Science.gov

Sample records for acid transport mechanisms

  1. Unraveling fatty acid transport and activation mechanisms in Yarrowia lipolytica.

    PubMed

    Dulermo, Rémi; Gamboa-Meléndez, Heber; Ledesma-Amaro, Rodrigo; Thévenieau, France; Nicaud, Jean-Marc

    2015-09-01

    Fatty acid (FA) transport and activation have been extensively studied in the model yeast species Saccharomyces cerevisiae but have rarely been examined in oleaginous yeasts, such as Yarrowia lipolytica. Because the latter begins to be used in biodiesel production, understanding its FA transport and activation mechanisms is essential. We found that Y. lipolytica has FA transport and activation proteins similar to those of S. cerevisiae (Faa1p, Pxa1p, Pxa2p, Ant1p) but mechanism of FA peroxisomal transport and activation differs greatly with that of S. cerevisiae. While the ScPxa1p/ScPxa2p heterodimer is essential for growth on long-chain FAs, ΔYlpxa1 ΔYlpxa2 is not impaired for growth on FAs. Meanwhile, ScAnt1p and YlAnt1p are both essential for yeast growth on medium-chain FAs, suggesting they function similarly. Interestingly, we found that the ΔYlpxa1 ΔYlpxa2 ΔYlant1 mutant was unable to grow on short-, medium-, or long-chain FAs, suggesting that YlPxa1p, YlPxa2p, and YlAnt1p belong to two different FA degradation pathways. We also found that YlFaa1p is involved in FA storage in lipid bodies and that FA remobilization largely depended on YlFat1p, YlPxa1p and YlPxa2p. This study is the first to comprehensively examine FA intracellular transport and activation in oleaginous yeast.

  2. Ascorbic acid participates in a general mechanism for concerted glucose transport inhibition and lactate transport stimulation.

    PubMed

    Castro, Maite A; Angulo, Constanza; Brauchi, Sebastián; Nualart, Francisco; Concha, Ilona I

    2008-11-01

    In this paper, we present a novel function for ascorbic acid. Ascorbic acid is an important water-soluble antioxidant and cofactor in various enzyme systems. We have previously demonstrated that an increase in neuronal intracellular ascorbic acid is able to inhibit glucose transport in cortical and hippocampal neurons. Because of the presence of sodium-dependent vitamin C transporters, ascorbic acid is highly concentrated in brain, testis, lung, and adrenal glands. In this work, we explored how ascorbic acid affects glucose and lactate uptake in neuronal and non-neuronal cells. Using immunofluorescence and reverse transcriptase-polymerase chain reaction (RT-PCR) analysis, the expression of glucose and ascorbic acid transporters in non-neuronal cells was studied. Like neurons, HEK293 cells expressed GLUT1, GLUT3, and SVCT2. With radioisotope-based methods, only intracellular ascorbic acid, but not extracellular, inhibits 2-deoxyglucose transport in HEK293 cells. As monocarboxylates such as pyruvate and lactate, are important metabolic sources, we analyzed the ascorbic acid effect on lactate transport in cultured neurons and HEK293 cells. Intracellular ascorbic acid was able to stimulate lactate transport in both cell types. Extracellular ascorbic acid did not affect this transport. Our data show that ascorbic acid inhibits glucose transport and stimulates lactate transport in neuronal and non-neuronal cells. Mammalian cells frequently present functional glucose and monocarboxylate transporters, and we describe here a general effect in which ascorbic acid functions like a glucose/monocarboxylate uptake switch in tissues expressing ascorbic acid transporters.

  3. Integration of computational modeling with membrane transport studies reveals new insights into amino acid exchange transport mechanisms.

    PubMed

    Widdows, Kate L; Panitchob, Nuttanont; Crocker, Ian P; Please, Colin P; Hanson, Mark A; Sibley, Colin P; Johnstone, Edward D; Sengers, Bram G; Lewis, Rohan M; Glazier, Jocelyn D

    2015-06-01

    Uptake of system L amino acid substrates into isolated placental plasma membrane vesicles in the absence of opposing side amino acid (zero-trans uptake) is incompatible with the concept of obligatory exchange, where influx of amino acid is coupled to efflux. We therefore hypothesized that system L amino acid exchange transporters are not fully obligatory and/or that amino acids are initially present inside the vesicles. To address this, we combined computational modeling with vesicle transport assays and transporter localization studies to investigate the mechanisms mediating [(14)C]L-serine (a system L substrate) transport into human placental microvillous plasma membrane (MVM) vesicles. The carrier model provided a quantitative framework to test the 2 hypotheses that l-serine transport occurs by either obligate exchange or nonobligate exchange coupled with facilitated transport (mixed transport model). The computational model could only account for experimental [(14)C]L-serine uptake data when the transporter was not exclusively in exchange mode, best described by the mixed transport model. MVM vesicle isolates contained endogenous amino acids allowing for potential contribution to zero-trans uptake. Both L-type amino acid transporter (LAT)1 and LAT2 subtypes of system L were distributed to MVM, with L-serine transport attributed to LAT2. These findings suggest that exchange transporters do not function exclusively as obligate exchangers.

  4. Mechanism of L-lactic acid transport in L6 skeletal muscle cells.

    PubMed

    Kobayashi, Masaki; Itagaki, Shirou; Hirano, Takeshi; Iseki, Ken

    2004-10-01

    L-lactic acid transport plays an important role in the regulation of L-lactic acid circulation into and out of muscle. To clarify the transport mechanism of L-lactic acid in skeletal muscle, L-lactic acid uptake was investigated using a L6 cell line. mRNAs of monocarboxylate transporter (MCT) 1, 2 and 4 were found to be expressed in L6 cells. The [(14)C] L-lactic acid uptake by L6 cells increased up to pH of 6.0. The [(14)C] L-lactic acid uptake at pH 6.0 was concentration-dependent with a K(m) of 3.7 mM. This process was reduced by alpha-cyano-4-hydroxycinnamate, a typical MCT1, 2 and 4 inhibitor. These results suggest that an MCT participates in the uptake of L-lactic acid by L6 cells. [(14)C] L-lactic acid uptake was markedly inhibited by monocarboxylic acids and monocarboxylate drugs but not by dicarboxylic acids and amino acids. Moreover, benzoic acid, a substrate for MCT1, competitively inhibited this process with K(i) of 1.7 mM. [(14)C] L-lactic acid efflux in L6 cells was inhibited by alpha-cyano-4-hydroxycinnamate but not by benzoic acid. These results suggest that [(14)C] L-lactic acid efflux in L6 cells is mediated by MCT other than MCT1.

  5. Transport mechanism and regulatory properties of the human amino acid transporter ASCT2 (SLC1A5).

    PubMed

    Scalise, Mariafrancesca; Pochini, Lorena; Panni, Simona; Pingitore, Piero; Hedfalk, Kristina; Indiveri, Cesare

    2014-11-01

    The kinetic mechanism of the transport catalyzed by the human glutamine/neutral amino acid transporter hASCT2 over-expressed in P. pastoris was determined in proteoliposomes by pseudo-bi-substrate kinetic analysis of the Na(+)-glutamineex/glutaminein transport reaction. A random simultaneous mechanism resulted from the experimental analysis. Purified functional hASCT2 was chemically cross-linked to a stable dimeric form. The oligomeric structure correlated well with the kinetic mechanism of transport. Half-saturation constants (Km) of the transporter for the other substrates Ala, Ser, Asn and Thr were measured both on the external and internal side. External Km were much lower than the internal ones confirming the asymmetry of the transporter. The electric nature of the transport reaction was determined imposing a negative inside membrane potential generated by K(+) gradients in the presence of valinomycin. The transport reaction resulted to be electrogenic and the electrogenicity originated from external Na(+). Internal Na(+) exerted a stimulatory effect on the transport activity which could be explained by a regulatory, not a counter-transport, effect. Native and deglycosylated hASCT2 extracted from HeLa showed the same transport features demonstrating that the glycosyl moiety has no role in transport function. Both in vitro and in vivo interactions of hASCT2 with the scaffold protein PDZK1 were revealed.

  6. Structural basis of the alternating-access mechanism in a bile acid transporter

    NASA Astrophysics Data System (ADS)

    Zhou, Xiaoming; Levin, Elena J.; Pan, Yaping; McCoy, Jason G.; Sharma, Ruchika; Kloss, Brian; Bruni, Renato; Quick, Matthias; Zhou, Ming

    2014-01-01

    Bile acids are synthesized from cholesterol in hepatocytes and secreted through the biliary tract into the small intestine, where they aid in absorption of lipids and fat-soluble vitamins. Through a process known as enterohepatic recirculation, more than 90% of secreted bile acids are then retrieved from the intestine and returned to the liver for resecretion. In humans, there are two Na+-dependent bile acid transporters involved in enterohepatic recirculation, the Na+-taurocholate co-transporting polypeptide (NTCP; also known as SLC10A1) expressed in hepatocytes, and the apical sodium-dependent bile acid transporter (ASBT; also known as SLC10A2) expressed on enterocytes in the terminal ileum. In recent years, ASBT has attracted much interest as a potential drug target for treatment of hypercholesterolaemia, because inhibition of ASBT reduces reabsorption of bile acids, thus increasing bile acid synthesis and consequently cholesterol consumption. However, a lack of three-dimensional structures of bile acid transporters hampers our ability to understand the molecular mechanisms of substrate selectivity and transport, and to interpret the wealth of existing functional data. The crystal structure of an ASBT homologue from Neisseria meningitidis (ASBTNM) in detergent was reported recently, showing the protein in an inward-open conformation bound to two Na+ and a taurocholic acid. However, the structural changes that bring bile acid and Na+ across the membrane are difficult to infer from a single structure. To understand the structural changes associated with the coupled transport of Na+ and bile acids, here we solved two structures of an ASBT homologue from Yersinia frederiksenii (ASBTYf) in a lipid environment, which reveal that a large rigid-body rotation of a substrate-binding domain gives the conserved `crossover' region, where two discontinuous helices cross each other, alternating accessibility from either side of the cell membrane. This result has implications

  7. New mechanisms that regulate Saccharomyces cerevisiae short peptide transporter achieve balanced intracellular amino acid concentrations.

    PubMed

    Melnykov, Artem V

    2016-01-01

    The budding yeast Saccharomyces cerevisiae is able to take up large quantities of amino acids in the form of di- and tripeptides via a short peptide transporter, Ptr2p. It is known that PTR2 can be induced by certain peptides and amino acids, and the mechanisms governing this upregulation are understood at the molecular level. We describe two new opposing mechanisms of regulation that emphasize potential toxicity of amino acids: the first is upregulation of PTR2 in a population of cells, caused by amino acid secretion that accompanies peptide uptake; the second is loss of Ptr2p activity, due to transporter internalization following peptide uptake. Our findings emphasize the importance of proper amino acid balance in the cell and extend understanding of peptide import regulation in yeast.

  8. Substrate specificity and transport mechanism of amino-acid transceptor Slimfast from Aedes aegypti

    PubMed Central

    Boudko, Dmitri Y.; Tsujimoto, Hitoshi; Rodriguez, Stacy D.; Meleshkevitch, Ella A.; Price, David P.; Drake, Lisa L.; Hansen, Immo A.

    2015-01-01

    Anautogenous mosquitoes depend on vertebrate blood as nutrient source for their eggs. A highly efficient set of membrane transporters mediates the massive movement of nutrient amino acids between mosquito tissues after a blood meal. Here we report the characterization of the amino-acid transporter Slimfast (Slif) from the yellow-fever mosquito Aedes aegypti using codon-optimized heterologous expression. Slif is a well-known component of the target-of-rapamycin signalling pathway and fat body nutrient sensor, but its substrate specificity and transport mechanism were unknown. We found that Slif transports essential cationic and neutral amino acids with preference for arginine. It has an unusual dual-affinity mechanism with only the high affinity being Na+ dependent. Tissue-specific expression and blood meal-dependent regulation of Slif are consistent with conveyance of essential amino acids from gut to fat body. Slif represents a novel transport system and type of transceptor for sensing and transporting essential amino acids during mosquito reproduction. PMID:26449545

  9. Acid-base transport in pancreatic cancer: molecular mechanisms and clinical potential.

    PubMed

    Kong, Su Chii; Giannuzzo, Andrea; Gianuzzo, Andrea; Novak, Ivana; Pedersen, Stine Falsig

    2014-12-01

    Solid tumors are characterized by a microenvironment that is highly acidic, while intracellular pH (pHi) is normal or even elevated. This is the result of elevated metabolic rates in the highly proliferative cancer cells, in conjunction with often greatly increased rates of net cellular acid extrusion. Studies in various cancers have suggested that while the acid extrusion mechanisms employed are generally the same as those in healthy cells, the specific transporters upregulated vary with the cancer type. The main such transporters include Na(+)/H(+) exchangers, various HCO3(-) transporters, H(+) pumps, and lactate-H(+) cotransporters. The mechanisms leading to their dysregulation in cancer are incompletely understood but include changes in transporter expression levels, trafficking and membrane localization, and posttranslational modifications. In turn, accumulating evidence has revealed that in addition to supporting their elevated metabolic rate, their increased acid efflux capacity endows the cancer cells with increased capacity for invasiveness, proliferation, and chemotherapy resistance. The pancreatic duct exhibits an enormous capacity for acid-base transport, rendering pHi dysregulation a potentially very important topic in pancreatic ductal adenocarcinoma (PDAC). PDAC - accounting for about 90% of all pancreatic cancers - has one of the highest cancer mortality rates known, and new diagnostic and treatment options are highly needed. However, very little is known about whether pH regulation is altered in PDAC and, if so, the possible role of this in cancer development. Here, we review current models for pancreatic acid-base transport and pH homeostasis and summarize current views on acid-base dysregulation in cancer, focusing where possible on the few studies to date in PDAC. Finally, we present new data-mining analyses of acid-base transporter expression changes in PDAC and discuss essential directions for future work.

  10. Structure and mechanism of a Na+-independent amino acid transporter.

    PubMed

    Shaffer, Paul L; Goehring, April; Shankaranarayanan, Aruna; Gouaux, Eric

    2009-08-21

    Amino acid, polyamine, and organocation (APC) transporters are secondary transporters that play essential roles in nutrient uptake, neurotransmitter recycling, ionic homeostasis, and regulation of cell volume. Here, we present the crystal structure of apo-ApcT, a proton-coupled broad-specificity amino acid transporter, at 2.35 angstrom resolution. The structure contains 12 transmembrane helices, with the first 10 consisting of an inverted structural repeat of 5 transmembrane helices like the leucine transporter LeuT. The ApcT structure reveals an inward-facing, apo state and an amine moiety of lysine-158 located in a position equivalent to the sodium ion site Na2 of LeuT. We propose that lysine-158 is central to proton-coupled transport and that the amine group serves the same functional role as the Na2 ion in LeuT, thus demonstrating common principles among proton- and sodium-coupled transporters.

  11. Mechanisms underlying the transport and intracellular metabolism of acetic acid in the presence of glucose in the yeast Zygosaccharomyces bailii.

