proton-motive-force-dependent and non-proton-motive-force-dependent mechanisms.

    PubMed

    Strobel, H J; Russell, J B; Driessen, A J; Konings, W N

    1989-01-01

    Lactobacillus casei 393 cells which were energized with glucose (pH 6.0) took up glutamine, asparagine, glutamate, aspartate, leucine, and phenylalanine. Little or no uptake of several essential amino acids (valine, isoleucine, arginine, cysteine, tyrosine, and tryptophan) was observed. Inhibition studies indicated that there were at least five amino acid carriers, for glutamine, asparagine, glutamate/aspartate, phenylalanine, or branched-chain amino acids. Transport activities had pH optima between 5.5 and 6.0, but all amino acid carriers showed significant activity even at pH 4.0. Leucine and phenylalanine transport decreased markedly when the pH was increased to 7.5. Inhibitors which decreased proton motive force (delta p) nearly eliminated leucine and phenylalanine uptake, and studies with de-energized cells and membrane vesicles showed that an artificial electrical potential (delta psi) of at least -100 mV was needed for rapid uptake. An artificial delta p was unable to drive glutamine, asparagine, or glutamate uptake, and transport of these amino acids was sensitive to a decline in intracellular pH. When intracellular pH was greater than 7.7, glutamine, asparagine, or glutamate was transported rapidly even though the proton motive force had been abolished by inhibitors. PMID:2492498

  5. Amino Acid Transport in Pseudomonas aeruginosa

    PubMed Central

    Kay, W. W.; Gronlund, Audrey F.

    1969-01-01

    Properties of the transport systems for amino acids in Pseudomonas aeruginosa were investigated. Exogenous 14C-labeled amino acids were shown to equilibrate with the internal native amino acid pool prior to incorporation into protein. When added at low external concentrations, the majority of the amino acids examined entered the protein of the cell unaltered. The rates of amino acid transport, established at low concentrations with 18 commonly occurring amino acids, varied as much as 40-fold. The transport process became saturated at high external amino acid concentrations, was temperature-sensitive, and was inhibited by sodium azide and iodoacetamide. Intracellular to extracellular amino acid ratios of 100- to 300-fold were maintained during exponential growth of the population in a glucose minimal medium. When the medium became depleted of glucose, neither extracellular nor intracellular amino acids could be detected. PMID:4974392

  6. Truck and Transport Mechanic. Occupational Analyses Series.

    ERIC Educational Resources Information Center

    McRory, Aline; Ally, Mohamed

    This analysis covers tasks performed by a truck and transport mechanic, an occupational title some provinces and territories of Canada have also identified as commercial transport vehicle mechanic; transport truck mechanic; truck and coach technician; and truck and transport service technician. A guide to analysis discusses development, structure,…

  7. Amino acid transporters: roles in amino acid sensing and signalling in animal cells.

    PubMed Central

    Hyde, Russell; Taylor, Peter M; Hundal, Harinder S

    2003-01-01

    Amino acid availability regulates cellular physiology by modulating gene expression and signal transduction pathways. However, although the signalling intermediates between nutrient availability and altered gene expression have become increasingly well documented, how eukaryotic cells sense the presence of either a nutritionally rich or deprived medium is still uncertain. From recent studies it appears that the intracellular amino acid pool size is particularly important in regulating translational effectors, thus, regulated transport of amino acids across the plasma membrane represents a means by which the cellular response to amino acids could be controlled. Furthermore, evidence from studies with transportable amino acid analogues has demonstrated that flux through amino acid transporters may act as an initiator of nutritional signalling. This evidence, coupled with the substrate selectivity and sensitivity to nutrient availability classically associated with amino acid transporters, plus the recent discovery of transporter-associated signalling proteins, demonstrates a potential role for nutrient transporters as initiators of cellular nutrient signalling. Here, we review the evidence supporting the idea that distinct amino acid "receptors" function to detect and transmit certain nutrient stimuli in higher eukaryotes. In particular, we focus on the role that amino acid transporters may play in the sensing of amino acid levels, both directly as initiators of nutrient signalling and indirectly as regulators of external amino acid access to intracellular receptor/signalling mechanisms. PMID:12879880

  8. Membranes, mechanics, and intracellular transport

    NASA Astrophysics Data System (ADS)

    Parthasarathy, Raghuveer

    2012-10-01

    Cellular membranes are remarkable materials -- self-assembled, flexible, two-dimensional fluids. Understanding how proteins manipulate membrane curvature is crucial to understanding the transport of cargo in cells, yet the mechanical activities of trafficking proteins remain poorly understood. Using an optical-trap based assay involving dynamic deformation of biomimetic membranes, we have examined the behavior of Sar1, a key component of the COPII family of transport proteins. We find that Sar1 from yeast (S. cerevisiae) lowers membrane rigidity by up to 100% as a function of its concentration, thereby lowering the energetic cost of membrane deformation. Human Sar1 proteins can also lower the mechanical rigidity of the membranes to which they bind. However, unlike the yeast proteins, the rigidity is not a monotonically decreasing function of concentration but rather shows increased rigidity and decreased mobility at high concentrations that implies interactions between proteins. In addition to describing this study of membrane mechanics, I'll also discuss some topics relevant to a range of biophysical investigations, such as the insights provided by imaging methods and open questions in the dynamics of multicellular systems.

  9. Carboxylic Acids Plasma Membrane Transporters in Saccharomyces cerevisiae.

    PubMed

    Casal, Margarida; Queirós, Odília; Talaia, Gabriel; Ribas, David; Paiva, Sandra

    2016-01-01

    This chapter covers the functionally characterized plasma membrane carboxylic acids transporters Jen1, Ady2, Fps1 and Pdr12 in the yeast Saccharomyces cerevisiae, addressing also their homologues in other microorganisms, as filamentous fungi and bacteria. Carboxylic acids can either be transported into the cells, to be used as nutrients, or extruded in response to acid stress conditions. The secondary active transporters Jen1 and Ady2 can mediate the uptake of the anionic form of these substrates by a H(+)-symport mechanism. The undissociated form of carboxylic acids is lipid-soluble, crossing the plasma membrane by simple diffusion. Furthermore, acetic acid can also be transported by facilitated diffusion via Fps1 channel. At the cytoplasmic physiological pH, the anionic form of the acid prevails and it can be exported by the Pdr12 pump. This review will highlight the mechanisms involving carboxylic acids transporters, and the way they operate according to the yeast cell response to environmental changes, as carbon source availability, extracellular pH and acid stress conditions. PMID:26721276

  10. Identification and application of keto acids transporters in Yarrowia lipolytica.

    PubMed

    Guo, Hongwei; Liu, Peiran; Madzak, Catherine; Du, Guocheng; Zhou, Jingwen; Chen, Jian

    2015-01-01

    Production of organic acids by microorganisms is of great importance for obtaining building-block chemicals from sustainable biomass. Extracellular accumulation of organic acids involved a series of transporters, which play important roles in the accumulation of specific organic acid while lack of systematic demonstration in eukaryotic microorganisms. To circumvent accumulation of by-product, efforts have being orchestrated to carboxylate transport mechanism for potential clue in Yarrowia lipolytica WSH-Z06. Six endogenous putative transporter genes, YALI0B19470g, YALI0C15488g, YALI0C21406g, YALI0D24607g, YALI0D20108g and YALI0E32901g, were identified. Transport characteristics and substrate specificities were further investigated using a carboxylate-transport-deficient Saccharomyces cerevisiae strain. These transporters were expressed in Y. lipolytica WSH-Z06 to assess their roles in regulating extracellular keto acids accumulation. In a Y. lipolytica T1 line over expressing YALI0B19470g, α-ketoglutarate accumulated to 46.7 g·L(-1), whereas the concentration of pyruvate decreased to 12.3 g·L(-1). Systematic identification of these keto acids transporters would provide clues to further improve the accumulation of specific organic acids with higher efficiency in eukaryotic microorganisms. PMID:25633653

  11. Identification and application of keto acids transporters in Yarrowia lipolytica

    PubMed Central

    Guo, Hongwei; Liu, Peiran; Madzak, Catherine; Du, Guocheng; Zhou, Jingwen; Chen, Jian

    2015-01-01

    Production of organic acids by microorganisms is of great importance for obtaining building-block chemicals from sustainable biomass. Extracellular accumulation of organic acids involved a series of transporters, which play important roles in the accumulation of specific organic acid while lack of systematic demonstration in eukaryotic microorganisms. To circumvent accumulation of by-product, efforts have being orchestrated to carboxylate transport mechanism for potential clue in Yarrowia lipolytica WSH-Z06. Six endogenous putative transporter genes, YALI0B19470g, YALI0C15488g, YALI0C21406g, YALI0D24607g, YALI0D20108g and YALI0E32901g, were identified. Transport characteristics and substrate specificities were further investigated using a carboxylate-transport-deficient Saccharomyces cerevisiae strain. These transporters were expressed in Y. lipolytica WSH-Z06 to assess their roles in regulating extracellular keto acids accumulation. In a Y. lipolytica T1 line over expressing YALI0B19470g, α-ketoglutarate accumulated to 46.7 g·L−1, whereas the concentration of pyruvate decreased to 12.3 g·L−1. Systematic identification of these keto acids transporters would provide clues to further improve the accumulation of specific organic acids with higher efficiency in eukaryotic microorganisms. PMID:25633653

  12. Reactive geothermal transport simulation to study the formation mechanism of impermeable barrier between acidic and neutral fluid zones in the Onikobe geothermal field, Japan

    SciTech Connect

    Todaka, Noritumi; Akasaka, Chitosi; Xu, Tianfu; Pruess, Karsten

    2003-03-06

    Two types of fluids are encountered in the Onikobe geothermal reservoir (Japan): One is neutral and the other is acidic. It is hypothesized that acidic fluid might be upwelling along a fault zone from magma and that an impermeable barrier might be present between the acidic and neutral fluid zones. To test such a conceptual model and to study the geochemical behavior due to mixing of the two fluids, reactive geothermal transport simulations under both natural and production conditions were carried out using the code TOUGHREACT. Results indicate Mn-rich smectite precipitates near the mixing front. Precipitation of sphalerite and galena occurs in a similar region as the Mn-rich smectite. Precipitation of these minerals depends on pH and temperature. In addition, quartz, pyrite, and calcite precipitate in the shallow zone resulting in further development of caprock. The changes in porosity and permeability due to precipitation of Mn-rich smectite are small compared with that of quartz, calcite, and pyrite. However, the smectite precipitation is likely to fill open fractures and to form an impermeable barrier between acidic and neutral fluid regions. The simulated mineral assemblage is generally consistent with observations in the Onikobe field. The numerical simulations described here provide useful insight into geochemical behavior and formation of impermeable barriers from fluid mixing. The method presented in this paper may be useful in fundamental analysis of hydrothermal systems and in the exploration of geothermal reservoirs, including chemical evolution, mineral alteration, mineral scaling, and changes in porosity and permeability.

  13. Reactive geothermal transport simulations to study the formation mechanism of an impermeable barrier between acidic and neutral fluid zones in the Onikobe Geothermal Field, Japan

    NASA Astrophysics Data System (ADS)

    Todaka, Norifumi; Akasaka, Chitoshi; Xu, Tianfu; Pruess, Karsten

    2004-05-01

    Two types of fluids are encountered in the Onikobe geothermal reservoir (Japan): one is neutral and the other is acidic. It is hypothesized that acidic fluid might be upwelling along a fault zone from magma and that an impermeable barrier might be present between the acidic and neutral fluid zones. To test such a conceptual model and to study the geochemical behavior due to mixing of the two fluids, reactive geothermal transport simulations under both natural and production conditions were carried out using the code TOUGHREACT. Results indicate Mn-rich smectite precipitates near the mixing front. Precipitation of sphalerite and galena occurs in a similar region as the Mn-rich smectite. Precipitation of these minerals depends on pH and temperature. In addition, quartz, pyrite, and calcite precipitate in the shallow zone resulting in further development of caprock. The changes in porosity and permeability due to precipitation of Mn-rich smectite are small compared with that of quartz, calcite, and pyrite. However, the smectite precipitation is likely to fill open fractures and to form an impermeable barrier between acidic and neutral fluid regions. The simulated mineral assemblage is generally consistent with observations in the Onikobe field. The numerical simulations described here provide useful insight into geochemical behavior and formation of impermeable barriers from fluid mixing. The method presented in this paper may be useful in fundamental analysis of hydrothermal systems and in the exploration of geothermal reservoirs, including chemical evolution, mineral alteration, mineral scaling, and changes in porosity and permeability.

  14. Transport mechanism of a glutamate transporter homologue GltPh.

    PubMed

    Ji, Yurui; Postis, Vincent L G; Wang, Yingying; Bartlam, Mark; Goldman, Adrian

    2016-06-15

    Glutamate transporters are responsible for uptake of the neurotransmitter glutamate in mammalian central nervous systems. Their archaeal homologue GltPh, an aspartate transporter isolated from Pyrococcus horikoshii, has been the focus of extensive studies through crystallography, MD simulations and single-molecule FRET (smFRET). Here, we summarize the recent research progress on GltPh, in the hope of gaining some insights into the transport mechanism of this aspartate transporter. PMID:27284058

  15. Transport mechanism of a glutamate transporter homologue GltPh

    PubMed Central

    Ji, Yurui; Postis, Vincent L.G.; Wang, Yingying; Bartlam, Mark; Goldman, Adrian

    2016-01-01

    Glutamate transporters are responsible for uptake of the neurotransmitter glutamate in mammalian central nervous systems. Their archaeal homologue GltPh, an aspartate transporter isolated from Pyrococcus horikoshii, has been the focus of extensive studies through crystallography, MD simulations and single-molecule FRET (smFRET). Here, we summarize the recent research progress on GltPh, in the hope of gaining some insights into the transport mechanism of this aspartate transporter. PMID:27284058

  16. Transport of D-serine via the amino acid transporter ATB(0,+) expressed in the colon.

    PubMed

    Hatanaka, Takahiro; Huang, Wei; Nakanishi, Takeo; Bridges, Christy C; Smith, Sylvia B; Prasad, Puttur D; Ganapathy, Malliga E; Ganapathy, Vadivel

    2002-02-22

    D-Serine, synthesized endogenously in the brain, is an important modulator of glutamatergic neurotransmission. Since colonic bacteria produce D-serine, we asked the question whether there are transport mechanisms in the colon that might make this exogenously produced D-serine available to the host. Here we identify for the first time an amino acid transporter in the intestine for high-affinity active transport of D-serine. This transporter, called ATB(0,+), is a Na(+)- and Cl(-)-coupled transporter for L-enantiomers of neutral and cationic amino acids. Here we demonstrate that ATB(0,+) is also capable of mediating the Na(+)- and Cl(-)-coupled transport of D-serine. The affinity of ATB(0,+) for L-serine and D-serine is similar, the K(t) value for the two enantiomers being approximately 150 microM. In addition to D-serine, ATB(0,+) transports D-alanine, D-methionine, D-leucine, and D-tryptophan. However, several other neutral and cationic amino acids that are transportable substrates for ATB(0,+) as L-enantiomers are not transported when presented as D-enantiomers. ATB(0,+) is expressed in the intestinal tract, interestingly not in the proximal intestine but in the distal intestine. Expression is most predominant in the colon where the transporter is localized to the luminal membrane of colonocytes, making this transporter uniquely suitable for absorption of bacteria-derived D-serine. PMID:11846403

  17. Sodium-coupled sugar and amino acid transport in an acidic microenvironment.

    PubMed

    Ahearn, G A; Clay, L P

    1988-01-01

    1. Nutrient transport mechanisms of lobster hepatopancreatic epithelial brush border membrane vesicles (BBMV) are strongly influenced by the acidic nature of the tubular lumen. 2. Sodium-dependent glucose uptake by BBMV was electrogenic and was stimulated at low pH by reducing sugar transport Ki, without affecting JM. 3. Glutamate was largely transported in zwitterionic form at pH 4.0 by an electrically silent cotransport mechanism with both Na and Cl. 4. Increased H+ concentration tripled the apparent membrane permeability to glutamate as well as the amino acid transport JM. 5. At pH 4.0 leucine was transported as a cation by two dissimilar carrier systems: a Na-independent process shared by polar amino acids, and an electroneutral Na-2Cl-dependent mechanism shared with non-polar amino acids. 6. A model is proposed for hepatopancreatic BBMV at acidic pH which employs ionic chemical gradients and membrane potential as nutrient transport driving forces. PMID:2902970

  18. Molecular basis of essential amino acid transport from studies of insect nutrient amino acid transporters of the SLC6 family (NAT-SLC6)

    PubMed Central

    Boudko, Dmitri Y.

    2012-01-01

    Two protein families that represent major components of essential amino acid transport in insects have been identified. They are annotated as the SLC6 and SLC7 families of transporters according to phylogenetic proximity to characterized amino acid transporters (HUGO nomenclature). Members of these families have been identified as important apical and basolateral parts of transepithelial essential amino acid absorption in the metazoan alimentary canal. Synergistically, they play critical physiological roles as essential substrate providers to diverse metabolic processes, including generic protein synthesis. This review briefly clarifies the requirements for amino acid transport and a variety of amino acid transport mechanisms, including the aforementioned families. Further it focuses on the large group of Nutrient Amino acid Transporters (NATs), which comprise a recently identified subfamily of the Neurotransmitter Sodium Symporter family (NSS or SLC6). The first insect NAT, cloned from the caterpillar gut, has a broad substrate spectrum similar to mammalian B0 transporters. Several new NAT-SLC6 members have been characterized in an effort to explore mechanisms for the essential amino acid absorption in model dipteran insects. The identification and functional characterization of new B0-like and narrow specificity transporters of essential amino acids in fruit fly and mosquitoes leads to a fundamentally important insight: that NATs evolved and act together as the integrated active core of a transport network that mediates active alimentary absorption and systemic distribution of essential amino acids. This role of NATs is projected from the most primitive prokaryotes to the most complex metazoan organisms, and represents an interesting platform for unraveling the molecular evolution of amino acid transport and modeling amino acid transport disorders. The comparative study of NATs elucidates important adaptive differences between essential amino acid transportomes

  19. Manganese Transport via the Transferrin Mechanism

    PubMed Central

    Gunter, Thomas E.; Gerstner, Brent; Gunter, Karlene K.; Malecki, Jon; Gelein, Robert; Valentine, William M.; Aschner, Michael; Yule, David I.

    2013-01-01

    Excessive manganese (Mn) uptake by brain cells, particularly in regions like the basal ganglia, can lead to toxicity. Mn2+ is transported into cells via a number of mechanisms, while Mn3+ is believed to be transported similarly to iron (Fe) via the transferrin (Tf) mechanism. Cellular Mn uptake is therefore determined by the activity of the mechanisms transporting Mn into each type of cell and by the amounts of Mn2+, Mn3+ and their complexes to which these cells are exposed; this complicates understanding the contributions of each transporter to Mn toxicity. While uptake of Fe3+ via the Tf mechanism is well understood, uptake of Mn3+ via this mechanism has not been systematically studied. The stability of the Mn3+Tf complex allowed us to form and purify this complex and label it with a fluorescent (Alexa green) tag. Using purified and labeled Mn3+Tf and biophysical tools, we have developed a novel approach to study Mn3+Tf transport independently of other Mn transport mechanisms. This approach was used to compare the uptake of Mn3+Tf into neuronal cell lines with published descriptions of Fe3+ uptake via the Tf mechanism, and to obtain quantitative information on Mn uptake via the Tf mechanism. Results confirm that in these cell lines significant Mn3+ is transported by the Tf mechanism similarly to Fe3+Tf transport; although Mn3+Tf transport is markedly slower than other Mn transport mechanisms. This novel approach may prove useful for studying Mn toxicity in other systems and cell types. PMID:23146871

  20. All-trans-retinoic Acid Promotes Trafficking of Human Concentrative Nucleoside Transporter-3 (hCNT3) to the Plasma Membrane by a TGF-β1-mediated Mechanism*

    PubMed Central

    Fernández-Calotti, Paula; Pastor-Anglada, Marçal

    2010-01-01

    Human concentrative nucleoside transporter-3 (hCNT3) is a sodium-coupled nucleoside transporter that exhibits high affinity and broad substrate selectivity, making it the most suitable candidate for mediating the uptake and cytotoxic action of most nucleoside-derived drugs. The drug of this class most commonly used in the treatment of chronic lymphocytic leukemia (CLL) is the pro-apoptotic nucleoside analog fludarabine (Flu), which enters CLL cells primarily through human equilibrative nucleoside transporters (hENTs). Although CLL cells lack hCNT3 activity, they do express this transporter protein, which is located mostly in the cytosol. The aim of our study was to identify agents and mechanisms capable of promoting hCNT3 trafficking to the plasma membrane. Here, we report that all-trans-retinoic acid (ATRA), currently used in the treatment of acute promyelocytic leukemia (APL), increases hCNT3-related activity through a mechanism that involves trafficking of pre-existing hCNT3 proteins to the plasma membrane. This effect is mediated by the autocrine action of transforming growth factor (TGF)-β1, which is transcriptionally activated by ATRA in a p38-dependent manner. TGF-β1 acts through activation of ERK1/2 and the small GTPase RhoA to promote plasma membrane trafficking of the hCNT3 protein. PMID:20172853

  1. Modeling Electrical Transport through Nucleic Acids

    NASA Astrophysics Data System (ADS)

    Qi, Jianqing

    Nucleic acids play a vital role in many biological systems and activities. In recent years, engineers and scientists have been interested in studying their electrical properties. The motivation for these studies stems from the following facts: (1) the bases, which form the building blocks of nucleic acids, have unique ionization potentials. Further, nucleic acids are one of the few nanomaterials that can be reproducibly manufactured with a high degree of accuracy (though admittedly their placement at desired locations remains a challenge). As a result, designed strands with specific sequences may offer unique device properties; (2) electrical methods offer potential for sequencing nucleic acids based on a single molecule; (3) electrical methods for disease detection based on the current flowing through nucleic acids are beginning to be demonstrated. While experiments in the above mentioned areas is promising, a deeper understanding of the electrical current flow through the nucleic acids needs to be developed. The modeling of current flowing in these molecules is complex because: (1) they are based on atomic scale contacts between nucleic acids and metal, which cannot be reproducibly built; (2) the conductivity of nucleic acids is easily influenced by the environment, which is constantly changing; and (3) the nucleic acids by themselves are floppy. This thesis focuses on the modeling of electrical transport through nucleic acids that are connected to two metal electrodes at nanoscale. We first develop a decoherent transport model for the double-stranded helix based on the Landauer-Buttiker framework. This model is rationalized by comparison with an experiment that measured the conductance of four different DNA strands. The developed model is then used to study the: (1) potential to make barriers and wells for quantum transport using specifically engineered sequences; (2) change in the electrical properties of a specific DNA strand with and without methylation; (3

  2. Renal Transport of Uric Acid: Evolving Concepts and Uncertainties

    PubMed Central

    Bobulescu, Ion Alexandru; Moe, Orson W.

    2013-01-01

    In addition to its role as a metabolic waste product, uric acid has been proposed to be an important molecule with multiple functions in human physiology and pathophysiology and may be linked to human diseases beyond nephrolithiasis and gout. Uric acid homeostasis is determined by the balance between production, intestinal secretion, and renal excretion. The kidney is an important regulator of circulating uric acid levels, by reabsorbing around 90% of filtered urate, while being responsible for 60–70% of total body uric acid excretion. Defective renal handling of urate is a frequent pathophysiologic factor underpinning hyperuricemia and gout. In spite of tremendous advances over the past decade, the molecular mechanisms of renal urate transport are still incompletely understood. Many transport proteins are candidate participants in urate handling, with URAT1 and GLUT9 being the best characterized to date. Understanding these transporters is increasingly important for the practicing clinician as new research unveils their physiology, importance in drug action, and genetic association with uric acid levels in human populations. The future may see the introduction of new drugs that specifically act on individual renal urate transporters for the treatment of hyperuricemia and gout. PMID:23089270

  3. Mechanical forces and lymphatic transport.

    PubMed

    Breslin, Jerome W

    2014-11-01

    This review examines the current understanding of how the lymphatic vessel network can optimize lymph flow in response to various mechanical forces. Lymphatics are organized as a vascular tree, with blind-ended initial lymphatics, precollectors, prenodal collecting lymphatics, lymph nodes, postnodal collecting lymphatics and the larger trunks (thoracic duct and right lymph duct) that connect to the subclavian veins. The formation of lymph from interstitial fluid depends heavily on oscillating pressure gradients to drive fluid into initial lymphatics. Collecting lymphatics are segmented vessels with unidirectional valves, with each segment, called a lymphangion, possessing an intrinsic pumping mechanism. The lymphangions propel lymph forward against a hydrostatic pressure gradient. Fluid is returned to the central circulation both at lymph nodes and via the larger lymphatic trunks. Several recent developments are discussed, including evidence for the active role of endothelial cells in lymph formation; recent developments on how inflow pressure, outflow pressure, and shear stress affect the pump function of the lymphangion; lymphatic valve gating mechanisms; collecting lymphatic permeability; and current interpretations of the molecular mechanisms within lymphatic endothelial cells and smooth muscle. An improved understanding of the physiological mechanisms by which lymphatic vessels sense mechanical stimuli, integrate the information, and generate the appropriate response is key for determining the pathogenesis of lymphatic insufficiency and developing treatments for lymphedema. PMID:25107458

  4. Mechanical Forces and Lymphatic Transport

    PubMed Central

    Breslin, Jerome W.

    2014-01-01

    This review examines current understanding of how the lymphatic vessel network can optimize lymph flow in response to various mechanical forces. Lymphatics are organized as a vascular tree, with blind-ended initial lymphatics, precollectors, prenodal collecting lymphatics, lymph nodes, postnodal collecting lymphatics and the larger trunks (thoracic duct and right lymph duct) that connect to the subclavian veins. The formation of lymph from interstitial fluid depends heavily on oscillating pressure gradients to drive fluid into initial lymphatics. Collecting lymphatics are segmented vessels with unidirectional valves, with each segment, called a lymphangion, possessing an intrinsic pumping mechanism. The lymphangions propel lymph forward against a hydrostatic pressure gradient. Fluid is returned to the central circulation both at lymph nodes and via the larger lymphatic trunks. Several recent developments are discussed, including: evidence for the active role of endothelial cells in lymph formation; recent developments on how inflow pressure, outflow pressure, and shear stress affect pump function of the lymphangion; lymphatic valve gating mechanisms; collecting lymphatic permeability; and current interpretations of the molecular mechanisms within lymphatic endothelial cells and smooth muscle. Improved understanding of the physiological mechanisms by lymphatic vessels sense mechanical stimuli, integrate the information, and generate the appropriate response is key for determining the pathogenesis of lymphatic insufficiency and developing treatments for lymphedema. PMID:25107458

  5. Reactive solute transport in acidic streams

    USGS Publications Warehouse

    Broshears, R.E.

    1996-01-01

    Spatial and temporal profiles of Ph and concentrations of toxic metals in streams affected by acid mine drainage are the result of the interplay of physical and biogeochemical processes. This paper describes a reactive solute transport model that provides a physically and thermodynamically quantitative interpretation of these profiles. The model combines a transport module that includes advection-dispersion and transient storage with a geochemical speciation module based on MINTEQA2. Input to the model includes stream hydrologic properties derived from tracer-dilution experiments, headwater and lateral inflow concentrations analyzed in field samples, and a thermodynamic database. Simulations reproduced the general features of steady-state patterns of observed pH and concentrations of aluminum and sulfate in St. Kevin Gulch, an acid mine drainage stream near Leadville, Colorado. These patterns were altered temporarily by injection of sodium carbonate into the stream. A transient simulation reproduced the observed effects of the base injection.

  6. Introduction to nucleocytoplasmic transport: molecules and mechanisms.

    PubMed

    Peters, Reiner

    2006-01-01

    Nucleocytoplasmic transport, the exchange of matter between nucleus and cytoplasm, plays a fundamental role in human and other eukaryotic cells, affecting almost every aspect of health and disease. The only gate for the transport of small and large molecules as well as supramolecular complexes between nucleus and cytoplasm is the nuclear pore complex (NPC). The NPC is not a normal membrane transport protein (transporter). Composed of 500 to 1000 peptide chains, the NPC features a mysterious functional duality. For most molecules, it constitutes a molecular sieve with a blurred cutoff at approx 10 nm, but for molecules binding to phenylalanine-glycine (FG) motifs, the NPC appears to be a channel of approx 50 nm diameter, permitting bidirectional translocation at high speed. To achieve this, the NPC cooperates with soluble factors, the nuclear transport receptors, which shuttle between nuclear contents and cytoplasm. Here, we provide a short introduction to nucleocytoplasmic transport by describing first the structure and composition of the nuclear pore complex. Then, mechanisms of nucleocytoplasmic transport are discussed. Finally, the still essentially unresolved mechanisms by which nuclear transport receptors and transport complexes are translocated through the nuclear pore complex are considered, and a novel translocation model is suggested. PMID:16739728

  7. The involvement of L-type amino acid transporters in theanine transport.

    PubMed

    Yamamoto, Sachiko; Kimura, Toru; Tachiki, Takashi; Anzai, Naohiko; Sakurai, Takuya; Ushimaru, Makoto

    2012-01-01

    L-Theanine has favorable physiological effects in terms of human health, but the mechanisms that transport it to its target organs or cells are not completely defined. To identify the major transport mechanisms of L-theanine, we screened for candidate transporters of L-3H-theanine in several mammal cell lines that intrinsically express multiple transporters with various specificities. All of the cells tested, T24, HepG2, COS1, 293A, Neuro2a, and HuH7, absorbed L-3H-theanine. Uptake was significantly inhibited by the addition of L-leucine and by a specific inhibitor of the system L transport system, 2-aminobicyclo-(2,2,1)-heptane-2-carboxylic acid (BCH). L-3H-Theanine uptake occurred mostly independently of Na+. These results indicate that L-theanine was taken up via a system L like transport system in all of the cells tested. Additionally, in experiments using cells stably expressing two system L isoforms, LAT1 and LAT2, we found that the two isoforms mediated L-theanine transport to similar extents. Taken together, our results indicate that L-theanine is transported mostly via the system L transport pathway and its isoforms. PMID:23221699

  8. Acid-base transport in pancreas—new challenges

    PubMed Central

    Novak, Ivana; Haanes, Kristian A.; Wang, Jing

    2013-01-01

    Along the gastrointestinal tract a number of epithelia contribute with acid or basic secretions in order to aid digestive processes. The stomach and pancreas are the most extreme examples of acid (H+) and base (HCO−3) transporters, respectively. Nevertheless, they share the same challenges of transporting acid and bases across epithelia and effectively regulating their intracellular pH. In this review, we will make use of comparative physiology to enlighten the cellular mechanisms of pancreatic HCO−3 and fluid secretion, which is still challenging physiologists. Some of the novel transporters to consider in pancreas are the proton pumps (H+-K+-ATPases), as well as the calcium-activated K+ and Cl− channels, such as KCa3.1 and TMEM16A/ANO1. Local regulators, such as purinergic signaling, fine-tune, and coordinate pancreatic secretion. Lastly, we speculate whether dys-regulation of acid-base transport contributes to pancreatic diseases including cystic fibrosis, pancreatitis, and cancer. PMID:24391597

  9. Energetics of low affinity amino acid transport into brain slices.

    PubMed

    Banay-Schwartz, M; Teller, D N; Lajtha, A

    1976-01-01

    It appears possible to dissect and study some of the potential energy sources for amino acid transport in brain slices despite the apparent complexity of the tissue in comparison to that of isolated bacterial vesicles23. The uptake capability of the tissue may be inadvertently damaged in some experimental protocols so that very special controls must be used to ensure that the treatment did not somehow inactivate the very mechanism that thereafter will be tested. We have presented some evidence that brain slice amino acid transport may not be obligatorily linked to glycolysis, ATP levels, Na+, K+-ATPase activity, K+ levels or direction of flux, or to Na+ flux. However, the energy source linkage for different amino acids appears to be rather specific, so that further generalizations are difficult to sustain. For instance, the incubation media and conditions we describe here were experimentally adjusted to maximize uptake of D-glu or alpha-AIB in the absence of glucose, or in lowered K+ or Na+. Therefore, these procedures, the results of which directly challenge some common assumptions regarding the energy basis for active transport in brain slices, probably will not be universally extensible to all other actively transported amino acids. PMID:782193

  10. Fatty Acid and Lipid Transport in Plant Cells.

    PubMed

    Li, Nannan; Xu, Changcheng; Li-Beisson, Yonghua; Philippar, Katrin

    2016-02-01

    Fatty acids (FAs) and lipids are essential - not only as membrane constituents but also for growth and development. In plants and algae, FAs are synthesized in plastids and to a large extent transported to the endoplasmic reticulum for modification and lipid assembly. Subsequently, lipophilic compounds are distributed within the cell, and thus are transported across most membrane systems. Membrane-intrinsic transporters and proteins for cellular FA/lipid transfer therefore represent key components for delivery and dissemination. In addition to highlighting their role in lipid homeostasis and plant performance, different transport mechanisms for land plants and green algae - in the model systems Arabidopsis thaliana, Chlamydomonas reinhardtii - are compared, thereby providing a current perspective on protein-mediated FA and lipid trafficking in photosynthetic cells. PMID:26616197

  11. Cation-halide transport through peptide pores containing aminopicolinic acid.

    PubMed

    Basak, Debajyoti; Sridhar, Sucheta; Bera, Amal K; Madhavan, Nandita

    2016-05-18

    Synthetic pores that selectively transport ions of biological significance through membranes could be potentially used in medical diagnostics or therapeutics. Herein, we report cation-selective octapeptide pores derived from alanine and aminopicolinic acid. The ion transport mechanism through the pores has been established to be a cation-chloride symport. The cation-chloride co-transport is biologically essential for the efficient functioning of the central nervous system and has been implicated in diseases such as epilepsy. The pores formed in synthetic lipid bilayers do not exhibit any closing events. The ease of synthesis as well as infinite lifetimes of these pores provides scope for modifying their transport behaviour to develop sensors. PMID:27137995

  12. Report membrane transport of lactic acid in the filamentous fungus Rhizopus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The fungus Rhizopus is frequently used for fermentative production of lactic acid, but little is known about the mechanisms or proteins for transporting this carboxylic acid. Since transport of the lactate anion across the plasma membrane is critical to prevent acidification of the cytoplasm, we ev...

  13. Uptake of aristolochic acid I into Caco-2 cells by monocarboxylic acid transporters.

    PubMed

    Kimura, Osamu; Haraguchi, Koichi; Ohta, Chiho; Koga, Nobuyuki; Kato, Yoshihisa; Endo, Tetsuya

    2014-01-01

    The uptake mechanism of aristolochic acid I (AAI) was investigated using Caco-2 cells cultured on dishes and permeable membranes. The uptake of AAI from the apical membrane of Caco-2 cells cultured on a dish was rapid, and a decrease in the pH of the incubation medium significantly increased uptake. Incubation at low temperature (4°C) and treatment with sodium azide (a metabolic inhibitor) or carbonylcyanide p-trifluoromethoxyphenylhydrazone (a protonophore) significantly inhibited the AAI uptake. Coincubation with L-lactic acid or benzoic acid, typical substrates for the proton-linked monocarboxylic acid transporters (MCTs), significantly decreased the AAI uptake, as did coincubation with α-cyano-4-hydroxycinnamate (an inhibitor of MCTs). Dixon plotting revealed the competitive inhibition of benzoic acid on the AAI uptake. To confirm the AAI uptake via MCTs, the apical-to-basolateral transport of AAI was investigated using the Caco-2 cells cultured on the permeable membranes. The transport of AAI at pH 6.0 was markedly higher than that at pH 7.4, and was significantly decreased by coincubation with benzoic acid. These results suggest that the uptake of AAI from the apical membrane of Caco-2 cells is mediated mainly by MCTs along with benzoic acid. PMID:25177030

  14. Transport Mechanism of a Bacterial Homologue of Glutamate Transporters

    SciTech Connect

    Reyes, N.; Ginter, C; Boudker, O

    2009-01-01

    Glutamate transporters are integral membrane proteins that catalyse a thermodynamically uphill uptake of the neurotransmitter glutamate from the synaptic cleft into the cytoplasm of glia and neuronal cells by harnessing the energy of pre-existing electrochemical gradients of ions. Crucial to the reaction is the conformational transition of the transporters between outward and inward facing states, in which the substrate binding sites are accessible from the extracellular space and the cytoplasm, respectively. Here we describe the crystal structure of a double cysteine mutant of a glutamate transporter homologue from Pyrococcus horikoshii, GltPh, which is trapped in the inward facing state by cysteine crosslinking. Together with the previously determined crystal structures of Glt{sub Ph} in the outward facing state, the structure of the crosslinked mutant allows us to propose a molecular mechanism by which Glt{sub Ph} and, by analogy, mammalian glutamate transporters mediate sodium-coupled substrate uptake.

  15. Transport and signaling via the amino acid binding site of the yeast Gap1 amino acid transceptor.

    PubMed

    Van Zeebroeck, Griet; Bonini, Beatriz Monge; Versele, Matthias; Thevelein, Johan M

    2009-01-01

    Transporter-related nutrient sensors, called transceptors, mediate nutrient activation of signaling pathways through the plasma membrane. The mechanism of action of transporting and nontransporting transceptors is unknown. We have screened 319 amino acid analogs to identify compounds that act on Gap1, a transporting amino acid transceptor in yeast that triggers activation of the protein kinase A pathway. We identified competitive and noncompetitive inhibitors of transport, either with or without agonist action for signaling, including nontransported agonists. Using substituted cysteine accessibility method (SCAM) analysis, we identified Ser388 and Val389 as being exposed into the amino acid binding site, and we show that agonist action for signaling uses the same binding site as used for transport. Our results provide the first insight, to our knowledge, into the mechanism of action of transceptors. They indicate that signaling requires a ligand-induced specific conformational change that may be part of but does not require the complete transport cycle. PMID:19060912

  16. Molecular Mechanism of Biological Proton Transport

    SciTech Connect

    Pomes, R.

    1998-09-01

    Proton transport across lipid membranes is a fundamental aspect of biological energy transduction (metabolism). This function is mediated by a Grotthuss mechanism involving proton hopping along hydrogen-bonded networks embedded in membrane-spanning proteins. Using molecular simulations, the authors have explored the structural, dynamic, and thermodynamic properties giving rise to long-range proton translocation in hydrogen-bonded networks involving water molecules, or water wires, which are emerging as ubiquitous H{sup +}-transport devices in biological systems.

  17. Modeling Transport and Flow Regulatory Mechanisms of the Kidney

    PubMed Central

    Layton, Anita T.

    2013-01-01

    The kidney plays an indispensable role in the regulation of whole-organism water balance, electrolyte balance, and acid-base balance, and in the excretion of metabolic wastes and toxins. In this paper, we review representative mathematical models that have been developed to better understand kidney physiology and pathophysiology, including the regulation of glomerular filtration, the regulation of renal blood flow by means of the tubuloglomerular feedback mechanisms and of the myogenic mechanism, the urine concentrating mechanism, and regulation of renal oxygen transport. We discuss how such modeling efforts have significantly expanded our understanding of renal function in both health and disease. PMID:23914303

  18. Carnitine transport and fatty acid oxidation.

    PubMed

    Longo, Nicola; Frigeni, Marta; Pasquali, Marzia

    2016-10-01

    Carnitine is essential for the transfer of long-chain fatty acids across the inner mitochondrial membrane for subsequent β-oxidation. It can be synthesized by the body or assumed with the diet from meat and dairy products. Defects in carnitine biosynthesis do not routinely result in low plasma carnitine levels. Carnitine is accumulated by the cells and retained by kidneys using OCTN2, a high affinity organic cation transporter specific for carnitine. Defects in the OCTN2 carnitine transporter results in autosomal recessive primary carnitine deficiency characterized by decreased intracellular carnitine accumulation, increased losses of carnitine in the urine, and low serum carnitine levels. Patients can present early in life with hypoketotic hypoglycemia and hepatic encephalopathy, or later in life with skeletal and cardiac myopathy or sudden death from cardiac arrhythmia, usually triggered by fasting or catabolic state. This disease responds to oral carnitine that, in pharmacological doses, enters cells using the amino acid transporter B(0,+). Primary carnitine deficiency can be suspected from the clinical presentation or identified by low levels of free carnitine (C0) in the newborn screening. Some adult patients have been diagnosed following the birth of an unaffected child with very low carnitine levels in the newborn screening. The diagnosis is confirmed by measuring low carnitine uptake in the patients' fibroblasts or by DNA sequencing of the SLC22A5 gene encoding the OCTN2 carnitine transporter. Some mutations are specific for certain ethnic backgrounds, but the majority are private and identified only in individual families. Although the genotype usually does not correlate with metabolic or cardiac involvement in primary carnitine deficiency, patients presenting as adults tend to have at least one missense mutation retaining residual activity. This article is part of a Special Issue entitled: Mitochondrial Channels edited by Pierre Sonveaux, Pierre Maechler

  19. Boramino acid as a marker for amino acid transporters

    PubMed Central

    Liu, Zhibo; Chen, Haojun; Chen, Kai; Shao, Yihan; Kiesewetter, Dale O.; Niu, Gang; Chen, Xiaoyuan

    2015-01-01

    Amino acid transporters (AATs) are a series of integral channels for uphill cellular uptake of nutrients and neurotransmitters. Abnormal expression of AATs is often associated with cancer, addiction, and multiple mental diseases. Although methods to evaluate in vivo expression of AATs would be highly useful, efforts to develop them have been hampered by a lack of appropriate tracers. We describe a new class of AA mimics—boramino acids (BAAs)—that can serve as general imaging probes for AATs. The structure of a BAA is identical to that of the corresponding natural AA, except for an exotic replacement of the carboxylate with -BF3−. Cellular studies demonstrate strong AAT-mediated cell uptake, and animal studies show high tumor-specific accumulation, suggesting that BAAs hold great promise for the development of new imaging probes and smart AAT-targeting drugs. PMID:26601275

  20. Fatty acid transport and activation and the expression patterns of genes involved in fatty acid trafficking.

    PubMed

    Sandoval, Angel; Fraisl, Peter; Arias-Barrau, Elsa; Dirusso, Concetta C; Singer, Diane; Sealls, Whitney; Black, Paul N

    2008-09-15

    These studies defined the expression patterns of genes involved in fatty acid transport, activation and trafficking using quantitative PCR (qPCR) and established the kinetic constants of fatty acid transport in an effort to define whether vectorial acylation represents a common mechanism in different cell types (3T3-L1 fibroblasts and adipocytes, Caco-2 and HepG2 cells and three endothelial cell lines (b-END3, HAEC, and HMEC)). As expected, fatty acid transport protein (FATP)1 and long-chain acyl CoA synthetase (Acsl)1 were the predominant isoforms expressed in adipocytes consistent with their roles in the transport and activation of exogenous fatty acids destined for storage in the form of triglycerides. In cells involved in fatty acid processing including Caco-2 (intestinal-like) and HepG2 (liver-like), FATP2 was the predominant isoform. The patterns of Acsl expression were distinct between these two cell types with Acsl3 and Acsl5 being predominant in Caco-2 cells and Acsl4 in HepG2 cells. In the endothelial lines, FATP1 and FATP4 were the most highly expressed isoforms; the expression patterns for the different Acsl isoforms were highly variable between the different endothelial cell lines. The transport of the fluorescent long-chain fatty acid C(1)-BODIPY-C(12) in 3T3-L1 fibroblasts and 3T3-L1 adipocytes followed typical Michaelis-Menten kinetics; the apparent efficiency (k(cat)/K(T)) of this process increases over 2-fold (2.1 x 10(6)-4.5 x 10(6)s(-1)M(-1)) upon adipocyte differentiation. The V(max) values for fatty acid transport in Caco-2 and HepG2 cells were essentially the same, yet the efficiency was 55% higher in Caco-2 cells (2.3 x 10(6)s(-1)M(-1) versus 1.5 x 10(6)s(-1)M(-1)). The kinetic parameters for fatty acid transport in three endothelial cell types demonstrated they were the least efficient cell types for this process giving V(max) values that were nearly 4-fold lower than those defined form 3T3-L1 adipocytes, Caco-2 cells and HepG2 cells. The

  1. [Enhancers on the transmembrane transport of chlorogenic acid].

    PubMed

    Ren, Jing; Deng, Sheng-Qi; Jiang, Xue-Hua; Wang, Ling-Ling; Xiao, Yu

    2014-02-01

    To investigate the influence of the difference enhancers on the transport mechanism of chlorogenic acid (CGA) across Caco-2 cells model, a RP-HPLC method was adopted to detect the concentrations of CGA. At the concentrations of 20 to 80 microg x mL(-1), the difference of absorption rate constants (K(a)) was not statistically significant. At the concentrations of 40 and 20 microg x mL(-1), the ratios of apparent permeability coefficients (P(app)) of the apical to basolateral and the basolateral to apical were 1.14 and 1.18, respectively. With the effect of enhancers K(a) and P(app) increased, the absorption half-life (T1/2) decreased. CGA passed through the Caco-2 cell membrane mainly by passive transport. It showed that monocarboxylic acid transporter (MCT) could be involved in the across membrane transport process of CGA. Borneol had no effect on the cell membrane transport processes. The order of increasing absorption of CGA caused by the enhancers was sodium lauryl sulphate > sodium taurocholate > carbomer. PMID:24761618

  2. Abscisic acid transporters cooperate to control seed germination

    PubMed Central

    Kang, Joohyun; Yim, Sojeong; Choi, Hyunju; Kim, Areum; Lee, Keun Pyo; Lopez-Molina, Luis; Martinoia, Enrico; Lee, Youngsook

    2015-01-01

    Seed germination is a key developmental process that has to be tightly controlled to avoid germination under unfavourable conditions. Abscisic acid (ABA) is an essential repressor of seed germination. In Arabidopsis, it has been shown that the endosperm, a single cell layer surrounding the embryo, synthesizes and continuously releases ABA towards the embryo. The mechanism of ABA transport from the endosperm to the embryo was hitherto unknown. Here we show that four AtABCG transporters act in concert to deliver ABA from the endosperm to the embryo: AtABCG25 and AtABCG31 export ABA from the endosperm, whereas AtABCG30 and AtABCG40 import ABA into the embryo. Thus, this work establishes that radicle extension and subsequent embryonic growth are suppressed by the coordinated activity of multiple ABA transporters expressed in different tissues. PMID:26334616

  3. Comparative physiology of renal tubular transport mechanisms.

    PubMed Central

    Long, S.; Giebisch, G.

    1979-01-01

    This manuscript discusses current concepts of glomerular filtration and tubular transport of sodium, water, potassium, and urinary acidification by vertebrate kidneys in a comparative context. Work in mammalian and amphibian nephrons receives major emphasis due to our interest in application of new techniques for investigation of cellular mechanisms; when available, data from other vertebrate classes are discussed. Images FIG. 3 PMID:395765

  4. Peroxisomal ABC transporters: functions and mechanism

    PubMed Central

    Baker, Alison; Carrier, David J.; Schaedler, Theresia; Waterham, Hans R.; van Roermund, Carlo W.; Theodoulou, Frederica L.

    2015-01-01

    Peroxisomes are arguably the most biochemically versatile of all eukaryotic organelles. Their metabolic functions vary between different organisms, between different tissue types of the same organism and even between different developmental stages or in response to changed environmental conditions. New functions for peroxisomes are still being discovered and their importance is underscored by the severe phenotypes that can arise as a result of peroxisome dysfunction. The β-oxidation pathway is central to peroxisomal metabolism, but the substrates processed are very diverse, reflecting the diversity of peroxisomes across species. Substrates for β-oxidation enter peroxisomes via ATP-binding cassette (ABC) transporters of subfamily D; (ABCD) and are activated by specific acyl CoA synthetases for further metabolism. Humans have three peroxisomal ABCD family members, which are half transporters that homodimerize and have distinct but partially overlapping substrate specificity; Saccharomyces cerevisiae has two half transporters that heterodimerize and plants have a single peroxisomal ABC transporter that is a fused heterodimer and which appears to be the single entry point into peroxisomes for a very wide variety of β-oxidation substrates. Our studies suggest that the Arabidopsis peroxisomal ABC transporter AtABCD1 accepts acyl CoA substrates, cleaves them before or during transport followed by reactivation by peroxisomal synthetases. We propose that this is a general mechanism to provide specificity to this class of transporters and by which amphipathic compounds are moved across peroxisome membranes. PMID:26517910

  5. A paradoxical teratogenic mechanism for retinoic acid.

    PubMed

    Lee, Leo M Y; Leung, Chun-Yin; Tang, Walfred W C; Choi, Heung-Ling; Leung, Yun-Chung; McCaffery, Peter J; Wang, Chi-Chiu; Woolf, Adrian S; Shum, Alisa S W

    2012-08-21

    Retinoic acid, an active metabolite of vitamin A, plays essential signaling roles in mammalian embryogenesis. Nevertheless, it has long been recognized that overexposure to vitamin A or retinoic acid causes widespread teratogenesis in rodents as well as humans. Although it has a short half-life, exposure to high levels of retinoic acid can disrupt development of yet-to-be formed organs, including the metanephros, the embryonic organ which normally differentiates into the mature kidney. Paradoxically, it is known that either an excess or a deficiency of retinoic acid results in similar malformations in some organs, including the mammalian kidney. Accordingly, we hypothesized that excess retinoic acid is teratogenic by inducing a longer lasting, local retinoic acid deficiency. This idea was tested in an established in vivo mouse model in which exposure to excess retinoic acid well before metanephric rudiments exist leads to failure of kidney formation several days later. Results showed that teratogen exposure was followed by decreased levels of Raldh transcripts encoding retinoic acid-synthesizing enzymes and increased levels of Cyp26a1 and Cyp26b1 mRNAs encoding enzymes that catabolize retinoic acid. Concomitantly, there was significant reduction in retinoic acid levels in whole embryos and kidney rudiments. Restoration of retinoic acid levels by maternal supplementation with low doses of retinoic acid following the teratogenic insult rescued metanephric kidney development and abrogated several extrarenal developmental defects. This previously undescribed and unsuspected mechanism provides insight into the molecular pathway of retinoic acid-induced teratogenesis. PMID:22869719

  6. Apical transporters for neutral amino acids: physiology and pathophysiology.

    PubMed

    Bröer, Stefan

    2008-04-01

    Absorption of amino acids in kidney and intestine involves a variety of transporters for different groups of amino acids. This is illustrated by inherited disorders of amino acid absorption, such as Hartnup disorder, cystinuria, iminoglycinuria, dicarboxylic aminoaciduria, and lysinuric protein intolerance, affecting separate groups of amino acids. Recent advances in the molecular identification of apical neutral amino acid transporters has shed a light on the molecular basis of Hartnup disorder and iminoglycinuria. PMID:18400692

  7. Electrogenicity of Na(+)-coupled bile acid transporters.

    PubMed Central

    Weinman, S. A.

    1997-01-01

    The Na(+)-bile acid cotransporters NTCP and ASBT are largely responsible for the Na(+)-dependent bile acid uptake in hepatocytes and intestinal epithelial cells, respectively. This review discusses the experimental methods available for demonstrating electrogenicity and examines the accumulating evidence that coupled transport by each of these bile acid transporters is electrogenic. The evidence includes measurements of transport-associated currents by patch clamp electrophysiological techniques, as well as direct measurement of fluorescent bile acid transport rates in whole cell patch clamped, voltage clamped cells. The results support a Na+:bile acid coupling stoichiometry of 2:1. PMID:9626753

  8. Promising antioxidant and anticancer (human breast cancer) oxidovanadium(IV) complex of chlorogenic acid. Synthesis, characterization and spectroscopic examination on the transport mechanism with bovine serum albumin.

    PubMed

    Naso, Luciana G; Valcarcel, María; Roura-Ferrer, Meritxell; Kortazar, Danel; Salado, Clarisa; Lezama, Luis; Rojo, Teofilo; González-Baró, Ana C; Williams, Patricia A M; Ferrer, Evelina G

    2014-06-01

    A new chlorogenate oxidovanadium complex (Na[VO(chlorog)(H2O)3].4H2O) was synthesized by using Schlenk methodology in the course of a reaction at inert atmosphere in which deprotonated chlorogenic acid ligand binds to oxidovanadium(IV) in a reaction experiment controlled via EPR technique and based in a species distribution diagram. The compound was characterized by FTIR, EPR, UV-visible and diffuse reflectance spectroscopies and thermogravimetric, differential thermal and elemental analyses. The ligand and the complex were tested for their antioxidant effects on DPPH (1,1-diphenyl-2-picrylhydrazyl radical), ABTS(+) (radical cation of 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt), O2(-), OH and ROO radicals and their cytotoxic activity on different cancer cell lines (SKBR3, T47D and MDAMB231) and primary human mammary epithelial cells. The complex behaved as good antioxidant agent with strongest inhibitory effects on O2(-), OH and ROO radicals and exhibited selective cytotoxicity against SKBR3 cancer cell line. Albumin interaction experiments denoted high affinity toward the complex and its calculated binding constant was indicative of a strong binding to the protein. Based on this study, it is hypothesized that Na[VO(chlorog)(H2O)3].4H2O would be a promising candidate for further evaluation as an antioxidant and anticancer agent. PMID:24681549

  9. Acid tolerance mechanisms utilized by Streptococcus mutans

    PubMed Central

    Matsui, Robert; Cvitkovitch, Dennis

    2010-01-01

    Since its discovery in 1924 by J Clarke, Streptococcus mutans has been the focus of rigorous research efforts due to its involvement in caries initiation and progression. Its ability to ferment a range of dietary carbohydrates can rapidly drop the external environmental pH, thereby making dental plaque inhabitable to many competing species and can ultimately lead to tooth decay. Acid production by this oral pathogen would prove suicidal if not for its remarkable ability to withstand the acid onslaught by utilizing a wide variety of highly evolved acid-tolerance mechanisms. The elucidation of these mechanisms will be discussed, serving as the focus of this review. PMID:20210551

  10. Mfsd2a is a transporter for the essential omega-3 fatty acid docosahexaenoic acid.

    PubMed

    Nguyen, Long N; Ma, Dongliang; Shui, Guanghou; Wong, Peiyan; Cazenave-Gassiot, Amaury; Zhang, Xiaodong; Wenk, Markus R; Goh, Eyleen L K; Silver, David L

    2014-05-22

    Docosahexaenoic acid (DHA) is an omega-3 fatty acid that is essential for normal brain growth and cognitive function. Consistent with its importance in the brain, DHA is highly enriched in brain phospholipids. Despite being an abundant fatty acid in brain phospholipids, DHA cannot be de novo synthesized in brain and must be imported across the blood-brain barrier, but mechanisms for DHA uptake in brain have remained enigmatic. Here we identify a member of the major facilitator superfamily--Mfsd2a (previously an orphan transporter)--as the major transporter for DHA uptake into brain. Mfsd2a is found to be expressed exclusively in endothelium of the blood-brain barrier of micro-vessels. Lipidomic analysis indicates that Mfsd2a-deficient (Mfsd2a-knockout) mice show markedly reduced levels of DHA in brain accompanied by neuronal cell loss in hippocampus and cerebellum, as well as cognitive deficits and severe anxiety, and microcephaly. Unexpectedly, cell-based studies indicate that Mfsd2a transports DHA in the form of lysophosphatidylcholine (LPC), but not unesterified fatty acid, in a sodium-dependent manner. Notably, Mfsd2a transports common plasma LPCs carrying long-chain fatty acids such LPC oleate and LPC palmitate, but not LPCs with less than a 14-carbon acyl chain. Moreover, we determine that the phosphor-zwitterionic headgroup of LPC is critical for transport. Importantly, Mfsd2a-knockout mice have markedly reduced uptake of labelled LPC DHA, and other LPCs, from plasma into brain, demonstrating that Mfsd2a is required for brain uptake of DHA. Our findings reveal an unexpected essential physiological role of plasma-derived LPCs in brain growth and function. PMID:24828044

  11. Overview on mechanisms of acetic acid resistance in acetic acid bacteria.

    PubMed

    Wang, Bin; Shao, Yanchun; Chen, Fusheng

    2015-02-01

    Acetic acid bacteria (AAB) are a group of gram-negative or gram-variable bacteria which possess an obligate aerobic property with oxygen as the terminal electron acceptor, meanwhile transform ethanol and sugar to corresponding aldehydes, ketones and organic acids. Since the first genus Acetobacter of AAB was established in 1898, 16 AAB genera have been recorded so far. As the main producer of a world-wide condiment, vinegar, AAB have evolved an elegant adaptive system that enables them to survive and produce a high concentration of acetic acid. Some researches and reviews focused on mechanisms of acid resistance in enteric bacteria and made the mechanisms thoroughly understood, while a few investigations did in AAB. As the related technologies with proteome, transcriptome and genome were rapidly developed and applied to AAB research, some plausible mechanisms conferring acetic acid resistance in some AAB strains have been published. In this review, the related mechanisms of AAB against acetic acid with acetic acid assimilation, transportation systems, cell morphology and membrane compositions, adaptation response, and fermentation conditions will be described. Finally, a framework for future research for anti-acid AAB will be provided. PMID:25575804

  12. Shared Molecular Mechanisms of Membrane Transporters.

    PubMed

    Drew, David; Boudker, Olga

    2016-06-01

    The determination of the crystal structures of small-molecule transporters has shed light on the conformational changes that take place during structural isomerization from outward- to inward-facing states. Rather than using a simple rocking movement of two bundles around a central substrate-binding site, it has become clear that even the most simplistic transporters utilize rearrangements of nonrigid bodies. In the most dramatic cases, one bundle is fixed while the other, structurally divergent, bundle carries the substrate some 18 Å across the membrane, which in this review is termed an elevator alternating-access mechanism. Here, we compare and contrast rocker-switch, rocking-bundle, and elevator alternating-access mechanisms to highlight shared features and novel refinements to the basic alternating-access model. PMID:27023848

  13. The D-amino acid transport by the invertebrate SLC6 transporters KAAT1 and CAATCH1 from Manduca sexta.

    PubMed

    Vollero, Alessandra; Imperiali, Francesca G; Cinquetti, Raffaella; Margheritis, Eleonora; Peres, Antonio; Bossi, Elena

    2016-02-01

    The ability of the SLC6 family members, the insect neutral amino acid cotransporter KAAT1(K(+)-coupled amino acid transporter 1) and its homologous CAATCH1(cation anion activated amino acid transporter/channel), to transport D-amino acids has been investigated through heterologous expression in Xenopus laevis oocytes and electrophysiological techniques. In the presence of D-isomers of leucine, serine, and proline, the msKAAT1 generates inward, transport-associated, currents with variable relative potencies, depending on the driving ion Na(+) or K(+). Higher concentrations of D-leucine (≥1 mmol/L) give rise to an anomalous response that suggests the existence of a second binding site with inhibitory action on the transport process. msCAATCH1 is also able to transport the D-amino acids tested, including D-leucine, whereas L-leucine acts as a blocker. A similar behavior is exhibited by the KAAT1 mutant S308T, confirming the relevance of the residue in this position in L-leucine binding and the different interaction of D-leucine with residues involved in transport mechanism. D-leucine and D-serine on various vertebrate orthologs B(0)AT1 (SLC6A19) elicited only a very small current and singular behavior was not observed, indicating that it is specific of the insect neutral amino acid transporters. These findings highlight the relevance of D-amino acid absorption in the insect nutrition and metabolism and may provide new evidences in the molecular transport mechanism of SLC6 family. PMID:26884475

  14. How LeuT shapes our understanding of the mechanisms of sodium-coupled neurotransmitter transporters.

    PubMed

    Penmatsa, Aravind; Gouaux, Eric

    2014-03-01

    Neurotransmitter transporters are ion-coupled symporters that drive the uptake of neurotransmitters from neural synapses. In the past decade, the structure of a bacterial amino acid transporter, leucine transporter (LeuT), has given valuable insights into the understanding of architecture and mechanism of mammalian neurotransmitter transporters. Different conformations of LeuT, including a substrate-free state, inward-open state, and competitive and non-competitive inhibitor-bound states, have revealed a mechanistic framework for the transport and transport inhibition of neurotransmitters. The current review integrates our understanding of the mechanistic and pharmacological properties of eukaryotic neurotransmitter transporters obtained through structural snapshots of LeuT. PMID:23878376

  15. Structural Determinants for Transport Across the Intestinal Bile Acid Transporter Using C-24 Bile Acid Conjugates

    PubMed Central

    Rais, Rana; Acharya, Chayan; MacKerell, Alexander D.; Polli, James E.

    2010-01-01

    The human apical sodium dependent bile acid transporter (hASBT) re-absorbs gram quantities of bile acid daily and is a potential prodrug target to increase oral drug absorption. In the absence of a high resolution hASBT crystal structure, 3D-QSAR modeling may prove beneficial in designing prodrug targets to hASBT. The objective was to derive a conformationally sampled pharmacophore 3D–QSAR (CSP-SAR) model for the uptake of bile acid conjugates by hASBT. A series of bile acid conjugates of glutamyl chenodeoxycholate were evaluated in terms of Km and normalized Vmax(normVmax) using hASBT-MDCK cells. All mono-anionic conjugates were potent substrates. Dianions, cations and zwitterions, which bound with a high affinity, were not substrates. CSP-SAR models were derived using structural and physicochemical descriptors, and evaluated via cross-validation. The best CSP-SAR model for Km included two structural and two physiochemical descriptors, where substrate hydrophobicity enhanced affinity. A best CSP-SAR model for Km/normVmax employed one structural and three physicochemical descriptors, also indicating hydrophobicity enhanced efficiency. Overall, the bile acid C-24 region accommodated a range of substituted anilines, provided a single negative charge was present near C-24. In comparing uptake findings to prior inhibition results, increased hydrophobicity enhanced activity, with dianions and zwitterions hindering activity. PMID:20939504

  16. The mechanism of folate transport in rabbit reticulocytes

    PubMed Central

    Bobzien, William F.; Goldman, David

    1972-01-01

    Folate transport in phenylhydrazine-induced rabbit reticulocytes was studied with the non-metabolized folate-analog, methotrexate. The time-course of methotrexate uptake into a mixed population of reticulocytes and mature erythrocytes is a two-component process consisting of a small, but rapid, initial uptake phase followed by a much slower uptake component which remains essentially constant over the period of observation. The velocity of the latter uptake component is directly proportional to the per cent reticulocytes and appears to represent a unidirectional influx of methotrexate into these cells. Uptake of methotrexate into reticulocytes was found to have the following characteristics: (a) temperature sensitivity, Q10 of 4; (b) uptake velocity as a function of the extracellular methotrexate concentration approximated Michaelis-Menten kinetics with a maximum transport velocity of 48 pmoles/min per g dry wt; the extracellular methotrexate level at which the uptake velocity was one-half maximum was 1.4 μM; (c) 5-formyltetrahydrofolate markedly inhibited methotrexate uptake but pteroylglutamic acid inhibition was weak; (d) uptake was stimulated in cells preincubated with 5-formyltetrahydrofolate, indicative of hetero-exchange diffusion; (e) uptake was independent of extracellular sodium but was inhibited by anions including nitrate, phosphate, and glucose-6-phosphate; (f) uptake was enhanced by azide plus iodoacetate. These data indicate that folate transport in rabbit reticulocytes is mediated by a carrier mechanism which disappears with reticulocyte maturation. The mechanism of folate transport in rabbit reticulocytes is qualitatively similar to tumor cells previously studied; both appear to have an energy-dependent mechanism limiting folate uptake, and influx in both is inhibited by structurally unrelated inorganic and organic anions. These studies suggest that circulating pteroylglutamic acid is of little importance in meeting the folate requirements of

  17. ABC transporter AtABCG25 is involved in abscisic acid transport and responses

    PubMed Central

    Kuromori, Takashi; Miyaji, Takaaki; Yabuuchi, Hikaru; Shimizu, Hidetada; Sugimoto, Eriko; Kamiya, Asako; Moriyama, Yoshinori; Shinozaki, Kazuo

    2010-01-01

    Abscisic acid (ABA) is one of the most important phytohormones involved in abiotic stress responses, seed maturation, germination, and senescence. ABA is predominantly produced in vascular tissues and exerts hormonal responses in various cells, including guard cells. Although ABA responses require extrusion of ABA from ABA-producing cells in an intercellular ABA signaling pathway, the transport mechanisms of ABA through the plasma membrane remain unknown. Here we isolated an ATP-binding cassette (ABC) transporter gene, AtABCG25, from Arabidopsis by genetically screening for ABA sensitivity. AtABCG25 was expressed mainly in vascular tissues. The fluorescent protein-fused AtABCG25 was localized at the plasma membrane in plant cells. In membrane vesicles derived from AtABCG25-expressing insect cells, AtABCG25 exhibited ATP-dependent ABA transport. The AtABCG25-overexpressing plants showed higher leaf temperatures, implying an influence on stomatal regulation. These results strongly suggest that AtABCG25 is an exporter of ABA and is involved in the intercellular ABA signaling pathway. The presence of the ABA transport mechanism sheds light on the active control of multicellular ABA responses to environmental stresses among plant cells. PMID:20133881

  18. Pyrolysis Mechanisms of Aromatic Carboxylic Acids

    SciTech Connect

    Britt, P.F.; Eskay, T.P.; Buchanan, A.C. III

    1997-12-31

    Although decarboxylation of carboxylic acids is widely used in organic synthesis, there is limited mechanistic information on the uncatalyzed reaction pathways of aromatic carboxylic acids at 300-400 {degrees} C. The pyrolysis mechanisms of 1,2-(3,3-dicarboxyphenyl)ethane, 1,2-(4,4-dicarboxylphenyl)ethane, 1-(3-carboxyphenyl)-2-(4- biphenyl)ethane, and substituted benzoic acids have been investigated at 325-425 {degrees} C neat and diluted in an inert solvent. Decarboxylation is the dominant pyrolysis path. Arrhenius parameters, substituent effects, and deuterium isotope effects are consistent with decarboxylation by an electrophilic aromatic substitution reaction. Pyrolysis of benzoic acid in naphthalene, as a solvent, produces significant amounts of 1- and 2-phenylnaphthalenes. The mechanistic pathways for decarboxylation and arylation with be presented.

  19. Inactivation of the glutamine/amino acid transporter ASCT2 by 1,2,3-dithiazoles: proteoliposomes as a tool to gain insights in the molecular mechanism of action and of antitumor activity

    SciTech Connect

    Oppedisano, Francesca; Catto, Marco; Koutentis, Panayiotis A.; Nicolotti, Orazio; Pochini, Lorena; Koyioni, Maria; Introcaso, Antonellina; Michaelidou, Sophia S.; Carotti, Angelo; Indiveri, Cesare

    2012-11-15

    The ASCT2 transport system catalyses a sodium-dependent antiport of glutamine and other neutral amino acids which is involved in amino acid metabolism. A library of 1,2,3-dithiazoles was designed, synthesized and evaluated as inhibitors of the glutamine/amino acid ASCT2 transporter in the model system of proteoliposomes reconstituted with the rat liver transporter. Fifteen of the tested compounds at concentration of 20 μM or below, inhibited more than 50% the glutamine/glutamine antiport catalysed by the reconstituted transporter. These good inhibitors bear a phenyl ring with electron withdrawing substituents. The inhibition was reversed by 1,4-dithioerythritol indicating that the effect was likely owed to the formation of mixed sulfides with the protein's Cys residue(s). A dose–response analysis of the most active compounds gave IC{sub 50} values in the range of 3–30 μM. Kinetic inhibition studies indicated a non-competitive inhibition, presumably because of a potential covalent interaction of the dithiazoles with cysteine thiol groups that are not located at the substrate binding site. Indeed, computational studies using a homology structural model of ASCT2 transporter, suggested as possible binding targets, Cys-207 or Cys-210, that belong to the CXXC motif of the protein. -- Highlights: ► Non‐competitive inhibition of ASCT2 by 1,2,3-dithiazoles was studied in proteoliposomes. ► Different 1,2,3-dithiazoles were synthesized and evaluated as transporter inhibitors. ► Many compounds potently inhibited the glutamine/glutamine antiport catalyzed by ASCT2. ► The inhibition was reversed by DTE indicating reaction with protein Cys. ► The most active compounds gave IC{sub 50} in the range of 3–30 μM.

  20. Expression pattern of peptide and amino acid genes in digestive tract of transporter juvenile turbot ( Scophthalmus maximus L.)

    NASA Astrophysics Data System (ADS)

    Xu, Dandan; He, Gen; Mai, Kangsen; Zhou, Huihui; Xu, Wei; Song, Fei

    2016-04-01

    Turbot ( Scophthalmus maximus L.), a carnivorous fish species with high dietary protein requirement, was chosen to examine the expression pattern of peptide and amino acid transporter genes along its digestive tract which was divided into six segments including stomach, pyloric caeca, rectum, and three equal parts of the remainder of the intestine. The results showed that the expression of two peptide and eleven amino acid transporters genes exhibited distinct patterns. Peptide transporter 1 (PepT1) was rich in proximal intestine while peptide transporter 2 (PepT2) was abundant in distal intestine. A number of neutral and cationic amino acid transporters expressed richly in whole intestine including B0-type amino acid transporter 1 (B0AT1), L-type amino acid transporter 2 (LAT2), T-type amino acid transporter 1 (TAT1), proton-coupled amino acid transporter 1 (PAT1), y+L-type amino acid transporter 1 (y+LAT1), and cationic amino acid transporter 2 (CAT2) while ASC amino acid transporter 2 (ASCT2), sodium-coupled neutral amino acid transporter 2 (SNAT2), and y+L-type amino acid transporter 2 (y+LAT2) abundantly expressed in stomach. In addition, system b0,+ transporters (rBAT and b0,+AT) existed richly in distal intestine. These findings comprehensively characterized the distribution of solute carrier family proteins, which revealed the relative importance of peptide and amino acid absorption through luminal membrane. Our findings are helpful to understand the mechanism of the utilization of dietary protein in fish with a short digestive tract.

  1. Role for Ion Transport in Porcine Vocal Fold Epithelial Defense to Acid Challenge

    PubMed Central

    Erickson-Levendoski, Elizabeth; Sivasankar, M. Preeti

    2012-01-01

    Objective The vocal fold epithelium is routinely exposed to gastric contents, including acid and pepsin, during laryngopharyngeal reflux events. The epithelium may possess intrinsic defenses to reflux. The first objective of the current study was to examine whether vocal fold epithelial ion transport is one potential mechanism of defense to gastric contents. The second objective was to determine whether ion transport in response to gastric contents is associated with the secretion of bicarbonate. Study Design Prospective design in excised porcine larynges. Setting Laboratory. Subjects and Methods Porcine vocal folds (N = 56) were exposed on the luminal surface to acid, pepsin, or sham challenges. Ion transport at baseline and following challenge exposure was measured using electrophysiological techniques. To examine specific ion transport mechanisms, vocal folds were pretreated with either a sodium channel blocker or bicarbonate channel blocker. Results Within 60 seconds of acid but not pepsin exposure, there was a significant increase in ion transport. This rapid increase in ion transport was transient and related to bicarbonate secretion. Conclusion The current data suggest that porcine vocal folds immediately increase bicarbonate secretion following exposure to acid. Bicarbonate secretion may act to neutralize acid. These findings contribute to the identification of the mechanisms underlying vocal fold defense to reflux and offer implications for the development of treatments for reflux-induced vocal fold injury. PMID:22086905

  2. Molecular cloning of mouse amino acid transport system B0, a neutral amino acid transporter related to Hartnup disorder.

    PubMed

    Bröer, Angelika; Klingel, Karin; Kowalczuk, Sonja; Rasko, John E J; Cavanaugh, Juleen; Bröer, Stefan

    2004-06-01

    Resorption of amino acids in kidney and intestine is mediated by transporters, which prefer groups of amino acids with similar physico-chemical properties. It is generally assumed that most neutral amino acids are transported across the apical membrane of epithelial cells by system B(0). Here we have characterized a novel member of the Na(+)-dependent neurotransmitter transporter family (B(0)AT1) isolated from mouse kidney, which shows all properties of system B(0). Flux experiments showed that the transporter is Na(+)-dependent, electrogenic, and actively transports most neutral amino acids but not anionic or cationic amino acids. Superfusion of mB(0)AT1-expressing oocytes with neutral amino acids generated inward currents, which were proportional to the fluxes observed with labeled amino acids. In situ hybridization showed strong expression in intestinal microvilli and in the proximal tubule of the kidney. Expression of mouse B(0)AT1 was restricted to kidney, intestine, and skin. It is generally assumed that mutations of the system B(0) transporter underlie autosomal recessive Hartnup disorder. In support of this notion mB(0)AT1 is located on mouse chromosome 13 in a region syntenic to human chromosome 5p15, the locus of Hartnup disorder. Thus, the human homologue of this transporter is an excellent functional and positional candidate for Hartnup disorder. PMID:15044460

  3. Insulin increases mRNA abundance of the amino acid transporter SLC7A5/LAT1 via an mTORC1‐dependent mechanism in skeletal muscle cells

    PubMed Central

    Walker, Dillon K.; Drummond, Micah J.; Dickinson, Jared M.; Borack, Michael S.; Jennings, Kristofer; Volpi, Elena; Rasmussen, Blake B.