    PubMed

    Sousa, M J; Rodrigues, F; Côrte-Real, M; Leão, C

    1998-03-01

    Zygosaccharomyces bailii ISA 1307 displays biphasic growth in a medium containing a mixture of glucose (0.5%, w/v) and acetic acid (0.5%, w/v), pH 5.0 and 3.0. In cells harvested during the first growth phase, no activity of a mediated acetic acid transport system was found. Incubation of these cells in phosphate buffer with cycloheximide for 1 h restored activity of an acetic acid carrier which behaved as the one present in glucose-grown cells. These results indicated that the acetic acid carrier is probably present in cells from the first growth phase of the mixed medium but its activity was affected by the presence of acetic acid in the culture medium. In glucose-grown cells, after incubation in phosphate buffer with glucose and acetic acid, the activity of the acetic acid carrier decreased significantly with increased acid concentration in the incubation buffer. At acid concentrations above 16.7 mM, no significant carrier activity was detectable. Furthermore, the intracellular acid concentration increased with the extracellular one and was inversely correlated with the activity of the acetic acid carrier, suggesting the involvement of a feedback inhibition mechanism in the regulation of the carrier. During biphasic growth, the first phase corresponded to a simultaneous consumption of glucose and acetic acid, and the second to the utilization of the remaining acid. The enzyme acetyl-CoA synthetase was active in both growth phases, even in the presence of glucose. Activity of isocitrate lyase and phosphoenolpyruvate carboxykinase was found only in acetic-acid-grown cells. Thus it appears that both membrane transport and acetyl-CoA synthetase and their regulation are important for Z. bailii to metabolize acetic acid in the presence of glucose. This fact correlates with the high resistance of this yeast to environments with mixtures of sugars and acetic acid such as those often present during wine fermentation.

  12. Bile acid transporters

    PubMed Central

    Dawson, Paul A.; Lan, Tian; Rao, Anuradha

    2009-01-01

    In liver and intestine, transporters play a critical role in maintaining the enterohepatic circulation and bile acid homeostasis. Over the past two decades, there has been significant progress toward identifying the individual membrane transporters and unraveling their complex regulation. In the liver, bile acids are efficiently transported across the sinusoidal membrane by the Na+ taurocholate cotransporting polypeptide with assistance by members of the organic anion transporting polypeptide family. The bile acids are then secreted in an ATP-dependent fashion across the canalicular membrane by the bile salt export pump. Following their movement with bile into the lumen of the small intestine, bile acids are almost quantitatively reclaimed in the ileum by the apical sodium-dependent bile acid transporter. The bile acids are shuttled across the enterocyte to the basolateral membrane and effluxed into the portal circulation by the recently indentified heteromeric organic solute transporter, OSTα-OSTβ. In addition to the hepatocyte and enterocyte, subgroups of these bile acid transporters are expressed by the biliary, renal, and colonic epithelium where they contribute to maintaining bile acid homeostasis and play important cytoprotective roles. This article will review our current understanding of the physiological role and regulation of these important carriers. PMID:19498215

  13. Promoter Analysis of the Human Ascorbic Acid Transporters SVCT1 & 2: Mechanisms of Adaptive Regulation in Liver Epithelial Cells

    PubMed Central

    Reidling, Jack C.; Rubin, Stanley A.

    2010-01-01

    Ascorbic acid, the active form of vitamin C, is a vital antioxidant in the human liver, yet the molecular mechanisms involved in the regulation of ascorbic acid transporters (hSVCT1 and hSVCT2) in liver cells are poorly understood. Therefore, we characterized the minimal promoter regions of hSVCT1 & 2 in cultured human liver epithelial cells (HepG2) and examined the effects of ascorbic acid deprivation and supplementation on activity and regulation of the transport systems. Identified minimal promoters required for basal activity were found to include multiple cis-regulatory elements, whereas mutational analysis demonstrated that HNF-1 sites in the hSVCT1 promoter and KLF/Sp1 sites in the hSVCT2 promoter were essential for activities. When cultured in ascorbic acid deficient or supplemented media, HepG2 cells demonstrated significant (P < 0.01) and specific reciprocal changes in [14C]-Ascorbic acid uptake, and in hSVCT1 mRNA and protein levels as well as hSVCT1 promoter activity. However, no significant changes in hSVCT2 expression or promoter activity were observed during ascorbic acid deficient or supplemented conditions. We mapped the ascorbic acid responsive region in the hSVCT1 promoter and determined that HNF-1 sites are important for the adaptive regulation response. The results of these studies further characterize the hSVCT1 and 2 promoters, establish that ascorbic acid uptake by human liver epithelial cells is adaptively regulated, and show that transcriptional mechanisms via HNF-1 in the hSVCT1 promoter may, in part, be involved in this regulation. PMID:20471816

  14. Mechanism of proton transport in ionic-liquid-doped perfluorosulfonic acid membranes.

    PubMed

    Kumar, Milan; Venkatnathan, Arun

    2013-11-21

    Ionic-liquid-doped perfluorosulfonic acid membranes (PFSA) are promising electrolytes for intermediate/high-temperature fuel cell applications. In the present study, we examine proton-transport pathways in a triethylammonium-triflate (TEATF) ionic liquid (IL)-doped Nafion membrane using quantum chemistry calculations. The IL-doped membrane matrix contains triflic acid (TFA), triflate anions (TFA(-)), triethylamine (TEA), and triethylammonium cations (TEAH(+)). Results show that proton abstraction from the sulfonic acid end groups in the membrane by TFA(-) facilitates TEAH(+) interaction with the side-chains. In the IL-doped PFSA membrane matrix, proton transfer from TFA to TEA and TFA to TFA(-) occurs. However, proton transfer from a tertiary amine cation (TEAH(+)) to a tertiary amine (TEA) does not occur without an interaction with an anion (TFA(-)). An anion interaction with the amine increases its basicity, and as a consequence, it takes a proton from a cation either instantly (if the cation is freely moving) or with a small activation energy barrier of 2.62 kcal/mol (if the cation is interacting with another anion). The quantum chemistry calculations predict that anions are responsible for proton-exchange between cations and neutral molecules of a tertiary amine. Results from this study can assist the experimental choice of IL to provide enhanced proton conduction in PFSA membrane environments.

  15. Novel insights in transport mechanisms and kinetics of phenylacetic acid and penicillin-G in Penicillium chrysogenum.

    PubMed

    Douma, Rutger D; Deshmukh, Amit T; de Jonge, Lodewijk P; de Jong, Bouke W; Seifar, Reza M; Heijnen, Joseph J; van Gulik, Walter M

    2012-01-01

    Although penicillin-G (PenG) production by the fungus Penicillium chrysogenum is a well-studied process, little is known about the mechanisms of transport of the precursor phenylacetic acid (PAA) and the product PenG over the cell membrane. To obtain more insight in the nature of these mechanisms, in vivo stimulus response experiments were performed with PAA and PenG in chemostat cultures of P. chrysogenum at time scales of seconds to minutes. The results indicated that PAA is able to enter the cell by passive diffusion of the undissociated acid at a high rate, but is at the same time actively excreted, possibly by an ATP-binding cassette transporter. This results in a futile cycle, dissipating a significant amount of metabolic energy, which was confirmed by increased rates of substrate and oxygen consumption, and carbon dioxide production. To estimate the kinetic properties of passive import and active export of PAA over the cell membrane, a dynamic mathematical model was constructed. With this model, a good description of the dynamic data could be obtained. Also, PenG was found to be rapidly taken up by the cells upon extracellular addition, indicating that PenG transport is reversible. The measured concentration gradient of PenG over the cell membrane corresponded well with facilitated transport. Also, for PenG transport, a dynamic model was constructed and validated with experimental data. The outcome of the model simulations was in agreement with the presence of a facilitated transport system for PenG.

  16. Eicosapentaenoic acid inhibits intestinal β-carotene absorption by downregulation of lipid transporter expression via PPAR-α dependent mechanism.

    PubMed

    Mashurabad, Purna Chandra; Kondaiah, Palsa; Palika, Ravindranadh; Ghosh, Sudip; Nair, Madhavan K; Raghu, Pullakhandam

    2016-01-15

    The involvement of lipid transporters, the scavenger receptor class B, type I (SR-BI) and Niemann-Pick type C1 Like 1 protein (NPC1L1) in carotenoid absorption is demonstrated in intestinal cells and animal models. Dietary ω-3 fatty acids are known to possess antilipidemic properties, which could be mediated by activation of PPAR family transcription factors. The present study was conducted to determine the effect of docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA), on intestinal β-carotene absorption. β-carotene uptake in Caco-2/TC7 cells was inhibited by EPA (p < 0.01) and PPARα agonist (P < 0.01), but not by DHA, PPARγ or PPARδ agonists. Despite unaltered β-carotene uptake, both DHA and PPARδ agonists inhibited the NPC1L1 expression. Further, EPA also induced the expression of carnitine palmitoyl transferase 1A (CPT1A) expression, a PPARα target gene. Interestingly, EPA induced inhibition of β-carotene uptake and SR B1 expression were abrogated by specific PPARα antagonist, but not by PPARδ antagonist. EPA and PPARα agonist also inhibited the basolateral secretion of β-carotene from Caco-2 cells grown on permeable supports. These results suggest that EPA inhibits intestinal β-carotene absorption by down regulation of SR B1 expression via PPARα dependent mechanism and provide an evidence for dietary modulation of intestinal β-carotene absorption.

  17. Molecular mechanism of substrate specificity in the bacterial neutral amino acid transporter LeuT.

    PubMed

    Noskov, Sergei Y

    2008-12-01

    The recently published X-ray structure of LeuT, a Na(+)/Cl(-)-dependent neurotransmitter transporter, has provided fresh impetus to efforts directed at understanding the molecular principles governing specific neurotransmitter transport. The combination of the LeuT crystal structure with the results of molecular simulations enables the functional data on specific binding and transport to be related to molecular structure. All-atom FEP and molecular dynamics (MD) simulations of LeuT embedded in an explicit membrane were performed alongside a decomposition analysis to dissect the molecular determinants of the substrate specificity of LeuT. It was found that the ligand must be in a zwitterionic (ZW) form to bind tightly to the transporter. The theoretical results on the absolute binding-free energies for leucine, alanine, and glycine show that alanine can be a potent substrate for LeuT, although leucine is preferred, which is consistent with the recent experimental data (Singh et al., Nature 2007;448:952-956). Furthermore, LeuT displays robust specificity for leucine over glycine. Interestingly, the ability of LeuT to discriminate between substrates relies on the dynamics of residues that form its binding pocket (e.g., F253 and Q250) and the charged side chains (R30-D404) from a second coordination shell. The water-mediated R30-D404 salt bridge is thought to be part of the extracellular (EC) gate of LeuT. The introduction of a polar ligand such as glycine to the water-depleted binding pocket of LeuT gives rise to structural rearrangements of the R30-D404-Q250 hydrogen-bonding network and leads to increased hydration of the binding pocket. Conformational changes associated with the broken hydrogen bond between Q250 and R30 are shown to be important for tight and selective ligand binding to LeuT.

  18. Transport mechanism for L-lactic acid in human myocytes using human prototypic embryonal rhabdomyosarcoma cell line (RD cells).

    PubMed

    Kobayashi, Masaki; Fujita, Itaru; Itagaki, Shirou; Hirano, Takeshi; Iseki, Ken

    2005-07-01

    Monocarboxylate transporter (MCT), which cotransport L-lactic acid and protons across cell membranes, are important for regulation of muscle pH. However, it has not been demonstrated in detail whether MCT isoform contribute to the transport of L-lactic acid in skeletal muscle. The aim of this study was to characterize L-lactic acid transport using an human rhabdomyosarcoma (RD) cell line as a model of human skeletal muscle. mRNAs of MCT 1, 2 and 4 were found to be expressed in RD cells. The [14C] L-lactic acid uptake was concentration-dependent with a Km of 1.19 mM. This Km value was comparable to its Km values for MCT1 or MCT2. MCT1 mRNA was found to be present markedly greater than that MCT2. Therefore, MCT1 most probably acts on L-lactic acid uptake at RD cells. [14C] L-Lactic acid efflux in RD cells was inhibited by alpha-cyano-4-hydroxycinnamate (CHC) but not by butyric acid, a substrate of MCT1. Accordingly, MCT2 or MCT4 is responsible for L-lactic acid efflux by RD cells. MCT4 mRNA was found to be present significantly greater than that MCT2. We conclude that MCT1 is responsible for L-lactic acid uptake and L-lactic acid efflux is mediated by MCT4 in RD cells.

  19. Unusual effects of monocarboxylic acids on the structure and on the transport and mechanical properties of chitosan films.

    PubMed

    Chen, Fei; Gällstedt, Mikael; Olsson, Richard T; Gedde, Ulf W; Hedenqvist, Mikael S

    2015-11-05

    The purpose of this study was to study the transport of monocarboxylic acids in chitosan films, since this is important for understanding and predicting the drying kinetics of chitosan from aqueous solutions. Despite the wealth of data on chitosan films prepared from aqueous monocarboxylic acid solutions, this transport has not been reported. Chitosan films were exposed to formic, acetic, propionic and butyric acid vapours, it was found that the rate of uptake decreased with increasing molecular size. The equilibration time was unexpectedly long, especially for propionic and butyric acid, nine months. A clear two-stage uptake curve was observed for propionic acid. Evidently, the rate of uptake was determined by acid-induced changes in the material. X-ray diffraction and infrared spectroscopy indicated that the structure of the chitosan acetate and buffered chitosan films changed during exposure to acid and during the subsequent drying. The dried films previously exposed to the acid showed less crystalline features than the original material and a novel repeating structure possibly involving acid molecules. The molar mass of the chitosan decreased on exposure to acid but tensile tests revealed that the films were always ductile. The films exposed to acid vapour (propionic and butyric acid) for the longest period of time were insoluble in the size-exclusion chromatography eluent, and they were also the most ductile/extensible of all samples studied.

  20. The human erythrocyte anion-transport protein. Partial amino acid sequence, conformation and a possible molecular mechanism for anion exchange.

    PubMed Central

    Brock, C J; Tanner, M J; Kempf, C

    1983-01-01

    The N-terminal 72 residues of an integral membrane fragment, P5, of the human erythrocyte anion-transport protein, which is known to be directly involved in the anion-exchange process, was shown to have the following amino acid sequence: Met-Val-Pro-Lys-Pro-Gln-Gly-Pro-Leu-Pro-Asn-Thr-Ala-Leu-Leu-Ser-Leu-Val-Leu-Met -Ala-Gly-Thr-Phe-Phe-Phe-Ala-Met-Met-Leu-Arg-Lys-Phe-Lys-Asn-Ser-Ser-Tyr-Phe-Pro-Gly-Lys-Leu-Arg-Arg-Val-Ile-Gly-Asp-Phe-Gly-Val-Pro-Ile-Ser-Ile-Leu-Ile-Met-Val-Leu-Val-Asp-Phe-Phe-Ile-Gln-Asp-Thr-Tyr-Thr-Gln- The structure of this fragment was analysed, with account being taken of the constraints that apply to the folding of integral membrane proteins and the topographical locations of various sites in the sequence. It was concluded that this sequence forms two transmembrane alpha-helices. These are probably part of a cluster of amphipathic transmembrane alpha-helices, which could comprise that part of the protein responsible for transport activity. The presently available evidence relating to the anion-exchange process was considered with the structural features noted in this study and a possible molecular mechanism is proposed. In this model the rearrangement of a network of intramembranous charged pairs mediates the translocation of an anion between anion-binding regions at each surface of the membrane, which are composed of clusters of positively charged amino acids. This model imposes a sequential exchange mechanism on the system. Supplementary material, including Tables and Figures describing the compositions of peptides determined by amino acid analysis and sequence studies, quantitative and qualitative data that provide a residue-by-residue justification for the sequence assignment and a description of modifications to and use of the solid-phase sequencer has been deposited as Supplementary Publication SUP 50123 (12 pages) with the British Library Lending Division, Boston Spa, Wetherby, West Yorkshire LS23 7BQ, U.K., from whom copies can be

  1. Mechanisms of glutamate transport.

    PubMed

    Vandenberg, Robert J; Ryan, Renae M

    2013-10-01

    L-Glutamate is the predominant excitatory neurotransmitter in the mammalian central nervous system and plays important roles in a wide variety of brain functions, but it is also a key player in the pathogenesis of many neurological disorders. The control of glutamate concentrations is critical to the normal functioning of the central nervous system, and in this review we discuss how glutamate transporters regulate glutamate concentrations to maintain dynamic signaling mechanisms between neurons. In 2004, the crystal structure of a prokaryotic homolog of the mammalian glutamate transporter family of proteins was crystallized and its structure determined. This has paved the way for a better understanding of the structural basis for glutamate transporter function. In this review we provide a broad perspective of this field of research, but focus primarily on the more recent studies with a particular emphasis on how our understanding of the structure of glutamate transporters has generated new insights.

  2. [Hepatocellular transport of bile acids and organic anions in infection and SIRS--evidence for different mechanisms for regulating membrane transport proteins].

    PubMed

    Bolder, U; Thasler, W E; Hofmann, A F; Jauch, K W

    1998-01-01

    The alteration of proinflammatory mediators during sepsis and SIRS results in a large variety of adaptive changes of metabolic and physiologic variables. This study investigated the alterations of hepatocellular transport in a rat sepsis model (LPS i.p.) as well as in a model inducing SIRS by sterile abscess formation (turpentine i.m.). Two bile acids (Cholyltaurine and Chemodeoxycholyltaurine) and one organic anion (Sulfolithocholyltaurine) were used as marker substrates to investigate the time course of hepatocellular transport function. Experiments were performed in isolated perfused rat livers and plasma membrane vesicles. During sepsis, both, the transport of bile acids and that of the organic anion was markedly reduced. In contrast no alteration of transport was detected during SIRS. However, biliary secretion of glutathione (+90%) and bile acid independent bile flow (%) were increased. mRNA levels of bile acid and organic anion transport proteins were reduced. The lowest values were noted 12 h after injection of LPS or turpentine. Almost unchanged kinetic parameters during SIRS pointed to a normal population of transporters with regard to quantity and substrate affinity. Therefore it seems that transcriptional regulation plays an important role for the expression of transport proteins during sepsis, whereas posttranscriptional regulation may be of importance during SIRS. The clinical phenomenon of septic cholestasis including jaundice implies endotoxemia and differenciates against SIRS.

  3. Fetal hydantoin syndrome: inhibition of placental folic acid transport as a potential mechanism for fetal growth retardation in the rat

    SciTech Connect

    Will, M.; Barnard, J.A.; Said, H.M.; Ghishan, F.K.

    1985-04-01

    Maternal hydantoin ingestion during pregnancy results in a well defined clinical entity termed ''fetal hydantoin syndrome''. The clinical characteristics of this syndrome includes growth retardation, and congenital anomalies. Because folic acid is essential for protein synthesis and growth, and since hydantoin interferes with intestinal transport of folic acid, the authors postulated that part of the fetal hydantoin syndrome may be due to inhibition of placental folic acid by maternal hydantoin. Therefore, they studied in vivo placental folate transport in a well-established model for fetal hydantoin syndrome in the rat. Our results indicate that maternal hydantoin ingestion, significantly decreased fetal weight and placental and fetal uptake of folate compared to controls. To determine whether maternal hydantoin ingestion has a generalized or specific effect on placental function, they examined placental and fetal zinc transport in the same model. Our results indicate that zinc transport is not altered by hydantoin ingestion. They conclude that maternal hydantoin ingestion results in fetal growth retardation which may be due in part to inhibition of placental folate transport.

  4. Vapor transport mechanisms

    NASA Technical Reports Server (NTRS)

    Workman, G. L.

    1978-01-01

    The Raman scattering furnace for investigating vapor transport mechanisms was completed and checked out. Preliminary experiments demonstate that a temperature resolution of plus and minus 5 C is possible with this system operating in a backscatter mode. In the experiments presented with the GeI 4 plus excess Ge system at temperatures up to 600 C, only the GeI4 band at 150 cm superscript minus 1 was observed. Further experiments are in progress to determine if GeI2 does become the major vapor species above 440 C.

  5. Cysteine transport through excitatory amino acid transporter 3 (EAAT3).

    PubMed

    Watts, Spencer D; Torres-Salazar, Delany; Divito, Christopher B; Amara, Susan G

    2014-01-01

    Excitatory amino acid transporters (EAATs) limit glutamatergic signaling and maintain extracellular glutamate concentrations below neurotoxic levels. Of the five known EAAT isoforms (EAATs 1-5), only the neuronal isoform, EAAT3 (EAAC1), can efficiently transport the uncharged amino acid L-cysteine. EAAT3-mediated cysteine transport has been proposed to be a primary mechanism used by neurons to obtain cysteine for the synthesis of glutathione, a key molecule in preventing oxidative stress and neuronal toxicity. The molecular mechanisms underlying the selective transport of cysteine by EAAT3 have not been elucidated. Here we propose that the transport of cysteine through EAAT3 requires formation of the thiolate form of cysteine in the binding site. Using Xenopus oocytes and HEK293 cells expressing EAAT2 and EAAT3, we assessed the transport kinetics of different substrates and measured transporter-associated currents electrophysiologically. Our results show that L-selenocysteine, a cysteine analog that forms a negatively-charged selenolate ion at physiological pH, is efficiently transported by EAATs 1-3 and has a much higher apparent affinity for transport when compared to cysteine. Using a membrane tethered GFP variant to monitor intracellular pH changes associated with transport activity, we observed that transport of either L-glutamate or L-selenocysteine by EAAT3 decreased intracellular pH, whereas transport of cysteine resulted in cytoplasmic alkalinization. No change in pH was observed when cysteine was applied to cells expressing EAAT2, which displays negligible transport of cysteine. Under conditions that favor release of intracellular substrates through EAAT3 we observed release of labeled intracellular glutamate but did not detect cysteine release. Our results support a model whereby cysteine transport through EAAT3 is facilitated through cysteine de-protonation and that once inside, the thiolate is rapidly re-protonated. Moreover, these findings suggest

  6. The ABC-Type Multidrug Resistance Transporter LmrCD Is Responsible for an Extrusion-Based Mechanism of Bile Acid Resistance in Lactococcus lactis▿

    PubMed Central

    Zaidi, Arsalan Haseeb; Bakkes, Patrick J.; Lubelski, Jacek; Agustiandari, Herfita; Kuipers, Oscar P.; Driessen, Arnold J. M.

    2008-01-01

    Upon prolonged exposure to cholate and other toxic compounds, Lactococcus lactis develops a multidrug resistance phenotype that has been attributed to an elevated expression of the heterodimeric ABC-type multidrug transporter LmrCD. To investigate the molecular basis of bile acid resistance in L. lactis and to evaluate the contribution of efflux-based mechanisms in this process, the drug-sensitive L. lactis NZ9000 ΔlmrCD strain was challenged with cholate. A resistant strain was obtained that, compared to the parental strain, showed (i) significantly improved resistance toward several bile acids but not to drugs, (ii) morphological changes, and (iii) an altered susceptibility to antimicrobial peptides. Transcriptome and transport analyses suggest that the acquired resistance is unrelated to elevated transport activity but, instead, results from a multitude of stress responses, changes to the cell envelope, and metabolic changes. In contrast, wild-type cells induce the expression of lmrCD upon exposure to cholate, whereupon the cholate is actively extruded from the cells. Together, these data suggest a central role for an efflux-based mechanism in bile acid resistance and implicate LmrCD as the main system responsible in L. lactis. PMID:18790870

  7. Transport and biological activities of bile acids.

    PubMed

    Zwicker, Brittnee L; Agellon, Luis B

    2013-07-01

    Bile acids have emerged as important biological molecules that support the solubilization of various lipids and lipid-soluble compounds in the gut, and the regulation of gene expression and cellular function. Bile acids are synthesized from cholesterol in the liver and eventually released into the small intestine. The majority of bile acids are recovered in the distal end of the small intestine and then returned to the liver for reuse. The components of the mechanism responsible for the recycling of bile acids within the enterohepatic circulation have been identified whereas the mechanism for intracellular transport is less understood. Recently, the ileal lipid binding protein (ILBP; human gene symbol FABP6) was shown to be needed for the efficient transport of bile acids from the apical side to the basolateral side of enterocytes in the distal intestine. This review presents an overview of the transport of bile acids between the liver and the gut as well as within hepatocytes and enterocytes. A variety of pathologies is associated with the malfunction of the bile acid transport system.

  8. Tape transport mechanism

    DOEpatents

    Groh, Edward F.; McDowell, William; Modjeski, Norbert S.; Keefe, Donald J.; Groer, Peter

    1979-01-01

    A device is provided for transporting, in a stepwise manner, tape between a feed reel and takeup reel. An indexer moves across the normal path of the tape displacing it while the tape on the takeup reel side of the indexer is braked. After displacement, the takeup reel takes up the displaced tape while the tape on the feed reel side of the indexer is braked, providing stepwise tape transport in precise intervals determined by the amount of displacement caused by the indexer.

  9. Vacuolar Transport of Abscisic Acid Glucosyl Ester Is Mediated by ATP-Binding Cassette and Proton-Antiport Mechanisms in Arabidopsis1[W][OPEN

    PubMed Central

    Burla, Bo; Pfrunder, Stefanie; Nagy, Réka; Francisco, Rita Maria; Lee, Youngsook; Martinoia, Enrico

    2013-01-01

    Abscisic acid (ABA) is a key plant hormone involved in diverse physiological and developmental processes, including abiotic stress responses and the regulation of stomatal aperture and seed germination. Abscisic acid glucosyl ester (ABA-GE) is a hydrolyzable ABA conjugate that accumulates in the vacuole and presumably also in the endoplasmic reticulum. Deconjugation of ABA-GE by the endoplasmic reticulum and vacuolar β-glucosidases allows the rapid formation of free ABA in response to abiotic stress conditions such as dehydration and salt stress. ABA-GE further contributes to the maintenance of ABA homeostasis, as it is the major ABA catabolite exported from the cytosol. In this work, we identified that the import of ABA-GE into vacuoles isolated from Arabidopsis (Arabidopsis thaliana) mesophyll cells is mediated by two distinct membrane transport mechanisms: proton gradient-driven and ATP-binding cassette (ABC) transporters. Both systems have similar Km values of approximately 1 mm. According to our estimations, this low affinity appears nevertheless to be sufficient for the continuous vacuolar sequestration of ABA-GE produced in the cytosol. We further demonstrate that two tested multispecific vacuolar ABCC-type ABC transporters from Arabidopsis exhibit ABA-GE transport activity when expressed in yeast (Saccharomyces cerevisiae), which also supports the involvement of ABC transporters in ABA-GE uptake. Our findings suggest that the vacuolar ABA-GE uptake is not mediated by specific, but rather by several, possibly multispecific, transporters that are involved in the general vacuolar sequestration of conjugated metabolites. PMID:24028845

  10. Intestinal transport and metabolism of bile acids

    PubMed Central

    Dawson, Paul A.; Karpen, Saul J.

    2015-01-01

    In addition to their classical roles as detergents to aid in the process of digestion, bile acids have been identified as important signaling molecules that function through various nuclear and G protein-coupled receptors to regulate a myriad of cellular and molecular functions across both metabolic and nonmetabolic pathways. Signaling via these pathways will vary depending on the tissue and the concentration and chemical structure of the bile acid species. Important determinants of the size and composition of the bile acid pool are their efficient enterohepatic recirculation, their host and microbial metabolism, and the homeostatic feedback mechanisms connecting hepatocytes, enterocytes, and the luminal microbiota. This review focuses on the mammalian intestine, discussing the physiology of bile acid transport, the metabolism of bile acids in the gut, and new developments in our understanding of how intestinal metabolism, particularly by the gut microbiota, affects bile acid signaling. PMID:25210150

  11. Mechanical approach to chemical transport

    PubMed Central

    Kocherginsky, Nikolai; Gruebele, Martin

    2016-01-01

    Nonequilibrium thermodynamics describes the rates of transport phenomena with the aid of various thermodynamic forces, but often the phenomenological transport coefficients are not known, and the description is not easily connected with equilibrium relations. We present a simple and intuitive model to address these issues. Our model is based on Lagrangian dynamics for chemical systems with dissipation, so one may think of the model as physicochemical mechanics. Using one main equation, the model allows a systematic derivation of all transport and equilibrium equations, subject to the limitation that heat generated or absorbed in the system must be small for the model to be valid. A table with all major examples of transport and equilibrium processes described using physicochemical mechanics is given. In equilibrium, physicochemical mechanics reduces to standard thermodynamics and the Gibbs–Duhem relation, and we show that the First and Second Laws of thermodynamics are satisfied for our system plus bath model. Out of equilibrium, our model provides relationships between transport coefficients and describes system evolution in the presence of several simultaneous external fields. The model also leads to an extension of the Onsager–Casimir reciprocal relations for properties simultaneously transported by many components. PMID:27647899

  12. Novel Lactate Transporters from Carboxylic Acid-Producing Rhizopus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The fungus Rhizopus is frequently used for fermentative production of lactic acid, but little is known about the mechanisms or proteins for transporting this carboxylic acid. Since transport of the lactate anion across the plasma membrane is critical to prevent acidification of the cytoplasm, we ev...

  13. Compartmentation of malic acid in mesophyll cells of Kalanchoee daigremontiana: indications of a intracellular cytosolic vesicle transport mechanism

    SciTech Connect

    Balsamo, R.A.; Uribe, E.G.