    2014-01-01

    Abstract Amino acid transporters (AATs) provide a link between amino acid availability and mammalian/mechanistic target of rapamycin complex 1 (mTORC1) activation although the direct relationship remains unclear. Previous studies in various cell types have used high insulin concentrations to determine the role of insulin on mTORC1 signaling and AAT mRNA abundance. However, this approach may limit applicability to human physiology. Therefore, we sought to determine the effect of insulin on mTORC1 signaling and whether lower insulin concentrations stimulate AAT mRNA abundance in muscle cells. We hypothesized that lower insulin concentrations would increase mRNA abundance of select AAT via an mTORC1‐dependent mechanism in C2C12 myotubes. Insulin (0.5 nmol/L) significantly increased phosphorylation of the mTORC1 downstream effectors p70 ribosomal protein S6 kinase 1 (S6K1) and ribosomal protein S6 (S6). A low rapamycin dose (2.5 nmol/L) significantly reduced the insulin‐(0.5 nmol/L) stimulated S6K1 and S6 phosphorylation. A high rapamycin dose (50 nmol/L) further reduced the insulin‐(0.5 nmol/L) stimulated phosphorylation of S6K1 and S6. Insulin (0.5 nmol/L) increased mRNA abundance of SLC38A2/SNAT2 (P ≤ 0.043) and SLC7A5/LAT1 (P ≤ 0.021) at 240 min and SLC36A1/PAT1 (P = 0.039) at 30 min. High rapamycin prevented an increase in SLC38A2/SNAT2 (P = 0.075) and SLC36A1/PAT1 (P ≥ 0.06) mRNA abundance whereas both rapamycin doses prevented an increase in SLC7A5/LAT1 (P ≥ 0.902) mRNA abundance. We conclude that a low insulin concentration increases SLC7A5/LAT1 mRNA abundance in an mTORC1‐dependent manner in skeletal muscle cells. PMID:24760501

  4. Transport, metabolism, and effect of chronic feeding of lagodeoxycholic acid. A new, natural bile acid.

    PubMed

    Schmassmann, A; Angellotti, M A; Clerici, C; Hofmann, A F; Ton-Nu, H T; Schteingart, C D; Marcus, S N; Hagey, L R; Rossi, S S; Aigner, A

    1990-10-01

    Ursodeoxycholic acid, the 7 beta-hydroxy epimer of chenodeoxycholic acid, is more hydrophilic and less hepatotoxic than chenodeoxycholic acid. Because "lagodeoxycholic acid," the 12 beta-hydroxy epimer of deoxycholic acid, is also more hydrophilic than deoxycholic acid, it was hypothesized that it should also be less hepatotoxic than deoxycholic acid. To test this, lagodeoxycholic acid was synthesized, and its transport and metabolism were examined in the rat, rabbit, and hamster. The taurine conjugate of lagodeoxycholic acid was moderately well transported by the perfused rat ileum (Tmax = 2 mumol/min.kg). In rats and hamsters with biliary fistulas, the taurine conjugate of lagodeoxycholic acid was well transported by the liver with a Tmax greater than 20 mumol/min.kg; for the taurine conjugate of deoxycholic acid, doses infused at a rate greater than 2.5 mumol/min.kg are known to cause cholestasis and death. Hepatic biotransformation of lagodeoxycholic acid in the rabbit was limited to conjugation with glycine; in the hamster, lagodeoxycholic acid was conjugated with glycine or taurine; in addition, 7-hydroxylation occurred to a slight extent (approximately 10%). When lagodeoxycholic acid was instilled in the rabbit colon, it was absorbed as such although within hours it was progressively epimerized by bacteria to deoxycholic acid. When injected intravenously and allowed to circulate enterohepatically, lagodeoxycholic acid was largely epimerized to deoxycholic acid in 24 hours. Surgical creation of a distal ileostomy abolished epimerization in the rabbit, indicating that exposure to colonic bacterial enzymes was required for the epimerization. Lagodeoxycholic acid was administered for 3 weeks at a dose of 180 mumol/day (0.1% by weight of a chow diet; 2-4 times the endogenous bile acid synthesis rate); other groups received identical doses of deoxycholic acid (hamster) or cholyltaurine, a known precursor of deoxycholic acid (rabbit). After 3 weeks of

  5. Analysis of Bacillus subtilis hut operon expression indicates that histidine-dependent induction is mediated primarily by transcriptional antitermination and that amino acid repression is mediated by two mechanisms: regulation of transcription initiation and inhibition of histidine transport.

    PubMed Central

    Wray, L V; Fisher, S H

    1994-01-01

    Expression of the Bacillus subtilis hut operon is induced by histidine and subject to regulation by carbon catabolite repression and amino acid repression. A set of hut-lacZ transcriptional fusions was constructed and used to identify the cis-acting sites required for histidine induction and amino acid repression. Histidine induction was found to be primarily mediated by transcriptional antitermination at a palindromic sequence located immediately downstream of the first structural gene in the hut operon, hutP. High levels of histidine induction were observed only in hut-lacZ fusions which contained this palindromic sequence. The hutC1 mutation, which results in constitutive expression of the hut operon, was sequenced and found to contain a GC to TA transversion located within the stem-loop structure. Transcription of hut DNA in vitro revealed that the palindromic structure functions as a transcriptional terminator with wild-type hut DNA but not with hutC1 DNA. Two sites were found to be involved in amino acid repression of hut expression: (i) an operator, hutOA, which lies downstream of the hut promoter, and (ii) the hut terminator. The rate of [14C]histidine uptake in amino acid-grown cells was sixfold lower than that seen in cells grown without amino acids. Thus, inhibition of histidine transport in amino acid-grown cells indirectly regulates hut expression by interfering with histidine induction at the hut terminator. Images PMID:8071225

  6. Sialic acid acquisition in bacteria-one substrate, many transporters.

    PubMed

    Thomas, Gavin H

    2016-06-15

    The sialic acids are a family of 9-carbon sugar acids found predominantly on the cell-surface glycans of humans and other animals within the Deuterostomes and are also used in the biology of a wide range of bacteria that often live in association with these animals. For many bacteria sialic acids are simply a convenient source of food, whereas for some pathogens they are also used in immune evasion strategies. Many bacteria that use sialic acids derive them from the environment and so are dependent on sialic acid uptake. In this mini-review I will describe the discovery and characterization of bacterial sialic acids transporters, revealing that they have evolved multiple times across multiple diverse families of transporters, including the ATP-binding cassette (ABC), tripartite ATP-independent periplasmic (TRAP), major facilitator superfamily (MFS) and sodium solute symporter (SSS) transporter families. In addition there is evidence for protein-mediated transport of sialic acids across the outer membrane of Gram negative bacteria, which can be coupled to periplasmic processing of different sialic acids to the most common form, β-D-N-acetylneuraminic acid (Neu5Ac) that is most frequently taken up into the cell. PMID:27284039

  7. Sialic Acid Transport Contributes to Pneumococcal Colonization ▿

    PubMed Central

    Marion, Carolyn; Burnaugh, Amanda M.; Woodiga, Shireen A.; King, Samantha J.

    2011-01-01

    Streptococcus pneumoniae is a major cause of pneumonia and meningitis. Airway colonization is a necessary precursor to disease, but little is known about how the bacteria establish and maintain colonization. Carbohydrates are required as a carbon source for pneumococcal growth and, therefore, for colonization. Free carbohydrates are not readily available in the naso-oropharynx; however, N- and O-linked glycans are common in the airway. Sialic acid is the most common terminal modification on N- and O-linked glycans and is likely encountered frequently by S. pneumoniae in the airway. Here we demonstrate that sialic acid supports pneumococcal growth when provided as a sole carbon source. Growth on sialic acid requires import into the bacterium. Three genetic regions have been proposed to encode pneumococcal sialic acid transporters: one sodium solute symporter and two ATP binding cassette (ABC) transporters. Data demonstrate that one of these, satABC, is required for transport of sialic acid. A satABC mutant displayed significantly reduced growth on both sialic acid and the human glycoprotein alpha-1. The importance of satABC for growth on human glycoprotein suggests that sialic acid transport may be important in vivo. Indeed, the satABC mutant was significantly reduced in colonization of the murine upper respiratory tract. This work demonstrates that S. pneumoniae is able to use sialic acid as a sole carbon source and that utilization of sialic acid is likely important during pneumococcal colonization. PMID:21189320

  8. Regulation of renal amino acid transporters during metabolic acidosis.

    PubMed

    Moret, Caroline; Dave, Mital H; Schulz, Nicole; Jiang, Jean X; Verrey, Francois; Wagner, Carsten A

    2007-02-01

    The kidney plays a major role in acid-base homeostasis by adapting the excretion of acid equivalents to dietary intake and metabolism. Urinary acid excretion is mediated by the secretion of protons and titratable acids, particularly ammonia. NH(3) is synthesized in proximal tubule cells from glutamine taken up via specific amino acid transporters. We tested whether kidney amino acid transporters are regulated in mice in which metabolic acidosis was induced with NH(4)Cl. Blood gas and urine analysis confirmed metabolic acidosis. Real-time RT-PCR was performed to quantify the mRNAs of 16 amino acid transporters. The mRNA of phosphoenolpyruvate carboxykinase (PEPCK) was quantified as positive control for the regulation and that of GAPDH, as internal standard. In acidosis, the mRNA of kidney system N amino acid transporter SNAT3 (SLC38A3/SN1) showed a strong induction similar to that of PEPCK, whereas all other tested mRNAs encoding glutamine or glutamate transporters were unchanged or reduced in abundance. At the protein level, Western blotting and immunohistochemistry demonstrated an increased abundance of SNAT3 and reduced expression of the basolateral cationic amino acid/neutral amino acid exchanger subunit y(+)-LAT1 (SLC7A7). SNAT3 was localized to the basolateral membrane of the late proximal tubule S3 segment in control animals, whereas its expression was extended to the earlier S2 segment of the proximal tubule during acidosis. Our results suggest that the selective regulation of SNAT3 and y(+)LAT1 expression may serve a major role in the renal adaptation to acid secretion and thus for systemic acid-base balance. PMID:17003226

  9. Allosteric Mechanisms of Molecular Machines at the Membrane: Transport by Sodium-Coupled Symporters.

    PubMed

    LeVine, Michael V; Cuendet, Michel A; Khelashvili, George; Weinstein, Harel

    2016-06-01

    Solute transport across cell membranes is ubiquitous in biology as an essential physiological process. Secondary active transporters couple the unfavorable process of solute transport against its concentration gradient to the energetically favorable transport of one or several ions. The study of such transporters over several decades indicates that their function involves complex allosteric mechanisms that are progressively being revealed in atomistic detail. We focus on two well-characterized sodium-coupled symporters: the bacterial amino acid transporter LeuT, which is the prototype for the "gated pore" mechanism in the mammalian synaptic monoamine transporters, and the archaeal GltPh, which is the prototype for the "elevator" mechanism in the mammalian excitatory amino acid transporters. We present the evidence for the role of allostery in the context of a quantitative formalism that can reconcile biochemical and biophysical data and thereby connects directly to recent insights into the molecular structure and dynamics of these proteins. We demonstrate that, while the structures and mechanisms of these transporters are very different, the available data suggest a common role of specific models of allostery in their functions. We argue that such allosteric mechanisms appear essential not only for sodium-coupled symport in general but also for the function of other types of molecular machines in the membrane. PMID:26892914

  10. Mechanisms of abscisic acid-mediated control of stomatal aperture.

    PubMed

    Munemasa, Shintaro; Hauser, Felix; Park, Jiyoung; Waadt, Rainer; Brandt, Benjamin; Schroeder, Julian I

    2015-12-01

    Drought stress triggers an increase in the level of the plant hormone abscisic acid (ABA), which initiates a signaling cascade to close stomata and reduce water loss. Recent studies have revealed that guard cells control cytosolic ABA concentration through the concerted actions of biosynthesis, catabolism as well as transport across membranes. Substantial progress has been made at understanding the molecular mechanisms of how the ABA signaling core module controls the activity of anion channels and thereby stomatal aperture. In this review, we focus on our current mechanistic understanding of ABA signaling in guard cells including the role of the second messenger Ca(2+) as well as crosstalk with biotic stress responses. PMID:26599955

  11. Acid aerosol transport episodes in Toronto, Ontario

    SciTech Connect

    Thurston, G.D. . Inst. of Environmental Medicine); Waldman, J. )

    1987-01-01

    In this paper, the authors examine the pollution data collected during a 1986 field study in order to assess the nature and sources of acidic aerosols in the Toronto metropolitan area during this period. Through the examination of the continuous and filter aerosol data, isobaric back-trajectories of air masses, weather maps, and available trace element data, assessment are made of the character and possible sources of acid aerosols in this Southern Ontario city.

  12. Physiological Adaptation to the Loss of Amino Acid Transport Ability

    PubMed Central

    DeBusk, Ruth M.; Ogilvie-Villa, Susan

    1982-01-01

    A strain of Neurospora crassa devoid of constitutive amino acid transport ability can utilize arginine as the sole nitrogen source. Nitrogen starvation, presence of arginine, and mutational inactivation of the general permease are key factors in signaling production of an extracellular enzyme which removes the alpha-amino group from the amino acid. PMID:6214547

  13. Nucleic acids encoding metal uptake transporters and their uses

    DOEpatents

    Schroeder, Julian I.; Antosiewicz, Danuta M.; Schachtman, Daniel P.; Clemens, Stephan

    1999-01-01

    The invention provides LCT1 nucleic acids which encode metal ion uptake transporters. The invention also provides methods of modulating heavy metal and alkali metal uptake in plants. The methods involve producing transgenic plants comprising a recombinant expression cassette containing an LCT1 nucleic acid linked to a plant promoter.

  14. Role of ion transporters in the bile acid-induced esophageal injury.

    PubMed

    Laczkó, Dorottya; Rosztóczy, András; Birkás, Klaudia; Katona, Máté; Rakonczay, Zoltán; Tiszlavicz, László; Róka, Richárd; Wittmann, Tibor; Hegyi, Péter; Venglovecz, Viktória

    2016-07-01

    Barrett's esophagus (BE) is considered to be the most severe complication of gastro-esophageal reflux disease (GERD), in which the prolonged, repetitive episodes of combined acidic and biliary reflux result in the replacement of the squamous esophageal lining by columnar epithelium. Therefore, the acid-extruding mechanisms of esophageal epithelial cells (EECs) may play an important role in the defense. Our aim was to identify the presence of acid/base transporters on EECs and to investigate the effect of bile acids on their expressions and functions. Human EEC lines (CP-A and CP-D) were acutely exposed to bile acid cocktail (BAC) and the changes in intracellular pH (pHi) and Ca(2+) concentration ([Ca(2+)]i) were measured by microfluorometry. mRNA and protein expression of ion transporters was investigated by RT-PCR, Western blot, and immunohistochemistry. We have identified the presence of a Na(+)/H(+) exchanger (NHE), Na(+)/HCO3 (-) cotransporter (NBC), and a Cl(-)-dependent HCO3 (-) secretory mechanism in CP-A and CP-D cells. Acute administration of BAC stimulated HCO3 (-) secretion in both cell lines and the NHE activity in CP-D cells by an inositol triphosphate-dependent calcium release. Chronic administration of BAC to EECs increased the expression of ion transporters compared with nontreated cells. A similar expression pattern was observed in biopsy samples from BE compared with normal epithelium. We have shown that acute administration of bile acids differently alters ion transport mechanisms of EECs, whereas chronic exposure to bile acids increases the expression of acid/base transporters. We speculate that these adaptive processes of EECs represent an important mucosal defense against the bile acid-induced epithelial injury. PMID:27198194

  15. Charge transport mechanisms in phthalocyanine thin films

    NASA Astrophysics Data System (ADS)

    Colesniuc, Corneliu; Sharoni, Amos; Schuller, Ivan K.

    2008-03-01

    Devices consisting of phthalocyanine thin films sandwiched between gold electrodes were fabricated by organic molecular beam deposition. Samples with different organic layer thickness were deposited on sapphire substrates in-situ, using a shadow mask and a mobile sample holder controlled manually. The structural asymmetry of the devices determined by the different metal-organic interfaces is reflected in the I-V curves at positive and negative voltages. The logarithmic scale I-V plots can be fitted with linear functions of different slopes corresponding to different conduction regimes. At low temperatures a transition from the ohmic regime to a slope two space charge limited conduction mechanism is followed at higher voltages by a high slope linear dependence that tends to saturate when the voltage reaches maximum values. At higher temperatures the intermediary space charge limited regime disappears and the transition is from ohmic to high slope space charge limited. Traps with different energy and energy distribution determine the different conduction regimes. Shallow traps located at discrete energy levels control the transport at intermediate voltages while exponentially distributed traps determine the high voltage behavior. Work supported by AFOSR-MURI.

  16. Mechanism of ochratoxin A transport in kidney

    SciTech Connect

    Sokol, P.P.; Ripich, G.; Holohan, P.D.; Ross, C.R.

    1988-08-01

    The effect of the fungal metabolite (mycotoxin) Ochratoxin A (OTA) on the transport of p-amino(/sup 3/H)hippurate (PAH), a prototypic organic anion, was examined in renal brush border (BBMV) and basolateral membrane vesicles (BLMV). OTA was as effective an inhibitor of PAH uptake in both membranes as probenecid. The dose response curves for OTA in BBMV and BLMV gave IC50 values of 20 +/- 6 and 32 +/- 7 microM, respectively. The effect was specific since the transport of the organic cation N1-methylnicotinamide was not affected. The phenomenon of counterflow was studied to establish that OTA is translocated. OTA produced trans stimulation of PAH transport in both BBMV and BLMV, demonstrating that OTA is transported across both these membranes. The data suggest that OTA interacts with the PAH transport system in both BBMV and BLMV. We conclude that OTA transport in the kidney is mediated via the renal organic anion transport system.

  17. Molecular Evolution of Plant AAP and LHT Amino Acid Transporters.

    PubMed

    Tegeder, Mechthild; Ward, John M

    2012-01-01

    Nitrogen is an essential mineral nutrient and it is often transported within living organisms in its reduced form, as amino acids. Transport of amino acids across cellular membranes requires proteins, and here we report the phylogenetic analysis across taxa of two amino acid transporter families, the amino acid permeases (AAPs) and the lysine-histidine-like transporters (LHTs). We found that the two transporter families form two distinct groups in plants supporting the concept that both are essential. AAP transporters seem to be restricted to land plants. They were found in Selaginella moellendorffii and Physcomitrella patens but not in Chlorophyte, Charophyte, or Rhodophyte algae. AAPs were strongly represented in vascular plants, consistent with their major function in phloem (vascular tissue) loading of amino acids for sink nitrogen supply. LHTs on the other hand appeared prior to land plants. LHTs were not found in chlorophyte algae Chlamydomonas reinhardtii and Volvox carterii. However, the characean alga Klebsormidium flaccidum encodes KfLHT13 and phylogenetic analysis indicates that it is basal to land plant LHTs. This is consistent with the hypothesis that characean algae are ancestral to land plants. LHTs were also found in both S. moellendorffii and P. patens as well as in monocots and eudicots. To date, AAPs and LHTs have mainly been characterized in Arabidopsis (eudicots) and these studies provide clues to the functions of the newly identified homologs. PMID:22645574

  18. Molecular Evolution of Plant AAP and LHT Amino Acid Transporters

    PubMed Central

    Tegeder, Mechthild; Ward, John M.

    2012-01-01

    Nitrogen is an essential mineral nutrient and it is often transported within living organisms in its reduced form, as amino acids. Transport of amino acids across cellular membranes requires proteins, and here we report the phylogenetic analysis across taxa of two amino acid transporter families, the amino acid permeases (AAPs) and the lysine–histidine-like transporters (LHTs). We found that the two transporter families form two distinct groups in plants supporting the concept that both are essential. AAP transporters seem to be restricted to land plants. They were found in Selaginella moellendorffii and Physcomitrella patens but not in Chlorophyte, Charophyte, or Rhodophyte algae. AAPs were strongly represented in vascular plants, consistent with their major function in phloem (vascular tissue) loading of amino acids for sink nitrogen supply. LHTs on the other hand appeared prior to land plants. LHTs were not found in chlorophyte algae Chlamydomonas reinhardtii and Volvox carterii. However, the characean alga Klebsormidium flaccidum encodes KfLHT13 and phylogenetic analysis indicates that it is basal to land plant LHTs. This is consistent with the hypothesis that characean algae are ancestral to land plants. LHTs were also found in both S. moellendorffii and P. patens as well as in monocots and eudicots. To date, AAPs and LHTs have mainly been characterized in Arabidopsis (eudicots) and these studies provide clues to the functions of the newly identified homologs. PMID:22645574

  19. Regulation of amino acid transport in Escherichia coli by transcription termination factor rho.

    PubMed Central

    Quay, S C; Oxender, D L

    1977-01-01

    Amino acid transport rates and amino acid binding proteins were examined in a strain containing the rho-120 mutation (formerly SuA), which has been shown to lower the rho-dependent, ribonucleic acid-activated adenosine triphosphatase activity to 9% of the rho activity in the isogenic wild-type strain. Tryptophan and proline transport, which occur by membrane-bound systems, were not altered. On the other hand, arginine, histidine, leucine, isoleucine, and valine transport were variably increased by a factor of 1.4 to 5.0. Kinetics of leucine transport showed that the LIV (leucine, isoleucine, and valine)-I (binding protein-associated) transport system is increased 8.5-fold, whereas the LIV-II (membrane-bound) system is increased 1.5-fold in the rho mutant under leucine-limited growth conditions. The leucine binding protein is increased fourfold under the same growth conditions. The difference in leucine transport in these strains was greatest during leucine-limited growth; growth on complex media repressed both strains to the same transport activity. We propose that rho-dependent transcriptional termination is important for leucine-specific repression of branched-chain amino acid transport, although rho-independent regulation, presumably by a corepressor-aporepressor-type mechanism, must also occur. PMID:324970

  20. Acid aerosol transport episodes in Toronto, Ontario

    SciTech Connect

    Thurston, G.D.; Waldman, J.M.

    1987-07-01

    Authors used recently developed equipment to continuously monitor levels of H/sub 2/SO/sub 4/, NH/sub 4/HSO/sub 4/ and (NH/sub 4/)/sub 2/SO/sub 4/ concentrations in the ambient air outside Toronto, Ontario. These data were combined with 48-hour isobaric air mass back-trajectories ending in Toronto on each of the four days with highest acid (and sulfate) aerosol levels. The air masses with highest acid levels were found to have first passed over the SO/sub 2/ source region of the U.S. and then across the Great Lakes to Toronto. The role of ammonia as a modulator of aerosol acidity for eastern U.S. cities but not for Toronto (where the Great Lakes serve as ammonia sinks) is also discussed.

  1. Regulation of amino acid transporters in pluripotent cell populations in the embryo and in culture; novel roles for sodium-coupled neutral amino acid transporters.

    PubMed

    Tan, Boon Siang Nicholas; Rathjen, Peter D; Harvey, Alexandra J; Gardner, David K; Rathjen, Joy

    2016-08-01

    The developmental outcomes of preimplantation mammalian embryos are regulated directly by the surrounding microenvironment, and inappropriate concentrations of amino acids, or the loss of amino acid-sensing mechanisms, can be detrimental and impact further development. A specific role for l-proline in the differentiation of embryonic stem (ES) cells, a cell population derived from the blastocyst, has been shown in culture. l-proline acts as a signalling molecule, exerting its effects through cell uptake and subsequent metabolism. Uptake in ES cells occurs predominantly through the sodium-coupled neutral amino acid transporter 2, Slc38a2 (SNAT2). Dynamic expression of amino acid transporters has been shown in the early mammalian embryo, reflecting functional roles for amino acids in embryogenesis. The expression of SNAT2 and family member Slc38a1 (SNAT1) was determined in mouse embryos from the 2-cell stage through to the early post-implantation pre-gastrulation embryo. Key changes in expression were validated in cell culture models of development. Both transporters showed temporal dynamic expression patterns and changes in intracellular localisation as differentiation progressed. Changes in transporter expression likely reflect different amino acid requirements during development. Findings include the differential expression of SNAT1 in the inner and outer cells of the compacted morula and nuclear localisation of SNAT2 in the trophectoderm and placental lineages. Furthermore, SNAT2 expression was up-regulated in the epiblast prior to primitive ectoderm formation, an expression pattern consistent with a role for the transporter in later developmental decisions within the pluripotent lineage. We propose that the differential expression of SNAT2 in the epiblast provides evidence for an l-proline-mediated mechanism contributing to the regulation of embryonic development. PMID:27373508

  2. Acid-base transport by the renal proximal tubule

    PubMed Central

    Skelton, Lara A.; Boron, Walter F.; Zhou, Yuehan

    2015-01-01

    Each day, the kidneys filter 180 L of blood plasma, equating to some 4,300 mmol of the major blood buffer, bicarbonate (HCO3−). The glomerular filtrate enters the lumen of the proximal tubule (PT), and the majority of filtered HCO3− is reclaimed along the early (S1) and convoluted (S2) portions of the PT in a manner coupled to the secretion of H+ into the lumen. The PT also uses the secreted H+ to titrate non-HCO3− buffers in the lumen, in the process creating “new HCO3−” for transport into the blood. Thus, the PT – along with more distal renal segments – is largely responsible for regulating plasma [HCO3−]. In this review we first focus on the milestone discoveries over the past 50+ years that define the mechanism and regulation of acid-base transport by the proximal tubule. Further on in the review, we will summarize research still in progress from our laboratory, work that addresses the problem of how the PT is able to finely adapt to acid–base disturbances by rapidly sensing changes in basolateral levels of HCO3− and CO2 (but not pH), and thereby to exert tight control over the acid–base composition of the blood plasma. PMID:21170887

  3. Acid phosphatase deactivation by a series mechanism.

    PubMed

    Gianfreda, L; Marrucci, G; Grizzuti, N; Greco, G

    1984-05-01

    Acid phosphatase (E.C.3.1.3.2.) thermal deactivation at pH 3.77 has been investigated by monitoring the enzyme activity as a function of time in the hydrolysis of p-nitrophenyl phosphate. The experimental curves obtained show a two-slope behavior in a log (activity)versus-time plot, which indicates that deactivation occurs via a complex mechanism. From the dependence of the kinetic parameters on both deactivation and hydrolysis temperatures, it is inferred that the deactivation mechanism involves intermediate, temperature-dependent, less-active forms of the enzyme. This interpretation is confirmed by the results of additional tests in which the temperature was suddenly changed during the deactivation process. PMID:18553349

  4. Mechanism of action of 5-arninosalicylic acid

    PubMed Central

    Greenfield, S. M.; Thompson, R. P. H.

    1992-01-01

    5-Aminosalicylic Acid (5-ASA) has been used for over 50 years in the treatment of inflammatory bowel disease in the pro-drug form sulphasalazine (SASP). SASP is also used to treat rheumatoid arthritis. However whether the therapeutic properties of SASP are due to the intact molecule, the 5-ASA or sulphapyridine components is unknown. Several mechanisms of action have been proposed for 5-ASA and SASP including interference in the metabolism of arachidonic acid to prostaglandins and leukotrienes, scavenging,of reactive oxygen species, effects on leucocyte function and production of cytokines. However, it is unlikely that the anti-inflammatory properties of SASP and 5-ASA are due to several different properties but more likely that a single property of 5-ASA explains the theraapeutic effects of 5-ASA and SASP. Reactive oxygen species (ROS) are involved in the metabolism of prostaglandins and leukotrienes and can act as second messengers, and so the scavenging of ROS may be the single mechanism of action of 5-ASA that gives rise to its antiinflammatory effects in both inflammatory bowel disease and rheumatoid arthritis. PMID:18475455

  5. Transport Function of Rice Amino Acid Permeases (AAPs).

    PubMed

    Taylor, Margaret R; Reinders, Anke; Ward, John M

    2015-07-01

    The transport function of four rice (Oryza sativa) amino acid permeases (AAPs), OsAAP1 (Os07g04180), OsAAP3 (Os06g36180), OsAAP7 (Os05g34980) and OsAAP16 (Os12g08090), was analyzed by expression in Xenopus laevis oocytes and electrophysiology. OsAAP1, OsAAP7 and OsAAP16 functioned, similarly to Arabidopsis AAPs, as general amino acid permeases. OsAAP3 had a distinct substrate specificity compared with other rice or Arabidopsis AAPs. OsAAP3 transported the basic amino acids lysine and arginine well but selected against aromatic amino acids. The transport of basic amino acids was further analyzed for OsAAP1 and OsAAP3, and the results support the transport of both neutral and positively charged forms of basic amino acids by the rice AAPs. Cellular localization using the tandem enhanced green fluorescent protein (EGFP)-red fluorescent protein (RFP) reporter pHusion showed that OsAAP1 and OsAAP3 localized to the plasma membrane after transient expression in onion epidermal cells or stable expression in Arabidopsis. PMID:25907566

  6. Inhibition of 5-methyltetrahydrofolic acid transport by amphipathic drugs.

    PubMed

    Branda, R F; Nelson, N L

    1981-01-01

    Numerous chemically unrelated drugs after the membrane transport of folate compounds. To investigate drug structure-activity relationships, we measured the effect of amphipathic drugs (that is, compounds with polar-apolar character) on 5-methyltetrahydrofolic acid permeability of human erythrocytes. All drugs tested were inhibitory, but only compounds that exist at least partially in the anionic form were highly active. Ethacrynic acid, sulfinpyrazone, phenylbutazone, sulfasalazine, and furosemide were effective transport inhibitors in micromolar concentrations. In contrast, compounds that are capable of forming cations at physiologic pH, such as chlorpromazine, procaine, tetracaine, and papaverine, were inhibitory only in millimolar concentrations or caused hemolysis before major inhibition was seen. Inhibitory activity correlated with drug dissociation constant (r = 0.87). A double-reciprocal plot analysis of drug effect on 5-methyltetrahydrofolic acid transport showed changes in both Km and Vmax (indicating a mixture of competitive and noncompetitive inhibition) by ethacrynic acid, sulfasalazine, and phlorizin. Inhibitory activity of a series of eight phenoxyacetic derivatives, including ethacrynic acid, correlated highly with measurements of liposolubility (r = 0.87) but only weakly with the Hammet substituent constant (r = 0.56). These results suggest that the effect of amphipathic drugs on 5-methyltetrahydrofolic acid transport is influenced by drug pKa and by the presence of hydrophobic substituents, but is relatively independent of electron-attracting groups. PMID:6926815

  7. Xenobiotic, Bile Acid, and Cholesterol Transporters: Function and Regulation

    PubMed Central

    Aleksunes, Lauren M.

    2010-01-01

    Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting β polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) α and β] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of regulatory

  8. Transported acid aerosols measured in southern Ontario

    NASA Astrophysics Data System (ADS)

    Keeler, Gerald J.; Spengler, John D.; Koutrakis, Petros; Allen, George A.; Raizenne, Mark; Stern, Bonnie

    During the period 29 June 1986-9 August 1986, a field health study assessing the acute health effects of air pollutants on children was conducted at a summer girls' camp on the northern shore of Lake Erie in SW Ontario. Continuous air pollution measurements of SO 2, O 3, NO x, particulate sulfates, light scattering, and meteorological measurements including temperature, dew point, and wind speed and direction were made. Twelve-hour integrated samples of size fractioned particles were also obtained using dichotomous samplers and Harvard impactors equipped with an ammonia denuder for subsequent hydrogen ion determination. Particulate samples were analyzed for trace elements by X-ray fluorescence and Neutron Activation, and for organic and elemental carbon by a thermal/optical technique. The measured aerosol was periodically very acidic with observed 12-h averaged H + concentrations in the range < 10-560 nmoles m -3. The aerosol H + appeared to represent the net strong acidity after H 2SO 4 reaction with NH 3(g). Average daytime concentrations were higher than night-time for aerosol H +, sulfate, fine mass and ozone. Prolonged episodes of atmospheric acidity, sulfate, and ozone were associated with air masses arriving at the measurement site from the west and from the southwest over Lake Erie. Sulfate concentrations measured at the lakeshore camp were more than twice those measured at inland sites during extreme pollution episodes. The concentration gradient observed with onshore flow was potentially due to enhanced deposition near the lakeshore caused by discontinuities in the meteorological fields in this region.

  9. Inflammatory bowel disease alters intestinal bile acid transporter expression.

    PubMed

    Jahnel, Jörg; Fickert, Peter; Hauer, Almuthe C; Högenauer, Christoph; Avian, Alexander; Trauner, Michael

    2014-09-01

    The enterohepatic circulation of bile acids (BAs) critically depends on absorption of BA in the terminal ileum and colon, which can be affected by inflammatory bowel disease (IBD). Diarrhea in IBD is believed to result in part from BA malabsorption (BAM). We explored whether IBD alters mRNA expression of key intestinal BA transporters, BA detoxifying systems, and nuclear receptors that regulate BA transport and detoxification. Using real-time polymerase chain reaction, mucosal biopsy specimens from the terminal ileum in Crohn's disease (CD) patients and from the descending colon in ulcerative colitis (UC) patients were assessed for mRNA expression. Levels were compared with healthy controls. The main ileal BA uptake transporter, the apical sodium dependent bile acid transporter, was downregulated in active CD and UC and in CD in remission. Other significant changes such as repression of breast cancer-related protein and sulphotransferase 2A1 were seen only during active disease. In UC, pancolitis (but not exclusively left-sided colitis) was associated with altered expression of major BA transporters [multidrug resistance-associated protein 3 (MRP3), MRP4, multidrug resistance gene 1, organic solute transporter α/β] and nuclear receptors (pregnane X receptor, vitamin D receptor) in the descending colon. UC pancolitis leads to broad changes and CD ileitis to selective changes in intestinal BA transporter expression. Early medical manipulation of intestinal BA transporters may help prevent BAM. PMID:24965812

  10. The orally active antihyperglycemic drug beta-guanidinopropionic acid is transported by the human proton-coupled amino acid transporter hPAT1.

    PubMed

    Metzner, Linda; Dorn, Madlen; Markwardt, Fritz; Brandsch, Matthias

    2009-01-01

    The orally administered creatine analogue beta-guanidinopropionic acid (beta-GPA) decreases plasma glucose levels by increasing the sensitivity to insulin. This effect is based on a beta-GPA induced expression of mRNA and total protein content of the insulin-responsive glucose transporter GLUT4. Although the oral availability of beta-GPA is well established, the underlying uptake mechanism has not yet been studied. We investigated whether the H(+)-coupled amino acid transporter PAT1, which is expressed in the apical membrane of intestinal cells, accepts guanidine derivatives as substrates. Uptake of l-[(3)H]proline into Caco-2 cells expressing hPAT1 constitutively was strongly inhibited by beta-GPA and its derivatives guanidinoacetic acid (GAA) and 4-guanidinobutyric acid (4-GBA). Competition assays revealed apparent affinity constants of about 1.5 mM. Electrophysiological measurements at hPAT1-expressing Xenopus laevis oocytes unequivocally demonstrated that beta-GPA, GAA and 4-GBA are effectively transported by this transport system in an electrogenic manner. We conclude that hPAT1 might be responsible for the intestinal absorption of beta-GPA thereby allowing its oral administration. Moreover, with beta-GPA we identified a new high affinity hPAT1 substrate that might be an interesting starting point for future drug design-drug delivery strategies. PMID:19358571

  11. Structural insights into ABC transporter mechanism

    SciTech Connect

    Oldham, Michael L.; Davidson, Amy L.; Chen, Jue

    2010-07-27

    ATP-binding cassette (ABC) transporters utilize the energy from ATP hydrolysis to transport substances across the membrane. In recent years, crystal structures of several ABC transporters have become available. These structures show that both importers and exporters oscillate between two conformations: an inward-facing conformation with the substrate translocation pathway open to the cytoplasm and an outward-facing conformation with the translocation pathway facing the opposite side of the membrane. In this review, conformational differences found in the structures of homologous ABC transporters are analyzed to understand how alternating-access is achieved. It appears that rigid-body rotations of the transmembrane subunits, coinciding with the opening and closing of the nucleotide-binding subunits, couples ATP hydrolysis to substrate translocation.

  12. Mechanisms of lactone hydrolysis in acidic conditions.

    PubMed

    Gómez-Bombarelli, Rafael; Calle, Emilio; Casado, Julio

    2013-07-19

    The acid-catalyzed hydrolysis of linear esters and lactones was studied using a hybrid supermolecule-polarizable continuum model (PCM) approach including up to six water molecules. The compounds studied included two linear esters, four β-lactones, two γ-lactones, and one δ-lactone: ethyl acetate, methyl formate, β-propiolactone, β-butyrolactone, β-isovalerolactone, diketene (4-methyleneoxetan-2-one), γ-butyrolactone, 2(5H)-furanone, and δ-valerolactone. The theoretical results are in good quantitative agreement with the experimental measurements reported in the literature and also in excellent qualitative agreement with long-held views regarding the nature of the hydrolysis mechanisms at molecular level. The present results help to understand the balance between the unimolecular (A(AC)1) and bimolecular (A(AC)2) reaction pathways. In contrast to the experimental setting, where one of the two branches is often occluded by the requirement of rather extreme experimental conditions, we have been able to estimate both contributions for all the compounds studied and found that a transition from A(AC)2 to A(AC)1 hydrolysis takes place as acidity increases. A parallel work addresses the neutral and base-catalyzed hydrolysis of lactones. PMID:23731203

  13. Na+ Interactions with the Neutral Amino Acid Transporter ASCT1*

    PubMed Central

    Scopelliti, Amanda J.; Heinzelmann, Germano; Kuyucak, Serdar; Ryan, Renae M.; Vandenberg, Robert J.

    2014-01-01

    The alanine, serine, cysteine transporters (ASCTs) belong to the solute carrier family 1A (SLC1A), which also includes the excitatory amino acid transporters (EAATs) and the prokaryotic aspartate transporter GltPh. Acidic amino acid transport by the EAATs is coupled to the co-transport of three Na+ ions and one proton, and the counter-transport of one K+ ion. In contrast, neutral amino acid exchange by the ASCTs does not require protons or the counter-transport of K+ ions and the number of Na+ ions required is not well established. One property common to SLC1A family members is a substrate-activated anion conductance. We have investigated the number and location of Na+ ions required by ASCT1 by mutating residues in ASCT1 that correspond to residues in the EAATs and GltPh that are involved in Na+ binding. Mutations to all three proposed Na+ sites influence the binding of substrate and/or Na+, or the rate of substrate exchange. A G422S mutation near the Na2 site reduced Na+ affinity, without affecting the rate of exchange. D467T and D467A mutations in the Na1 site reduce Na+ and substrate affinity and also the rate of substrate exchange. T124A and D380A mutations in the Na3 site selectively reduce the affinity for Na+ and the rate of substrate exchange without affecting substrate affinity. In many of the mutants that reduce the rate of substrate transport the amplitudes of the substrate-activated anion conductances are not substantially affected indicating altered ion dependence for channel activation compared with substrate exchange. PMID:24808181

  14. Primordial transport of sugars and amino acids via Schiff bases

    NASA Astrophysics Data System (ADS)

    Stillwell, William; Rau, Aruna

    1981-09-01

    Experimental support is given for a model concerning the origin of a primordial transport system. The model is based on the facilitated diffusion of amino acids stimulated by aliphatic aldehyde carriers and sugars stimulated by aliphatic amine carriers. The lipid-soluble diffusing species is the Schiff base. The possible role of this simple transport system in the origin of an early protocell is discussed.

  15. Characterization of mouse amino acid transporter B0AT1 (slc6a19)

    PubMed Central

    2005-01-01

    The mechanism of the mouse (m)B0AT1 (slc6a19) transporter was studied in detail using two electrode voltage-clamp techniques and tracer studies in the Xenopus oocyte expression system. All neutral amino acids induced inward currents at physiological potentials, but large neutral non-aromatic amino acids were the preferred substrates of mB0AT1. Substrates were transported with K0.5 values ranging from approx. 1 mM to approx. 10 mM. The transporter mediates Na+–amino acid co-transport with a stoichiometry of 1:1. No other ions were involved in the transport mechanism. An increase in the extracellular Na+ concentration reduced the K0.5 for leucine, and vice versa. Moreover, the K0.5 values and Vmax values of both substrates varied with the membrane potential. As a result, K0.5 and Vmax values are a complex function of the concentration of substrate and co-substrate and the membrane potential. A model is presented assuming random binding order and a positive charge associated with the ternary [Na+–substrate–transporter] complex, which is consistent with the experimental data. PMID:15804236

  16. Jaumann transport in relativistic continuum mechanics

    NASA Astrophysics Data System (ADS)

    Radhakrishna, L.; Katkar, L. N.; Date, T. H.

    1981-10-01

    We define the Jaumann derivative of a tensor field in relativity by a formal generalization of a stress rate in viscoelasticity. A tensor field is said to be Jaumann transported iff its Jaumann derivative vanishes. It is found that the gravitational potentials are Jaumann transported identically. The concept of a “complete rotation tensor” has been introduced to study the Jaumann derivative with respect to a null vector field. This provides a characterization of the integrability of a hypersurface orthogonal congruence. A perfect fluid collapsing by neutrino emission and undergoing Jaumann transport with respect to the neutrino flow is found to be compatible with that of a catastrophic collapse. The circumstances leading to the existence of “ghost neutrinos” are cited. The degeneracy of the Kerr-Newman black hole into the Reissner-Nordstrom black hole is expressed in terms of the Jaumann propagation.

  17. New insights into the molecular mechanism of intestinal fatty acid absorption

    PubMed Central

    Wang, Tony Y.; Liu, Min; Portincasa, Piero; Wang, David Q.-H.

    2013-01-01

    Background Dietary fat is the most important energy source of all the nutrients. Fatty acids, stored as triacylglycerols in the body, are an important reservoir of stored energy and derive primarily from animal fats and vegetable oils. Design Although the molecular mechanisms for the transport of water-insoluble amphipathic fatty acids across cell membranes have been debated for many years, it is now believed that the dominant means for intestinal fatty acid uptake is via membrane-associated fatty acid-binding proteins, i.e., fatty acid transporters on the apical membrane of enterocytes. Results These findings indicate that intestinal fatty acid absorption is a multistep process that is regulated by multiple genes at the enterocyte level, and intestinal fatty acid absorption efficiency could be determined by factors influencing intraluminal fatty acid molecules across the brush border membrane of enterocytes. To facilitate research on intestinal, hepatic and plasma triacylglycerol metabolism, it is imperative to establish standard protocols for precisely and accurately measuring the efficiency of intestinal fatty acid absorption in humans and animal models. In this review, we will discuss the chemical structure and nomenclature of fatty acids and summarize recent progress in investigating the molecular mechanisms underlying the intestinal absorption of fatty acids, with a particular emphasis on the physical-chemistry of intestinal lipids and the molecular physiology of intestinal fatty acid transporters. Conclusions A better understanding of the molecular mechanism of intestinal fatty acid absorption should lead to novel approaches to the treatment and the prevention of fatty acid-related metabolic diseases that are prevalent worldwide. PMID:24102389

  18. Neutral amino acid transport in bovine articular chondrocytes.

    PubMed

    Barker, G A; Wilkins, R J; Golding, S; Ellory, J C

    1999-02-01

    1. The sodium-dependent amino acid transport systems responsible for proline, glycine and glutamine transport, together with the sodium-independent systems for leucine and tryptophan, have been investigated in isolated bovine chondrocytes by inhibition studies and ion replacement. Each system was characterized kinetically. 2. Transport via system A was identified using the system-specific analogue alpha-methylaminoisobutyric acid (MeAIB) as an inhibitor of proline, glycine and glutamine transport. 3. Uptake of proline, glycine and glutamine via system ASC was identified by inhibition with alanine or serine. 4. System Gly was identified by the inhibition of glycine transport with excess sarcosine (a substrate for system Gly) whilst systems A and ASC were inhibited. This system, having a very limited substrate specificity and tissue distribution, was also shown to be Na+ and Cl- dependent. Evidence for expression of the system Gly component GLYT-1 was obtained using the reverse transcriptase-polymerase chain reaction (RT-PCR). 5. System N, also of narrow substrate specificity and tissue distribution, was shown to be present in chondrocytes. Na+-dependent glutamine uptake was inhibited by high concentrations of histidine (a substrate of system N) in the presence of excess MeAIB and serine. 6. System L was identified using the system specific analogue 2-aminobicyclo(2,2, 1)heptane-2-carboxylic acid (BCH) and D-leucine as inhibitors of leucine and tryptophan transport. 7. The presence of system T was tested by using leucine, tryptophan and tyrosine inhibition. It was concluded that this system was absent in the chondrocyte. 8. Kinetic analysis showed the Na+-independent chondrocyte L system to have apparent affinities for leucine and tryptophan of 125 +/- 27 and 36 +/- 11 microM, respectively. 9. Transport of the essential amino acids leucine and tryptophan into bovine chondrocytes occurs only by the Na+-independent system L, but with a higher affinity than the

  19. Taxol induced apoptosis regulates amino acid transport in breast cancer cells.

    PubMed

    Wu, Yanyuan; Shen, Dejun; Chen, Zujian; Clayton, Sheila; Vadgama, Jaydutt V

    2007-03-01

    A major outcome from Taxol treatment is induction of tumor cell apoptosis. However, metabolic responses to Taxol-induced apoptosis are poorly understood. In this study, we hypothesize that alterations in specific amino acid transporters may affect the Taxol-induced apoptosis in breast cancer cells. In this case, the activity of the given transporter may serve as a biomarker that could provide a biological assessment of response to drug treatment. We have examined the mechanisms responsible for Taxol-induced neutral amino acid uptake by breast cancer cells, such as MCF-7, BT474, MDAMB231 and T47D. The biochemical and molecular studies include: (1) growth-inhibition (MTT); (2) transport kinetics: (3) substrate-specific inhibition; (4) effect of thiol-modifying agents NEM and NPM; (5) gene expression of amino acid transporters; and (6) apoptotic assays. Our data show that Taxol treatment of MCF-7 cells induced a transient increase in Na(+)-dependent transport of the neutral amino acid transporter B0 at both gene and protein level. This increase was attenuated by blocking the transporter in the presence of high concentrations of the substrate amino acid. Other neutral amino acid transporters such as ATA2 (System A) and ASC were not altered. Amino acid starvation resulted in the expected up-regulation of System A (ATA2) gene, but not for B0 and ASC. B0 was significantly down regulated. Taxol treatment had no significant effect on the uptake of arginine and glutamate as measured by System y(+) and X(-) (GC) respectively. Tunel assays and FACS cell cycle analysis demonstrated that both Taxol- and doxorubicin-induced upregulation of B0 transporter gene with accompanying increase in cell apoptosis, could be reversed partially by blocking the B0 transporter with high concentration of alanine, and/or by inhibiting the caspase pathway. Both Taxol and doxorubicin treatment caused a significant decrease in S-phase of the cell cycle. However, Taxol-induced an increase primarily

  20. Grain transport mechanics in shallow flow

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A physical model based on continuum multiphase flow is described to represent saltating transport of grains in shallow overland flows. The two-phase continuum flow of water and sediment considers coupled St.Venant type equations. The interactive cumulative effect of grains is incorporated by a dispe...

  1. Grain transport mechanics in shallow overland flow

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A physical model based on continuum multiphase flow is described to represent saltating transport of grains in shallow overland flow. The two phase continuum flow of water and sediment considers coupled St.Venant type equations. The interactive cumulative effect of grains is incorporated by a disper...

  2. Transport of amino acids and nucleic acid precursors in malarial parasites

    PubMed Central

    Sherman, I. W.

    1977-01-01

    In vitro studies have shown that exogenously supplied amino acids are transferred into the malaria-infected cell, where they are incorporated into proteins. Most amino acids appear to enter the cell by facilitated or simple diffusion; however, the high distribution ratios seen in Plasmodium knowlesi-infected cells are difficult to explain on this basis. The changes (leakiness) observed in amino acid transport in P. lophurae infected cells are probably the result of ATP depletion in the host cell as well as the elaboration of plasmodial substances. Depletion of isoleucine, methionine, and cysteine from the medium strikingly depresses the in vitro growth of P. knowlesi. The degree of amino acid incorporation into the malaria-infected cell is not correlated with the amount of a particular amino acid in the host cell haemoglobin, the decline of that amino acid in the plasma of infected animals, or the ratio of free amino acids of the erythrocyte to those of the plasma. In erythrocyte-“free” P. lophurae, carrier-mediated transport is apparently limited to a small number of amino acids; all others seem to enter by simple diffusion. Malaria-infected erythrocytes transport exogenously supplied purines at substantially higher rates than uninfected red cells. The preferred purines are adenosine, hypoxanthine, and inosine. The only pyrimidine incorporated is orotic acid. Thymidine, cytidine, and uridine do not readily enter the red cell, and incorporation does not take place because the parasites lack the appropriate enzyme for conversion to nucleotides. Erythrocyte-“free” P. berghei and P. lophurae take up purines and orotic acid. It has been suggested that in vivo the preferred purines are hypoxanthine and inosine, and that the transport locus for erythrocytes is specific for 6-oxopurines. Similar results of purine incorporation are reported for the insect stages of P. cynomolgi and P. berghei, although transport studies have not been carried out. PMID:338180

  3. Statistical Mechanics of Collective Transport by Ants

    NASA Astrophysics Data System (ADS)

    Pinkoviezky, Itai; Gelblum, Aviram; Fonio, Ehud; Ghosh, Abhijit; Gov, Nir; Feinerman, Ofer

    Collective decisions and cooperation within groups are essential for the survival of many species. Conflicts within the group must be suppressed but conformism may render the system unresponsive to new information. Collective transport by ants is therefore an ideal model system to study how animal groups optimize these opposing requirements. We combine experiments and theory to characterize the collective transport. The ants are modeled as binary Ising spins, representing the two roles ants can perform during transport. It turns out that the ants poise themselves collectively near a critical point where the response to a newly attached ant is maximized. We identify the size as being proportional to an inverse effective temperature and thus the system can exhibit a mesoscopic transition between order and disorder by manipulating the size. Constraining the cargo with a string makes the system behave as a strongly non-linear pendulum. Theoretically we predict that a Hopf bifurcation occurs at a critical size followed by a global bifurcation where full swings emerge. Remarkably, these theoretical predictions were verified experimentally.

  4. Metabolic mechanism of phenyllactic acid naturally occurring in Chinese pickles.

    PubMed

    Li, Xingfeng; Ning, Yawei; Liu, Dou; Yan, Aihong; Wang, Zhixin; Wang, Shijie; Miao, Ming; Zhu, Hong; Jia, Yingmin

    2015-11-01

    Phenyllactic acid, a phenolic acid phytochemical with the antimicrobial activity, was rarely reported in food besides honey and sourdough. This study evidenced a new food source of phenyllactic acid and elucidated its metabolic mechanism. Phenyllactic acid naturally occurred in Chinese pickles with concentrations ranged from 0.02 to 0.30 mM in 23 pickle samples including homemade and commercial ones. Then, lactic acid bacteria capable of metabolizing phenyllactic acid were screened from each homemade pickle and a promising strain was characterized as Lactobacillus plantarum. Moreover, the investigation of the metabolic mechanism of phenyllactic acid in pickles suggested that the yield of phenyllactic acid was positively related to the content of phenylalanine in food, and the addition of phenylalanine as precursor substance could significantly promote the production of phenyllactic acid. This investigation could provide some insights into the accumulation of phenyllactic acid in pickle for long storage life. PMID:25976820

  5. Secondary metabolites in plants: transport and self-tolerance mechanisms.

    PubMed

    Shitan, Nobukazu

    2016-07-01

    Plants produce a host of secondary metabolites with a wide range of biological activities, including potential toxicity to eukaryotic cells. Plants generally manage these compounds by transport to the apoplast or specific organelles such as the vacuole, or other self-tolerance mechanisms. For efficient production of such bioactive compounds in plants or microbes, transport and self-tolerance mechanisms should function cooperatively with the corresponding biosynthetic enzymes. Intensive studies have identified and characterized the proteins responsible for transport and self-tolerance. In particular, many transporters have been isolated and their physiological functions have been proposed. This review describes recent progress in studies of transport and self-tolerance and provides an updated inventory of transporters according to their substrates. Application of such knowledge to synthetic biology might enable efficient production of valuable secondary metabolites in the future. PMID:26940949

  6. Chronic intermittent psychological stress promotes macrophage reverse cholesterol transport by impairing bile acid absorption in mice

    PubMed Central

    Silvennoinen, Reija; Quesada, Helena; Kareinen, Ilona; Julve, Josep; Kaipiainen, Leena; Gylling, Helena; Blanco-Vaca, Francisco; Escola-Gil, Joan Carles; Kovanen, Petri T; Lee-Rueckert, Miriam

    2015-01-01

    Psychological stress is a risk factor for atherosclerosis, yet the pathophysiological mechanisms involved remain elusive. The transfer of cholesterol from macrophage foam cells to liver and feces (the macrophage-specific reverse cholesterol transport, m-RCT) is an important antiatherogenic pathway. Because exposure of mice to physical restraint, a model of psychological stress, increases serum levels of corticosterone, and as bile acid homeostasis is disrupted in glucocorticoid-treated animals, we investigated if chronic intermittent restraint stress would modify m-RCT by altering the enterohepatic circulation of bile acids. C57Bl/6J mice exposed to intermittent stress for 5 days exhibited increased transit through the large intestine and enhanced fecal bile acid excretion. Of the transcription factors and transporters that regulate bile acid homeostasis, the mRNA expression levels of the hepatic farnesoid X receptor (FXR), the bile salt export pump (BSEP), and the intestinal fibroblast growth factor 15 (FGF15) were reduced, whereas those of the ileal apical sodium-dependent bile acid transporter (ASBT), responsible for active bile acid absorption, remained unchanged. Neither did the hepatic expression of cholesterol 7α-hydroxylase (CYP7A1), the key enzyme regulating bile acid synthesis, change in the stressed mice. Evaluation of the functionality of the m-RCT pathway revealed increased fecal excretion of bile acids that had been synthesized from macrophage-derived cholesterol. Overall, our study reveals that chronic intermittent stress in mice accelerates m-RCT specifically by increasing fecal excretion of bile acids. This novel mechanism of m-RCT induction could have antiatherogenic potential under conditions of chronic stress. PMID:25969465

  7. Chronic intermittent psychological stress promotes macrophage reverse cholesterol transport by impairing bile acid absorption in mice.

    PubMed

    Silvennoinen, Reija; Quesada, Helena; Kareinen, Ilona; Julve, Josep; Kaipiainen, Leena; Gylling, Helena; Blanco-Vaca, Francisco; Escola-Gil, Joan Carles; Kovanen, Petri T; Lee-Rueckert, Miriam

    2015-05-11

    Psychological stress is a risk factor for atherosclerosis, yet the pathophysiological mechanisms involved remain elusive. The transfer of cholesterol from macrophage foam cells to liver and feces (the macrophage-specific reverse cholesterol transport, m-RCT) is an important antiatherogenic pathway. Because exposure of mice to physical restraint, a model of psychological stress, increases serum levels of corticosterone, and as bile acid homeostasis is disrupted in glucocorticoid-treated animals, we investigated if chronic intermittent restraint stress would modify m-RCT by altering the enterohepatic circulation of bile acids. C57Bl/6J mice exposed to intermittent stress for 5 days exhibited increased transit through the large intestine and enhanced fecal bile acid excretion. Of the transcription factors and transporters that regulate bile acid homeostasis, the mRNA expression levels of the hepatic farnesoid X receptor (FXR), the bile salt export pump (BSEP), and the intestinal fibroblast growth factor 15 (FGF15) were reduced, whereas those of the ileal apical sodium-dependent bile acid transporter (ASBT), responsible for active bile acid absorption, remained unchanged. Neither did the hepatic expression of cholesterol 7α-hydroxylase (CYP7A1), the key enzyme regulating bile acid synthesis, change in the stressed mice. Evaluation of the functionality of the m-RCT pathway revealed increased fecal excretion of bile acids that had been synthesized from macrophage-derived cholesterol. Overall, our study reveals that chronic intermittent stress in mice accelerates m-RCT specifically by increasing fecal excretion of bile acids. This novel mechanism of m-RCT induction could have antiatherogenic potential under conditions of chronic stress. PMID:25969465

  8. Differential effects of cyclosporin A on transport of bile acids by rat hepatocytes: relationship to individual serum bile acid levels.

    PubMed

    Azer, S A; Stacey, N H

    1994-02-01

    Cyclosporin A treatment has been reported to induce hepatotoxicity marked by a rise in total serum bile acid and total bilirubin. The mechanism of cyclosporin A-induced hepatotoxicity seems to be related to interference with hepatocellular transport of these substrates although this remains to be fully substantiated. The purpose of this study was to investigate whether the hepatocellular uptake of the different bile acids, in the presence of cyclosporin A, is consistent with the changes in their respective individual serum bile acid concentrations. High-performance liquid chromatography has been used to assay individual serum bile acids in cyclosporin A-treated rats at doses of 0.1, 1, and 10 mg/kg/day for 4 days. Control rats were treated with Cremophor (1 ml/kg/day). At the higher doses, cyclosporin A produced a significant increase in levels of cholic acid, taurocholic acid, chenodeoxycholic acid, and deoxycholic acid compared with controls. Serum glycocholate was unaffected even at the highest dose. Inhibition of initial rate of uptake and accumulation of [14C]cholic acid, [14C]chenodeoxycholic acid, and [14C]deoxycholic acid by isolated rat hepatocytes was consistent with the changes in their respective serum bile acids. Coincubation of rat hepatocytes with unlabeled cholic acid (100 microM), the major serum bile acid in cyclosporin A-treated rats, showed a further inhibitory effect on [14C]cholic acid and [14C]deoxycholic acid accumulation. The initial rate of uptake of [14C]glycocholate was also inhibited. However, accumulation of glycocholic acid did not show significant changes at the longer incubation times (2-30 min). In addition, coincubation of rat hepatocytes with unlabeled cholic acid (100 microM) plus cyclosporin A did not induce any inhibition of glycocholate accumulation. Together, these differences provide an explanation for the unchanged serum levels of glycocholate. In conclusion, the changes in individual serum bile acids in cyclosporin A

  9. Mechanism of isotonic water transport in glands.

    PubMed

    Ussing, H H; Eskesen, K

    1989-07-01

    Since water and electrolytes pass cell membranes via separate channels, there can be no interactions in the membranes, and osmotic interactions between water and solutes can be expressed as the product of solute flux, frictional coefficient of solute, and length of pathway. It becomes clear that isotonic transport via a cell is impossible. In glands, where cation-selective junctions impede anion flux between the cells, isotonic water transport is only possible if sodium, after having passed the junction, is reabsorbed in the acinus and returned to the serosal side. Thus it can be recycled via the cation-selective junction and exert its drag on water more than once. This hypothesis was tested on frog skin glands. Skins were mounted in flux chambers with identical Ringer solutions on both sides. Na channels of the principal cells were closed with amiloride in the outside solution, and secretion stimulated with noradrenaline in the inside solution. Influx and efflux of Na, K and Br (used as tracer for Cl) were measured on paired half-skins during the constant-secretion phase. Flux ratios for both Na and K were higher than expected for electrodiffusion, indicating outgoing solvent drag. Flux ratios for K were much higher than those for Na. This is an agreement with the concept that Na is reabsorbed in the acinus and K is not. Two independent expressions for the degree of sodium recycling are developed. Under all experimental conditions these expressions give values for the recycling which are in good agreement. PMID:2473601

  10. Late endosomal membranes rich in lysobisphosphatidic acid regulate cholesterol transport.

    PubMed

    Kobayashi, T; Beuchat, M H; Lindsay, M; Frias, S; Palmiter, R D; Sakuraba, H; Parton, R G; Gruenberg, J

    1999-06-01

    The fate of free cholesterol released after endocytosis of low-density lipoproteins remains obscure. Here we report that late endosomes have a pivotal role in intracellular cholesterol transport. We find that in the genetic disease Niemann-Pick type C (NPC), and in drug-treated cells that mimic NPC, cholesterol accumulates in late endosomes and sorting of the lysosomal enzyme receptor is impaired. Our results show that the characteristic network of lysobisphosphatidic acid-rich membranes contained within multivesicular late endosomes regulates cholesterol transport, presumably by acting as a collection and distribution device. The results also suggest that similar endosomal defects accompany the anti-phospholipid syndrome and NPC. PMID:10559883

  11. Drag of the Cytosol as a Transport Mechanism in Neurons

    PubMed Central

    Mussel, Matan; Zeevy, Keren; Diamant, Haim; Nevo, Uri

    2014-01-01

    Axonal transport is typically divided into two components, which can be distinguished by their mean velocity. The fast component includes steady trafficking of different organelles and vesicles actively transported by motor proteins. The slow component comprises nonmembranous materials that undergo infrequent bidirectional motion. The underlying mechanism of slow axonal transport has been under debate during the past three decades. We propose a simple displacement mechanism that may be central for the distribution of molecules not carried by vesicles. It relies on the cytoplasmic drag induced by organelle movement and readily accounts for key experimental observations pertaining to slow-component transport. The induced cytoplasmic drag is predicted to depend mainly on the distribution of microtubules in the axon and the organelle transport rate. PMID:24940788

  12. Inhibition of ileal bile acid transporter: An emerging therapeutic strategy for chronic idiopathic constipation

    PubMed Central

    Mosińska, Paula; Fichna, Jakub; Storr, Martin

    2015-01-01

    Chronic idiopathic constipation is a common disorder of the gastrointestinal tract that encompasses a wide profile of symptoms. Current treatment options for chronic idiopathic constipation are of limited value; therefore, a novel strategy is necessary with an increased effectiveness and safety. Recently, the inhibition of the ileal bile acid transporter has become a promising target for constipation-associated diseases. Enhanced delivery of bile acids into the colon achieves an accelerated colonic transit, increased stool frequency, and relief of constipation-related symptoms. This article provides insight into the mechanism of action of ileal bile acid transporter inhibitors and discusses their potential clinical use for pharmacotherapy of constipation in chronic idiopathic constipation. PMID:26139989

  13. Quantum mechanisms of density wave transport

    PubMed Central

    Miller, John H.; Wijesinghe, Asanga I.

    2012-01-01

    We report on new developments in the quantum picture of correlated electron transport in charge and spin density waves. The model treats the condensate as a quantum fluid in which charge soliton domain wall pairs nucleate above a Coulomb blockade threshold field. We employ a time-correlated soliton tunneling model, analogous to the theory of time-correlated single electron tunneling, to interpret the voltage oscillations and nonlinear current-voltage characteristics above threshold. An inverse scaling relationship between threshold field and dielectric response, originally proposed by Grüner, emerges naturally from the model. Flat dielectric and other ac responses below threshold in NbSe3 and TaS3, as well as small density wave phase displacements, indicate that the measured threshold is often much smaller than the classical depinning field. In some materials, the existence of two distinct threshold fields suggests that both soliton nucleation and classical depinning may occur. In our model, the ratio of electrostatic charging to pinning energy helps determine whether soliton nucleation or classical depinning dominates. PMID:22711979

  14. Mitochondrial transporters for ornithine and related amino acids: a review.

    PubMed

    Monné, Magnus; Miniero, Daniela Valeria; Daddabbo, Lucia; Palmieri, Luigi; Porcelli, Vito; Palmieri, Ferdinando

    2015-09-01

    Among the members of the mitochondrial carrier family, there are transporters that catalyze the translocation of ornithine and related substrates, such as arginine, homoarginine, lysine, histidine, and citrulline, across the inner mitochondrial membrane. The mitochondrial carriers ORC1, ORC2, and SLC25A29 from Homo sapiens, BAC1 and BAC2 from Arabidopsis thaliana, and Ort1p from Saccharomyces cerevisiae have been biochemically characterized by transport assays in liposomes. All of them transport ornithine and amino acids with side chains terminating at least with one amine. There are, however, marked differences in their substrate specificities including their affinity for ornithine (KM values in the mM to μM range). These differences are most likely reflected by minor differences in the substrate binding sites of these carriers. The physiological role of the above-mentioned mitochondrial carriers is to link several metabolic pathways that take place partly in the cytosol and partly in the mitochondrial matrix and to provide basic amino acids for mitochondrial translation. In the liver, human ORC1 catalyzes the citrulline/ornithine exchange across the mitochondrial inner membrane, which is required for the urea cycle. Human ORC1, ORC2, and SLC25A29 are likely to be involved in the biosynthesis and transport of arginine, which can be used as a precursor for the synthesis of NO, agmatine, polyamines, creatine, glutamine, glutamate, and proline, as well as in the degradation of basic amino acids. BAC1 and BAC2 are implicated in some processes similar to those of their human counterparts and in nitrogen and amino acid metabolism linked to stress conditions and the development of plants. Ort1p is involved in the biosynthesis of arginine and polyamines in yeast. PMID:26002808

  15. The Mechanism of Cu+ Transport ATPases

    PubMed Central

    Padilla-Benavides, Teresita; McCann, Courtney J.; Argüello, José M.

    2013-01-01

    Cu+-ATPases are membrane proteins that couple the hydrolysis of ATP to the efflux of cytoplasmic Cu+. In cells, soluble chaperone proteins bind and distribute cytoplasmic Cu+, delivering the ion to the transmembrane metal-binding sites in the ATPase. The structure of Legionella pneumophila Cu+-ATPase (Gourdon, P., Liu, X. Y., Skjørringe, T., Morth, J. P., Møller, L. B., Pedersen, B. P., and Nissen, P. (2011) Nature 475, 59–64) shows that a kinked transmembrane segment forms a “platform” exposed to the cytoplasm. In addition, neighboring invariant Met, Asp, and Glu are located at the “entrance” of the ion path. Mutations of amino acids in these regions of the Archaeoglobus fulgidus Cu+-ATPase CopA do not affect ATPase activity in the presence of Cu+ free in solution. However, Cu+ bound to the corresponding chaperone (CopZ) could not activate the mutated ATPases, and in parallel experiments, CopZ was unable to transfer Cu+ to CopA. Furthermore, mutation of a specific electronegative patch on the CopZ surface abolishes the ATPase activation and Cu+ transference, indicating that the region is required for the CopZ-CopA interaction. Moreover, the data suggest that the interaction is driven by the complementation of the electropositive platform in the ATPase and the electronegative Cu+ chaperone. This docking likely places the Cu+ proximal to the conserved carboxyl and thiol groups in the entrance site that induce metal release from the chaperone via ligand exchange. The initial interaction of Cu+ with the pump is transient because Cu+ is transferred from the entrance site to transmembrane metal-binding sites involved in transmembrane translocation. PMID:23184962

  16. Bed rest impairs skeletal muscle amino acid transporter expression, mTORC1 signaling, and protein synthesis in response to essential amino acids in older adults

    PubMed Central

    Dickinson, Jared M.; Fry, Christopher S.; Walker, Dillon K.; Gundermann, David M.; Reidy, Paul T.; Timmerman, Kyle L.; Markofski, Melissa M.; Paddon-Jones, Douglas; Rasmussen, Blake B.; Volpi, Elena

    2012-01-01

    Skeletal muscle atrophy during bed rest is attributed, at least in part, to slower basal muscle protein synthesis (MPS). Essential amino acids (EAA) stimulate mammalian target of rapamycin (mTORC1) signaling, amino acid transporter expression, and MPS and are necessary for muscle mass maintenance, but there are no data on the effect of inactivity on this anabolic mechanism. We hypothesized that bed rest decreases muscle mass in older adults by blunting the EAA stimulation of MPS through reduced mTORC1 signaling and amino acid transporter expression in older adults. Six healthy older adults (67 ± 2 yr) participated in a 7-day bed rest study. We used stable isotope tracers, Western blotting, and real-time qPCR to determine the effect of bed rest on MPS, muscle mTORC1 signaling, and amino acid transporter expression and content in the postabsorptive state and after acute EAA ingestion. Bed rest decreased leg lean mass by ∼4% (P < 0.05) and increased postabsorptive mTOR protein (P < 0.05) levels while postabsorptive MPS was unchanged (P > 0.05). Before bed rest acute EAA ingestion increased MPS, mTOR (Ser2448), S6 kinase 1 (Thr389, Thr421/Ser424), and ribosomal protein S6 (Ser240/244) phosphorylation, activating transcription factor 4, L-type amino acid transporter 1 and sodium-coupled amino acid transporter 2 protein content (P < 0.05). However, bed rest blunted the EAA-induced increase in MPS, mTORC1 signaling, and amino acid transporter protein content. We conclude that bed rest in older adults significantly attenuated the EAA-induced increase in MPS with a mechanism involving reduced mTORC1 signaling and amino acid transporter protein content. Together, our data suggest that a blunted EAA stimulation of MPS may contribute to muscle loss with inactivity in older persons. PMID:22338078

  17. Thermodynamic evidence for a dual transport mechanism in a POT peptide transporter

    PubMed Central

    Parker, Joanne L; Mindell, Joseph A; Newstead, Simon

    2014-01-01

    Peptide transport plays an important role in cellular homeostasis as a key route for nitrogen acquisition in mammalian cells. PepT1 and PepT2, the mammalian proton coupled peptide transporters (POTs), function to assimilate and retain diet-derived peptides and play important roles in drug pharmacokinetics. A key characteristic of the POT family is the mechanism of peptide selectivity, with members able to recognise and transport >8000 different peptides. In this study, we present thermodynamic evidence that in the bacterial POT family transporter PepTSt, from Streptococcus thermophilus, at least two alternative transport mechanisms operate to move peptides into the cell. Whilst tri-peptides are transported with a proton:peptide stoichiometry of 3:1, di-peptides are co-transported with either 4 or 5 protons. This is the first thermodynamic study of proton:peptide stoichiometry in the POT family and reveals that secondary active transporters can evolve different coupling mechanisms to accommodate and transport chemically and physically diverse ligands across the membrane. DOI: http://dx.doi.org/10.7554/eLife.04273.001 PMID:25457052

  18. Structural basis for amino acid export by DMT superfamily transporter YddG.

    PubMed

    Tsuchiya, Hirotoshi; Doki, Shintaro; Takemoto, Mizuki; Ikuta, Tatsuya; Higuchi, Takashi; Fukui, Keita; Usuda, Yoshihiro; Tabuchi, Eri; Nagatoishi, Satoru; Tsumoto, Kouhei; Nishizawa, Tomohiro; Ito, Koichi; Dohmae, Naoshi; Ishitani, Ryuichiro; Nureki, Osamu

    2016-06-16

    The drug/metabolite transporter (DMT) superfamily is a large group of membrane transporters ubiquitously found in eukaryotes, bacteria and archaea, and includes exporters for a remarkably wide range of substrates, such as toxic compounds and metabolites. YddG is a bacterial DMT protein that expels aromatic amino acids and exogenous toxic compounds, thereby contributing to cellular homeostasis. Here we present structural and functional analyses of YddG. Using liposome-based analyses, we show that Escherichia coli and Starkeya novella YddG export various amino acids. The crystal structure of S. novella YddG at 2.4 Å resolution reveals a new membrane transporter topology, with ten transmembrane segments in an outward-facing state. The overall structure is basket-shaped, with a large substrate-binding cavity at the centre of the molecule, and is composed of inverted structural repeats related by two-fold pseudo-symmetry. On the basis of this intramolecular symmetry, we propose a structural model for the inward-facing state and a mechanism of the conformational change for substrate transport, which we confirmed by biochemical analyses. These findings provide a structural basis for the mechanism of transport of DMT superfamily proteins. PMID:27281193

  19. Identification of regulatory mechanisms of intestinal folate transport in condition of folate deficiency.

    PubMed

    Thakur, Shilpa; Rahat, Beenish; Hamid, Abid; Najar, Rauf Ahmad; Kaur, Jyotdeep

    2015-10-01

    Folic acid is an essential micronutrient, deficiency of which can lead to disturbance in various metabolic processes of cell. Folate transport across intestine occurs via the involvement of specialized folate transporters viz. proton coupled folate transporter (PCFT) and reduced folate carrier (RFC), which express at the membrane surfaces. The current study was designed to identify the regulatory mechanisms underlying the effects of folate deficiency (FD) on folate transport in human intestinal cell line as well as in rats and to check the reversibility of such effects. Caco-2 cells were grown for five generations in control and FD medium. Following treatment, one subgroup of cells was shifted on folate sufficient medium and grown for three more generations. Similarly, rats were fed an FD diet for 3 and 5 months, and after 3 months of FD treatment, one group of rats were shifted on normal folate-containing diet. Increase in folate transport and expression of folate transporters were observed on FD treatment. However, when cells and rats were shifted to control conditions after treatment, transport and expression of these genes restored to the control level. FD was found to have no impact on promoter methylation of PCFT and RFC; however, messenger RNA stability of transporters was found to be decreased, suggesting some adaptive response. Overall, increased expression of transporters under FD conditions can be attributed to enhanced rate of transcription of folate transporters and also to the increased binding of specificity protein 1 transcription factor to the RFC promoter only. PMID:26168702

  20. Transport in Halobacterium Halobium: Light-Induced Cation-Gradients, Amino Acid Transport Kinetics, and Properties of Transport Carriers

    NASA Technical Reports Server (NTRS)

    Lanyi, Janos K.

    1977-01-01

    Cell envelope vesicles prepared from H. halobium contain bacteriorhodopsin and upon illumination protons are ejected. Coupled to the proton motive force is the efflux of Na(+). Measurements of Na-22 flux, exterior pH change, and membrane potential, Delta(psi) (with the dye 3,3'-dipentyloxadicarbocyanine) indicate that the means of Na(+) transport is sodium/proton exchange. The kinetics of the pH changes and other evidence suggests that the antiport is electrogenic (H(+)/Na(++ greater than 1). The resulting large chemical gradient for Na(+) (outside much greater than inside), as well as the membrane potential, will drive the transport of 18 amino acids. The I9th, glutamate, is unique in that its accumulation is indifferent to Delta(psi): this amino acid is transported only when a chemical gradient for Na(+) is present. Thus, when more and more NaCl is included in the vesicles glutamate transport proceeds with longer and longer lags. After illumination the gradient of H+() collapses within 1 min, while the large Na(+) gradient and glutamate transporting activity persists for 10- 15 min, indicating that proton motive force is not necessary for transport. A chemical gradient of Na(+), arranged by suspending vesicles loaded with KCl in NaCl, drives glutamate transport in the dark without other sources of energy, with V(sub max) and K(sub m) comparable to light-induced transport. These and other lines of evidence suggest that the transport of glutamate is facilitated by symport with Na(+), in an electrically neutral fashion, so that only the chemical component of the Na(+) gradient is a driving force.

  1. Mechanisms of methylmercury transport across the blood-brain barrier

    SciTech Connect

    Kerper, L.E.