    1987-04-01

    Leaf tissue was harvested over a 24hr period at one to three hour intervals. The malic acid levels in the tissue were assayed spectrophotometrically and the percent cell volume occupied by cytosolic vesicles in replicate samples was determined. The total volume of the cytosolic vesicles fluctuated throughout the photoperiod concommitantly with malic acid concentrations present in the tissue. An intact leaf tissue section (10.2cm/sup 2/) was radiolabeled with /sup 14/CO/sub 2/ seven hours into the dark period for thirty minutes. Two dimensional thin layer chromatography and electrophoresis of the tissue determined that 96% of the label was incorporated into malic acid. A freeze substitution procedure was initiated followed by microautoradiography (Fisher 1971) which allowed for the tracing of intracellular malic acid migration and compartmentation within the mesophyll cells. The results and interpretation of this experiment will be presented.

  14. Characterization of Na(+) transport to gain insight into the mechanism of acid-base and ion regulation in white sturgeon (Acipenser transmontanus).

    PubMed

    Shartau, Ryan B; Brix, Kevin V; Brauner, Colin J

    2017-02-01

    Freshwater fish actively take up ions via specific transporters to counter diffusive losses to their hypotonic environment. While much is known about the specific mechanisms employed by teleosts, almost nothing is known about the basal fishes, such as white sturgeon (Acipenser transmontanus) which may offer insight into the evolution of osmo- and ionoregulation in fishes. We investigated Na(+) uptake in juvenile white sturgeon in the presence and absence of transporter inhibitors. We found that sturgeon acclimated to 100μmoll(-1) Na(+) have Na(+) uptake kinetics typical of teleosts and that a Na(+)/H(+) exchanger (NHE) is the predominant transporter for Na(+) uptake. White sturgeon are tolerant to hypercarbia-induced respiratory acidoses and recover blood pH (pHe) at 1.5kPa PCO2 but not at higher PCO2 (6kPa PCO2) where they preferentially regulate intracellular pH (pHi). It was hypothesized that during exposure to hypercarbia Na(+) uptake would increase at CO2 tensions at which fish were capable of pHe regulation but decrease at higher tensions when they were preferentially regulating pHi. We found that Na(+) uptake did not increase at 1.5kPa PCO2, but at 6kPa PCO2 Na(+) uptake was reduced by 95% while low water pH equivalent to 6kPa PCO2 reduced Na(+) uptake by 71%. Lastly, we measured net acid flux during hypercarbia, which indicates that net acid flux is not associated with Na(+) uptake. These findings indicate Na(+) uptake in sturgeon is not different from freshwater teleosts but is sensitive to hypercarbia and is not associated with pHe compensation during hypercarbia.

  15. Two non-steroidal anti-inflammatory drugs, niflumic acid and diclofenac, inhibit the human glutamate transporter EAAT1 through different mechanisms.

    PubMed

    Takahashi, Kanako; Ishii-Nozawa, Reiko; Takeuchi, Kouichi; Nakazawa, Ken; Sato, Kaoru

    2010-01-01

    We investigated the effects of non-steroidal anti-inflammatory drugs on substrate-induced currents of L-glutamate (L-Glu) transporter EAAT1 expressed in Xenopus laevis oocytes. Niflumic acid (NFA) and diclofenac inhibited L-Glu-induced current through EAAT1 in a non-competitive manner. NFA produced a leftward shift in reversal potential (E(rev)) of L-Glu-induced current and increased current amplitude at the potentials more negative than -100 mV. Diclofenac had no effects on E(rev) and inhibited the current amplitude to the same extent at all negative potentials. These results indicate that NFA and diclofenac inhibit the L-Glu-induced EAAT1 current via different mechanisms.

  16. Nimesulide binding site in the B0AT1 (SLC6A19) amino acid transporter. Mechanism of inhibition revealed by proteoliposome transport assay and molecular modelling.

    PubMed

    Pochini, Lorena; Seidita, Angela; Sensi, Cristina; Scalise, Mariafrancesca; Eberini, Ivano; Indiveri, Cesare

    2014-06-01

    The effect of pharmaceutical compounds on the rat kidney B0AT1 transporter in proteoliposomes has been screened. To this aim, inhibition of the transport activity by the different compounds was measured on Na(+)-[(3)H]glutamine co-transport in the presence of membrane potential positive outside. Most of the tested drugs had no effect on the transport activity. Some compounds exhibited inhibitory effects from 5 to 88% at concentration of 300μM. Among the tested compounds, only the anti-inflammatory drug nimesulide exerted potent inhibition on B0AT1. From dose response analysis, an IC50 value of 23μM was found. Inhibition kinetic analysis was performed: noncompetitive inhibition of the glutamine transport was observed while competitive behaviour was found when the inhibition was analyzed with respect to the Na(+) concentration. Several molecules harbouring functional groups of nimesulide (analogues) were tested as inhibitors. None among the tested molecules has the capacity to inhibit the transport with the exception of the compound NS-398, whose chemical structure is very close to that of whole nimesulide. The IC50 for this compound was 131μM. Inhibition kinetics showed behaviour of NS-398 identical to that of nimesulide, i.e., noncompetitive inhibition respect to glutamine and competitive inhibition respect to Na(+). Molecular docking of nimesulide suggested that this drug is able to bind B0AT1 in an external dedicated binding site and that its binding produces a steric hindrance effect of the protein translocation path abolishing the transporter activity.

  17. Enhancing the intestinal absorption of low molecular weight chondroitin sulfate by conjugation with α-linolenic acid and the transport mechanism of the conjugates.

    PubMed

    Xiao, Yuliang; Li, Pingli; Cheng, Yanna; Zhang, Xinke; Sheng, Juzheng; Wang, Decai; Li, Juan; Zhang, Qian; Zhong, Chuanqing; Cao, Rui; Wang, Fengshan

    2014-04-25

    The purpose of this report was to demonstrate the effect of amphiphilic polysaccharides-based self-assembling micelles on enhancing the oral absorption of low molecular weight chondroitin sulfate (LMCS) in vitro and in vivo, and identify the transepithelial transport mechanism of LMCS micelles across the intestinal barrier. α-Linolenic acid-low molecular weight chondroitin sulfate polymers(α-LNA-LMCS) were successfully synthesized, and characterized by FTIR, (1)HNMR, TGA/DSC, TEM, laser light scattering and zeta potential. The significant oral absorption enhancement and elimination half-life (t₁/₂) extension of LNA-LMCS2 in rats were evidenced by intragastric administration in comparison with CS and LMCS. Caco-2 transport studies demonstrated that the apparent permeability coefficient (Papp) of LNA-LMCS2 was significantly higher than that of CS and LMCS (p<0.001), and no significant effects on the overall integrity of the monolayer were observed during the transport process. In addition, α-LNA-LMCS micelles accumulated around the cell membrane and intercellular space observed by confocal laser scanning microscope (CLSM). Furthermore, evident alterations in the F-actin cytoskeleton were detected by CLSM observation following the treatment of the cell monolayers with α-LNA-LMCS micelles, which further certified the capacity of α-LNA-LMCS micelles to open the intercellular tight junctions rather than disrupt the overall integrity of the monolayer. Therefore, LNA-LMCS2 with low cytotoxicity and high bioavailability might be a promising substitute for CS in clinical use, such as treating osteoarthritis, atherosclerosis, etc.

  18. Abscisic Acid Transport in Human Erythrocytes*

    PubMed Central

    Vigliarolo, Tiziana; Guida, Lucrezia; Millo, Enrico; Fresia, Chiara; Turco, Emilia; De Flora, Antonio; Zocchi, Elena

    2015-01-01

    Abscisic acid (ABA) is a plant hormone involved in the response to environmental stress. Recently, ABA has been shown to be present and active also in mammals, where it stimulates the functional activity of innate immune cells, of mesenchymal and hemopoietic stem cells, and insulin-releasing pancreatic β-cells. LANCL2, the ABA receptor in mammalian cells, is a peripheral membrane protein that localizes at the intracellular side of the plasma membrane. Here we investigated the mechanism enabling ABA transport across the plasmamembrane of human red blood cells (RBC). Both influx and efflux of [3H]ABA occur across intact RBC, as detected by radiometric and chromatographic methods. ABA binds specifically to Band 3 (the RBC anion transporter), as determined by labeling of RBC membranes with biotinylated ABA. Proteoliposomes reconstituted with human purified Band 3 transport [3H]ABA and [35S]sulfate, and ABA transport is sensitive to the specific Band 3 inhibitor 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid. Once inside RBC, ABA stimulates ATP release through the LANCL2-mediated activation of adenylate cyclase. As ATP released from RBC is known to exert a vasodilator response, these results suggest a role for plasma ABA in the regulation of vascular tone. PMID:25847240

  19. Transport of amino acids in Lactobacillus casei by proton-motive-force-dependent and non-proton-motive-force-dependent mechanisms.

    PubMed Central

    Strobel, H J; Russell, J B; Driessen, A J; Konings, W N

    1989-01-01

    Lactobacillus casei 393 cells which were energized with glucose (pH 6.0) took up glutamine, asparagine, glutamate, aspartate, leucine, and phenylalanine. Little or no uptake of several essential amino acids (valine, isoleucine, arginine, cysteine, tyrosine, and tryptophan) was observed. Inhibition studies indicated that there were at least five amino acid carriers, for glutamine, asparagine, glutamate/aspartate, phenylalanine, or branched-chain amino acids. Transport activities had pH optima between 5.5 and 6.0, but all amino acid carriers showed significant activity even at pH 4.0. Leucine and phenylalanine transport decreased markedly when the pH was increased to 7.5. Inhibitors which decreased proton motive force (delta p) nearly eliminated leucine and phenylalanine uptake, and studies with de-energized cells and membrane vesicles showed that an artificial electrical potential (delta psi) of at least -100 mV was needed for rapid uptake. An artificial delta p was unable to drive glutamine, asparagine, or glutamate uptake, and transport of these amino acids was sensitive to a decline in intracellular pH. When intracellular pH was greater than 7.7, glutamine, asparagine, or glutamate was transported rapidly even though the proton motive force had been abolished by inhibitors. PMID:2492498

  20. Membranes, mechanics, and intracellular transport

    NASA Astrophysics Data System (ADS)

    Parthasarathy, Raghuveer

    2012-10-01

    Cellular membranes are remarkable materials -- self-assembled, flexible, two-dimensional fluids. Understanding how proteins manipulate membrane curvature is crucial to understanding the transport of cargo in cells, yet the mechanical activities of trafficking proteins remain poorly understood. Using an optical-trap based assay involving dynamic deformation of biomimetic membranes, we have examined the behavior of Sar1, a key component of the COPII family of transport proteins. We find that Sar1 from yeast (S. cerevisiae) lowers membrane rigidity by up to 100% as a function of its concentration, thereby lowering the energetic cost of membrane deformation. Human Sar1 proteins can also lower the mechanical rigidity of the membranes to which they bind. However, unlike the yeast proteins, the rigidity is not a monotonically decreasing function of concentration but rather shows increased rigidity and decreased mobility at high concentrations that implies interactions between proteins. In addition to describing this study of membrane mechanics, I'll also discuss some topics relevant to a range of biophysical investigations, such as the insights provided by imaging methods and open questions in the dynamics of multicellular systems.

  1. Arachidonic acid inhibits glycine transport in cultured glial cells.

    PubMed Central

    Zafra, F; Alcantara, R; Gomeza, J; Aragon, C; Gimenez, C

    1990-01-01

    The effects of arachidonic acid on glycine uptake, exchange and efflux in C6 glioma cells were investigated. Arachidonic acid produced a dose-dependent inhibition of high-affinity glycine uptake. This effect was not due to a simple detergent-like action on membranes, as the inhibition of glycine transport was most pronounced with cis-unsaturated long-chain fatty acids, whereas saturated and trans-unsaturated fatty acids had relatively little or no effect. Endogenous unsaturated non-esterified fatty acids may exert a similar inhibitory effect on the transport of glycine. The mechanism for this inhibitory effect has been examined in a plasma membrane vesicle preparation derived from C6 cells, which avoids metabolic or compartmentation interferences. The results suggest that part of the selective inhibition of glycine transport by arachidonic acid could be due to the effects of the arachidonic acid on the lipid domain surrounding the carrier. PMID:2121132

  2. Amino acid transporters: roles in amino acid sensing and signalling in animal cells.

    PubMed Central

    Hyde, Russell; Taylor, Peter M; Hundal, Harinder S

    2003-01-01

    Amino acid availability regulates cellular physiology by modulating gene expression and signal transduction pathways. However, although the signalling intermediates between nutrient availability and altered gene expression have become increasingly well documented, how eukaryotic cells sense the presence of either a nutritionally rich or deprived medium is still uncertain. From recent studies it appears that the intracellular amino acid pool size is particularly important in regulating translational effectors, thus, regulated transport of amino acids across the plasma membrane represents a means by which the cellular response to amino acids could be controlled. Furthermore, evidence from studies with transportable amino acid analogues has demonstrated that flux through amino acid transporters may act as an initiator of nutritional signalling. This evidence, coupled with the substrate selectivity and sensitivity to nutrient availability classically associated with amino acid transporters, plus the recent discovery of transporter-associated signalling proteins, demonstrates a potential role for nutrient transporters as initiators of cellular nutrient signalling. Here, we review the evidence supporting the idea that distinct amino acid "receptors" function to detect and transmit certain nutrient stimuli in higher eukaryotes. In particular, we focus on the role that amino acid transporters may play in the sensing of amino acid levels, both directly as initiators of nutrient signalling and indirectly as regulators of external amino acid access to intracellular receptor/signalling mechanisms. PMID:12879880

  3. Carboxylic Acids Plasma Membrane Transporters in Saccharomyces cerevisiae.

    PubMed

    Casal, Margarida; Queirós, Odília; Talaia, Gabriel; Ribas, David; Paiva, Sandra

    2016-01-01

    This chapter covers the functionally characterized plasma membrane carboxylic acids transporters Jen1, Ady2, Fps1 and Pdr12 in the yeast Saccharomyces cerevisiae, addressing also their homologues in other microorganisms, as filamentous fungi and bacteria. Carboxylic acids can either be transported into the cells, to be used as nutrients, or extruded in response to acid stress conditions. The secondary active transporters Jen1 and Ady2 can mediate the uptake of the anionic form of these substrates by a H(+)-symport mechanism. The undissociated form of carboxylic acids is lipid-soluble, crossing the plasma membrane by simple diffusion. Furthermore, acetic acid can also be transported by facilitated diffusion via Fps1 channel. At the cytoplasmic physiological pH, the anionic form of the acid prevails and it can be exported by the Pdr12 pump. This review will highlight the mechanisms involving carboxylic acids transporters, and the way they operate according to the yeast cell response to environmental changes, as carbon source availability, extracellular pH and acid stress conditions.

  4. Ascorbic acid transport into cultured pituitary cells

    SciTech Connect

    Cullen, E.I.; May, V.; Eipper, R.A.

    1986-05-01

    An amidating enzyme designated peptidyl-glycine ..cap alpha..-amidating monooxygenase (PAM) has been studied in a variety of tissues and is dependent on molecular oxygen and stimulated by copper and ascorbic acid. To continue investigating the relationship among cellular ascorbic acid concentrations, amidating ability, and PAM activity, the authors studied ascorbic acid transport in three cell preparations that contain PAM and produce amidated peptides: primary cultures of rat anterior and intermediate pituitary and mouse AtT-20 tumor cells. When incubated in 50 ..mu..M (/sup 14/C)ascorbic acid all three cell preparations concentrated ascorbic acid 20- to 40-fold, producing intracellular ascorbate concentrations of 1 to 2 mM, based on experimentally determined cell volumes. All three cell preparations displayed saturable ascorbic acid uptake with half-maximal initial rates occurring between 9 and 18 ..mu..M ascorbate. Replacing NaCl in the uptake buffer with choline chloride significantly diminished ascorbate uptake in all three preparations. Ascorbic acid efflux from these cells was slow, displaying half-lives of 7 hours. Unlike systems that transport dehydroascorbic acid, the transport system for ascorbic acid in these cells was not inhibited by glucose. Thus, ascorbate is transported into pituitary cells by a sodium-dependent, active transport system.

  5. Identification and application of keto acids transporters in Yarrowia lipolytica

    PubMed Central

    Guo, Hongwei; Liu, Peiran; Madzak, Catherine; Du, Guocheng; Zhou, Jingwen; Chen, Jian

    2015-01-01

    Production of organic acids by microorganisms is of great importance for obtaining building-block chemicals from sustainable biomass. Extracellular accumulation of organic acids involved a series of transporters, which play important roles in the accumulation of specific organic acid while lack of systematic demonstration in eukaryotic microorganisms. To circumvent accumulation of by-product, efforts have being orchestrated to carboxylate transport mechanism for potential clue in Yarrowia lipolytica WSH-Z06. Six endogenous putative transporter genes, YALI0B19470g, YALI0C15488g, YALI0C21406g, YALI0D24607g, YALI0D20108g and YALI0E32901g, were identified. Transport characteristics and substrate specificities were further investigated using a carboxylate-transport-deficient Saccharomyces cerevisiae strain. These transporters were expressed in Y. lipolytica WSH-Z06 to assess their roles in regulating extracellular keto acids accumulation. In a Y. lipolytica T1 line over expressing YALI0B19470g, α-ketoglutarate accumulated to 46.7 g·L−1, whereas the concentration of pyruvate decreased to 12.3 g·L−1. Systematic identification of these keto acids transporters would provide clues to further improve the accumulation of specific organic acids with higher efficiency in eukaryotic microorganisms. PMID:25633653

  6. Identification and application of keto acids transporters in Yarrowia lipolytica.

    PubMed

    Guo, Hongwei; Liu, Peiran; Madzak, Catherine; Du, Guocheng; Zhou, Jingwen; Chen, Jian

    2015-01-30

    Production of organic acids by microorganisms is of great importance for obtaining building-block chemicals from sustainable biomass. Extracellular accumulation of organic acids involved a series of transporters, which play important roles in the accumulation of specific organic acid while lack of systematic demonstration in eukaryotic microorganisms. To circumvent accumulation of by-product, efforts have being orchestrated to carboxylate transport mechanism for potential clue in Yarrowia lipolytica WSH-Z06. Six endogenous putative transporter genes, YALI0B19470g, YALI0C15488g, YALI0C21406g, YALI0D24607g, YALI0D20108g and YALI0E32901g, were identified. Transport characteristics and substrate specificities were further investigated using a carboxylate-transport-deficient Saccharomyces cerevisiae strain. These transporters were expressed in Y. lipolytica WSH-Z06 to assess their roles in regulating extracellular keto acids accumulation. In a Y. lipolytica T1 line over expressing YALI0B19470g, α-ketoglutarate accumulated to 46.7 g·L(-1), whereas the concentration of pyruvate decreased to 12.3 g·L(-1). Systematic identification of these keto acids transporters would provide clues to further improve the accumulation of specific organic acids with higher efficiency in eukaryotic microorganisms.

  7. SLC27 fatty acid transport proteins.

    PubMed

    Anderson, Courtney M; Stahl, Andreas

    2013-01-01

    The uptake and metabolism of long chain fatty acids (LCFA) are critical to many physiological and cellular processes. Aberrant accumulation or depletion of LCFA underlie the pathology of numerous metabolic diseases. Protein-mediated transport of LCFA has been proposed as the major mode of LCFA uptake and activation. Several proteins have been identified to be involved in LCFA uptake. This review focuses on the SLC27 family of fatty acid transport proteins, also known as FATPs, with an emphasis on the gain- and loss-of-function animal models that elucidate the functions of FATPs in vivo and how these transport proteins play a role in physiological and pathological situations.

  8. Molecular mechanisms and regulation of iron transport.

    PubMed

    Chung, Jayong; Wessling-Resnick, Marianne

    2003-04-01

    Iron homeostasis is primarily maintained through regulation of its transport. This review summarizes recent discoveries in the field of iron transport that have shed light on the molecular mechanisms of dietary iron uptake, pathways for iron efflux to and between peripheral tissues, proteins implicated in organellar transport of iron (particularly the mitochondrion), and novel regulators that have been proposed to control iron assimilation. The transport of both transferrin-bound and nontransferrin-bound iron to peripheral tissues is discussed. Finally, the regulation of iron transport is also considered at the molecular level, with posttranscriptional, transcriptional, and posttranslational control mechanisms being reviewed.

  9. Common folds and transport mechanisms of secondary active transporters.

    PubMed

    Shi, Yigong

    2013-01-01

    Secondary active transporters exploit the electrochemical potential of solutes to shuttle specific substrate molecules across biological membranes, usually against their concentration gradient. Transporters of different functional families with little sequence similarity have repeatedly been found to exhibit similar folds, exemplified by the MFS, LeuT, and NhaA folds. Observations of multiple conformational states of the same transporter, represented by the LeuT superfamily members Mhp1, AdiC, vSGLT, and LeuT, led to proposals that structural changes are associated with substrate binding and transport. Despite recent biochemical and structural advances, our understanding of substrate recognition and energy coupling is rather preliminary. This review focuses on the common folds and shared transport mechanisms of secondary active transporters. Available structural information generally supports the alternating access model for substrate transport, with variations and extensions made by emerging structural, biochemical, and computational evidence.

  10. Selective amino acid substitutions convert the creatine transporter to a gamma-aminobutyric acid transporter.

    PubMed

    Dodd, Joanna R; Christie, David L

    2007-05-25

    The creatine transporter (CRT) is a member of a large family of sodium-dependent neurotransmitter and amino acid transporters. The CRT is closely related to the gamma-aminobutyric acid (GABA) transporter, GAT-1, yet GABA is not an effective substrate for the CRT. The high resolution structure of a prokaryotic homologue, LeuT has revealed precise details of the substrate binding site for leucine (Yamashita, A., Singh, S. K., Kawate, T., Jin, Y., and Gouaux, E. (2005) Nature 437, 215-223). We have now designed mutations based on sequence comparisons of the CRT with GABA transporters and the LeuT structural template in an attempt to alter the substrate specificity of the CRT. Combinations of two or three amino acid substitutions at four selected positions resulted in the loss of creatine transport activity and gain of a specific GABA transport function. GABA transport by the "gain of function" mutants was sensitive to nipecotic acid, a competitive inhibitor of GABA transporters. Our results show LeuT to be a good structural model to identify amino acid residues involved in the substrate and inhibitor selectivity of eukaryotic sodium-dependent neurotransmitter and amino acid transporters. However, modification of the binding site alone appears to be insufficient for efficient substrate translocation. Additional residues must mediate the conformational changes required for the diffusion of substrate from the binding site to the cytoplasm.

  11. Valproic acid induces the glutamate transporter excitatory amino acid transporter-3 in human oligodendroglioma cells.

    PubMed

    Bianchi, M G; Franchi-Gazzola, R; Reia, L; Allegri, M; Uggeri, J; Chiu, M; Sala, R; Bussolati, O

    2012-12-27

    Glutamate transport in early, undifferentiated oligodendrocytic precursors has not been characterized thus far. Here we show that human oligodendroglioma Hs683 cells are not endowed with EAAT-dependent anionic amino acid transport. However, in these cells, but not in U373 human glioblastoma cells, valproic acid (VPA), an inhibitor of histone deacetylases, markedly induces SLC1A1 mRNA, which encodes for the glutamate transporter EAAT3. The effect is detectable after 8h and persists up to 120h of treatment. EAAT3 protein increase becomes detectable after 24h of treatment and reaches its maximum after 72-96h, when it is eightfold more abundant than control. The initial influx of d-aspartate increases in parallel, exhibiting the typical features of an EAAT3-mediated process. SLC1A1 mRNA induction is associated with the increased expression of PDGFRA mRNA (+150%), a marker of early oligodendrocyte precursor cells, while the expression of GFAP, CNP and TUBB3 remains unchanged. Short term experiments have indicated that the VPA effect is shared by trichostatin A, another inhibitor of histone deacetylases. On the contrary, EAAT3 induction is neither prevented by inhibitors of mitogen-activated protein kinases nor triggered by a prolonged incubation with lithium, thus excluding a role for the GSK3β/β-catenin pathway. Thus, the VPA-dependent induction of the glutamate transporter EAAT3 in human oligodendroglioma cells likely occurs through an epigenetic mechanism and may represent an early indicator of commitment to oligodendrocytic differentiation.

  12. A statistical mechanical theory of proton transport kinetics in hydrogen-bonded networks based on population correlation functions with applications to acids and bases.

    PubMed

    Tuckerman, Mark E; Chandra, Amalendu; Marx, Dominik

    2010-09-28

    Extraction of relaxation times, lifetimes, and rates associated with the transport of topological charge defects in hydrogen-bonded networks from molecular dynamics simulations is a challenge because proton transfer reactions continually change the identity of the defect core. In this paper, we present a statistical mechanical theory that allows these quantities to be computed in an unbiased manner. The theory employs a set of suitably defined indicator or population functions for locating a defect structure and their associated correlation functions. These functions are then used to develop a chemical master equation framework from which the rates and lifetimes can be determined. Furthermore, we develop an integral equation formalism for connecting various types of population correlation functions and derive an iterative solution to the equation, which is given a graphical interpretation. The chemical master equation framework is applied to the problems of both hydronium and hydroxide transport in bulk water. For each case it is shown that the theory establishes direct links between the defect's dominant solvation structures, the kinetics of charge transfer, and the mechanism of structural diffusion. A detailed analysis is presented for aqueous hydroxide, examining both reorientational time scales and relaxation of the rotational anisotropy, which is correlated with recent experimental results for these quantities. Finally, for OH(-)(aq) it is demonstrated that the "dynamical hypercoordination mechanism" is consistent with available experimental data while other mechanistic proposals are shown to fail. As a means of going beyond the linear rate theory valid from short up to intermediate time scales, a fractional kinetic model is introduced in the Appendix in order to describe the nonexponential long-time behavior of time-correlation functions. Within the mathematical framework of fractional calculus the power law decay ∼t(-σ), where σ is a parameter of the

  13. Amino Acid Transport into Cultured Tobacco Cells

    PubMed Central

    Harrington, H. Michael; Henke, Randolph R.

    1981-01-01

    Lysine transport into suspension-cultured Wisconsin-38 tobacco cells was observed. Uptake was linear (up to 90 minutes) with respect to time and amount of tissue only after 4 to 6 hours preincubation in calcium-containing medium. The observed cellular accumulation of lysine was against a concentration gradient and not due to exchange diffusion. Transport was stimulated by low pH and characterized by a biphasic uptake isotherm with two Km values for lysine. System I (Km ≃ 5 × 10−6 molar; Vmax ≃ 180 nanomoles per gram fresh weight per hour) and system II (Km ≃ 10−4 molar; Vmax ≃ 1900 nanomoles per gram fresh weight per hour) were inhibited by N-ethylmaleimide and a variety of respiratory inhibitors. This inhibition was not due to increased efflux. In antagonism experiments, system I was inhibited most effectively by basic amino acids, followed by the sulfur amino acids. System I was only slightly inhibited by the neutral and aromatic amino acids and was not inhibited by the acidic amino acids aspartic and glutamic acids. Transport by system II was inhibited by all of the tested amino acids (including aspartic and glutamic acids) and analogs; however, this system was not inhibited by d-arginine. Neither system was strongly inhibited by d-lysine or the lysine analog S-2-aminoethyl-l-cysteine. Arginine was shown to be a competitive inhibitor of both systems with values for Ki similar to the respective Km values. These studies suggest the presence of at least two amino acid permeases in W-38 tobacco cells. PMID:16661678

  14. Mechanical Forces and Lymphatic Transport

    PubMed Central

    Breslin, Jerome W.

    2014-01-01

    This review examines current understanding of how the lymphatic vessel network can optimize lymph flow in response to various mechanical forces. Lymphatics are organized as a vascular tree, with blind-ended initial lymphatics, precollectors, prenodal collecting lymphatics, lymph nodes, postnodal collecting lymphatics and the larger trunks (thoracic duct and right lymph duct) that connect to the subclavian veins. The formation of lymph from interstitial fluid depends heavily on oscillating pressure gradients to drive fluid into initial lymphatics. Collecting lymphatics are segmented vessels with unidirectional valves, with each segment, called a lymphangion, possessing an intrinsic pumping mechanism. The lymphangions propel lymph forward against a hydrostatic pressure gradient. Fluid is returned to the central circulation both at lymph nodes and via the larger lymphatic trunks. Several recent developments are discussed, including: evidence for the active role of endothelial cells in lymph formation; recent developments on how inflow pressure, outflow pressure, and shear stress affect pump function of the lymphangion; lymphatic valve gating mechanisms; collecting lymphatic permeability; and current interpretations of the molecular mechanisms within lymphatic endothelial cells and smooth muscle. Improved understanding of the physiological mechanisms by lymphatic vessels sense mechanical stimuli, integrate the information, and generate the appropriate response is key for determining the pathogenesis of lymphatic insufficiency and developing treatments for lymphedema. PMID:25107458

  15. Amino acid transport by prosthecae of Asticcacaulis biprosthecum: evidence for a broad-range transport system.

    PubMed

    Tam, E; Pate, J L

    1985-10-01

    Prosthecae purified from cells of Asticcaulis biprosthecum possess active transport systems that transport all 20 amino acids tested. Using ascorbate-reduced phenazine methosulphate in the presence of oxygen, all 20 amino acids are accumulated against a concentration gradient by isolated prosthecae. Results of experiments testing the inhibition of transport of one amino acid by another, and of experiments testing the exchange of exogenous amino acids with those preloaded in prosthecae, along with characteristics of mutants defective in amino acid transport, suggest the presence in prosthecae of three amino acid transport systems. One, the general or G system, transports at least 18 of the 20 amino acids tested. Another system, referred to as the proline or P system, transports seven amino acids (including proline) that are also transported by the G system. The third system transports only glutamate and aspartate, and is referred to as the acidic amino acid transport system or A system.