    1993-01-01

    Methylmercury readily enters the brain of exposed individuals, and is highly neurotoxic. The goal of this research was to determine the mechanisms of methylmercury transport across both the luminal and abluminal membranes of brain capillary endothelial cells, the cells which comprise the blood-brain barrier. The rapid carotid injection technique was used in rats to investigate the uptake of methylmercury from blood into brain endothelial cells. Uptake of ([sup 203]Hg)-methylmercury complexed with L-cysteine (CH[sub 3] [sup 203]Hg-L-Cys) was more rapid than that of ([sup 203]Hg)-methylmercury complexed with D-cysteine or bovine serum albumin. Uptake of CH[sub 3][sup 203]Hg-L-Cys was saturable, and was inhibited by substrates for the L (alanine-preferring) carrier. Brain uptake of [sup 14]C-L-methionine was inhibited by CH[sub 3]Hg-L-Cys but not by CH[sub 3]HgCl. Uptake of [sup 203]Hg administered as CH[sub 3]Hg-L-Cys-glutathione (CH[sub 3][sup 203]Hg-GSH) was comparable to CH[sub 3][sup 203]Hg-L-Cys uptake at 2 [mu]M. L-Methionine and 2-aminobicyclo-(2,2,1)-heptane-2-carboxylic acid (BCH) inhibited [sup 203]Hg uptake administered as CH[sub 3][sup 203]Hg-GSH, whereas acivicin had no effect. This uptake was also inhibited by S-ethylglutathione when pH of the injection solution was allowed to rise to 8.5. In later experiments performed at pH 8.2, uptake of [sup 203]Hg administered as CH[sub 3][sup 203]Hg-GSH was inhibited only by BCH. To study mechanisms of methylmercury efflux from endothelial cells, a primary culture of bovine brain capillary endothelial cells was developed. Intracellular glutathione concentration was 2.6 [+-] 0.7 mM. Incubation of CH[sub 3][sup 203]HgCl-preloaded cells with GSH depletors decreased ([sup 203]Hg)-methylmercury efflux in a dose-dependent manner which correlated with intracellular GSH concentrations. ([sup 203]Hg)-Methylmercury efflux was also inhibited by GSH-S-conjugates an GSH analogs, but not by amino acids.

  2. Transepithelial transport of aliphatic carboxylic acids studied in Madin Darby canine kidney (MDCK) cell monolayers

    SciTech Connect

    Cho, M.J.; Adson, A.; Kezdy, F.J. )

    1990-04-01

    Transport of 14C-labeled acetic, propionic (PA), butyric, valeric, heptanoic (HA), and octanoic (OA) acids across the Madin Darby canine kidney (MDCK) epithelial cell monolayer grown on a porous polycarbonate membrane was studied in Hanks' balanced salt solution (HBSS) at 37{degrees}C in both apical-to-basolateral and basolateral-to-apical directions. At micromolar concentrations of solutes, metabolic decomposition was significant as evidenced by (14C)CO2 production during the OA transport. The apparent permeability (Pe) indicates that as lipophilicity increases, diffusion across the unstirred boundary layer becomes rate limiting. In support of this notion, transport of OA and HA was enhanced by agitation, showed an activation energy of 3.7 kcal/mol for OA, and resulted in identical Pe values for both transport directions. Analysis of Pe changes with varying alkyl chain length resulted in a delta G of -0.68 +/- 0.09 kcal/mol for -CH2-group transfer from an aqueous phase to the MDCK cells. When the intercellular tight junctions were opened by the divalent chelator EGTA in Ca2+/Mg2(+)-free HBSS, transport of the fluid-phase marker Lucifer yellow greatly increased because of paracellular leakage. PA transport also showed a significant increase, but OA transport was independent of EGTA. Although albumin also undergoes paracellular transport in the presence of EGTA and OA binds strongly to albumin, OA transport in EGTA solution was unchanged by albumin. These observations indicate that transmembrane transport is the major mechanism for lipophilic substances. The present study, together with earlier work on the transport of polar substances, shows that the MDCK cell monolayer is an excellent model of the transepithelial transport barrier.

  3. Aluminum in acidic surface waters: chemistry, transport, and effects.

    PubMed Central

    Driscoll, C T

    1985-01-01

    Ecologically significant concentrations of Al have been reported in surface waters draining "acid-sensitive" watersheds that are receiving elevated inputs of acidic deposition. It has been hypothesized that mineral acids from atmospheric deposition have remobilized Al previously precipitated within the soil during soil development. This Al is then thought to be transported to adjacent surface waters. Dissolved mononuclear Al occurs as aquo Al, as well as OH-, F-, SO4(2-), and organic complexes. Although past investigations have often ignored non-hydroxide complexes of Al, it appears that organic and F complexes are the predominant forms of Al in dilute (low ionic strength) acidic surface waters. The concentration of inorganic forms of Al increases exponentially with decreases in solution pH. This response is similar to the theoretical pH dependent solubility of Al mineral phases. The concentration of organic forms of Al, however, is strongly correlated with variations in organic carbon concentration of surface waters rather than pH. Elevated concentrations of Al in dilute acidic waters are of interest because: Al is an important pH buffer; Al may influence the cycling of important elements like P, organic carbon, and trace metals; and Al is potentially toxic to aquatic organisms. An understanding of the aqueous speciation of Al is essential for an evaluation of these processes. PMID:3935428

  4. Ion homeostasis, channels, and transporters: an update on cellular mechanisms.

    PubMed

    Dubyak, George R

    2004-12-01

    The steady-state maintenance of highly asymmetric concentrations of the major inorganic cations and anions is a major function of both plasma membranes and the membranes of intracellular organelles. Homeostatic regulation of these ionic gradients is critical for most functions. Due to their charge, the movements of ions across biological membranes necessarily involves facilitation by intrinsic membrane transport proteins. The functional characterization and categorization of membrane transport proteins was a major focus of cell physiological research from the 1950s through the 1980s. On the basis of these functional analyses, ion transport proteins were broadly divided into two classes: channels and carrier-type transporters (which include exchangers, cotransporters, and ATP-driven ion pumps). Beginning in the mid-1980s, these functional analyses of ion transport and homeostasis were complemented by the cloning of genes encoding many ion channels and transporter proteins. Comparison of the predicted primary amino acid sequences and structures of functionally similar ion transport proteins facilitated their grouping within families and superfamilies of structurally related membrane proteins. Postgenomics research in ion transport biology increasingly involves two powerful approaches. One involves elucidation of the molecular structures, at the atomic level in some cases, of model ion transport proteins. The second uses the tools of cell biology to explore the cell-specific function or subcellular localization of ion transport proteins. This review will describe how these approaches have provided new, and sometimes surprising, insights regarding four major questions in current ion transporter research. 1) What are the fundamental differences between ion channels and ion transporters? 2) How does the interaction of an ion transport protein with so-called adapter proteins affect its subcellular localization or regulation by various intracellular signal transduction

  5. Atmospheric transport and diffusion mechanisms in coastal circulation systems

    SciTech Connect

    Kaleel, R.J.; Shearer, D.L.; MacRae, B.L.

    1983-06-01

    This study defines the cyclical aspects of coastal atmospheric behavior that are important to the transport and diffusion (dispersion) of radionuclides. The report is developed around discussions of the meteorological dynamics of the cyclical and (cellular) atmospheric coastal phenomena and the atmospheric transport/diffusion mechanisms along with an assessment of the measurements accompanying both. Further, the efforts directed to modeling both the atmospheric and transport/diffusion processes are summarized and evaluated. Lastly, the review is summarized through a set of conclusions about the current level of understanding of coastal atmospheric phenomena. Recommendations are offered which identify certain aspects of local scale cyclical coastal phenomena that are important to the NRC.

  6. X-ray structure of dopamine transporter elucidates antidepressant mechanism.

    PubMed

    Penmatsa, Aravind; Wang, Kevin H; Gouaux, Eric

    2013-11-01

    Antidepressants targeting Na(+)/Cl(-)-coupled neurotransmitter uptake define a key therapeutic strategy to treat clinical depression and neuropathic pain. However, identifying the molecular interactions that underlie the pharmacological activity of these transport inhibitors, and thus the mechanism by which the inhibitors lead to increased synaptic neurotransmitter levels, has proven elusive. Here we present the crystal structure of the Drosophila melanogaster dopamine transporter at 3.0 Å resolution bound to the tricyclic antidepressant nortriptyline. The transporter is locked in an outward-open conformation with nortriptyline wedged between transmembrane helices 1, 3, 6 and 8, blocking the transporter from binding substrate and from isomerizing to an inward-facing conformation. Although the overall structure of the dopamine transporter is similar to that of its prokaryotic relative LeuT, there are multiple distinctions, including a kink in transmembrane helix 12 halfway across the membrane bilayer, a latch-like carboxy-terminal helix that caps the cytoplasmic gate, and a cholesterol molecule wedged within a groove formed by transmembrane helices 1a, 5 and 7. Taken together, the dopamine transporter structure reveals the molecular basis for antidepressant action on sodium-coupled neurotransmitter symporters and elucidates critical elements of eukaryotic transporter structure and modulation by lipids, thus expanding our understanding of the mechanism and regulation of neurotransmitter uptake at chemical synapses. PMID:24037379

  7. How to move an amphipathic molecule across a lipid bilayer: different mechanisms for different ABC transporters?

    PubMed

    Theodoulou, Frederica L; Carrier, David J; Schaedler, Theresia A; Baldwin, Stephen A; Baker, Alison

    2016-06-15

    Import of β-oxidation substrates into peroxisomes is mediated by ATP binding cassette (ABC) transporters belonging to subfamily D. In order to enter the β-oxidation pathway, fatty acids are activated by conversion to fatty acyl-CoA esters, a reaction which is catalysed by acyl-CoA synthetases (ACSs). Here, we present evidence for an unusual transport mechanism, in which fatty acyl-CoA substrates are accepted by ABC subclass D protein (ABCD) transporters, cleaved by the transporters during transit across the lipid bilayer to release CoA, and ultimately re-esterified in the peroxisome lumen by ACSs which interact with the transporter. We propose that this solves the biophysical problem of moving an amphipathic molecule across the peroxisomal membrane, since the intrinsic thioesterase activity of the transporter permits separate membrane translocation pathways for the hydrophobic fatty acid moiety and the polar CoA moiety. The cleavage/re-esterification mechanism also has the potential to control entry of disparate substrates into the β-oxidation pathway when coupled with distinct peroxisomal ACSs. A different solution to the movement of amphipathic molecules across a lipid bilayer is deployed by the bacterial lipid-linked oligosaccharide (LLO) flippase, PglK, in which the hydrophilic head group and the hydrophobic polyprenyl tail of the substrate are proposed to have distinct translocation pathways but are not chemically separated during transport. We discuss a speculative alternating access model for ABCD proteins based on the mammalian ABC transporter associated with antigen processing (TAP) and compare it to the novel mechanism suggested by the recent PglK crystal structures and biochemical data. PMID:27284041

  8. How to move an amphipathic molecule across a lipid bilayer: different mechanisms for different ABC transporters?

    PubMed Central

    Theodoulou, Frederica L.; Carrier, David J.; Schaedler, Theresia A.; Baldwin, Stephen A.; Baker, Alison

    2016-01-01

    Import of β-oxidation substrates into peroxisomes is mediated by ATP binding cassette (ABC) transporters belonging to subfamily D. In order to enter the β-oxidation pathway, fatty acids are activated by conversion to fatty acyl-CoA esters, a reaction which is catalysed by acyl-CoA synthetases (ACSs). Here, we present evidence for an unusual transport mechanism, in which fatty acyl-CoA substrates are accepted by ABC subclass D protein (ABCD) transporters, cleaved by the transporters during transit across the lipid bilayer to release CoA, and ultimately re-esterified in the peroxisome lumen by ACSs which interact with the transporter. We propose that this solves the biophysical problem of moving an amphipathic molecule across the peroxisomal membrane, since the intrinsic thioesterase activity of the transporter permits separate membrane translocation pathways for the hydrophobic fatty acid moiety and the polar CoA moiety. The cleavage/re-esterification mechanism also has the potential to control entry of disparate substrates into the β-oxidation pathway when coupled with distinct peroxisomal ACSs. A different solution to the movement of amphipathic molecules across a lipid bilayer is deployed by the bacterial lipid-linked oligosaccharide (LLO) flippase, PglK, in which the hydrophilic head group and the hydrophobic polyprenyl tail of the substrate are proposed to have distinct translocation pathways but are not chemically separated during transport. We discuss a speculative alternating access model for ABCD proteins based on the mammalian ABC transporter associated with antigen processing (TAP) and compare it to the novel mechanism suggested by the recent PglK crystal structures and biochemical data. PMID:27284041

  9. Regulation of hepatic bile acid transporters Ntcp and Bsep expression.

    PubMed

    Cheng, Xingguo; Buckley, David; Klaassen, Curtis D

    2007-12-01

    Sodium-taurocholate cotransporting polypeptide (Ntcp) and bile salt export pump (Bsep) are two key transporters for hepatic bile acid uptake and excretion. Alterations in Ntcp and Bsep expression have been reported in pathophysiological conditions. In the present study, the effects of age, gender, and various chemicals on the regulation of these two transporters were characterized in mice. Ntcp and Bsep mRNA levels in mouse liver were low in the fetus, but increased to its highest expression at parturition. After birth, mouse Ntcp and Bsep mRNA decreased by more than 50%, and then gradually increased to adult levels by day 30. Expression of mouse Ntcp mRNA and protein exhibit higher levels in female than male livers. No gender difference exists in BSEP/Bsep expression in human and mouse livers. Hormone replacements conducted in gonadectomized, hypophysectomized, and lit/lit mice indicate that female-predominant Ntcp expression in mouse liver is due to the inhibitory effect of male-pattern GH secretion, but not sex hormones. Ntcp and Bsep expression are in general resistant to induction by a large battery of microsomal enzyme inducers. Administration of cholestyramine increased Ntcp, whereas chenodeoxycholic acid (CDCA) increased Bsep mRNA expression. In conclusion, mouse Ntcp and Bsep are regulated by age, gender, cholestyramine, and bile acid, but resistant to induction by most microsomal enzyme inducers. PMID:17897632

  10. MATE Transporter-Dependent Export of Hydroxycinnamic Acid Amides.

    PubMed

    Dobritzsch, Melanie; Lübken, Tilo; Eschen-Lippold, Lennart; Gorzolka, Karin; Blum, Elke; Matern, Andreas; Marillonnet, Sylvestre; Böttcher, Christoph; Dräger, Birgit; Rosahl, Sabine

    2016-02-01

    The ability of Arabidopsis thaliana to successfully prevent colonization by Phytophthora infestans, the causal agent of late blight disease of potato (Solanum tuberosum), depends on multilayered defense responses. To address the role of surface-localized secondary metabolites for entry control, droplets of a P. infestans zoospore suspension, incubated on Arabidopsis leaves, were subjected to untargeted metabolite profiling. The hydroxycinnamic acid amide coumaroylagmatine was among the metabolites secreted into the inoculum. In vitro assays revealed an inhibitory activity of coumaroylagmatine on P. infestans spore germination. Mutant analyses suggested a requirement of the p-coumaroyl-CoA:agmatine N4-p-coumaroyl transferase ACT for the biosynthesis and of the MATE transporter DTX18 for the extracellular accumulation of coumaroylagmatine. The host plant potato is not able to efficiently secrete coumaroylagmatine. This inability is overcome in transgenic potato plants expressing the two Arabidopsis genes ACT and DTX18. These plants secrete agmatine and putrescine conjugates to high levels, indicating that DTX18 is a hydroxycinnamic acid amide transporter with a distinct specificity. The export of hydroxycinnamic acid amides correlates with a decreased ability of P. infestans spores to germinate, suggesting a contribution of secreted antimicrobial compounds to pathogen defense at the leaf surface. PMID:26744218

  11. Choline inhibition of amino acid transport in preimplantation mouse blastocysts

    SciTech Connect

    Campione, A.L.; Haghighat, N.; Gorman, J.; Van Winkle, L.J.

    1987-05-01

    Addition of 70 mM choline chloride to Brinster's medium (140 mM Na/sup +/) inhibited uptake of approx. 1 ..mu..M (/sup 3/H)glycine, leucine, lysine and alanine in blastocysts by about 50% each during a five-minute incubation period at 37/sup 0/C, whereas 70 mM LiCl, sodium acetate and NaCl or 140 mM mannitol had no effect. They attribute the apparent linear relationship between Gly transport in blastocysts and the square of the (Na/sup +/), observed when choline was substituted for Na/sup +/ in Brinster's medium, to concomitant, concentration-dependent enhancement and inhibition of transport by Na/sup +/ and choline, respectively. As expected, Gly uptake and the (Na/sup +/) were linearly related up to 116 mM Na/sup +/, when Na/sup +/ was replaced with Li/sup +/. The rates of Na/sup +/-independent Gly and Ala uptake were <5% and <2% of the total, respectively, and similar when either Li/sup +/ or choline replaced Na/sup +/. Therefore, neither Li/sup +/ nor choline appears to substitute for Na/sup +/ in supporting Na/sup +/-dependent transport in blastocysts. Na/sup +/-independent Leu uptake was 20 times faster than Gly or Ala uptake and appeared to be inhibited by choline in blastocysts since it was about 37% slower when choline instead of Li/sup +/ was substituted for Na/sup +/. In contrast to blastocysts, choline had no effect on amino acid transport in cleavage-stage mouse embryos. The unexpected sensitivity of transport to choline in blastocysts underscores the importance of testing the effects of this substance when it is used to replace Na/sup +/ in new transport studies.

  12. Transport and metabolism of glycolic acid by Chlamydomonas reinhardtii

    SciTech Connect

    Wilson, B.J.

    1987-01-01

    In order to understand the excretion of glycolate from Chlamydomonas reinhardtii, the conditions affecting glycolate synthesis and metabolism were investigated. Although glycolate is synthesized only in the light, the metabolism occurs in the light and dark with greater metabolism in the light due to refixation of photorespiratory CO/sub 2/. The amount of internal glycolate will affect the metabolism of externally added glycolate. When glycolate synthesis exceeds the metabolic capacity, glycolate is excreted from the cell. The transport of glycolate into the cells occurs very rapidly. Equilibrium is achieved at 4/sup 0/C within the time cells are pelleted by the silicone oil centrifugation technique through a layer of (/sup 14/C) glycolate. Glycolate uptake does not show the same time, temperature and pH dependencies as diffusion of benzoate. Uptake can be inhibited by treatment of cells with N-ethylmaleimide and stimulated in the presence of valino-mycin/KCl. Acetate and lactate are taken up as quickly as glycolate. The hypothesis was made that glycolate is transported by a protein carrier that transports monocarboxylic acids. The equilibrium concentration of glycolate is dependent on the cell density, implying that there may be a large number of transporter sites and that uptake is limited by substrate availability.

  13. Perfluorocarboxylic acid (PFCA) atmospheric formation and transport to the Arctic.

    NASA Astrophysics Data System (ADS)

    Pike-thackray, C.; Selin, N. E.

    2015-12-01

    Perfluorocarboxylic acids (PFCAs) are highly persistent and toxic environmental contaminants that have been found in remote locations such as the Arctic, far from emission sources. These persistent organic pollutants are emitted directly to the atmosphere as well as being produced by the degradation of precursor compounds in the atmosphere, but recent trends towards increasing precursor emissions and decreasing direct emissions raise the importance of production in the atmosphere. Our work aims to improve understanding of the atmospheric degradation of fluorotelomer precursor compounds to form the long-chain PFCAs PFOA (C8) and PFNA (C9).Using the atmospheric chemical transport model GEOS-Chem, which uses assimilated meteorology to simulate the atmospheric transport of trace gas species, we investigate the interaction of the atmospheric formation of PFCAs and the atmospheric transport of their precursor species. Our simulations are a first application of the GEOS-Chem framework to PFCA chemistry. We highlight the importance of the spatial and temporal variability of background atmospheric chemical conditions experienced during transport. We find that yields and formation times of PFOA and PFNA respond differently and strongly to the photochemical conditions of the atmosphere, such as the abundance of NO, HO2, and other photochemical species.

  14. Salvianolic acids: small compounds with multiple mechanisms for cardiovascular protection

    PubMed Central

    2011-01-01

    Salvianolic acids are the most abundant water-soluble compounds extracted from Radix Salvia miltiorrhiza (Danshen). In China, Danshen has been wildly used to treat cardiovascular diseases for hundreds of years. Salvianolic acids, especially salvianolic acid A (Sal A) and salvianolic acid B (Sal B), have been found to have potent anti-oxidative capabilities due to their polyphenolic structure. Recently, intracellular signaling pathways regulated by salvianolic acids in vascular endothelial cells, aortic smooth muscle cells, as well as cardiomyocytes, have been investigated both in vitro and in vivo upon various cardiovascular insults. It is discovered that the cardiovascular protection of salvianolic acids is not only because salvianolic acids act as reactive oxygen species scavengers, but also due to the reduction of leukocyte-endothelial adherence, inhibition of inflammation and metalloproteinases expression from aortic smooth muscle cells, and indirect regulation of immune function. Competitive binding of salvianolic acids to target proteins to interrupt protein-protein interactions has also been found to be a mechanism of cardiovascular protection by salvianolic acids. In this article, we review a variety of studies focusing on the above mentioned mechanisms. Besides, the target proteins of salvianolic acids are also described. These results of recent advances have shed new light to the development of novel therapeutic strategies for salvianolic acids to treat cardiovascular diseases. PMID:21569331

  15. Amino acid depletion activates TonEBP and sodium-coupled inositol transport.

    PubMed

    Franchi-Gazzola, R; Visigalli, R; Dall'Asta, V; Sala, R; Woo, S K; Kwon, H M; Gazzola, G C; Bussolati, O

    2001-06-01

    The expression of the osmosensitive sodium/myo-inositol cotransporter (SMIT) is regulated by multiple tonicity-responsive enhancers (TonEs) in the 5'-flanking region of the gene. In response to hypertonicity, the nuclear abundance of the transcription factor TonE-binding protein (TonEBP) is increased, and the transcription of the SMIT gene is induced. Transport system A for neutral amino acids, another osmosensitive mechanism, is progressively stimulated if amino acid substrates are not present in the extracellular compartment. Under this condition, as in hypertonicity, cells shrink and mitogen-activated protein kinases are activated. We demonstrate here that a clear-cut nuclear redistribution of TonEBP, followed by SMIT expression increase and inositol transport activation, is observed after incubation of cultured human fibroblasts in Earle's balanced salts (EBSS), an isotonic, amino acid-free saline. EBSS-induced SMIT stimulation is prevented by substrates of system A, although these compounds do not compete with inositol for transport through SMIT. We conclude that the incubation in isotonic, amino acid-free saline triggers an osmotic stimulus and elicits TonEBP-dependent responses like hypertonic treatment. PMID:11350742

  16. Catalyst Transport in Corn Stover Internodes: Elucidating Transport Mechanisms Using Direct Blue-I

    SciTech Connect

    Viamajala, S.; Selig, M. J.; Vinzant, T. B.; Tucker, M. P.; Himmel, M. E.; McMillan, J. D.; Decker, S. R.

    2006-04-01

    The transport of catalysts (chemicals and enzymes) within plant biomass is believed to be a major bottleneck during thermochemical pretreatment and enzymatic conversion of lignocellulose. Subjecting biomass to size reduction and mechanical homogenization can reduce catalyst transport limitations; however, such processing adds complexity and cost to the over-all process. Using high-resolution light microscopy, we have monitored the transport of an aqueous solution of Direct Blue-I (DB-I) dye through intact corn internodes under a variety of impregnation conditions. DB-I is a hydrophilic anionic dye with affinity for cellulose. This model system has enabled us to visualize likely barriers and mechanisms of catalyst transport in corn stems. Microscopic images were compared with calculated degrees of saturation (i.e., volume fraction of internode void space occupied by dye solution) to correlate impregnation strategies with dye distribution and transport mechanisms. Results show the waxy rind exterior and air trapped within individual cells to be the major barriers to dye transport, whereas the vascular bundles, apoplastic continuum (i.e., the intercellular void space at cell junctions), and fissures formed during the drying process provided the most utilized pathways for transport. Although representing only 20-30% of the internode volume, complete saturation of the apoplast and vascular bundles by fluid allowed dye contact with a majority of the cells in the internode interior.

  17. Unveiling the gating mechanism of ECF Transporter RibU

    NASA Astrophysics Data System (ADS)

    Song, Jianing; Ji, Changge; Zhang, John Z. H.

    2013-12-01

    Energy-coupling factor (ECF) transporters are responsible for uptake of micronutrients in prokaryotes. The recently reported crystal structure of an ECF transporter RibU provided a foundation for understanding the structure and transport mechanism of ECF transporters. In the present study, molecular dynamics (MD) was carried out to study the conformational changes of the S component RibU upon binding by riboflavin. Our result and analysis revealed a critically important gating mechanism, in which part of loop5 (L5') (eleven residues, missing in the crystal structure) between TM5 and TM6 is dynamically flexible and serves as a gate. Specifically, the L5' opens a large cavity accessible to riboflavin from the extracellular space in Apo-RibU and closes the cavity upon riboflavin binding through hydrophobic packing with riboflavin. Thus, L5'is proposed to be the gate for riboflavin binding. In addition, steered molecular dynamics (SMD) simulation is employed to investigate the translocation dynamics of RibU during riboflavin transport. The simulation result does not show evidence that the S component alone can carry out the transport function. Since loop regions are very flexible and therefore could not be resolved by crystallography, their dynamics are hard to predict based on crystal structure alone.

  18. Directional auxin transport mechanisms in early diverging land plants.

    PubMed

    Viaene, Tom; Landberg, Katarina; Thelander, Mattias; Medvecka, Eva; Pederson, Eric; Feraru, Elena; Cooper, Endymion D; Karimi, Mansour; Delwiche, Charles F; Ljung, Karin; Geisler, Markus; Sundberg, Eva; Friml, Jiří

    2014-12-01

    The emergence and radiation of multicellular land plants was driven by crucial innovations to their body plans. The directional transport of the phytohormone auxin represents a key, plant-specific mechanism for polarization and patterning in complex seed plants. Here, we show that already in the early diverging land plant lineage, as exemplified by the moss Physcomitrella patens, auxin transport by PIN transporters is operational and diversified into ER-localized and plasma membrane-localized PIN proteins. Gain-of-function and loss-of-function analyses revealed that PIN-dependent intercellular auxin transport in Physcomitrella mediates crucial developmental transitions in tip-growing filaments and waves of polarization and differentiation in leaf-like structures. Plasma membrane PIN proteins localize in a polar manner to the tips of moss filaments, revealing an unexpected relation between polarization mechanisms in moss tip-growing cells and multicellular tissues of seed plants. Our results trace the origins of polarization and auxin-mediated patterning mechanisms and highlight the crucial role of polarized auxin transport during the evolution of multicellular land plants. PMID:25448004

  19. Chlorpromazine, clozapine and olanzapine inhibit anionic amino acid transport in cultured human fibroblasts.

    PubMed

    Marchesi, C; Dall'Asta, V; Rotoli, B M; Bianchi, M G; Maggini, C; Gazzola, G C; Bussolati, O

    2006-09-01

    We report here that chlorpromazine, a first generation antipsychotic drug, inhibits anionic amino acid transport mediated by system X(-) (AG) (EAAT transporters) in cultured human fibroblasts. With 30 microM chlorpromazine, transport inhibition is detectable after 3 h of treatment, maximal after 48 h (>60%), and referable to a decrease in V(max). Chlorpromazine effect is not dependent upon changes of membrane potential and is selective for system X(-) (AG) since transport systems A and y(+) are not affected. Among antipsychotic drugs, the inhibitory effect of chlorpromazine is shared by two dibenzodiazepines, clozapine and olanzapine, while other compounds, such as risperidon, zuclopentixol, sertindol and haloperidol, are not effective. Transport inhibition by clozapine and olanzapine, but not by chlorpromazine, is reversible, suggesting that the mechanisms involved are distinct. These results indicate that a subset of antipsychotic drugs inhibits EAAT transporters in non-nervous tissues and prompt further investigation on possible alterations of glutamate transport in peripheral tissues of schizophrenic patients. PMID:16699818

  20. Mechanism of the reaction of isocyanic acid with ethanol

    SciTech Connect

    Sheludyakov, Y.L.; Shubareva, F.Z.; Golodov, V.A.; Korolev, A.V.

    1995-03-01

    The kinetics of the interaction of isocyanic acid with ethanol is investigated. The reaction products include ethyl carbamate and ethyl allophanate, the yields of which depend on both the concentration ratio of HNCO:ROH and the presence of a catalyst. The influence of water, acid, and base additives is also examined. A reaction mechanism is proposed.

  1. Richardson-Schottky transport mechanism in ZnS nanoparticles

    NASA Astrophysics Data System (ADS)

    Ali, Hassan; Khan, Usman; Rafiq, M. A.; Falak, Attia; Narain, Adeela; Jing, Tang; Xu, Xiulai

    2016-05-01

    We report the synthesis and electrical transport mechanism in ZnS semiconductor nanoparticles. Temperature dependent direct current transport measurements on the compacts of ZnS have been performed to investigate the transport mechanism for temperature ranging from 300 K to 400 K. High frequency dielectric constant has been used to obtain the theoretical values of Richardson-Schottky and Poole-Frenkel barrier lowering coefficients. Experimental value of the barrier lowering coefficient has been calculated from conductance-voltage characteristics. The experimental value of barrier lowering coefficient βexp lies close to the theoretical value of Richardson-Schottky barrier lowering coefficient βth,RS showing Richardson-Schottky emission has been responsible for conduction in ZnS nanoparticles for the temperature range studied.

  2. Molecular mechanism and functional significance of acid generation in the Drosophila midgut

    PubMed Central

    Overend, Gayle; Luo, Yuan; Henderson, Louise; Douglas, Angela E.; Davies, Shireen A.; Dow, Julian A. T.

    2016-01-01

    The gut of Drosophila melanogaster includes a proximal acidic region (~pH 2), however the genome lacks the H+/K+ ATPase characteristic of the mammalian gastric parietal cell, and the molecular mechanisms of acid generation are poorly understood. Here, we show that maintenance of the low pH of the acidic region is dependent on H+ V-ATPase, together with carbonic anhydrase and five further transporters or channels that mediate K+, Cl− and HCO3− transport. Abrogation of the low pH did not influence larval survival under standard laboratory conditions, but was deleterious for insects subjected to high Na+ or K+ load. Insects with elevated pH in the acidic region displayed increased susceptibility to Pseudomonas pathogens and increased abundance of key members of the gut microbiota (Acetobacter and Lactobacillus), suggesting that the acidic region has bacteriostatic or bacteriocidal activity. Conversely, the pH of the acidic region was significantly reduced in germ-free Drosophila, indicative of a role of the gut bacteria in shaping the pH conditions of the gut. These results demonstrate that the acidic gut region protects the insect and gut microbiome from pathological disruption, and shed light on the mechanisms by which low pH can be maintained in the absence of H+, K+ ATPase. PMID:27250760

  3. Molecular mechanism and functional significance of acid generation in the Drosophila midgut.

    PubMed

    Overend, Gayle; Luo, Yuan; Henderson, Louise; Douglas, Angela E; Davies, Shireen A; Dow, Julian A T

    2016-01-01

    The gut of Drosophila melanogaster includes a proximal acidic region (~pH 2), however the genome lacks the H(+)/K(+) ATPase characteristic of the mammalian gastric parietal cell, and the molecular mechanisms of acid generation are poorly understood. Here, we show that maintenance of the low pH of the acidic region is dependent on H(+) V-ATPase, together with carbonic anhydrase and five further transporters or channels that mediate K(+), Cl(-) and HCO3(-) transport. Abrogation of the low pH did not influence larval survival under standard laboratory conditions, but was deleterious for insects subjected to high Na(+) or K(+) load. Insects with elevated pH in the acidic region displayed increased susceptibility to Pseudomonas pathogens and increased abundance of key members of the gut microbiota (Acetobacter and Lactobacillus), suggesting that the acidic region has bacteriostatic or bacteriocidal activity. Conversely, the pH of the acidic region was significantly reduced in germ-free Drosophila, indicative of a role of the gut bacteria in shaping the pH conditions of the gut. These results demonstrate that the acidic gut region protects the insect and gut microbiome from pathological disruption, and shed light on the mechanisms by which low pH can be maintained in the absence of H(+), K(+) ATPase. PMID:27250760

  4. Issues in tokamak/stellarator transport and confinement enhancement mechanisms

    SciTech Connect

    Perkins, F.W.

    1990-08-01

    At present, the mechanism for anomalous energy transport in low-{beta} toroidal plasmas -- tokamaks and stellarators -- remains unclear, although transport by turbulent E {times} B velocities associated with nonlinear, fine-scale microinstabilities is a leading candidate. This article discusses basic theoretical concepts of various transport and confinement enhancement mechanisms as well as experimental ramifications which would enable one to distinguish among them and hence identify a dominant transport mechanism. While many of the predictions of fine-scale turbulence are born out by experiment, notable contradictions exist. Projections of ignition margin rest both on the scaling properties of the confinement mechanism and on the criteria for entering enhanced confinement regimes. At present, the greatest uncertainties lie with the basis for scaling confinement enhancement criteria. A series of questions, to be answered by new experimental/theoretical work, is posed to resolve these outstanding contradictions (or refute the fine-scale turbulence model) and to establish confinement enhancement criteria. 73 refs., 4 figs., 5 tabs.

  5. The prebiotic synthesis of amino acids - interstellar vs. atmospheric mechanisms

    NASA Astrophysics Data System (ADS)

    Meierhenrich, U. J.; Muñoz Caro, G. M.; Schutte, W. A.; Barbier, B.; Arcones Segovia, A.; Rosenbauer, H.; Thiemann, W. H.-P.; Brack, A.

    2002-11-01

    Until very recently, prebiotic amino acids were believed to have been generated in the atmosphere of the early Earth, as successfully simulated by the Urey-Miller experiments. Two independent studies now identified ice photochemistry in the interstellar medium as a possible source of prebiotic amino acids. Ultraviolet irradiation of ice mixtures containing identified interstellar molecules (such as H2O, CO2, CO, CH3OH, and NH3) in the conditions of vacuum and low temperature found in the interstellar medium generated amino acid structures including glycine, alanine, serine, valine, proline, and aspartic acid. After warmup, hydrolysis and derivatization, our team was able to identify 16 amino acids as well as furans and pyrroles. Enantioselective analyses of the amino acids showed racemic mixtures. A prebiotic interstellar origin of amino acid structures is now discussed to be a plausible alternative to the Urey-Miller mechanism.

  6. Modeling of glycerol-3-phosphate transporter suggests a potential 'tilt' mechanism involved in its function.

    PubMed

    Tsigelny, Igor F; Greenberg, Jerry; Kouznetsova, Valentina; Nigam, Sanjay K

    2008-10-01

    "rocker switch" may apply to certain MFS transporters, intermediate "tilted" states may exist under certain circumstances or as transitional structures. Although wet lab experimental confirmation is required, our results suggest that transport mechanisms in this transporter family should probably not be assumed to be conserved simply based on standard structural homology considerations. Furthermore, steered molecular dynamics elucidating energetic interactions of ligands with amino acid residues in an appropriately modeled transporter may have predictive value in understanding the impact of mutations and/or polymorphisms on transporter function. PMID:18942157

  7. Tumor microenvironment promotes dicarboxylic acid carrier-mediated transport of succinate to fuel prostate cancer mitochondria

    PubMed Central

    Zhunussova, Aigul; Sen, Bhaswati; Friedman, Leah; Tuleukhanov, Sultan; Brooks, Ari D; Sensenig, Richard; Orynbayeva, Zulfiya

    2015-01-01

    Prostate cancer cells reprogram their metabolism, so that they support their elevated oxidative phosphorylation and promote a cancer friendly microenvironment. This work aimed to explore the mechanisms that cancer cells employ for fueling themselves with energy rich metabolites available in interstitial fluids. The mitochondria oxidative phosphorylation in metastatic prostate cancer DU145 cells and normal prostate epithelial PrEC cells were studied by high-resolution respirometry. An important finding was that prostate cancer cells at acidic pH 6.8 are capable of consuming exogenous succinate, while physiological pH 7.4 was not favorable for this process. Using specific inhibitors, it was demonstrated that succinate is transported in cancer cells by the mechanism of plasma membrane Na+-dependent dycarboxylic acid transporter NaDC3 (SLC13A3 gene). Although the level of expression of SLC13A3 was not significantly altered when maintaining cells in the medium with lower pH, the respirometric activity of cells under acidic condition was elevated in the presence of succinate. In contrast, normal prostate cells while expressing NaDC3 mRNA do not produce NaDC3 protein. The mechanism of succinate influx via NaDC3 in metastatic prostate cancer cells could yield a novel target for anti-cancer therapy and has the potential to be used for imaging-based diagnostics to detect non-glycolytic tumors. PMID:26175936

  8. Studies on the Mechanism of Action of Nalidixic Acid

    PubMed Central

    Bourguignon, Gerard J.; Levitt, Martin; Sternglanz, Rolf

    1973-01-01

    With three independent techniques (absorption spectrophotometry, measurement of the deoxyribonucleic acid [DNA] melting temperature, and equilibrium dialysis), no evidence has been found for the binding of nalidixic acid to purified DNA. Also, no evidence has been found to support the hypothesis that nalidixic acid is permanently modified to a new, active compound by the bacterial cell. By using an in vitro DNA replication system developed by Bonhoeffer and colleagues, soluble extracts from nalidixic acid-sensitive cells have been shown to confer nalidixic acid sensitivity on the DNA synthesis of lysates from nalidixic acid-resistant cells. The activity in the extracts is only present in sensitive cells and is nondialyzable and heat sensitive. Finally, two known nalidixic acid-resistant mutants of Escherichia coli, mapping at nal A and nal B, respectively, have been tested to determine whether either of them is a transport mutant. It has been shown that nal Br is a transport mutant whereas nal Ar is not. PMID:4208771

  9. Temperature and Mechanisms of Methane Transport in Trees

    NASA Astrophysics Data System (ADS)

    Kutschera, E.; Khalil, A. K.; Rice, A. L.; Rosenstiel, T. N.; Butenhoff, C. L.

    2012-12-01

    The mechanisms of methane (CH4) transport through trees are still not well understood. Previous work has established that transport mechanisms likely differ from rice and emergent aquatic plants. Establishing the role of trees in overall plant CH4 emissions requires a thorough understanding of tree transport. Using stable isotope measurements of CH4 assists in elucidating these transport mechanisms. Although it has been shown that CH4 is transported through the stems of trees, emission from leaves by transpiration has not been ruled out. The effect of temperature on these mechanisms is important to the prediction of changes in CH4 emissions from the biosphere in altered global climates. The effect of temperature on methane (CH4) emitted from black cottonwood (Populus trichocarpa) trees has been measured. Trees were grown hydroponically under greenhouse conditions. After several months of growth, CH4 canopy flux was measured over three weeks. Temperatures were altered from 22oC the first week to 25oC the second week and to 18oC the final week. CH4 flux increased with temperature, where the difference in flux between the coolest and warmest week was statistically significant. A Q10 for CH4 flux from trees was calculated to be 2.7. Stable carbon isotope measurements of emitted CH4 were enriched at the warmest temperature compared to the coolest temperature, although all measurements were depleted with respect to the isotopic composition of root water CH4. This data not only gives insight into the temperature effects on CH4 flux from trees, but the mechanisms of CH4 flux themselves. This research was supported in part by the Office of Science (BER), U. S. Department of Energy, Grant No. DE-FG02-08ER64515, and through NASA / Oregon Space Grant Consortium, grants NNG05GJ85H and NNX10AK68H.

  10. Increased Rat Placental Fatty Acid, but Decreased Amino Acid and Glucose Transporters Potentially Modify Intrauterine Programming.

    PubMed

    Nüsken, Eva; Gellhaus, Alexandra; Kühnel, Elisabeth; Swoboda, Isabelle; Wohlfarth, Maria; Vohlen, Christina; Schneider, Holm; Dötsch, Jörg; Nüsken, Kai-Dietrich

    2016-07-01

    Regulation of placental nutrient transport significantly affects fetal development and may modify intrauterine growth restriction (IUGR) and fetal programming. We hypothesized that placental nutrient transporters are differentially affected both by utero-placental insufficiency and prenatal surgical stress. Pregnant rats underwent bilateral uterine artery and vein ligation (LIG), sham operation (SOP) or no operation (controls, C) on gestational day E19. Placentas were obtained by caesarean section 4 h (LIG, n=20 placentas; SOP, n=24; C, n=12), 24 h (LIG, n=28; SOP, n=20; C, n=12) and 72 h (LIG, n=20; SOP, n=20; C, n=24) after surgery. Gene and protein expression of placental nutrient transporters for fatty acids (h-FABP, CD36), amino acids (SNAT1, SNAT2) and glucose (GLUT-1, Connexin 26) were examined by qRT-PCR, western blot and immunohistochemistry. Interestingly, the mean protein expression of h-FABP was doubled in placentas of LIG and SOP animals 4, 24 (SOP significant) and 72 h (SOP significant) after surgery. CD36 protein was significantly increased in LIG after 72 h. SNAT1 and SNAT2 protein and gene expressions were significantly reduced in LIG and SOP after 24 h. Further significantly reduced proteins were GLUT-1 in LIG (4 h, 72 h) and SOP (24 h), and Connexin 26 in LIG (72 h). In conclusion, placental nutrient transporters are differentially affected both by reduced blood flow and stress, probably modifying the already disturbed intrauterine milieu and contributing to IUGR and fetal programming. Increased fatty acid transport capacity may affect energy metabolism and could be a compensatory reaction with positive effects on brain development. J. Cell. Biochem. 117: 1594-1603, 2016. © 2015 Wiley Periodicals, Inc. PMID:26590355

  11. Regulation of hepatic bile acid transporters Ntcp and Bsep expression

    PubMed Central

    Cheng, Xingguo; Buckley, David; Klaassen, Curtis D.

    2009-01-01

    Sodium-taurocholate cotransporting polypeptide (Ntcp) and bile salt export pump (Bsep) are two key transporters for hepatic bile acid uptake and excretion. Alterations in Ntcp and Bsep expression have been reported in pathophysiological conditions. In the present study, the effects of age, gender, and various chemicals on the regulation of these two transporters were characterized in mice. Ntcp and Bsep mRNA levels in mouse liver were low in the fetus, but increased to its highest expression at parturition. After birth, mouse Ntcp and Bsep mRNA decreased by more than 50%, and then gradually increased to adult levels by day 30. Expression of mouse Ntcp mRNA and protein exhibit higher levels in female than male livers, which is consistent with the trend of human NTCP mRNA expression between men and women. No gender difference exists in BSEP/Bsep expression in human and mouse livers. Hormone replacements conducted in gonadectomized, hypophysectomized, and lit/lit mice indicate that female-predominant Ntcp expression in mouse liver is due to the inhibitory effect of male-pattern GH secretion, but not sex hormones. Ntcp and Bsep expression are in general resistant to induction by a large battery of microsomal enzyme inducers. Administration of cholestyramine increased Ntcp, whereas chenodeoxycholic acid increased Bsep mRNA expression. In silico analysis indicates that female-predominant mouse and human Ntcp/NTCP expression may be due to GH. In conclusion, mouse Ntcp and Bsep are regulated by age, gender, cholestyramine, and bile acid, but resistant to induction by most microsomal enzyme inducers. PMID:17897632

  12. The mechanical cost of transport of fast running animals.

    PubMed

    Fuentes, Mauricio A

    2014-03-21

    Regarding running animals, algebraic expressions for the horizontal (ωx) and vertical (ωy) components of the mechanical cost of transport are deduced for a ground force pattern based on the Spring-mass model. Defining μ˜ as the maximum ground forces ratio μ˜=max(Fx)/max(Fy), the analysis shows that the mechanical cost of transport ωx+ωy for fast running animals is approximately proportional to μ˜, and to the relative contact length, and positively correlated to the limb take-off angle and the collision angle. The vertical cost ωy is shown to approximate to zero for fast running animals. Sustained top running speeds are predicted to require the largest possible values of μ˜ and therefore relatively large horizontal propulsive forces, as well as a minimum possible ground contact time. The equations also show that animals running relatively slow would tend to prefer certain interval of values for parameter μ˜, which would minimize both their mechanical cost of transport and their metabolic cost of transport. Very large animals are suspected to be less capable of developing large values of μ˜, which possibly renders them incapable of developing great speeds. PMID:24333209

  13. Transport of the two natural auxins, indole-3-butyric acid and indole-3-acetic acid, in Arabidopsis

    NASA Technical Reports Server (NTRS)

    Rashotte, Aaron M.; Poupart, Julie; Waddell, Candace S.; Muday, Gloria K.; Brown, C. S. (Principal Investigator)

    2003-01-01

    Polar transport of the natural auxin indole-3-acetic acid (IAA) is important in a number of plant developmental processes. However, few studies have investigated the polar transport of other endogenous auxins, such as indole-3-butyric acid (IBA), in Arabidopsis. This study details the similarities and differences between IBA and IAA transport in several tissues of Arabidopsis. In the inflorescence axis, no significant IBA movement was detected, whereas IAA is transported in a basipetal direction from the meristem tip. In young seedlings, both IBA and IAA were transported only in a basipetal direction in the hypocotyl. In roots, both auxins moved in two distinct polarities and in specific tissues. The kinetics of IBA and IAA transport appear similar, with transport rates of 8 to 10 mm per hour. In addition, IBA transport, like IAA transport, is saturable at high concentrations of auxin, suggesting that IBA transport is protein mediated. Interestingly, IAA efflux inhibitors and mutations in genes encoding putative IAA transport proteins reduce IAA transport but do not alter IBA movement, suggesting that different auxin transport protein complexes are likely to mediate IBA and IAA transport. Finally, the physiological effects of IBA and IAA on hypocotyl elongation under several light conditions were examined and analyzed in the context of the differences in IBA and IAA transport. Together, these results present a detailed picture of IBA transport and provide the basis for a better understanding of the transport of these two endogenous auxins.

  14. A Plasma Membrane Association Module in Yeast Amino Acid Transporters.

    PubMed

    Popov-Čeleketić, Dušan; Bianchi, Frans; Ruiz, Stephanie J; Meutiawati, Febrina; Poolman, Bert

    2016-07-29

    Amino acid permeases (AAPs) in the plasma membrane (PM) of Saccharomyces cerevisiae are responsible for the uptake of amino acids and involved in regulation of their cellular levels. Here, we report on a strong and complex module for PM association found in the C-terminal tail of AAPs. Using in silico analyses and mutational studies we found that the C-terminal sequences of Gap1, Bap2, Hip1, Tat1, Tat2, Mmp1, Sam3, Agp1, and Gnp1 are about 50 residues long, associate with the PM, and have features that discriminate them from the termini of organellar amino acid transporters. We show that this sequence (named PMasseq) contains an amphipathic α-helix and the FWC signature, which is palmitoylated by palmitoyltransferase Pfa4. Variations of PMasseq, found in different AAPs, lead to different mobilities and localization patterns, whereas the disruption of the sequence has an adverse effect on cell viability. We propose that PMasseq modulates the function and localization of AAPs along the PM. PMasseq is one of the most complex protein signals for plasma membrane association across species and can be used as a delivery vehicle for the PM. PMID:27226538

  15. Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120

    PubMed Central

    Pernil, Rafael; Picossi, Silvia; Herrero, Antonia; Flores, Enrique; Mariscal, Vicente

    2015-01-01

    Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium that can use inorganic compounds such as nitrate or ammonium as nitrogen sources. In the absence of combined nitrogen, it can fix N2 in differentiated cells called heterocysts. Anabaena also shows substantial activities of amino acid uptake, and three ABC-type transporters for amino acids have been previously characterized. Seven new loci encoding predicted amino acid transporters were identified in the Anabaena genomic sequence and inactivated. Two of them were involved in amino acid uptake. Locus alr2535-alr2541 encodes the elements of a hydrophobic amino acid ABC-type transporter that is mainly involved in the uptake of glycine. ORF all0342 encodes a putative transporter from the dicarboxylate/amino acid:cation symporter (DAACS) family whose inactivation resulted in an increased uptake of a broad range of amino acids. An assay to study amino acid release from Anabaena filaments to the external medium was set up. Net release of the alanine analogue α-aminoisobutyric acid (AIB) was observed when transport system N-I (a hydrophobic amino acid ABC-type transporter) was engaged in the uptake of a specific substrate. The rate of AIB release was directly proportional to the intracellular AIB concentration, suggesting leakage from the cells by diffusion. PMID:25915115

  16. Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120.

    PubMed

    Pernil, Rafael; Picossi, Silvia; Herrero, Antonia; Flores, Enrique; Mariscal, Vicente

    2015-01-01

    Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium that can use inorganic compounds such as nitrate or ammonium as nitrogen sources. In the absence of combined nitrogen, it can fix N2 in differentiated cells called heterocysts. Anabaena also shows substantial activities of amino acid uptake, and three ABC-type transporters for amino acids have been previously characterized. Seven new loci encoding predicted amino acid transporters were identified in the Anabaena genomic sequence and inactivated. Two of them were involved in amino acid uptake. Locus alr2535-alr2541 encodes the elements of a hydrophobic amino acid ABC-type transporter that is mainly involved in the uptake of glycine. ORF all0342 encodes a putative transporter from the dicarboxylate/amino acid:cation symporter (DAACS) family whose inactivation resulted in an increased uptake of a broad range of amino acids. An assay to study amino acid release from Anabaena filaments to the external medium was set up. Net release of the alanine analogue α-aminoisobutyric acid (AIB) was observed when transport system N-I (a hydrophobic amino acid ABC-type transporter) was engaged in the uptake of a specific substrate. The rate of AIB release was directly proportional to the intracellular AIB concentration, suggesting leakage from the cells by diffusion. PMID:25915115

  17. Structure and mechanism of the mammalian fructose transporter GLUT5.

    PubMed

    Nomura, Norimichi; Verdon, Grégory; Kang, Hae Joo; Shimamura, Tatsuro; Nomura, Yayoi; Sonoda, Yo; Hussien, Saba Abdul; Qureshi, Aziz Abdul; Coincon, Mathieu; Sato, Yumi; Abe, Hitomi; Nakada-Nakura, Yoshiko; Hino, Tomoya; Arakawa, Takatoshi; Kusano-Arai, Osamu; Iwanari, Hiroko; Murata, Takeshi; Kobayashi, Takuya; Hamakubo, Takao; Kasahara, Michihiro; Iwata, So; Drew, David

    2015-10-15

    The altered activity of the fructose transporter GLUT5, an isoform of the facilitated-diffusion glucose transporter family, has been linked to disorders such as type 2 diabetes and obesity. GLUT5 is also overexpressed in certain tumour cells, and inhibitors are potential drugs for these conditions. Here we describe the crystal structures of GLUT5 from Rattus norvegicus and Bos taurus in open outward- and open inward-facing conformations, respectively. GLUT5 has a major facilitator superfamily fold like other homologous monosaccharide transporters. On the basis of a comparison of the inward-facing structures of GLUT5 and human GLUT1, a ubiquitous glucose transporter, we show that a single point mutation is enough to switch the substrate-binding preference of GLUT5 from fructose to glucose. A comparison of the substrate-free structures of GLUT5 with occluded substrate-bound structures of Escherichia coli XylE suggests that, in addition to global rocker-switch-like re-orientation of the bundles, local asymmetric rearrangements of carboxy-terminal transmembrane bundle helices TM7 and TM10 underlie a 'gated-pore' transport mechanism in such monosaccharide transporters. PMID:26416735

  18. Structure and mechanism of the mammalian fructose transporter GLUT5

    PubMed Central

    Shimamura, Tatsuro; Nomura, Yayoi; Sonoda, Yo; Hussien, Saba Abdul; Qureshi, Aziz Abdul; Coincon, Mathieu; Sato, Yumi; Abe, Hitomi; Nakada-Nakura, Yoshiko; Hino, Tomoya; Arakawa, Takatoshi; Kusano-Arai, Osamu; Iwanari, Hiroko; Murata, Takeshi; Kobayashi, Takuya; Hamakubo, Takao; Kasahara, Michihiro; Iwata, So; Drew, David

    2015-01-01

    The altered activity of the fructose transporter GLUT5, an isoform of the facilitated-diffusion glucose transporter family, has been linked to disorders such as type 2 diabetes and obesity. GLUT5 is also overexpressed in certain tumor cells and inhibitors are potential drugs for these conditions. Here, we describe the crystal structure of GLUT5 from Rattus norvegicus and Bos taurus in open outward- and open inward-facing conformations, respectively. GLUT5 has a major facilitator superfamily fold like other homologous monosaccharide transporters. Based on a comparison of the inward-facing structures of GLUT5 and human GLUT1, a ubiquitous glucose transporter, we show that a single point mutation is enough to switch the substrate binding preference of GLUT5 from fructose to glucose. A comparison of the substrate-free structures of GLUT5 with occluded substrate-bound structures of XylE suggests that, besides global rocker-switch like re-orientation of the bundles, local asymmetric rearrangements of C-terminal bundle helices TMs 7 and 10 underlie a “gated-pore” transport mechanism in such monosaccharide transporters. PMID:26416735

  19. The 2-Hydroxycarboxylate Transporter Family: Physiology, Structure, and Mechanism

    PubMed Central

    Sobczak, Iwona; Lolkema, Juke S.

    2005-01-01

    The 2-hydroxycarboxylate transporter family is a family of secondary transporters found exclusively in the bacterial kingdom. They function in the metabolism of the di- and tricarboxylates malate and citrate, mostly in fermentative pathways involving decarboxylation of malate or oxaloacetate. These pathways are found in the class Bacillales of the low-CG gram-positive bacteria and in the gamma subdivision of the Proteobacteria. The pathways have evolved into a remarkable diversity in terms of the combinations of enzymes and transporters that built the pathways and of energy conservation mechanisms. The transporter family includes H+ and Na+ symporters and precursor/product exchangers. The proteins consist of a bundle of 11 transmembrane helices formed from two homologous domains containing five transmembrane segments each, plus one additional segment at the N terminus. The two domains have opposite orientations in the membrane and contain a pore-loop or reentrant loop structure between the fourth and fifth transmembrane segments. The two pore-loops enter the membrane from opposite sides and are believed to be part of the translocation site. The binding site is located asymmetrically in the membrane, close to the interface of membrane and cytoplasm. The binding site in the translocation pore is believed to be alternatively exposed to the internal and external media. The proposed structure of the 2HCT transporters is different from any known structure of a membrane protein and represents a new structural class of secondary transporters. PMID:16339740

  20. Catalytic Mechanism of the Maltose Transporter Hydrolyzing ATP.

    PubMed

    Huang, Wenting; Liao, Jie-Lou

    2016-01-12

    We use quantum mechanical and molecular mechanical (QM/MM) simulations to study ATP hydrolysis catalyzed by the maltose transporter. This protein is a prototypical member of a large family that consists of ATP-binding cassette (ABC) transporters. The ABC proteins catalyze ATP hydrolysis to perform a variety of biological functions. Despite extensive research efforts, the precise molecular mechanism of ATP hydrolysis catalyzed by the ABC enzymes remains elusive. In this work, the reaction pathway for ATP hydrolysis in the maltose transporter is evaluated using a QM/MM implementation of the nudged elastic band method without presuming reaction coordinates. The potential of mean force along the reaction pathway is obtained with an activation free energy of 19.2 kcal/mol in agreement with experiments. The results demonstrate that the reaction proceeds via a dissociative-like pathway with a trigonal bipyramidal transition state in which the cleavage of the γ-phosphate P-O bond occurs and the O-H bond of the lytic water molecule is not yet broken. Our calculations clearly show that the Walker B glutamate as well as the switch histidine stabilizes the transition state via electrostatic interactions rather than serving as a catalytic base. The results are consistent with biochemical and structural experiments, providing novel insight into the molecular mechanism of ATP hydrolysis in the ABC proteins. PMID:26666844

  1. Amino acid transporter B(0)AT1 (slc6a19) and ancillary protein: impact on function.

    PubMed

    Margheritis, Eleonora; Imperiali, Francesca Guia; Cinquetti, Raffaella; Vollero, Alessandra; Terova, Genciana; Rimoldi, Simona; Girardello, Rossana; Bossi, Elena

    2016-08-01

    Amino acids play an important role in the metabolism of all organisms. Their epithelial re-absorption is due to specific transport proteins, such as B(0)AT1, a Na(+)-coupled neutral amino acid symporter belonging to the solute carrier 6 family. Here, a recently cloned fish orthologue, from the intestine of Salmo salar, was electrophysiologically characterized with the two-electrode voltage clamp technique, in Xenopus laevis oocytes heterologously expressing the transporter. Substrate specificity, apparent affinities and the ionic dependence of the transport mechanism were determined in the presence of specific collectrin. Results demonstrated that like the human, but differently from sea bass (Dicentrarchus labrax) orthologue, salmon B(0)AT1 needs to be associated with partner proteins to be correctly expressed at the oocyte plasma membrane. Cloning of sea bass collectrin and comparison of membrane expression and functionality of the B(0)AT1 orthologue transporters allowed a deeper investigation on the role of their interactions. The parameters acquired by electrophysiological and immunolocalization experiments in the mammalian and fish transporters contributed to highlight the dynamic of relations and impacts on transport function of the ancillary proteins. The comparative characterization of the physiological parameters of amino acid transporters with auxiliary proteins can help the comprehension of the regulatory mechanism of essential nutrient absorption. PMID:27255547

  2. Mechanism of cytotoxic action of perfluorinated acids

    SciTech Connect

    Kleszczynski, Konrad Skladanowski, Andrzej C.

    2009-02-01

    Perfluorinated (aliphatic) acids (PFAs) and congeners have many applications in various industrial fields and household for decades. Years later they have been detected in wildlife and this has spurred interest in environmental occurrence as well as influencing living organisms. PFAs were established as peroxisome proliferators and hepatocarcinogens. Amphipatic structure suggests that they may alter cell membrane potential (mb{delta}{psi}) and/or induce changes in cytosolic pH (pHi). The aim of this study was to examine the correlation between changes of above parameters and PFAs structure (CF{sub 6}-CF{sub 12}) in human colon carcinoma HCT116 cells. mb{delta}{psi} and pHi were measured by flow cytometry using fluorescence polarization of the plasma membrane probe 3,3'-dipentyloxacarbocyanine (DiOC{sub 5}(3)) and fluorescein diacetate (FDA), respectively. Dose- and time-dependent manner analysis revealed relatively fast depolarization of plasma membrane and acidification of cytosol both positively correlated with fluorocarbon chain length. mb{delta}{psi} depletion after 4 h of incubation reached 8.01% and 30.08% for 50 {mu}M PFOA and 50 {mu}M PFDoDA, respectively. Prolonged treatment (72 h) led to dramatic dissipation of membrane potential up to 21.65% and 51.29% and strong acidification to pHi level at 6.92 and 6.03 at the presence of above compounds, respectively. The data demonstrate that PFAs can alter plasma membrane protonotrophy with the mode dependent on the compound hydrophobicity.

  3. Amyloid protein precursor stimulates excitatory amino acid transport. Implications for roles in neuroprotection and pathogenesis.

    PubMed

    Masliah, E; Raber, J; Alford, M; Mallory, M; Mattson, M P; Yang, D; Wong, D; Mucke, L

    1998-05-15

    Excitatory neurotransmitters such as glutamate are required for the normal functioning of the central nervous system but can trigger excitotoxic neuronal injury if allowed to accumulate to abnormally high levels. Their extracellular levels are controlled primarily by transmitter uptake into astrocytes. Here, we demonstrate that the amyloid protein precursor may participate in the regulation of this important process. The amyloid protein precursor has been well conserved through evolution, and a number of studies indicate that it may function as an endogenous excitoprotectant. However, the mechanisms underlying this neuroprotective capacity remain largely unknown. At moderate levels of expression, human amyloid protein precursors increased glutamate/aspartate uptake in brains of transgenic mice, with the 751-amino acid isoform showing greater potency than the 695-amino acid isoform. Cerebral glutamate/aspartate transporter protein levels were higher in transgenic mice than in non-transgenic controls, whereas transporter mRNA levels were unchanged. Amyloid protein precursor-dependent stimulation of aspartate uptake by cultured primary astrocytes was associated with increases in protein kinase A and C activity and could be blocked by inhibitors of these kinases. The stimulation of astroglial excitatory amino acid transport by amyloid protein precursors could protect the brain against excitotoxicity and may play an important role in neurotransmission. PMID:9575214

  4. Electrochemical reactivity and proton transport mechanisms in nanostructured ceria.

    PubMed

    Ding, J; Strelcov, E; Kalinin, S V; Bassiri-Gharb, N

    2016-08-26

    Electrochemical reactivity and ionic transport at the nanoscale are essential in many energy applications. In this study, time-resolved Kelvin probe force microscopy (tr-KPFM) is utilized for surface potential mapping of nanostructured ceria, in both space and time domains. The fundamental mechanisms of proton injection and transport are studied as a function of environmental conditions and the presence or absence of triple phase boundaries. Finite element modeling is used to extract physical parameters from the experimental data, allowing not only quantification of the observed processes, but also decoupling of their contributions to the measured signal. The constructed phase diagrams of the parameters demonstrate a thermally activated proton injection reaction at the triple phase boundary, and two transport processes that are responsible for the low-temperature proton conductivity of nanostructured ceria. PMID:27407076

  5. Electrochemical reactivity and proton transport mechanisms in nanostructured ceria

    NASA Astrophysics Data System (ADS)

    Ding, J.; Strelcov, E.; Kalinin, S. V.; Bassiri-Gharb, N.

    2016-08-01

    Electrochemical reactivity and ionic transport at the nanoscale are essential in many energy applications. In this study, time-resolved Kelvin probe force microscopy (tr-KPFM) is utilized for surface potential mapping of nanostructured ceria, in both space and time domains. The fundamental mechanisms of proton injection and transport are studied as a function of environmental conditions and the presence or absence of triple phase boundaries. Finite element modeling is used to extract physical parameters from the experimental data, allowing not only quantification of the observed processes, but also decoupling of their contributions to the measured signal. The constructed phase diagrams of the parameters demonstrate a thermally activated proton injection reaction at the triple phase boundary, and two transport processes that are responsible for the low-temperature proton conductivity of nanostructured ceria.

  6. Mechanism of ionophoric transport of indium-111 cations through a lipid bilayer membrane

    SciTech Connect

    Choi, H.O.; Hwang, K.J.

    1987-01-01

    The use of mobile ionophores to facilitate the transport of /sup 111/In through a lipid bilayer membrane has broad applications in liposome technology and cell labeling. However, the mechanism of such ionophore-mediated transport of /sup 111/In through a lipid bilayer membrane is not completely clear. The present report describes the correlations of the behaviors of ionophoric loading of /sup 111/In into liposomes with the lipophilicity and the indium-binding affinity of three ionophores, namely, 8-hydroxyquinoline, acetylacetone, and tropolone. Our results suggest that the mechanism of the ionophoric transport of /sup 111/In through a lipid bilayer membrane involves the rapid exchange of /sup 111/In cations among the ionophores in both the aqueous solution and the lipid bilayer. Furthermore, the effectiveness of an ionophore in facilitating the transport of /sup 111/In from the external aqueous compartment to the entrapped nitrilotriacetic acid depends not only on the lipophilicity of the (/sup 111/In)ionophore complex, but also on the lipophilicity of the free ionophore itself and the competition of /sup 111/In between nitrilotriacetic acid inside the inner aqueous compartment of the liposome and the ionophore imbedded in the lipid bilayer membrane of the liposome.

  7. Induction of amino acid transporters expression by endurance exercise in rat skeletal muscle

    SciTech Connect

    Murakami, Taro Yoshinaga, Mariko

    2013-10-04

    Highlights: •Regulation of amino acid transporter expression in working muscle remains unclear. •Expression of amino acid transporters for leucine were induced by a bout of exercise. •Requirement of leucine in muscle cells might regulate expression of its transporters. •This information is beneficial for understanding the muscle remodeling by exercise. -- Abstract: We here investigated whether an acute bout of endurance exercise would induce the expression of amino acid transporters that regulate leucine transport across plasma and lysosomal membranes in rat skeletal muscle. Rats ran on a motor-driven treadmill at a speed of 28 m/min for 90 min. Immediately after the exercise, we observed that expression of mRNAs encoding L-type amino acid transporter 1 (LAT1) and CD98 was induced in the gastrocnemius, soleus, and extensor digitorum longus (EDL) muscles. Sodium-coupled neutral amino acid transporter 2 (SNAT2) mRNA was also induced by the exercise in those three muscles. Expression of proton-assisted amino acid transporter 1 (PAT1) mRNA was slightly but not significantly induced by a single bout of exercise in soleus and EDL muscles. Exercise-induced mRNA expression of these amino acid transporters appeared to be attenuated by repeated bouts of the exercise. These results suggested that the expression of amino acid transporters for leucine may be induced in response to an increase in the requirement for this amino acid in the cells of working skeletal muscles.

  8. Enhanced charge transport in highly conducting PEDOT-PSS films after acid treatment

    NASA Astrophysics Data System (ADS)

    Shiva, V. Akshaya; Bhatia, Ravi; Menon, Reghu

    The high electrical conductivity, good stability, high strength, flexibility and good transparency of poly(3,4-ethylenedioxythiophene)-poly(styrenesulfonate) (PEDOT-PSS), make it useful for many applications including polymeric anodes for organic photovoltaics, light-emitting diodes, flexible electrodes, supercapacitors, electrochromic devices, field-effect transistors and antistatic-coatings. However, the electrical conductivity of PEDOT-PSS has to be increased significantly for replacement of indium tin oxide (ITO) as the transparent electrode in optoelectronic devices. The as prepared (pristine) PEDOT-PSS film prepared from the PEDOT-PSS aqueous solution usually has conductivity below 1Scm-1, remarkably lower than ITO. Significant conductivity enhancement has been observed on transparent and conductive PEDOT-PSS films after a treatment with inorganic acids. Our study investigates the charge transport in pristine and H2SO4, HNO3, HCl treated PEDOT-PSS films. We have treated the films with various concentrations of acids to probe the effect of the acid treatment on the conduction mechanism. The study includes the measurement of dc and electric field dependent conductivity of films in the temperature range of 4.2K-300K. We have also performed magneto-resistance measurements in the range of 0-5T. An enhancement by a factor of~103 has been observed in the room temperature conductivity. The detailed magneto-transport studies explain the various mechanisms for the conductivity enhancement observed.

  9. The transport mechanism of the mitochondrial ADP/ATP carrier.

    PubMed

    Kunji, Edmund R S; Aleksandrova, Antoniya; King, Martin S; Majd, Homa; Ashton, Valerie L; Cerson, Elizabeth; Springett, Roger; Kibalchenko, Mikhail; Tavoulari, Sotiria; Crichton, Paul G; Ruprecht, Jonathan J

    2016-10-01

    The mitochondrial ADP/ATP carrier imports ADP from the cytosol and exports ATP from the mitochondrial matrix, which are key transport steps for oxidative phosphorylation in eukaryotic organisms. The transport protein belongs to the mitochondrial carrier family, a large transporter family in the inner membrane of mitochondria. It is one of the best studied members of the family and serves as a paradigm for the molecular mechanism of mitochondrial carriers. Structurally, the carrier consists of three homologous domains, each composed of two transmembrane α-helices linked with a loop and short α-helix on the matrix side. The transporter cycles between a cytoplasmic and matrix state in which a central substrate binding site is alternately accessible to these compartments for binding of ADP or ATP. On both the cytoplasmic and matrix side of the carrier are networks consisting of three salt bridges each. In the cytoplasmic state, the matrix salt bridge network is formed and the cytoplasmic network is disrupted, opening the central substrate binding site to the intermembrane space and cytosol, whereas the converse occurs in the matrix state. In the transport cycle, tighter substrate binding in the intermediate states allows the interconversion of conformations by lowering the energy barrier for disruption and formation of these networks, opening and closing the carrier to either side of the membrane in an alternating way. Conversion between cytoplasmic and matrix states might require the simultaneous rotation of three domains around a central translocation pathway, constituting a unique mechanism among transport proteins. This article is part of a Special Issue entitled: Mitochondrial Channels edited by Pierre Sonveaux, Pierre Maechler and Jean-Claude Martinou. PMID:27001633

  10. A Coupled Model of Multiphase Flow, Reactive Biogeochemical Transport, Thermal Transport and Geo-Mechanics.

    NASA Astrophysics Data System (ADS)

    Tsai, C. H.; Yeh, G. T.

    2015-12-01

    In this investigation, a coupled model of multiphase flow, reactive biogeochemical transport, thermal transport and geo-mechanics in subsurface media is presented. It iteratively solves the mass conservation equation for fluid flow, thermal transport equation for temperature, reactive biogeochemical transport equations for concentration distributions, and solid momentum equation for displacement with successive linearization algorithm. With species-based equations of state, density of a phase in the system is obtained by summing up concentrations of all species. This circumvents the problem of having to use empirical functions. Moreover, reaction rates of all species are incorporated in mass conservation equation for fluid flow. Formation enthalpy of all species is included in the law of energy conservation as a source-sink term. Finite element methods are used to discretize the governing equations. Numerical experiments are presented to examine the accuracy and robustness of the proposed model. The results demonstrate the feasibility and capability of present model in subsurface media.

  11. Mechanisms of vitamin K transport and metabolism in Swiss 3T3 mouse fibroblasts

    SciTech Connect

    Canfield, L.M.; Townsend, A.F.; Hibbs, D.B.

    1986-03-01

    Transport of vitamin K into isolated fibroblasts was followed using /sup 3/H vitamin K/sub 1/. The initial rate is saturable by 5 min. at 25..mu..M vitamin K with a Km(app) of 10..mu..M and V/sub max/ of 50 pmols/min/10/sup 6/ cells. Kinetics of uptake are biphasic with a second slower rate ensuing after 10 minutes. Insensitivity of the initial rate of uptake to FCCP or ouabain indicates an ATP-independent transport mechanism. Specificity of transport is shown by competition of uptake of /sup 3/H vitamin K by unlabelled vitamin and strong (>90%) inhibition of the initial rate by equimolar concentrations of the vitamin K analog, Chloro-K. In addition, following uptake, both vitamins K/sub 1/ and K/sub 2/ are metabolized to their respective epoxides. Vitamin K/sub 1/ epoxide is also transported into fibroblasts and metabolized to the parent quinone in a Warfarin-sensitive reaction. Following alkaline hydrolysis of isolated intracellular protein, the vitamin K-dependent amino acid, gamma carboxyglutamic acid (gla) was detected. It is concluded that vitamin K is specifically transported into fibroblasts and metabolized via the classical pathway described in liver with the concomitant production of vitamin K-dependent proteins.

  12. Impact of Microbial Growth on Subsurface Perfluoroalkyl Acid Transport

    NASA Astrophysics Data System (ADS)

    Weathers, T. S.; Higgins, C. P.; Sharp, J.

    2014-12-01

    The fate and transport of poly and perfluoroalkyl substances (PFASs) in the presence of active microbial communities has not been widely investigated. These emerging contaminants are commonly utilized in aqueous film-forming foams (AFFF) and have often been detected in groundwater. This study explores the transport of a suite of perfluorocarboxylic acids and perfluoroalkylsulfonates, including perfluorooctanoic acid (PFOA) and perfluorooctane sulfonate (PFOS), in microbially active settings. Single point organic carbon normalized sorption coefficients derived by exposing inactive cellular material to PFASs result in more than an order of magnitude increase in sorption compared to soil organic carbon sorption coefficients found in literature. For example, the sorption coefficients for PFOS are 4.05±0.07 L/kg and 2.80±0.08 L/kg for cellular organic carbon and soil organic carbon respectively. This increase in sorption, coupled with enhanced extracellular polymeric substance production observed during growth of a common hydrocarbon degrading soil microbe exposed to source-level concentrations of PFASs (10 mg/L of 11 analytes, 110 mg/L total) may result in PFAS retardation in situ. To address the upscaling of this phenomenon, flow-through columns packed with low-organic carbon sediment and biostimulated with 10 mg/L glucose were exposed to PFAS concentrations from 15 μg/L to 10 mg/L of each 11 analytes. Breakthrough and tailing of each analyte was measured and modeled with Hydrus-1D to explore sorption coefficients over time for microbially active columns.

  13. Mechanism of electrodialytic ion transport through solvent extraction membranes

    SciTech Connect

    Moskvin, L.N.; Shmatko, A.G.; Krasnoperov, V.M.

    1987-02-01

    The authors construct a mathematical model for electrodialysis and solvent extraction via an ion-selective ion exchange membrane and accounts for the electrochemical, ion exchange, and diffusional behavior of the processes including their dependence on component concentration and current and voltage. The model is tested against experimental data for the electrodialytic transport of anionic platinum complexes of chlorides from hydrochloric acid solution through tributylphosphate membranes. The platinum concentration in the aqueous solution was determined by gamma spectroscopy obtained via platinum 191 as a radiotracer.

  14. A mirror transport mechanism for use at cryogenic temperatures

    NASA Technical Reports Server (NTRS)

    Stark, Kenneth W.; Wilson, Meredith

    1986-01-01

    The Mirror Transport Mechanism (MTM), which supports a pair of dihedral mirrors and moves them in a very smooth and uniform scanning motion normal to a beamsplitter is described. Each scan is followed by a quick flyback and repeat. Material selection, design, and testing of all major components of the MTM are discussed. Flex pivot failures during vibration testing, excessive dihedral platform sag under one g operation, electronic and fiber optic characteristics, and tolerancing considerations are covered. Development of the mechanism has reached the final phase of thermal and vibration qualification. Environmental testing of the complete FIRAS experiment is just beginning.

  15. Molecular Mechanisms for Sweet-suppressing Effect of Gymnemic Acids*

    PubMed Central

    Sanematsu, Keisuke; Kusakabe, Yuko; Shigemura, Noriatsu; Hirokawa, Takatsugu; Nakamura, Seiji; Imoto, Toshiaki; Ninomiya, Yuzo

    2014-01-01

    Gymnemic acids are triterpene glycosides that selectively suppress taste responses to various sweet substances in humans but not in mice. This sweet-suppressing effect of gymnemic acids is diminished by rinsing the tongue with γ-cyclodextrin (γ-CD). However, little is known about the molecular mechanisms underlying the sweet-suppressing effect of gymnemic acids and the interaction between gymnemic acids versus sweet taste receptor and/or γ-CD. To investigate whether gymnemic acids directly interact with human (h) sweet receptor hT1R2 + hT1R3, we used the sweet receptor T1R2 + T1R3 assay in transiently transfected HEK293 cells. Similar to previous studies in humans and mice, gymnemic acids (100 μg/ml) inhibited the [Ca2+]i responses to sweet compounds in HEK293 cells heterologously expressing hT1R2 + hT1R3 but not in those expressing the mouse (m) sweet receptor mT1R2 + mT1R3. The effect of gymnemic acids rapidly disappeared after rinsing the HEK293 cells with γ-CD. Using mixed species pairings of human and mouse sweet receptor subunits and chimeras, we determined that the transmembrane domain of hT1R3 was mainly required for the sweet-suppressing effect of gymnemic acids. Directed mutagenesis in the transmembrane domain of hT1R3 revealed that the interaction site for gymnemic acids shared the amino acid residues that determined the sensitivity to another sweet antagonist, lactisole. Glucuronic acid, which is the common structure of gymnemic acids, also reduced sensitivity to sweet compounds. In our models, gymnemic acids were predicted to dock to a binding pocket within the transmembrane domain of hT1R3. PMID:25056955

  16. Mechanisms of Carrier Transport Induced by a Microswimmer Bath

    SciTech Connect

    Kaiser, Andreas; Sokolov, Andrey; Aranson, Igor S.; Lowen, Hartmut

    2015-04-01

    Recently, it was found that a wedgelike microparticle (referred to as ”carrier”) which is only allowed to translate but not to rotate exhibits a directed translational motion along the wedge cusp if it is exposed to a bath of microswimmers. Here we model this effect in detail by resolving the microswimmers explicitly using interaction models with different degrees of mutual alignment. Using computer simulations we study the impact of these interactions on the transport efficiency of V-shaped carrier. We show that the transport mechanisms itself strongly depends on the degree of alignment embodied in the modelling of the individual swimmer dynamics. For weak alignment, optimal carrier transport occurs in the turbulent microswimmer state and is induced by swirl depletion inside the carrier. For strong aligning interactions, optimal transport occurs already in the dilute regime and is mediated by a polar cloud of swimmers in the carrier wake pushing the wedge-particle forward. We also demonstrate that the optimal shape of the carrier leading to maximal transport speed depends on the kind of interaction model used.

  17. Effects of inhaled acids on respiratory tract defense mechanisms.

    PubMed Central

    Schlesinger, R B

    1985-01-01

    The respiratory tract is endowed with an interlocking array of nonspecific and specific defense mechanisms which protect it from the effects of inhaled microbes and toxicants, and reduce the risk of absorption of materials into the bloodstream, with subsequent systemic translocation. Ambient acids may compromise these defenses, perhaps providing a link between exposure and development of chronic and acute pulmonary disease. This paper reviews the effects of inhaled acids upon the nonspecific clearance system of the lungs. PMID:3908089

  18. Interaction of sulfuric acid corrosion and mechanical wear of iron

    NASA Technical Reports Server (NTRS)

    Rengstorff, G. W. P.; Miyoshi, K.; Buckley, D. H.

    1984-01-01

    Friction and wear experiments were conducted with elemental iron sliding on aluminum oxide in aerated sulfuric acid at concentrations ranging from very dilute (0.00007 N; i.e., 4 ppm) to very concentrated (96 percent acid). Load and reciprocating sliding speed were kept constant. With the most dilute acid concentration of 0.00007 to 0.0002 N, a complex corrosion product formed that was friable and often increased friction and wear. At slightly higher concentrations of 0.001 N, metal losses were essentially by wear alone. Because no buildup of corrosion products occurred, this acid concentration became the standard from which to separate metal loss from direct corrosion and mechanical wear losses. When the acid concentration was increased to 5 percent (1 N), the well-established high corrosion rate of iron in sulfuric acid strongly dominated the total wear loss. This strong corrosion increased to 30 percent acid and decreased somewhat to 50 percent acid in accordance with expectations. However, the low corrosion of iron expected at acid concentrations of 65 to 96 percent was not observed in the wear area. It was apparent that the normal passivating film was being worn away and a galvanic cell established that rapidly attacked the wear area. Under the conditions where direct corrosion losses were highest, the coefficient of friction was the lowest.

  19. Interaction of sulfuric acid corrosion and mechanical wear of iron

    NASA Technical Reports Server (NTRS)

    Rengstorff, G. W. P.; Miyoshi, K.; Buckley, D. H.

    1986-01-01

    Friction and wear experiment were conducted with elemental iron sliding on aluminum oxide in aerated sulfuric acid at concentrations ranging from very dilute (0.00007 N; i.e., 4 ppm) to very concentrated (96 percent acid). Load and reciprocating sliding speed were kept constant. With the most dilute acid concentration of 0.00007 to 0.0002 N, a complex corrosion product formed that was friable and often increased friction and wear. At slightly higher concentrations of 0.001 N, metal losses were essentially by wear alone. Because no buildup of corrosion products occurred, this acid concentration became the standard from which to separate metal loss from direct corrosion and mechanical wear losses. When the acid concentration was increased to 5 percent (1 N), the well-established high corrosion rate of iron in sulfuric acid strongly dominated the total wear loss. This strong corrosion increased to 30 percent acid and decreased somewhat to 50 percent acid in accordance with expectations. However, the low corrosion of iron expected at acid concentrations of 65 to 96 percent was not observed in the wear area. It was apparent that the normal passivating film was being worn away and a galvanic cell established that rapidly attacked the wear area. Under the conditions where direct corrosion losses were highest, the coefficient of friction was the lowest.

  20. Butyric acid increases transepithelial transport of ferulic acid through upregulation of the monocarboxylate transporters SLC16A1 (MCT1) and SLC16A3 (MCT4).

    PubMed

    Ziegler, Kerstin; Kerimi, Asimina; Poquet, Laure; Williamson, Gary

    2016-06-01

    Ferulic acid is released by microbial hydrolysis in the colon, where butyric acid, a major by-product of fermentation, constitutes the main energy source for colonic enterocytes. We investigated how varying concentrations of this short chain fatty acid may influence the absorption of the phenolic acid. Chronic treatment of Caco-2 cells with butyric acid resulted in increased mRNA and protein abundance of the monocarboxylate transporters SLC16A1 (MCT1) and SLC16A3 (MCT4), previously proposed to facilitate ferulic acid absorption in addition to passive diffusion. Short term incubation with butyric acid only led to upregulation of MCT4 while both conditions increased transepithelial transport of ferulic acid in the apical to basolateral, but not basolateral to apical, direction. Chronic treatment also elevated intracellular concentrations of ferulic acid, which in turn gave rise to increased concentrations of ferulic acid metabolites. Immunofluorescence staining of cells revealed uniform distribution of MCT1 protein in the cell membrane, whereas MCT4 was only detected in the lateral plasma membrane sections of Caco-2 cells. We therefore propose that MCT1 may be acting as an uptake transporter and MCT4 as an efflux system across the basolateral membrane for ferulic acid, and that this process is stimulated by butyric acid. PMID:26854723

  1. Possible involvement of lipoic acid in binding protein-dependent transport systems in Escherichia coli.

    PubMed

    Richarme, G

    1985-04-01

    We describe the properties of the binding protein dependent-transport of ribose, galactose, and maltose and of the lactose permease, and the phosphoenolpyruvate-glucose phosphotransferase transport systems in a strain of Escherichia coli which is deficient in the synthesis of lipoic acid, a cofactor involved in alpha-keto acid dehydrogenation. Such a strain can grow in the absence of lipoic acid in minimal medium supplemented with acetate and succinate. Although the lactose permease and the phosphoenolypyruvate-glucose phosphotransferase are not affected by lipoic acid deprivation, the binding protein-dependent transports are reduced by 70% in conditions of lipoic acid deprivation when compared with their activity in conditions of lipoic acid supply. The remaining transport is not affected by arsenate but is inhibited by the uncoupler carbonylcyanide-m-chlorophenylhydrazone; however the lipoic acid-dependent transport is completely inhibited by arsenate and only weakly inhibited by carbonylcyanide-m-chlorophenylhydrazone. The known inhibitor of alpha-keto acid dehydrogenases, 5-methoxyindole-2-carboxylic acid, completely inhibits all binding protein-dependent transports whether in conditions of lipoic supply or deprivation; the results suggest a possible relation between binding protein-dependent transport and alpha-keto acid dehydrogenases and shed light on the inhibition of these transports by arsenicals and uncouplers. PMID:3920206

  2. Insights into transport mechanism from LeuT engineered to transport tryptophan

    SciTech Connect

    Piscitelli, Chayne L.; Gouaux, Eric

    2012-01-10

    LeuT is a bacterial homologue of the neurotransmitter:sodium symporter (NSS) family and, being the only NSS member to have been structurally characterized by X-ray crystallography, is a model protein for studying transporter structure and mechanism. Transport activity in LeuT was hypothesized to require structural transitions between open-to-out and occluded conformations dependent upon protein:ligand binding complementarity. Here, using crystallographic and functional analysis, we show that binding site modification produces changes in both structure and activity that are consistent with complementarity-dependent structural transitions to the occluded state. The mutation I359Q converts the activity of tryptophan from inhibitor to transportable substrate. This mutation changes the local environment of the binding site, inducing the bound tryptophan to adopt a different conformer than in the wild-type complex. Instead of trapping the transporter open, tryptophan binding now allows the formation of an occluded state. Thus, transport activity is correlated to the ability of the ligand to promote the structural transition to the occluded state, a step in the transport cycle that is dependent on protein:ligand complementarity in the central binding site.

  3. Autotoxicity mechanism of Oryza sativa: transcriptome response in rice roots exposed to ferulic acid

    PubMed Central

    2013-01-01

    Background Autotoxicity plays an important role in regulating crop yield and quality. To help characterize the autotoxicity mechanism of rice, we performed a large-scale, transcriptomic analysis of the rice root response to ferulic acid, an autotoxin from rice straw. Results Root growth rate was decreased and reactive oxygen species, calcium content and lipoxygenase activity were increased with increasing ferulic acid concentration in roots. Transcriptome analysis revealed more transcripts responsive to short ferulic-acid exposure (1- and 3-h treatments, 1,204 genes) than long exposure (24 h, 176 genes). Induced genes were involved in cell wall formation, chemical detoxification, secondary metabolism, signal transduction, and abiotic stress response. Genes associated with signaling and biosynthesis for ethylene and jasmonic acid were upregulated with ferulic acid. Ferulic acid upregulated ATP-binding cassette and amino acid/auxin permease transporters as well as genes encoding signaling components such as leucine-rich repeat VIII and receptor-like cytoplasmic kinases VII protein kinases, APETALA2/ethylene response factor, WRKY, MYB and Zinc-finger protein expressed in inflorescence meristem transcription factors. Conclusions The results of a transcriptome analysis suggest the molecular mechanisms of plants in response to FA, including toxicity, detoxicification and signaling machinery. FA may have a significant effect on inhibiting rice root elongation through modulating ET and JA hormone homeostasis. FA-induced gene expression of AAAP transporters may contribute to detoxicification of the autotoxin. Moreover, the WRKY and Myb TFs and LRR-VIII and SD-2b kinases might regulate downstream genes under FA stress but not general allelochemical stress. This comprehensive description of gene expression information could greatly facilitate our understanding of the mechanisms of autotoxicity in plants. PMID:23705659

  4. TNF-α stimulates System A amino acid transport in primary human trophoblast cells mediated by p38 MAPK signaling

    PubMed Central

    Aye, Irving L M H; Jansson, Thomas; Powell, Theresa L

    2015-01-01

    Maternal obesity and gestational diabetes mellitus (GDM) increase the risk of delivering infants that are large for gestational age with greater adiposity, who are prone to the development of metabolic disease in childhood and beyond. These maternal conditions are also associated with increased levels of the proinflammatory cytokine TNF-α in maternal tissues and the placenta. Recent evidence suggests that changes in placental amino acid transport contribute to altered fetal growth. TNF-α was previously shown to stimulate System A amino acid transport in primary human trophoblasts (PHTs), however the molecular mechanisms remain unknown. In this study, we tested the hypothesis that TNF-α regulates amino acid uptake in cultured PHTs by a mitogen-activated protein kinase (MAPK)-dependent mechanism. Treatment of PHTs with TNF-α significantly increased System A amino acid transport, as well as Erk and p38 MAPK signaling. Pharmacological antagonism of p38, but not Erk MAPK activity, inhibited TNF-α stimulated System A activity. Silencing of p38 MAPK using siRNA transfections prevented TNF-α stimulated System A transport in PHTs. TNF-α significantly increased the protein expression of System A transporters SNAT1 and SNAT2, but did not affect their mRNA expression. The effects of TNF-α on SNAT1 and SNAT2 protein expression were reversed by p38 MAPK siRNA silencing. In conclusion, TNF-α regulates System A activity through increased SNAT1 and SNAT2 transporter protein expression in PHTs. These findings suggest that p38 MAPK may represent a critical mechanistic link between elevated proinflammatory cytokines and increased placental amino acid transport in obese and GDM pregnancies associated with fetal overgrowth. PMID:26508738

  5. Quantum-mechanical transport equation for atomic systems.

    NASA Technical Reports Server (NTRS)

    Berman, P. R.

    1972-01-01

    A quantum-mechanical transport equation (QMTE) is derived which should be applicable to a wide range of problems involving the interaction of radiation with atoms or molecules which are also subject to collisions with perturber atoms. The equation follows the time evolution of the macroscopic atomic density matrix elements of atoms located at classical position R and moving with classical velocity v. It is quantum mechanical in the sense that all collision kernels or rates which appear have been obtained from a quantum-mechanical theory and, as such, properly take into account the energy-level variations and velocity changes of the active (emitting or absorbing) atom produced in collisions with perturber atoms. The present formulation is better suited to problems involving high-intensity external fields, such as those encountered in laser physics.

  6. Avidity Mechanism of Dendrimer–Folic Acid Conjugates

    PubMed Central

    2015-01-01

    Multivalent conjugation of folic acid has been employed to target cells overexpressing folate receptors. Such polymer conjugates have been previously demonstrated to have high avidity to folate binding protein. However, the lack of a monovalent folic acid–polymer material has prevented a full binding analysis of these conjugates, as multivalent binding mechanisms and polymer-mass mechanisms are convoluted in samples with broad distributions of folic acid-to-dendrimer ratios. In this work, the synthesis of a monovalent folic acid–dendrimer conjugate allowed the elucidation of the mechanism for increased binding between the folic acid–polymer conjugate and a folate binding protein surface. The increased avidity is due to a folate-keyed interaction between the dendrimer and protein surfaces that fits into the general framework of slow-onset, tight-binding mechanisms of ligand/protein interactions. PMID:24725205

  7. Evaporation as the transport mechanism of metals in arid regions.

    PubMed

    Lima, Ana T; Safar, Zeinab; Loch, J P Gustav

    2014-09-01

    Soils of arid regions are exposed to drought and drastic temperature oscillations throughout the year. Transport mechanisms in these soils are therefore very different from the ones in temperate regions, where rain dictates the fate of most elements in soils. Due to the low rainfall and high evaporation rates in arid regions, groundwater quality is not threatened and all soil contamination issues tend to be overlooked. But if soil contamination happens, where do contaminants go? This study tests the hypothesis of upward metal movement in soils when evaporation is the main transport mechanism. Laboratory evaporation tests were carried out with heavy metal spiked Saudi soil, using circulation of air as the driving force (Fig. 1). Main results show that loamy soil retains heavy metals quite well while evaporation drives heavy metals to the surface of a sandy soil. Evaporation transports heavy metals upward in sandy soils of arid regions, making them accumulate at the soil surface. Sand being the dominating type of soil in arid regions, soils can then be a potential source of contaminated aerosols and atmospheric pollution - a transboundary problem. Some other repercussions for this problem are foreseen, such as the public ingestion or inhalation of dust. PMID:24997976

  8. Molecular Mechanisms of Phosphorus Metabolism and Transport during Leaf Senescence

    PubMed Central

    Stigter, Kyla A.; Plaxton, William C.

    2015-01-01

    Leaf senescence, being the final developmental stage of the leaf, signifies the transition from a mature, photosynthetically active organ to the attenuation of said function and eventual death of the leaf. During senescence, essential nutrients sequestered in the leaf, such as phosphorus (P), are mobilized and transported to sink tissues, particularly expanding leaves and developing seeds. Phosphorus recycling is crucial, as it helps to ensure that previously acquired P is not lost to the environment, particularly under the naturally occurring condition where most unfertilized soils contain low levels of soluble orthophosphate (Pi), the only form of P that roots can directly assimilate from the soil. Piecing together the molecular mechanisms that underpin the highly variable efficiencies of P remobilization from senescing leaves by different plant species may be critical for devising effective strategies for improving overall crop P-use efficiency. Maximizing Pi remobilization from senescing leaves using selective breeding and/or biotechnological strategies will help to generate P-efficient crops that would minimize the use of unsustainable and polluting Pi-containing fertilizers in agriculture. This review focuses on the molecular mechanisms whereby P is remobilized from senescing leaves and transported to sink tissues, which encompasses the action of hormones, transcription factors, Pi-scavenging enzymes, and Pi transporters. PMID:27135351

  9. Fatty acid transport protein 1 can compensate for fatty acid transport protein 4 in the developing mouse epidermis.

    PubMed

    Lin, Meei-Hua; Miner, Jeffrey H

    2015-02-01

    Fatty acid transport protein (FATP) 4 is one of a family of six FATPs that facilitate long- and very-long-chain fatty acid uptake. Mice lacking FATP4 are born with tight, thick skin and a defective barrier; they die neonatally because of dehydration and restricted movements. Mutations in SLC27A4, the gene encoding FATP4, cause ichthyosis prematurity syndrome (IPS), characterized by premature birth, respiratory distress, and edematous skin with severe ichthyotic scaling. Symptoms of surviving patients become mild, although atopic manifestations are common. We previously showed that suprabasal keratinocyte expression of a Fatp4 transgene in Fatp4 mutant skin rescues the lethality and ameliorates the skin phenotype. Here we tested the hypothesis that FATP1, the closest FATP4 homolog, can compensate for the lack of FATP4 in our mouse model of IPS, as it might do postnatally in IPS patients. Transgenic expression of FATP1 in suprabasal keratinocytes rescued the phenotype of Fatp4 mutants, and FATP1 sorted to the same intracellular organelles as endogenous FATP4. Thus, FATP1 and FATP4 likely have overlapping substrate specificities, enzymatic activities, and biological functions. These results suggest that increasing expression of FATP1 in suprabasal keratinocytes could normalize the skin of IPS patients and perhaps prevent the atopic manifestations. PMID:25184958

  10. Mechanism of electrochemical charge transport in individual transition metal complexes.

    PubMed

    Albrecht, Tim; Guckian, Adrian; Kuznetsov, Alexander M; Vos, Johannes G; Ulstrup, Jens

    2006-12-27

    We used electrochemical scanning tunneling microscopy (STM) and spectroscopy (STS) to elucidate the mechanism of electron transport through individual pyridyl-based Os complexes. Our tunneling data obtained by two-dimensional electrochemical STS and STM imaging lead us to the conclusion that electron transport occurs by thermally activated hopping. The conductance enhancement around the redox potential of the complex, which is reminiscent of switching and transistor characterics in electronics, is reflected both in the STM imaging contrast and directly in the tunneling current. The latter shows a biphasic distance dependence, in line with a two-step electron hopping process. Under conditions where the substrate/molecule electron transfer (ET) step is dominant in determining the overall tunneling current, we determined the conductance of an individual Os complex to be 9 nS (Vbias = 0.1 V). We use theoretical approaches to connect the single-molecule conductance with electrochemical kinetics data obtained from monolayer experiments. While the latter leave some controversy regarding the degree of electronic coupling, our results suggest that electron transport occurs in the adiabatic limit of strong electronic coupling. Remarkably, and in contrast to established ET theory, the redox-mediated tunneling current remains strongly distance dependent due to the electronic coupling, even in the adiabatic limit. We exploit this feature and apply it to electrochemical single-molecule conductance data. In this way, we attempt to paint a unified picture of electrochemical charge transport at the single-molecule and monolayer levels. PMID:17177467

  11. Proton-assisted amino acid transporters are conserved regulators of proliferation and amino acid-dependent mTORC1 activation

    PubMed Central

    Heublein, S; Kazi, S; Ögmundsdóttir, M H; Attwood, E V; Kala, S; Boyd, C A R; Wilson, C; Goberdhan, D C I

    2011-01-01

    The PI3-kinase (PI3K)/Akt and downstream mammalian target of rapamycin complex 1 (mTORC1) signalling cascades promote normal growth and are frequently hyperactivated in tumour cells. mTORC1 is also regulated by local nutrients, particularly amino acids, but the mechanisms involved are poorly understood. Unexpectedly, members of the proton-assisted amino acid transporter (PAT or SLC36) family emerged from in vivo genetic screens in Drosophila as transporters with uniquely potent effects on mTORC1-mediated growth. Here we show the two human PATs that are widely expressed in normal tissues and cancer cell lines, PAT1 and PAT4, behave similarly to fly PATs when expressed in Drosophila. siRNA knockdown reveals that these molecules are required for activation of mTORC1 targets and for proliferation in human MCF-7 breast cancer and HEK-293 embryonic kidney cell lines. Furthermore, activation of mTORC1 in starved HEK-293 cells stimulated by amino acids requires PAT1 and PAT4, and is elevated in PAT1-overexpressing cells. Importantly, in HEK-293 cells, PAT1 is highly concentrated in intracellular compartments, including endosomes, where mTOR shuttles upon amino acid stimulation. Our data are therefore consistent with a model in which PATs modulate mTORC1's activity not by transporting amino acids into the cell, but by modulating the intracellular response to amino acids. PMID:20498635

  12. Physiologic hyperinsulinemia stimulates protein synthesis and enhances transport of selected amino acids in human skeletal muscle.

    PubMed Central

    Biolo, G; Declan Fleming, R Y; Wolfe, R R

    1995-01-01

    We have investigated the mechanisms of the anabolic effect of insulin on muscle protein metabolism in healthy volunteers, using stable isotopic tracers of amino acids. Calculations of muscle protein synthesis, breakdown, and amino acid transport were based on data obtained with the leg arteriovenous catheterization and muscle biopsy. Insulin was infused (0.15 mU/min per 100 ml leg) into the femoral artery to increase femoral venous insulin concentration (from 10 +/- 2 to 77 +/- 9 microU/ml) with minimal systemic perturbations. Tissue concentrations of free essential amino acids decreased (P < 0.05) after insulin. The fractional synthesis rate of muscle protein (precursor-product approach) increased (P < 0.01) after insulin from 0.0401 +/- 0.0072 to 0.0677 +/- 0.0101%/h. Consistent with this observation, rates of utilization for protein synthesis of intracellular phenylalanine and lysine (arteriovenous balance approach) also increased from 40 +/- 8 to 59 +/- 8 (P < 0.05) and from 219 +/- 21 to 298 +/- 37 (P < 0.08) nmol/min per 100 ml leg, respectively. Release from protein breakdown of phenylalanine, leucine, and lysine was not significantly modified by insulin. Local hyperinsulinemia increased (P < 0.05) the rates of inward transport of leucine, lysine, and alanine, from 164 +/- 22 to 200 +/- 25, from 126 +/- 11 to 221 +/- 30, and from 403 +/- 64 to 595 +/- 106 nmol/min per 100 ml leg, respectively. Transport of phenylalanine did not change significantly. We conclude that insulin promoted muscle anabolism, primarily by stimulating protein synthesis independently of any effect on transmembrane transport. Images PMID:7860765

  13. Applications of hydroxy acids: classification, mechanisms, and photoactivity

    PubMed Central

    Kornhauser, Andrija; Coelho, Sergio G; Hearing, Vincent J

    2010-01-01

    Hydroxy acids (HAs) represent a class of compounds which have been widely used in a number of cosmetic and therapeutic formulations in order to achieve a variety of beneficial effects for the skin. We review and discuss the most frequently used classes of these compounds, such as α-hydroxy acids, β-hydroxy acids, polyhydroxy acids, and bionic acids, and describe their applications as cosmetic and therapeutic agents. Special emphasis is devoted to the safety evaluation of these formulations, in particular on the effects of their prolonged use on sun-exposed skin. Furthermore, we summarize the very limited number of studies dealing with the modifications evoked by topical application of products containing HAs on photocarcinogenesis. In spite of the large number of reports on the cosmetic and clinical effects of HAs, their biological mechanism(s) of action still require more clarification. Some of these mechanisms are discussed in this article along with important findings on the effect of HAs on melanogenesis and on tanning. We also emphasize the important contribution of cosmetic vehicles in these types of studies. Thus, HAs play an important role in cosmetic formulations, as well as in many dermatologic applications, such as in treating photoaging, acne, ichthyosis, rosacea, pigmentation disorders, and psoriasis. PMID:21437068

  14. Applications of hydroxy acids: classification, mechanisms, and photoactivity.

    PubMed

    Kornhauser, Andrija; Coelho, Sergio G; Hearing, Vincent J

    2010-01-01

    Hydroxy acids (HAs) represent a class of compounds which have been widely used in a number of cosmetic and therapeutic formulations in order to achieve a variety of beneficial effects for the skin. We review and discuss the most frequently used classes of these compounds, such as α-hydroxy acids, β-hydroxy acids, polyhydroxy acids, and bionic acids, and describe their applications as cosmetic and therapeutic agents. Special emphasis is devoted to the safety evaluation of these formulations, in particular on the effects of their prolonged use on sun-exposed skin. Furthermore, we summarize the very limited number of studies dealing with the modifications evoked by topical application of products containing HAs on photocarcinogenesis. In spite of the large number of reports on the cosmetic and clinical effects of HAs, their biological mechanism(s) of action still require more clarification. Some of these mechanisms are discussed in this article along with important findings on the effect of HAs on melanogenesis and on tanning. We also emphasize the important contribution of cosmetic vehicles in these types of studies. Thus, HAs play an important role in cosmetic formulations, as well as in many dermatologic applications, such as in treating photoaging, acne, ichthyosis, rosacea, pigmentation disorders, and psoriasis. PMID:21437068

  15. Structure-based ligand discovery for the Large-neutral Amino Acid Transporter 1, LAT-1.

    PubMed

    Geier, Ethan G; Schlessinger, Avner; Fan, Hao; Gable, Jonathan E; Irwin, John J; Sali, Andrej; Giacomini, Kathleen M

    2013-04-01

    The Large-neutral Amino Acid Transporter 1 (LAT-1)--a sodium-independent exchanger of amino acids, thyroid hormones, and prescription drugs--is highly expressed in the blood-brain barrier and various types of cancer. LAT-1 plays an important role in cancer development as well as in mediating drug and nutrient delivery across the blood-brain barrier, making it a key drug target. Here, we identify four LAT-1 ligands, including one chemically novel substrate, by comparative modeling, virtual screening, and experimental validation. These results may rationalize the enhanced brain permeability of two drugs, including the anticancer agent acivicin. Finally, two of our hits inhibited proliferation of a cancer cell line by distinct mechanisms, providing useful chemical tools to characterize the role of LAT-1 in cancer metabolism. PMID:23509259

  16. Structure-based ligand discovery for the Large-neutral Amino Acid Transporter 1, LAT-1

    PubMed Central

    Geier, Ethan G.; Schlessinger, Avner; Fan, Hao; Gable, Jonathan E.; Irwin, John J.; Sali, Andrej; Giacomini, Kathleen M.

    2013-01-01

    The Large-neutral Amino Acid Transporter 1 (LAT-1)—a sodium-independent exchanger of amino acids, thyroid hormones, and prescription drugs—is highly expressed in the blood–brain barrier and various types of cancer. LAT-1 plays an important role in cancer development as well as in mediating drug and nutrient delivery across the blood–brain barrier, making it a key drug target. Here, we identify four LAT-1 ligands, including one chemically novel substrate, by comparative modeling, virtual screening, and experimental validation. These results may rationalize the enhanced brain permeability of two drugs, including the anticancer agent acivicin. Finally, two of our hits inhibited proliferation of a cancer cell line by distinct mechanisms, providing useful chemical tools to characterize the role of LAT-1 in cancer metabolism. PMID:23509259

  17. Electron transport mechanisms in polymer-carbon sphere composites

    NASA Astrophysics Data System (ADS)

    Nieves, Cesar A.; Ramos, Idalia; Pinto, Nicholas J.; Zimbovskaya, Natalya A.

    2016-07-01

    A set of uniform carbon microspheres (CSs) whose diameters have the order of 0.125 μm to 10 μm was prepared from aqueous sucrose solution by means of hydrothermal carbonization of sugar molecules. A pressed pellet was composed by mixing CSs with polyethylene oxide (PEO). Electrical characterization of the pellet was carried out showing Ohmic current-voltage characteristics and temperature-dependent conductivity in the range of 80 K mechanisms of electron transport. It was shown that thermally induced electron tunneling between adjacent spheres may take on an important part in the electron transport through the CS/PEO composites.

  18. Study of internal transport barrier triggering mechanism in tokamak plasmas

    SciTech Connect

    Dong, J.Q.; Mou, Z.Z.; Long, Y.X.; Mahajan, S.M.

    2004-12-01

    Sheared flow layers driven by magnetic energy, released in tearing-reconnection processes inherent in dissipative magnetohydrodynamics, are proposed as a triggering mechanism for the creation of the internal transport barrier (ITB) in tokamak plasmas. The double tearing mode, mediated by anomalous electron viscosity in configurations with a nonmonotonic safety factor, is investigated as an example. Particular emphasis is placed on the formation of sheared poloidal flow layers in the vicinity of the magnetic islands. A quasilinear simulation demonstrates that the sheared flows induced by the mode have desirable characteristics (lying just outside the magnetic islands), and sufficient levels required for ITB formation. A possible explanation is also proffered for the experimental observation that the transport barriers are preferentially formed in the proximity of low-order rational surfaces.

  19. Mechanical Fatigue Testing of High Burnup Fuel for Transportation Applications

    SciTech Connect

    Wang, Jy-An John; Wang, Hong

    2015-05-01

    This report describes testing designed to determine the ability of high burnup (HBU) (>45 GWd/MTU) spent fuel to maintain its integrity under normal conditions of transportation. An innovative system, Cyclic Integrated Reversible-bending Fatigue Tester (CIRFT), has been developed at Oak Ridge National Laboratory (ORNL) to test and evaluate the mechanical behavior of spent nuclear fuel (SNF) under conditions relevant to storage and transportation. The CIRFT system is composed of a U-frame equipped with load cells for imposing the pure bending loads on the SNF rod test specimen and measuring the in-situ curvature of the fuel rod during bending using a set up with three linear variable differential transformers (LVDTs).

  20. Characterization of an N-system amino acid transporter expressed in retina and its involvement in glutamine transport.

    PubMed

    Gu, S; Roderick, H L; Camacho, P; Jiang, J X

    2001-06-29

    We report here on the characterization of a mouse N-system amino acid transporter protein, which is involved in the transport of glutamine. This protein of 485 amino acids shares 52% sequence homology with an N-system amino acid transporter, mouse N-system amino acid transporter (mNAT) and its orthologs. Because this protein shares a high degree of sequence homology and functional similarity to mNAT, we named it mNAT2. mNAT2 is predominately expressed in the retina and to a slightly lesser extent in the brain. In the retina, it is located in the axons of ganglion cells in the nerve fiber layer and in the bundles of the optic nerve. Functional analysis of mNAT2 expressed in Xenopus oocytes revealed that the strongest transport activities were specific for l-glutamine. In addition, mNAT2 is a Na(+)- and pH-dependent, high affinity transporter and partially tolerates substitution of Na(+) by Li(+). Additionally, mNAT2 functions as a carrier-mediated transporter that facilitates efflux. The unique expression pattern and selective glutamine transport properties of mNAT2 suggest that it plays a specific role in the uptake of glutamine involved in the generation of the neurotransmitter glutamate in retina. PMID:11325958

  1. Hypertonic upregulation of amino acid transport system A in vascular smooth muscle cells.

    PubMed

    Chen, J G; Klus, L R; Steenbergen, D K; Kempson, S A

    1994-08-01

    The A10 line of vascular smooth muscle cells has Na+ dependent transport systems for alanine, proline, and Pi, whereas uptake of leucine, myo-inositol and D-glucose is Na+ independent. When A10 cells were incubated for 4 h in medium made hypertonic by addition of sucrose, there was a marked increase in Na(+)-dependent transport of alanine and proline but no change in Na(+)-dependent Pi uptake or Na(+)-independent uptake of leucine and inositol. Intracellular alanine content was increased 61% by the hypertonic treatment. Other nonpenetrating solutes, such as cellobiose and mannitol, reproduced the effect of sucrose, but urea, a penetrating solute, did not. Studies with 2-(methylamino)-isobutyric acid revealed that the upregulation by hypertonicity involved only system A. Increases in alanine and proline uptake also occurred after incubating the cells in isotonic medium containing 0.1 mM ouabain, suggesting that an increase in intracellular Na+ may be part of the intracellular signal for upregulation of system A. Hypertonic upregulation of Na(+)-dependent alanine transport occurred also in primary cultures of vascular smooth muscle cells. The response was blocked by actinomycin D and cycloheximide, indicating that gene transcription and protein synthesis play important roles in the mechanism leading to increased alanine uptake. We conclude that vascular smooth muscle cells, during prolonged hypertonic stress, activate system A and accumulate specific neutral amino acids which may act as organic osmolytes to help maintain normal cell volume. PMID:8074188

  2. Enterobacteria modulate intestinal bile acid transport and homeostasis through apical sodium-dependent bile acid transporter (SLC10A2) expression.

    PubMed

    Miyata, Masaaki; Yamakawa, Hiroki; Hamatsu, Mayumi; Kuribayashi, Hideaki; Takamatsu, Yuki; Yamazoe, Yasushi

    2011-01-01

    In our study, ampicillin (AMP)-mediated decrease of enterobacteria caused increases in hepatic bile acid concentration through (at least in part) elevation of bile acid synthesis in C57BL/6N mice. We investigated the involvement of enterobacteria on intestinal bile acid absorption in AMP-treated mice in the present study. Fecal enterobacterial levels and fecal bile acid excretion rates were markedly decreased in mice treated with AMP (100 mg/kg) for 3 days, whereas bile acid concentrations in portal blood were significantly increased compared with those in mice treated with a vehicle. Ileal apical sodium-dependent bile acid transporter (SLC10A2) mRNA levels and ileal SLC10A2 protein levels in brush-border membranes were significantly increased compared with those in mice treated with the vehicle. In AMP-treated mice, total bile acid levels were increased, whereas levels of enterobacteria-biotransformed bile acid, taurodeoxycholic acid, and cholic acid were decreased in intestinal lumen. These phenomena were also observed in farnesoid X receptor-null mice treated with AMP for 3 days. Discontinuation of AMP administration after 3 days (vehicle administration for 4 days) increased levels of fecal enterobacteria, fecal bile acid excretion, and taurodeoxycholic acid and cholic acid in the intestinal lumen, whereas the discontinuation decreased ileal SLC10A2 expression and bile acid concentrations in the portal blood. Coadministration of taurodeoxycholic acid or cholic acid decreased ileal SLC10A2 expression in mice treated with AMP. These results suggest that enterobacteria-mediated bile acid biotransformation modulates intestinal bile acid transport and homeostasis through down-regulation of ileal SLC10A2 expression. PMID:20884752

  3. Mechanical transport in two-dimensional networks of fractures

    SciTech Connect

    Endo, H.K.

    1984-04-01

    The objectives of this research are to evaluate directional mechanical transport parameters for anisotropic fracture systems, and to determine if fracture systems behave like equivalent porous media. The tracer experiments used to measure directional tortuosity, longitudinal geometric dispersivity, and hydraulic effective porosity are conducted with a uniform flow field and measurements are made from the fluid flowing within a test section where linear length of travel is constant. Since fluid flow and mechanical transport are coupled processes, the directional variations of specific discharge and hydraulic effective porosity are measured in regions with constant hydraulic gradients to evaluate porous medium equivalence for the two processes, respectively. If the fracture region behaves like an equivalent porous medium, the system has the following stable properties: (1) specific discharge is uniform in any direction and can be predicted from a permeability tensor; and (2) hydraulic effective porosity is directionally stable. Fracture systems with two parallel sets of continuous fractures satisfy criterion 1. However, in these systems hydraulic effective porosity is directionally dependent, and thus, criterion 2 is violated. Thus, for some fracture systems, fluid flow can be predicted using porous media assumptions, but it may not be possible to predict transport using porous media assumptions. Two discontinuous fracture systems were studied which satisfied both criteria. Hydraulic effective porosity for both systems has a value between rock effective porosity and total porosity. A length-density analysis (LDS) of Canadian fracture data shows that porous media equivalence for fluid flow and transport is likely when systems have narrow aperture distributions. 54 references, 90 figures, 7 tables.

  4. Reactive Transport Modeling of Acid Gas Generation and Condensation

    SciTech Connect

    G. Zhahg; N. Spycher; E. Sonnenthal; C. Steefel

    2005-01-25

    Pulvirenti et al. (2004) recently conducted a laboratory evaporation/condensation experiment on a synthetic solution of primarily calcium chloride. This solution represents one potential type of evaporated pore water at Yucca Mountain, Nevada, a site proposed for geologic storage of high-level nuclear waste. These authors reported that boiling this solution to near dryness (a concentration factor >75,000 relative to actual pore waters) leads to the generation of acid condensate (pH 4.5) presumably due to volatilization of HCl (and minor HF and/or HNO{sub 3}). To investigate the various processes taking place, including boiling, gas transport, and condensation, their experiment was simulated by modifying an existing multicomponent and multiphase reactive transport code (TOUGHREACT). This code was extended with a Pitzer ion-interaction model to deal with high ionic strength. The model of the experiment was set-up to capture the observed increase in boiling temperature (143 C at {approx}1 bar) resulting from high concentrations of dissolved salts (up to 8 m CaCl{sub 2}). The computed HCI fugacity ({approx} 10{sup -4} bars) generated by boiling under these conditions is not sufficient to lower the pH of the condensate (cooled to 80 and 25 C) down to observed values unless the H{sub 2}O mass fraction in gas is reduced below {approx}10%. This is because the condensate becomes progressively diluted by H{sub 2}O gas condensation. However, when the system is modeled to remove water vapor, the computed pH of instantaneous condensates decreases to {approx}1.7, consistent with the experiment (Figure 1). The results also show that the HCl fugacity increases, and calcite, gypsum, sylvite, halite, MgCl{sub 2}4H{sub 2}O and CaCl{sub 2} precipitate sequentially with increasing concentration factors.

  5. Mechanisms of suberoylanilide hydroxamic acid inhibition of mammary cell growth

    PubMed Central

    Said, Thenaa K; Moraes, Ricardo CB; Sinha, Raghu; Medina, Daniel

    2001-01-01

    The mechanism of suberoylanilide hydroxamic acid in cell growth inhibition involved induction of pRb-2/p130 interaction and nuclear translocation with E2F-4, followed by significant repression in E2F-1 and PCNA nuclear levels, which led to inhibition in DNA synthesis in mammary epithelial cell lines. PMID:11250759

  6. ACID RAIN AND SOIL MICROBIAL ACTIVITY: EFFECTS AND THEIR MECHANISMS

    EPA Science Inventory

    In the investigation, our aim was to determine if acid rain affects soil microbial activity and to identify possible mechanisms of observed effects. A Sierran forest soil (pH 6.4) planted with Ponderosa pine seedlings was exposed to simulated rain (pH 2.0, 3.0, 4.0 and 5.6) with ...

  7. L-aspartic acid transport by cat erythrocytes

    SciTech Connect

    Chen, C.W.; Preston, R.L.

    1986-03-01

    Cat and dog red cells are unusual in that they have no Na/K ATPase and contain low K and high Na intracellularly. They also show significant Na dependent L-aspartate (L-asp) transport. The authors have characterized this system in cat RBCs. The influx of /sup 3/H-L-asp (typically 2..mu..M) was measured in washed RBCs incubated for 60 s at 37/sup 0/C in medium containing 140 mM NaCl, 5 mM Kcl, 2 mM CaCl/sub 2/, 15 mM MOPS pH 7.4, 5 mM glucose, and /sup 14/C-PEG as a space marker. The cells were washed 3 times in the medium immediately before incubation which was terminated by centrifuging the RBCs through a layer of dibutylphthalate. Over an L-asp concentration range of 0.5-1000..mu..M, influx obeyed Michaelis-Menten kinetics with a small added linear diffusion component. The Kt and Jmax of the saturable component were 5.40 +/- 0.34 ..mu..M and 148.8 +/- 7.2 ..mu..mol 1. cell/sup -1/h/sup -1/ respectively. Replacement of Na with Li, K, Rb, Cs or choline reduce influx to diffusion. With the addition of asp analogues (4/sup +/M L-asp, 40/sup +/M inhibitor), the following sequence of inhibition was observed (range 80% to 40% inhib.): L-glutamate > L-cysteine sulfonate > D-asp > L-cysteic acid > D-glutamate. Other amino acids such as L-alanine, L-proline, L-lysine, L-cysteine, and taurine showed no inhibition (<5%). These data suggest that cat red cells contain a high-affinity Na dependent transport system for L-asp, glutamate, and closely related analogues which resembles that found in the RBCs of other carnivores and in neural tissues.

  8. Vertical transport processes of an acid-iron waste in a MERL stratified mesocosm

    SciTech Connect

    Fox, M.F.; Kester, D.R.; Hunt, C.D.

    1986-01-01

    The vertical transport of the Fe particles formed after an acid-Fe waste mixes with seawater and the impact of the waste on the trace metal composition of seawater were examined in a stratified tank (2 m diameter and 5 m deep) at the MERL facility of the University of Rhode Island. Two acid-Fe waste additions were made to one of the stratified tanks at concentrations comparable to those observed after the initial dispersion of the waste in the ocean (10/sup 5/ dilution); a second stratified tank was maintained as a control. The removal of the Fe waste from the water column was due to settling of the Fe particles through the pycnocline; biological transport of the Fe particles was not an important removal mechanism. The kinetic behavior of the Fe particles was different after the two waste additions; gravitational settling was the rate-limiting step after the first addition, whereas flocculation was the rate-limiting step after the second waste addition. The first acid-Fe waste addition apparently altered the properties of the seawater, possibly stripping organic substances from the water column. This alteration in the characteristics of seawater changed the distribution of Pb and V between the dissolved and particulate forms. Both Pb and V showed a strong correlation with Fe, suggesting scavenging of these metals by the Fe particles. Cu and Cd show remarkable independence from the behavior of Fe. 18 references, 6 figures, 5 tables.

  9. Accumulation of ascorbate by endocrine-regulated and glucose-sensitive transport of dehydroascorbic acid in luteinized rat ovarian cells.

    PubMed

    Kodaman, P H; Aten, R F; Behrman, H R

    1998-02-01

    The corpus luteum is notable for very high levels of ascorbic acid. In luteal cells, ascorbic acid depletion occurs as a result of consumption during radical scavenging, inhibition of ascorbic acid uptake, and stimulation of its secretion. Oxidation of ascorbic acid generates dehydroascorbic acid (DHAA). Although levels of DHAA in blood are much lower than those of ascorbic acid, DHAA serves as the major transportable form of ascorbate for certain cell types. The aim of the present studies was to investigate whether DHAA transport is a potential mechanism for conserving ascorbic acid in the corpus luteum. DHAA uptake by rat luteal cells precultured for 24 h was linear for up to 30 min. Kinetics studies showed that uptake of DHAA was a concentration-dependent and saturable process with an estimated Michaelis constant (Km) of 830 microM and a maximum velocity (Vmax) of 700 pmol/min per 10(6) cells, a rate 50 times that of ascorbate transport. More than 90% of DHAA was reduced to ascorbic acid within 2 h of cellular uptake. DHAA uptake was energy- and microfilament-dependent, as transport was inhibited by 2,4-dinitrophenol (1 mM) and cytochalasin B (10 microM). Menadione (50 microM), an intracellular generator of reactive oxygen species, also markedly reduced DHAA uptake. In contrast to ascorbic acid transport, DHAA uptake was potently inhibited by glucose and phloretin, an inhibitor of glucose transporters, with IC50s of approximately 5 mM and 10 microM, respectively. DHAA uptake appears to occur via an insulin-insensitive transporter, as insulin (10 nM) had no effect on uptake. However, 24-h preincubation with insulin-like growth factor (IGF)-I dose-dependently (10-100 ng/ml) stimulated DHAA uptake; similar concentrations of IGF-II had no effect. The secretion of radioactivity by cells preloaded with radiolabeled DHAA was significantly increased by prostaglandin F2alpha (1 microM). The ability of luteal cells to transport DHAA in a regulated manner may serve to

  10. Fatty Acid-Binding Protein 5 Facilitates the Blood-Brain Barrier Transport of Docosahexaenoic Acid.

    PubMed

    Pan, Yijun; Scanlon, Martin J; Owada, Yuji; Yamamoto, Yui; Porter, Christopher J H; Nicolazzo, Joseph A

    2015-12-01

    The brain has a limited ability to synthesize the essential polyunsaturated fatty acid (PUFA) docosahexaenoic acid (DHA) from its omega-3 fatty acid precursors. Therefore, to maintain brain concentrations of this PUFA at physiological levels, plasma-derived DHA must be transported across the blood-brain barrier (BBB). While DHA is able to partition into the luminal membrane of brain endothelial cells, its low aqueous solubility likely limits its cytosolic transfer to the abluminal membrane, necessitating the requirement of an intracellular carrier protein to facilitate trafficking of this PUFA across the BBB. As the intracellular carrier protein fatty acid-binding protein 5 (FABP5) is expressed at the human BBB, the current study assessed the putative role of FABP5 in the brain endothelial cell uptake and BBB transport of DHA in vitro and in vivo, respectively. hFAPB5 was recombinantly expressed and purified from Escherichia coli C41(DE3) cells and the binding affinity of DHA to hFABP5 assessed using isothermal titration calorimetry. The impact of FABP5 siRNA on uptake of (14)C-DHA into immortalized human brain microvascular endothelial (hCMEC/D3) cells was assessed. An in situ transcardiac perfusion method was optimized in C57BL/6 mice and subsequently used to compare the BBB influx rate (Kin) of (14)C-DHA between FABP5-deficient (FABP5(-/-)) and wild-type (FABP5(+/+)) C57BL/6 mice. DHA bound to hFABP5 with an equilibrium dissociation constant of 155 ± 8 nM (mean ± SEM). FABP5 siRNA transfection decreased hCMEC/D3 mRNA and protein expression of FABP5 by 53.2 ± 5.5% and 44.8 ± 13.7%, respectively, which was associated with a 14.1 ± 2.7% reduction in (14)C-DHA cellular uptake. By using optimized conditions for the in situ transcardiac perfusion (a 1 min preperfusion (10 mL/min) followed by perfusion of (14)C-DHA (1 min)), the Kin of (14)C-DHA was 0.04 ± 0.01 mL/g/s. Relative to FABP5(+/+) mice, the Kin of (14)C-DHA decreased 36.7 ± 12.4% in FABP5(-/-) mice

  11. Study of the mechanisms of acid rain formation

    SciTech Connect

    Parungo, F.; Nagamoto, C.; Madel, R.

    1987-11-01

    Samples of rain, snow, cloud water, aerosols and soil were collected in Colorado to study the mechanisms of acid rain formation. Chemical compositions of various types of samples were analyzed to investigate the stepwise incorporation of inpurities into precipitation. Local soil was generally alkaline; atmospheric aerosols, which are mixtures of stirred-up soil particles and anthropogenic pollution, were slightly acidic; cloud condensation nuclei, which initiate clouds at condensation level, had an average pH of approx.6. However, local clouds were very acidic (pH approx.4), indicating that further acidification takes place in clouds by adsorption of acidic gases, e.g., CO/sub 2/, SO/sub 2/, and NO/sub x/. We found that summer showers formed by coalescence of cloud droplets are likely to be as acidic as cloud water. The chemistry of snow may differ from that of clouds, depending on the mechanisms of snow formation. If snow crystals are initiated by deposition nucleation and grown by diffusion of water vapor from surrounding evaporating cloud droplets as in the Bergeron--Findeisen process, the snow crystals are purified and should not be acidic. If the snow crystals are initiated by freezing of cloud droplets and grow by vapor diffusion, then the constituents of cloud water are diluted and the snow is less acidic than cloud water. If snow grains (graupel) are formed by accretion of frozen cloud drops or by riming, the snow can be as acidic as cloud water. Raindrops formed by melting snow inherit the chemistry of the parent snow, but differentiate in scavenging coefficiencies of gases and aerosols below the clouds. Both atmospheric chemical reactions and cloud microphysical processes are responsible for chemical variations in precipitation.

  12. Regulatory signals for intestinal amino acid transporters and peptidases

    SciTech Connect

    Ferraris, R.P.; Kwan, W.W.; Diamond, J. )

    1988-08-01

    Dietary protein ultimately regulates many processes involved in protein digestion, but it is often unclear whether proteins themselves, peptides, or amino acids (AAs) are the proximate regulatory signal. Hence the authors compared several processes involved in protein digestion in mice adapted to one of three rations, identical except for containing 54% of either casein, a partial hydrolysate of casein, or a free AA mixture simulating a complete hydrolysate of casein. The authors measured brush-border uptakes of seven AAs that variously serve as substrates for four AA transporters, and brush-border and cytosolic activities of four peptidases. The three rations yielded essentially the same AA uptake rates. Peptidase activities tended to be lower on the AA ration than on the protein ration. In other studies, all three rations yielded the same rates of brush-border peptide uptake; protein is only modestly more effective than AAs at inducing synthesis of pancreatic proteases; and, depending on the animal species, protein is either much less or much more effective than AAs at stimulating release of cholecystokinin and hence of pancreatic enzymes. Thus the regulators of each process involved in protein digestion are not necessarily that process's substrate.

  13. Identification of an abscisic acid transporter by functional screening using the receptor complex as a sensor

    PubMed Central

    Kanno, Yuri; Hanada, Atsushi; Chiba, Yasutaka; Ichikawa, Takanari; Nakazawa, Miki; Matsui, Minami; Koshiba, Tomokazu; Kamiya, Yuji; Seo, Mitsunori

    2012-01-01

    Movement of the plant hormone abscisic acid (ABA) within plants has been documented; however, the molecular mechanisms that regulate ABA transport are not fully understood. By using a modified yeast two-hybrid system, we screened Arabidopsis cDNAs capable of inducing interactions between the ABA receptor PYR/PYL/RCAR and PP2C protein phosphatase under low ABA concentrations. By using this approach, we identified four members of the NRT1/PTR family as candidates for ABA importers. Transport assays in yeast and insect cells demonstrated that at least one of the candidates ABA-IMPORTING TRANSPORTER (AIT) 1, which had been characterized as the low-affinity nitrate transporter NRT1.2, mediates cellular ABA uptake. Compared with WT, the ait1/nrt1.2 mutants were less sensitive to exogenously applied ABA during seed germination and/or postgermination growth, whereas overexpression of AIT1/NRT1.2 resulted in ABA hypersensitivity in the same conditions. Interestingly, the inflorescence stems of ait1/nrt1.2 had a lower surface temperature than those of the WT because of excess water loss from open stomata. We detected promoter activities of AIT1/NRT1.2 around vascular tissues in inflorescence stems, leaves, and roots. These data suggest that the function of AIT1/NRT1.2 as an ABA importer at the site of ABA biosynthesis is important for the regulation of stomatal aperture in inflorescence stems. PMID:22645333

  14. Phloem transport: a review of mechanisms and controls.

    PubMed

    De Schepper, Veerle; De Swaef, Tom; Bauweraerts, Ingvar; Steppe, Kathy

    2013-11-01

    It is generally believed that an osmotically generated pressure gradient drives the phloem mass flow. So far, this widely accepted Münch theory has required remarkably few adaptations, but the debate on alternative and additional hypotheses is still ongoing. Recently, a possible shortcoming of the Münch theory has been pointed out, suggesting that the Münch pressure flow is more suitable for herbs than for trees. Estimation of the phloem resistance indicates that a point might be reached in long sieve tubes where the pressure required to drive the Münch flow cannot be generated. Therefore, the relay hypothesis regained belief as it implies that the sieve tubes are shorter then the plant's axial axis. In the source phloem, three different loading strategies exist which probably result from evolutionary advantages. Passive diffusion seems to be the most primitive one, whereas active loading strategies substantially increase the growth potential. Along the transport phloem, a leakage-retrieval mechanism is observed. Appreciable amounts of carbohydrates are lost from the sieve tubes to feed the lateral sinks, while a part of these lost carbohydrates is subsequently reloaded into the sieve tubes. This mechanism is probably involved to buffer short-term irregularities in phloem turgor and gradient. In the long term, the mechanism controls the replenishment and remobilization of lateral stem storage tissues. As phloem of higher plants has multiple functions in plant development, reproduction, signalling, and growth, the fundamental understanding of the mechanisms behind phloem transport should be elucidated to increase our ability to influence plant growth and development. PMID:24106290

  15. Osmoregulation in zebrafish: ion transport mechanisms and functional regulation

    PubMed Central

    Guh, Ying-Jey; Lin, Chia-Hao; Hwang, Pung-Pung

    2015-01-01

    Fish, like mammals, have to maintain their body fluid ionic and osmotic homeostasis through sophisticated iono-/osmoregulation mechanisms, which are conducted mainly by ionocytes of the gill (the skin in embryonic stages), instead of the renal tubular cells in mammals. Given the advantages in terms of genetic database availability and manipulation, zebrafish is an emerging model for research into regulatory and integrative physiology. At least five types of ionocytes, HR, NaR, NCC, SLC26, and KS cells, have been identified to carry out Na+ uptake/H+ secretion/NH4+ excretion, Ca2+ uptake, Na+/Cl- uptake, K+ secretion, and Cl- uptake/HCO3- secretion, respectively, through distinct sets of transporters. Several hormones, namely isotocin, prolactin, cortisol, stanniocalcin-1, calcitonin, endothelin-1, vitamin D, parathyorid hormone 1, catecholamines, and the renin-angiotensin-system, have been demonstrated to positively or negatively regulate ion transport through specific receptors at different ionocytes stages, at either the transcriptional/translational or posttranslational level. The knowledge obtained using zebrafish answered many long-term contentious or unknown issues in the field of fish iono-/osmoregulation. The homology of ion transport pathways and hormone systems also means that the zebrafish model informs studies on mammals or other animal species, thereby providing insights into related fields. PMID:26600749

  16. Designing Novel Nanoformulations Targeting Glutamate Transporter Excitatory Amino Acid Transporter 2: Implications in Treating Drug Addiction

    PubMed Central

    Rao, PSS; Yallapu, Murali M.; Sari, Youssef; Fisher, Paul B.; Kumar, Santosh

    2015-01-01

    Chronic drug abuse is associated with elevated extracellular glutamate concentration in the brain reward regions. Deficit of glutamate clearance has been identified as a contributing factor that leads to enhanced glutamate concentration following extended drug abuse. Importantly, normalization of glutamate level through induction of glutamate transporter 1 (GLT1)/ excitatory amino acid transporter 2 (EAAT2) expression has been described in several in vivo studies. GLT1 upregulators including ceftriaxone, a beta-lactam antibiotic, have been effective in attenuating drug-seeking and drug-consumption behavior in rodent models. However, potential obstacles toward clinical translation of GLT1 (EAAT2) upregulators as treatment for drug addiction might include poor gastrointestinal absorption, serious peripheral adverse effects, and/or suboptimal CNS concentrations. Given the growing success of nanotechnology in targeting CNS ailments, nanoformulating known GLT1 (EAAT2) upregulators for selective uptake across the blood brain barrier presents an ideal therapeutic approach for treating drug addiction. In this review, we summarize the results obtained with promising GLT1 (EAAT2) inducing compounds in animal models recapitulating drug addiction. Additionally, the various nanoformulations that can be employed for selectively increasing the CNS bioavailability of GLT1 (EAAT2) upregulators are discussed. Finally, the applicability of GLT1 (EAAT2) induction via central delivery of drug-loaded nanoformulations is described. PMID:26635971

  17. gamma-Glutamyl amino acids. Transport and conversion to 5-oxoproline in the kidney

    SciTech Connect

    Bridges, R.J.; Meister, A.

    1985-06-25

    Transport of gamma-glutamyl amino acids, a step in the proposed glutathione-gamma-glutamyl transpeptidase-mediated amino acid transport pathway, was examined in mouse kidney. The transport of gamma-glutamyl amino acids was demonstrated in vitro in studies on kidney slices. Transport was followed by measuring uptake of /sup 35/S after incubation of the slices in media containing gamma-glutamyl methionine (/sup 35/S)sulfone. The experimental complication associated with extracellular conversion of the gamma-glutamyl amino acid to amino acid and uptake of the latter by slices was overcome by using 5-oxoproline formation (catalyzed by intracellular gamma-glutamyl-cyclotransferase) as an indicator of gamma-glutamyl amino acid transport. This method was also successfully applied to studies on transport of gamma-glutamyl amino acids in vivo. Transport of gamma-glutamyl amino acids in vitro and in vivo is inhibited by several inhibitors of gamma-glutamyl transpeptidase and also by high extracellular levels of glutathione. This seems to explain urinary excretion of gamma-glutamylcystine by humans with gamma-glutamyl transpeptidase deficiency and by mice treated with inhibitors of this enzyme. Mice depleted of glutathione by treatment with buthionine sulfoximine (which inhibits glutathione synthesis) or by treatment with 2,6-dimethyl-2,5-heptadiene-4-one (which effectively interacts with tissue glutathione) exhibited significantly less transport of gamma-glutamyl amino acids than did untreated controls. The findings suggest that intracellular glutathione functions in transport of gamma-glutamyl amino acids. Evidence was also obtained for transport of gamma-glutamyl gamma-glutamylphenylalanine into kidney slices.

  18. Tuning transport properties on graphene multiterminal structures by mechanical deformations

    NASA Astrophysics Data System (ADS)

    Latge, Andrea; Torres, Vanessa; Faria, Daiara

    The realization of mechanical strain on graphene structures is viewed as a promise route to tune electronic and transport properties such as changing energy band-gaps and promoting localization of states. Using continuum models, mechanical deformations are described by effective gauge fields, mirrored as pseudomagnetic fields that may reach quite high values. Interesting symmetry features are developed due to out of plane deformations on graphene; lift sublattice symmetry was predicted and observed in centrosymmetric bumps and strained nanobubbles. Here we discuss the effects of Gaussian-like strain on a hexagonal graphene flake connected to three leads, modeled as perfect graphene nanoribbons. The Green function formalism is used within a tight-binding approximation. For this particular deformation sharp resonant states are achieved depending on the strained structure details. We also study a fold-strained structure in which the three leads are deformed extending up to the very center of the hexagonal flake. We show that conductance suppressions can be controlled by the strain intensity and important transport features are modeled by the electronic band structure of the leads.

  19. Calcium transport mechanism in molting crayfish revealed by microanalysis

    SciTech Connect

    Mizuhira, V.; Ueno, M.

    1983-01-01

    Crayfish provide a good model in which to study the transport mechanism of Ca ions. During the molting stage, decalcified Ca ions are transferred into the blood and accumulate in the gastrolith epithelium, after which a gastrolith is formed on the surface of the epithelium. The gastrolith is dissolved in the stomach after molting, and the Ca is reabsorbed and redistributed throughout the newly formed exoskeleton. We studied the mechanism of Ca transport by cytochemical precipitation of Ca ions and by electron microanalysis, including X-ray microanalysis (EDX) and electron energy-loss spectroscopy (EELS), with a computer. In EDX analysis, the fine precipitates of K-antimonate in the gastrolith mitochondria clearly defined Ca with antimony; we also observed a large amount of Ca-oxalate in the mitochondria, and Ca-K X-ray pulses were clearly defined. Ca-K X-rays were also detected from fresh freeze-substituted mitochondria. Finally, we succeeded in taking a Ca-L EELS image from the mitochondria of fresh freeze-substituted thin sections. Only a very small amount of Ca was detected from the cell membrane and other organelles. Ca-adenosine triphosphatase (ATPase) and Mg-ATPase activity was also very clearly demonstrated in the mitochondria. These enzymes may play an important role in Ca metabolism.

  20. Characteristics and Possible Functions of Mitochondrial Ca2+ Transport Mechanisms

    PubMed Central

    Gunter, Thomas E.; Sheu, Shey-Shing

    2009-01-01

    Mitochondria produce around 92% of the ATP used in the typical animal cell by oxidative phosphorylation using energy from their electrochemical proton gradient. Intramitochondrial free Ca2+ concentration ([Ca2+]m) has been found to be an important component of control of the rate of this ATP production. In addition, [Ca2+]m also controls the opening of a large pore in the inner mitochondrial membrane, the permeability transition pore (PTP), which plays a role in mitochondrial control of programmed cell death or apoptosis. Therefore, [Ca2+]m can control whether the cell has sufficient ATP to fulfill its functions and survive or is condemned to death. Ca2+ is also one of the most important second messengers within the cytosol, signaling changes in cellular response through Ca2+ pulses or transients. Mitochondria can also sequester Ca2+ from these transients so as to modify the shape of Ca2+ signaling transients or control their location within the cell. All of this is controlled by the action of four or five mitochondrial Ca2+ transport mechanisms and the PTP. The characteristics of these mechanisms of Ca2+ transport and a discussion of how they might function are described in this paper. PMID:19161975

  1. Multi-scale mechanical and transport properties of a hydrogel.

    PubMed

    Salahshoor, Hossein; Rahbar, Nima

    2014-09-01

    In this paper, molecular dynamic simulation was used to study the effect of water on the equilibrated structure and mechanical properties of cross-linked hydrogel at multiple scales. The hydrogel consisted of Polyethylene glycol diglycidyl ether (PEGDGE) as epoxy and the Jeffamine, poly-oxy-alkylene-amines, as curing agent. The results for systems with various water contents indicated that the cross-links were more hydrophilic within the hydrogel structure. Effects of cross-linking on the transport properties were also investigated by computing diffusion coefficients of water molecules. A new Coarse-Grained (CG) scheme for hydrogels is proposed, and validated by comparing the transport properties with the all-atom method, demonstrating the capability of the model to capture the correct dynamic evolution of the system. The all-atom model of the hydrogel was mapped to the CG model using the MARTINI force field. This method resulted in a more realistic representation of the stiffness of the system, compared to the previous experimental studies in the literature. The variation of the stiffness of the hydrogel as a function of the water content showed that 40% water content is the optimal value for mechanical performance of the hydrogel. PMID:24967978

  2. Developing Hypothetical Inhibition Mechanism of Novel Urea Transporter B Inhibitor

    NASA Astrophysics Data System (ADS)

    Li, Min; Tou, Weng Ieong; Zhou, Hong; Li, Fei; Ren, Huiwen; Chen, Calvin Yu-Chian; Yang, Baoxue

    2014-07-01

    Urea transporter B (UT-B) is a membrane channel protein that specifically transports urea. UT-B null mouse exhibited urea selective urine concentrating ability deficiency, which suggests the potential clinical applications of the UT-B inhibitors as novel diuretics. Primary high-throughput virtual screening (HTVS) of 50000 small-molecular drug-like compounds identified 2319 hit compounds. These 2319 compounds were screened by high-throughput screening using an erythrocyte osmotic lysis assay. Based on the pharmacological data, putative UT-B binding sites were identified by structure-based drug design and validated by ligand-based and QSAR model. Additionally, UT-B structural and functional characteristics under inhibitors treated and untreated conditions were simulated by molecular dynamics (MD). As the result, we identified four classes of compounds with UT-B inhibitory activity and predicted a human UT-B model, based on which computative binding sites were identified and validated. A novel potential mechanism of UT-B inhibitory activity was discovered by comparing UT-B from different species. Results suggest residue PHE198 in rat and mouse UT-B might block the inhibitor migration pathway. Inhibitory mechanisms of UT-B inhibitors and the functions of key residues in UT-B were proposed. The binding site analysis provides a structural basis for lead identification and optimization of UT-B inhibitors.

  3. Hepatic transport of bile acid and effect of conjugation.

    PubMed

    Kitani, K

    1995-06-01

    Biliary transport of bile salts was investigated by measuring: 1) biliary transport maxima values (Tm) for different conjugated bile salts; and 2) biliary excretion of unconjugated bile salts relative to their conjugates under the continuous i.v. infusion of various unconjugated bile salts. The order of Tm values found in the rat of both sexes was tauro (and glyco) ursodeoxycholate (TUDC, GUDC), tauro alpha- and beta-muricholate (T alpha-MC, T beta-MC) > taurocholate(TC) > taurochenodeoxycholate (TCDC), while in female hamsters it was TC > TCDC > TUDC. The differences in the Tm order between rats and hamsters cast doubt on the currently proposed view that the apparent Tm values of bile salts are primarily determined by their physical-chemical properties (detergent property in particular). The biliary excretion of unconjugated bile salts was most efficient with ursocholate (UC) and alpha-MC followed by beta-MC, with UDC (and probably 7 ketolithocholate) being the least efficient for excretion. Thus, while for some bile salts such as cholate and UC, the amidation is not a prerequisite to their efficient excretion, for other bile salts such as UDC, the amidation is an excellent mechanism for facilitating the biliary excretion. In an attempt to explain the above order for the efficacy of the biliary excretion of unconjugated bile salts on the basis of their physical-chemical properties, we must remember that unlike rats, the biliary excretion of dehydrocholate and cholate in dogs is more limited than their respective taurine conjugates.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8541581

  4. Overcoming ABC transporter-mediated multidrug resistance: Molecular mechanisms and novel therapeutic drug strategies.

    PubMed

    Li, Wen; Zhang, Han; Assaraf, Yehuda G; Zhao, Kun; Xu, Xiaojun; Xie, Jinbing; Yang, Dong-Hua; Chen, Zhe-Sheng

    2016-07-01

    Multidrug resistance is a key determinant of cancer chemotherapy failure. One of the major causes of multidrug resistance is the enhanced efflux of drugs by membrane ABC transporters. Targeting ABC transporters projects a promising approach to eliminating or suppressing drug resistance in cancer treatment. To reveal the functional mechanisms of ABC transporters in drug resistance, extensive studies have been conducted from identifying drug binding sites to elucidating structural dynamics. In this review article, we examined the recent crystal structures of ABC proteins to depict the functionally important structural elements, such as domains, conserved motifs, and critical amino acids that are involved in ATP-binding and drug efflux. We inspected the drug-binding sites on ABC proteins and the molecular mechanisms of various substrate interactions with the drug binding pocket. While our continuous battle against drug resistance is far from over, new approaches and technologies have emerged to push forward our frontier. Most recent developments in anti-MDR strategies include P-gp inhibitors, RNA-interference, nano-medicines, and delivering combination strategies. With the advent of the 'Omics' era - genomics, epigenomics, transcriptomics, proteomics, and metabolomics - these disciplines play an important role in fighting the battle against chemoresistance by further unraveling the molecular mechanisms of drug resistance and shed light on medical therapies that specifically target MDR. PMID:27449595

  5. Transport of Sulfide-Reduced Graphene Oxide in Saturated Quartz Sand: Cation-Dependent Retention Mechanisms.

    PubMed

    Xia, Tianjiao; Fortner, John D; Zhu, Dongqiang; Qi, Zhichong; Chen, Wei

    2015-10-01

    We describe how the reduction of graphene oxide (GO) via environmentally relevant pathways affects its transport behavior in porous media. A pair of sulfide-reduced GOs (RGOs), prepared by reducing 10 mg/L GO with 0.1 mM Na2S for 3 and 5 days, respectively, exhibited lower mobility than did parent GO in saturated quartz sand. Interestingly, decreased mobility cannot simply be attributed to the increased hydrophobicity and aggregation upon GO reduction because the retention mechanisms of RGOs were highly cation-dependent. In the presence of Na(+) (a representative monovalent cation), the main retention mechanism was deposition in the secondary energy minimum. However, in the presence of Ca(2+) (a model divalent cation), cation bridging between RGO and sand grains became the most predominant retention mechanism; this was because sulfide reduction markedly increased the amount of hydroxyl groups (a strong metal-complexing moiety) on GO. When Na(+) was the background cation, increasing pH (which increased the accumulation of large hydrated Na(+) ions on grain surface) and the presence of Suwannee River humic acid (SRHA) significantly enhanced the transport of RGO, mainly due to steric hindrance. However, pH and SRHA had little effect when Ca(2+) was the background cation because neither affected the extent of cation bridging that controlled particle retention. These findings highlight the significance of abiotic transformations on the fate and transport of GO in aqueous systems. PMID:26348539

  6. Adsorption and transport of polymaleic acid on Callovo-Oxfordian clay stone: Batch and transport experiments

    NASA Astrophysics Data System (ADS)

    Durce, Delphine; Landesman, Catherine; Grambow, Bernd; Ribet, Solange; Giffaut, Eric

    2014-08-01

    Dissolved Organic Matter (DOM) can affect the mobility of radionuclides in pore water of clay-rich geological formations, such as those intended to be used for nuclear waste disposal. The present work studies the adsorption and transport properties of a polycarboxylic acid, polymaleic acid (PMA, Mw = 1.9 kDa), on Callovo-Oxfordian argillite samples (COx). Even though this molecule is rather different from the natural organic matter found in clay rock, the study of its retention properties on both dispersed and intact samples allows assessing to which extent organic acids may undergo sorption under natural conditions (pH 7) and what could be the impact on their mobility. PMA sorption and desorption were investigated in dispersed systems. The degree of sorption was measured after 1, 8 and 21 days and for a range of PMA initial concentrations from 4.5 × 10- 7 to 1.4 × 10- 3 mol.L- 1. The reversibility of the sorption process was estimated by desorption experiments performed after the sorption experiments. At the sorption steady state, the sorption was described by a two-site Langmuir model. A total sorption capacity of COx for PMA was found to be 1.01×10- 2 mol.kg- 1 distributed on two sorption sites, one weak and one strong. The desorption of PMA was incomplete, independently of the duration of the sorption phase. The amount of desorbable PMA even appeared to decrease for sorption phases from 1 to 21 days. To describe the apparent desorption hysteresis, two conceptual models were applied. The two-box diffusion model accounted for intraparticle diffusion and more generally for nonequilibrium processes. The two-box first-order non-reversible model accounted for a first-order non-reversible sorption and more generally for kinetically-controlled irreversible sorption processes. The use of the two models revealed that desorption hysteresis was not the result of nonequilibrium processes but was due to irreversible sorption. Irreversible sorption on the strong site was

  7. Molecular mechanism of proton transport in CLC Cl-/H+ exchange transporters

    PubMed Central

    Feng, Liang; Campbell, Ernest B.; MacKinnon, Roderick

    2012-01-01

    CLC proteins underlie muscle, kidney, bone, and other organ system function by catalyzing the transport of Cl- ions across cell and organellar membranes. Some CLC proteins are ion channels while others are pumps that exchange Cl- for H+. The pathway through which Cl- ions cross the membrane has been characterized, but the transport of H+ and the principle by which their movement is coupled to Cl- movement is not well understood. Here we show that H+ transport depends not only on the presence of a specific glutamate residue but also the presence of Cl- ions. H+ transport, however, can be isolated and analyzed in the absence of Cl- by mutating the glutamate to alanine and adding carboxylate-containing molecules to solution, consistent with the notion that H+ transfer is mediated through the entry of a carboxylate group into the anion pathway. Cl- ions and carboxylate interact with each other strongly. These data support a mechanism in which the glutamate carboxylate functions as a surrogate Cl- ion, but it can accept a H+ and transfer it between the external solution and the central Cl- binding site, coupled to the movement of 2 Cl- ions. PMID:22753511

  8. Characterizing MttA as a mitochondrial cis-aconitic acid transporter by metabolic engineering.

    PubMed

    Steiger, Matthias G; Punt, Peter J; Ram, Arthur F J; Mattanovich, Diethard; Sauer, Michael

    2016-05-01

    The mitochondrial carrier protein MttA is involved in the biosynthesis of itaconic acid in Aspergillus terreus. In this paper, the transport specificity of MttA is analyzed making use of different metabolically engineered Aspergillus niger strains. Furthermore, the mitochondrial localization of this protein is confirmed using fluorescence microscopy. It was found that MttA preferentially transports cis-aconitic acid over citric acid and does not transport itaconic acid. The expression of MttA in selected A. niger strains results in secretion of aconitic acid. MttA can be used in further strain engineering strategies to transport cis-aconitic acid to the cytosol to produce itaconic acid or related metabolites. The microbial production of aconitic acid (9g/L) is achieved in strains expressing this transport protein. Thus, metabolic engineering can be used for both the in vivo characterization of transport protein function like MttA and to make use of this protein by creating aconitic acid producing strains. PMID:26875555

  9. To gate, or not to gate: regulatory mechanisms for intercellular protein transport and virus movement in plants.

    PubMed

    Ueki, Shoko; Citovsky, Vitaly

    2011-09-01

    Cell-to-cell signal transduction is vital for orchestrating the whole-body physiology of multi-cellular organisms, and many endogenous macromolecules, proteins, and nucleic acids function as such transported signals. In plants, many of these molecules are transported through plasmodesmata (Pd), the cell wall-spanning channel structures that interconnect plant cells. Furthermore, Pd also act as conduits for cell-to-cell movement of most plant viruses that have evolved to pirate these channels to spread the infection. Pd transport is presumed to be highly selective, and only a limited repertoire of molecules is transported through these channels. Recent studies have begun to unravel mechanisms that actively regulate the opening of the Pd channel to allow traffic. This macromolecular transport between cells comprises two consecutive steps: intracellular targeting to Pd and translocation through the channel to the adjacent cell. Here, we review the current knowledge of molecular species that are transported though Pd and the mechanisms that control this traffic. Generally, Pd traffic can occur by passive diffusion through the trans-Pd cytoplasm or through the membrane/lumen of the trans-Pd ER, or by active transport that includes protein-protein interactions. It is this latter mode of Pd transport that is involved in intercellular traffic of most signal molecules and is regulated by distinct and sometimes interdependent mechanisms, which represent the focus of this article. PMID:21746703

  10. Fatty acid transport protein-2 inhibitor Grassofermata/CB5 protects cells against lipid accumulation and toxicity

    SciTech Connect

    Saini, Nipun; Black, Paul N.; Montefusco, David; DiRusso, Concetta C.