  16. Modeling Electrical Transport through Nucleic Acids

    NASA Astrophysics Data System (ADS)

    Qi, Jianqing

    Nucleic acids play a vital role in many biological systems and activities. In recent years, engineers and scientists have been interested in studying their electrical properties. The motivation for these studies stems from the following facts: (1) the bases, which form the building blocks of nucleic acids, have unique ionization potentials. Further, nucleic acids are one of the few nanomaterials that can be reproducibly manufactured with a high degree of accuracy (though admittedly their placement at desired locations remains a challenge). As a result, designed strands with specific sequences may offer unique device properties; (2) electrical methods offer potential for sequencing nucleic acids based on a single molecule; (3) electrical methods for disease detection based on the current flowing through nucleic acids are beginning to be demonstrated. While experiments in the above mentioned areas is promising, a deeper understanding of the electrical current flow through the nucleic acids needs to be developed. The modeling of current flowing in these molecules is complex because: (1) they are based on atomic scale contacts between nucleic acids and metal, which cannot be reproducibly built; (2) the conductivity of nucleic acids is easily influenced by the environment, which is constantly changing; and (3) the nucleic acids by themselves are floppy. This thesis focuses on the modeling of electrical transport through nucleic acids that are connected to two metal electrodes at nanoscale. We first develop a decoherent transport model for the double-stranded helix based on the Landauer-Buttiker framework. This model is rationalized by comparison with an experiment that measured the conductance of four different DNA strands. The developed model is then used to study the: (1) potential to make barriers and wells for quantum transport using specifically engineered sequences; (2) change in the electrical properties of a specific DNA strand with and without methylation; (3

  17. Regulation of amino acid metabolic enzymes and transporters in plants.

    PubMed

    Pratelli, Réjane; Pilot, Guillaume

    2014-10-01

    Amino acids play several critical roles in plants, from providing the building blocks of proteins to being essential metabolites interacting with many branches of metabolism. They are also important molecules that shuttle organic nitrogen through the plant. Because of this central role in nitrogen metabolism, amino acid biosynthesis, degradation, and transport are tightly regulated to meet demand in response to nitrogen and carbon availability. While much is known about the feedback regulation of the branched biosynthesis pathways by the amino acids themselves, the regulation mechanisms at the transcriptional, post-transcriptional, and protein levels remain to be identified. This review focuses mainly on the current state of our understanding of the regulation of the enzymes and transporters at the transcript level. Current results describing the effect of transcription factors and protein modifications lead to a fragmental picture that hints at multiple, complex levels of regulation that control and coordinate transport and enzyme activities. It also appears that amino acid metabolism, amino acid transport, and stress signal integration can influence each other in a so-far unpredictable fashion.

  18. Renal Transport of Uric Acid: Evolving Concepts and Uncertainties

    PubMed Central

    Bobulescu, Ion Alexandru; Moe, Orson W.

    2013-01-01

    In addition to its role as a metabolic waste product, uric acid has been proposed to be an important molecule with multiple functions in human physiology and pathophysiology and may be linked to human diseases beyond nephrolithiasis and gout. Uric acid homeostasis is determined by the balance between production, intestinal secretion, and renal excretion. The kidney is an important regulator of circulating uric acid levels, by reabsorbing around 90% of filtered urate, while being responsible for 60–70% of total body uric acid excretion. Defective renal handling of urate is a frequent pathophysiologic factor underpinning hyperuricemia and gout. In spite of tremendous advances over the past decade, the molecular mechanisms of renal urate transport are still incompletely understood. Many transport proteins are candidate participants in urate handling, with URAT1 and GLUT9 being the best characterized to date. Understanding these transporters is increasingly important for the practicing clinician as new research unveils their physiology, importance in drug action, and genetic association with uric acid levels in human populations. The future may see the introduction of new drugs that specifically act on individual renal urate transporters for the treatment of hyperuricemia and gout. PMID:23089270

  19. The involvement of L-type amino acid transporters in theanine transport.

    PubMed

    Yamamoto, Sachiko; Kimura, Toru; Tachiki, Takashi; Anzai, Naohiko; Sakurai, Takuya; Ushimaru, Makoto

    2012-01-01

    L-Theanine has favorable physiological effects in terms of human health, but the mechanisms that transport it to its target organs or cells are not completely defined. To identify the major transport mechanisms of L-theanine, we screened for candidate transporters of L-3H-theanine in several mammal cell lines that intrinsically express multiple transporters with various specificities. All of the cells tested, T24, HepG2, COS1, 293A, Neuro2a, and HuH7, absorbed L-3H-theanine. Uptake was significantly inhibited by the addition of L-leucine and by a specific inhibitor of the system L transport system, 2-aminobicyclo-(2,2,1)-heptane-2-carboxylic acid (BCH). L-3H-Theanine uptake occurred mostly independently of Na+. These results indicate that L-theanine was taken up via a system L like transport system in all of the cells tested. Additionally, in experiments using cells stably expressing two system L isoforms, LAT1 and LAT2, we found that the two isoforms mediated L-theanine transport to similar extents. Taken together, our results indicate that L-theanine is transported mostly via the system L transport pathway and its isoforms.

  20. Mechanisms of Stratospheric Ozone Transport.

    DTIC Science & Technology

    1982-12-03

    amounts orcur too fat south and about 1 month too late. 92 CHANGE IN (740) (PPM) DIABATIC. cos ( LAT ) 70 50 ~40 (D 30_ _ _ _ _ ) 1 5 Ŗ 2.5 Z. 20 10 0 D...AD-A122 609 MECHANISMS OF STRATOSPHERIC OZONE BRANSPOR(U) NAVAL RESEARCH LAB WASHINGTON DC R B ROOD ET AL 03 DEC 82 UNCLASSIFIED F/G 4/ 1 ...NLIEIIIIEIIII EIIIIIIIIIIIIl IIIEIIIIIEEEEE IIIIIIIIIIIIIl EIIIIIIIIIIIIl EIIIIIIIIIIIIl 1111.0 112 M *0 MIt ROCLt RLS’OLU7ION TLST CHART - - - ,T 1 m -N ;’ V

  1. Neutral amino acid transport across brain microvessel endothelial cell monolayers

    SciTech Connect

    Audus, K.L.; Borchardt, R.T.

    1986-03-01

    Brain microvessel endothelial cells (BMEC) which form the blood-brain barrier (BBB) possess an amino acid carrier specific for large neutral amino acids (LNAA). The carrier is important for facilitating the delivery of nutrient LNAA's and centrally acting drugs that are LNAA's, to the brain. Bovine BMEC's were isolated and grown up to complete monolayers on regenerated cellulose-membranes in primary culture. To study the transendothelial transport of leucine, the monolayers were placed in a side-by-side diffusion cell, and transport across the monolayers followed with (/sup 3/H)-leucine. The transendothelial transport of leucine in this in vitro model was determined to be bidirectional, and time-, temperature-, and concentration-dependent. The transport of leucine was saturable and the apparent K/sub m/ and V/sub max/, 0.18 mM and 6.3 nmol/mg/min, respectively. Other LNAA's, including the centrally acting drugs, ..cap alpha..-methyldopa, L-DOPA, ..cap alpha..-methyl-tyrosine, and baclofen, inhibited leucine transport. The leucine carrier was also found to be stereospecific and not sensitive to inhibitors of active transport. These results are consistent with previous in vitro and in vivo studies. Primary cultures of BMEC's appear to be a potentially important tool for investigating at the cellular level, the transport mechanisms of the BBB.

  2. Reactive solute transport in acidic streams

    USGS Publications Warehouse

    Broshears, R.E.

    1996-01-01

    Spatial and temporal profiles of Ph and concentrations of toxic metals in streams affected by acid mine drainage are the result of the interplay of physical and biogeochemical processes. This paper describes a reactive solute transport model that provides a physically and thermodynamically quantitative interpretation of these profiles. The model combines a transport module that includes advection-dispersion and transient storage with a geochemical speciation module based on MINTEQA2. Input to the model includes stream hydrologic properties derived from tracer-dilution experiments, headwater and lateral inflow concentrations analyzed in field samples, and a thermodynamic database. Simulations reproduced the general features of steady-state patterns of observed pH and concentrations of aluminum and sulfate in St. Kevin Gulch, an acid mine drainage stream near Leadville, Colorado. These patterns were altered temporarily by injection of sodium carbonate into the stream. A transient simulation reproduced the observed effects of the base injection.

  3. Phosphorylation mechanisms in dopamine transporter regulation.

    PubMed

    Foster, James D; Vaughan, Roxanne A

    2016-11-09

    The dopamine transporter (DAT) is a plasma membrane phosphoprotein that actively translocates extracellular dopamine (DA) into presynaptic neurons. The transporter is the primary mechanism for control of DA levels and subsequent neurotransmission, and is the target for abused and therapeutic drugs that exert their effects by suppressing reuptake. The transport capacity of DAT is acutely regulated by signaling systems and drug exposure, providing neurons the ability to fine-tune DA clearance in response to specific conditions. Kinase pathways play major roles in these mechanisms, and this review summarizes the current status of DAT phosphorylation characteristics and the evidence linking transporter phosphorylation to control of reuptake and other functions. Greater understanding of these processes may aid in elucidation of their possible contributions to DA disease states and suggest specific phosphorylation sites as targets for therapeutic manipulation of reuptake.

  4. Polar auxin transport: models and mechanisms.

    PubMed

    van Berkel, Klaartje; de Boer, Rob J; Scheres, Ben; ten Tusscher, Kirsten

    2013-06-01

    Spatial patterns of the hormone auxin are important drivers of plant development. The observed feedback between the active, directed transport that generates auxin patterns and the auxin distribution that influences transport orientation has rendered this a popular subject for modelling studies. Here we propose a new mathematical framework for the analysis of polar auxin transport and present a detailed mathematical analysis of published models. We show that most models allow for self-organised patterning for similar biological assumptions, and find that the pattern generated is typically unidirectional, unless additional assumptions or mechanisms are incorporated. Our analysis thus suggests that current models cannot explain the bidirectional fountain-type patterns found in plant meristems in a fully self-organised manner, and we discuss future research directions to address the gaps in our understanding of auxin transport mechanisms.

  5. Respiratory fluid mechanics and transport processes.

    PubMed

    Grotberg, J B

    2001-01-01

    The field of respiratory flow and transport has experienced significant research activity over the past several years. Important contributions to the knowledge base come from pulmonary and critical care medicine, surgery, physiology, environmental health sciences, biophysics, and engineering. Several disciplines within engineering have strong and historical ties to respiration including mechanical, chemical, civil/environmental, aerospace and, of course, biomedical engineering. This review draws from a wide variety of scientific literature that reflects the diverse constituency and audience that respiratory science has developed. The subject areas covered include nasal flow and transport, airway gas flow, alternative modes of ventilation, nonrespiratory gas transport, aerosol transport, airway stability, mucus transport, pulmonary acoustics, surfactant dynamics and delivery, and pleural liquid flow. Within each area are a number of subtopics whose exploration can provide the opportunity of both depth and breadth for the interested reader.

  6. Molecular Mechanism of Biological Proton Transport

    SciTech Connect

    Pomes, R.

    1998-09-01

    Proton transport across lipid membranes is a fundamental aspect of biological energy transduction (metabolism). This function is mediated by a Grotthuss mechanism involving proton hopping along hydrogen-bonded networks embedded in membrane-spanning proteins. Using molecular simulations, the authors have explored the structural, dynamic, and thermodynamic properties giving rise to long-range proton translocation in hydrogen-bonded networks involving water molecules, or water wires, which are emerging as ubiquitous H{sup +}-transport devices in biological systems.

  7. Acid-base transport in pancreas—new challenges

    PubMed Central

    Novak, Ivana; Haanes, Kristian A.; Wang, Jing

    2013-01-01

    Along the gastrointestinal tract a number of epithelia contribute with acid or basic secretions in order to aid digestive processes. The stomach and pancreas are the most extreme examples of acid (H+) and base (HCO−3) transporters, respectively. Nevertheless, they share the same challenges of transporting acid and bases across epithelia and effectively regulating their intracellular pH. In this review, we will make use of comparative physiology to enlighten the cellular mechanisms of pancreatic HCO−3 and fluid secretion, which is still challenging physiologists. Some of the novel transporters to consider in pancreas are the proton pumps (H+-K+-ATPases), as well as the calcium-activated K+ and Cl− channels, such as KCa3.1 and TMEM16A/ANO1. Local regulators, such as purinergic signaling, fine-tune, and coordinate pancreatic secretion. Lastly, we speculate whether dys-regulation of acid-base transport contributes to pancreatic diseases including cystic fibrosis, pancreatitis, and cancer. PMID:24391597

  8. Regulation of the plasma amino acid profile by leucine via the system L amino acid transporter.

    PubMed

    Zhen, Hongmin; Nakamura, Koichi; Kitaura, Yasuyuki; Kadota, Yoshihiro; Ishikawa, Takuya; Kondo, Yusuke; Xu, Minjun; Shimomura, Yoshiharu

    2015-01-01

    Plasma concentrations of amino acids reflect the intracellular amino acid pool in mammals. However, the regulatory mechanism requires clarification. In this study, we examined the effect of leucine administration on plasma amino acid profiles in mice with and without the treatment of 2-aminobicyclo-(2,2,1)-heptane-2-carboxylic acid (BCH) or rapamycin as an inhibitor of system L or mammalian target of rapamycin complex 1, respectively. The elevation of plasma leucine concentration after leucine administration was associated with a significant decrease in the plasma concentrations of isoleucine, valine, methionine, phenylalanine, and tyrosine; BCH treatment almost completely blocked the leucine-induced decrease in plasma amino acid concentrations. Rapamycin treatment had much less effects on the actions of leucine than BCH treatment. These results suggest that leucine regulates the plasma concentrations of branched-chain amino acids, methionine, phenylalanine, and tyrosine, and that system L amino acid transporters are involved in the leucine action.

  9. Report membrane transport of lactic acid in the filamentous fungus Rhizopus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The fungus Rhizopus is frequently used for fermentative production of lactic acid, but little is known about the mechanisms or proteins for transporting this carboxylic acid. Since transport of the lactate anion across the plasma membrane is critical to prevent acidification of the cytoplasm, we ev...

  10. [Advances in plant anthocyanin transport mechanism].

    PubMed

    Wang, Lu; Dai, Silan; Jin, Xuehua; Huang, He; Hong, Yan

    2014-06-01

    Anthocyanin biosynthesis is one of the thoroughly studied enzymatic pathways in biology, but little is known about the molecular mechanisms of its final stage: the transport of the anthocyanins into the vacuole. A clear picture of the dynamic trafficking of flavonoids is only now beginning to emerge. So far four different models have been proposed to explain the transport of anthocyanins from biosynthetic sites to the central vacuole, and four types of transporters have been found associated with the transport of anthocyanins: glutathione S-transferase, multidrug resistance-associated protein, multidrug and toxic compound extrusion, bilitranslocase-homologue. The functions of these proteins and related genes have also been studied. Although different models have been proposed, cellular and subcellular information is still lacking for reconciliation of different lines of evidence in various anthocyanin sequestration studies. According to the information available, through sequence analysis, gene expression analysis, subcellular positioning and complementation experiments, the function and location of these transporters can be explored, and the anthocyanin transport mechanism can be better understood.