    2015-09-25

    The inhibition of the fatty acid uptake into non-adipose tissues provides an attractive target for prevention of lipotoxicity leading to obesity-associated non-alcoholic fatty liver disease and type 2 diabetes. Fatty acid transport proteins (FATPs) are bifunctional proteins involved in the uptake and activation of fatty acids by esterification with coenzyme A. Here we characterize Grassofermata/CB5, previously identified as a fatty acid uptake inhibitor directed against HsFATP2. The compound was effective in inhibiting the uptake of fatty acids in the low micro-molar range (IC{sub 50} 8–11 μM) and prevented palmitate-mediated lipid accumulation and cell death in cell lines that are models for intestines, liver, muscle and pancreas. In adipocytes, uptake inhibition was less effective (IC{sub 50} 58 μM). Inhibition was specific for long chain fatty acids and was ineffective toward medium chain fatty acids, which are transported by diffusion. Kinetic analysis of Grassofermata-dependent FA transport inhibition verified a non-competitive mechanism. By comparison with Grassofermata, several atypical antipsychotic drugs previously implicated as inhibitors of FA uptake were ineffectual. In mice Grassofermata decreased absorption of {sup 13}C-oleate demonstrating its potential as a therapeutic agent. - Highlights: • Grassofermata is a small compound inhibitor of FATP2. • Uptake inhibition is specific for long chain fatty acids. • Uptake kinetics shows low specificity for adipocytes compared to other cell types. • Inhibition is by a non-competitive mechanism. • Atypical antipsychotics do not inhibit FA uptake by comparison with Grassofermata.

  11. Fishy Business: Effect of Omega-3 Fatty Acids on Zinc Transporters and Free Zinc Availability in Human Neuronal Cells

    PubMed Central

    De Mel, Damitha; Suphioglu, Cenk

    2014-01-01

    Omega-3 (ω-3) fatty acids are one of the two main families of long chain polyunsaturated fatty acids (PUFA). The main omega-3 fatty acids in the mammalian body are α-linolenic acid (ALA), docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA). Central nervous tissues of vertebrates are characterized by a high concentration of omega-3 fatty acids. Moreover, in the human brain, DHA is considered as the main structural omega-3 fatty acid, which comprises about 40% of the PUFAs in total. DHA deficiency may be the cause of many disorders such as depression, inability to concentrate, excessive mood swings, anxiety, cardiovascular disease, type 2 diabetes, dry skin and so on. On the other hand, zinc is the most abundant trace metal in the human brain. There are many scientific studies linking zinc, especially excess amounts of free zinc, to cellular death. Neurodegenerative diseases, such as Alzheimer’s disease, are characterized by altered zinc metabolism. Both animal model studies and human cell culture studies have shown a possible link between omega-3 fatty acids, zinc transporter levels and free zinc availability at cellular levels. Many other studies have also suggested a possible omega-3 and zinc effect on neurodegeneration and cellular death. Therefore, in this review, we will examine the effect of omega-3 fatty acids on zinc transporters and the importance of free zinc for human neuronal cells. Moreover, we will evaluate the collective understanding of mechanism(s) for the interaction of these elements in neuronal research and their significance for the diagnosis and treatment of neurodegeneration. PMID:25195602

  12. Fishy business: effect of omega-3 fatty acids on zinc transporters and free zinc availability in human neuronal cells.

    PubMed

    De Mel, Damitha; Suphioglu, Cenk

    2014-08-01

    Omega-3 (ω-3) fatty acids are one of the two main families of long chain polyunsaturated fatty acids (PUFA). The main omega-3 fatty acids in the mammalian body are α-linolenic acid (ALA), docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA). Central nervous tissues of vertebrates are characterized by a high concentration of omega-3 fatty acids. Moreover, in the human brain, DHA is considered as the main structural omega-3 fatty acid, which comprises about 40% of the PUFAs in total. DHA deficiency may be the cause of many disorders such as depression, inability to concentrate, excessive mood swings, anxiety, cardiovascular disease, type 2 diabetes, dry skin and so on. On the other hand, zinc is the most abundant trace metal in the human brain. There are many scientific studies linking zinc, especially excess amounts of free zinc, to cellular death. Neurodegenerative diseases, such as Alzheimer's disease, are characterized by altered zinc metabolism. Both animal model studies and human cell culture studies have shown a possible link between omega-3 fatty acids, zinc transporter levels and free zinc availability at cellular levels. Many other studies have also suggested a possible omega-3 and zinc effect on neurodegeneration and cellular death. Therefore, in this review, we will examine the effect of omega-3 fatty acids on zinc transporters and the importance of free zinc for human neuronal cells. Moreover, we will evaluate the collective understanding of mechanism(s) for the interaction of these elements in neuronal research and their significance for the diagnosis and treatment of neurodegeneration. PMID:25195602

  13. Skeletal muscle amino acid transporter expression is increased in young and older adults following resistance exercise

    PubMed Central

    Fry, Christopher S.; Glynn, Erin L.; Timmerman, Kyle L.; Dickinson, Jared M.; Walker, Dillon K.; Gundermann, David M.; Volpi, Elena; Rasmussen, Blake B.

    2011-01-01

    Amino acid transporters and mammalian target of rapamycin complex 1 (mTORC1) signaling are important contributors to muscle protein anabolism. Aging is associated with reduced mTORC1 signaling following resistance exercise, but the role of amino acid transporters is unknown. Young (n = 13; 28 ± 2 yr) and older (n = 13; 68 ± 2 yr) subjects performed a bout of resistance exercise. Skeletal muscle biopsies (vastus lateralis) were obtained at basal and 3, 6, and 24 h postexercise and were analyzed for amino acid transporter mRNA and protein expression and regulators of amino acid transporter transcription utilizing real-time PCR and Western blotting. We found that basal amino acid transporter expression was similar in young and older adults (P > 0.05). Exercise increased L-type amino acid transporter 1/solute-linked carrier (SLC) 7A5, CD98/SLC3A2, sodium-coupled neutral amino acid transporter 2/SLC38A2, proton-assisted amino acid transporter 1/SLC36A1, and cationic amino acid transporter 1/SLC7A1 mRNA expression in both young and older adults (P < 0.05). L-type amino acid transporter 1 and CD98 protein increased only in younger adults (P < 0.05). eukaryotic initiation factor 2 α-subunit (S52) increased similarly in young and older adults postexercise (P < 0.05). Ribosomal protein S6 (S240/244) and activating transcription factor 4 nuclear protein expression tended to be higher in the young, while nuclear signal transducer and activator of transcription 3 (STAT3) (Y705) was higher in the older subjects postexercise (P < 0.05). These results suggest that the rapid upregulation of amino acid transporter expression following resistance exercise may be regulated differently between the age groups, but involves a combination of mTORC1, activating transcription factor 4, eukaryotic initiation factor 2 α-subunit, and STAT3. We propose an increase in amino acid transporter expression may contribute to enhanced amino acid sensitivity following exercise in young and older

  14. Epoxyeicosatrienoic Acids Affect Electrolyte Transport in Renal Tubular Epithelial Cells: Dependence on Cyclooxygenase and Cell Polarity

    PubMed Central

    Nüsing, Rolf M.; Schweer, Horst; Fleming, Ingrid; Zeldin, Darryl C.; Wegmann, Markus

    2007-01-01

    We investigated the effects of epoxyeicosatrienoic acids (EETs) on ion transport in the polarized renal distal tubular cell line, MDCK C7. Of the four EET regioisomers (5,6-EET, 8,9-EET, 11,12-EET, and 14,15-EET) studied, only apical, but not basolateral, application of 5,6-EET increased short circuit current (Isc) with kinetics similar to those of arachidonic acid. The ion transport was blocked by preincubation with the cyclooxygenase inhibitor indomethacin or with the chloride channel blocker NPPB. Further, both a Cl−-free bath solution and the Ca2+ antagonist verapamil blocked 5,6-EET-induced ion transport. Although the presence of the PGE2 receptors EP2, EP3, and EP4 was demonstrated, apically added PGE2 was ineffective and basolaterally added PGE2 caused a different kinetics in ion transport compared to 5,6-EET. Moreover, PGE2 sythesis in MDCK C7 cells was unaffected by 5,6-EET treatment. GC/MS/MS analysis of cell supernatants revealed the presence of the biologically inactive 5,6-dihydroxy-PGE1 in 5,6-EET-treated cells, but not in control cells. Indomethacin suppressed the formation of 5,6-dihydroxy-PGE1. 5,6-epoxy-PGE1 the precursor of 5,6-dihydroxy-PGE1, caused a similar ion transport as 5,6-EET. Cytochrome P450 enzymes homolog to human CYP2C8, CYP2C9, and CYP2J2 protein were detected immunologically in the MDCK C7 cells. Our findings suggest that 5,6-EET affects Cl-transport in renal distal tubular cells independent of PGE2 but by a mechanism, dependent on its conversion to 5,6-epoxy-PGE1 by cyclooxygenase. We suggest a role for this P450 epoxygenase product in the regulation of electrolyte transport, especially as a saluretic compound acting from the luminal side of tubular cells in the mammalian kidney. PMID:17494091

  15. Epoxyeicosatrienoic acids affect electrolyte transport in renal tubular epithelial cells: dependence on cyclooxygenase and cell polarity.

    PubMed

    Nüsing, Rolf M; Schweer, Horst; Fleming, Ingrid; Zeldin, Darryl C; Wegmann, Markus

    2007-07-01

    We investigated the effects of epoxyeicosatrienoic acids (EETs) on ion transport in the polarized renal distal tubular cell line, Madin-Darby canine kidney (MDCK) C7. Of the four EET regioisomers (5,6-EET, 8,9-EET, 11,12-EET, and 14,15-EET) studied, only apical, but not basolateral, application of 5,6-EET increased short-circuit current (I(sc)) with kinetics similar to those of arachidonic acid. The ion transport was blocked by preincubation with the cyclooxygenase inhibitor indomethacin or with the chloride channel blocker NPPB. Furthermore, both a Cl(-)-free bath solution and the Ca(2+) antagonist verapamil blocked 5,6-EET-induced ion transport. Although the presence of the PGE(2) receptors EP2, EP3, and EP4 was demonstrated, apically added PGE(2) was ineffective and basolaterally added PGE(2) caused a different kinetics in ion transport compared with 5,6-EET. Moreover, PGE(2) synthesis in MDCK C7 cells was unaffected by 5,6-EET treatment. GC/MS/MS analysis of cell supernatants revealed the presence of the biologically inactive 5,6-dihydroxy-PGE(1) in 5,6-EET-treated cells, but not in control cells. Indomethacin suppressed the formation of 5,6-dihydroxy-PGE(1). 5,6-Epoxy-PGE(1), the precursor of 5,6-dihydroxy-PGE(1), caused a similar ion transport as 5,6-EET. Cytochrome P-450 enzymes homolog to human CYP2C8, CYP2C9, and CYP2J2 protein were detected immunologically in the MDCK C7 cells. Our findings suggest that 5,6-EET affects Cl(-) transport in renal distal tubular cells independent of PGE(2) but by a mechanism, dependent on its conversion to 5,6-epoxy-PGE(1) by cyclooxygenase. We suggest a role for this P450 epoxygenase product in the regulation of electrolyte transport, especially as a saluretic compound acting from the luminal side of tubular cells in the mammalian kidney. PMID:17494091

  16. Transporter-targeted cholic acid-cytarabine conjugates for improved oral absorption.

    PubMed

    Zhang, Dong; Li, Dongpo; Shang, Lei; He, Zhonggui; Sun, Jin

    2016-09-10

    Cytarabine has a poor oral absorption due to its rapid deamination and poor membrane permeability. Bile acid transporters are highly expressed both in enterocytes and hepatocytes and to increase the oral bioavailability and investigate the potential application of cytarabine for liver cancers, a transporter- recognizing prodrug strategy was applied to design and synthesize four conjugates of cytarabine with cholic acid (CA), chenodeoxycholic acid (CDCA), hyodeoxycholic acid (HDCA) and ursodeoxycholic acid (UDCA). The anticancer activities against HepG2 cells were evaluated by MTT assay and the role of bile acid transporters during cellular transport was investigated in a competitive inhibition experiment. The in vitro and in vivo metabolic stabilities of these conjugates were studied in rat plasma and liver homogenates. Finally, an oral bioavailability study was conducted in rats. All the cholic acid-cytarabine conjugates (40μM) showed potent antiproliferative activities (up to 70%) against HepG2 cells after incubation for 48h. The addition of bile acids could markedly reduce the antitumor activities of these conjugates. The N(4)-ursodeoxycholic acid conjugate of cytarabine (compound 5) exhibited optimal stability (t1/2=90min) in vitro and a 3.9-fold prolonged half-life of cytarabine in vivo. More importantly, compound 5 increased the oral bioavailability 2-fold compared with cytarabine. The results of the present study suggest that the prodrug strategy based on the bile acid transporters is suitable for improving the oral absorption and the clinical application of cytarabine. PMID:27377011

  17. Identification and characterization of an amino acid transporter expressed differentially in liver

    PubMed Central

    Gu, Sumin; Roderick, Hywel Llewelyn; Camacho, Patricia; Jiang, Jean X.

    2000-01-01

    Cellular metabolic needs are fulfilled by transport of amino acids across the plasma membrane by means of specialized transporter proteins. Although many of the classical amino acid transporters have been characterized functionally, less than half of these proteins have been cloned. In this report, we identify and characterize a cDNA encoding a plasma membrane amino acid transporter. The deduced amino acid sequence is 505 residues and is highly hydrophobic with the likely predicted structure of 9 transmembrane domains, which putatively place the amino terminus in the cytoplasm and the carboxy terminus on the cell surface. Expression of the cRNA in Xenopus laevis oocytes revealed strong transport activities specific for histidine and glutamine. This protein is a Na+- and pH-dependent transporter and tolerates substitution of Na+ by Li+. Furthermore, this transporter is not an obligatory exchanger because efflux occurs in the absence of influx. This transporter is expressed predominantly in the liver, although it is also present in the kidney, brain, and heart. In the liver, it is located in the plasma membrane of hepatocytes, and the strongest expression was detected in those adjacent to the central vein, gradually decreasing towards the portal tract. Because this protein displays functional similarities to the N-system amino acid transport, we have termed it mNAT, for murine N-system amino acid transporter. This is the first transporter gene identified within the N-system, one of the major amino acid transport systems in the body. The expression pattern displayed by mNAT suggests a potential role in hepatocyte physiology. PMID:10716701

  18. Placental amino acid transport may be regulated by maternal vitamin D and vitamin D-binding protein: results from the Southampton Women's Survey.

    PubMed

    Cleal, J K; Day, P E; Simner, C L; Barton, S J; Mahon, P A; Inskip, H M; Godfrey, K M; Hanson, M A; Cooper, C; Lewis, R M; Harvey, N C

    2015-06-28

    Both maternal 25-hydroxyvitamin D (25(OH)D) concentrations during pregnancy and placental amino acid transporter gene expression have been associated with development of the offspring in terms of body composition and bone structure. Several amino acid transporter genes have vitamin D response elements in their promoters suggesting the possible linkage of these two mechanisms. We aimed to establish whether maternal 25(OH)D and vitamin D-binding protein (VDBP) levels relate to expression of placental amino acid transporters. RNA was extracted from 102 placental samples collected in the Southampton Women's Survey, and gene expression was analysed using quantitative real-time PCR. Gene expression data were normalised to the geometric mean of three housekeeping genes, and related to maternal factors and childhood body composition. Maternal serum 25(OH)D and VDBP levels were measured by radioimmunoassay. Maternal 25(OH)D and VDBP levels were positively associated with placental expression of specific genes involved in amino acid transport. Maternal 25(OH)D and VDBP concentrations were correlated with the expression of specific placental amino acid transporters, and thus may be involved in the regulation of amino acid transfer to the fetus. The positive correlation of VDBP levels and placental transporter expression suggests that delivery of vitamin D to the placenta may be important. This exploratory study identifies placental amino acid transporters which may be altered in response to modifiable maternal factors and provides a basis for further studies. PMID:25940599

  19. Modeling uranium transport in acidic contaminated groundwater with base addition

    SciTech Connect

    Zhang, Fan; Luo, Wensui; Parker, Jack C.; Brooks, Scott C; Watson, David B; Jardine, Philip; Gu, Baohua

    2011-01-01

    This study investigates reactive transport modeling in a column of uranium(VI)-contaminated sediments with base additions in the circulating influent. The groundwater and sediment exhibit oxic conditions with low pH, high concentrations of NO{sub 3}{sup -}, SO{sub 4}{sup 2-}, U and various metal cations. Preliminary batch experiments indicate that additions of strong base induce rapid immobilization of U for this material. In the column experiment that is the focus of the present study, effluent groundwater was titrated with NaOH solution in an inflow reservoir before reinjection to gradually increase the solution pH in the column. An equilibrium hydrolysis, precipitation and ion exchange reaction model developed through simulation of the preliminary batch titration experiments predicted faster reduction of aqueous Al than observed in the column experiment. The model was therefore modified to consider reaction kinetics for the precipitation and dissolution processes which are the major mechanism for Al immobilization. The combined kinetic and equilibrium reaction model adequately described variations in pH, aqueous concentrations of metal cations (Al, Ca, Mg, Sr, Mn, Ni, Co), sulfate and U(VI). The experimental and modeling results indicate that U(VI) can be effectively sequestered with controlled base addition due to sorption by slowly precipitated Al with pH-dependent surface charge. The model may prove useful to predict field-scale U(VI) sequestration and remediation effectiveness.

  20. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.

    PubMed

    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D

    2014-10-01

    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective. PMID:25055961

  1. Regulation of amino acid transporter trafficking by mTORC1 in primary human trophoblast cells is mediated by the ubiquitin ligase Nedd4-2.

    PubMed

    Rosario, Fredrick J; Dimasuay, Kris Genelyn; Kanai, Yoshikatsu; Powell, Theresa L; Jansson, Thomas

    2016-04-01

    Changes in placental amino acid transfer directly contribute to altered fetal growth, which increases the risk for perinatal complications and predisposes for the development of obesity, diabetes and cardiovascular disease later in life. Placental amino acid transfer is critically dependent on the expression of specific transporters in the plasma membrane of the trophoblast, the transporting epithelium of the human placenta. However, the molecular mechanisms regulating this process are largely unknown. Nedd4-2 is an ubiquitin ligase that catalyses the ubiquitination of proteins, resulting in proteasomal degradation. We hypothesized that inhibition of mechanistic target of rapamycin complex 1 (mTORC1) decreases amino acid uptake in primary human trophoblast (PHT) cells by activation of Nedd4-2, which increases transporter ubiquitination resulting in decreased transporter expression in the plasma membrane. mTORC 1 inhibition increased the expression of Nedd4-2, promoted ubiquitination and decreased the plasma membrane expression of SNAT2 (an isoform of the System A amino acid transporter) and LAT1 (a System L amino acid transporter isoform), resulting in decreased cellular amino acid uptake. Nedd4-2 silencing markedly increased the trafficking of SNAT2 and LAT1 to the plasma membrane, which stimulated cellular amino acid uptake. mTORC1 inhibition by silencing of raptor failed to decrease amino acid transport following Nedd4-2 silencing. In conclusion, we have identified a novel link between mTORC1 signalling and ubiquitination, a common posttranslational modification. Because placental mTORC1 is inhibited in fetal growth restriction and activated in fetal overgrowth, we propose that regulation of placental amino acid transporter ubiquitination by mTORC1 and Nedd4-2 constitutes a molecular mechanisms underlying abnormal fetal growth. PMID:26608079

  2. Mechanisms of acid reflux associated with cigarette smoking.

    PubMed Central

    Kahrilas, P J; Gupta, R R

    1990-01-01

    Studies were done to evaluate the lower oesophageal sphincter function of chronic smokers compared with non-smokers and to ascertain the acute effects of smoking on the sphincter and the occurrence of acid reflux. All subjects (non-smokers, asymptomatic cigarette smokers, and smokers with oesophagitis) were studied postprandially with a lower oesophageal sphincter sleeve assembly, distal oesophageal pH electrode, and submental electromyographic electrodes. The two groups of cigarette smokers then smoked three cigarettes in succession before being recorded for an additional hour. As a group, the cigarette smokers had significantly lower lower oesophageal sphincter pressure compared with non-smokers but the sphincter was not further compromised by acutely smoking cigarettes. Cigarette smoking did, however, acutely increase the rate at which acid reflux events occurred. The mechanisms of acid reflux during cigarette smoking were mainly dependent upon the coexistence of diminished lower oesophageal sphincter pressure. Fewer than half of reflux events occurred by transient lower oesophageal sphincter relaxations. The majority of acid reflux occurred with coughing or deep inspiration during which abrupt increases in intra-abdominal pressure overpowered a feeble sphincter. We conclude that cigarette smoking probably exacerbates reflux disease by directly provoking acid reflux and perhaps by a long lasting reduction of lower oesophageal sphincter pressure. PMID:2318431

  3. Mechanism of antiinflammatory actions of curcumine and boswellic acids.

    PubMed

    Ammon, H P; Safayhi, H; Mack, T; Sabieraj, J

    1993-03-01

    Curcumine from Curcuma longa and the gum resin of Boswellia serrata, which were demonstrated to act as anti-inflammatories in in vivo animal models, were studied in a set of in vitro experiments in order to elucidate the mechanism of their beneficial effects. Curcumine inhibited the 5-lipoxygenase activity in rat peritoneal neutrophils as well as the 12-lipoxygenase and the cyclooxygenase activities in human platelets. In a cell free peroxidation system curcumine exerted strong antioxidative activity. Thus, its effects on the dioxygenases are probably due to its reducing capacity. Boswellic acids were isolated from the gum resin of Boswellia serrata and identified as the active principles. Boswellic acids inhibited the leukotriene synthesis via 5-lipoxygenase, but did not affect the 12-lipoxygenase and the cyclooxygenase activities. Additionally, boswellic acids did not impair the peroxidation of arachidonic acid by iron and ascorbate. The data suggest that boswellic acids are specific, non-redox inhibitors of leukotriene synthesis either interacting directly with 5-lipoxygenase or blocking its translocation. PMID:8510458

  4. Mechanisms for stimulation of rat anterior pituitary cells by arginine and other amino acids.

    PubMed Central

    Villalobos, C; Núñez, L; García-Sancho, J

    1997-01-01

    1. Arginine and other amino acids are secretagogues for growth hormone and prolactin in the intact animal, but the mechanism of action is unclear. We have studied the effects of amino acids on cytosolic free calcium concentration ([Ca2+]i) in single rat anterior pituitary (AP) cells. Arginine elicited a large increase of [Ca2+]i) in about 40% of all the AP cells, suggesting that amino acids may modulate hormone secretion by acting directly on the pituitary. 2. Cell typing by immunofluorescence of the hormone the cells store showed that the arginine-sensitive cells are distributed uniformly within all the five AP cell types. The arginine-sensitive cells overlapped closely with the subpopulation of cells sensitive to thyrotrophin-releasing hormone. 3. Other cationic as well as several neutral (dipolar) amino acids had the same effect as arginine. The increase of [Ca2+]i was dependent on extracellular Ca2+ and blocked by dihydropyridine, suggesting that it is due to Ca2+ influx through L-type voltage-gated Ca2+ channels. The [Ca2+]i increase was also blocked by removal of extracellular Na+ but not by tetrodotoxin. The substrate specificity for stimulation of AP cells resembled closely that of the amino acid transport system B0+. We propose that electrogenic amino acid influx through this pathway depolarizes the plasma membrane with the subsequent activation of voltage-gated Ca2+ channels and Ca2+ entry. 4. Amino acids also stimulated prolactin secretion in vitro with a similar substrate specificity to that found for the [Ca2+]i increase. Existing data on the stimulation of secretion of other hormones by amino acids suggest that a similar mechanism could apply to other endocrine glands. PMID:9263921

  5. Mechanism of transport and distribution of organic solvents in blood

    NASA Technical Reports Server (NTRS)

    Lam, C. W.; Galen, T. J.; Boyd, J. F.; Pierson, D. L.

    1990-01-01

    Little is known about the mechanism of transport and distribution of volatile organic compounds in blood. Studies were conducted on five typical organic solvents to investigate how these compounds are transported and distributed in blood. Groups of four to five rats were exposed for 2 hr to 500 ppm of n-hexane, toluene, chloroform, methyl isobutyl ketone (MIBK), or diethyl ether vapor; 94, 66, 90, 51, or 49%, respectively, of these solvents in the blood were found in the red blood cells (RBCs). Very similar results were obtained in vitro when aqueous solutions of these solvents were added to rat blood. In vitro studies were also conducted on human blood with these solvents; 66, 43, 65, 49, or 46%, respectively, of the added solvent was taken up by the RBCs. These results indicate that RBCs from humans and rats exhibited substantial differences in affinity for the three more hydrophobic solvents studied. When solutions of these solvents were added to human plasma and RBC samples, large fractions (51-96%) of the solvents were recovered from ammonium sulfate-precipitated plasma proteins and hemoglobin. Smaller fractions were recovered from plasma water and red cell water. Less than 10% of each of the added solvents in RBC samples was found in the red cell membrane ghosts. These results indicate that RBCs play an important role in the uptake and transport of these solvents. Proteins, chiefly hemoglobin, are the major carriers of these compounds in blood. It can be inferred from the results of the present study that volatile lipophilic organic solvents are probably taken up by the hydrophobic sites of blood proteins.

  6. The putative Cationic Amino Acid Transporter 9 is targeted to vesicles and may be involved in plant amino acid homeostasis

    PubMed Central

    Yang, Huaiyu; Stierhof, York-Dieter; Ludewig, Uwe

    2015-01-01

    Amino acids are major primary metabolites. Their uptake, translocation, compartmentation, and re-mobilization require a diverse set of cellular transporters. Here, the broadly expressed gene product of CATIONIC AMINO ACID TRANSPORTER 9 (CAT9) was identified as mainly localized to vesicular membranes that are involved in vacuolar trafficking, including those of the trans-Golgi network. In order to probe whether and how these compartments are involved in amino acid homeostasis, a loss-of-function cat9-1 mutant and ectopic over-expressor plants were isolated. Under restricted nitrogen supply in soil, cat9-1 showed a chlorotic phenotype, which was reversed in the over-expressors. The total soluble amino acid pools were affected in the mutants, but this was only significant under poor nitrogen supply. Upon nitrogen starvation, the soluble amino acid leaf pools were lower in the over-expressor, compared with cat9-1. Over-expression generally affected total soluble amino acid concentrations, slightly delayed development, and finally improved the survival upon severe nitrogen starvation. The results potentially identify a novel function of vesicular amino acid transport mediated by CAT9 in the cellular nitrogen-dependent amino acid homeostasis. PMID:25883600

  7. The putative Cationic Amino Acid Transporter 9 is targeted to vesicles and may be involved in plant amino acid homeostasis.

    PubMed

    Yang, Huaiyu; Stierhof, York-Dieter; Ludewig, Uwe

    2015-01-01

    Amino acids are major primary metabolites. Their uptake, translocation, compartmentation, and re-mobilization require a diverse set of cellular transporters. Here, the broadly expressed gene product of CATIONIC AMINO ACID TRANSPORTER 9 (CAT9) was identified as mainly localized to vesicular membranes that are involved in vacuolar trafficking, including those of the trans-Golgi network. In order to probe whether and how these compartments are involved in amino acid homeostasis, a loss-of-function cat9-1 mutant and ectopic over-expressor plants were isolated. Under restricted nitrogen supply in soil, cat9-1 showed a chlorotic phenotype, which was reversed in the over-expressors. The total soluble amino acid pools were affected in the mutants, but this was only significant under poor nitrogen supply. Upon nitrogen starvation, the soluble amino acid leaf pools were lower in the over-expressor, compared with cat9-1. Over-expression generally affected total soluble amino acid concentrations, slightly delayed development, and finally improved the survival upon severe nitrogen starvation. The results potentially identify a novel function of vesicular amino acid transport mediated by CAT9 in the cellular nitrogen-dependent amino acid homeostasis. PMID:25883600

  8. Permeability of membranes to amino acids and modified amino acids: mechanisms involved in translocation

    NASA Technical Reports Server (NTRS)

    Chakrabarti, A. C.; Deamer, D. W. (Principal Investigator); Miller, S. L. (Principal Investigator)

    1994-01-01

    The amino acid permeability of membranes is of interest because they are one of the key solutes involved in cell function. Membrane permeability coefficients (P) for amino acid classes, including neutral, polar, hydrophobic, and charged species, have been measured and compared using a variety of techniques. Decreasing lipid chain length increased permeability slightly (5-fold), while variations in pH had only minor effects on the permeability coefficients of the amino acids tested in liposomes. Increasing the membrane surface charge increased the permeability of amino acids of the opposite charge, while increasing the cholesterol content decreased membrane permeability. The permeability coefficients for most amino acids tested were surprisingly similar to those previously measured for monovalent cations such as sodium and potassium (approximately 10(-12)-10(-13) cm s-1). This observation suggests that the permeation rates for the neutral, polar and charged amino acids are controlled by bilayer fluctuations and transient defects, rather than partition coefficients and Born energy barriers. Hydrophobic amino acids were 10(2) more permeable than the hydrophilic forms, reflecting their increased partition coefficient values. External pH had dramatic effects on the permeation rates for the modified amino acid lysine methyl ester in response to transmembrane pH gradients. It was established that lysine methyl ester and other modified short peptides permeate rapidly (P = 10(-2) cm s-1) as neutral (deprotonated) molecules. It was also shown that charge distributions dramatically alter permeation rates for modified di-peptides. These results may relate to the movement of peptides through membranes during protein translocation and to the origin of cellular membrane transport on the early Earth.

  9. Statistical-mechanical theory of passive transport through semipermeable membranes.

    PubMed

    del Castillo, L F; Mason, E A; Revercomb, H E

    1979-09-01

    The first general multicomponent equations for transport through semipermeable membranes are derived from basic statistical-mechanical principles. The procedure follows that used earlier for open membranes, but semipermeability is modelled mathematically by the introduction of external forces on the impermeant species. Gases are treated first in order to clarify the problems involved, but the final results apply to general nonideal solutions of any concentration. The mixed-solvent effect is treated rigorously, and a mixed-solvent osmotic pressure is defined. A useful specific identification of so-called osmotic flow is given, along with a demonstration that such an identification cannot be unique. Results are obtained both for discontinuous membrane models, and for a continuous model. PMID:486702

  10. Mechanisms and scalings of energetic ion transport via tokamak microturbulence

    SciTech Connect

    Hauff, T.; Jenko, F.

    2008-11-15

    The turbulent ExB advection of energetic ions in three-dimensional tokamak geometry is investigated both analytically and numerically. It is shown that orbit averaging (leading to a significant reduction of the diffusivity) is only valid for low magnetic shear. At moderate or high magnetic shear, a rather slow decrease of the diffusivity is found, proportional to (E/T{sub e}){sup -1} or (E/T{sub e}){sup -1.5} for particles with a large or small parallel velocity component, respectively. The decorrelation mechanisms responsible for this behavior are studied and explained in detail. Moreover, it is found that resonances between the toroidal drift of the particles and the diamagnetic drift of the turbulence can lead to an enhancement of the fast ion transport.

  11. Flexible Mechanical Conveyors for Regolith Extraction and Transport

    NASA Technical Reports Server (NTRS)

    Walton, Otis R.; Vollmer, Hubert J.

    2013-01-01

    A report describes flexible mechanical conveying systems for transporting fine cohesive regolith under microgravity and vacuum conditions. They are totally enclosed, virtually dust-free, and can include enough flexibility in the conveying path to enable an expanded range of extraction and transport scenarios, including nonlinear drill-holes and excavation of enlarged subsurface openings without large entry holes. The design of the conveyors is a modification of conventional screw conveyors such that the central screw-shaft and the outer housing or conveyingtube have a degree of bending flexibility, allowing the conveyors to become nonlinear conveying systems that can convey around gentle bends. The central flexible shaft is similar to those used in common tools like a weed whacker, consisting of multiple layers of tightly wound wires around a central wire core. Utilization of compliant components (screw blade or outer wall) increases the robustness of the conveying, allowing an occasional oversized particle to pass hough the conveyor without causing a jam or stoppage

  12. New molecular mechanisms of inter-organelle lipid transport.

    PubMed

    Drin, Guillaume; von Filseck, Joachim Moser; Čopič, Alenka

    2016-04-15

    Lipids are precisely distributed in cell membranes, along with associated proteins defining organelle identity. Because the major cellular lipid factory is the endoplasmic reticulum (ER), a key issue is to understand how various lipids are subsequently delivered to other compartments by vesicular and non-vesicular transport pathways. Efforts are currently made to decipher how lipid transfer proteins (LTPs) work either across long distances or confined to membrane contact sites (MCSs) where two organelles are at close proximity. Recent findings reveal that proteins of the oxysterol-binding protein related-proteins (ORP)/oxysterol-binding homology (Osh) family are not all just sterol transporters/sensors: some can bind either phosphatidylinositol 4-phosphate (PtdIns(4)P) and sterol or PtdIns(4)P and phosphatidylserine (PS), exchange these lipids between membranes, and thereby use phosphoinositide metabolism to create cellular lipid gradients. Lipid exchange is likely a widespread mechanism also utilized by other LTPs to efficiently trade lipids between organelle membranes. Finally, the discovery of more proteins bearing a lipid-binding module (SMP or START-like domain) raises new questions on how lipids are conveyed in cells and how the activities of different LTPs are coordinated. PMID:27068959

  13. Hyporheic flow and transport processes: mechanisms, models, and biogeochemical implications

    USGS Publications Warehouse

    Boano, Fulvio; Harvey, Judson W.; Marion, Andrea; Packman, Aaron I.; Revelli, Roberto; Ridolfi, Luca; Anders, Wörman

    2014-01-01

    Fifty years of hyporheic zone research have shown the important role played by the hyporheic zone as an interface between groundwater and surface waters. However, it is only in the last two decades that what began as an empirical science has become a mechanistic science devoted to modeling studies of the complex fluid dynamical and biogeochemical mechanisms occurring in the hyporheic zone. These efforts have led to the picture of surface-subsurface water interactions as regulators of the form and function of fluvial ecosystems. Rather than being isolated systems, surface water bodies continuously interact with the subsurface. Exploration of hyporheic zone processes has led to a new appreciation of their wide reaching consequences for water quality and stream ecology. Modern research aims toward a unified approach, in which processes occurring in the hyporheic zone are key elements for the appreciation, management, and restoration of the whole river environment. In this unifying context, this review summarizes results from modeling studies and field observations about flow and transport processes in the hyporheic zone and describes the theories proposed in hydrology and fluid dynamics developed to quantitatively model and predict the hyporheic transport of water, heat, and dissolved and suspended compounds from sediment grain scale up to the watershed scale. The implications of these processes for stream biogeochemistry and ecology are also discussed."

  14. Hyporheic flow and transport processes: Mechanisms, models, and biogeochemical implications

    NASA Astrophysics Data System (ADS)

    Boano, F.; Harvey, J. W.; Marion, A.; Packman, A. I.; Revelli, R.; Ridolfi, L.; Wörman, A.

    2014-12-01

    Fifty years of hyporheic zone research have shown the important role played by the hyporheic zone as an interface between groundwater and surface waters. However, it is only in the last two decades that what began as an empirical science has become a mechanistic science devoted to modeling studies of the complex fluid dynamical and biogeochemical mechanisms occurring in the hyporheic zone. These efforts have led to the picture of surface-subsurface water interactions as regulators of the form and function of fluvial ecosystems. Rather than being isolated systems, surface water bodies continuously interact with the subsurface. Exploration of hyporheic zone processes has led to a new appreciation of their wide reaching consequences for water quality and stream ecology. Modern research aims toward a unified approach, in which processes occurring in the hyporheic zone are key elements for the appreciation, management, and restoration of the whole river environment. In this unifying context, this review summarizes results from modeling studies and field observations about flow and transport processes in the hyporheic zone and describes the theories proposed in hydrology and fluid dynamics developed to quantitatively model and predict the hyporheic transport of water, heat, and dissolved and suspended compounds from sediment grain scale up to the watershed scale. The implications of these processes for stream biogeochemistry and ecology are also discussed.

  15. Increased ubiquitination and reduced plasma membrane trafficking of placental amino acid transporter SNAT-2 in human IUGR.

    PubMed

    Chen, Yi-Yung; Rosario, Fredrick J; Shehab, Majida Abu; Powell, Theresa L; Gupta, Madhulika B; Jansson, Thomas

    2015-12-01

    Placental amino acid transport is decreased in intrauterine growth restriction (IUGR); however, the underlying mechanisms remain largely unknown. We have shown that mechanistic target of rapamycin (mTOR) signalling regulates system A amino acid transport by modulating the ubiquitination and plasma membrane trafficking of sodium-coupled neutral amino acid transporter 2 (SNAT-2) in cultured primary human trophoblast cells. We hypothesize that IUGR is associated with (1) inhibition of placental mTORC1 and mTORC2 signalling pathways, (2) increased amino acid transporter ubiquitination in placental homogenates and (3) decreased protein expression of SNAT-2 in the syncytiotrophoblast microvillous plasma membrane (MVM). To test this hypothesis, we collected placental tissue and isolated MVM from women with pregnancies complicated by IUGR (n=25) and gestational age-matched women with appropriately grown control infants (n=19, birth weights between the twenty-fifth to seventy-fifth percentiles). The activity of mTORC1 and mTORC2 was decreased whereas the protein expression of the ubiquitin ligase NEDD4-2 (neural precursor cell expressed developmentally down-regulated protein 4-2; +72%, P<0.0001) and the ubiquitination of SNAT-2 (+180%, P<0.05) were increased in homogenates of IUGR placentas. Furthermore, IUGR was associated with decreased system A amino acid transport activity (-72%, P<0.0001) and SNAT-1 (-42%, P<0.05) and SNAT-2 (-31%, P<0.05) protein expression in MVM. In summary, these findings are consistent with the possibility that decreased placental mTOR activity causes down-regulation of placental system A activity by shifting SNAT-2 trafficking towards proteasomal degradation, thereby contributing to decreased fetal amino acid availability and restricted fetal growth in IUGR. PMID:26374858

  16. Auxin Transport in Zea mays Coleoptiles II. Influence of Light on the Transport of Indoleacetic Acid-2-C.

    PubMed

    Naqvi, S M; Gordon, S A

    1967-01-01

    The effect of bilateral irradiation with white light (1000 Meter Candle Sec) on the basipetal transport of auxin has been investigated. Illumination of either the intact shoot or the excised coleoptile tip of the Zea seedling, decreased the amount of diffusible auxin obtained from the tip, and decreased Avena curvature response to unilaterally applied indoleacetic acid. Irradiation of the intact Zea seedling did not affect the absorption of (14)C-labeled indoleacetic acid from an agar block subsequently placed on the decapitated coleoptile. However, light caused a significant decrease in the amount of labeled auxin basipetally transported, without affecting materially the velocity of that transport. These and other observations are interpreted as support for the hypothesis that the primary hormonal phenomenon in first-positive phototropism is a light-induced impairment in the basipetal transport of auxin. PMID:16656477

  17. Amino acid absorption and homeostasis in mice lacking the intestinal peptide transporter PEPT1.

    PubMed

    Nässl, Anna-Maria; Rubio-Aliaga, Isabel; Fenselau, Henning; Marth, Mena Katharina; Kottra, Gabor; Daniel, Hannelore

    2011-07-01

    The intestinal peptide transporter PEPT1 mediates the uptake of di- and tripeptides derived from dietary protein breakdown into epithelial cells. Whereas the transporter appears to be essential to compensate for the reduced amino acid delivery in patients with mutations in amino acid transporter genes, such as in cystinuria or Hartnup disease, its physiological role in overall amino acid absorption is still not known. To assess the quantitative importance of PEPT1 in overall amino acid absorption and metabolism, PEPT1-deficient mice were studied by using brush border membrane vesicles, everted gut sacs, and Ussing chambers, as well as by transcriptome and proteome analysis of intestinal tissue samples. Neither gene expression nor proteome profiling nor functional analysis revealed evidence for any compensatory changes in the levels and/or function of transporters for free amino acids in the intestine. However, most plasma amino acid levels were increased in Pept1(-/-) compared with Pept1(+/+) animals, suggesting that amino acid handling is altered. Plasma appearance rates of (15)N-labeled amino acids determined after intragastric administration of a low dose of protein remained unchanged, whereas administration of a large protein load via gavage revealed marked differences in plasma appearance of selected amino acids. PEPT1 seems, therefore, important for overall amino acid absorption only after high dietary protein intake when amino acid transport processes are saturated and PEPT1 can provide additional absorption capacity. Since renal amino acid excretion remained unchanged, elevated basal concentrations of plasma amino acids in PEPT1-deficient animals seem to arise mainly from alterations in hepatic amino acid metabolism. PMID:21350187

  18. Theoretical study of the reaction mechanism of phenolic acid decarboxylase.

    PubMed

    Sheng, Xiang; Lind, Maria E S; Himo, Fahmi

    2015-12-01

    The cofactor-free phenolic acid decarboxylases (PADs) catalyze the non-oxidative decarboxylation of phenolic acids to their corresponding p-vinyl derivatives. Phenolic acids are toxic to some organisms, and a number of them have evolved the ability to transform these compounds, including PAD-catalyzed reactions. Since the vinyl derivative products can be used as polymer precursors and are also of interest in the food-processing industry, PADs might have potential applications as biocatalysts. We have investigated the detailed reaction mechanism of PAD from Bacillus subtilis using quantum chemical methodology. A number of different mechanistic scenarios have been considered and evaluated on the basis of their energy profiles. The calculations support a mechanism in which a quinone methide intermediate is formed by protonation of the substrate double bond, followed by C-C bond cleavage. A different substrate orientation in the active site is suggested compared to the literature proposal. This suggestion is analogous to other enzymes with p-hydroxylated aromatic compounds as substrates, such as hydroxycinnamoyl-CoA hydratase-lyase and vanillyl alcohol oxidase. Furthermore, on the basis of the calculations, a different active site residue compared to previous proposals is suggested to act as the general acid in the reaction. The mechanism put forward here is consistent with the available mutagenesis experiments and the calculated energy barrier is in agreement with measured rate constants. The detailed mechanistic understanding developed here might be extended to other members of the family of PAD-type enzymes. It could also be useful to rationalize the recently developed alternative promiscuous reactivities of these enzymes. PMID:26408050

  19. Seasonal upregulation of catabolic enzymes and fatty acid transporters in the flight muscle of migrating hoary bats, Lasiurus cinereus.

    PubMed

    McGuire, Liam P; Fenton, M Brock; Guglielmo, Christopher G

    2013-06-01

    The high energy density of fat, and limited capacity for carbohydrate storage suggest that migrating bats should fuel endurance flights with fat, as observed in migrating birds. Yet, cursorial mammals are unable to support high intensity exercise with fat stores. We hypothesized that migratory bats and birds have converged on similar physiological mechanisms to fuel endurance flight with fat. We predicted bats would seasonally upregulate fatty acid transport and oxidation pathways when migration demands were high. We studied seasonal variation in mitochondrial oxidative enzyme activities and fatty acid transport protein expression in the flight muscle of hoary bats (Lasiurus cinereus). Carnitine palmitoyl transferase, 3-hydroxyacyl-CoA dehydrogenase and citrate synthase activity increased during migration. There were no changes in expression of fatty acid translocase or plasma membrane fatty acid binding protein. Heart-type fatty acid binding protein expression increased 5-fold in migrating females, but did not vary seasonally in males. An aerial insectivore lifestyle, and the coincidence of migration and pregnancy may explain differences in transporter expression compared to previously studied birds. Overall, our results are consistent with seasonal upregulation of lipid metabolism and aerobic capacity, and confirm that migration poses distinct physiological challenges for bats. PMID:23545469

  20. CLUB FORMATION MECHANISM FOR TRANSPORT-COMMUNITY CREDIT CARDS

    NASA Astrophysics Data System (ADS)

    Ding, Yue; Kobayashi, Kiyoshi; Nishida, Junji; Yoshida, Mamoru

    In this paper, the roles of transport-community cards jointly issued by a public transport firm and retails are investigated as a means to vitalize an obsolescence shopping center located in a middle of a city. When both the price of goods supplied by the retails and the transport fares affect the consumers' behavior, there exist pecuniary externality between the behaviors of the retails and transport firms. The introduction of a transport-community cards system enables to integrate a basket of goods and transport service into a single commodity; thus, the pecuniary externality can be internalized by price coordination. In addition, the paper clarifies theoretically that the transport firm initiatively decides the price of the transportation service and the retails transfer their incomes to the transport firm so that they are induced to jointly issue the transport-community cards.

  1. Decoupling Mechanical and Ion Transport Properties in Polymer Electrolyte Membranes

    NASA Astrophysics Data System (ADS)

    McIntosh, Lucas D.

    Polymer electrolytes are mixtures of a polar polymer and salt, in which the polymer replaces small molecule solvents and provides a dielectric medium so that ions can dissociate and migrate under the influence of an external electric field. Beginning in the 1970s, research in polymer electrolytes has been primarily motivated by their promise to advance electrochemical energy storage and conversion devices, such as lithium ion batteries, flexible organic solar cells, and anhydrous fuel cells. In particular, polymer electrolyte membranes (PEMs) can improve both safety and energy density by eliminating small molecule, volatile solvents and enabling an all-solid-state design of electrochemical cells. The outstanding challenge in the field of polymer electrolytes is to maximize ionic conductivity while simultaneously addressing orthogonal mechanical properties, such as modulus, fracture toughness, or high temperature creep resistance. The crux of the challenge is that flexible, polar polymers best-suited for polymer electrolytes (e.g., poly(ethylene oxide)) offer little in the way of mechanical robustness. Similarly, polymers typically associated with superior mechanical performance (e.g., poly(methyl methacrylate)) slow ion transport due to their glassy polymer matrix. The design strategy is therefore to employ structured electrolytes that exhibit distinct conducting and mechanically robust phases on length scales of tens of nanometers. This thesis reports a remarkably simple, yet versatile synthetic strategy---termed polymerization-induced phase separation, or PIPS---to prepare PEMs exhibiting an unprecedented combination of both high conductivity and high modulus. This performance is enabled by co-continuous, isotropic networks of poly(ethylene oxide)/ionic liquid and highly crosslinked polystyrene. A suite of in situ, time-resolved experiments were performed to investigate the mechanism by which this network morphology forms, and it appears to be tied to the

  2. [Anaerobic reduction of humus/Fe (III) and electron transport mechanism of Fontibacter sp. SgZ-2].

    PubMed

    Ma, Chen; Yang, Gui-qin; Lu, Qin; Zhou, Shun-gui

    2014-09-01

    Humus and Fe(III) respiration are important extracellular respiration metabolism. Electron transport pathway is the key issue of extracellular respiration. To understand the electron transport properties and the environmental behavior of a novel Fe(III)- reducing bacterium, Fontibacter sp. SgZ-2, capacities of anaerobic humus/Fe(III) reduction and electron transport mechanisms with four electron acceptors were investigated in this study. The results of anaerobic batch experiments indicated that strain SgZ-2 had the ability to reduce humus analog [ 9,10-anthraquinone-2,6-disulfonic acid (AQDS) and 9,10-anthraquinone-2-sulfonic acid (AQS)], humic acids (HA), soluble Fe(III) (Fe-EDTA and Fe-citrate) and Fe(III) oxides [hydrous ferric oxide (HFO)]. Fermentative sugars (glucose and sucrose) were the most effective electron donors in the humus/Fe(III) reduction by strain SgZ-2. Additionally, differences of electron carrier participating in the process of electron transport with different electron acceptors (i. e. , oxygen, AQS, Fe-EDTA and HFO) were investigated using respiratory inhibitors. The results suggested that similar respiratory chain components were involved in the reducing process of oxygen and Fe-EDTA, including dehydrogenase, quinones and cytochromes b-c. In comparison, only dehydrogenase was found to participate in the reduction of AQS and HFO. In conclusion, different electron transport pathways may be employed by strain SgZ-2 between insoluble and soluble electron acceptors or among soluble electron acceptors. Preliminary models of electron transport pathway with four electron acceptors were proposed for strain SgZ-2, and the study of electron transport mechanism was explored to the genus Fontibacter. All the results from this study are expected to help understand the electron transport properties and the environmental behavior of the genus Fontibacter. PMID:25518675

  3. Simulation of Electrical Transport in Rocks under Mechanical Action

    NASA Astrophysics Data System (ADS)

    Salgueiro da Silva, M. A.; Seixas, T. M.

    2015-12-01

    Rock's electrical properties can be changed by mechanical action, especially when deformation is accompanied by micro-fracturing processes. Knowing how electrical charge is generated in inelastically deformed rocks, the nature and properties of the generated charge carriers, and their spatial distribution and propagation is crucial to gain insight into the origin of seismo-electromagnetic signals. In this work, we describe briefly a model for the numerical simulation of electrical transport in rocks under mechanical action, assuming that high and low mobility charge carriers of opposite signs can be simultaneously generated by micro-fracturing processes and recombine, diffuse and drift across the sample rock. The electrical behavior can then be described using an adaptation of the formalism applied to semiconductors. We provide simulation results on a one-dimensional lattice using finite-difference discretization. Our results show that a large mobility contrast among charge carriers allows charge separation inside the deformation region, which leads to the formation of charged layers of alternate signs. Inside these layers, rapid electric field variations are observed which can lead to the emission of electromagnetic radiation. With proper positioning of current electrodes inside the deformation region, it is possible to collect electrical current even without any applied voltage. We discuss our results in the light of available experimental results on the generation of electrical and electromagnetic signals in deformed rocks.

  4. Competing mechanisms of momentum transport in large wind farms

    NASA Astrophysics Data System (ADS)

    Meyers, Johan; Meneveau, Charles

    2011-11-01

    In very large wind farms in the atmospheric boundary layer, energy, and momentum are on average transported from layers above the farm downward towards the turbines (Calaf, Meneveau, Meyers, Phys. Fluids 2010). In the current work, we investigate in more detail the three-dimensional flows of mass, momentum and energy towards individual turbines, based on a suite of large-eddy simulations. We find that there are two competing mechanisms which bring momentum to the turbines, i.e. a sideways flux, and a top-down flux of momentum (sideways fluxes themselves are fed by a top-down flux in regions outside the turbine wake area). For large spanwise turbine spacings, sideways momentum fluxes are dominating; for small spanwise spacings, the top-down mechanism is dominant. Inspired by these observations, we propose a new integral model for wind-farm performance, in which competing fluxes of momentum are represented by closed analytical expressions obtained by integrating momentum equations over different regions in the ABL. The research of CM is supported by NSF AGS 1045189.

  5. Plasmodium falciparum Malaria Elicits Inflammatory Responses that Dysregulate Placental Amino Acid Transport

    PubMed Central

    Boeuf, Philippe; Aitken, Elizabeth H.; Chandrasiri, Upeksha; Chua, Caroline Lin Lin; McInerney, Bernie; McQuade, Leon; Duffy, Michael; Molyneux, Malcolm; Brown, Graham; Glazier, Jocelyn; Rogerson, Stephen J.

    2013-01-01

    Placental malaria (PM) can lead to poor neonatal outcomes, including low birthweight due to fetal growth restriction (FGR), especially when associated with local inflammation (intervillositis or IV). The pathogenesis of PM-associated FGR is largely unknown, but in idiopathic FGR, impaired transplacental amino acid transport, especially through the system A group of amino acid transporters, has been implicated. We hypothesized that PM-associated FGR could result from impairment of transplacental amino acid transport triggered by IV. In a cohort of Malawian women and their infants, the expression and activity of system A (measured by Na+-dependent 14C-MeAIB uptake) were reduced in PM, especially when associated with IV, compared to uninfected placentas. In an in vitro model of PM with IV, placental cells exposed to monocyte/infected erythrocytes conditioned medium showed decreased system A activity. Amino acid concentrations analyzed by reversed phase ultra performance liquid chromatography in paired maternal and cord plasmas revealed specific alterations of amino acid transport by PM, especially with IV. Overall, our data suggest that the fetoplacental unit responds to PM by altering its placental amino acid transport to maintain adequate fetal growth. However, IV more profoundly compromises placental amino acid transport function, leading to FGR. Our study offers the first pathogenetic explanation for FGR in PM. PMID:23408887

  6. Antigen-specific stimulation of amino acid transport in bovine lymphocytes

    SciTech Connect

    Tate, E.H.

    1982-01-01

    Treatment of bovine lymphocytes isolated from animals which were either infected with Mycobacterium bovis or sensitized to a purified protein derivative (PPD-B) from this organism induced an increase in the transport of a-aminoisobutyric acid (AIB) and a-methylaminoisobutyric acid (MeAIB). PPD-B did not stimulate these transport activities in lymphocytes from nonsensitized animals. The transport stimulation was first measurable after about 7 hours of treatment, reached about a two-fold enhancement after 20 hours, and continued to increase to 30- to 40-fold after 6 days. The stimulation of AIB transport was inhibited by both ouabain and cycloheximide. Experiments to determine transport system specificities in nonstimulated lymphocytes showed that MeAIB transport was primarily by the Na/sup +/-dependent, A-system,and leucine transport was mostly by Na/sup +/-independent system(s). In contrast, AIB transport was about 25% by the A-system, 25% by at least one Na/sup +/-dependent, non-A-system, and 50% by one or more Na/sup +/-independent system(s). Analysis of the three components of AIB transport after treatment with PPD-B showed that: 1) transport by both the A-system and the Na/sup +/-independent system(s) was stimulated; 2) A-system transport was stimulated to a larger extent than Na/sup +/-independent transport; and 3) Na/sup +/-dependent, non-A-system transport was not stimulated significantly.

  7. Transport of monocarboxylic acids at the blood-brain barrier: Studies with monolayers of primary cultured bovine brain capillary endothelial cells

    SciTech Connect

    Terasaki, T.; Takakuwa, S.; Moritani, S.; Tsuji, A. )

    1991-09-01

    The kinetics and mechanism of the transport of monocarboxylic acids (MCAs) were studied by using primary cultured bovine brain capillary endothelial cells. Concentration-dependent uptake of acetic acid was observed, and the kinetic parameters were estimated as follows: the Michaelis constant, Kt, was 3.41 {plus minus} 1.87 mM, the maximum uptake rate, Jmax, was 144.7 {plus minus} 55.7 nmol/mg of protein/min and the nonsaturable first-order rate constant, Kd, was 6.66 {plus minus} 1.98 microliters/mg of protein/min. At medium pH below 7.0, the uptake rate of (3H)acetic acid increased markedly with decreasing medium pH, whereas pH-independent uptake was observed in the presence of 10 mM acetic acid. An energy requirement for (3H)acetic acid uptake was also demonstrated, because metabolic inhibitors (2,4-dinitrophenol and rotenone) reduced significantly the uptake rate (P less than .05). Carbonylcyanide-p-trifluoro-methoxyphenylhydrazone, a protonophore, inhibited significantly the uptake of (3H)acetic acid at medium pH of 5.0 and 6.0, whereas 4,4{prime}-diisothiocyanostilben-2,2{prime}-disulfonic acid did not. Several MCAs inhibited significantly the uptake rate of (3H)acetic acid, whereas di- and tricarboxylic acids did not. The uptake of (3H)acetic acid was competitively inhibited by salicylic acid, with an inhibition constant, Ki, of 3.60 mM, suggesting a common transport system between acetic acid and salicylic acid. Moreover, at the medium pH of 7.4, salicylic acid and valproic acid inhibited significantly the uptake of (3H)acetic acid, demonstrating that the transport of MCA drugs could also be ascribed to the MCA transport system at the physiologic pH.

  8. [Investigation on mechanism of pyrite oxidation in acidic solutions].

    PubMed

    Wang, Nan; Yi, Xiao-Yun; Dang, Zhi; Liu, Yun

    2012-11-01

    The mechanism of pyrite oxidation in acidic solutions was investigated by electrochemical analysis methods, such as open-circuit potential, cyclic voltammetry, Tafel polarization curve and anodic polarization curve, using a pyrite-carbon paste electrode as working electrode. The results showed that the oxidation process of pyrite in acidic solutions was via a two-step reaction: the first step was the dissolution of iron moiety and formation of a passivation film composed of elemental sulphur, metal-deficient sulfide and polysulfide; the second step was the further oxidation of these intermediate products to SO4(2-). The final reaction products of pyrite oxidation were Fe3+ and SO4(2-) in acidic solutions. In addition, the open-circuit potential and corrosion potential were positively shifted, the peak current and the corrosion current were increased with the increase in concentration of H2SO4 solutions. This indicated that increased acidity of the system was advantageous to the oxidation of pyrite. PMID:23323425

  9. Transport mechanisms of contaminants released from fine sediment in rivers

    NASA Astrophysics Data System (ADS)

    Cheng, Pengda; Zhu, Hongwei; Zhong, Baochang; Wang, Daozeng

    2015-12-01

    Contaminants released from sediment into rivers are one of the main problems to study in environmental hydrodynamics. For contaminants released into the overlying water under different hydrodynamic conditions, the mechanical mechanisms involved can be roughly divided into convective diffusion, molecular diffusion, and adsorption/desorption. Because of the obvious environmental influence of fine sediment (D_{90}= 0.06 mm), non-cohesive fine sediment, and cohesive fine sediment are researched in this paper, and phosphorus is chosen for a typical adsorption of a contaminant. Through theoretical analysis of the contaminant release process, according to different hydraulic conditions, the contaminant release coupling mathematical model can be established by the N-S equation, the Darcy equation, the solute transport equation, and the adsorption/desorption equation. Then, the experiments are completed in an open water flume. The simulation results and experimental results show that convective diffusion dominates the contaminant release both in non-cohesive and cohesive fine sediment after their suspension, and that they contribute more than 90 % of the total release. Molecular diffusion and desorption have more of a contribution for contaminant release from unsuspended sediment. In unsuspension sediment, convective diffusion is about 10-50 times larger than molecular diffusion during the initial stages under high velocity; it is close to molecular diffusion in the later stages. Convective diffusion is about 6 times larger than molecular diffusion during the initial stages under low velocity, it is about a quarter of molecular diffusion in later stages, and has a similar level with desorption/adsorption. In unsuspended sediment, a seepage boundary layer exists below the water-sediment interface, and various release mechanisms in that layer mostly dominate the contaminant release process. In non-cohesive fine sediment, the depth of that layer increases linearly with shear

  10. Naringenin inhibits seed germination and seedling root growth through a salicylic acid-independent mechanism in Arabidopsis thaliana.

    PubMed

    Hernández, Iker; Munné-Bosch, Sergi

    2012-12-01

    Flavonoids fulfill an enormous range of biological functions in plants. In seeds, these compounds play several roles; for instance proanthocyanidins protect them from moisture, pathogen attacks, mechanical stress, UV radiation, etc., and flavonols have been suggested to protect the embryo from oxidative stress. The present study aimed at determining the role of flavonoids in Arabidopsis thaliana (L.) seed germination, and the involvement of salicylic acid (SA) and auxin (indole-3-acetic acid), two phytohormones with the same biosynthetic origin as flavonoids, the shikimate pathway, in such a putative role. We show that naringenin, a flavanone, strongly inhibits the germination of A. thaliana seeds in a dose-dependent and SA-independent manner. Altered auxin levels do not affect seed germination in Arabidopsis, but impaired auxin transport does, although to a minor extent. Naringenin and N-1-naphthylphthalamic acid (NPA) impair auxin transport through the same mechanisms, so the inhibition of germination by naringenin might involve impaired auxin transport among other mechanisms. From the present study it is concluded that naringenin inhibits the germination of Arabidopsis seeds in a dose-dependent and SA-independent manner, and the results also suggest that such effects are exerted, at least to some extent, through impaired auxin transport, although additional mechanisms seem to operate as well. PMID:23031844

  11. Uptake of 4-chloro-2-methylphenoxyacetic acid (MCPA) from the apical membrane of Caco-2 cells by the monocarboxylic acid transporter

    SciTech Connect

    Kimura, Osamu; Tsukagoshi, Kensuke; Endo, Tetsuya

    2008-03-15

    The cellular uptake mechanism of 4-chloro-2-methylphenoxyacetic acid (MCPA), a phenoxyacetic acid derivative, was investigated using Caco-2 epithelial cells. The cells were incubated with 50 {mu}M MCPA at pH 6.0 and 37 deg. C, and the uptake of MCPA from the apical membranes was measured. The uptake of MCPA was significantly decreased by incubation at low temperature (4 {sup o}C) and markedly increased by lowering the extracellular pH. Pretreatment with a protonophore, carbonylcyanide-p-(trifluoromethoxy)phenylhydrazone (25 {mu}M), or metabolic inhibitors, 2,4-dinitrophenol (1 mM) and sodium azide (10 mM), significantly decreased the uptake of MCPA by 53%, 45% and 48%, respectively. Coincubation of MCPA with 10 mM L-lactic acid or {alpha}-cyano-4-hydroxycinnamate, which is a substrate or an inhibitor of the monocarboxylic acid transporters (MCTs), significantly decreased the uptake of MCPA by 31% and 20%, respectively, and coincubation with benzoic acid profoundly decreased the uptake by 68%. In contrast, coincubation with succinic acid (a dicarboxylic acid) did not affect the uptake. Kinetic analysis of initial MCPA uptake suggested that MCPA is taken up via a carrier-mediated process [K{sub m} = 1.37 {+-} 0.15 mM, V{sub max} = 115 {+-} 6 nmol (mg protein){sup -1} (3 min){sup -1}]. Lineweaver-Burk plots show that benzoic acid competitively inhibits the uptake of MCPA with a K{sub i} value of 4.68 {+-} 1.76 mM. A trans-stimulation effect on MCPA uptake was found in cells preloaded with benzoic acid. These results suggest that the uptake of MCPA from the apical membrane of Caco-2 cells is mainly mediated by common MCTs along with benzoic acid but also in part by L-lactic acid.

  12. DFT investigation on the decarboxylation mechanism of ortho hydroxy benzoic acids with acid catalysis.

    PubMed

    Hu, Yanying; Gao, Lu; Dai, Zhoutong; Sun, Guojuan; Zhang, Tongcun; Jia, Shiru; Dai, Yujie; Zhang, Xiuli

    2016-03-01

    A density functional theory (DFT) study was performed to explore the mechanisms of the acid-catalyzed decarboxylation reaction of salicylic acids using the B3LYP method with 6-31++G(d,p) basis set in both gas phase and aqueous environment. The α-protonated cation of carboxylate acid was formed during the decarboxylation process in acidic conditions, and the presence of hydrogen ions promotes decarboxylation greatly by significantly decreasing the overall reaction energy barriers to 20.98 kcal mol(-1) in gas phase and 20.93 kcal mol(-1) in water, respectively. The hydrogen in the α-carbon came directly from the acid rather than from the carboxyl group in neutral state. Compared with the reaction in gas phase, water in aqueous state causes the reaction to occur more easily. Substituents of methyl group, chlorine and fluorine at the ortho-position to the carboxyl of salicylic acid could further lower the decarboxylation energy barriers and facilitate the reaction. PMID:26874949

  13. Characteristics of the transport of ascorbic acid into leucocytes

    SciTech Connect

    Raghoebar, M.; Huisman, J.A.M.; van den Berg, W.B.; van Ginneken, C.A.M.

    1987-02-02

    The degree and the mode of association of (/sup 14/C)-ascorbic acid with leucocytes are examined. The degree of association of ascorbic acid with polymorphonuclear leucocytes (1-3 %) is dependent on cell type, extracellular concentration of ascorbic acid, incubation temperature, intactness of the cells and the extracellular pH. All experiments are performed according to strict protocols as these compounds are labile in aqueous solutions. Further it is noticed that in all experiments an outward gradient of leucocyte endogenic ascorbic acid exists. The results suggest that the association process comprises at least one saturable pathway. The activation of polymorphonuclear leucocytes by phorbol myristate acetate increases the accumulation of ascorbic acid threefold. 30 references, 7 figures, 3 tables.

  14. Mechanism of Calcium Lactate Facilitating Phytic Acid Degradation in Soybean during Germination.

    PubMed

    Hui, Qianru; Yang, Runqiang; Shen, Chang; Zhou, Yulin; Gu, Zhenxin

    2016-07-13

    Calcium lactate facilitates the growth and phytic acid degradation of soybean sprouts, but the mechanism is unclear. In this study, calcium lactate (Ca) and calcium lactate with lanthanum chloride (Ca+La) were used to treat soybean sprouts to reveal the relevant mechanism. Results showed that the phytic acid content decreased and the availability of phosphorus increased under Ca treatment. This must be due to the enhancement of enzyme activity related to phytic acid degradation. In addition, the energy metabolism was accelerated by Ca treatment. The energy status and energy metabolism-associated enzyme activity also increased. However, the transmembrane transport of calcium was inhibited by La(3+) and concentrated in intercellular space or between the cell wall and cell membrane; thus, Ca+La treatment showed reverse results compared with those of Ca treatment. Interestingly, gene expression did not vary in accordance with their enzyme activity. These results demonstrated that calcium lactate increased the rate of phytic acid degradation by enhancing growth, phosphorus metabolism, and energy metabolism. PMID:27324823

  15. Aging mechanisms and service life of lead-acid batteries

    NASA Astrophysics Data System (ADS)

    Ruetschi, Paul

    In lead-acid batteries, major aging processes, leading to gradual loss of performance, and eventually to the end of service life, are: Anodic corrosion (of grids, plate-lugs, straps or posts). Positive active mass degradation and loss of adherence to the grid (shedding, sludging). Irreversible formation of lead sulfate in the active mass (crystallization, sulfation). Short-circuits. Loss of water. Aging mechanisms are often inter-dependent. For example, corrosion of the grids will lead to increased resistance to current flow, which will in turn impede proper charge of certain parts of the active mass, resulting in sulfation. Active mass degradation may lead to short-circuits. Sulfation may be the result of a loss of water, and so forth. The rates of the different aging processes strongly depend on the type of use (or misuse) of the battery. Over-charge will lead to accelerated corrosion and also to accelerated loss of water. With increasing depth-of-discharge during cycling, positive active mass degradation is accelerated. Some aging mechanisms are occurring only upon misuse. Short-circuits across the separators, due to the formation of metallic lead dendrites, for example, are usually formed only after (excessively) deep discharge. Stationary batteries, operated under float-charge conditions, will age typically by corrosion of the positive grids. On the other hand, service life of batteries subject to cycling regimes, will typically age by degradation of the structure of the positive active mass. Starter batteries are usually aging by grid corrosion, for instance in normal passenger car use. However, starter batteries of city buses, making frequent stops, may age (prematurely) by positive active mass degradation, because the batteries are subject to numerous shallow discharge cycles. Valve-regulated batteries often fail as a result of negative active mass sulfation, or water loss. For each battery design, and type of use, there is usually a characteristic

  16. Potential mechanisms for low uric acid in Parkinson disease.

    PubMed

    Sampat, Radhika; Young, Sarah; Rosen, Ami; Bernhard, Douglas; Millington, David; Factor, Stewart; Jinnah, H A

    2016-04-01

    Several epidemiologic studies have described an association between low serum uric acid (UA) and Parkinson disease (PD). Uric acid is a known antioxidant, and one proposed mechanism of neurodegeneration in PD is oxidative damage of dopamine neurons. However, other complex metabolic pathways may contribute. The purpose of this study is to elucidate potential mechanisms of low serum UA in PD. Subjects who met diagnostic criteria for definite or probable PD (n = 20) and controls (n = 20) aged 55-80 years were recruited. Twenty-four hour urine samples were collected from all participants, and both uric acid and allantoin were measured and corrected for body mass index (BMI). Urinary metabolites were compared using a twoway ANOVA with diagnosis and sex as the explanatory variables. There were no significant differences between PD and controls for total UA (p = 0.60), UA corrected for BMI (p = 0.37), or in the interaction of diagnosis and sex on UA (p = 0.24). Similarly, there were no significant differences between PD and controls for allantoin (p = 0.47), allantoin corrected for BMI (p = 0.57), or in the interaction of diagnosis and sex on allantoin (p = 0.78). Allantoin/UA ratios also did not significantly differ by diagnosis (p = 0.99). Our results imply that low serum UA in PD may be due to an intrinsic mechanism that alters the homeostatic set point for serum UA in PD, and may contribute to relatively lower protection against oxidative damage. These findings provide indirect support for neuroprotection trials aimed at raising serum UA. PMID:26747026

  17. Mechanisms of corrosion inhibitors used in acidizing wells

    SciTech Connect

    Frenier, W.W.; Growcock, F.B.; Lopp, V.R. )

    1988-11-01

    Two model compounds, n-dodecylpyridinium bromide (n-DDPB) and 1-octyn-3-ol, were tested in HCL acid as inhibitors for J55 oilfield steel. This paper describes the kinetic and chemical analyses conducted to arrive at inhibition mechanisms for these model compounds. These studies show that the pyridinium forms a weak bond with the chloride-covered surface and is sensitive to temperature and (HCl). Octynol, however, chemisorbs and produces a film that contains a reaction product of the acetylenic alcohol. This film is quite insensitive to changes in temperature and (HCl).

  18. Palmitate stimulates glucose transport in rat adipocytes by a mechanism involving translocation of the insulin sensitive glucose transporter (GLUT4)

    NASA Technical Reports Server (NTRS)

    Hardy, R. W.; Ladenson, J. H.; Henriksen, E. J.; Holloszy, J. O.; McDonald, J. M.

    1991-01-01

    In rat adipocytes, palmitate: a) increases basal 2-deoxyglucose transport 129 +/- 27% (p less than 0.02), b) decreases the insulin sensitive glucose transporter (GLUT4) in low density microsomes and increases GLUT4 in plasma membranes and c) increases the activity of the insulin receptor tyrosine kinase. Palmitate-stimulated glucose transport is not additive with the effect of insulin and is not inhibited by the protein kinase C inhibitors staurosporine and sphingosine. In rat muscle, palmitate: a) does not affect basal glucose transport in either the soleus or epitrochlearis and b) inhibits insulin-stimulated glucose transport by 28% (p less than 0.005) in soleus but not in epitrochlearis muscle. These studies demonstrate a potentially important differential role for fatty acids in the regulation of glucose transport in different insulin target tissues.

  19. An Ekman Transport Mechanism for the Atlantic Multidecadal Oscillation

    NASA Astrophysics Data System (ADS)

    Pratt, V. R.

    2014-12-01

    Multidecadal global climate since 1850 consists of the expected greenhouse warming and two cycles of a fluctuation commonly associated with the AMO that so far has not been satisfactorily explained. In GC53C-06 at AGUFM13 we compared land and sea temperatures during the global warmings of 1860-1880 and 1910-1940 and inferred that heat flowed sea to land, ruling out aerosol-based external forcings and indicating an internal source such as an instability in the AMOC. Length of day during the past century has varied by ~4 ms inversely with the AMO. Noting that the ocean floor is some five times thinner than the continental crust, we propose here that Earth's rotation regulates heat flux through the ocean floor. One mechanism for this is centrifugal force pulling plates apart, particularly along the Mid-Atlantic Ridge and around the Ring of Fire, increasing flux by an amount that would easily pass unnoticed in the 1930s. Another mechanism, perhaps less strong, is stress from rotational acceleration increasing the thermal conductivity of the young rocks comprising the ocean floor. A difficulty is that the ocean would absorb the fluctuations before reaching the surface. We overcome this difficulty via Ekman transport. This mechanism acts on a 50 m deep layer at the surface to drive it polewards from the ITCZ at 3 cm/sec or 1000 km/yr, orders of magnitude faster than the MOC which therefore cannot interfere. This creates a suction at the ITCZ and a downwards pumping action at 30°. In order to close this cycle there must be a flow equal in volume rate towards the ITCZ at depth. We propose that the heat entering the ocean bottom between 30° S and 30° N enters these two "Ekman cells", which carry it to the surface via the ITCZ. To evaluate feasibility, take the area of the participating 50m surface layer to be 1014 m2, making the volume of the top and bottom layers 1016 m3. Only 1022 J of heat is needed to warm or cool this by 1/3.85 = 0.26 °C. Over the 30 years 1910

  20. Transport of hop bitter acids across intestinal Caco-2 cell monolayers.

    PubMed

    Cattoor, Ko; Bracke, Marc; Deforce, Dieter; De Keukeleire, Denis; Heyerick, Arne

    2010-04-14

    Several health-beneficial properties of hop bitter acids have been reported (inhibition of bone resorption and anticarcinogenic and anti-inflammatory activities); however, scientific data on the bioavailability of these compounds are lacking. As a first approach to study the bioavailability, the epithelial transport of hop alpha- and beta-acids across Caco-2 monolayers was investigated. Hop acids were added either to the apical or to the basolateral chamber and, at various time points, amounts transported to the receiving compartment were determined. The monolayer integrity control was performed by using marker compounds (atenolol and propranolol), transepithelial electrical resistance (TEER) measurement, and determination of the fluorescein efflux. The TEER and fluorescein efflux confirmed the preservation of the monolayer integrity. The membrane permeability of the alpha-acids (apparent permeability coefficients for apical to basolateral transport (P(appAB)) ranged from 14 x 10(-6) to 41 x 10(-6) cm/s) was determined to be substantially higher than that of the beta-acids (P(appAB) values ranging from 0.9 x 10(-6) to 2.1 x 10(-6) cm/s). Notably, the beta-acids exhibited significantly different bidirectional P(app) values with efflux ratios around 10. The involvement of carrier-mediated transport for beta-acids (active efflux pathway by P-gp, BCRP, and/or MRP-2 type efflux pumps) could be confirmed by transport experiments with specific inhibitors (verapamil and indomethacin). It appears that alpha-acids are efficiently absorbed, whereas the permeability of beta-acids is low. Limiting factors in the absorption of beta-acids could involve P-gp and MRP-2 type efflux transporters and phase II metabolism. PMID:20329731

  1. Aphid amino acid transporter regulates glutamine supply to intracellular bacterial symbionts.

    PubMed

    Price, Daniel R G; Feng, Honglin; Baker, James D; Bavan, Selvan; Luetje, Charles W; Wilson, Alex C C

    2014-01-01

    Endosymbiotic associations have played a major role in evolution. However, the molecular basis for the biochemical interdependence of these associations remains poorly understood. The aphid-Buchnera endosymbiosis provides a powerful system to elucidate how these symbioses are regulated. In aphids, the supply of essential amino acids depends on an ancient nutritional symbiotic association with the gamma-proteobacterium Buchnera aphidicola. Buchnera cells are densely packed in specialized aphid bacteriocyte cells. Here we confirm that five putative amino acid transporters are highly expressed and/or highly enriched in Acyrthosiphon pisum bacteriocyte tissues. When expressed in Xenopus laevis oocytes, two bacteriocyte amino acid transporters displayed significant levels of glutamine uptake, with transporter ACYPI001018, LOC100159667 (named here as Acyrthosiphon pisum glutamine transporter 1, ApGLNT1) functioning as the most active glutamine transporter. Transporter ApGLNT1 has narrow substrate selectivity, with high glutamine and low arginine transport capacity. Notably, ApGLNT1 has high binding affinity for arginine, and arginine acts as a competitive inhibitor for glutamine transport. Using immunocytochemistry, we show that ApGLNT1 is localized predominantly to the bacteriocyte plasma membrane, a location consistent with the transport of glutamine from A. pisum hemolymph to the bacteriocyte cytoplasm. On the basis of functional transport data and localization, we propose a substrate feedback inhibition model in which the accumulation of the essential amino acid arginine in A. pisum hemolymph reduces the transport of the precursor glutamine into bacteriocytes, thereby regulating amino acid biosynthesis in the bacteriocyte. Structural similarities in the arrangement of hosts and symbionts across endosymbiotic systems suggest that substrate feedback inhibition may be mechanistically important in other endosymbioses. PMID:24367072

  2. Utilization of Lactic Acid by Fusarium oxysporum var. lini: Regulation of Transport and Metabolism

    PubMed Central

    Castro, Ieso M.; Loureiro-Dias, Maria C.

    1994-01-01

    Lactic acid was transported in Fusarium oxysporum var. lini ATCC 10960 by a saturable transport system that had a half-saturation constant of 56.6 ± 7.5 μM and a maximum velocity of 0.61 ± 0.10 mmol h-1 g-1 (dry weight) at 26°C and pH 5.0. This transport system was inducible and was not expressed in the presence of a repressing substrate. Evidence is presented that the anionic form lactate- was taken up by the cells. Propionic, acetic, pyruvic, and bromoacetic acids but not succinic acid competitively inhibited the transport of lactic acid. Bromoacetic acid, which was not metabolized, was taken up to a steady-state level when intracellular and extracellular concentrations were identical, indicating that the transport system was not accumulative. The enzymatic activity that was physiologically more relevant in the metabolism of lactic acid was lactate: ferricytochrome c oxidase. This enzyme did not exhibit stereospecifity and was induced by lactic acid. PMID:16349143

  3. Role of organic acids in promoting colloidal transport of mercury from mine tailings

    USGS Publications Warehouse

    Slowey, A.J.; Johnson, S.B.; Rytuba, J.J.; Brown, Gordon E., Jr.

    2005-01-01

    A number of factors affect the transport of dissolved and paniculate mercury (Hg) from inoperative Hg mines, including the presence of organic acids in the rooting zone of vegetated mine waste. We examined the role of the two most common organic acids in soils (oxalic and citric acid) on Hg transport from such waste by pumping a mixed organic acid solution (pH 5.7) at 1 mL/min through Hg mine tailings columns. For the two total organic acid concentrations investigated (20 ??M and 1 mM), particle-associated Hg was mobilized, with the onset of paniculate Hg transport occurring later for the lower organic acid concentration. Chemical analyses of column effluent indicate that 98 wt % of Hg mobilized from the column was paniculate. Hg speciation was determined using extended X-ray absorption fine structure spectroscopy and transmission electron microscopy, showing that HgS minerals are dominant in the mobilized particles. Hg adsorbed to colloids is another likely mode of transport due to the abundance of Fe-(oxyhydr)oxides, Fe-sulfides, alunite, and jarosite in the tailings to which Hg(II) adsorbs. Organic acids produced by plants are likely to enhance the transport of colloid-associated Hg from vegetated Hg mine tailings by dissolving cements to enable colloid release. ?? 2005 American Chemical Society.

  4. Micro-electro-mechanical systems phosphoric acid fuel cell

    DOEpatents

    Sopchak, David A.; Morse, Jeffrey D.; Upadhye, Ravindra S.; Kotovsky, Jack; Graff, Robert T.

    2010-08-17

    A phosphoric acid fuel cell system comprising a porous electrolyte support, a phosphoric acid electrolyte in the porous electrolyte support, a cathode electrode contacting the phosphoric acid electrolyte, and an anode electrode contacting the phosphoric acid electrolyte.

  5. Micro-electro-mechanical systems phosphoric acid fuel cell

    DOEpatents

    Sopchak, David A.; Morse, Jeffrey D.; Upadhye, Ravindra S.; Kotovsky, Jack; Graff, Robert T.

    2010-12-21

    A phosphoric acid fuel cell system comprising a porous electrolyte support, a phosphoric acid electrolyte in the porous electrolyte support, a cathode electrode contacting the phosphoric acid electrolyte, and an anode electrode contacting the phosphoric acid electrolyte.

  6. Characterization of methylaminoisobutyric acid transport by system A in rat mammary gland.

    PubMed

    Tovar, A R; Avila, E; DeSantiago, S; Torres, N

    2000-07-01

    During lactation, the mammary gland has a large demand for amino acids for the synthesis of milk proteins and fatty acids. Arteriovenous differences in amino acids across the mammary gland show an elevated uptake of small neutral amino acids that are mainly transported via system A. The purpose of this study was to characterize the transport of methylaminoisobutyric acid (MeAIB), an amino acid analog used to model transport by system A in lactating rat mammary gland explants. MeAIB accumulation in mammary gland cells increased steadily, and after 3 hours of incubation, the intracellular concentration of the analog was 8-fold higher than the concentration in the medium. MeAIB transport into mammary gland explants showed a Km of 3.3 +/- 0.4 mmol/L and a maximal velocity (Vmax) of 555 +/- 23 pmol/microL intracellular fluid (ICF) x min, indicating a system with high capacity but low affinity for its substrate. MeAIB transport into mammary tissue depended highly on Na+, and the uptake was inhibited by addition of natural and analog small neutral amino acids. Cationic, anionic, and large neutral amino acids did not reduce MeAIB transport into mammary gland explants. Preincubation of mammary gland explants in an amino acid-free medium stimulated MeAIB transport, suggesting an adaptive regulation. The addition of an equimolar mixture of alanine, glycine, and serine to the preincubation medium inhibited stimulation of MeAIB transport. Furthermore, stimulation of MeAIB uptake by amino acid starvation was also prevented by the addition of actinomycin D, cycloheximide, tunicamycin, and colchicine. Dibutyryl cyclic adenosine monophosphate (cAMP) increased MeAIB uptake, whereas phorbol 12-myristate 13-acetate (PMA) did not stimulate MeAIB transport. During the first postweaning days, kinetic analyses showed a decrease of 27% in the Vmax. Injection of rat lactating mammary gland mRNA into Xenopus laevis oocytes induced expression of the MeAIB transport system; however, the

  7. LHT1, a lysine- and histidine-specific amino acid transporter in arabidopsis.

    PubMed Central

    Chen, L; Bush, D R

    1997-01-01

    We have identified a new amino acid transporter from the Arabidopsis thaliana expressed sequence tag cDNA collection by functional complementation of a yeast amino acid transport mutant. Transport analysis of the expressed protein in yeast shows that it is a high-affinity transporter for both lysine (Lys) and histidine with Michaelis constant values of 175 and 400 microM, respectively. This transporter (LHT1, lysine histidine transporter) has little affinity for arginine when measured directly in uptake experiments or indirectly with substrate competition. The cDNA is 1.7 kb with an open reading frame that codes for a protein with 446 amino acids and a calculated molecular mass of 50.5 kD. Hydropathy analysis shows that LHT1 is an integral membrane protein with 9 to 10 putative membrane-spanning domains. Southern-blot analysis suggests that LHT1 is a single-copy gene in the Arabidopsis genome. RNA gel-blot analysis shows that this transporter is present in all tissues, with the strongest expression in young leaves, flowers, and siliques. Wholemount, in situ hybridization revealed that expression is further localized on the surface of roots in young seedlings and in pollen. Overall, LHT1 belongs to a new class of amino acid transporter that is specific for Lys and histidine, and, given its substrate specificity, it has significant promise as a tool for improving the Lys content of Lys-deficient grains. PMID:9390441

  8. Fluorescence measurement of chloride transport in monolayer cultured cells. Mechanisms of chloride transport in fibroblasts.

    PubMed

    Chao, A C; Dix, J A; Sellers, M C; Verkman, A S

    1989-12-01

    The methodology has been developed to measure Cl activity and transport in cultured cells grown on a monolayer using the entrapped Cl-sensitive fluorophore 6-methoxy-N-[3-sulfopropyl] quinolinium (SPQ). The method was applied to a renal epithelial cell line, LLC-PKI, and a nonepithelial cell line, Swiss 3T3 fibroblasts. SPQ was nontoxic to cells when present for greater than h in the culture media. To load with SPQ (5 mM), cells were made transiently permeable by exposure to hypotonic buffer (150 mOsm, 4 min). Intracellular fluorescence was monitored continuously by epifluorescence microscopy using low illumination intensity at 360 +/- 5 nm excitation wavelength and photomultiplier detection at greater than 410 nm. Over 60 min at 37 degrees C, there was no photobleaching and less than 10% leakage of SPQ out of cells; intracellular SPQ fluorescence was uniform. SPQ fluorescence was calibrated against intracellular [Cl] using high K solutions containing the ionophores nigericin and tributyltin. The Stern-Volmer constant (Kq) for quenching of intracellular SPQ by Cl was 13 M-1 for fibroblasts and LLC-PKl cells. In the absence of Cl, SPQ lifetime was 26 ns in aqueous solution and 3.7 +/- 0.6 ns in cells, showing that the lower Kq in cells than in free solution (Kq = 118 M-1) was due to SPQ quenching by intracellular anions. To examine Cl transport mechanisms, the time course of intracellular [Cl] was measured in response to rapid Cl addition and removal in the presence of ion or pH gradients. In fibroblasts, three distinct Cl transporting systems were identified: a stilbeneinhibitable Cl/HCO3 exchanger, a furosemide-sensitive Na/K/2Cl cotransporter, and a Ca-regulated Cl conductance. These results establish a direct optical method to measure intracellular [Cl] continuously in cultured cells. PMID:2482083

  9. Mechanisms of lipid malabsorption in Cystic Fibrosis: the impact of essential fatty acids deficiency

    PubMed Central

    Peretti, N; Marcil, V; Drouin, E; Levy, E

    2005-01-01

    Transport mechanisms, whereby alimentary lipids are digested and packaged into small emulsion particles that enter intestinal cells to be translocated to the plasma in the form of chylomicrons, are impaired in cystic fibrosis. The purpose of this paper is to focus on defects that are related to intraluminal and intracellular events in this life-limiting genetic disorder. Specific evidence is presented to highlight the relationship between fat malabsorption and essential fatty acid deficiency commonly found in patients with cystic fibrosis that are often related to the genotype. Given the interdependency of pulmonary disease, pancreatic insufficiency and nutritional status, greater attention should be paid to the optimal correction of fat malabsorption and essential fatty acid deficiency in order to improve the quality of life and extend the life span of patients with cystic fibrosis. PMID:15869703

  10. Maternal bile acid transporter deficiency promotes neonatal demise

    PubMed Central

    Zhang, Yuanyuan; Li, Fei; Wang, Yao; Pitre, Aaron; Fang, Zhong-ze; Frank, Matthew W.; Calabrese, Christopher; Krausz, Kristopher W.; Neale, Geoffrey; Frase, Sharon; Vogel, Peter; Rock, Charles O.; Gonzalez, Frank J.; Schuetz, John D.

    2015-01-01

    Intrahepatic cholestasis of pregnancy (ICP) is associated with adverse neonatal survival and is estimated to impact between 0.4 and 5% of pregnancies worldwide. Here we show that maternal cholestasis (due to Abcb11 deficiency) produces neonatal death among all offspring within 24 h of birth due to atelectasis-producing pulmonary hypoxia, which recapitulates the neonatal respiratory distress of human ICP. Neonates of Abcb11-deficient mothers have elevated pulmonary bile acids and altered pulmonary surfactant structure. Maternal absence of Nr1i2 superimposed on Abcb11 deficiency strongly reduces maternal serum bile acid concentrations and increases neonatal survival. We identify pulmonary bile acids as a key factor in the disruption of the structure of pulmonary surfactant in neonates of ICP. These findings have important implications for neonatal respiratory failure, especially when maternal bile acids are elevated during pregnancy, and highlight potential pathways and targets amenable to therapeutic intervention to ameliorate this condition. PMID:26416771

  11. Molecular Characterisation of Transport Mechanisms at the Developing Mouse Blood–CSF Interface: A Transcriptome Approach

    PubMed Central

    Liddelow, Shane A.; Temple, Sally; Møllgård, Kjeld; Gehwolf, Renate; Wagner, Andrea; Bauer, Hannelore; Bauer, Hans-Christian; Phoenix, Timothy N.; Dziegielewska, Katarzyna M.; Saunders, Norman R.

    2012-01-01

    Exchange mechanisms across the blood–cerebrospinal fluid (CSF) barrier in the choroid plexuses within the cerebral ventricles control access of molecules to the central nervous system, especially in early development when the brain is poorly vascularised. However, little is known about their molecular or developmental characteristics. We examined the transcriptome of lateral ventricular choroid plexus in embryonic day 15 (E15) and adult mice. Numerous genes identified in the adult were expressed at similar levels at E15, indicating substantial plexus maturity early in development. Some genes coding for key functions (intercellular/tight junctions, influx/efflux transporters) changed expression during development and their expression patterns are discussed in the context of available physiological/permeability results in the developing brain. Three genes: Secreted protein acidic and rich in cysteine (Sparc), Glycophorin A (Gypa) and C (Gypc), were identified as those whose gene products are candidates to target plasma proteins to choroid plexus cells. These were investigated using quantitative- and single-cell-PCR on plexus epithelial cells that were albumin- or total plasma protein-immunopositive. Results showed a significant degree of concordance between plasma protein/albumin immunoreactivity and expression of the putative transporters. Immunohistochemistry identified SPARC and GYPA in choroid plexus epithelial cells in the embryo with a subcellular distribution that was consistent with transport of albumin from blood to cerebrospinal fluid. In adult plexus this pattern of immunostaining was absent. We propose a model of the cellular mechanism in which SPARC and GYPA, together with identified vesicle-associated membrane proteins (VAMPs) may act as receptors/transporters in developmentally regulated transfer of plasma proteins at the blood–CSF interface. PMID:22457777

  12. Mechanisms of lithium transport in amorphous polyethylene oxide.

    PubMed

    Duan, Yuhua; Halley, J W; Curtiss, Larry; Redfern, Paul

    2005-02-01

    We report calculations using a previously reported model of lithium perchlorate in polyethylene oxide in order to understand the mechanism of lithium transport in these systems. Using an algorithm suggested by Voter, we find results for the diffusion rate which are quite close to experimental values. By analysis of the individual events in which large lithium motions occur during short times, we find that no single type of rearrangement of the lithium environment characterizes these events. We estimate the free energies of the lithium ion as a function of position during these events by calculation of potentials of mean force and thus derive an approximate map of the free energy as a function of lithium position during these events. The results are consistent with a Marcus-like picture in which the system slowly climbs a free energy barrier dominated by rearrangement of the polymer around the lithium ions, after which the lithium moves very quickly to a new position. Reducing the torsion forces in the model causes the diffusion rates to increase. PMID:15740341

  13. Mechanical manipulations on electronic transport of graphene nanoribbons

    NASA Astrophysics Data System (ADS)

    Wang, Jing; Zhang, Guiping; Ye, Fei; Wang, Xiaoqun

    2015-06-01

    We study the effects of uniaxial strains on the transport properties of graphene nanoribbons (GNRs) connected with two metallic leads in heterojunctions, using the transfer matrix method. Two typical GNRs with zigzag and armchair boundaries are considered and the tension is applied either parallel or perpendicular to the ribbon axis. It turns out that the electron-hole symmetry is missing in the gate voltage dependence of the conductance data of the armchair GNRs, while it persists in the zigzag ribbons under any strains. For an armchair GNR with a vertical tension applied, a sharp drop of conductance is found near the critical value of the strain inducing a quantum phase transition, which allows one to determine the critical strain accurately via measuring the conductance. In the zigzag ribbon, there exists a range of gate voltage around zero, where the conductance is insensitive to the small horizontal strains. The band structures and low-energy properties are calculated to elucidate the mechanism on the strain effects in GNRs. We expect that our results can be useful in developing graphene-based strain sensors.

  14. Boric acid inhibits embryonic histone deacetylases: A suggested mechanism to explain boric acid-related teratogenicity

    SciTech Connect

    Di Renzo, Francesca; Cappelletti, Graziella; Broccia, Maria L.; Giavini, Erminio; Menegola, Elena . E-mail: elena.menegola@unimi.it

    2007-04-15

    Histone deacetylases (HDAC) control gene expression by changing histonic as well as non histonic protein conformation. HDAC inhibitors (HDACi) are considered to be among the most promising drugs for epigenetic treatment for cancer. Recently a strict relationship between histone hyperacetylation in specific tissues of mouse embryos exposed to two HDACi (valproic acid and trichostatin A) and specific axial skeleton malformations has been demonstrated. The aim of this study is to verify if boric acid (BA), that induces in rodents malformations similar to those valproic acid and trichostatin A-related, acts through similar mechanisms: HDAC inhibition and histone hyperacetylation. Pregnant mice were treated intraperitoneally with a teratogenic dose of BA (1000 mg/kg, day 8 of gestation). Western blot analysis and immunostaining were performed with anti hyperacetylated histone 4 (H4) antibody on embryos explanted 1, 3 or 4 h after treatment and revealed H4 hyperacetylation at the level of somites. HDAC enzyme assay was performed on embryonic nuclear extracts. A significant HDAC inhibition activity (compatible with a mixed type partial inhibition mechanism) was evident with BA. Kinetic analyses indicate that BA modifies substrate affinity by a factor {alpha} = 0.51 and maximum velocity by a factor {beta} = 0.70. This work provides the first evidence for HDAC inhibition by BA and suggests such a molecular mechanism for the induction of BA-related malformations.

  15. Transportation impact analysis for the shipment of low specific activity nitric acid. Revisison 1

    SciTech Connect

    Green, J.R.

    1995-05-16

    This is in support of the Plutonium-Uranium Extraction (PUREX) Facility Low Specific Activity (LSA) Nitric Acid Shipment Environmental Assessment. It analyzes potential toxicological and radiological risks associated with transportation of PUREX Facility LSA Nitric Acid from the Hanford Site to Portsmouth VA, Baltimore MD, and Port Elizabeth NJ.

  16. Mechanisms of triglyceride metabolism in patients with bile acid diarrhea.

    PubMed

    Sagar, Nidhi Midhu; McFarlane, Michael; Nwokolo, Chuka; Bardhan, Karna Dev; Arasaradnam, Ramesh Pulendran

    2016-08-14

    Bile acids (BAs) are essential for the absorption of lipids. BA synthesis is inhibited through intestinal farnesoid X receptor (FXR) activity. BA sequestration is known to influence BA metabolism and control serum lipid concentrations. Animal data has demonstrated a regulatory role for the FXR in triglyceride metabolism. FXR inhibits hepatic lipogenesis by inhibiting the expression of sterol regulatory element binding protein 1c via small heterodimer primer activity. Conversely, FXR promotes free fatty acids oxidation by inducing the expression of peroxisome proliferator-activated receptor α. FXR can reduce the expression of microsomal triglyceride transfer protein, which regulates the assembly of very low-density lipoproteins (VLDL). FXR activation in turn promotes the clearance of circulating triglycerides by inducing apolipoprotein C-II, very low-density lipoproteins receptor (VLDL-R) and the expression of Syndecan-1 together with the repression of apolipoprotein C-III, which increases lipoprotein lipase activity. There is currently minimal clinical data on triglyceride metabolism in patients with bile acid diarrhoea (BAD). Emerging data suggests that a third of patients with BAD have hypertriglyceridemia. Further research is required to establish the risk of hypertriglyceridaemia in patients with BAD and elicit the mechanisms behind this, allowing for targeted treatment. PMID:27570415

  17. Mechanisms of triglyceride metabolism in patients with bile acid diarrhea

    PubMed Central

    Sagar, Nidhi Midhu; McFarlane, Michael; Nwokolo, Chuka; Bardhan, Karna Dev; Arasaradnam, Ramesh Pulendran

    2016-01-01

    Bile acids (BAs) are essential for the absorption of lipids. BA synthesis is inhibited through intestinal farnesoid X receptor (FXR) activity. BA sequestration is known to influence BA metabolism and control serum lipid concentrations. Animal data has demonstrated a regulatory role for the FXR in triglyceride metabolism. FXR inhibits hepatic lipogenesis by inhibiting the expression of sterol regulatory element binding protein 1c via small heterodimer primer activity. Conversely, FXR promotes free fatty acids oxidation by inducing the expression of peroxisome proliferator-activated receptor α. FXR can reduce the expression of microsomal triglyceride transfer protein, which regulates the assembly of very low-density lipoproteins (VLDL). FXR activation in turn promotes the clearance of circulating triglycerides by inducing apolipoprotein C-II, very low-density lipoproteins receptor (VLDL-R) and the expression of Syndecan-1 together with the repression of apolipoprotein C-III, which increases lipoprotein lipase activity. There is currently minimal clinical data on triglyceride metabolism in patients with bile acid diarrhoea (BAD). Emerging data suggests that a third of patients with BAD have hypertriglyceridemia. Further research is required to establish the risk of hypertriglyceridaemia in patients with BAD and elicit the mechanisms behind this, allowing for targeted treatment. PMID:27570415

  18. Molecular mechanisms of boron transport in plants: involvement of Arabidopsis NIP5;1 and NIP6;1.

    PubMed

    Miwa, Kyoko; Tanaka, Mayuki; Kamiya, Takehiro; Fujiwara, Toru

    2010-01-01

    Understanding of the molecular mechanisms of boron (B) transport has been greatly advanced in the last decade. BOR1, the first B transporter in living systems, was identified by forward genetics using Arabidopsis mutants. Genes similar to BOR1 have been reported to share different physiological roles in plants. NIPS;1, a member of aquaporins in Arabidopsis, was then identified as a boric acid channel gene responsible for the B uptake into roots. NIP6;1, the most similar gene to NIPS;1, encodes a B channel essential for B distribution to young leaves. In the present chapter, recent advancement of the understanding of molecular mechanisms of B transport and roles of NIP genes are discussed. PMID:20666226

  19. Analysis of acidity production during enhanced reductive dechlorination using a simplified reactive transport model

    NASA Astrophysics Data System (ADS)

    Brovelli, A.; Barry, D. A.; Robinson, C.; Gerhard, J. I.

    2012-07-01

    Build-up of fermentation products and hydrochloric acid at a contaminated site undergoing enhanced reductive dechlorination can result in groundwater acidification. Sub-optimal pH conditions can inhibit microbial activity and lead to reduced dechlorination rates. The extent of acidification likely to occur is site-specific and depends primarily on the extent of fermentation and dechlorination, the geochemical composition of soil and groundwater, and the pH-sensitivity of the active microbial populations. Here, the key chemical and physical mechanisms that control the extent of groundwater acidification in a contaminated site were examined, and the extent to which the remediation efficiency was affected by variations in groundwater pH was evaluated using a simplified process-based reactive-transport model. This model was applied successfully to a well-documented field site and was then employed in a sensitivity analysis to identify the processes likely to significantly influence acidity production and subsequent microbial inhibition. The accumulation of organic acids produced from the fermentation of the injected substrate was the main cause of the pH change. The concentration of dissolved sulphates controlled substrate utilisation efficiency because sulphate-reducing biomass competed with halo-respiring biomass for the fermentation products. It was shown further that increased groundwater velocity increases dilution and reduces the accumulation of acidic products. As a consequence, the flow rate corresponding to the highest remediation efficiency depends on the fermentation and dechlorination rates. The model enables investigation and forecasting of the extent and areal distribution of pH change, providing a means to optimise the application of reductive dechlorination for site remediation.

  20. Prebiotically plausible mechanisms increase compositional diversity of nucleic acid sequences

    PubMed Central

    Derr, Julien; Manapat, Michael L.; Rajamani, Sudha; Leu, Kevin; Xulvi-Brunet, Ramon; Joseph, Isaac; Nowak, Martin A.; Chen, Irene A.

    2012-01-01

    During the origin of life, the biological information of nucleic acid polymers must have increased to encode functional molecules (the RNA world). Ribozymes tend to be compositionally unbiased, as is the vast majority of possible sequence space. However, ribonucleotides vary greatly in synthetic yield, reactivity and degradation rate, and their non-enzymatic polymerization results in compositionally biased sequences. While natural selection could lead to complex sequences, molecules with some activity are required to begin this process. Was the emergence of compositionally diverse sequences a matter of chance, or could prebiotically plausible reactions counter chemical biases to increase the probability of finding a ribozyme? Our in silico simulations using a two-letter alphabet show that template-directed ligation and high concatenation rates counter compositional bias and shift the pool toward longer sequences, permitting greater exploration of sequence space and stable folding. We verified experimentally that unbiased DNA sequences are more efficient templates for ligation, thus increasing the compositional diversity of the pool. Our work suggests that prebiotically plausible chemical mechanisms of nucleic acid polymerization and ligation could predispose toward a diverse pool of longer, potentially structured molecules. Such mechanisms could have set the stage for the appearance of functional activity very early in the emergence of life. PMID:22319215

  1. Bacterial Transition Metal P1B-ATPases, Transport Mechanism and Roles in Virulence

    PubMed Central

    Argüello, José M.; González-Guerrero, Manuel; Raimunda, Daniel

    2011-01-01

    P1B-type ATPases are polytopic membrane proteins that couple the hydrolysis of ATP to the efflux of cytoplasmic transition metals. This article reviews recent progress in our understanding of the structure and function of these proteins in bacteria. These are members of the P-type superfamily of transport ATPases. Cu+-ATPases are the most frequently observed and best-characterized members of this group of transporters. However, bacterial genomes show diverse arrays of P1B-type ATPases with a range of substrates (Cu+, Zn2+, Co2+). Furthermore, because of the structural similarities among transitions metals, these proteins can also transport non-physiological substrates (Cu2+, Cd2+, Pb2+, Au+, Ag+). P1B-type ATPases have six or eight transmembrane segments (TM) with metal coordinating amino acids in three core TMs flanking the cytoplasmic domain responsible for ATP binding and hydrolysis. In addition, regulatory cytoplasmic metal binding domains are present in most P1B-type ATPases. Central to the transport mechanism is the binding of the uncomplexed metal to these proteins when cytoplasmic substrates are bound to chaperone and chelating molecules. Metal binding to regulatory sites is through a reversible metal exchange among chaperones and cytoplasmic metal binding domains. In contrast, the chaperone-mediated metal delivery to transport sites appears as a largely irreversible event. P1B-ATPases have two overarching physiological functions: to maintain cytoplasmic metal levels and to provide metals for the periplasmic assembly of metalloproteins. Recent studies have shown that both roles are critical for bacterial virulence, since P1B-ATPases appear key to overcome high phagosomal metal levels and are required for the assembly of periplasmic and secreted metalloproteins that are essential for survival in extreme oxidant environments. PMID:21999638

  2. Ion Transport Dynamics in Acid Variable Charge Subsoils

    SciTech Connect

    Qafoku, Nik; Sumner, Malcolm E.; Toma, Mitsuru

    2005-06-06

    This is a mini-review of the research work conducted by the authors with the objective of studying ion transport in variable charge subsoils collected from different areas around the world. An attempt is made in these studies to relate the unique behavior manifested during ionic transport in these subsoils with their mineralogical, physical and chemical properties, which are markedly different from those in soils from temperate regions. The variable charge subsoils have a relatively high salt sorption capacity and anion exchange capacity (AEC) that retards anions downward movement. The AEC correlates closely with the anion retardation coefficients. Ca2+ applied with gypsum in topsoil may be transported to the subsoil and may improve the subsoil chemical properties. These results may help in developing appropriate management strategies under a range of mineralogical, physical, and chemical conditions.

  3. Structural basis for Na(+) transport mechanism by a light-driven Na(+) pump.

    PubMed

    Kato, Hideaki E; Inoue, Keiichi; Abe-Yoshizumi, Rei; Kato, Yoshitaka; Ono, Hikaru; Konno, Masae; Hososhima, Shoko; Ishizuka, Toru; Hoque, Mohammad Razuanul; Kunitomo, Hirofumi; Ito, Jumpei; Yoshizawa, Susumu; Yamashita, Keitaro; Takemoto, Mizuki; Nishizawa, Tomohiro; Taniguchi, Reiya; Kogure, Kazuhiro; Maturana, Andrés D; Iino, Yuichi; Yawo, Hiromu; Ishitani, Ryuichiro; Kandori, Hideki; Nureki, Osamu

    2015-05-01

    Krokinobacter eikastus rhodopsin 2 (KR2) is the first light-driven Na(+) pump discovered, and is viewed as a potential next-generation optogenetics tool. Since the positively charged Schiff base proton, located within the ion-conducting pathway of all light-driven ion pumps, was thought to prohibit the transport of a non-proton cation, the discovery of KR2 raised the question of how it achieves Na(+) transport. Here we present crystal structures of KR2 under neutral and acidic conditions, which represent the resting and M-like intermediate states, respectively. Structural and spectroscopic analyses revealed the gating mechanism, whereby the flipping of Asp116 sequesters the Schiff base proton from the conducting pathway to facilitate Na(+) transport. Together with the structure-based engineering of the first light-driven K(+) pumps, electrophysiological assays in mammalian neurons and behavioural assays in a nematode, our studies reveal the molecular basis for light-driven non-proton cation pumps and thus provide a framework that may advance the development of next-generation optogenetics. PMID:25849775

  4. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  5. Effect of the peroxisome proliferator perfluoro-n-decanoic acid on glucose transport in the isolated perfused rat liver.

    PubMed

    Goecke-Flora, C M; Wyman, J F; Jarnot, B M; Reo, N V

    1995-01-01

    The perfluorinated carboxylic acid, perfluoro-n-decanoic acid (PFDA), is a known peroxisome proliferator which displays toxicity in rodents. Using a paired-tracer first-pass extraction technique, the effect of PFDA on hepatic glucose transport was determined in the isolated perfused rat liver. In brief, livers isolated from PFDA-treated and control rats on day 5 posttreatment were administered the radiolabeled glucose analog, 3-O-[14C]methyl-D-glucose ([14C]3-O-MG) in addition to [fructose-1-3H(N)]sucrose ([3H]sucrose), which served as a measure of extracellular volume. Hepatic glucose transport was calculated from the change in the ratio [14C]3-O-MG/[3H]sucrose during passage through the liver. Data from this study indicate that PFDA inhibits hepatic glucose transport. Percent hepatic glucose extraction is 1.8-fold greater in controls than in PFDA-treated rats. No significant difference in lactate dehydrogenase levels was observed in the liver perfusate from PFDA-treated and control rats. This suggests that the difference in percent glucose extraction between PFDA-treated and control groups is specifically due to the PFDA treatment and is not attributed to differences in liver viability between groups. Although the exact mechanism for this inhibition in hepatic glucose transport is not known, it is hypothesized that PFDA may have a major impact on membrane structure/function which, in turn, may alter glucose transport. PMID:7703370

  6. The SLC36 family of proton-coupled amino acid transporters and their potential role in drug transport

    PubMed Central

    Thwaites, David T; Anderson, Catriona MH

    2011-01-01

    Members of the solute carrier (SLC) 36 family are involved in transmembrane movement of amino acids and derivatives. SLC36 consists of four members. SLC36A1 and SLC36A2 both function as H+-coupled amino acid symporters. SLC36A1 is expressed at the luminal surface of the small intestine but is also commonly found in lysosomes in many cell types (including neurones), suggesting that it is a multipurpose carrier with distinct roles in different cells including absorption in the small intestine and as an efflux pathway following intralysosomal protein breakdown. SLC36A1 has a relatively low affinity (Km 1–10 mM) for its substrates, which include zwitterionic amino and imino acids, heterocyclic amino acids and amino acid-based drugs and derivatives used experimentally and/or clinically to treat epilepsy, schizophrenia, bacterial infections, hyperglycaemia and cancer. SLC36A2 is expressed at the apical surface of the human renal proximal tubule where it functions in the reabsorption of glycine, proline and hydroxyproline. SLC36A2 also transports amino acid derivatives but has a narrower substrate selectivity and higher affinity (Km 0.1–0.7 mM) than SLC36A1. Mutations in SLC36A2 lead to hyperglycinuria and iminoglycinuria. SLC36A3 is expressed only in testes and is an orphan transporter with no known function. SLC36A4 is widely distributed at the mRNA level and is a high-affinity (Km 2–3 µM) transporter for proline and tryptophan. We have much to learn about this family of transporters, but from current knowledge, it seems likely that their function will influence the pharmacokinetic profiles of amino acid-based drugs by mediating transport in both the small intestine and kidney. LINKED ARTICLES This article is part of a themed section on Transporters. To view the other articles in this section visit http://dx.doi.org/10.1111/bph.2011.164.issue-7 PMID:21501141

  7. The nitric oxide-donating derivative of acetylsalicylic acid, NCX 4016, stimulates glucose transport and glucose transporters translocation in 3T3-L1 adipocytes.

    PubMed

    Kaddai, V; Gonzalez, T; Bolla, M; Le Marchand-Brustel, Y; Cormont, M

    2008-07-01

    NCX 4016 is a nitric oxide (NO)-donating derivative of acetylsalicylic acid. NO and salicylate, in vivo metabolites of NCX 4016, were shown to be potential actors in controlling glucose homeostasis. In this study, we evaluated the action of NCX 4016 on the capacity of 3T3-L1 adipocytes to transport glucose in basal and insulin-stimulated conditions. NCX 4016 induced a twofold increase in glucose uptake in parallel with the translocation of the glucose transporters GLUT1 and GLUT4 to the plasma membrane, leaving unaffected their total expression levels. Importantly, NCX 4016 further increased glucose transport induced by a physiological concentration of insulin. The stimulatory effect of NCX 4016 on glucose uptake appears to be mediated by its NO moiety. Indeed, it is inhibited by a NO scavenger and treatment with acetylsalicylic or salicylic acid had no effect. Although NO is involved in the action of NCX 4016, it did not mainly depend on the soluble cGMP cyclase/protein kinase G pathway. Furthermore, NCX 4016-stimulated glucose transport did not involve the insulin-signaling cascade required to stimulate glucose transport. NCX 4016 induces a small activation of the mitogen-activated protein kinases p38 and c-Jun NH(2)-terminal kinase and no activation of other stress-activated signaling molecules, including extracellular signal-regulated kinase, inhibitory factor kappaB, or AMP-activated kinases. Interestingly, NCX 4016 modified the content of S-nitrosylated proteins in adipocytes. Taken together, our results indicate that NCX 4016 induced glucose transport in adipocytes through a novel mechanism possibly involving S-nitrosylation. NCX 4016 thus possesses interesting characteristics to be considered as a candidate molecule for the treatment of patients suffering from metabolic syndrome and type 2 diabetes. PMID:18492771

  8. CO2-ECBM related coupled physical and mechanical transport processes

    NASA Astrophysics Data System (ADS)

    Gensterblum, Y.; Sartorius, M.; Busch, A.; Krooss, B. M.; Littke, R.

    2012-12-01

    The interrelation of cleat transport processes and mechanical properties was investigated by permeability tests at different stress levels (60% to 130% of in-situ stress) with sorbing (CH4, CO2) and inert gases (N2, Ar, He) on a subbituminous A coal from the Surat Basin, Queensland Australia (figure). From the flow tests under controlled triaxial stress conditions the Klinkenberg-corrected "true" permeability coefficients and the Klinkenberg slip factors were derived. The "true"-, absolute or Klinkenberg-corrected permeability depends on gas type. Following the approach of Seidle et al. (1992) the cleat volume compressibility (cf) was calculated from observed changes in apparent permeability upon variation of external stress (at equal mean gas pressures). The observed effects also show a clear dependence on gas type. Due to pore or cleat compressibility the cleat aperture decreases with increasing effective stress. Vice versa, with increasing mean pore pressure at lower confining pressure an increase in permeability is observed, which is attributed to a widening of cleat aperture. Non-sorbing gases like helium and argon show higher apparent permeabilities than sorbing gases like methane and CO2. Permeability coefficients measured with successively increasing mean gas pressures were consistently lower than those determined at decreasing mean gas pressures. The kinetics of matrix transport processes were studied by sorption tests on different particle sizes at various moisture contents and temperatures (cf. Busch et al., 2006). Methane uptake rates were determined from the pressure decline curves recorded for each particle-size fraction, and "diffusion coefficients" were calculated using several unipore and bidisperse diffusion models. While the CH4 sorption capacity of moisture-equilibrated coals was significantly lower (by 50%) than that of dry coals, no hysteresis was observed between sorption and desorption on dry and moisture-equilibrated samples and the

  9. Characterization of the role of ABCG2 as a bile acid transporter in liver and placenta.

    PubMed

    Blazquez, Alba G; Briz, Oscar; Romero, Marta R; Rosales, Ruben; Monte, Maria J; Vaquero, Javier; Macias, Rocio I R; Cassio, Doris; Marin, Jose J G

    2012-02-01

    ABCG2 is involved in epithelial transport/barrier functions. Here, we have investigated its ability to transport bile acids in liver and placenta. Cholylglycylamido fluorescein (CGamF) was exported by WIF-B9/R cells, which do not express the bile salt export pump (BSEP). Sensitivity to typical inhibitors suggested that CGamF export was mainly mediated by ABCG2. In Chinese hamster ovary (CHO cells), coexpression of rat Oatp1a1 and human ABCG2 enhanced the uptake and efflux, respectively, of CGamF, cholic acid (CA), glycoCA (GCA), tauroCA, and taurolithocholic acid-3-sulfate. The ability of ABCG2 to export these bile acids was confirmed by microinjecting them together with inulin in Xenopus laevis oocytes expressing this pump. ABCG2-mediated bile acid transport was inhibited by estradiol 17β-d-glucuronide and fumitremorgin C. Placental barrier for bile acids accounted for <2-fold increase in fetal cholanemia despite >14-fold increased maternal cholanemia induced by obstructive cholestasis in pregnant rats. In rat placenta, the expression of Abcg2, which was much higher than that of Bsep, was not affected by short-term cholestasis. In pregnant rats, fumitremorgin C did not affect uptake/secretion of GCA by the liver but inhibited its fetal-maternal transfer. Compared with wild-type mice, obstructive cholestasis in pregnant Abcg2(-/-) knockout mice induced similar bile acid accumulation in maternal serum but higher accumulation in placenta, fetal serum, and liver. In conclusion, ABCG2 is able to transport bile acids. The importance of this function depends on the relative expression in the same epithelium of other bile acid exporters. Thus, ABCG2 may play a key role in bile acid transport in placenta, as BSEP does in liver. PMID:22096226

  10. Fluid flow and particle transport in mechanically ventilated airways. Part II: particle transport.

    PubMed

    Alzahrany, Mohammed; Van Rhein, Timothy; Banerjee, Arindam; Salzman, Gary

    2016-07-01

    The flow mechanisms that play a role on aerosol deposition were identified and presented in a companion paper (Timothy et al. in Med Biol Eng Comput. doi: 10.1007/s11517-015-1407-3 , 2015). In the current paper, the effects of invasive conventional mechanical ventilation waveforms and endotracheal tube (ETT) on the aerosol transport were investigated. In addition to the enhanced deposition seen at the carinas of the airway bifurcations, enhanced deposition was also seen in the right main bronchus due to impaction and turbulent dispersion resulting from the fluid structures created by jet caused by the ETT. The orientation of the ETT toward right bronchus resulted in a substantial deposition inside right lung compared to left lung. The deposition inside right lung was ~12-fold higher than left lung for all considered cases, except for the case of using pressure-controlled sinusoidal waveform where a reduction of this ratio by ~50 % was found. The total deposition during pressure constant, volume ramp, and ascending ramp waveforms was similar and ~1.44 times higher than deposition fraction when using pressure sinusoidal waveform. Varying respiratory waveform demonstrated a significant role on the deposition enhancement factors and give evidence of drug aerosol concentrations in key deposition sites, which may be significant for drugs with negative side effects in high concentrations. These observations are thought to be important for ventilation treatment strategy. PMID:26541600

  11. Glucocorticoid-dependent induction of interleukin-6 receptor expression in human hepatocytes facilitates interleukin-6 stimulation of amino acid transport.

    PubMed Central

    Fischer, C P; Bode, B P; Takahashi, K; Tanabe, K K; Souba, W W

    1996-01-01

    OBJECTIVE: The authors studied the effects of interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-alpha) on glutamine and alanine transport in isolated human hepatocytes. They also evaluated the role of dexamethasone in modulating this response and its effects on the expression of the plasma membrane high-affinity IL-6 receptor. SUMMARY BACKGROUND DATA: Animal studies indicate that cytokines are important mediators of the increased hepatic amino acid uptake that occurs during cancer and sepsis, but studies in human tissues are lacking. The control of transport by cytokines and cytokine receptor expression in the liver may provide a mechanism by which hepatocytes can modulate amino acid availability during catabolic disease states. METHODS: Human hepatocytes were isolated from wedge biopsy specimens and plated in 24-well trays. Interleukin-6 and TNF-alpha, in combination with the synthetic glucocorticoid dexamethasone, were added to hepatocytes in culture, and the transport of radiolabeled glutamine and alanine was measured. Fluorescent-activated cell sorter (FACS) analysis was used to study the effects of dexamethasone on IL-6 receptor number in the well-differentiated human hepatoma HepG2. RESULTS: Both IL-6 and TNF-alpha exerted a small stimulatory effect on alanine and glutamine transport. Dexamethasone alone did not alter transport rates, but pretreatment of cells augmented the effects of both cytokines on carrier-mediated amino acid uptake. Dexamethasone pretreatment and a combination of IL-6 and TNF-alpha resulted in a greater than twofold increase in transport activity. Fluorescent-activated cell sorter analysis demonstrated that dexamethasone induced a threefold increase in the expression of high-affinity IL-6 receptors. CONCLUSIONS: Interleukin-6 and TNF-alpha work coordinately with glucocorticoids to stimulate amino acid uptake in human hepatocytes. Dexamethasone exerts a permissive effect on cytokine-mediated increases in transport by increasing IL

  12. Sex-dependent activity of the spinal excitatory amino acid transporter: Role of estrous cycle.

    PubMed

    Sajjad, Jahangir; Felice, Valeria D; Golubeva, Anna V; Cryan, John F; O'Mahony, Siobhain M

    2016-10-01

    Females are more likely to experience visceral pain than males, yet mechanisms underlying this sex bias are not fully elucidated. Moreover, pain sensitivity can change throughout the menstrual cycle. Alterations in the glutamatergic system have been implicated in several pain-disorders; however, whether these are sex-dependent is unclear. Thus, we aimed to investigate sex differences in the spinal cord glutamate uptake and how it varies across the estrous cycle. The activity of the glutamate transporters, excitatory amino acid transporters (EAATs) was assessed using an ex vivo aspartate radioactive uptake assay in the lumbosacral spinal cord in Sprague-Dawley male and female rats. The gene expression of EAATs, glutamate receptor subunits NR1 and NR2B and the estrogen receptors ERα & ERβ in the spinal cord were also analyzed. EAAT activity was lower in females, particularly during the estrus phase, and this was the only cycle stage that was responsive to the pharmacological effects of the EAATs activator riluzole. Interestingly, EAAT1 mRNA expression was lower in high-estrogen and high-ERα states compared to diestrus in females. We conclude that the Spinal EAAT activity in females is different to that in males, and varies across the estrous cycle. Furthermore, the expression levels of estrogen receptors also showed a cycle-dependent pattern that may affect EAATs function and expression. PMID:27471194

  13. Role of organic anion-transporting polypeptides for cellular mesalazine (5-aminosalicylic acid) uptake.

    PubMed

    König, Jörg; Glaeser, Hartmut; Keiser, Markus; Mandery, Kathrin; Klotz, Ulrich; Fromm, Martin F

    2011-06-01

    The therapeutic effects and metabolism of mesalazine (5-aminosalicylic acid) in patients with inflammatory bowel disease require intracellular accumulation of the drug in intestinal epithelial cells and hepatocytes. The molecular mechanisms of mesalazine uptake into cells have not been characterized so far. Using human embryonic kidney cells stably expressing uptake transporters of the organic anion-transporting polypeptide (OATP) family, which are expressed in human intestine and/or liver, we found that mesalazine uptake is mediated by OATP1B1, OATP1B3, and OATP2B1 but not by OATP1A2 and OATP4A1. Moreover, genetic variations (*1b, *5, *15) in the SLCO1B1 gene encoding OATP1B1 reduced the K(m) value for mesalazine uptake from 55.1 to 16.3, 24.3, and 32.4 μM, respectively, and the respective V(max) values. Finally, budesonide, cyclosporine, and rifampin were identified as inhibitors of OATP1B1-, OATP1B3-, and OATP2B1-meditated mesalazine uptake. These in vitro data indicate that OATP-mediated uptake and its modification by genetic factors and comedications may play a role for mesalazine effects. PMID:21430235

  14. Structural basis of intramitochondrial phosphatidic acid transport mediated by Ups1-Mdm35 complex

    PubMed Central

    Yu, Fang; He, Fangyuan; Yao, Hongyan; Wang, Chengyuan; Wang, Jianchuan; Li, Jianxu; Qi, Xiaofeng; Xue, Hongwei; Ding, Jianping; Zhang, Peng

    2015-01-01

    Ups1 forms a complex with Mdm35 and is critical for the transport of phosphatidic acid (PA) from the mitochondrial outer membrane to the inner membrane. We report the crystal structure of the Ups1-Mdm35-PA complex and the functional characterization of Ups1-Mdm35 in PA binding and transfer. Ups1 features a barrel-like structure consisting of an antiparallel β-sheet and three α-helices. Mdm35 adopts a three-helical clamp-like structure to wrap around Ups1 to form a stable complex. The β-sheet and α-helices of Ups1 form a long tunnel-like pocket to accommodate the substrate PA, and a short helix α2 acts as a lid to cover the pocket. The hydrophobic residues lining the pocket and helix α2 are critical for PA binding and transfer. In addition, a hydrophilic patch on the surface of Ups1 near the PA phosphate-binding site also plays an important role in the function of Ups1-Mdm35. Our study reveals the molecular basis of the function of Ups1-Mdm35 and sheds new light on the mechanism of intramitochondrial phospholipid transport by the MSF1/PRELI family proteins. PMID:26071601

  15. Light-activated amino acid transport in Halobacterium halobium envelope vesicles

    NASA Technical Reports Server (NTRS)

    Macdonald, R. E.; Lanyi, J. K.

    1977-01-01

    Vesicles prepared from Halobacterium halobium cell envelopes accumulate amino acids in response to light-induced electrical and chemical gradients. Nineteen of 20 commonly occurring amino acids have been shown to be actively accumulated by these vesicles in response to illumination or in response to an artificially created Na+ gradient. On the basis of shared common carriers the transport systems can be divided into eight classes, each responsible for the transport of one or several amino acids: arginine, lysine, histidine; asparagine, glutamine; alanine, glycine, threonine, serine; leucine, valine, isoleucine, methionine; phenylalanine, tyrosine, tryptophan; aspartate; glutamate; proline. Available evidence suggests that these carriers are symmetrical in that amino acids can be transported equally well in both directions across the vesicle membranes. A tentative working model to account for these observations is presented.

  16. Active transport of vesicles in neurons is modulated by mechanical tension

    NASA Astrophysics Data System (ADS)

    Ahmed, Wylie W.; Saif, Taher A.

    2014-03-01

    Effective intracellular transport of proteins and organelles is critical in cells, and is especially important for ensuring proper neuron functionality. In neurons, most proteins are synthesized in the cell body and must be transported through thin structures over long distances where normal diffusion is insufficient. Neurons transport subcellular cargo along axons and neurites through a stochastic interplay of active and passive transport. Mechanical tension is critical in maintaining proper function in neurons, but its role in transport is not well understood. To this end, we investigate the active and passive transport of vesicles in Aplysia neurons while changing neurite tension via applied strain, and quantify the resulting dynamics. We found that tension in neurons modulates active transport of vesicles by increasing the probability of active motion, effective diffusivity, and induces a retrograde bias. We show that mechanical tension modulates active transport processes in neurons and that external forces can couple to internal (subcellular) forces and change the overall transport dynamics.

  17. Myosin 1b Regulates Amino Acid Transport by Associating Transporters with the Apical Plasma Membrane of Kidney Cells

    PubMed Central

    Komaba, Shigeru; Coluccio, Lynne M.

    2015-01-01

    Amino acid transporters (AATers) in the brush border of the apical plasma membrane (APM) of renal proximal tubule (PT) cells mediate amino acid transport (AAT). We found that the membrane-associated class I myosin myosin 1b (Myo1b) localized at the apical brush border membrane of PTs. In opossum kidney (OK) 3B/2 epithelial cells, which are derived from PTs, expressed rat Myo1b-GFP colocalized in patched microvilli with expressed mouse V5-tagged SIT1 (SIT1-V5), which mediates neutral amino acid transport in OK cells. Lentivirus-mediated delivery of opossum Myo1b-specific shRNA resulted in knockdown (kd) of Myo1b expression, less SIT1-V5 at the APM as determined by localization studies, and a decrease in neutral AAT as determined by radioactive uptake assays. Myo1b kd had no effect on Pi transport or noticeable change in microvilli structure as determined by rhodamine phalloidin staining. The studies are the first to define a physiological role for Myo1b, that of regulating renal AAT by modulating the association of AATers with the APM. PMID:26361046

  18. Bibliography for acid-rock drainage and selected acid-mine drainage issues related to acid-rock drainage from transportation activities

    USGS Publications Warehouse

    Bradley, Michael W.; Worland, Scott C.

    2015-01-01

    Acid-rock drainage occurs through the interaction of rainfall on pyrite-bearing formations. When pyrite (FeS2) is exposed to oxygen and water in mine workings or roadcuts, the mineral decomposes and sulfur may react to form sulfuric acid, which often results in environmental problems and potential damage to the transportation infrastructure. The accelerated oxidation of pyrite and other sulfidic minerals generates low pH water with potentially high concentrations of trace metals. Much attention has been given to contamination arising from acid mine drainage, but studies related to acid-rock drainage from road construction are relatively limited. The U.S. Geological Survey, in cooperation with the Tennessee Department of Transportation, is conducting an investigation to evaluate the occurrence and processes controlling acid-rock drainage and contaminant transport from roadcuts in Tennessee. The basic components of acid-rock drainage resulting from transportation activities are described and a bibliography, organized by relevant categories (remediation, geochemical, microbial, biological impact, and secondary mineralization) is presented.

  19. Center for low-gravity fluid mechanics and transport phenomena

    NASA Technical Reports Server (NTRS)

    Kassoy, D. R.; Sani, R. L.

    1991-01-01

    Research projects in several areas are discussed. Mass transport in vapor phase systems, droplet collisions and coalescence in microgravity, and rapid solidification of undercooled melts are discussed.

  20. Single-vesicle imaging reveals different transport mechanisms between glutamatergic and GABAergic vesicles.

    PubMed

    Farsi, Zohreh; Preobraschenski, Julia; van den Bogaart, Geert; Riedel, Dietmar; Jahn, Reinhard; Woehler, Andrew

    2016-02-26

    Synaptic transmission is mediated by the release of neurotransmitters, which involves exo-endocytotic cycling of synaptic vesicles. To maintain synaptic function, synaptic vesicles are refilled with thousands of neurotransmitter molecules within seconds after endocytosis, using the energy provided by an electrochemical proton gradient. However, it is unclear how transmitter molecules carrying different net charges can be efficiently sequestered while maintaining charge neutrality and osmotic balance. We used single-vesicle imaging to monitor pH and electrical gradients and directly showed different uptake mechanisms for glutamate and γ-aminobutyric acid (GABA) operating in parallel. In contrast to glutamate, GABA was exchanged for protons, with no other ions participating in the transport cycle. Thus, only a few components are needed to guarantee reliable vesicle filling with different neurotransmitters. PMID:26912364

  1. The importance of glutamate, glycine, and {gamma}-aminobutyric acid transport and regulation in manganese, mercury and lead neurotoxicity

    SciTech Connect

    Fitsanakis, Vanessa A.; Aschner, Michael . E-mail: michael.aschner@vanderbilt.edu

    2005-05-01

    Historically, amino acids were studied in the context of their importance in protein synthesis. In the 1950s, the focus of research shifted as amino acids were recognized as putative neurotransmitters. Today, many amino acids are considered important neurochemicals. Although many amino acids play a role in neurotransmission, glutamate (Glu), glycine (Gly), and {gamma}-aminobutyric acid (GABA) are among the more prevalent and better understood. Glu, the major excitatory neurotransmitter, and Gly and GABA, the major inhibitory neurotransmitters, in the central nervous system, are known to be tightly regulated. Prolonged exposure to environmental toxicants, such as manganese (Mn), mercury (Hg), or lead (Pb), however, can lead to dysregulation of these neurochemicals and subsequent neurotoxicity. While the ability of these metals to disrupt the regulation of Glu, Gly and GABA have been studied, few articles have examined the collective role of these amino acids in the respective metal's mechanism of toxicity. For each of the neurotransmitters above, we will provide a brief synopsis of their regulatory function, including the importance of transport and re-uptake in maintaining their optimal function. Additionally, the review will address the hypothesis that aberrant homeostasis of any of these amino acids, or a combination of the three, plays a role in the neurotoxicity of Mn, Hg, or Pb.

  2. The solute carrier family 10 (SLC10): beyond bile acid transport

    PubMed Central

    da Silva, Tatiana Claro; Polli, James E.; Swaan, Peter W.

    2012-01-01

    The solute carrier (SLC) family 10 (SLC10) comprises influx transporters of bile acids, steroidal hormones, various drugs, and several other substrates. Because the seminal transporters of this family, namely, sodium/taurocholate cotransporting polypeptide (NTCP; SLC10A1) and the apical sodium-dependent bile acid transporter (ASBT; SLC10A2), were primarily bile acid transporters, the term “sodium bile salt cotransporting family” was used for the SLC10 family. However, this notion became obsolete with the finding of other SLC10 members that do not transport bile acids. For example, the sodium-dependent organic anion transporter (SOAT; SLC10A6) transports primarily sulfated steroids. Moreover, NTCP was shown to also transport steroids and xenobiotics, including HMG-CoA inhibitors (statins). The SLC10 family contains four additional members, namely, P3 (SLC10A3; SLC10A3), P4 (SLC10A4; SLC10A4), P5 (SLC10A5; SLC10A5) and SLC10A7 (SLC10A7), several of which were unknown or considered hypothetical until approximately a decade ago. While their substrate specificity remains undetermined, great progress has been made towards their characterization in recent years. SLC10A4 may participate in vesicular storage or exocytosis of neurotransmitters or mastocyte mediators, whereas SLC10A5 and SLC10A7 may be involved in solute transport and SLC10A3 may have a role as a housekeeping protein. Finally, the newly found role of bile acids in glucose and energy homeostasis, via the TGR5 receptor, sheds new light on the clinical relevance of ASBT and NTCP. The present mini-review provides a brief summary of recent progress on members of the SLC10 family. PMID:23506869

  3. Interannual forcing mechanisms of California Current transports II: Mesoscale eddies

    NASA Astrophysics Data System (ADS)

    Davis, Andrew; Di Lorenzo, Emanuele

    2015-02-01

    Mesoscale eddies exert dominant control of cross-shelf exchanges, yet the forcing dynamics underlying their interannual and decadal variability remain uncertain. Using an ensemble of high-resolution ocean model hindcasts of the central and eastern North Pacific from 1950 to 2010 we diagnose the forcing mechanisms of low-frequency eddy variability in the California Current System (CCS). We quantify eddy activity by developing eddy counts based on closed contours of the Okubo-Weiss parameter and find that the spatial and temporal features of model-derived counts largely reproduce the short AVISO observational record. Comparison of model ensemble members allows us to separate the intrinsic and deterministic fractions of eddy variability in the northern CCS (34.5-50°N) and in the southern CCS (28.5-34.5°N). In the North, a large fraction of low-frequency eddy variability (30% anticyclones, 20% cyclones) is deterministic and shared with satellite observations. We develop a diagnostic model based on indices of the large-scale barotropic and baroclinic states of the CCS which recovers this deterministic variance. This model also strongly correlates with local atmospheric forcing. In contrast to the North, Southern CCS eddy counts exhibit very little deterministic variance, and eddy formation closely resembles a red-noise process. This new understanding of the external forcings of eddy variability allows us to better estimate how climate variability and change impact mesoscale transports in the California Current. The skill of our diagnostic model and its close association with local wind stress curl indicate that local atmospheric forcing is the dominant driver of eddy activity on interannual and decadal time scales north of pt. conception (~33°N).

  4. Transport and defect mechanism in copper-based delafossite materials

    NASA Astrophysics Data System (ADS)

    Ingram, Brian James

    The defect mechanism and transport properties of cuprous-based delafossite compounds of the general form CuMO2 (M = Al, Sc, and Y) were investigated. The size of the B-site cation (M), plays a significant role in determining the electrical properties of the compound. All the systems under investigation, regardless of B-site cation, are small polaron conductors which exhibit thermally activated mobilities, consequently the upper bound of mobility is 0.10--1.0 cm2 V -1 s-1. The defect mechanism is strongly dependant on the size and chemistry of the B-site cation. The Al-compound has a moderate room temperature conductivity of ˜1.5 x 10-2 S/cm and a hole concentration on the order of 1019 cm-3. Intrinsic defects such as Oi″ and VCu• as well as tramp impurity (e.g., CaAl') do not contribute significantly to the hole population, which corresponds to approximately 1% polaron occupation of the Cu sites at high temperatures. A defect associate of the form (AlCu••2O i″)″ was found to be the dominant source of hole generation in CuAlO2. At low temperatures two holes (CuCu•) tightly bind with forming a neutral complex. The large B-site cation compounds (CuScO2 and CuYO2) do not exhibit an equivalent defect associate due to the instability of Sc and Y in low coordination sites, therefore the intrinsic Sc- and Y-compounds have inferior electrical properties compared to CuAlO2. The large B-site compounds do, however, have a propensity for acceptor dopants, e.g., oxygen interstitials and extrinsic doping. Under the experimental conditions of this study, isolated oxygen interstitials were found in insignificant concentrations. The solubility limits of Mg in CuScO2 and Ca in CuYO2 were found to be approximately 1% and 0.2%, respectively, corresponding to room temperature conductivities of 2 x 10-2 and 1.7 x 10-3 S cm-1---substantial increases from the undoped values. Based on small polaron theory a maximum conductivity was determined to be ˜600 S cm-1 for the

  5. PARAMETRIC METHODOLOGIES OF CLOUD VERTICAL TRANSPORT FOR ACID DEPOSITION MODELS

    EPA Science Inventory

    A CUmulus VENTing (CUVENT) cloud module has been developed that calculates the vertical flux of mass from the boundary layer to the cloud layer by an ensemble of nonprecipitating subgrid-scale air mass clouds. This model will be integrated into the Regional Acid Deposition Model ...

  6. The glutamate and neutral amino acid transporter family: physiological and pharmacological implications.

    PubMed

    Kanai, Yoshikatsu; Hediger, Matthias A

    2003-10-31

    The solute carrier family 1 (SLC1) is composed of five high affinity glutamate transporters, which exhibit the properties of the previously described system XAG-, as well as two Na+-dependent neutral amino acid transporters with characteristics of the so-called "ASC" (alanine, serine and cysteine). The SLC1 family members are structurally similar, with almost identical hydropathy profiles and predicted membrane topologies. The transporters have eight transmembrane domains and a structure reminiscent of a pore loop between the seventh and eighth domains [Neuron 21 (1998) 623]. However, each of these transporters exhibits distinct functional properties. Glutamate transporters mediate transport of L-Glu, L-Asp and D-Asp, accompanied by the cotransport of 3 Na+ and one 1 H+, and the countertransport of 1 K+, whereas ASC transporters mediate Na+-dependent exchange of small neutral amino acids such as Ala, Ser, Cys and Thr. Given the high concentrating capacity provided by the unique ion coupling pattern of glutamate transporters, they play crucial roles in protecting neurons against glutamate excitotoxicity in the central nervous system (CNS). The regulation and manipulation of their function is a critical issue in the pathogenesis and treatment of CNS disorders involving glutamate excitotoxicity. Loss of function of the glial glutamate transporter GLT1 (SLC1A2) has been implicated in the pathogenesis of amyotrophic lateral sclerosis (ALS), resulting in damage of adjacent motor neurons. The importance of glial glutamate transporters in protecting neurons from extracellular glutamate was further demonstrated in studies of the slc1A2 glutamate transporter knockout mouse. The findings suggest that therapeutic upregulation of GLT1 may be beneficial in a variety of pathological conditions. Selective inhibition of the neuronal glutamate transporter EAAC1 (SLC1A1) but not the glial glutamate transporters may be of therapeutic interest, allowing blockage of glutamate exit from

  7. The Emergence and Evolution of Life in a "Fatty Acid World" Based on Quantum Mechanics

    NASA Astrophysics Data System (ADS)

    Tamulis, Arvydas; Grigalavicius, Mantas

    2011-02-01

    Quantum mechanical based electron correlation interactions among molecules are the source of the weak hydrogen and Van der Waals bonds that are critical to the self-assembly of artificial fatty acid micelles. Life on Earth or elsewhere could have emerged in the form of self-reproducing photoactive fatty acid micelles, which gradually evolved into nucleotide-containing micelles due to the enhanced ability of nucleotide-coupled sensitizer molecules to absorb visible light. Comparison of the calculated absorption spectra of micelles with and without nucleotides confirmed this idea and supports the idea of the emergence and evolution of nucleotides in minimal cells of a so-called Fatty Acid World. Furthermore, the nucleotide-caused wavelength shift and broadening of the absorption pattern potentially gives these molecules an additional valuable role, other than a purely genetic one in the early stages of the development of life. From the information theory point of view, the nucleotide sequences in such micelles carry positional information providing better electron transport along the nucleotide-sensitizer chain and, in addition, providing complimentary copies of that information for the next generation. Nucleotide sequences, which in the first period of evolution of fatty acid molecules were useful just for better absorbance of the light in the longer wavelength region, later in the PNA or RNA World, took on the role of genetic information storage.

  8. In vitro exploration of potential mechanisms of toxicity of the human hepatotoxic drug fenclozic acid.

    PubMed

    Rodrigues, Alison V M; Rollison, Helen E; Martin, Scott; Sarda, Sunil; Schulz-Utermoehl, Timothy; Stahl, Simone; Gustafsson, Frida; Eakins, Julie; Kenna, J Gerry; Wilson, Ian D

    2013-08-01

    The carboxylic acid NSAID fenclozic acid exhibited an excellent preclinical safety profile and promising clinical efficacy, yet was withdrawn from clinical development in 1971 due to hepatotoxicity observed in clinical trials. A variety of modern in vitro approaches have been used to explore potential underlying mechanisms. Covalent binding studies were undertaken with [(14)C]-fenclozic acid to investigate the possible role of reactive metabolites. Time-dependent covalent binding to protein was observed in NADPH-supplemented liver microsomes, although no metabolites were detected in these incubations or in reactive metabolite trapping experiments. In human hepatocytes, covalent binding was observed at lower levels than in microsomes and a minor uncharacterizable metabolite was also observed. In addition, covalent binding was observed in incubations undertaken with dog and rat hepatocytes, where a taurine conjugate of the drug was detected. Although an acyl glucuronide metabolite was detected when liver microsomes from human, rat and dog were supplemented with UDPGA, there was no detectable UDPGA-dependent covalent binding. No effects were observed when fenclozic acid was assessed for P450-dependent and P450-independent cytotoxicity to THLE cell lines, time-dependent inhibition of five major human cytochrome P450 enzymes, inhibition of the biliary efflux transporters BSEP and MRP2 or mitochondrial toxicity to THLE or HepG2 cells. These data suggest that Phase 1 bioactivation plays a role in the hepatotoxicity of fenclozic acid and highlight the unique insight into mechanisms of human drug toxicity that can be provided by investigations of biotransformation and covalent binding to proteins. PMID:23609606

  9. Mechanisms by which docosahexaenoic acid and related fatty acids reduce colon cancer risk and inflammatory disorders of the intestine

    PubMed Central

    Chapkin, Robert S.; Seo, Jeongmin; McMurray, David N.; Lupton, Joanne R.

    2008-01-01

    A growing body of epidemiological, clinical, and experimental evidence has underscored both the pharmacological potential and the nutritional value of dietary fish oil enriched in very long chain n-3 PUFAs such as docosahexaenoic acid (DHA, 22:6, n-3) and eicosapentaenoic acid (EPA, 20:5, n-3). The broad health benefits of very long chain n-3 PUFAs and the pleiotropic effects of dietary fish oil and DHA have been proposed to involve alterations in membrane structure and function, eicosanoid metabolism, gene expression and the formation of lipid peroxidation products, although a comprehensive understanding of the mechanisms of action has yet to be elucidated. In this review, we present data demonstrating that DHA selectively modulates the subcellular localization of lipidated signaling proteins depending on their transport pathway, which may be universally applied to other lipidated protein trafficking. An interesting possibility raised by the current observations is that lipidated proteins may exhibit different subcellular distribution profiles in various tissues, which contain a distinct membrane lipid composition. In addition, the current findings clearly indicate that subcellular localization of proteins with a certain trafficking pathway can be subjected to selective regulation by dietary manipulation. This form of regulated plasma membrane targeting of a select subset of upstream signaling proteins may provide cells with the flexibility to coordinate the arrangement of signaling translators on the cell surface. Ultimately, this may allow organ systems such as the colon to optimally decode, respond, and adapt to the vagaries of an ever-changing extracellular environment. PMID:18346463

  10. Investigation of mechanics of mine acid formation. Volume 1

    SciTech Connect

    Paciorek, K.L.; Kimble, P.F.; Vatasescu, A.L.; Toben, W.A.; Kratzer, R.H.

    1980-03-01

    The objective of the contract was to determine, by the combination of laboratory experiments and mine samplings, the kinetics and mechanisms of the various reactions that produce mine acid drainage. To achieve this goal, primary investigations were performed utilizing pure iron disulfide in the form of pyrite and marcasite, free from coal. The effects of temperature, concentration, surface area, media nature, oxygen, presence of additional ions and bacterial action with respect to dissolution rates were measured. Thiobacillus ferrooxidans and T. thiooxidans were included in this study, both as purchased cultures and freshly isolated from mine samples. Mine samplings were performed to determine the type and quantity of bacteria present, the effect of weathering upon coals' propensity to produce acid and other drainage, the effect of other minerals and the nature of the mine water upon ion liberation, and the effect of the different kinds of bacteria upon the above process. It was established that both pyrite and marcasite, provided sufficient surface area is exposed, will produce hydrogen, sulfate, and iron ions. This process is accelerated in the case of pyrite and marcasite by the presence of T. ferrooxidans and ferric ions. T. thiooxidans accelerates marcasite solubilization and the dissolution of iron disulfide present in coal, but had no effect on museum grade pyrite.

  11. Retinoic acid receptors: from molecular mechanisms to cancer therapy.

    PubMed

    di Masi, Alessandra; Leboffe, Loris; De Marinis, Elisabetta; Pagano, Francesca; Cicconi, Laura; Rochette-Egly, Cécile; Lo-Coco, Francesco; Ascenzi, Paolo; Nervi, Clara

    2015-02-01

    Retinoic acid (RA), the major bioactive metabolite of retinol or vitamin A, induces a spectrum of pleiotropic effects in cell growth and differentiation that are relevant for embryonic development and adult physiology. The RA activity is mediated primarily by members of the retinoic acid receptor (RAR) subfamily, namely RARα, RARβ and RARγ, which belong to the nuclear receptor (NR) superfamily of transcription factors. RARs form heterodimers with members of the retinoid X receptor (RXR) subfamily and act as ligand-regulated transcription factors through binding specific RA response elements (RAREs) located in target genes promoters. RARs also have non-genomic effects and activate kinase signaling pathways, which fine-tune the transcription of the RA target genes. The disruption of RA signaling pathways is thought to underlie the etiology of a number of hematological and non-hematological malignancies, including leukemias, skin cancer, head/neck cancer, lung cancer, breast cancer, ovarian cancer, prostate cancer, renal cell carcinoma, pancreatic cancer, liver cancer, glioblastoma and neuroblastoma. Of note, RA and its derivatives (retinoids) are employed as potential chemotherapeutic or chemopreventive agents because of their differentiation, anti-proliferative, pro-apoptotic, and anti-oxidant effects. In humans, retinoids reverse premalignant epithelial lesions, induce the differentiation of myeloid normal and leukemic cells, and prevent lung, liver, and breast cancer. Here, we provide an overview of the biochemical and molecular mechanisms that regulate the RA and retinoid signaling pathways. Moreover, mechanisms through which deregulation of RA signaling pathways ultimately impact on cancer are examined. Finally, the therapeutic effects of retinoids are reported. PMID:25543955

  12. Physiological and regulatory properties of the general amino acid transport system of Neurospora crassa.

    PubMed Central

    DeBusk, R M; DeBusk, A G

    1980-01-01

    The fundamental properties of the general amino acid transport system of Neurospora crassa were investigated in the conidial stage of the life cycle. The transport activity was found to be under genetic control, and an isogenic set of mutants deficient for the neutral, basic, or general amino acid transport systems and combinations thereof was constructed and used for analyzing the properties specific to the general permease. Amino acid transport by this system was found to be a carrier-mediated active process with broad specificity for the neutral and basic amino acids. Kinetic analysis revealed that a common binding site functioned to transport both neutral and basic amino acids and that the permease had a high affinity for its substrates. The kinetic parameters Km, Vmax, and Ki were defined for several substrates. Two modes of regulation were detected: substrate inhibition and ammonium repression. Activity of the general system was enhanced by the removal of ammonium ions from the incubation medium with a concomitant decline in either neutral or basic permease activity, suggesting that a common component exists between the neutral and the general systems and between the basic and the general systems. PMID:6447141

  13. Coupling of hydrologic transport and chemical reactions in a stream affected by acid mine drainage

    USGS Publications Warehouse

    Kimball, B.A.; Broshears, R.E.; Bencala, K.E.; McKnight, Diane M.

    1994-01-01

    Experiments in St. Kevin Gulch, an acid mine drainage stream, examined the coupling of hydrologic transport to chemical reactions affecting metal concentrations. Injection of LiCl as a conservative tracer was used to determine discharge and residence time along a 1497-m reach. Transport of metals downstream from inflows of acidic, metal-rich water was evaluated based on synoptic samples of metal concentrations and the hydrologic characteristics of the stream. Transport of SO4 and Mn was generally conservative, but in the subreaches most affected by acidic inflows, transport was reactive. Both 0.1-??m filtered and particulate Fe were reactive over most of the stream reach. Filtered Al partitioned to the particulate phase in response to high instream concentrations. Simulations that accounted for the removal of SO4, Mn, Fe, and Al with first-order reactions reproduced the steady-state profiles. The calculated rate constants for net removal used in the simulations embody several processes that occur on a stream-reach scale. The comparison between rates of hydrologie transport and chemical reactions indicates that reactions are only important over short distances in the stream near the acidic inflows, where reactions occur on a comparable time scale with hydrologic transport and thus affect metal concentrations.

  14. Computational Models for Drug Inhibition of the Human Apical Sodium-dependent Bile Acid Transporter

    PubMed Central

    Zheng, Xiaowan; Ekins, Sean; Raufman, Jean-Pierre; Polli, James E.