  11. Modeling Transport and Flow Regulatory Mechanisms of the Kidney

    PubMed Central

    Layton, Anita T.

    2013-01-01

    The kidney plays an indispensable role in the regulation of whole-organism water balance, electrolyte balance, and acid-base balance, and in the excretion of metabolic wastes and toxins. In this paper, we review representative mathematical models that have been developed to better understand kidney physiology and pathophysiology, including the regulation of glomerular filtration, the regulation of renal blood flow by means of the tubuloglomerular feedback mechanisms and of the myogenic mechanism, the urine concentrating mechanism, and regulation of renal oxygen transport. We discuss how such modeling efforts have significantly expanded our understanding of renal function in both health and disease. PMID:23914303

  12. Energy coupling mechanisms of MFS transporters

    PubMed Central

    Zhang, Xuejun C; Zhao, Yan; Heng, Jie; Jiang, Daohua

    2015-01-01

    Major facilitator superfamily (MFS) is a large class of secondary active transporters widely expressed across all life kingdoms. Although a common 12-transmembrane helix-bundle architecture is found in most MFS crystal structures available, a common mechanism of energy coupling remains to be elucidated. Here, we discuss several models for energy-coupling in the transport process of the transporters, largely based on currently available structures and the results of their biochemical analyses. Special attention is paid to the interaction between protonation and the negative-inside membrane potential. Also, functional roles of the conserved sequence motifs are discussed in the context of the 3D structures. We anticipate that in the near future, a unified picture of the functions of MFS transporters will emerge from the insights gained from studies of the common architectures and conserved motifs. PMID:26234418

  13. Comparative physiology of renal tubular transport mechanisms.

    PubMed Central

    Long, S.; Giebisch, G.

    1979-01-01

    This manuscript discusses current concepts of glomerular filtration and tubular transport of sodium, water, potassium, and urinary acidification by vertebrate kidneys in a comparative context. Work in mammalian and amphibian nephrons receives major emphasis due to our interest in application of new techniques for investigation of cellular mechanisms; when available, data from other vertebrate classes are discussed. Images FIG. 3 PMID:395765

  14. MECHANISM OF GLUCOSE TRANSPORT ACROSS THE YEAST CELL MEMBRANE

    PubMed Central

    Cirillo, Vincent P.

    1962-01-01

    Cirillo, Vincent P. (Seton Hall College of Medicine and Dentistry, Jersey City, N.J.). Mechanism of glucose transport across the yeast cell membrane. J. Bacteriol. 84:485–491. 1962.—The kinetics of d-glucose and l-sorbose transport was studied in Saccharomyces cerevisiae inhibited with iodoacetic acid under nitrogen to prevent glucose metabolism. d-Glucose was found to compete with l-sorbose for a common membrane transport system with an apparent affinity greater than 25 times that of sorbose. A comparison of the net rate of glucose and sorbose transport at 50 and 500 mm external concentration showed that glucose transport is greater than that of sorbose from the lower concentration, but sorbose transport is greater than glucose at the higher concentration. This reversal of transport rate of two sugars with markedly different affinities is predicted by the membrane carrier theory. A further prediction of carrier theory was confirmed by the demonstration that the rate of glucose transport into fructose-loaded cells is greater than into unloaded cells. PMID:14021412

  15. Amino Acid Transport in Mycobacterium smegmatis

    PubMed Central

    Yabu, Kunihiko

    1970-01-01

    The transport of d-alanine, d-glutamic acid, and d-valine in Mycobacterium smegmatis was compared quantitatively with that of their l-isomers. It appeared that the uptake of d-alanine was mediated by an active process displaying saturation kinetics characteristic of enzyme function, whereas the uptake of d-glutamic acid was accomplished by a passive process showing diffusion kinetics. Both processes were involved in the uptake of l-alanine, l-glutamic acid, d-valine, and l-valine. d-Valine competed with l-valine for entry into the cell through a single active process. d-Alanine and l-alanine also utilized the same active process, but the d-isomer could not enter the cell through the passive process. The passive process exhibited characteristics of diffusion, but was sensitive to sulfhydryl-blocking reagents and showed competition among structurally related amino acids. These last findings suggested that the passive process is a facilitated diffusion. PMID:5437732

  16. Fatty acid transport and activation and the expression patterns of genes involved in fatty acid trafficking.

    PubMed

    Sandoval, Angel; Fraisl, Peter; Arias-Barrau, Elsa; Dirusso, Concetta C; Singer, Diane; Sealls, Whitney; Black, Paul N

    2008-09-15

    These studies defined the expression patterns of genes involved in fatty acid transport, activation and trafficking using quantitative PCR (qPCR) and established the kinetic constants of fatty acid transport in an effort to define whether vectorial acylation represents a common mechanism in different cell types (3T3-L1 fibroblasts and adipocytes, Caco-2 and HepG2 cells and three endothelial cell lines (b-END3, HAEC, and HMEC)). As expected, fatty acid transport protein (FATP)1 and long-chain acyl CoA synthetase (Acsl)1 were the predominant isoforms expressed in adipocytes consistent with their roles in the transport and activation of exogenous fatty acids destined for storage in the form of triglycerides. In cells involved in fatty acid processing including Caco-2 (intestinal-like) and HepG2 (liver-like), FATP2 was the predominant isoform. The patterns of Acsl expression were distinct between these two cell types with Acsl3 and Acsl5 being predominant in Caco-2 cells and Acsl4 in HepG2 cells. In the endothelial lines, FATP1 and FATP4 were the most highly expressed isoforms; the expression patterns for the different Acsl isoforms were highly variable between the different endothelial cell lines. The transport of the fluorescent long-chain fatty acid C(1)-BODIPY-C(12) in 3T3-L1 fibroblasts and 3T3-L1 adipocytes followed typical Michaelis-Menten kinetics; the apparent efficiency (k(cat)/K(T)) of this process increases over 2-fold (2.1 x 10(6)-4.5 x 10(6)s(-1)M(-1)) upon adipocyte differentiation. The V(max) values for fatty acid transport in Caco-2 and HepG2 cells were essentially the same, yet the efficiency was 55% higher in Caco-2 cells (2.3 x 10(6)s(-1)M(-1) versus 1.5 x 10(6)s(-1)M(-1)). The kinetic parameters for fatty acid transport in three endothelial cell types demonstrated they were the least efficient cell types for this process giving V(max) values that were nearly 4-fold lower than those defined form 3T3-L1 adipocytes, Caco-2 cells and HepG2 cells. The

  17. Endothelium as a gatekeeper of fatty acid transport

    PubMed Central

    Mehrotra, Devi; Wu, Jingxia; Papangeli, Irinna; Chun, Hyung J.

    2013-01-01

    The endothelium transcends all clinical disciplines and is key to the function of every organ system. A crucial, but poorly understood role of the endothelium is its ability to control the transport of energy supply according to organ needs. Fatty acids (FAs) in particular represent a key energy source that is utilized by a number of tissues, but whose utilization must be tightly regulated to avoid potentially deleterious consequences of excess accumulation, including insulin resistance. Recent studies have identified key endothelial signaling mechanisms involving vascular endothelial growth factor B, peroxisome proliferator-activated receptor-γ, and the peptide ligand apelin, that are critical to endothelial regulation of FA transport. Here we discuss the mechanisms by which these signaling pathways regulate this key endothelial function. PMID:24315207

  18. Functional transformations of bile acid transporters induced by high-affinity macromolecules

    PubMed Central

    Al-Hilal, Taslim A.; Chung, Seung Woo; Alam, Farzana; Park, Jooho; Lee, Kyung Eun; Jeon, Hyesung; Kim, Kwangmeyung; Kwon, Ick Chan; Kim, In-San; Kim, Sang Yoon; Byun, Youngro

    2014-01-01

    Apical sodium-dependent bile acid transporters (ASBT) are the intestinal transporters that form intermediate complexes with substrates and its conformational change drives the movement of substrates across the cell membrane. However, membrane-based intestinal transporters are confined to the transport of only small molecular substrates. Here, we propose a new strategy that uses high-affinity binding macromolecular substrates to functionally transform the membrane transporters so that they behave like receptors, ultimately allowing the apical-basal transport of bound macromolecules. Bile acid based macromolecular substrates were synthesized and allowed to interact with ASBT. ASBT/macromolecular substrate complexes were rapidly internalized in vesicles, localized in early endosomes, dissociated and escaped the vesicular transport while binding of cytoplasmic ileal bile acid binding proteins cause exocytosis of macromolecules and prevented entry into lysosomes. This newly found transformation process of ASBT suggests a new transport mechanism that could aid in further utilization of ASBT to mediate oral macromolecular drug delivery. PMID:24566561

  19. Inorganic nanoparticles as nucleic acid transporters into eukaryotic cells

    NASA Astrophysics Data System (ADS)

    Amirkhanov, R. N.; Zarytova, V. F.; Zenkova, M. A.

    2017-02-01

    The review is concerned with inorganic nanoparticles (gold, titanium dioxide, silica, iron oxides, calcium phosphate) used as nucleic acid transporters into mammalian cells. Methods for the synthesis of nanoparticles and approaches to surface modification through covalent or noncovalent attachment of low- or high-molecular-weight compounds are considered. The data available from the literature on biological action of nucleic acids delivered into the cells by nanoparticles and on the effect of nanoparticles and their conjugates and complexes on the cell survival are summarized. Pathways of cellular internalization of nanoparticles and the mechanism of their excretion, as well as the ways of release of nucleic acids from their complexes with nanoparticles after the cellular uptake are described. The bibliography includes 161 references.

  20. How LeuT shapes our understanding of the mechanisms of sodium-coupled neurotransmitter transporters.

    PubMed

    Penmatsa, Aravind; Gouaux, Eric

    2014-03-01

    Neurotransmitter transporters are ion-coupled symporters that drive the uptake of neurotransmitters from neural synapses. In the past decade, the structure of a bacterial amino acid transporter, leucine transporter (LeuT), has given valuable insights into the understanding of architecture and mechanism of mammalian neurotransmitter transporters. Different conformations of LeuT, including a substrate-free state, inward-open state, and competitive and non-competitive inhibitor-bound states, have revealed a mechanistic framework for the transport and transport inhibition of neurotransmitters. The current review integrates our understanding of the mechanistic and pharmacological properties of eukaryotic neurotransmitter transporters obtained through structural snapshots of LeuT.

  1. Transport of Aromatic Amino Acids by Pseudomonas aeruginosa

    PubMed Central

    Kay, W. W.; Gronlund, Audrey F.

    1971-01-01

    Kinetic studies of the transport of aromatic amino acids by Pseudomonas aeruginosa revealed the existence of two high-affinity transport systems which recognized the three aromatic amino acids. From competition data and studies on the exchange of preformed aromatic amino acid pools, the first transport system was found to be functional with phenylalanine, tyrosine, and tryptophan (in order of decreasing activity), whereas the second system was active with tryptophan, phenylalanine, and tyrosine. The two systems also transported a number of aromatic amino acid analogues but not other amino acids. Mutants defective in each of the two and in both transport systems were isolated and described. When the amino acids were added at low external concentrations to cells growing logarithmically in glucose minimal medium, the tryptophan pool very quickly became saturated. Under identical conditions, phenylalanine and tyrosine each accumulated in the intracellular pool of P. aeruginosa at a concentration which was 10 times greater than that of tryptophan. PMID:4994029

  2. Molecular mechanisms for proton transport in membranes.

    PubMed Central

    Nagle, J F; Morowitz, H J

    1978-01-01

    Likely mechanisms for proton transport through biomembranes are explored. The fundamental structural element is assumed to be continuous chains of hydrogen bonds formed from the protein side groups, and a molecular example is presented. From studies in ice, such chains are predicted to have low impedance and can function as proton wires. In addition, conformational changes in the protein may be linked to the proton conduction. If this possibility is allowed, a simple proton pump can be described that can be reversed into a molecular motor driven by an electrochemical potential across the membrane. PMID:272644

  3. Transport of malic acid and other dicarboxylic acids in the yeast Hansenula anomala.

    PubMed

    Côrte-Real, M; Leão, C

    1990-04-01

    DL-Malic acid-grown cells of the yeast Hansenula anomala formed a saturable transport system that mediated accumulative transport of L-malic acid with the following kinetic parameters at pH 5.0: Vmax, 0.20 nmol.s-1.mg (dry weight)-1; Km, 0.076 mM L-malate. Uptake of malic acid was accompanied by proton disappearance from the external medium with rates that followed Michaelis-Menten kinetics as a function of malic acid concentration. Fumaric acid, alpha-ketoglutaric acid, oxaloacetic acid, D-malic acid, and L-malic acid were competitive inhibitors of succinic acid transport, and all induced proton movements that followed Michaelis-Menten kinetics, suggesting that all of these dicarboxylates used the same transport system. Maleic acid, malonic acid, oxalic acid, and L-(+)-tartaric acid, as well as other Krebs cycle acids such as citric and isocitric acids, were not accepted by the malate transport system. Km measurements as a function of pH suggested that the anionic forms of the acids were transported by an accumulative dicarboxylate proton symporter. The accumulation ratio at pH 5.0 was about 40. The malate system was inducible and was subject to glucose repression. Undissociated succinic acid entered the cells slowly by simple diffusion. The permeability of the cells by undissociated acid increased with pH, with the diffusion constant increasing 100-fold between pH 3.0 and 6.0.

  4. Transport of two naphthoic acids and salicylic acid in soil: experimental study and empirical modeling.

    PubMed

    Hanna, K; Lassabatere, L; Bechet, B

    2012-09-15

    In contrast to the parent compounds, the mechanisms responsible for the transport of natural metabolites of polycyclic aromatic hydrocarbons (PAH) in contaminated soils have been scarcely investigated. In this study, the sorption of three aromatic acids (1-naphthoic acid (NA), 1-hydroxy-2-naphthoic acid (HNA) and salicylic acid (SA)) was examined on soil, in a batch equilibrium single-system, with varying pH and acid concentrations. Continuous flow experiments were also carried out under steady-state water flow. The adsorption behavior of naphthoic and benzoic acids was affected by ligand functionality and molecular structure. All modeling options (equilibrium, chemical nonequilibrium, i.e. chemical kinetics, physical nonequilibrium, i.e. surface sites in the immobile water fraction, and both chemical and physical nonequilibrium) were tested in order to describe the breakthrough behavior of organic compounds in homogeneously packed soil columns. Tracer experiments showed a small fractionation of flow into mobile and immobile compartments, and the related hydrodynamic parameters were used for the modeling of reactive transport. In all cases, the isotherm parameters obtained from column tests differed from those derived from the batch experiments. The best accurate modeling was obtained considering nonequilibrium for the three organic compounds. Both chemical and physical nonequilibrium led to appropriate modeling for HNA and NA, while chemical nonequilibrium was the sole option for SA. SA sorption occurs mainly in mobile water and results from the concomitancy of instantaneous and kinetically limited sites. For all organic compounds, retention is contact condition dependent and differs between batch and column experiments. Such results show that preponderant mechanisms are solute dependent and kinetically limited, which has important implications for the fate and transport of carboxylated aromatic compounds in contaminated soils.