    2009-01-01

    The human apical sodium-dependent bile acid transporter (ASBT; SLC10A2) is the primary mechanism for intestinal bile acid re-absorption. In the colon, secondary bile acids increase the risk of cancer. Therefore, drugs that inhibit ASBT have the potential to increase the risk of colon cancer. The objectives of this study were to identify FDA-approved drugs that inhibit ASBT and to derive computational models for ASBT inhibition. Inhibition was evaluated using ASBT-MDCK monolayers and taurocholate as the model substrate. Computational modeling employed a HipHop qualitative approach, a Hypogen quantitative approach, as well as a modified Laplacian Bayesian modeling method using 2D descriptors. Initially, 30 compounds were screened for ASBT inhibition. A qualitative pharmacophore was developed using the most potent 11 compounds and applied to search a drug database, yielding 58 hits. Additional compounds were tested and their Ki values were measured. A 3D-QSAR and a Bayesian model were developed using 38 molecules. The quantitative pharmacophore consisted of one hydrogen bond acceptor, three hydrophobic features, and five excluded volumes. Each model was further validated with two external test sets of 30 and 19 molecules. Validation analysis showed both models exhibited good predictability in determining whether a drug is a potent or non-potent ASBT inhibitor. The Bayesian model correctly ranked the most active compounds. In summary, using a combined in vitro and computational approach, we found that many FDA-approved drugs from diverse classes, such as the dihydropyridine calcium channel blockers and HMG CoA-reductase inhibitors, are ASBT inhibitors. PMID:19673539

  15. Proton transport in triflic acid hydrates studied via path integral car-parrinello molecular dynamics.

    PubMed

    Hayes, Robin L; Paddison, Stephen J; Tuckerman, Mark E

    2009-12-31

    The mono-, di-, and tetrahydrates of trifluoromethanesulfonic acid, which contain characteristic H(3)O(+), H(5)O(2)(+), and H(9)O(4)(+) structures, provide model systems for understanding proton transport in materials with high perfluorosulfonic acid density such as perfluorosulfonic acid membranes commonly employed in hydrogen fuel cells. Ab initio molecular dynamics simulations indicate that protons in these solids are predisposed to transfer to the water most strongly bound to sulfonate groups via a Grotthuss-type mechanism, but quickly return to the most solvated defect structure either due to the lack of a nearby species to stabilize the new defect or a preference for the proton to be maximally hydrated. Path integral molecular dynamics of the mono- and dihydrate reveal significant quantum effects that facilitate proton transfer to the "presolvated" water or SO(3)(-) in the first solvation shell and increase the Zundel character of all the defects. These trends are quantified in free energy profiles for each bonding environment. Hydrogen bonding criteria for HOH-OH(2) and HOH-O(3)S are extracted from the two-dimensional potential of mean force. The quantum radial distribution function, radius of gyration, and root-mean-square displacement position correlation function show that the protonic charge is distributed over two or more water molecules. Metastable structural defects with one excess proton shared between two sulfonate groups and another Zundel or Eigen type cation defect are found for the mono- and dihydrate but not for the tetrahydrate crystal. Results for the tetrahydrate native crystal exhibit minor differences at 210 and 250 K. IR spectra are calculated for all native and stable defect structures. Graph theory techniques are used to characterize the chain lengths and ring sizes in the hydrogen bond network. Low conductivities when limited water is present may be attributable to trapping of protons between SO(3)(-) groups and the increased

  16. Computational models for drug inhibition of the human apical sodium-dependent bile acid transporter.

    PubMed

    Zheng, Xiaowan; Ekins, Sean; Raufman, Jean-Pierre; Polli, James E

    2009-01-01

    The human apical sodium-dependent bile acid transporter (ASBT; SLC10A2) is the primary mechanism for intestinal bile acid reabsorption. In the colon, secondary bile acids increase the risk of cancer. Therefore, drugs that inhibit ASBT have the potential to increase the risk of colon cancer. The objectives of this study were to identify FDA-approved drugs that inhibit ASBT and to derive computational models for ASBT inhibition. Inhibition was evaluated using ASBT-MDCK monolayers and taurocholate as the model substrate. Computational modeling employed a HipHop qualitative approach, a Hypogen quantitative approach, and a modified Laplacian Bayesian modeling method using 2D descriptors. Initially, 30 compounds were screened for ASBT inhibition. A qualitative pharmacophore was developed using the most potent 11 compounds and applied to search a drug database, yielding 58 hits. Additional compounds were tested, and their K(i) values were measured. A 3D-QSAR and a Bayesian model were developed using 38 molecules. The quantitative pharmacophore consisted of one hydrogen bond acceptor, three hydrophobic features, and five excluded volumes. Each model was further validated with two external test sets of 30 and 19 molecules. Validation analysis showed both models exhibited good predictability in determining whether a drug is a potent or nonpotent ASBT inhibitor. The Bayesian model correctly ranked the most active compounds. In summary, using a combined in vitro and computational approach, we found that many FDA-approved drugs from diverse classes, such as the dihydropyridine calcium channel blockers and HMG CoA-reductase inhibitors, are ASBT inhibitors. PMID:19673539

  17. New functions of the chloroplast Preprotein and Amino acid Transporter (PRAT) family members in protein import.

    PubMed

    Rossig, Claudia; Reinbothe, Christiane; Gray, John; Valdes, Oscar; von Wettstein, Diter; Reinbothe, Steffen

    2014-01-01

    Plant cells contain distinct compartments such as the nucleus, the endomembrane system comprising the endoplasmic reticulum and Golgi apparatus, peroxisomes, vacuoles, as well as mitochondria and chloroplasts. All of these compartments are surrounded by 1 or 2 limiting membranes and need to import proteins from the cytosol. Previous work led to the conclusion that mitochondria and chloroplasts use structurally different protein import machineries in their outer and inner membranes for the uptake of cytosolic precursor proteins. Our most recent data show that there is some unexpected overlap. Three members of the family of preprotein and amino acid transporters, PRAT, were identified in chloroplasts that mediate the uptake of transit sequence-less proteins into the inner plastid envelope membrane. By analogy, mitochondria contain with TIM22 a related PRAT protein that is involved in the import of transit sequence-less proteins into the inner mitochondrial membrane. Both mitochondria and chloroplasts thus make use of similar import mechanisms to deliver some of their proteins to their final place. Because single homologs of HP20- and HP30-like proteins are present in algae such as Chlamydomonas, Ostreococcus, and Volvox, which diverged from land plants approximately 1 billion years ago, it is likely that the discovered PRAT-mediated mechanism of protein translocation evolved concomitantly with the secondary endosymbiotic event that gave rise to green plants. PMID:24476934

  18. Numerical investigation of transport mechanism in four-body problem using Lagrangian coherent structure

    NASA Astrophysics Data System (ADS)

    Qi, Rui; Huang, Biao

    2016-01-01

    Transport mechanism is critical for understanding natural phenomena in the solar system and is beneficial to space mission design. In this study, transport mechanism in the bicircular four-body problem is numerically explored by using Lagrangian coherent structure (LCS), a tool widely used for identifying transport barriers in fluid flow. First, equations of motion of the bicircular problem are derived and five topology configurations of forbidden region are presented. Then, definition and computational method of LCS are introduced. Finally, properties of LCS which are useful for revealing transport mechanism in the four-body problem are numerically investigated.

  19. Mechanisms for Two-Step Proton Transfer Reactions in the Outward-Facing Form of MATE Transporter.

    PubMed

    Nishima, Wataru; Mizukami, Wataru; Tanaka, Yoshiki; Ishitani, Ryuichiro; Nureki, Osamu; Sugita, Yuji

    2016-03-29

    Bacterial pathogens or cancer cells can acquire multidrug resistance, which causes serious clinical problems. In cells with multidrug resistance, various drugs or antibiotics are extruded across the cell membrane by multidrug transporters. The multidrug and toxic compound extrusion (MATE) transporter is one of the five families of multidrug transporters. MATE from Pyrococcus furiosus uses H(+) to transport a substrate from the cytoplasm to the outside of a cell. Crystal structures of MATE from P. furiosus provide essential information on the relevant H(+)-binding sites (D41 and D184). Hybrid quantum mechanical/molecular mechanical simulations and continuum electrostatic calculations on the crystal structures predict that D41 is protonated in one structure (Straight) and, both D41 and D184 protonated in another (Bent). All-atom molecular dynamics simulations suggest a dynamic equilibrium between the protonation states of the two aspartic acids and that the protonation state affects hydration in the substrate binding cavity and lipid intrusion in the cleft between the N- and C-lobes. This hypothesis is examined in more detail by quantum mechanical/molecular mechanical calculations on snapshots taken from the molecular dynamics trajectories. We find the possibility of two proton transfer (PT) reactions in Straight: the 1st PT takes place between side-chains D41 and D184 through a transient formation of low-barrier hydrogen bonds and the 2nd through another H(+) from the headgroup of a lipid that intrudes into the cleft resulting in a doubly protonated (both D41 and D184) state. The 1st PT affects the local hydrogen bond network and hydration in the N-lobe cavity, which would impinge on the substrate-binding affinity. The 2nd PT would drive the conformational change from Straight to Bent. This model may be applicable to several prokaryotic H(+)-coupled MATE multidrug transporters with the relevant aspartic acids. PMID:27028644

  20. CO2-ECBM related coupled physical and mechanical transport processes

    NASA Astrophysics Data System (ADS)

    Gensterblum, Yves; Satorius, Michael; Busch, Andreas; Krooß, Bernhard

    2013-04-01

    The interrelation of cleat transport processes and mechanical properties was investigated by permeability tests at different stress levels (60% to 130% of in-situ stress) with sorbing (CH4, CO2) and inert gases (N2, Ar, He) on a sub bituminous A coal from the Surat Basin, Queensland Australia. From the flow tests under controlled triaxial stress conditions the Klinkenberg-corrected "true" permeability coefficients and the Klinkenberg slip factors were derived. The "true"-, absolute or Klinkenberg corrected permeability shows a gas type dependence. Following the approach of Seidle et al. (1992) the cleat volume compressibility (cf) was calculated from observed changes in apparent permeability upon variation of external stress (at equal mean gas pressures). The observed effects also show a clear dependence on gas type. Due to pore or cleat compressibility the cleat aperture decreases with increasing effective stress. Vice versa we observe with increasing mean pressure at lower confining pressure an increase in permeability which we attribute to a cleat aperture widening. The cleat volume compressibility (cf) also shows a dependence on the mean pore pressure. Non-sorbing gases like helium and argon show higher apparent permeabilities than sorbing gases like methane. Permeability coefficients measured with successively increasing mean gas pressures were consistently lower than those determined at decreasing mean gas pressures. This permeability hysteresis is in accordance with results reported by Harpalani and McPherson (1985). The kinetics of matrix transport processes were studied by sorption tests on different particle sizes at various moisture contents and temperatures (cf. Busch et al., 2006). Methane uptake rates were determined from the pressure decline curves recorded for each particle-size fraction, and "diffusion coefficients" were calculated using several unipore and bidisperse diffusion models. While the CH4 sorption capacity of moisture-equilibrated coals

  1. CO2-ECBM related coupled physical and mechanical transport processes

    NASA Astrophysics Data System (ADS)

    Gensterblum, Y.; Sartorius, M.; Busch, A.; Cumming, D.; Krooss, B. M.

    2012-04-01

    The interrelation of cleat transport processes and mechanical properties was investigated by permeability tests at different stress levels (60% to 130% of in-situ stress) with sorbing (CH4, CO2) and inert gases (N2, Ar, He) on a sub bituminous A coal from the Surat Basin, Queensland Australia. From the flow tests under controlled triaxial stress conditions the Klinkenberg-corrected "true" permeability coefficients and the Klinkenberg slip factors were derived. The "true"-, absolute or Klinkenberg corrected permeability shows a gas type dependence. Following the approach of Seidle et al. (1992) the cleat volume compressibility (cf) was calculated from observed changes in apparent permeability upon variation of external stress (at equal mean gas pressures). The observed effects also show a clear dependence on gas type. Due to pore or cleat compressibility the cleat aperture decreases with increasing effective stress. Vice versa we observe with increasing mean pressure at lower confining pressure an increase in permeability which we attribute to a cleat aperture widening. The cleat volume compressibility (cf) also shows a dependence on the mean pore pressure. Non-sorbing gases like helium and argon show higher apparent permeabilities than sorbing gases like methane. Permeability coefficients measured with successively increasing mean gas pressures were consistently lower than those determined at decreasing mean gas pressures. This permeability hysteresis is in accordance with results reported by Harpalani and McPherson (1985). The kinetics of matrix transport processes were studied by sorption tests on different particle sizes at various moisture contents and temperatures (cf. Busch et al., 2006). Methane uptake rates were determined from the pressure decline curves recorded for each particle-size fraction, and "diffusion coefficients" were calculated using several unipore and bidisperse diffusion models. While the CH4 sorption capacity of moisture-equilibrated coals

  2. Genetic evidence of a high-affinity cyanuric acid transport system in Pseudomonas sp. ADP.

    PubMed

    Platero, Ana I; Santero, Eduardo; Govantes, Fernando

    2014-03-01

    The Pseudomonas sp. ADP plasmid pADP-1 encodes the activities involved in the hydrolytic degradation of the s-triazine herbicide atrazine. Here, we explore the presence of a specific transport system for the central intermediate of the atrazine utilization pathway, cyanuric acid, in Pseudomonas sp. ADP. Growth in fed-batch cultures containing limiting cyanuric acid concentrations is consistent with high-affinity transport of this substrate. Acquisition of the ability to grow at low cyanuric acid concentrations upon conjugal transfer of pADP1 to the nondegrading host Pseudomonas putida KT2442 suggests that all activities required for this phenotype are encoded in this plasmid. Co-expression of the pADP1-borne atzDEF and atzTUVW genes, encoding the cyanuric acid utilization pathway and the subunits of an ABC-type solute transport system, in P. putida KT2442 was sufficient to promote growth at cyanuric acid concentrations as low as 50 μM in batch culture. Taken together, our results strongly suggest that the atzTUVW gene products are involved in high-affinity transport of cyanuric acid. PMID:24484197

  3. Proton-dependent glutamine uptake by aphid bacteriocyte amino acid transporter ApGLNT1.

    PubMed

    Price, Daniel R G; Wilson, Alex C C; Luetje, Charles W

    2015-10-01

    Aphids house large populations of the gammaproteobacterial symbiont Buchnera aphidicola in specialized bacteriocyte cells. The combined biosynthetic capability of the holobiont (Acyrthosiphon pisum and Buchnera) is sufficient for biosynthesis of all twenty protein coding amino acids, including amino acids that animals alone cannot synthesize; and that are present at low concentrations in A. pisum's plant phloem sap diet. Collaborative holobiont amino acid biosynthesis depends on glutamine import into bacteriocytes, which serves as a nitrogen-rich amino donor for biosynthesis of other amino acids. Recently, we characterized A. pisum glutamine transporter 1 (ApGLNT1), a member of the amino acid/auxin permease family, as the dominant bacteriocyte plasma membrane glutamine transporter. Here we show ApGLNT1 to be structurally and functionally related to mammalian proton-dependent amino acid transporters (PATs 1-4). Using functional expression in Xenopus laevis oocytes, combined with two-electrode voltage clamp electrophysiology we demonstrate that ApGLNT1 is electrogenic and that glutamine induces large inward currents. ApGLNT1 glutamine induced currents are dependent on external glutamine concentration, proton (H+) gradient across the membrane, and membrane potential. Based on these transport properties, ApGLNT1-mediated glutamine uptake into A. pisum bacteriocytes can be regulated by changes in either proton gradients across the plasma membrane or membrane potential. PMID:26028424

  4. Prohibitin/annexin 2 interaction regulates fatty acid transport in adipose tissue

    PubMed Central

    Salameh, Ahmad; Daquinag, Alexes C.; Staquicini, Daniela I.; An, Zhiqiang; Hajjar, Katherine A.; Pasqualini, Renata; Arap, Wadih; Kolonin, Mikhail G.

    2016-01-01

    We have previously identified prohibitin (PHB) and annexin A2 (ANX2) as proteins interacting on the surface of vascular endothelial cells in white adipose tissue (WAT) of humans and mice. Here, we demonstrate that ANX2 and PHB also interact in adipocytes. Mice lacking ANX2 have normal WAT vascularization, adipogenesis, and glucose metabolism but display WAT hypotrophy due to reduced fatty acid uptake by WAT endothelium and adipocytes. By using cell culture systems in which ANX2/PHB binding is disrupted either genetically or through treatment with a blocking peptide, we show that fatty acid transport efficiency relies on this protein complex. We also provide evidence that the interaction between ANX2 and PHB mediates fatty acid transport from the endothelium into adipocytes. Moreover, we demonstrate that ANX2 and PHB form a complex with the fatty acid transporter CD36. Finally, we show that the colocalization of PHB and CD36 on adipocyte surface is induced by extracellular fatty acids. Together, our results suggest that an unrecognized biochemical interaction between ANX2 and PHB regulates CD36-mediated fatty acid transport in WAT, thus revealing a new potential pathway for intervention in metabolic diseases. PMID:27468426

  5. Perfluoroalkyl Acid Concentrations in Blood Samples Subjected to Transportation and Processing Delay

    PubMed Central

    Bach, Cathrine Carlsen; Henriksen, Tine Brink; Bossi, Rossana; Bech, Bodil Hammer; Fuglsang, Jens; Olsen, Jørn; Nohr, Ellen Aagaard

    2015-01-01

    Background In studies of perfluoroalkyl acids, the validity and comparability of measured concentrations may be affected by differences in the handling of biospecimens. We aimed to investigate whether measured plasma levels of perfluoroalkyl acids differed between blood samples subjected to delay and transportation prior to processing and samples with immediate processing and freezing. Methods Pregnant women recruited at Aarhus University Hospital, Denmark, (n = 88) provided paired blood samples. For each pair of samples, one was immediately processed and plasma was frozen, and the other was delayed and transported as whole blood before processing and freezing of plasma (similar to the Danish National Birth Cohort). We measured 12 perfluoroalkyl acids and present results for compounds with more than 50% of samples above the lower limit of quantification. Results For samples taken in the winter, relative differences between the paired samples ranged between -77 and +38% for individual perfluoroalkyl acids. In most cases concentrations were lower in the delayed and transported samples, e.g. the relative difference was -29% (95% confidence interval -30; -27) for perfluorooctane sulfonate. For perfluorooctanoate there was no difference between the two setups [corresponding estimate 1% (0, 3)]. Differences were negligible in the summer for all compounds. Conclusions Transport of blood samples and processing delay, similar to conditions applied in some large, population-based studies, may affect measured perfluoroalkyl acid concentrations, mainly when outdoor temperatures are low. Attention to processing conditions is needed in studies of perfluoroalkyl acid exposure in humans. PMID:26356420

  6. Intracellular transport driven by cytoskeletal motors: General mechanisms and defects

    NASA Astrophysics Data System (ADS)

    Appert-Rolland, C.; Ebbinghaus, M.; Santen, L.

    2015-09-01

    Cells are the elementary units of living organisms, which are able to carry out many vital functions. These functions rely on active processes on a microscopic scale. Therefore, they are strongly out-of-equilibrium systems, which are driven by continuous energy supply. The tasks that have to be performed in order to maintain the cell alive require transportation of various ingredients, some being small, others being large. Intracellular transport processes are able to induce concentration gradients and to carry objects to specific targets. These processes cannot be carried out only by diffusion, as cells may be crowded, and quite elongated on molecular scales. Therefore active transport has to be organized. The cytoskeleton, which is composed of three types of filaments (microtubules, actin and intermediate filaments), determines the shape of the cell, and plays a role in cell motion. It also serves as a road network for a special kind of vehicles, namely the cytoskeletal motors. These molecules can attach to a cytoskeletal filament, perform directed motion, possibly carrying along some cargo, and then detach. It is a central issue to understand how intracellular transport driven by molecular motors is regulated. The interest for this type of question was enhanced when it was discovered that intracellular transport breakdown is one of the signatures of some neuronal diseases like the Alzheimer. We give a survey of the current knowledge on microtubule based intracellular transport. Our review includes on the one hand an overview of biological facts, obtained from experiments, and on the other hand a presentation of some modeling attempts based on cellular automata. We present some background knowledge on the original and variants of the TASEP (Totally Asymmetric Simple Exclusion Process), before turning to more application oriented models. After addressing microtubule based transport in general, with a focus on in vitro experiments, and on cooperative effects in the

  7. Incorporating Geochemical And Microbial Kinetics In Reactive Transport Models For Generation Of Acid Rock Drainage

    NASA Astrophysics Data System (ADS)

    Andre, B. J.; Rajaram, H.; Silverstein, J.

    2010-12-01

    Acid mine drainage, AMD, results from the oxidation of metal sulfide minerals (e.g. pyrite), producing ferrous iron and sulfuric acid. Acidophilic autotrophic bacteria such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans obtain energy by oxidizing ferrous iron back to ferric iron, using oxygen as the electron acceptor. Most existing models of AMD do not account for microbial kinetics or iron geochemistry rigorously. Instead they assume that oxygen limitation controls pyrite oxidation and thus focus on oxygen transport. These models have been successfully used for simulating conditions where oxygen availability is a limiting factor (e.g. source prevention by capping), but have not been shown to effectively model acid generation and effluent chemistry under a wider range of conditions. The key reactions, oxidation of pyrite and oxidation of ferrous iron, are both slow kinetic processes. Despite being extensively studied for the last thirty years, there is still not a consensus in the literature about the basic mechanisms, limiting factors or rate expressions for microbially enhanced oxidation of metal sulfides. An indirect leaching mechanism (chemical oxidation of pyrite by ferric iron to produce ferrous iron, with regeneration of ferric iron by microbial oxidation of ferrous iron) is used as the foundation of a conceptual model for microbially enhanced oxidation of pyrite. Using literature data, a rate expression for microbial consumption of ferrous iron is developed that accounts for oxygen, ferrous iron and pH limitation. Reaction rate expressions for oxidation of pyrite and chemical oxidation of ferrous iron are selected from the literature. A completely mixed stirred tank reactor (CSTR) model is implemented coupling the kinetic rate expressions, speciation calculations and flow. The model simulates generation of AMD and effluent chemistry that qualitatively agrees with column reactor and single rock experiments. A one dimensional reaction

  8. Defective canalicular transport and toxicity of dietary ursodeoxycholic acid in the abcb11-/- mouse: transport and gene expression studies.

    PubMed

    Wang, Renxue; Liu, Lin; Sheps, Jonathan A; Forrest, Dana; Hofmann, Alan F; Hagey, Lee R; Ling, Victor

    2013-08-15

    The bile salt export pump (BSEP), encoded by the abcb11 gene, is the major canalicular transporter of bile acids from the hepatocyte. BSEP malfunction in humans causes bile acid retention and progressive liver injury, ultimately leading to end-stage liver failure. The natural, hydrophilic, bile acid ursodeoxycholic acid (UDCA) is efficacious in the treatment of cholestatic conditions, such as primary biliary cirrhosis and cholestasis of pregnancy. The beneficial effects of UDCA include promoting bile flow, reducing hepatic inflammation, preventing apoptosis, and maintaining mitochondrial integrity in hepatocytes. However, the role of BSEP in mediating UDCA efficacy is not known. Here, we used abcb11 knockout mice (abcb11-/-) to test the effects of acute and chronic UDCA administration on biliary secretion, bile acid composition, liver histology, and liver gene expression. Acutely infused UDCA, or its taurine conjugate (TUDC), was taken up by the liver but retained, with negligible biliary output, in abcb11-/- mice. Feeding UDCA to abcb11-/- mice led to weight loss, retention of bile acids, elevated liver enzymes, and histological damage to the liver. Semiquantitative RT-PCR showed that genes encoding Mdr1a and Mdr1b (canalicular) as well as Mrp4 (basolateral) transporters were upregulated in abcb11-/- mice. We concluded that infusion of UDCA and TUDC failed to induce bile flow in abcb11-/- mice. UDCA fed to abcb11-/- mice caused liver damage and the appearance of biliary tetra- and penta-hydroxy bile acids. Supplementation with UDCA in the absence of Bsep caused adverse effects in abcb11-/- mice. PMID:23764895

  9. Regulation of branched-chain amino acid transport in Escherichia coli.

    PubMed Central

    Quay, S C; Oxender, D L

    1976-01-01

    The repression and derepression of leucine, isoleucine, and valine transport in Escherichia coli K-12 was examined by using strains auxotrophic for leucine, isoleucine, valine, and methionine. In experiments designed to limit each of these amino acids separately, we demonstrate that leucine limitation alone derepressed the leucine-binding protein, the high-affinity branched-chain amino acid transport system (LIV-I), and the membrane-bound, low-affinity system (LIV-II). This regulation did not seem to involve inactivation of transport components, but represented an increase in the differential rate of synthesis of transport components relative to total cellular proteins. The apparent regulation of transport by isoleucine, valine, and methionine reported elsewhere was shown to require an intact leucine, biosynthetic operon and to result from changes in the level of leucine biosynthetic enzymes. A functional leucyl-transfer ribonucleic acid synthetase was also required for repression of transport. Transport regulation was shown to be essentially independent of ilvA or its gene product, threonine deaminase. The central role of leucine or its derivatives in cellular metabolism in general is discussed. PMID:783137

  10. Insights into the mechanisms of sterol transport between organelles.

    PubMed

    Mesmin, Bruno; Antonny, Bruno; Drin, Guillaume

    2013-09-01

    In cells, the levels of sterol vary greatly among organelles. This uneven distribution depends largely on non-vesicular routes of transfer, which are mediated by soluble carriers called lipid-transfer proteins (LTPs). These proteins have a domain with a hydrophobic cavity that accommodates one sterol molecule. However, a demonstration of their role in sterol transport in cells remains difficult. Numerous LTPs also contain membrane-binding elements, but it is not clear how these LTPs couple their ability to target organelles with lipid transport activity. This issue appears critical, since many sterol transporters are thought to act at contact sites between two membrane-bound compartments. Here, we emphasize that biochemical and structural studies provide precious insights into the mode of action of sterol-binding proteins. Recent studies on START, Osh/ORP and NPC proteins suggest models on how these proteins could transport sterol between organelles and, thereby, influence cellular functions. PMID:23283302

  11. Abscisic acid perception and signaling: structural mechanisms and applications

    PubMed Central

    Ng, Ley Moy; Melcher, Karsten; Teh, Bin Tean; Xu, H Eric

    2014-01-01

    Adverse environmental conditions are a threat to agricultural yield and therefore exert a global effect on livelihood, health and the economy. Abscisic acid (ABA) is a vital plant hormone that regulates abiotic stress tolerance, thereby allowing plants to cope with environmental stresses. Previously, attempts to develop a complete understanding of the mechanisms underlying ABA signaling have been hindered by difficulties in the identification of bona fide ABA receptors. The discovery of the PYR/PYL/RCAR family of ABA receptors therefore represented a major milestone in the effort to overcome these roadblocks; since then, many structural and functional studies have provided detailed insights into processes ranging from ABA perception to the activation of ABA-responsive gene transcription. This understanding of the mechanisms of ABA perception and signaling has served as the basis for recent, preliminary developments in the genetic engineering of stress-resistant crops as well as in the design of new synthetic ABA agonists, which hold great promise for the agricultural enhancement of stress tolerance. PMID:24786231

  12. Physiological roles and transport mechanisms of boron: perspectives from plants.

    PubMed

    Tanaka, Mayuki; Fujiwara, Toru

    2008-07-01

    Boron, an orphan of the periodic table of the elements, is unique not only in its chemical properties but also in its roles in biology. Its requirement in plants was described more than 80 years ago. Understandings of the molecular basis of the requirement and transport have been advanced greatly in the last decade. This article reviews recent findings of boron function and transport in plants and discusses possible implication to other organisms including humans. PMID:17965876

  13. Tissue distribution of exogenous amino acids during transport across the vascularly perfused anuran small intestine.

    PubMed Central

    Cheeseman, C I; King, I; Smith, M W

    1983-01-01

    Microdensitometric analysis of autoradiographs has been used to measure the distribution and intracellular concentration of L-leucine and L-lysine during transport across the vascularly perfused small intestine of Rana pipiens. L-leucine was not accumulated in the mucosal epithelium to a concentration higher than that in the lumen under steady-state conditions, whereas L-lysine was concentrated on average three- to four-fold. 2. At the end of 30 min loading, the majority of both amino acids were found in the mucosal epithelium and the villous core, although significant amounts were also present in the muscle. Lysine showed a gradient of accumulation within the mucosal epithelium along the length of the villous folds, the highest concentrations being achieved in the cells near the tip. Leucine showed no such gradient under steady-state conditions. 3. Superfusion of the mucosal surface of the tissue with leucine for only 3 min did reveal a gradient for uptake into the mucosal epithelium, although it was still not as steep as that seen for lysine. 4. The presence of leucine in the vascular bed while lysine was perfused through the lumen significantly lowered the concentration of lysine in the mucosal epithelium and villous core and eliminated the concentration gradient in the mucosal epithelium seen along the villous fold. 5. When leucine was perfused on its own through the vascular bed, the uptake into the muscle was greatly increased compared to when the amino acid was presented from the lumen. At the same time, the uptake into the mucosal epithelium was reduced by 45%. 6. Analysis of the tissue content of leucine after loading for 30 min from the lumen and then washing out the amino acid for 15 min showed that the mucosal epithelium, villous core and muscle had contributed 74%, 17% and 9% respectively to the total amino acid lost from the tissue. 7. These results are discussed with regard to the significance of the exit mechanisms for these amino acids and the

  14. Inhibition of Human Hepatic Bile Acid Transporters by Tolvaptan and Metabolites: Contributing Factors to Drug-Induced Liver Injury?

    PubMed

    Slizgi, Jason R; Lu, Yang; Brouwer, Kenneth R; St Claire, Robert L; Freeman, Kimberly M; Pan, Maxwell; Brock, William J; Brouwer, Kim L R

    2016-01-01

    Tolvaptan is a vasopressin V(2)-receptor antagonist that has shown promise in treating Autosomal Dominant Polycystic Kidney Disease (ADPKD). Tolvaptan was, however, associated with liver injury in some ADPKD patients. Inhibition of bile acid transporters may be contributing factors to drug-induced liver injury. In this study, the ability of tolvaptan and two metabolites, DM-4103 and DM-4107, to inhibit human hepatic transporters (NTCP, BSEP, MRP2, MRP3, and MRP4) and bile acid transport in sandwich-cultured human hepatocytes (SCHH) was explored. IC(50) values were determined for tolvaptan, DM-4103 and DM-4107 inhibition of NTCP (∼41.5, 16.3, and 95.6 μM, respectively), BSEP (31.6, 4.15, and 119 μM, respectively), MRP2 (>50, ∼51.0, and >200 μM, respectively), MRP3 (>50, ∼44.6, and 61.2 μM, respectively), and MRP4 (>50, 4.26, and 37.9 μM, respectively). At the therapeutic dose of tolvaptan (90 mg), DM-4103 exhibited a C(max)/IC(50) value >0.1 for NTCP, BSEP, MRP2, MRP3, and MRP4. Tolvaptan accumulation in SCHH was extensive and not sodium-dependent; intracellular concentrations were ∼500 μM after a 10-min incubation duration with tolvaptan (15 μM). The biliary clearance of taurocholic acid (TCA) decreased by 43% when SCHH were co-incubated with tolvaptan (15 μM) and TCA (2.5 μM). When tolvaptan (15 μM) was co-incubated with 2.5 μM of chenodeoxycholic acid, taurochenodeoxycholic acid, or glycochenodeoxycholic acid in separate studies, the cellular accumulation of these bile acids increased by 1.30-, 1.68-, and 2.16-fold, respectively. Based on these data, inhibition of hepatic bile acid transport may be one of the biological mechanisms underlying tolvaptan-associated liver injury in patients with ADPKD. PMID:26507107

  15. Exciton transport, charge extraction, and loss mechanisms in organic photovoltaics

    NASA Astrophysics Data System (ADS)

    Scully, Shawn Ryan

    Organic photovoltaics have attracted significant interest over the last decade due to their promise as clean low-cost alternatives to large-scale electric power generation such as coal-fired power, natural gas, and nuclear power. Many believe power conversion efficiency targets of 10-15% must be reached before commercialization is possible. Consequently, understanding the loss mechanisms which currently limit efficiencies to 4-5% is crucial to identify paths to reach higher efficiencies. In this work, we investigate the dominant loss mechanisms in some of the leading organic photovoltaic architectures. In the first class of architectures, which include planar heterojunctions and bulk heterojunctions with large domains, efficiencies are primarily limited by the distance photogenerated excitations (excitons) can be transported (termed the exciton diffusion length) to a heterojunction where the excitons may dissociate. We will discuss how to properly measure the exciton diffusion length focusing on the effects of optical interference and of energy transfer when using fullerenes as quenching layers and show how this explains the variety of diffusion lengths reported for the same material. After understanding that disorder and defects limit exciton diffusion lengths, we suggest some approaches to overcome this. We then extensively investigate the use of long-range resonant energy transfer to increase exciton harvesting. Using simulations and experiments as support, we discuss how energy transfer can be engineered into architectures to increase the distance excitons can be harvested. In an experimental model system, DOW Red/PTPTB, we will show how the distance excitons are harvested can be increased by almost an order of magnitude up to 27 nm from a heterojunction and give design rules and extensions of this concept for future architectures. After understanding exciton harvesting limitations we will look at other losses that are present in planar heterojunctions. One of

  16. Mechanism of drug release from poly(L-lactic acid) matrix containing acidic or neutral drugs.

    PubMed

    Miyajima, M; Koshika, A; Okada, J; Ikeda, M

    1999-08-01

    The release profiles of acidic and neutral drugs from poly(L-lactic acid) [P(L)LA] matrices were investigated to reveal their release mechanism. Cylindrical matrices (rods; 10 mmx1 mm diameter) were prepared by the heat compression method. The acidic and neutral drugs investigated were dissolved in the P(L)LA rods. It was found that the release profiles consisted of two sequential stages. At the first release stage, P(L)LA remained in an amorphous state and the drugs diffused through the hydrated matrices. At the second release stage, P(L)LA transformed to a semicrystalline state and the drugs diffused through water-filled micropores developed by polymer crystallization. In addition, the drugs were also found to precipitate out as crystals in the rods, resulting in a transformation of the rods into drug-dispersed matrices. On the basis of these findings, we derived a modified diffusion equation for the drug release at the second stage. This equation showed good fits to the release profiles of these drugs. Furthermore, the availability of the derived equation was supported by the acceleration in the fractional drug release rate noted both with decreases in the drug content in the rod and increases in the pH of the medium. PMID:10425326

  17. Unveiling the Mechanism of Arginine Transport through AdiC with Molecular Dynamics Simulations: The Guiding Role of Aromatic Residues

    PubMed Central

    Krammer, Eva-Maria; Ghaddar, Kassem; André, Bruno

    2016-01-01

    Commensal and pathogenic enteric bacteria have developed several systems to adapt to proton leakage into the cytoplasm resulting from extreme acidic conditions. One such system involves arginine uptake followed by export of the decarboxylated product agmatine, carried out by the arginine/agmatine antiporter (AdiC), which thus works as a virtual proton pump. Here, using classical and targeted molecular dynamics, we investigated at the atomic level the mechanism of arginine transport through AdiC of E. coli. Overall, our MD simulation data clearly demonstrate that global rearrangements of several transmembrane segments are necessary but not sufficient for achieving transitions between structural states along the arginine translocation pathway. In particular, local structural changes, namely rotameric conversions of two aromatic residues, are needed to regulate access to both the outward- and inward-facing states. Our simulations have also enabled identification of a few residues, overwhelmingly aromatic, which are essential to guiding arginine in the course of its translocation. Most of them belong to gating elements whose coordinated motions contribute to the alternating access mechanism. Their conservation in all known E. coli acid resistance antiporters suggests that the transport mechanisms of these systems share common features. Last but not least, knowledge of the functional properties of AdiC can advance our understanding of the members of the amino acid-carbocation-polyamine superfamily, notably in eukaryotic cells. PMID:27482712

  18. Unveiling the Mechanism of Arginine Transport through AdiC with Molecular Dynamics Simulations: The Guiding Role of Aromatic Residues.

    PubMed

    Krammer, Eva-Maria; Ghaddar, Kassem; André, Bruno; Prévost, Martine

    2016-01-01

    Commensal and pathogenic enteric bacteria have developed several systems to adapt to proton leakage into the cytoplasm resulting from extreme acidic conditions. One such system involves arginine uptake followed by export of the decarboxylated product agmatine, carried out by the arginine/agmatine antiporter (AdiC), which thus works as a virtual proton pump. Here, using classical and targeted molecular dynamics, we investigated at the atomic level the mechanism of arginine transport through AdiC of E. coli. Overall, our MD simulation data clearly demonstrate that global rearrangements of several transmembrane segments are necessary but not sufficient for achieving transitions between structural states along the arginine translocation pathway. In particular, local structural changes, namely rotameric conversions of two aromatic residues, are needed to regulate access to both the outward- and inward-facing states. Our simulations have also enabled identification of a few residues, overwhelmingly aromatic, which are essential to guiding arginine in the course of its translocation. Most of them belong to gating elements whose coordinated motions contribute to the alternating access mechanism. Their conservation in all known E. coli acid resistance antiporters suggests that the transport mechanisms of these systems share common features. Last but not least, knowledge of the functional properties of AdiC can advance our understanding of the members of the amino acid-carbocation-polyamine superfamily, notably in eukaryotic cells. PMID:27482712

  19. Chemically- and mechanically-mediated influences on the transport and mechanical characteristics of rock fractures

    SciTech Connect

    Min, K.-B.; Rutqvist, J.; Elsworth, D.

    2009-02-01

    A model is presented to represent changes in the mechanical and transport characteristics of fractured rock that result from coupled mechanical and chemical effects. The specific influence is the elevation of dissolution rates on contacting asperities, which results in a stress- and temperature-dependent permanent closure. A model representing this pressure-dissolution-like behavior is adapted to define the threshold and resulting response in terms of fundamental thermodynamic properties of a contacting fracture. These relations are incorporated in a stress-stiffening model of fracture closure to define the stress- and temperature-dependency of aperture loss and behavior during stress and temperature cycling. These models compare well with laboratory and field experiments, representing both decoupled isobaric and isothermal responses. The model was applied to explore the impact of these responses on heated structures in rock. The result showed a reduction in ultimate induced stresses over the case where chemical effects were not incorporated, with permanent reduction in final stresses after cooling to ambient conditions. Similarly, permeabilities may be lower than they were in the case where chemical effects were not considered, with a net reduction apparent even after cooling to ambient temperature. These heretofore-neglected effects may have a correspondingly significant impact on the performance of heated structures in rock, such as repositories for the containment of radioactive wastes.

  20. Pyrazinamide Induced Rat Cholestatic Liver Injury through Inhibition of FXR Regulatory Effect on Bile Acid Synthesis and Transport.

    PubMed

    Guo, Hong-Li; Hassan, Hozeifa M; Zhang, Yun; Dong, Si-Zhe; Ding, Ping-Ping; Wang, Tao; Sun, Li-Xin; Zhang, Lu-Yong; Jiang, Zhen-Zhou

    2016-08-01

    Pyrazinamide (PZA) is an indispensable first-line drug used for the treatment of tuberculosis which may cause serious hepatotoxicity; however, the mechanisms underlying these toxicities are poorly understood. Cholestasis plays an important role in drug-induced liver injury. Since there were no previous published works reported cholestasis and PZA hepatotoxicity relationship, this study aimed to identify whether PZA can induce liver injury with characterized evidences of cholestasis and to clarify expression changes of proteins related to both bile acid synthesis and transport in PZA-induced liver injury. PZA (2 g/kg) was administered for 7 consecutive days by oral gavage. Results showed there were 2-fold elevation in both ALT and AST serum levels in PZA-treated rats. In addition, a 10-fold increment in serum total bile acid was observed after PZA administration. The mRNA and protein expressions of bile acid synthesis and transport parameters were markedly altered, in which FXR, Bsep, Mrp2, Mdr2, Ostα/β, Oatp1a1, Oatp1b2, and Cyp8b1 were decreased (P < .05), while Mrp3, Ntcp, Oatp1a4, and Cyp7a1 were increased (P < .05). Moreover, treatment with the FXR agonist obeticholic acid (OCA) generated obvious reductions in serum ALT, AST, and TBA levels in PZA-treated rats. Those effects were due to transcriptional regulation of pre-mentioned target genes by OCA. Taken together, these results suggested that PZA-induced cholestatic liver injury was related to FXR inhibition, leading to the dysfunction in bile acid synthesis and transport. PMID:27255380

  1. Osmotic water transport in aquaporins: evidence for a stochastic mechanism

    PubMed Central

    Zeuthen, Thomas; Alsterfjord, Magnus; Beitz, Eric; MacAulay, Nanna

    2013-01-01

    We test a novel, stochastic model of osmotic water transport in aquaporins. A solute molecule present at the pore mouth can either be reflected or permeate the pore. We assume that only reflected solute molecules induce osmotic transport of water through the pore, while permeating solute molecules give rise to no water transport. Accordingly, the rate of water transport is proportional to the reflection coefficient σ, while the solute permeability, PS, is proportional to 1 –σ. The model was tested in aquaporins heterologously expressed in Xenopus oocytes. A variety of aquaporin channel sizes and geometries were obtained with the two aquaporins AQP1 and AQP9 and mutant versions of these. Osmotic water transport was generated by adding 20 mm of a range of different-sized osmolytes to the outer solution. The osmotic water permeability and the reflection coefficient were measured optically at high resolution and compared to the solute permeability obtained from short-term uptake of radio-labelled solute under isotonic conditions. For each type of aquaporin there was a linear relationship between solute permeability and reflection coefficient, in accordance with the model. We found no evidence for coupling between water and solute fluxes in the pore. In confirmation of molecular dynamic simulations, we conclude that the magnitude of the osmotic water permeability and the reflection coefficient are determined by processes at the arginine selectivity filter located at the outward-facing end of the pore. PMID:23959676

  2. Mechanisms of molecular transport through the urea channel of Helicobacter pylori

    NASA Astrophysics Data System (ADS)

    McNulty, Reginald; Ulmschneider, Jakob P.; Luecke, Hartmut; Ulmschneider, Martin B.

    2013-12-01

    Helicobacter pylori survival in acidic environments relies on cytoplasmic hydrolysis of gastric urea into ammonia and carbon dioxide, which buffer the pathogen’s periplasm. Urea uptake is greatly enhanced and regulated by HpUreI, a proton-gated inner membrane channel protein essential for gastric survival of H. pylori. The crystal structure of HpUreI describes a static snapshot of the channel with two constriction sites near the center of the bilayer that are too narrow to allow passage of urea or even water. Here we describe the urea transport mechanism at atomic resolution, revealed by unrestrained microsecond equilibrium molecular dynamics simulations of the hexameric channel assembly. Two consecutive constrictions open to allow conduction of urea, which is guided through the channel by interplay between conserved residues that determine proton rejection and solute selectivity. Remarkably, HpUreI conducts water at rates equivalent to aquaporins, which might be essential for efficient transport of urea at small concentration gradients.

  3. Mechanisms of molecular transport through the urea channel of Helicobacter pylori.

    PubMed

    McNulty, Reginald; Ulmschneider, Jakob P; Luecke, Hartmut; Ulmschneider, Martin B

    2013-01-01

    Helicobacter pylori survival in acidic environments relies on cytoplasmic hydrolysis of gastric urea into ammonia and carbon dioxide, which buffer the pathogen's periplasm. Urea uptake is greatly enhanced and regulated by HpUreI, a proton-gated inner membrane channel protein essential for gastric survival of H. pylori. The crystal structure of HpUreI describes a static snapshot of the channel with two constriction sites near the center of the bilayer that are too narrow to allow passage of urea or even water. Here we describe the urea transport mechanism at atomic resolution, revealed by unrestrained microsecond equilibrium molecular dynamics simulations of the hexameric channel assembly. Two consecutive constrictions open to allow conduction of urea, which is guided through the channel by interplay between conserved residues that determine proton rejection and solute selectivity. Remarkably, HpUreI conducts water at rates equivalent to aquaporins, which might be essential for efficient transport of urea at small concentration gradients. PMID:24305683

  4. Mechanisms of molecular transport through the urea channel of Helicobacter pylori

    PubMed Central

    McNulty, Reginald; Ulmschneider, Jakob P.; Luecke, Hartmut; Ulmschneider, Martin B.

    2013-01-01

    Helicobacter pylori survival in acidic environments relies on cytoplasmic hydrolysis of gastric urea into ammonia and carbon dioxide, which buffer the pathogen’s periplasm. Urea uptake is greatly enhanced and regulated by HpUreI, a proton-gated inner membrane channel protein essential for gastric survival of H. pylori. The crystal structure of HpUreI describes a static snapshot of the channel with two constriction sites near the center of the bilayer that are too narrow to allow passage of urea or even water. Here we describe the urea transport mechanism at atomic resolution, revealed by unrestrained microsecond equilibrium molecular dynamics simulations of the hexameric channel assembly. Two consecutive constrictions open to allow conduction of urea, which is guided through the channel by interplay between conserved residues that determine proton rejection and solute selectivity. Remarkably, HpUreI conducts water at rates equivalent to aquaporins, which might be essential for efficient transport of urea at small concentration gradients. PMID:24305683

  5. Aminoaciduria and altered renal expression of luminal amino acid transporters in mice lacking novel gene collectrin.

    PubMed

    Malakauskas, Sandra M; Quan, Hui; Fields, Timothy A; McCall, Shannon J; Yu, Ming-Jiun; Kourany, Wissam M; Frey, Campbell W; Le, Thu H

    2007-02-01

    Defects in renal proximal tubule transport manifest in a number of human diseases. Although variable in clinical presentation, disorders such as Hartnup disease, Dent's disease, and Fanconi syndrome are characterized by wasting of solutes commonly recovered by the proximal tubule. One common feature of these disorders is aminoaciduria. There are distinct classes of amino acid transporters located in the apical and basal membranes of the proximal tubules that reabsorb >95% of filtered amino acids, yet few details are known about their regulation. We present our physiological characterization of a mouse line with targeted deletion of the gene collectrin that is highly expressed in the kidney. Collectrin-deficient mice display a reduced urinary concentrating capacity due to enhanced solute clearance resulting from profound aminoaciduria. The aminoaciduria is generalized, characterized by loss of nearly every amino acid, and results in marked crystalluria. Furthermore, in the kidney, collectrin-deficient mice have decreased plasma membrane populations of amino acid transporter subtypes B(0)AT1, rBAT, and b(0,+)AT, as well as altered cellular distribution of EAAC1. Our data suggest that collectrin is a novel mediator of renal amino acid transport and may provide further insight into the pathogenesis of a number of human disease correlates. PMID:16985211

  6. Transport and metabolism of fumaric acid in Saccharomyces cerevisiae in aerobic glucose-limited chemostat culture.

    PubMed

    Shah, Mihir V; van Mastrigt, Oscar; Heijnen, Joseph J; van Gulik, Walter M

    2016-04-01

    Currently, research is being focused on the industrial-scale production of fumaric acid and other relevant organic acids from renewable feedstocks via fermentation, preferably at low pH for better product recovery. However, at low pH a large fraction of the extracellular acid is present in the undissociated form, which is lipophilic and can diffuse into the cell. There have been no studies done on the impact of high extracellular concentrations of fumaric acid under aerobic conditions in S. cerevisiae, which is a relevant issue to study for industrial-scale production. In this work we studied the uptake and metabolism of fumaric acid in S. cerevisiae in glucose-limited chemostat cultures at a cultivation pH of 3.0 (pH < pK). Steady states were achieved with different extracellular levels of fumaric acid, obtained by adding different amounts of fumaric acid to the feed medium. The experiments were carried out with the wild-type S. cerevisiae CEN.PK 113-7D and an engineered S. cerevisiae ADIS 244 expressing a heterologous dicarboxylic acid transporter (DCT-02) from Aspergillus niger, to examine whether it would be capable of exporting fumaric acid. We observed that fumaric acid entered the cells most likely via passive diffusion of the undissociated form. Approximately two-thirds of the fumaric acid in the feed was metabolized together with glucose. From metabolic flux analysis, an increased ATP dissipation was observed only at high intracellular concentrations of fumarate, possibly due to the export of fumarate via an ABC transporter. The implications of our results for the industrial-scale production of fumaric acid are discussed. Copyright © 2015 John Wiley & Sons, Ltd. PMID:26683700

  7. DeltapH-Dependent Amino Acid Transport into Plasma Membrane Vesicles Isolated from Sugar Beet (Beta vulgaris L.) Leaves: II. Evidence for Multiple Aliphatic, Neutral Amino Acid Symports.

    PubMed

    Li, Z C; Bush, D R

    1991-08-01

    Proton-coupled aliphatic, neutral amino acid transport was investigated in plasma membrane vesicles isolated from sugar beet (Beta vulgaris L., cv Great Western) leaves. Two neutral amino acid symport systems were resolved based on inter-amino acid transport competition and on large variations in the specific activity of each porter in different species. Competitive inhibition was observed for transport competition between alanine, methionine, glutamine, and leucine (the alanine group) and between isoleucine, valine, and threonine (the isoleucine group). The apparent K(m) and K(i) values were similar for transport competition among amino acids within the alanine group. In contrast, the kinetics of transport competition between these two groups of amino acids did not fit a simple competitive model. Furthermore, members of the isoleucine group were weak transport antagonists of the alanine group. These results are consistent with two independent neutral amino acid porters. In support of that conclusion, the ratio of the specific activity of alanine transport versus isoleucine transport varied from two- to 13-fold in plasma membrane vesicles isolated from different plant species. This ratio would be expected to remain relatively stable if these amino acids were moving through a single transport system and, indeed, the ratio of alanine to glutamine transport varied less than twofold. Analysis of the predicted structure of the aliphatic, neutral amino acids in solution shows that isoleucine, valine, and threonine contain a branched methyl or hydroxyl group at the beta-carbon position that places a dense electron cloud close to the alpha-amino group. This does not occur for the unbranched amino acids or those that branch further away, e.g. leucine. We hypothesize that this structural feature of isoleucine, valine, and threonine results in unfavorable steric interactions with the alanine transport system that limits their flux through this porter. Hydrophobicity and

  8. Nanoscale mechanisms for the reduction of heat transport in bismuth

    NASA Astrophysics Data System (ADS)

    Markov, Maxime; Sjakste, Jelena; Fugallo, Giorgia; Paulatto, Lorenzo; Lazzeri, Michele; Mauri, Francesco; Vast, Nathalie

    2016-02-01

    Hand-on routes to reduce lattice thermal conductivity (LTC) in bismuth have been explored by employing a combination of Boltzmann's transport equation and ab initio calculations of phonon-phonon interaction within the density functional perturbation theory. We have first obtained the temperature dependence of the bulk LTC in excellent agreement with available experiments. A very accurate microscopic description of heat transport has been achieved and the electronic contribution to thermal conductivity has been determined. By controlling the interplay between phonon-phonon interaction and phonon scattering by sample boundaries, we predict the effect of size reduction for various temperatures and nanostructure shapes. The largest heat transport reduction is obtained in polycrystals with grain sizes smaller than 100 nm.

  9. Liquid water transport mechanism in the gas diffusion layer

    NASA Astrophysics Data System (ADS)

    Zhou, P.; Wu, C. W.

    We developed an equivalent capillary model of a microscale fiber-fence structure to study the microscale evolution and transport of liquid in a porous media and to reveal the basic principles of water transport in gas diffusion layer (GDL). Analytical solutions using the model show that a positive hydraulic pressure is needed to drive the liquid water to penetrate through the porous GDL even consisting of the hydrophilic fibers. Several possible contributions for the water configuration, such as capillary pressure, gravity, vapor condensation, wettability and microstructures of the GDL, are discussed using the lattice Boltzmann method (LBM). It is found that the distribution manners of the fibers and the spatial mixed-wettability in the GDL also play an important role in the transport of liquid water.

  10. Glycinergic-Fipronil Uptake Is Mediated by an Amino Acid Carrier System and Induces the Expression of Amino Acid Transporter Genes in Ricinus communis Seedlings.

    PubMed

    Xie, Yun; Zhao, Jun-Long; Wang, Chuan-Wei; Yu, Ai-Xin; Liu, Niu; Chen, Li; Lin, Fei; Xu, Han-Hong

    2016-05-18

    Phloem-mobile insecticides are efficient for piercing and sucking insect control. Introduction of sugar or amino acid groups to the parent compound can improve the phloem mobility of insecticides, so a glycinergic-fipronil conjugate (GlyF), 2-(3-(3-cyano-1-(2,6-dichloro-4-(trifluoromethyl)phenyl)-4-((trifluoromethyl)sulfinyl)-1H-pyrazole-5-yl)ureido) acetic acid, was designed and synthesized. Although the "Kleier model" predicted that this conjugate is not phloem mobile, GlyF can be continually detected during a 5 h collection of Ricinus communis phloem sap. Furthermore, an R. communis seedling cotyledon disk uptake experiment demonstrates that the uptake of GlyF is sensitive to pH, carbonyl cyanide m-chlorophenylhydrazone (CCCP), temperature, and p-chloromercuribenzenesulfonic acid (pCMBS) and is likely mediated by amino acid carrier system. To explore the roles of amino acid transporters (AATs) in GlyF uptake, a total of 62 AAT genes were identified from the R. communis genome in silico. Phylogenetic analysis revealed that AATs in R. communis were organized into the ATF (amino acid transporter) and APC (amino acid, polyaminem and choline transporter) superfamilies, with five subfamilies in ATF and two in APC. Furthermore, the expression profiles of 20 abundantly expressed AATs (cycle threshold (Ct) values <27) were analyzed at 1, 3, and 6 h after GlyF treatment by RT-qPCR. The results demonstrated that expression levels of four AAT genes, RcLHT6, RcANT15, RcProT2, and RcCAT2, were induced by the GlyF treatment in R. communis seedlings. On the basis of the observation that the expression profile of the four candidate genes is similar to the time course observation for GlyF foliar disk uptake, it is suggested that those four genes are possible candidates involved in the uptake of GlyF. These results contribute to a better understanding of the mechanism of GlyF uptake as well as phloem loading from a molecular biology perspective and facilitate functional

  11. Atomistic mechanisms of rapid energy transport in light-harvesting molecules

    NASA Astrophysics Data System (ADS)

    Ohmura, Satoshi; Koga, Shiro; Akai, Ichiro; Shimojo, Fuyuki; Kalia, Rajiv K.; Nakano, Aiichiro; Vashishta, Priya

    2011-03-01

    Synthetic supermolecules such as π-conjugated light-harvesting dendrimers efficiently harvest energy from sunlight, which is of significant importance for the global energy problem. Key to their success is rapid transport of electronic excitation energy from peripheral antennas to photochemical reaction cores, the atomistic mechanisms of which remains elusive. Here, quantum-mechanical molecular dynamics simulation incorporating nonadiabatic electronic transitions reveals the key molecular motion that significantly accelerates the energy transport based on the Dexter mechanism.

  12. Origin of traps and charge transport mechanism in hafnia

    SciTech Connect

    Islamov, D. R. Gritsenko, V. A.; Cheng, C. H.; Chin, A.

    2014-12-01

    In this study, we demonstrated experimentally and theoretically that oxygen vacancies are responsible for the charge transport in HfO{sub 2}. Basing on the model of phonon-assisted tunneling between traps, and assuming that the electron traps are oxygen vacancies, good quantitative agreement between the experimental and theoretical data of current-voltage characteristics was achieved. The thermal trap energy of 1.25 eV in HfO{sub 2} was determined based on the charge transport experiments.

  13. Mechanisms of acid resistance in enterohemorrhagic Escherichia coli.

    PubMed Central

    Lin, J; Smith, M P; Chapin, K C; Baik, H S; Bennett, G N; Foster, J W

    1996-01-01

    Enterohemorrhagic strains of Escherichia coli must pass through the acidic gastric barrier to cause gastrointestinal disease. Taking into account the apparent low infectious dose of enterohemorrhagic E. coli, 11 O157:H7 strains and 4 commensal strains of E. coli were tested for their abilities to survive extreme acid exposures (pH 3). Three previously characterized acid resistance systems were tested. These included an acid-induced oxidative system, an acid-induced arginine-dependent system, and a glutamate-dependent system. When challenged at pH 2.0, the arginine-dependent system provided more protection in the EHEC strains than in commensal strains. However, the glutamate-dependent system provided better protection than the arginine system and appeared equally effective in all strains. Because E. coli must also endure acid stress imposed by the presence of weak acids in intestinal contents at a pH less acidic than that of the stomach, the ability of specific acid resistance systems to protect against weak acids was examined. The arginine- and glutamate-dependent systems were both effective in protecting E. coli against the bactericidal effects of a variety of weak acids. The acids tested include benzoic acid (20 mM; pH 4.0) and a volatile fatty acid cocktail composed of acetic, propionic, and butyric acids at levels approximating those present in the intestine. The oxidative system was much less effective. Several genetic aspects of E. coli acid resistance were also characterized. The alternate sigma factor RpoS was shown to be required for oxidative acid resistance but was only partially involved with the arginine- and glutamate-dependent acid resistance systems. The arginine decarboxylase system (including adi and its regulators cysB and adiY) was responsible for arginine-dependent acid resistance. The results suggest that several acid resistance systems potentially contribute to the survival of pathogenic E. coli in the different acid stress environments of

  14. Low brain ascorbic acid increases susceptibility to seizures in mouse models of decreased brain ascorbic acid transport and Alzheimer's disease.

    PubMed

    Warner, Timothy A; Kang, Jing-Qiong; Kennard, John A; Harrison, Fiona E

    2015-02-01

    Seizures are a known co-occurring symptom of Alzheimer's disease, and they can accelerate cognitive and neuropathological dysfunction. Sub-optimal vitamin C (ascorbic acid) deficiency, that is low levels that do not lead the sufferer to present with clinical signs of scurvy (e.g. lethargy, hemorrhage, hyperkeratosis), are easily obtainable with insufficient dietary intake, and may contribute to the oxidative stress environment of both Alzheimer's disease and epilepsy. The purpose of this study was to test whether mice that have diminished brain ascorbic acid in addition to carrying human Alzheimer's disease mutations in the amyloid precursor protein (APP) and presenilin 1 (PSEN1) genes, had altered electrical activity in the brain (electroencephalography; EEG), and were more susceptible to pharmacologically induced seizures. Brain ascorbic acid was decreased in APP/PSEN1 mice by crossing them with sodium vitamin C transporter 2 (SVCT2) heterozygous knockout mice. These mice have an approximately 30% decrease in brain ascorbic acid due to lower levels of SVCT2 that supplies the brain with ASC. SVCT2+/-APP/PSEN1 mice had decreased ascorbic acid and increased oxidative stress in brain, increased mortality, faster seizure onset latency following treatment with kainic acid (10 mg/kg i.p.), and more ictal events following pentylenetetrazol (50 mg/kg i.p.) treatment. Furthermore, we report the entirely novel phenomenon that ascorbic acid deficiency alone increased the severity of kainic acid- and pentylenetetrazol-induced seizures. These data suggest that avoiding ascorbic acid deficiency may be particularly important in populations at increased risk for epilepsy and seizures, such as Alzheimer's disease. PMID:25616451

  15. Gymnemic acids inhibit sodium-dependent glucose transporter 1.

    PubMed

    Wang, Yu; Dawid, Corinna; Kottra, Gabor; Daniel, Hannelore; Hofmann, Thomas

    2014-06-25

    To evaluate the activity of botanicals used in Chinese Traditional Medicine as hypoglycemic agents for diabetes type II prevention and/or treatment, extracts prepared from 26 medicinal herbs were screened for their inhibitory activity on sodium-dependent glucose transporter 1 (SGLT1) by using two-electrode voltage-clamp recording of glucose uptake in Xenopus laevis oocytes microinjected with cRNA for SGLT1. Showing by far the strongest SGLT1 inhibitory effect, the phytochemicals extracted from Gymnema sylvestre (Retz.) Schult were located by means of activity-guided fractionation and identified as 3-O-β-D-glucuronopyranosyl-21-O-2-tigloyl-22-O-2-tigloyl gymnemagenin (1) and 3-O-β-D-glucuronopyranosyl-21-O-2-methylbutyryl-22-O-2-tigloyl gymnemagenin (2) by means of LC-MS/MS, UPLC-TOF/MS, and 1D/2D-NMR experiments. Both saponins exhibited low IC50 values of 5.97 (1) and 0.17 μM (2), the latter of which was in the same range as found for the high-affinity inhibitor phlorizin (0.21 μM). As SGLT1 is found in high levels in brush-border membranes of intestinal epithelial cells, these findings demonstrate for the first time the potential of these saponins for inhibiting electrogenic glucose uptake in the gastrointestinal tract. PMID:24856809

  16. Endoplasmic reticulum: Where nucleotide sugar transport meets cytokinin control mechanisms

    PubMed Central

    Niemann, Michael CE; Werner, Tomáš

    2015-01-01

    The endoplasmic reticulum (ER) is a multifunctional eukaryotic organelle where the vast majority of secretory proteins are folded and assembled to achieve their correct tertiary structures. The lumen of the ER and Golgi apparatus also provides an environment for numerous glycosylation reactions essential for modifications of proteins and lipids, and for cell wall biosynthesis. These glycosylation reactions require a constant supply of cytosolically synthesized substrate precursors, nucleotide sugars, which are transported by a group of dedicated nucleotide sugar transporters (NST). Recently, we have reported on the identification of a novel ER-localized NST protein, ROCK1, which mediates the transport of UDP-linked acetylated hexosamines across the ER membrane in Arabidopsis. Interestingly, it has been demonstrated that the activity of ROCK1 is important for the regulation of cytokinin-degrading enzymes, cytokinin oxidases/dehydrogenases (CKX), in the ER and, thus, for cytokinin responses. In this addendum we will address the biochemical and cellular activity of the ROCK1 transporter and its phylogenetic relation to other NST proteins. PMID:26418963

  17. Price Analysis of Railway Freight Transport under Marketing Mechanism

    NASA Astrophysics Data System (ADS)

    Shi, Ying; Fang, Xiaoping; Chen, Zhiya

    Regarding the problems in the reform of the railway tariff system and the pricing of the transport, by means of assaying the influence of the price elasticity on the artifice used for price, this article proposed multiple regressive model which analyzed price elasticity quantitatively. This model conclude multi-factors which influences on the price elasticity, such as the averagely railway freight charge, the averagely freight haulage of proximate supersede transportation mode, the GDP per capita in the point of origin, and a series of dummy variable which can reflect the features of some productive and consume demesne. It can calculate the price elasticity of different classes in different domains, and predict the freight traffic volume on different rate levels. It can calculate confidence-level, and evaluate the relevance of each parameter to get rid of irrelevant or little relevant variables. It supplied a good theoretical basis for directing the pricing of transport enterprises in market economic conditions, which is suitable for railway freight, passenger traffic and other transportation manner as well. SPSS (Statistical Package for the Social Science) software was used to calculate and analysis the example. This article realized the calculation by HYFX system(Ministry of Railways fund).

  18. Role of different scattering mechanisms on the temperature dependence of transport in graphene

    NASA Astrophysics Data System (ADS)

    Sarkar, Suman; Amin, Kazi Rafsanjani; Modak, Ranjan; Singh, Amandeep; Mukerjee, Subroto; Bid, Aveek

    2015-11-01

    Detailed experimental and theoretical studies of the temperature dependence of the effect of different scattering mechanisms on electrical transport properties of graphene devices are presented. We find that for high mobility devices the transport properties are mainly governed by completely screened short range impurity scattering. On the other hand, for the low mobility devices transport properties are determined by both types of scattering potentials - long range due to ionized impurities and short range due to completely screened charged impurities. The results could be explained in the framework of Boltzmann transport equations involving the two independent scattering mechanisms.

  19. Role of different scattering mechanisms on the temperature dependence of transport in graphene

    PubMed Central

    Sarkar, Suman; Amin, Kazi Rafsanjani; Modak, Ranjan; Singh, Amandeep; Mukerjee, Subroto; Bid, Aveek

    2015-01-01

    Detailed experimental and theoretical studies of the temperature dependence of the effect of different scattering mechanisms on electrical transport properties of graphene devices are presented. We find that for high mobility devices the transport properties are mainly governed by completely screened short range impurity scattering. On the other hand, for the low mobility devices transport properties are determined by both types of scattering potentials - long range due to ionized impurities and short range due to completely screened charged impurities. The results could be explained in the framework of Boltzmann transport equations involving the two independent scattering mechanisms. PMID:26608479

  20. Monocarboxylate Transporter-Mediated Transport of γ-Hydroxybutyric Acid in Human Intestinal Caco-2 Cells

    PubMed Central

    Lam, Wing Ki; Felmlee, Melanie A.

    2010-01-01

    The objectives of this study were to determine mRNA expression of monocarboxylate transporters (MCT) and to evaluate intestinal transport of the MCT substrates γ-hydroxybutyrate (GHB) and d-lactate in human intestinal Caco-2 cells. The presence of mRNA for MCT1, 2, 3, and 4 was observed in Caco-2 cells. The uptake of both GHB and d-lactate in Caco-2 cells was demonstrated to be pH- and concentration-dependent and sodium-independent. The uptake of GHB and d-lactate was best described by a Michaelis-Menten equation with passive diffusion (GHB: Km = 17.6 ± 10.5 mM, Vmax = 17.3 ± 11.7 nmol/min/mg, and P = 0.38 ± 0.15 μl/min/mg; and d-lactate: Km = 6.0 ± 2.9 mM, Vmax = 35.0 ± 18.4 nmol/min/mg, and P = 1.3 ± 0.6 μl/min/mg). The uptake of GHB and d-lactate was significantly decreased by the known MCT inhibitor α-cyano-4-hydroxycinnamate and the MCT substrates GHB and d-lactate but not by the organic cation tetraethylammonium chloride. Directional flux studies with both GHB and d-lactate suggested the involvement of carrier-mediated transport with the permeability in the apical to basolateral direction higher than that in the basolateral to apical direction. These findings confirm the presence of MCT1–4 in Caco-2 cells and demonstrate GHB and d-lactate transport characteristics consistent with proton-dependent MCT-mediated transport. PMID:19952290

  1. Influence of Verapamil and Cyclosporin A on bile acid metabolism and transport in rat liver slices.

    PubMed

    Barth, Astrid; Braun, Jerome; Müller, Dieter

    2006-08-01

    Verapamil (V) is a specific inhibitor of the P-glycoprotein (mdr1) in the hepatocyte canalicular membrane. Cyclosporin A (CsA) as an essential immunosuppressive drug has potentially cholestatic adverse effects on the liver, but increases the expression of mdr1. In precision-cut liver slices from 34- to 40-day-old male Wistar rats 26 individual free and conjugated bile acids (BAs) as markers of hepatic transport and synthesis function were analysed after 4 h incubation with V (100 microM) or CsA (5 microM) in Krebs-Henseleit buffer. Some slices were loaded with cholic acid (CA 5 microM) or tauro-ursodeoxycholic acid (T-UDCA 5 microM) to investigate the V and CsA effects under conditions of BA supplementation. BAs were determined in tissue and medium by HPLC with postcolumn derivatisation and fluorescence detection. V and CsA, influencing different targets in BA transport, enhanced slice concentrations of T- and glyco- (G-) conjugated CA only when exogenous CA was given additionally. This BA accumulation in tissue is more reflected at decreased medium concentrations of these BAs after V and CsA incubations. Both V and CsA also inhibited CA uptake into the slices. The acidic chenodeoxycholic acid (CDCA) synthesis pathway is disturbed: T- and G-CDCA concentrations are diminished in slices and medium after V and CsA incubations. T-UDCA plus V or CsA enhanced not only its own slice concentration but also the concentration of the trihydroxylated tauro-muricholic acid (T-beta-MCA), reflecting the conversion of the accumulated dihydroxylated T-UDCA into the T-beta-MCA. The similar effects of V and CsA on BA transport and metabolism can be explained by mdr1 mediated disturbances of cellular ATP transport rather than by inhibition of individual BA transporters. PMID:16793245

  2. Polaron conductivity mechanism in potassium acid phthalate crystal: AC-conductivity investigation

    NASA Astrophysics Data System (ADS)

    Filipič, Cene; Levstik, Iva; Levstik, Adrijan; Hadži, Dušan

    2016-08-01

    The complex dielectric constant, \\varepsilon *(ν ,T), of potassium acid phthalate monocrystal (KAP) was investigated over the broad frequency and temperature range. While the imaginary part of dielectric constant ε‧‧(ν) increases rapidly with increasing temperature in the studied temperature range, the real part of dielectric constant ε‧(ν) increases only at high temperatures; there is almost no change of ε‧(ν) below 200 K. Both values of ε‧ and ε‧‧ are frequency dependent; the values increase with decreasing frequencies. At temperatures below 450 K the ac electrical conductivity and dielectric constant follow simultaneously the universal dielectric response (UDR). The analysis of the temperature dependence of the UDR parameter s in terms of the theoretical model for small polarons revealed that this mechanism governs the charge transport in KAP crystal in the studied temperature range.

  3. Amino Acid Sensing by mTORC1: Intracellular Transporters Mark the Spot.

    PubMed

    Goberdhan, Deborah C I; Wilson, Clive; Harris, Adrian L

    2016-04-12

    Cell metabolism and growth are matched to nutrient availability via the amino-acid-regulated mechanistic target of rapamycin complex 1 (mTORC1). Transporters have emerged as important amino acid sensors controlling mTOR recruitment and activation at the surface of multiple intracellular compartments. Classically, this has involved late endosomes and lysosomes, but now, in a recent twist, also the Golgi apparatus. Here we propose a model in which specific amino acids in assorted compartments activate different mTORC1 complexes, which may have distinct drug sensitivities and functions. We will discuss the implications of this for mTORC1 function in health and disease. PMID:27076075

  4. D-cycloserine transport in human intestinal epithelial (Caco-2) cells: mediation by a H(+)-coupled amino acid transporter.

    PubMed Central

    Thwaites, D. T.; Armstrong, G.; Hirst, B. H.; Simmons, N. L.

    1995-01-01

    1. The ability of D-cycloserine to act as a substrate for H+/amino acid symport has been tested in epithelial layers of Caco-2 human intestinal cells. 2. In Na(+)-free media with the apical bathing media held at pH 6.0, D-cycloserine (20 mM) is an effective inhibitor of net transepithelial transport (Jnet) of L-alanine (100 microM) and its accumulation (across the apical membrane) in a similar manner to amino acid substrates (L-alanine, beta-alanine, L-proline and glycine). In contrast L-valine was ineffective as an inhibitor for H+/amino acid symport. Both inhibition of L-alanine Jnet and its accumulation by D-cycloserine were dose-dependent, maximal inhibition being achieved by 5-10 mM. 3. Both D-cycloserine and known substrates for H+/amino acid symport stimulated an inward short circuit current (Isc) when voltage-clamped monolayers of Caco-2 epithelia, mounted in Ussing chambers, were exposed to apical substrate in Na(+)-free media, with apical pH held at 6.0. The D-cycloserine dependent increase in Isc was dose-dependent with an apparent Km = 15.8 +/- 2.0 (mean +/- s.e. mean) mM, and Vmax = 373 +/- 21 nmol cm-2h-1. 4. D-Cycloserine (20 mM) induced a prompt acidification of Caco-2 cell cytosol when superfused at the apical surface in both Na+ and Na(+)-free conditions. Cytosolic acidification in response to D-cycloserine was dependent upon superfusate pH, being attenuated at pH 8 and enhanced in acidic media. 5. The increment in Isc with 20 mM D-cycloserine was non-additive with other amino acid substrates for H+/amino acid symport. PMID:8548174

  5. Polymeric Nucleic Acid Vehicles Exploit Active Inter-Organelle Trafficking Mechanisms

    PubMed Central

    Fichter, Katye M.; Ingle, Nilesh. P.; McLendon, Patrick M.; Reineke, Theresa M.

    2013-01-01

    Materials that self-assemble with nucleic acids into nanocomplexes (polyplexes) are widely used in many fundamental biological and biomedical experiments. However, understanding the intracellular transport mechanisms of these vehicles remains a major hurdle in their effective usage. Here, we investigate two polycation models, Glycofect, (which slowly degrades via hydrolysis) and linear PEI, (which does not rapidly hydrolyze) to determine the impact of polymeric structure on intracellular trafficking. Cells transfected using Glycofect underwent increasing transgene expression over the course of 40 h, and remained benign over the course of 7 days. Transgene expression in cells transfected with PEI peaked at 16 h post-transfection and resulted in less than 10% survival after 7 days. While saccharide-containing Glycofect has a higher buffering capacity than PEI, polyplexes created with Glycofect demonstrate more sustained endosomal release, possibly suggesting an additional or alternative delivery mechanism to the classical “proton sponge mechanism”. PEI appeared to promote release of DNA from acidic organelles more than Glycofect. Immunofluorescence images indicate that both Glycofect and linear PEI traffic oligodeoxynucleotides (ODNs) to the Golgi and endoplasmic reticulum, which may be a route taken for nuclear delivery. However, Glycofect polyplexes demonstrated higher colocalization with the ER than PEI polyplexes and colocalization experiments indicate retrograde transport of polyplexes via COP I vesicles from the Golgi to the ER. We conclude that slow release and unique trafficking behaviors of Glycofect polyplexes may be due to the presence of saccharide units and the degradable nature of the polymer, allowing more efficacious and benign delivery. PMID:23234474

  6. Effects of endotoxin exposure on cationic amino acid transporter function in ovine peripheral blood mononuclear cells.

    PubMed

    Clark, Megan F; Reade, Michael C; Boyd, C A R; Young, J Duncan

    2003-03-01

    Rodent models of sepsis differ from clinical human disease in that humans make substantially less whole-body nitric oxide and have different cellular responses to endotoxin. Sheep, when exposed to endotoxin, behave in a manner more similar to humans. Many studies of rodent peripheral blood mononuclear cells (PBMCs) exposed to endotoxin demonstrate increased cationic amino acid transporter function (particularly through the y+ transporter) to supply arginine substrate to upregulated nitric oxide synthase. Whether this is true in sheep is not known. We have studied cationic amino acid transport in sheep PBMCs stimulated with endotoxin, using labelled lysine. PBMCs stimulated both in vitro and in vivo show an initial reduction in total and y+ lysine transport (after 1-2 h exposure to endotoxin): a previously undescribed effect of endotoxin. In in vitro activated cells, the reduction in y+ transport was prevented by the lipoxygenase inhibitor, nordihydroguaretic acid (NDGA), and the phospholipase inhibitor 4-bromophenacyl bromide (4-BPAB), but not cyclohexamide or a number of other inhibitors of intracellular second-messenger pathways. In contrast after 14 h incubation, the expected increase in total and y+ lysine transport was seen. The increase in y+ transport could be prevented by cyclohexamide, dexamethasone, ibuprofen, the protein kinase C inhibitor sphingosine, NDGA and 4-BPAB. These results suggest that in response to endotoxin exposure there is an initial decrease in y+ activity mediated by a lipoxygenase product, followed by a substantial increase in y+ activity mediated by the products of either cyclo-oxygenase or lipoxygenase. Cyclo-oxygenase and/or lipoxygenase inhibition might be useful in reducing arginine transport, and hence nitric oxide production, in these cells. PMID:12621525

  7. Mechanism of Paroxetine (Paxil) Inhibition of the Serotonin Transporter

    PubMed Central

    Davis, Bruce A.; Nagarajan, Anu; Forrest, Lucy R.; Singh, Satinder K.

    2016-01-01

    The serotonin transporter (SERT) is an integral membrane protein that exploits preexisting sodium-, chloride-, and potassium ion gradients to catalyze the thermodynamically unfavorable movement of synaptic serotonin into the presynaptic neuron. SERT has garnered significant clinical attention partly because it is the target of multiple psychoactive agents, including the antidepressant paroxetine (Paxil), the most potent selective serotonin reuptake inhibitor known. However, the binding site and orientation of paroxetine in SERT remain controversial. To provide molecular insight, we constructed SERT homology models based on the Drosophila melanogaster dopamine transporter and docked paroxetine to these models. We tested the predicted binding configurations with a combination of radioligand binding and flux assays on wild-type and mutant SERTs. Our data suggest that the orientation of paroxetine, specifically its fluorophenyl ring, in SERT’s substrate binding site directly depends on this pocket’s charge distribution, and thereby provide an avenue toward understanding and enhancing high-affinity antidepressant activity. PMID:27032980

  8. Mechanism of Paroxetine (Paxil) Inhibition of the Serotonin Transporter.

    PubMed

    Davis, Bruce A; Nagarajan, Anu; Forrest, Lucy R; Singh, Satinder K

    2016-01-01

    The serotonin transporter (SERT) is an integral membrane protein that exploits preexisting sodium-, chloride-, and potassium ion gradients to catalyze the thermodynamically unfavorable movement of synaptic serotonin into the presynaptic neuron. SERT has garnered significant clinical attention partly because it is the target of multiple psychoactive agents, including the antidepressant paroxetine (Paxil), the most potent selective serotonin reuptake inhibitor known. However, the binding site and orientation of paroxetine in SERT remain controversial. To provide molecular insight, we constructed SERT homology models based on the Drosophila melanogaster dopamine transporter and docked paroxetine to these models. We tested the predicted binding configurations with a combination of radioligand binding and flux assays on wild-type and mutant SERTs. Our data suggest that the orientation of paroxetine, specifically its fluorophenyl ring, in SERT's substrate binding site directly depends on this pocket's charge distribution, and thereby provide an avenue toward understanding and enhancing high-affinity antidepressant activity. PMID:27032980

  9. Modulation of ileal bile acid transporter (ASBT) activity by depletion of plasma membrane cholesterol: association with lipid rafts

    PubMed Central

    Annaba, Fadi; Sarwar, Zaheer; Kumar, Pradeep; Saksena, Seema; Turner, Jerrold R.; Dudeja, Pradeep K.; Gill, Ravinder K.; Alrefai, Waddah A.

    2016-01-01

    Apical sodium-dependent bile acid transporter (ASBT) represents a highly efficient conservation mechanism of bile acids via mediation of their active transport across the luminal membrane of terminal ileum. To gain insight into the cellular regulation of ASBT, we investigated the association of ASBT with cholesterol and sphingolipid-enriched specialized plasma membrane microdomains known as lipid rafts and examined the role of membrane cholesterol in maintaining ASBT function. Human embryonic kidney (HEK)-293 cells stably transfected with human ASBT, human ileal brush-border membrane vesicles, and human intestinal epithelial Caco-2 cells were utilized for these studies. Floatation experiments on Optiprep density gradients demonstrated the association of ASBT protein with lipid rafts. Disruption of lipid rafts by depletion of membrane cholesterol with methyl-β-cyclodextrin (MβCD) significantly reduced the association of ASBT with lipid rafts, which was paralleled by a decrease in ASBT activity in Caco-2 and HEK-293 cells treated with MβCD. The inhibition in ASBT activity by MβCD was blocked in the cells treated with MβCD-cholesterol complexes. Kinetic analysis revealed that MβCD treatment decreased the Vmax of the transporter, which was not associated with alteration in the plasma membrane expression of ASBT. Our study illustrates that cholesterol content of lipid rafts is essential for the optimal activity of ASBT and support the association of ASBT with lipid rafts. These findings suggest a novel mechanism by which ASBT activity may be rapidly modulated by alterations in cholesterol content of plasma membrane and thus have important implications in processes related to maintenance of bile acid and cholesterol homeostasis. PMID:18063707

  10. Influence of organic acids on the transport of heavy metals in soil.

    PubMed

    Schwab, A P; Zhu, D S; Banks, M K

    2008-06-01

    Vegetation historically has been an important part of reclamation of sites contaminated with metals, whether the objective was to stabilize the metals or remove them through phytoremediation. Understanding the impact of organic acids typically found in the rhizosphere would contribute to our knowledge of the impact of plants in contaminated environments. Heavy metal transport in soils in the presence of simple organic acids was assessed in two laboratory studies. In the first study, thin layer chromatography (TLC) was used to investigate Zn, Cd, and Pb movement in a sandy loam soil as affected by soluble organic acids in the rhizosphere. Many of these organic acids enhanced heavy metal movement. For organic acid concentrations of 10mM, citric acid had the highest R(f) values (frontal distance moved by metal divided by frontal distance moved by the solution) for Zn, followed by malic, tartaric, fumaric, and glutaric acids. Citric acid also has the highest R(f) value for Cd movement followed by fumaric acid. Citric acid and tartaric acid enhanced Pb transport to the greatest degree. For most organic acids studied, R(f) values followed the trend Zn>Cd>Pb. Citric acid (10mM) increased R(f) values of Zn and Cd by approximately three times relative to water. In the second study, small soil columns were used to test the impact of simple organic acids on Zn, Cd, and Pb leaching in soils. Citric acid greatly enhanced Zn and Cd movement in soils but had little influence on Pb movement. The Zn and Cd in the effluents from columns treated with 10mM citric acid attained influent metal concentrations by the end of the experiment, but effluent metal concentrations were much less than influent concentrations for citrate <10mM. Exchangeable Zn in the soil columns was about 40% of total Zn, and approximately 80% total Cd was in exchangeable form. Nearly all of the Pb retained by the soil columns was exchangeable. PMID:18482743

  11. Substrate-specific effects of pirinixic acid derivatives on ABCB1-mediated drug transport

    PubMed Central

    Michaelis, Martin; Rothweiler, Florian; Wurglics, Mario; Aniceto, Natália; Dittrich, Michaela; Zettl, Heiko; Wiese, Michael; Wass, Mark; Ghafourian, Taravat; Schubert-Zsilavecz, Manfred; Cinatl, Jindrich

    2016-01-01

    Pirinixic acid derivatives, a new class of drug candidates for a range of diseases, interfere with targets including PPARα, PPARγ, 5-lipoxygenase (5-LO), and microsomal prostaglandin and E2 synthase-1 (mPGES1). Since 5-LO, mPGES1, PPARα, and PPARγ represent potential anti-cancer drug targets, we here investigated the effects of 39 pirinixic acid derivatives on prostate cancer (PC-3) and neuroblastoma (UKF-NB-3) cell viability and, subsequently, the effects of selected compounds on drug-resistant neuroblastoma cells. Few compounds affected cancer cell viability in low micromolar concentrations but there was no correlation between the anti-cancer effects and the effects on 5-LO, mPGES1, PPARα, or PPARγ. Most strikingly, pirinixic acid derivatives interfered with drug transport by the ATP-binding cassette (ABC) transporter ABCB1 in a drug-specific fashion. LP117, the compound that exerted the strongest effect on ABCB1, interfered in the investigated concentrations of up to 2μM with the ABCB1-mediated transport of vincristine, vinorelbine, actinomycin D, paclitaxel, and calcein-AM but not of doxorubicin, rhodamine 123, or JC-1. In silico docking studies identified differences in the interaction profiles of the investigated ABCB1 substrates with the known ABCB1 binding sites that may explain the substrate-specific effects of LP117. Thus, pirinixic acid derivatives may offer potential as drug-specific modulators of ABCB1-mediated drug transport. PMID:26887049

  12. MODULATION OF HEALTH AND PRODUCTION BY ORAL BETA-GLUCAN AND ASCORBIC ACID AFTER TRANSPORT

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Yeast cell-wall Beta-glucan works synergistically with ascorbic acid to enhance growth of neonatal calves in indoor, raised crates. Objectives of this study were to determine 1) if this combination of dietary supplements would improve neonatal calves' stress responses to transport, 2) production an...

  13. Substrate-specific effects of pirinixic acid derivatives on ABCB1-mediated drug transport.

    PubMed

    Michaelis, Martin; Rothweiler, Florian; Wurglics, Mario; Aniceto, Natália; Dittrich, Michaela; Zettl, Heiko; Wiese, Michael; Wass, Mark; Ghafourian, Taravat; Schubert-Zsilavecz, Manfred; Cinatl, Jindrich

    2016-03-01

    Pirinixic acid derivatives, a new class of drug candidates for a range of diseases, interfere with targets including PPARα, PPARγ, 5-lipoxygenase (5-LO), and microsomal prostaglandin and E2 synthase-1 (mPGES1). Since 5-LO, mPGES1, PPARα, and PPARγ represent potential anti-cancer drug targets, we here investigated the effects of 39 pirinixic acid derivatives on prostate cancer (PC-3) and neuroblastoma (UKF-NB-3) cell viability and, subsequently, the effects of selected compounds on drug-resistant neuroblastoma cells. Few compounds affected cancer cell viability in low micromolar concentrations but there was no correlation between the anti-cancer effects and the effects on 5-LO, mPGES1, PPARα, or PPARγ. Most strikingly, pirinixic acid derivatives interfered with drug transport by the ATP-binding cassette (ABC) transporter ABCB1 in a drug-specific fashion. LP117, the compound that exerted the strongest effect on ABCB1, interfered in the investigated concentrations of up to 2μM with the ABCB1-mediated transport of vincristine, vinorelbine, actinomycin D, paclitaxel, and calcein-AM but not of doxorubicin, rhodamine 123, or JC-1. In silico docking studies identified differences in the interaction profiles of the investigated ABCB1 substrates with the known ABCB1 binding sites that may explain the substrate-specific effects of LP117. Thus, pirinixic acid derivatives may offer potential as drug-specific modulators of ABCB1-mediated drug transport. PMID:26887049

  14. Disposition and transportation of surplus radioactive low specific activity nitric acid. Volume 1, Environmental Assessment

    SciTech Connect

    1995-05-01

    DOE is deactivating the PUREX plant at Hanford; this will involve the disposition of about 692,000 liters (183,000 gallons) of surplus nitric acid contaminated with low levels of U and other radionuclides. The nitric acid, designated as low specific activity, is stored in 4 storage tanks at PUREX. Five principal alternatives were evaluated: transfer for reuse (sale to BNF plc), no action, continued storage in Hanford upgraded or new facility, consolidation of DOE surplus acid, and processing the LSA nitric acid as waste. The transfer to BNF plc is the preferred alternative. From the analysis, it is concluded that the proposed disposition and transportation of the acid does not constitute a major federal action significantly affecting the quality of the human environment within the meaning of NEPA; therefore an environmental impact statement is not required.

  15. Intestinal peptidases form functional complexes with the neutral amino acid transporter B0AT1

    PubMed Central

    Fairweather, Stephen J.; Bröer, Angelika; O'Mara, Megan L.; Bröer, Stefan

    2012-01-01

    The brush-border membrane of the small intestine and kidney proximal tubule are the major sites for the absorption and re-absorption of nutrients in the body respectively. Transport of amino acids is mediated through the action of numerous secondary active transporters. In the mouse, neutral amino acids are transported by B0AT1 [broad neutral (0) amino acid transporter 1; SLC6A19 (solute carrier family 6 member 19)] in the intestine and by B0AT1 and B0AT3 (SLC6A18) in the kidney. Immunoprecipitation and Blue native electrophoresis of intestinal brush-border membrane proteins revealed that B0AT1 forms complexes with two peptidases, APN (aminopeptidase N/CD13) and ACE2 (angiotensin-converting enzyme 2). Physiological characterization of B0AT1 expressed together with these peptidases in Xenopus laevis oocytes revealed that APN increased the substrate affinity of the transporter up to 2.5-fold and also increased its surface expression (Vmax). Peptide competition experiments, in silico modelling and site-directed mutagenesis of APN suggest that the catalytic site of the peptidase is involved in the observed changes of B0AT1 apparent substrate affinity, possibly by increasing the local substrate concentration. These results provide evidence for the existence of B0AT1-containing digestive complexes in the brush-border membrane, interacting differentially with various peptidases, and responding to the dynamic needs of nutrient absorption in the intestine and kidney. PMID:22677001

  16. Amyloid-β Precursor Protein: Multiple fragments, numerous transport routes and mechanisms

    PubMed Central

    Muresan, Virgil; Muresan, Zoia Ladescu

    2015-01-01

    This review provides insight into the intraneuronal transport of the Amyloid-β Precursor Protein (APP), the prototype of an extensively posttranslationally modified and proteolytically cleaved transmembrane protein. Uncovering the intricacies of APP transport proves to be a challenging endeavor of cell biology research, deserving increased priority, since APP is at the core of the pathogenic process in Alzheimer’s disease. After being synthesized in the endoplasmic reticulum in the neuronal soma, APP enters the intracellular transport along the secretory, endocytic, and recycling routes. Along these routes, APP undergoes cleavage into defined sets of fragments, which themselves are transported – mostly independently – to distinct sites in neurons, where they exert their functions. We review the currently known routes and mechanisms of transport of full-length APP, and of APP fragments, commenting largely on the experimental challenges posed by studying transport of extensively cleaved proteins. The review emphasizes the interrelationships between the proteolytic and posttranslational modifications, the intracellular transport, and the functions of the APP species. A goal remaining to be addressed in the future is the incorporation of the various views on APP transport into a coherent picture. In this review, the disease context is only marginally addressed; the focus is on the basic biology of APP transport in normal conditions. As shown, the studies of APP transport uncovered numerous mechanisms of transport, some of them conventional, and others, novel, awaiting exploration. PMID:25573596

  17. Sediment transport mechanisms through the sustainable vegetated flow networks

    NASA Astrophysics Data System (ADS)

    Allen, Deonie; Haynes, Heather; Arthur, Scott

    2016-04-01

    Understanding the pollution treatment efficiency of a sustainable urban drainage (SuDS) asset or network requires the influx, transport, detention and discharge of the pollutant within the system. To date event specific monitoring of sediment (primarily total suspended solids) concentrations in the inflow and discharge from SuDS have been monitored. Long term analysis of where the sediment is transported to and the residency time of this pollutant within the SuDS asset or network have not been unraveled due to the difficulty in monitoring specific sediment particulate movement. Using REO tracing methodology, sediment particulate movement has become possible. In tracing sediment movement from an urban surface the internal residency and transportation of this sediment has illustrated SuDS asset differences in multi-event detention. Of key importance is the finding that sediment remains within the SuDS asset for extended periods of time, but that the location sediment detention changes. Thus, over multiple rainfall-runoff events sediment is seen to move through the SuDS assets and network proving the assumption that detained sediment is permanent and stationary to be inaccurate. Furthermore, mass balance analysis of SuDS sediment indicates that there is notable re-suspension and ongoing release of sediment from the SuDS over time and cumulative rainfall-runoff events. Continued monitoring of sediment deposition and concentration in suspension illustrates that sediment detention within SuDS decreases over time/multiple events, without stabilizing within a 12 month period. Repeated experiments show a consistent pattern of detention and release for the three SuDS networks monitored in Scotland. Through consideration of both rainfall and flow factors the drivers of sediment transport within the monitored SuDS have been identified. Within the limitation of this field study the key drivers to SuDS sediment detention efficiency (or transport of sediment through the system

  18. Charge transport and structural dynamics in carboxylic-acid-based deep eutectic mixtures.

    PubMed

    Griffin, Philip J; Cosby, Tyler; Holt, Adam P; Benson, Roberto S; Sangoro, Joshua R

    2014-08-01

    Charge transport and structural dynamics in the 1:2 mol ratio mixture of lidocaine and decanoic acid (LID-DA), a model deep eutectic mixture (DEM), have been characterized over a wide temperature range using broad-band dielectric spectroscopy and depolarized dynamic light scattering. Additionally, Fourier transform infrared spectroscopy measurements were performed to assess the degree of proton transfer between the neutral parent molecules. From our detailed analysis of the dielectric spectra, we have determined that this carboxylic-acid-based DEM is approximately 25% ionic at room temperature. Furthermore, we have found that the characteristic diffusion rate of mobile charge carriers is practically identical to the rate of structural relaxation at all measured temperatures, indicating that fast proton transport does not occur in LID-DA. Our results demonstrate that while LID-DA exhibits the thermal characteristics of a DEM, its charge transport properties resemble those of a protic ionic liquid. PMID:25025600

  19. Water transport mechanism through open capillaries analyzed by direct surface modifications on biological surfaces.

    PubMed

    Ishii, Daisuke; Horiguchi, Hiroko; Hirai, Yuji; Yabu, Hiroshi; Matsuo, Yasutaka; Ijiro, Kuniharu; Tsujii, Kaoru; Shimozawa, Tateo; Hariyama, Takahiko; Shimomura, Masatsugu

    2013-01-01

    Some small animals only use water transport mechanisms passively driven by surface energies. However, little is known about passive water transport mechanisms because it is difficult to measure the wettability of microstructures in small areas and determine the chemistry of biological surfaces. Herein, we developed to directly analyse the structural effects of wettability of chemically modified biological surfaces by using a nanoliter volume water droplet and a hi-speed video system. The wharf roach Ligia exotica transports water only by using open capillaries in its legs containing hair- and paddle-like microstructures. The structural effects of legs chemically modified with a self-assembled monolayer were analysed, so that the wharf roach has a smart water transport system passively driven by differences of wettability between the microstructures. We anticipate that this passive water transport mechanism may inspire novel biomimetic fluid manipulations with or without a gravitational field. PMID:24149467

  20. Collectrin and ACE2 in renal and intestinal amino acid transport.

    PubMed

    Singer, Dustin; Camargo, Simone M R

    2011-01-01

    Neutral amino acid transporters of the SLC6 family are expressed at the apical membrane of kidney and/or small intestine, where they (re-)absorb amino acids into the body. In this review we present the results concerning the dependence of their apical expression with their association to partner proteins. We will in particular focus on the situation of B0AT1 and B0AT3, that associate with members of the renin-angiotensin system (RAS), namely Tmem27 and angiotensin-converting enzyme 2 (ACE2), in a tissue specific manner. The role of this association in relation to the formation of a functional unit related to Na+ or amino acid transport will be assessed. We will conclude with some remarks concerning the relevance of this association to Hartnup disorder, where some mutations have been shown to differentially interact with the partner proteins. PMID:21814048

  1. Neutral amino acid transport in epithelial cells and its malfunction in Hartnup disorder.

    PubMed

    Bröer, S; Cavanaugh, J A; Rasko, J E J

    2005-02-01

    Hartnup disorder is an autosomal recessive abnormality of renal and gastrointestinal neutral amino acid transport. A corresponding transport activity has been characterized in kidney and intestinal cells and named system B(0). The failure to resorb amino acids in this disorder is thought to be compensated by a protein-rich diet. However, in combination with a poor diet and other factors, more severe symptoms can develop in Hartnup patients, including a photosensitive pellagra-like skin rash, cerebellar ataxia and other neurological symptoms. Homozygosity mapping in a Japanese family and linkage analysis on six Australian pedigrees placed the Hartnup disorder gene at a locus on chromosome 5p15. This fine mapping facilitated a candidate gene approach within the interval, which resulted in the cloning and characterization of a novel member of the sodium-dependent neurotransmitter transporter family (B(0)AT1, SLC6A19) from mouse and human kidney, which shows all properties of system B(0). Flux experiments and electrophysiological recording showed that the transporter is Na(+) dependent and Cl(-) independent, electrogenic and actively transports most neutral amino acids. In situ hybridization showed strong expression in intestinal villi and in the proximal tubule of the kidney. Expression of B(0)AT1 was restricted to kidney, intestine and skin. A total of ten mutations have been identified in SLC6A19 that co-segregate with disease in the predicted recessive manner, with the majority of affected individuals being compound heterozygotes. These mutations lead to altered neutral amino acid transport function compared to the wild-type allele in vitro. One of the mutations occurs in members of the original Hartnup family described in 1956, thereby defining SLC6A19 as the 'Hartnup'-gene. PMID:15667315

  2. Mutation and gene transfer of neutral amino acid transport System L genes in mammalian cells

    SciTech Connect

    El-Gewely, M.R.; Collarini, E.J.; Campbell, G.S.; Oxender, D.L.

    1987-05-01

    The authors are attempting to clone the genes coding for amino acid transport System L. Chinese hamster ovary (CHO) cell mutants that are temperature sensitive in their leucyl-tRNA synthetase show temperature-dependent regulation of System L. Temperature resistant mutants isolated from these cells have constitutively derepressed System L activity. Somatic cell fusion studies using these mutants have suggested that a trans-acting element controls regulation of System L. Mutants with reduced transport activity were isolated by a TH-suicide selection. The growth of these mutant cells is limited by the transport defect. CHO mutants were transformed with a human cosmid library, followed by selection at high temperatures and low leucine concentrations. Some transformants have increased levels of System L activity, suggesting that human genes coding for leucine transport have been incorporated into the CHO genome. Human sequences were rescued by a lambda in vitro packaging system. These sequences hybridize to vector and total human DNA. Experiments are being done to confirm that these sequences indeed code for transport System L. They are also attempting to label membrane components of amino acid transporters by group-specific modifying reagents.

  3. High specificity in response of the sodium-dependent multivitamin transporter to derivatives of pantothenic acid.

    PubMed

    Chirapu, Srinivas Reddy; Rotter, Charles J; Miller, Emily L; Varma, Manthena V; Dow, Robert L; Finn, M G

    2013-01-01

    Essential nutrients are attractive targets for the transport of biologically active agents across cell membranes, since many are substrates for active cellular importation pathways. The sodium-dependent multivitamin transporter (SMVT) is among the best characterized of these, and biotin derivatives have been its most popular targets. We have surveyed 45 derivatives of pantothenic acid, another substrate of SMVT, long known as a competitive inhibitor of biotin transport. Variations of the β-alanyl fragment of pantothenate were uniformly rejected by the transporter, including derivatives with very similar steric and acidic characteristics to the natural substrate. The secondary hydroxyl of the 2,2-dimethyl-1,3-propanediol (pantoyl) fragment was the only position at which potential linkers could be attached while retaining activity as an inhibitor of biotin uptake and a substrate for sodium-dependent transport. However, triazole conjugates to several drug-like cargo motifs were not accepted as substrates by human SMVT in cell culture. Two compounds were observed which did not inhibit biotin uptake but were themselves transported in a sodium-dependent fashion, suggesting more complex behavior than expected. These studies represent the most extensive examination to date of pantothenate as an anchor for SMVT-mediated drug delivery, showing that this route requires further investigation before being judged promising. PMID:23578027

  4. Salmonella infection inhibits intestinal biotin transport: cellular and molecular mechanisms

    PubMed Central

    Ghosal, Abhisek; Jellbauer, Stefan; Kapadia, Rubina; Raffatellu, Manuela

    2015-01-01

    Infection with the nontyphoidal Salmonella is a common cause of food-borne disease that leads to acute gastroenteritis/diarrhea. Severe/prolonged cases of Salmonella infection could also impact host nutritional status, but little is known about its effect on intestinal absorption of vitamins, including biotin. We examined the effect of Salmonella enterica serovar Typhimurium (S. typhimurium) infection on intestinal biotin uptake using in vivo (streptomycin-pretreated mice) and in vitro [mouse (YAMC) and human (NCM460) colonic epithelial cells, and human intestinal epithelial Caco-2 cells] models. The results showed that infecting mice with wild-type S. typhimurium, but not with its nonpathogenic isogenic invA spiB mutant, leads to a significant inhibition in jejunal/colonic biotin uptake and in level of expression of the biotin transporter, sodium-dependent multivitamin transporter. In contrast, infecting YAMC, NCM460, and Caco-2 cells with S. typhimurium did not affect biotin uptake. These findings suggest that the effect of S. typhimurium infection is indirect and is likely mediated by proinflammatory cytokines, the levels of which were markedly induced in the intestine of S. typhimurium-infected mice. Consistent with this hypothesis, exposure of NCM460 cells to the proinflammatory cytokines TNF-α and IFN-γ led to a significant inhibition of biotin uptake, sodium-dependent multivitamin transporter expression, and activity of the SLC5A6 promoter. The latter effects appear to be mediated, at least in part, via the NF-κB signaling pathway. These results demonstrate that S. typhimurium infection inhibits intestinal biotin uptake, and that the inhibition is mediated via the action of proinflammatory cytokines. PMID:25999427

  5. Molecular Switch Controlling the Binding of Anionic Bile Acid Conjugates to Human Apical Sodium-dependent Bile Acid Transporter

    PubMed Central

    Rais, Rana; Acharya, Chayan; Tririya, Gasirat; MacKerell, Alexander D.; Polli, James E.

    2010-01-01

    The human apical sodium-dependent bile acid transporter (hASBT) may serve as a prodrug target for oral drug absorption. Synthetic, biological, NMR and computational approaches identified the structure-activity relationships of mono- and dianionic bile acid conjugates for hASBT binding. Experimental data combined with a conformationally-sampled pharmacophore/QSAR modeling approach (CSP-SAR) predicted that dianionic substituents with intramolecular hydrogen bonding between hydroxyls on the cholane skeleton and the acid group on the conjugate's aromatic ring increased conjugate hydrophobicity and improved binding affinity. Notably, the model predicted the presence of a conformational molecular switch, where shifting the carboxylate substituent on an aromatic ring by a single position controlled binding affinity. Model validation was performed by effectively shifting the spatial location of the carboxylate by inserting a methylene adjacent to the aromatic ring, resulting in the predicted alteration in binding affinity. This work illustrates conformation as a determinant of ligand binding affinity to a biological transporter. PMID:20504026

  6. Experimental Study and Reactive Transport Modeling of Boric Acid Leaching of Concrete

    NASA Astrophysics Data System (ADS)

    Pabalan, R. T.; Chiang, K.-T. K.

    2013-07-01

    Borated water leakage through spent fuel pools (SFPs) at pressurized water reactors is a concern because it could cause corrosion of reinforcement steel in the concrete structure, compromise the integrity of the structure, or cause unmonitored releases of contaminated water to the environment. Experimental data indicate that pH is a critical parameter that determines the corrosion susceptibility of rebar in borated water and the degree of concrete degradation by boric acid leaching. In this study, reactive transport modeling of concrete leaching by borated water was performed to provide information on the solution pH in the concrete crack or matrix and the degree of concrete degradation at different locations of an SFP concrete structure exposed to borated water. Simulations up to 100 years were performed using different boric acid concentrations, crack apertures, and solution flow rates. Concrete cylinders were immersed in boric acid solutions for several months and the mineralogical changes and boric acid penetration in the concrete cylinder were evaluated as a function of time. The depths of concrete leaching by boric acid solution derived from the reactive transport simulations were compared with the measured boric acid penetration depth.

  7. Rapid high-affinity transport of a chemotherapeutic amino acid across the blood-brain barrier.

    PubMed

    Takada, Y; Vistica, D T; Greig, N H; Purdon, D; Rapoport, S I; Smith, Q R

    1992-04-15

    The therapeutic efficacy of many anticancer drugs against intracerebral tumors is limited by poor uptake into the central nervous system. One way to enhance brain delivery is to design agents that are transported into the brain by the saturable nutrient carriers of the blood-brain barrier. In this paper, we describe a nitrogen mustard amino acid, DL-2-amino-7-bis[(2-chloroethyl)amino/bd-1,2,3,4-tetrahydro-2-napthoi c acid, that is taken up into brain with high affinity by the large neutral amino acid carrier of the blood-brain barrier. Brain transport of DL-2-amino-7-bis[(2-chloroethyl)aminol-1,2,3,4-tetrahydro-2-naphth oic acid in the rat was found to be rapid (cerebrovascular permeability-surface area product approximately 2 x 10(-2) ml/s/g), saturable and inhibitable by large neutral amino acids. Maximal influx rate (Vmax) and half-saturation (Km) constants equaled 0.26 nmol/min/g and 0.19 microM, respectively, in the parietal cortex. Regional brain uptake of acid exceeded that of the clinical analogue, melphalan, by greater than 20-fold. The results demonstrate that drug modification to produce high-affinity ligands for the cerebrovascular nutrient carriers is a viable means to enhance drug delivery to brain for the treatment of brain tumors and other central nervous system disorders. PMID:1559223

  8. Angler awareness of aquatic nuisance species and potential transport mechanisms

    USGS Publications Warehouse

    Gates, K.K.; Guy, C.S.; Zale, A.V.; Horton, T.B.

    2009-01-01

    The role anglers play in transporting aquatic nuisance species (ANS) is important in managing infestations and preventing introductions. The objectives of this study were to: (1) quantify angler movement patterns in southwestern Montana, ANS awareness and equipment cleaning practices; and (2) quantify the amount of soil transported on boots and waders. Mean distance travelled by residents from their home to the survey site was 115 km (??17, 95% CI). Mean distance travelled by non-residents was 1738 km (??74). Fifty-one percent of residents and 49% of non-residents reported occasionally, rarely or never cleaning their boots and waders between uses. Mean weight of soil carried on one boot leg was 8.39 g (??1.50). Movement and equipment cleaning practices of anglers in southwestern Montana suggest that future control of ANS dispersal may require restricting the use of felt-soled wading boots, requiring river-specific wading equipment or providing cleaning stations and requiring their use. ?? 2009 Blackwell Publishing Ltd.

  9. Turbulence elasticity—A new mechanism for transport barrier dynamics

    SciTech Connect

    Guo, Z. B.; Diamond, P. H.; Kosuga, Y.; Gürcan, Ö. D.

    2014-09-15

    We present a new, unified model of transport barrier formation in “elastic” drift wave-zonal flow (DW-ZF) turbulence. A new physical quantity—the delay time (i.e., the mixing time for the DW turbulence)—is demonstrated to parameterize each stage of the transport barrier formation. Quantitative predictions for the onset of limit-cycle-oscillation (LCO) among DW and ZF intensities (also denoted as I-mode) and I-mode to high-confinement mode (H-mode) transition are also given. The LCO occurs when the ZF shearing rate (|〈v〉{sub ZF}{sup ′}|) enters the regime Δω{sub k}<|〈V〉{sub ZF}{sup ′}|<τ{sub cr}{sup −1}, where Δω{sub k} is the local turbulence decorrelation rate and τ{sub cr} is the threshold delay time. In the basic predator-prey feedback system, τ{sub cr} is also derived. The I-H transition occurs when |〈V〉{sub E×B}{sup ′}|>τ{sub cr}{sup −1}, where the mean E × B shear flow driven by ion pressure “locks” the DW-ZF system to the H-mode by reducing the delay time below the threshold value.

  10. Identification of a Novel Regulatory Mechanism of Nutrient Transport Controlled by TORC1-Npr1-Amu1/Par32.

    PubMed

    Boeckstaens, Mélanie; Merhi, Ahmad; Llinares, Elisa; Van Vooren, Pascale; Springael, Jean-Yves; Wintjens, René; Marini, Anna Maria

    2015-07-01

    Fine-tuning the plasma-membrane permeability to essential nutrients is fundamental to cell growth optimization. Nutritional signals including nitrogen availability are integrated by the TORC1 complex which notably regulates arrestin-mediated endocytosis of amino-acid transporters. Ammonium is a ubiquitous compound playing key physiological roles in many, if not all, organisms. In yeast, it is a preferred nitrogen source transported by three Mep proteins which are orthologues of the mammalian Rhesus factors. By combining genetic, kinetic, biochemical and cell microscopy analyses, the current study reveals a novel mechanism enabling TORC1 to regulate the inherent activity of ammonium transport proteins, independently of arrestin-mediated endocytosis, identifying the still functional orphan Amu1/Par32 as a selective regulator intermediate. We show that, under poor nitrogen supply, the TORC1 effector kinase' Npr1' promotes phosphorylation of Amu1/Par32 which appears mainly cytosolic while ammonium transport proteins are active. Upon preferred nitrogen supplementation, like glutamine or ammonium addition, TORC1 upregulation enables Npr1 inhibition and Amu1/Par32 dephosphorylation. In these conditions, as in Npr1-lacking cells, hypophosphorylated Amu1/Par32 accumulates at the cell surface and mediates the inhibition of specific ammonium transport proteins. We show that the integrity of a conserved repeated motif of Amu1/Par32 is required for the interaction with these transport proteins. This study underscores the diversity of strategies enabling TORC1-Npr1 to selectively monitor cell permeability to nutrients by discriminating between transporters to be degraded or transiently inactivated and kept stable at the plasma membrane. This study further identifies the function of Amu1/Par32 in acute control of ammonium transport in response to variations in nitrogen availability. PMID:26172854

  11. Identification of a Novel Regulatory Mechanism of Nutrient Transport Controlled by TORC1-Npr1-Amu1/Par32

    PubMed Central

    Boeckstaens, Mélanie; Merhi, Ahmad; Llinares, Elisa; Van Vooren, Pascale; Springael, Jean-Yves; Wintjens, René; Marini, Anna Maria

    2015-01-01

    Fine-tuning the plasma-membrane permeability to essential nutrients is fundamental to cell growth optimization. Nutritional signals including nitrogen availability are integrated by the TORC1 complex which notably regulates arrestin-mediated endocytosis of amino-acid transporters. Ammonium is a ubiquitous compound playing key physiological roles in many, if not all, organisms. In yeast, it is a preferred nitrogen source transported by three Mep proteins which are orthologues of the mammalian Rhesus factors. By combining genetic, kinetic, biochemical and cell microscopy analyses, the current study reveals a novel mechanism enabling TORC1 to regulate the inherent activity of ammonium transport proteins, independently of arrestin-mediated endocytosis, identifying the still functional orphan Amu1/Par32 as a selective regulator intermediate. We show that, under poor nitrogen supply, the TORC1 effector kinase' Npr1' promotes phosphorylation of Amu1/Par32 which appears mainly cytosolic while ammonium transport proteins are active. Upon preferred nitrogen supplementation, like glutamine or ammonium addition, TORC1 upregulation enables Npr1 inhibition and Amu1/Par32 dephosphorylation. In these conditions, as in Npr1-lacking cells, hypophosphorylated Amu1/Par32 accumulates at the cell surface and mediates the inhibition of specific ammonium transport proteins. We show that the integrity of a conserved repeated motif of Amu1/Par32 is required for the interaction with these transport proteins. This study underscores the diversity of strategies enabling TORC1-Npr1 to selectively monitor cell permeability to nutrients by discriminating between transporters to be degraded or transiently inactivated and kept stable at the plasma membrane. This study further identifies the function of Amu1/Par32 in acute control of ammonium transport in response to variations in nitrogen availability. PMID:26172854

  12. Effect of dietary polyunsaturated fatty acids on the expression of peroxisomal ABC transporters.

    PubMed

    Leclercq, Sabrina; Skrzypski, Jérémy; Courvoisier, Anne; Gondcaille, Catherine; Bonnetain, Franck; André, Agnès; Chardigny, Jean-Michel; Bellenger, Sandrine; Bellenger, Jérôme; Narce, Michel; Savary, Stéphane

    2008-10-01

    Peroxisomal ABC transporters encoded by the ABCD genes are thought to participate in the import of specific fatty acids in the peroxisomal matrix. ABCD1 deficiency is associated with X-linked adrenoleukodystrophy (X-ALD), the most frequent peroxisomal disorder which is characterized by the accumulation of saturated very-long-chain fatty acids (VLCFA). ABCD2 (the closest homolog of ABCD1) and ABCD3 have been shown to have partial functional redundancy with ABCD1; only when overexpressed, they can compensate for VLCFA accumulation. Other lipids, for instance polyunsaturated fatty acids (PUFA), should be possible candidate substrates for the ABCD2 and ABCD3 gene products, ALDRP and PMP70 respectively. Moreover, PUFA, which are known regulators of gene expression, could therefore represent potent inducers of the ABCD genes. To test this hypothesis, littermates of n-3-deficient rats were subjected to an n-3-deficient diet or equilibrated diets containing ALA (alpha-linolenic acid, 18:3n-3) as unique source of n-3 fatty acids or ALA plus DHA (docosahexaenoic acid, 22:6n-3) at two different doses. We analyzed the expression of peroxisomal ABC transporters and of the peroxisomal acyl-CoA oxidase gene 1 (Acox1) in adrenals, brain and liver. Whatever the diet, we did not observe any difference in gene expression in adrenals and brain. However, the hepatic expression level of Abcd2 and Abcd3 genes was found to be significantly higher in the n-3-deficient rats than in the rats fed the ALA diet or the DHA supplemented diets. This was accompanied by important changes in hepatic fatty acid composition. In summary, the hepatic expression of Abcd2 and Abcd3 but not of Abcd1 and Abcd4 appears to be highly sensitive towards dietary PUFA. This difference could be linked to the substrate specificity of the peroxisomal ABC transporters and a specific involvement of Abcd2 and Abcd3 in PUFA metabolism. PMID:18585430

  13. Mechanism(S) Involved in the Colon-Specific Expression of the Thiamine Pyrophosphate (Tpp) Transporter

    PubMed Central

    Nabokina, Svetlana M.; Ramos, Mel Brendan; Said, Hamid M.

    2016-01-01

    Microbiota of the large intestine synthesizes considerable amount of vitamin B1 (thiamine) in the form of thiamine pyrophosphate (TPP). We have recently demonstrated the existence of an efficient and specific carrier-mediated uptake process for TPP in human colonocytes, identified the TPP transporter (TPPT) involved (product of the SLC44A4 gene), and shown that expression of TPPT along the gastrointestinal (GI) tract is restricted to the colon. Our aim in this study was to determine the molecular basis of the colon-specific expression of TPPT focusing on a possible epigenetic mechanism. Our results showed that the CpG island predicted in the SLC44A4 promoter is non-methylated in the human colonic epithelial NCM460 cells, but is hyper-methylated in the human duodenal epithelial HuTu80 cells (as well as in the human retinal pigment epithelial ARPE19 cells). In the mouse (where TPPT expression in the GI tract is also restricted to the colon), the CpG island predicted in the Slc44a4 promoter is non-methylated in both the jejunum and colon, thus arguing against possible contribution of DNA methylation in the colon-specific expression of TPPT. A role for histone modifications in the tissue-specific pattern of Slc44a4 expression, however, was suggested by the findings that in mouse colon, histone H3 in the 5’-regulatory region of Slc44a4 is tri-methylated at lysine 4 and acetylated at lysine 9, whereas the tri-methylation at lysine 27 modification was negligible. In contrast, in the mouse jejunum, histone H3 is hyper-trimethylated at lysine 27 (repressor mark). Similarly, possible involvement of miRNA(s) in the tissue-specific expression of TPPT was also suggested by the findings that the 3’-UTR of SLC44A4 is targeted by specific miRNAs/RNA binding proteins in non-colonic, but not in colonic, epithelial cells. These studies show, for the first time, epigenetic mechanisms (histone modifications) play a role in determining the tissue-specific pattern of expression of

  14. Mechanism(S) Involved in the Colon-Specific Expression of the Thiamine Pyrophosphate (Tpp) Transporter.

    PubMed

    Nabokina, Svetlana M; Ramos, Mel Brendan; Said, Hamid M

    2016-01-01

    Microbiota of the large intestine synthesizes considerable amount of vitamin B1 (thiamine) in the form of thiamine pyrophosphate (TPP). We have recently demonstrated the existence of an efficient and specific carrier-mediated uptake process for TPP in human colonocytes, identified the TPP transporter (TPPT) involved (product of the SLC44A4 gene), and shown that expression of TPPT along the gastrointestinal (GI) tract is restricted to the colon. Our aim in this study was to determine the molecular basis of the colon-specific expression of TPPT focusing on a possible epigenetic mechanism. Our results showed that the CpG island predicted in the SLC44A4 promoter is non-methylated in the human colonic epithelial NCM460 cells, but is hyper-methylated in the human duodenal epithelial HuTu80 cells (as well as in the human retinal pigment epithelial ARPE19 cells). In the mouse (where TPPT expression in the GI tract is also restricted to the colon), the CpG island predicted in the Slc44a4 promoter is non-methylated in both the jejunum and colon, thus arguing against possible contribution of DNA methylation in the colon-specific expression of TPPT. A role for histone modifications in the tissue-specific pattern of Slc44a4 expression, however, was suggested by the findings that in mouse colon, histone H3 in the 5'-regulatory region of Slc44a4 is tri-methylated at lysine 4 and acetylated at lysine 9, whereas the tri-methylation at lysine 27 modification was negligible. In contrast, in the mouse jejunum, histone H3 is hyper-trimethylated at lysine 27 (repressor mark). Similarly, possible involvement of miRNA(s) in the tissue-specific expression of TPPT was also suggested by the findings that the 3'-UTR of SLC44A4 is targeted by specific miRNAs/RNA binding proteins in non-colonic, but not in colonic, epithelial cells. These studies show, for the first time, epigenetic mechanisms (histone modifications) play a role in determining the tissue-specific pattern of expression of TPPT

  15. Transport of indoleacetic acid in intact corn coleoptiles. [Zea mays L

    SciTech Connect

    Parker, K.E.; Briggs, W.R. )

    1990-10-01

    We have characterized the transport of ({sup 3}H)indoleacetic acid (IAA) in intact corn (Zea mays L.) coleoptiles. We have used a wide range of concentrations of added IAA (28 femtomoles to 100 picomoles taken up over 60 minutes). The shape of the transport curve varies with the concentration of added IAA, although the rate of movement of the observed front of tracer is invariant with concentration. At the lowest concentration of tracer used, the labeled IAA in the transport stream is not detectably metabolized or immobilized, curvature does not develop as a result of tracer application, and normal phototropic and gravitropic responsiveness are not affected. Therefore we believe we are observing the transport of true tracer quantities of labeled auxin at this lowest concentration.

  16. Cationic Amino Acid Uptake Constitutes a Metabolic Regulation Mechanism and Occurs in the Flagellar Pocket of Trypanosoma cruzi

    PubMed Central

    Bouvier, León A.; Cámara, María de los Milagros; Montserrat, Javier; Pereira, Claudio A.

    2012-01-01

    Trypanosomatids' amino acid permeases are key proteins in parasite metabolism since they participate in the adaptation of parasites to different environments. Here, we report that TcAAP3, a member of a Trypanosoma cruzi multigene family of permeases, is a bona fide arginine transporter. Most higher eukaryotic cells incorporate cationic amino acids through a single transporter. In contrast, T. cruzi can recognize and transport cationic amino acids by mono-specific permeases since a 100-fold molar excess of lysine could not affect the arginine transport in parasites that over-express the arginine permease (TcAAP3 epimastigotes). In order to test if the permease activity regulates downstream processes of the arginine metabolism, the expression of the single T. cruzi enzyme that uses arginine as substrate, arginine kinase, was evaluated in TcAAP3 epimastigotes. In this parasite model, intracellular arginine concentration increases 4-folds and ATP level remains constant until cultures reach the stationary phase of growth, with decreases of about 6-folds in respect to the controls. Interestingly, Western Blot analysis demonstrated that arginine kinase is significantly down-regulated during the stationary phase of growth in TcAAP3 epimastigotes. This decrease could represent a compensatory mechanism for the increase in ATP consumption as a consequence of the displacement of the reaction equilibrium of arginine kinase, when the intracellular arginine concentration augments and the glucose from the medium is exhausted. Using immunofluorescence techniques we also determined that TcAAP3 and the specific lysine transporter TcAAP7 co-localize in a specialized region of the plasma membrane named flagellar pocket, staining a single locus close to the flagellar pocket collar. Taken together these data suggest that arginine transport is closely related to arginine metabolism and cell energy balance. The clinical relevance of studying trypanosomatids' permeases relies on the

  17. Evidence of carrier mediated transport of ascorbic acid through mammalian cornea.

    PubMed

    Singla, Shivali; Majumdar, D K; Goyal, Sachin; Khilnani, Gurudas

    2011-07-01

    The purpose of the present study was to evaluate the transport of ascorbic acid, a water soluble molecule, through a predominantly lipophilic cornea. Thus in-vitro permeation of ascorbic acid from aqueous drops through freshly excised mammalian cornea was studied. Aqueous isotonic ophthalmic solutions of ascorbic acid of different concentrations (0.125% w/v to 2% w/v) (pH 5.4) were made. Further 1.0% w/v or 0.5% w/v ascorbic acid solution containing NaCl or dextrose as tonicity modifiers or Na(+)K(+)-ATPase inhibitors were also made. Permeation characteristics of drug were evaluated by putting 1 ml formulation on freshly excised cornea fixed between donor and receptor compartments of an all-glass modified Franz diffusion cell and measuring the drug permeated in the receptor by spectrophotometry at 265 nm, after 120 min. Statistical analysis was done by one-way analysis of variance (ANOVA) followed by Dunnett's test or paired t-test. Increase in drug concentration in the formulation resulted in an increase in the quantity permeated but after a certain level increase in permeation with increase in concentration was minimal. Aqueous drops made isotonic with dextrose showed decreased permeation through paired cornea compared with aqueous drops made isotonic with NaCl from 1% w/v ascorbic acid solution suggesting likely involvement of Na(+) co-transporter but there was decreased permeation through 0.5% w/v ascorbic acid solution made isotonic with NaCl as compared to solution made isotonic with dextrose. Further aqueous drops containing Na(+)K(+)-ATPase inhibitor {MAG-Mono Ammonium Glycyrrhizinate (25 μmol)} showed decreased corneal permeation from 0.5% w/v ascorbic acid solution but there was not significant decrease from 1% ascorbic acid solution since MAG is a competitive inhibitor of ascorbic acid. Aqueous drops containing Na(+)K(+)-ATPase inhibitor {MAG (50 μmol) or Ouabain (1 mmol)} showed decreased corneal permeation of ascorbic acid compared with control

  18. Structure and permeation mechanism of a mammalian urea transporter

    SciTech Connect

    Levin, Elena J.; Cao, Yu; Enkavi, Giray; Quick, Matthias; Pan, Yaping; Tajkhorshid, Emad; Zhou, Ming

    2012-09-17

    As an adaptation to infrequent access to water, terrestrial mammals produce urine that is hyperosmotic to plasma. To prevent osmotic diuresis by the large quantity of urea generated by protein catabolism, the kidney epithelia contain facilitative urea transporters (UTs) that allow rapid equilibration between the urinary space and the hyperosmotic interstitium. Here we report the first X-ray crystal structure of a mammalian UT, UT-B, at a resolution of 2.36 {angstrom}. UT-B is a homotrimer and each protomer contains a urea conduction pore with a narrow selectivity filter. Structural analyses and molecular dynamics simulations showed that the selectivity filter has two urea binding sites separated by an approximately 5.0 kcal/mol energy barrier. Functional studies showed that the rate of urea conduction in UT-B is increased by hypoosmotic stress, and that the site of osmoregulation coincides with the location of the energy barrier.

  19. On the mechanisms of heat transport across vacuum gaps

    NASA Astrophysics Data System (ADS)

    Budaev, Bair V.; Bogy, David B.

    2011-12-01

    Heat exchange between closely positioned bodies has become an important issue for many areas of modern technology including, but not limited to, integrated circuits, atomic force microscopy, and high-density magnetic recording, which deal with bodies separated by gaps as narrow as a few nanometers. It is now recognized that heat transport across a gap of sub-micron width does not follow the Stefan-Boltzmann law, which is based on a conventional theory developed for sufficiently wide gaps. This paper describes the structure of thermally excited electromagnetic fields in arbitrarily narrow gaps, and it also shows that heat can be carried across narrow vacuum gaps by acoustic waves. The structure of the acoustic wave fields is also described, and it is shown that they become the dominant heat carriers in gaps narrower than a certain critical width, which is estimated to be a few nanometers. For example, consider a vacuum gap between silicon half-spaces. When the gap's width is below a critical value, which is about 7.5 nm, the contribution of acoustic waves must be taken into account. Assuming that the wavelength of thermally excited acoustic waves is of order 1 nm, it may be possible to estimate the contribution of acoustic waves to heat transport across gaps with 4 nm < h < 7.5 nm by the kinetic theory, but for narrower gaps with h < 4 nm, this approximation is not valid, and then the full wave theory must be used. Also for gaps narrower than about 2.5 nm, there is no need to take into account electromagnetic radiation because its contribution is negligible compared to that of acoustic waves.

  20. Hartnup disorder: polymorphisms identified in the neutral amino acid transporter SLC1A5.

    PubMed

    Potter, S J; Lu, A; Wilcken, B; Green, K; Rasko, J E J

    2002-10-01

    Hartnup disorder is an inborn error of renal and gastrointestinal neutral amino acid transport. The cloning and functional characterization of the 'system B0' neutral amino acid transporter SLC1A5 led to it being proposed as a candidate gene for Hartnup disorder. Linkage analysis performed at 19q13.3, the chromosomal position of SLC1A5, was suggestive of an association with the Hartnup phenotype in some families. However, SLC1A5 was not linked to the Hartnup phenotype in other families. Linkage analysis also excluded an alternative candidate region at 11q13 implicated by a putative mouse model for Hartnup disorder. Sequencing of the coding region of SLC1A5 in Hartnup patients revealed two coding region polymorphisms. These mutations did not alter the predicted amino acid sequence of SLC1A5 and were considered unlikely to play a role in Hartnup disorder. There were no mutations in splice sites flanking each exon. Quantitative RT-PCR of SLC1A5 messenger RNA in affected and unaffected subjects did not support systemic differences in expression as an explanation for Hartnup disorder. In the six unrelated Hartnup pedigrees studied, examination of linkage at 19q13.3, polymorphisms in the coding sequence and quantitation of expression of SLC1A5 did not suffice to explain the defect in neutral amino acid transport. PMID:12555937

  1. Competing mechanisms for perfluoroalkyl acid accumulation in plants revealed using an Arabidopsis model system.

    PubMed

    Müller, Claudia E; LeFevre, Gregory H; Timofte, Anca E; Hussain, Fatima A; Sattely, Elizabeth S; Luthy, Richard G

    2016-05-01

    Perfluoroalkyl acids (PFAAs) bioaccumulate in plants, presenting a human exposure route if present in irrigation water. Curiously, accumulation of PFAAs in plant tissues is greatest for both the short-chain and long-chain PFAAs, generating a U-shaped relationship with chain length. In the present study, the authors decouple competing mechanisms of PFAA accumulation using a hydroponic model plant system (Arabidopsis thaliana) exposed to a suite of 10 PFAAs to determine uptake, depuration, and translocation kinetics. Rapid saturation of root concentrations occurred for all PFAAs except perfluorobutanoate, the least-sorptive (shortest-chain) PFAA. Shoot concentrations increased continuously, indicating that PFAAs are efficiently transported and accumulate in shoots. Tissue concentrations of PFAAs during depuration rapidly declined in roots but remained constant in shoots, demonstrating irreversibility of the translocation process. Root and shoot concentration factors followed the U-shaped trend with perfluoroalkyl chain length; however, when normalized to dead-tissue sorption, this relationship linearized. The authors therefore introduce a novel term, the "sorption normalized concentration factor," to describe PFAA accumulation in plants; because of their hydrophobicity, sorption is the determining factor for long-chain PFAAs, whereas the shortest-chain PFAAs are most effectively transported in the plant. The present study provides a mechanistic explanation for previously unexplained PFAA accumulation trends in plants and suggests that shorter-chained PFAAs may bioaccumulate more readily in edible portions. Environ Toxicol Chem 2016;35:1138-1147. © 2015 SETAC. PMID:26383989

  2. Elastic tunneling charge transport mechanisms in silicon quantum dots / Si O 2 thin films and superlattices

    NASA Astrophysics Data System (ADS)

    Illera, S.; Prades, J. D.; Cirera, A.

    2015-05-01

    The role of different charge transport mechanisms in Si / Si O 2 structures has been studied. A theoretical model based on the Transfer Hamiltonian Formalism has been developed to explain experimental current trends in terms of three different elastic tunneling processes: (1) trap assisted tunneling; (2) transport through an intermediate quantum dot; and (3) direct tunneling between leads. In general, at low fields carrier transport is dominated by the quantum dots whereas, for moderate and high fields, transport through deep traps inherent to the SiO2 is the most relevant process. Besides, current trends in Si / Si O 2 superlattice structure have been properly reproduced.

  3. Effects of chemical oxidants on perfluoroalkyl acid transport in one-dimensional porous media columns.

    PubMed

    McKenzie, Erica R; Siegrist, Robert L; McCray, John E; Higgins, Christopher P

    2015-02-01

    In situ chemical oxidation (ISCO) is a remediation approach that is often used to remediate soil and groundwater contaminated with fuels and chlorinated solvents. At many aqueous film-forming foam-impacted sites, perfluoroalkyl acids (PFAAs) can also be present at concentrations warranting concern. Laboratory experiments were completed using flow-through one-dimensional columns to improve our understanding of how ISCO (i.e., activated persulfate, permanganate, or catalyzed hydrogen peroxide) could affect the fate and transport of PFAAs in saturated porous media. While the resultant data suggest that standard ISCO is not a viable remediation strategy for PFAA decomposition, substantial changes in PFAA transport were observed upon and following the application of ISCO. In general, activated persulfate decreased PFAA transport, while permanganate and catalyzed hydrogen peroxide increased PFAA transport. PFAA sorption increased in the presence of increased aqueous polyvalent cation concentrations or decreased pH. The changes in contaminant mobility were greater than what would be predicted on the basis of aqueous chemistry considerations alone, suggesting that the application of ISCO results in changes to the porous media matrix (e.g., soil organic matter quality) that also influence transport. The application of ISCO is likely to result in changes in PFAA transport, where the direction (increased or decreased transport) and magnitude are dependent on PFAA characteristics, oxidant characteristics, and site-specific factors. PMID:25621878

  4. Inhibition of Large Neutral Amino Acid Transporters Suppresses Kynurenic Acid Production Via Inhibition of Kynurenine Uptake in Rodent Brain.

    PubMed

    Sekine, Airi; Kuroki, Yusuke; Urata, Tomomi; Mori, Noriyuki; Fukuwatari, Tsutomu

    2016-09-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor and N-methyl-D-aspartic acid receptor at endogenous brain concentrations. Recent studies have suggested that increases of brain KYNA levels are involved in psychiatric disorders such as schizophrenia and depression, and regulation of KYNA production has become a new target for treatment of these diseases. Kynurenine (KYN), the immediate precursor of KYNA, is transported into astrocytes via large neutral amino acid transporters (LATs). In the present study, the effect of LATs regulation on KYN uptake and KYNA production was investigated in vitro and in vivo using an LATs inhibitor, 2-aminobicyclo-(2,2,1)-heptane-2-carboxylic acid (BCH). In the in vitro study, cortical slices of rat brain were incubated with a physiological concentration of KYN and 3 µmol/L-3 mmol/L BCH. BCH inhibited KYNA production and KYN uptake in a dose-dependent manner, and their IC50 values were 90.7 and 97.4 µmol/L, respectively. In the in vivo study, mice were administered KYN (50 mg/kg BW) orally and BCH (200 mg/kg BW) intravenously. Administration of KYN increased brain KYN and KYNA levels compared with the mice treated with vehicle, whereas additional administration of BCH suppressed KYN-induced elevations in KYN and KYNA levels to 50 and 70 % in the brain. These results suggest that inhibition of LATs prevented the increase of KYNA production via blockade of KYN uptake in the brain in vitro and in vivo. LATs can be a target to modulate brain function by regulation of KYNA production in the brain. PMID:27161376

  5. Regulation of amniotic fluid volume: mathematical model based on intramembranous transport mechanisms

    PubMed Central

    Anderson, Debra F.; Cheung, Cecilia Y.

    2014-01-01

    Experimentation in late-gestation fetal sheep has suggested that regulation of amniotic fluid (AF) volume occurs primarily by modulating the rate of intramembranous transport of water and solutes across the amnion into underlying fetal blood vessels. In order to gain insight into intramembranous transport mechanisms, we developed a computer model that allows simulation of experimentally measured changes in AF volume and composition over time. The model included fetal urine excretion and lung liquid secretion as inflows into the amniotic compartment plus fetal swallowing and intramembranous absorption as outflows. By using experimental flows and solute concentrations for urine, lung liquid, and swallowed fluid in combination with the passive and active transport mechanisms of the intramembranous pathway, we simulated AF responses to basal conditions, intra-amniotic fluid infusions, fetal intravascular infusions, urine replacement, and tracheoesophageal occlusion. The experimental data are consistent with four intramembranous transport mechanisms acting in concert: 1) an active unidirectional bulk transport of AF with all dissolved solutes out of AF into fetal blood presumably by vesicles; 2) passive bidirectional diffusion of solutes, such as sodium and chloride, between fetal blood and AF; 3) passive bidirectional water movement between AF and fetal blood; and 4) unidirectional transport of lactate into the AF. Further, only unidirectional bulk transport is dynamically regulated. The simulations also identified areas for future study: 1) identifying intramembranous stimulators and inhibitors, 2) determining the semipermeability characteristics of the intramembranous pathway, and 3) characterizing the vesicles that are the primary mediators of intramembranous transport. PMID:25186112

  6. Regulation of amniotic fluid volume: mathematical model based on intramembranous transport mechanisms.

    PubMed

    Brace, Robert A; Anderson, Debra F; Cheung, Cecilia Y

    2014-11-15

    Experimentation in late-gestation fetal sheep has suggested that regulation of amniotic fluid (AF) volume occurs primarily by modulating the rate of intramembranous transport of water and solutes across the amnion into underlying fetal blood vessels. In order to gain insight into intramembranous transport mechanisms, we developed a computer model that allows simulation of experimentally measured changes in AF volume and composition over time. The model included fetal urine excretion and lung liquid secretion as inflows into the amniotic compartment plus fetal swallowing and intramembranous absorption as outflows. By using experimental flows and solute concentrations for urine, lung liquid, and swallowed fluid in combination with the passive and active transport mechanisms of the intramembranous pathway, we simulated AF responses to basal conditions, intra-amniotic fluid infusions, fetal intravascular infusions, urine replacement, and tracheoesophageal occlusion. The experimental data are consistent with four intramembranous transport mechanisms acting in concert: 1) an active unidirectional bulk transport of AF with all dissolved solutes out of AF into fetal blood presumably by vesicles; 2) passive bidirectional diffusion of solutes, such as sodium and chloride, between fetal blood and AF; 3) passive bidirectional water movement between AF and fetal blood; and 4) unidirectional transport of lactate into the AF. Further, only unidirectional bulk transport is dynamically regulated. The simulations also identified areas for future study: 1) identifying intramembranous stimulators and inhibitors, 2) determining the semipermeability characteristics of the intramembranous pathway, and 3) characterizing the vesicles that are the primary mediators of intramembranous transport. PMID:25186112

  7. Mechanism involved in enhancement of osteoblast differentiation by hyaluronic acid

    SciTech Connect

    Kawano, Michinao; Ariyoshi, Wataru; Iwanaga, Kenjiro; Okinaga, Toshinori; Habu, Manabu; Yoshioka, Izumi; Tominaga, Kazuhiro; Nishihara, Tatsuji

    2011-02-25

    Research highlights: {yields} In this study was to investigate the effects of HA on osteoblast differentiation induced by BMP-2. {yields} MG63 cells were incubated with BMP-2 and HA for various time periods. {yields} Phosphorylation of Smad 1/5/8, p38, and ERK proteins was determined by western blot analysis. To elucidate the nuclear translocation of phosphorylated Smad 1/5/8, stimulated cells were subjected to immunofluorescence microscopy. {yields} HA enhanced BMP-2 induces osteoblastic differentiation in MG63 cells via down-regulation of BMP-2 antagonists and ERK phosphorylation. -- Abstract: Objectives: Bone morphogenetic protein-2 (BMP-2) is expected to be utilized to fill bone defects and promote healing of fractures. However, it is unable to generate an adequate clinical response for use in bone regeneration. Recently, it was reported that glycosaminoglycans, including heparin, heparan sulfate, keratan sulfate, dermatan sulfate, chondroitin-4-sulfate, chondroitin-6-sulfate, and hyaluronic acid (HA), regulate BMP-2 activity, though the mechanism by which HA regulates osteogenic activities has not been fully elucidated. The aim of this study was to investigate the effects of HA on osteoblast differentiation induced by BMP-2. Materials and methods: Monolayer cultures of osteoblastic lineage MG63 cells were incubated with BMP-2 and HA for various time periods. To determine osteoblastic differentiation, alkaline phosphatase (ALP) activity in the cell lysates was quantified. Phosphorylation of Smad 1/5/8, p38, and ERK proteins was determined by Western blot analysis. To elucidate the nuclear translocation of phosphorylated Smad 1/5/8, stimulated cells were subjected to immunofluorescence microscopy. To further elucidate the role of HA in enhancement of BMP-2-induced Smad signaling, mRNA expressions of the BMP-2 receptor antagonists noggin and follistatin were detected using real-time RT-PCR. Results: BMP-2-induced ALP activation, Smad 1/5/8 phosphorylation, and

  8. A Novel Mechanism of Lysosomal Acid Sphingomyelinase Maturation

    PubMed Central

    Jenkins, Russell W.; Idkowiak-Baldys, Jolanta; Simbari, Fabio; Canals, Daniel; Roddy, Patrick; Riner, Clarke D.; Clarke, Christopher J.; Hannun, Yusuf A.

    2011-01-01

    Acid sphingomyelinase (aSMase) catalyzes the hydrolysis of sphingomyelin (SM) to form the bioactive lipid ceramide (Cer). Notably, aSMase exists in two forms: a zinc (Zn2+)-independent lysosomal aSMase (L-SMase) and a Zn2+-dependent secreted aSMase (S-SMase) that arise from alternative trafficking of a single protein precursor. Despite extensive investigation into the maturation and trafficking of aSMase, the exact identity of mature L-SMase has remained unclear. Here, we describe a novel mechanism of aSMase maturation involving C-terminal proteolytic processing within, or in close proximity to, endolysosomes. Using two different C-terminal-tagged constructs of aSMase (V5, DsRed), we demonstrate that aSMase is processed from a 75-kDa, Zn2+-activated proenzyme to a mature 65 kDa, Zn2+-independent L-SMase. L-SMase is recognized by a polyclonal Ab to aSMase, but not by anti-V5 or anti-DsRed antibodies, suggesting that the C-terminal tag is lost during maturation. Furthermore, indirect immunofluorescence staining demonstrated that mature L-SMase colocalized with the lysosomal marker LAMP1, whereas V5-aSMase localized to the Golgi secretory pathway. Moreover, V5-aSMase possessed Zn2+-dependent activity suggesting it may represent the common protein precursor of S-SMase and L-SMase. Importantly, the 65-kDa L-SMase, but not V5-aSMase, was sensitive to the lysosomotropic inhibitor desipramine, co-fractionated with lysosomes, and migrated at the same Mr as partially purified human aSMase. Finally, three aSMase mutants containing C-terminal Niemann-Pick mutations (R600H, R600P, ΔR608) exhibited defective proteolytic maturation. Taken together, these results demonstrate that mature L-SMase arises from C-terminal proteolytic processing of pro-aSMase and suggest that impaired C-terminal proteolysis may lead to severe defects in L-SMase function. PMID:21098024

  9. Transport of fatty acids and monoacylglycerols in white and brown adipose tissues.

    PubMed

    Scow, R O; Blanchette-Mackie, E J

    1991-01-01

    Long chain fatty acids (FA) and 2-monoacylglycerols (MG) are produced by lipoprotein lipase (LPL) from plasma triacylglycerols (TG) in capillaries of adipose tissue and transported to adipocytes for TG synthesis. It is widely proposed FA may be transported in cells by FA-binding protein. Mode of transport of MG has received little attention. Our findings in tissues and model membranes indicate that FA (as 1:1 acid-soaps) and MG can be transported in vivo by lateral movement in an interfacial continuum (IFC) of the outer leaflets of plasma and intracellular membranes of capillary endothelium and adipocytes. We postulate that FA and MG enter the IFC in capillaries and flow in the IFC across endothelium and extracellular space to sites in adipocytes where MG are hydrolyzed by MG-lipase (MGL) to FA and glycerol, and FA are esterified in endoplasmic reticulum or transferred to inner mitochondrial membrane for oxidation. FA and MG produced by hormone-sensitive lipase also enter the IFC. These MG flow in the IFC to sites of MGL activity, and the FA flow in the IFC to capillaries for transport to other tissues by albumin, or to mitochondria for heat production. PMID:1959050

  10. Agmatine transport in brain mitochondria: a different mechanism from that in liver mitochondria.

    PubMed

    Battaglia, V; Grancara, S; Mancon, M; Cravanzola, C; Colombatto, S; Grillo, M A; Tempera, G; Agostinelli, E; Toninello, A

    2010-02-01

    The diamine agmatine (AGM), exhibiting two positive charges at physiological pH, is transported into rat brain mitochondria (RBM) by an electrophoretic mechanism, requiring high membrane potential values and exhibiting a marked non-ohmic force-flux relationship. The mechanism of this transport apparently resembles that observed in rat liver mitochondria (RLM), but there are several characteristics that strongly suggest the presence of a different transporter of agmatine in RBM. In this type of mitochondria, the extent of initial binding and total accumulation is higher and lower, respectively, than that in liver; saturation kinetics and the flux-voltage relationship also exhibit different trends, whereas idazoxan and putrescine, ineffective in RLM, act as inhibitors. The characteristics of agmatine uptake in RBM lead to the conclusion that its transporter is a channel with two asymmetric energy barriers, showing some characteristics similar to those of the imidazoline receptor I(2) and the sharing with the polyamine transporter. PMID:19997762

  11. Histidine residues in the Na+-coupled ascorbic acid transporter-2 (SVCT2) are central regulators of SVCT2 function, modulating pH sensitivity, transporter kinetics, Na+ cooperativity, conformational stability, and subcellular localization.

    PubMed

    Ormazabal, Valeska; Zuñiga, Felipe A; Escobar, Elizabeth; Aylwin, Carlos; Salas-Burgos, Alexis; Godoy, Alejandro; Reyes, Alejandro M; Vera, Juan Carlos; Rivas, Coralia I

    2010-11-19

    Na(+)-coupled ascorbic acid transporter-2 (SVCT2) activity is impaired at acid pH, but little is known about the molecular determinants that define the transporter pH sensitivity. SVCT2 contains six histidine residues in its primary sequence, three of which are exofacial in the transporter secondary structure model. We used site-directed mutagenesis and treatment with diethylpyrocarbonate to identify histidine residues responsible for SVCT2 pH sensitivity. We conclude that five histidine residues, His(109), His(203), His(206), His(269), and His(413), are central regulators of SVCT2 function, participating to different degrees in modulating pH sensitivity, transporter kinetics, Na(+) cooperativity, conformational stability, and subcellular localization. Our results are compatible with a model in which (i) a single exofacial histidine residue, His(413), localized in the exofacial loop IV that connects transmembrane helices VII-VIII defines the pH sensitivity of SVCT2 through a mechanism involving a marked attenuation of the activation by Na(+) and loss of Na(+) cooperativity, which leads to a decreased V(max) without altering the transport K(m); (ii) exofacial histidine residues His(203), His(206), and His(413) may be involved in maintaining a functional interaction between exofacial loops II and IV and influence the general folding of the transporter; (iii) histidines 203, 206, 269, and 413 affect the transporter kinetics by modulating the apparent transport K(m); and (iv) histidine 109, localized at the center of transmembrane helix I, might be fundamental for the interaction of SVCT2 with the transported substrate ascorbic acid. Thus, histidine residues are central regulators of SVCT2 function. PMID:20843809

  12. Coupling mechanical forces to electrical signaling: molecular motors and the intracellular transport of ion channels.

    PubMed

    Barry, Joshua; Gu, Chen

    2013-04-01

    Proper localization of various ion channels is fundamental to neuronal functions, including postsynaptic potential plasticity, dendritic integration, action potential initiation and propagation, and neurotransmitter release. Microtubule-based forward transport mediated by kinesin motors plays a key role in placing ion channel proteins to correct subcellular compartments. PDZ- and coiled-coil-domain proteins function as adaptor proteins linking ionotropic glutamate and GABA receptors to various kinesin motors, respectively. Recent studies show that several voltage-gated ion channel/transporter proteins directly bind to kinesins during forward transport. Three major regulatory mechanisms underlying intracellular transport of ion channels are also revealed. These studies contribute to understanding how mechanical forces are coupled to electrical signaling and illuminating pathogenic mechanisms in neurodegenerative diseases. PMID:22910031

  13. Grotthuss mechanisms: from proton transport in proton wires to bioprotonic devices

    NASA Astrophysics Data System (ADS)

    Miyake, Takeo; Rolandi, Marco

    2016-01-01

    In 1804, Theodore von Grotthuss proposed a mechanism for proton (H+) transport between water molecules that involves the exchange of a covalent bond between H and O with a hydrogen bond. This mechanism also supports the transport of OH- as a proton hole and is essential in explaining proton transport in intramembrane proton channels. Inspired by the Grotthuss mechanism and its similarity to electron and hole transport in semiconductors, we have developed semiconductor type devices that are able to control and monitor a current of H+ as well as OH- in hydrated biopolymers. In this topical review, we revisit these devices that include protonic diodes, complementary, transistors, memories and transducers as well as a phenomenological description of their behavior that is analogous to electronic semiconductor devices.

  14. Coupling Mechanical Forces to Electrical Signaling: Molecular Motors and the Intracellular Transport of Ion Channels

    PubMed Central

    Barry, Joshua; Gu, Chen

    2013-01-01

    Proper localization of various ion channels is fundamental to neuronal functions, including postsynaptic potential plasticity, dendritic integration, action potential initiation and propagation, and neurotransmitter release. Microtubule-based forward transport mediated by kinesin motors plays a key role in placing ion channel proteins to correct subcellular compartments. PDZ- and coiled-coil-domain proteins function as adaptor proteins linking ionotropic glutamate and GABA receptors to various kinesin motors, respectively. Recent studies show that several voltage-gated ion channel/transporter proteins directly bind to kinesins during forward transport. Three major regulatory mechanisms underlying intracellular transport of ion channels are also revealed. These studies contribute to understanding how mechanical forces are coupled to electrical signaling and illuminating pathogenic mechanisms in neurodegenerative diseases. PMID:22910031

  15. The role of L-type amino acid transporters in the uptake of glyphosate across mammalian epithelial tissues.

    PubMed

    Xu, Jiaqiang; Li, Gao; Wang, Zhuoyi; Si, Luqin; He, Sijie; Cai, Jialing; Huang, Jiangeng; Donovan, Maureen D

    2016-02-01

    Glyphosate is one of the most commonly used herbicides worldwide due to its broad spectrum of activity and reported low toxicity to humans. Glyphosate has an amino acid-like structure that is highly polar and shows low bioavailability following oral ingestion and low systemic toxicity following intravenous exposures. Spray applications of glyphosate in agricultural or residential settings can result in topical or inhalation exposures to the herbicide. Limited systemic exposure to glyphosate occurs following skin contact, and pulmonary exposure has also been reported to be low. The results of nasal inhalation exposures, however, have not been evaluated. To investigate the mechanisms of glyphosate absorption across epithelial tissues, the permeation of glyphosate across Caco-2 cells, a gastrointestinal epithelium model, was compared with permeation across nasal respiratory and olfactory tissues excised from cows. Saturable glyphosate uptake was seen in all three tissues, indicating the activity of epithelial transporters. The uptake was shown to be ATP and Na(+) independent, and glyphosate permeability could be significantly reduced by the inclusion of competitive amino acids or specific LAT1/LAT2 transporter inhibitors. The pattern of inhibition of glyphosate permeability across Caco-2 and nasal mucosal tissues suggests that LAT1/2 play major roles in the transport of this amino-acid-like herbicide. Enhanced uptake into the epithelial cells at barrier mucosae, including the respiratory and gastrointestinal tracts, may result in more significant local and systemic effects than predicted from glyphosate's passive permeability, and enhanced uptake by the olfactory mucosa may result in further CNS disposition, potentially increasing the risk for brain-related toxicities. PMID:26701683

  16. Insulin-induced phospho-oligosaccharide stimulates amino acid transport in isolated rat hepatocytes.

    PubMed Central

    Varela, I; Avila, M; Mato, J M; Hue, L

    1990-01-01

    The ability of the insulin-induced phospho-oligosaccharide to stimulate amino acid transport was studied in isolated rat hepatocytes. At low alpha-aminoisobutyric acid concentrations (0.1 mM), both 100 nM-insulin and 10 microM-phospho-oligosaccharide doubled amino acid uptake after 2 h of incubation. This stimulation was prevented by 0.1 mM-cycloheximide or 5 micrograms of actinomycin D/ml, indicating that the phospho-oligosaccharide, like insulin, was acting via the synthesis of a high-affinity transport component. The effects of the phospho-oligosaccharide and of insulin were blocked by Ins2P (2.5 mM), but not by myo-inositol, inositol hexaphosphoric acid or several monosaccharides such as mannose, glucosamine and galactose. Both the temporal effect on amino acid entry and the extent of stimulation of this process by the phospho-oligosaccharide indicate that this molecule mimics, and may mediate, some of the long-term actions of insulin. However, the effects of phospho-oligosaccharide and insulin were not exactly the same, since the effect of insulin, but not of the phospho-oligosaccharide, was additive with that of glucagon. PMID:2185744

  17. Mechanism of unassisted ion transport across membrane bilayers

    NASA Technical Reports Server (NTRS)

    Wilson, M. A.; Pohorille, A.

    1996-01-01

    To establish how charged species move from water to the nonpolar membrane interior and to determine the energetic and structural effects accompanying this process, we performed molecular dynamics simulations of the transport of Na+ and Cl- across a lipid bilayer located between two water lamellae. The total length of molecular dynamics trajectories generated for each ion was 10 ns. Our simulations demonstrate that permeation of ions into the membrane is accompanied by the formation of deep, asymmetric thinning defects in the bilayer, whereby polar lipid head groups and water penetrate the nonpolar membrane interior. Once the ion crosses the midplane of the bilayer the deformation "switches sides"; the initial defect slowly relaxes, and a defect forms in the outgoing side of the bilayer. As a result, the ion remains well solvated during the process; the total number of oxygen atoms from water and lipid head groups in the first solvation shell remains constant. A similar membrane deformation is formed when the ion is instantaneously inserted into the interior of the bilayer. The formation of defects considerably lowers the free energy barrier to transfer of the ion across the bilayer and, consequently, increases the permeabilities o