  5. The Mechanism of 5-Methyltetrahydrofolate Transport by Human Erythrocytes

    PubMed Central

    Branda, Richard F.; Anthony, Bruce K.; Jacob, Harry S.

    1978-01-01

    The mechanism involved in 5-methyltetrahydrofolate uptake by human cells is poorly understood. To more clearly elucidate this physiologically important process, transport of the vitamin was studied in human erythrocytes. 5-methyltetrahydrofolate uptake was found to increase with reticulocytosis, but measurable incorporation occurred in erythrocyte suspensions depleted of reticulocytes, leukocytes, and platelets, indicating uptake by mature erythrocytes. Incubation of erythrocytes with increasing concentrations of [14C]5-methyltetrahydrofolate resulted in increasing uptake but decreasing percentage incorporation, consistent with saturation of a carrier system. Both influx and efflux phases of uptake were temperature dependent, with almost no transport at 4°C. Uptake of [14C]5-methytetrahydrofolate was effectively inhibited by unlabeled 5-methyltetrahydrofolate, 5-formyltetrahydrofolate, and methotrexate, but not by pteroylglutamic acid. Prior incubation with 5-formyltetrahydrofolate increased uptake of [14C]5-methyltetrahydrofolate, and extracellular 5-formyltetrahydrofolate enhanced efflux of [14C]5-methyltetrahydrofolate. Nearly total depletion of ATP increased uptake of [14C]5-methyltetrahydrofolate, but efflux was unchanged. Column chromatography of membrane-free hemolysate after incubation with [14C]5-methyltetrahydrofolate showed 95% of radioactivity corresponded to marker radioisotope, and no other peak was noted. Thus peripheral erythrocytes incorporate 5-methyltetrahydrofolate by a saturable, temperature-dependent, substrate-specific process which is influenced by counter-transport. This mechanism is qualitatively similar to the carrier-mediated transport of folate compounds previously described in other cell types. Therefore, human erythrocytes should be useful for detailed characterization of this membrane carrier system. PMID:659590

  6. Mechanism for alternating access in neurotransmitter transporters.

    PubMed

    Forrest, Lucy R; Zhang, Yuan-Wei; Jacobs, Miriam T; Gesmonde, Joan; Xie, Li; Honig, Barry H; Rudnick, Gary

    2008-07-29

    Crystal structures of LeuT, a bacterial homologue of mammalian neurotransmitter transporters, show a molecule of bound substrate that is essentially exposed to the extracellular space but occluded from the cytoplasm. Thus, there must exist an alternate conformation for LeuT in which the substrate is accessible to the cytoplasm and a corresponding mechanism that switches accessibility from one side of the membrane to the other. Here, we identify the cytoplasmic accessibility pathway of the alternate conformation in a mammalian serotonin transporter (SERT) (a member of the same transporter family as LeuT). We also propose a model for the cytoplasmic-facing state that exploits the internal pseudosymmetry observed in the crystal structure. LeuT contains two structurally similar repeats (TMs1-5 and TMs 6-10) that are inverted with respect to the plane of the membrane. The conformational differences between them result in the formation of the extracellular pathway. Our model for the cytoplasm-facing state exchanges the conformations of the two repeats and thus exposes the substrate and ion-binding sites to the cytoplasm. The conformational change that connects the two states primarily involves the tilting of a 4-helix bundle composed of transmembrane helices 1, 2, 6, and 7. Switching the tilt angle of this bundle is essentially equivalent to switching the conformation of the two repeats. Extensive mutagenesis of SERT and accessibility measurements, using cysteine reagents, are accommodated by our model. These observations may be of relevance to other transporter families, many of which contain internal inverted repeats.

  7. Drug Transport Mechanism of Oral Antidiabetic Nanomedicines

    PubMed Central

    Gundogdu, Evren; Yurdasiper, Aysu

    2014-01-01

    Context: Over the last few decades, extensive efforts have been made worldwide to develop nanomedicine delivery systems, especially via oral route for antidiabetic drugs. Absorption of insulin is hindered by epithelial cells of gastrointestinal tract, acidic gastric pH and digestive enzymes. Evidence Acquisition: Recent reports have identified and explained the beneficial role of several structural molecules like mucoadhesive polymers (polyacrylic acid, sodium alginate, chitosan) and other copolymers for the efficient transport and release of insulin to its receptors. Results: Insulin nanomedicines based on alginate-dextran sulfate core with a chitosan-polyethylene glycol-albumin shell reduced glycaemia in a dose dependent manner. Orally available exendin-4 formulations exerted their effects in a time dependent manner. Insulin nanoparticles formed by using alginate and dextran sulfate nucleating around calcium and binding to poloxamer, stabilized by chitosan, and subsequently coated with albumin showed a threefold increase of the hypoglycemic effect in comparison to free insulin in animal models. Solid lipid nanoparticles showed an enhancement of the bioavailability of repaglinide (RG) within optimized solid lipid nanoparticle formulations when compared with RG alone. Conclusions: Nanoparticles represent multiparticulate delivery systems designed to obtain prolonged or controlled drug delivery and to improve bioavailability as well as stability. Nanoparticles can also offer advantages like limiting fluctuations within therapeutic range, reducing side effects, protecting drugs from degradation, decreasing dosing frequency, and improving patient compliance and convenience PMID:24696697

  8. Structural Determinants for Transport Across the Intestinal Bile Acid Transporter Using C-24 Bile Acid Conjugates

    PubMed Central

    Rais, Rana; Acharya, Chayan; MacKerell, Alexander D.; Polli, James E.

    2010-01-01

    The human apical sodium dependent bile acid transporter (hASBT) re-absorbs gram quantities of bile acid daily and is a potential prodrug target to increase oral drug absorption. In the absence of a high resolution hASBT crystal structure, 3D-QSAR modeling may prove beneficial in designing prodrug targets to hASBT. The objective was to derive a conformationally sampled pharmacophore 3D–QSAR (CSP-SAR) model for the uptake of bile acid conjugates by hASBT. A series of bile acid conjugates of glutamyl chenodeoxycholate were evaluated in terms of Km and normalized Vmax(normVmax) using hASBT-MDCK cells. All mono-anionic conjugates were potent substrates. Dianions, cations and zwitterions, which bound with a high affinity, were not substrates. CSP-SAR models were derived using structural and physicochemical descriptors, and evaluated via cross-validation. The best CSP-SAR model for Km included two structural and two physiochemical descriptors, where substrate hydrophobicity enhanced affinity. A best CSP-SAR model for Km/normVmax employed one structural and three physicochemical descriptors, also indicating hydrophobicity enhanced efficiency. Overall, the bile acid C-24 region accommodated a range of substituted anilines, provided a single negative charge was present near C-24. In comparing uptake findings to prior inhibition results, increased hydrophobicity enhanced activity, with dianions and zwitterions hindering activity. PMID:20939504

  9. Ascorbic acid transport and accumulation in human neutrophils

    SciTech Connect

    Washko, P.; Rotrosen, D.; Levine, M. )

    1989-11-15

    The transport, accumulation, and distribution of ascorbic acid were investigated in isolated human neutrophils utilizing a new ascorbic acid assay, which combined the techniques of high performance liquid chromatography and coulometric electrochemical detection. Freshly isolated human neutrophils contained 1.0-1.4 mM ascorbic acid, which was localized greater than or equal to 94% to the cytosol, was not protein bound, and was present only as ascorbic acid and not as dehydroascorbic acid. Upon addition of ascorbic acid to the extracellular medium in physiologic amounts, ascorbic acid was accumulated in neutrophils in millimolar concentrations. Accumulation was mediated by a high affinity and a low affinity transporter; both transporters were responsible for maintenance of concentration gradients as large as 50-fold. The high affinity transporter had an apparent Km of 2-5 microns by Lineweaver-Burk and Eadie-Hofstee analyses, and the low affinity transporter had an apparent Km of 6-7 mM by similar analyses. Each transporter was saturable and temperature dependent. In normal human blood the high affinity transporter should be saturated, whereas the low affinity transporter should be in its linear phase of uptake.

  10. Differential regulation of placental amino acid transport by saturated and unsaturated fatty acids.

    PubMed

    Lager, Susanne; Jansson, Thomas; Powell, Theresa L

    2014-10-15

    Fatty acids are critical for normal fetal development but may also influence placental function. We have previously reported that oleic acid (OA) stimulates amino acid transport in primary human trophoblasts (PHTs). In other tissues, saturated and unsaturated fatty acids have distinct effects on cellular signaling, for instance, palmitic acid (PA) but not OA reduces IκBα expression. We hypothesized that saturated and unsaturated fatty acids differentially affect trophoblast amino acid transport and cellular signaling. To test this hypothesis, PHTs were cultured in docosahexaenoic acid (DHA; 50 μM), OA (100 μM), or PA (100 μM). DHA and OA were also combined to test whether DHA could counteract the OA stimulatory effect on amino acid transport. The effects of fatty acids were compared against a vehicle control. Amino acid transport was measured by isotope-labeled tracers. Activation of inflammatory-related signaling pathways and the mechanistic target of rapamycin (mTOR) pathway were determined by Western blot analysis. Exposure of PHTs to DHA for 24 h reduced amino acid transport and phosphorylation of p38 MAPK, STAT3, mTOR, eukaryotic initiation factor 4E-binding protein 1, and ribosomal protein (rp)S6. In contrast, OA increased amino acid transport and phosphorylation of ERK, mTOR, S6 kinase 1, and rpS6. The combination of DHA with OA increased amino acid transport and rpS6 phosphorylation. PA did not affect amino acid transport but reduced IκBα expression. In conclusion, these fatty acids differentially regulated placental amino acid transport and cellular signaling. Taken together, these findings suggest that dietary fatty acids could alter the intrauterine environment by modifying placental function, thereby having long-lasting effects on the developing fetus.

  11. Transport Mechanisms in Dielectric Optical Microcavities

    NASA Astrophysics Data System (ADS)

    Painchaud-April, G.; Poirier, J.; Dubé, L. J.

    2008-05-01

    Optical 2D microcavities have become a source of promising new technologies over the last decades. Applications ranging from high accuracy spectrometry to laser design will benefit from the development of such devices. The versatility of the concept resides in the ray-wave correspondence [1, 2]: the short wavelength limit of the system exhibits properties of well-known billiard systems, which may include Hamiltonian chaos. Therefore, since the wave behaviour of an optical microcavity is influenced by the underlying phase-space structure, a study and characterization of this structure becomes important to predict where the electromagnetic energy will flow out of the cavity. Whereas the correspondence works reasonably well for regular (classically integrable) and completely chaotic systems, partially chaotic systems of mixed phase space show transport properties largely influenced by tunnelling and localization effects with the consequence that the correspondence is all but lost. We will present the results of our investigations, in the ray and wave dynamics, in order to shed some light on the collaborating influence of the different transport mechanisms. [1] H. G. L. Schwefel et al., J. Opt. Soc. Am. B21, 923--934 (2004). [2] J. Wiersig and M. Hentschel, Phys. Rev. Lett, 100, 033901 (2008).

  12. Amino-acid transporters in T-cell activation and differentiation.

    PubMed

    Ren, W; Liu, G; Yin, J; Tan, B; Wu, G; Bazer, F W; Peng, Y; Yin, Y

    2017-03-02

    T-cell-mediated immune responses aim to protect mammals against cancers and infections, and are also involved in the pathogenesis of various inflammatory or autoimmune diseases. Cellular uptake and the utilization of nutrients is closely related to the T-cell fate decision and function. Research in this area has yielded surprising findings in the importance of amino-acid transporters for T-cell development, homeostasis, activation, differentiation and memory. In this review, we present current information on amino-acid transporters, such as LAT1 (l-leucine transporter), ASCT2 (l-glutamine transporter) and GAT-1 (γ-aminobutyric acid transporter-1), which are critically important for mediating peripheral naive T-cell homeostasis, activation and differentiation, especially for Th1 and Th17 cells, and even memory T cells. Mechanically, the influence of amino-acid transporters on T-cell fate decision may largely depend on the mechanistic target of rapamycin complex 1 (mTORC1) signaling. These discoveries remarkably demonstrate the role of amino-acid transporters in T-cell fate determination, and strongly indicate that manipulation of the amino-acid transporter-mTORC1 axis could ameliorate many inflammatory or autoimmune diseases associated with T-cell-based immune responses.

  13. Ligands targeting the excitatory amino acid transporters (EAATs).

    PubMed

    Dunlop, John; Butera, John A

    2006-01-01

    This review provides an overview of ligands for the excitatory amino acid transporters (EAATs), a family of high-affinity glutamate transporters localized to the plasma membrane of neurons and astroglial cells. Ligand development from the perspective of identifying novel and more selective tools for elucidating transporter subtype function, and the potential of transporter ligands in a therapeutic setting are discussed. Acute pharmacological modulation of EAAT activity in the form of linear and conformationally restricted glutamate and aspartate analogs is presented, in addition to recent strategies aimed more toward modulating transporter expression levels, the latter of particular significance to the development of transporter based therapeutics.

  14. Flavonoid transport mechanisms: how to go, and with whom.

    PubMed

    Zhao, Jian

    2015-09-01

    Subcellular flavonoid transport and its underlying regulatory mechanisms are still poorly understood, but are fascinating research frontiers in plant science. Recent studies support and further extend previous hypotheses indicating that vacuolar sequestration of flavonoids involves vesicle trafficking, membrane transporters, and glutathione S-transferase (GST). However, the question remains to be addressed of how three distinct but nonexclusive mechanisms are functionally integrated into diverse but redundant transport routes for vacuolar sequestration or extracellular secretion of flavonoids. In this review, I highlight recent progress in understanding flavonoid-transporting vesicle behavior and properties, GST and membrane transporter functions and mechanisms, and flavonoid transport substrate specificity and preference.

  15. Expression pattern of peptide and amino acid genes in digestive tract of transporter juvenile turbot ( Scophthalmus maximus L.)

    NASA Astrophysics Data System (ADS)

    Xu, Dandan; He, Gen; Mai, Kangsen; Zhou, Huihui; Xu, Wei; Song, Fei

    2016-04-01

    Turbot ( Scophthalmus maximus L.), a carnivorous fish species with high dietary protein requirement, was chosen to examine the expression pattern of peptide and amino acid transporter genes along its digestive tract which was divided into six segments including stomach, pyloric caeca, rectum, and three equal parts of the remainder of the intestine. The results showed that the expression of two peptide and eleven amino acid transporters genes exhibited distinct patterns. Peptide transporter 1 (PepT1) was rich in proximal intestine while peptide transporter 2 (PepT2) was abundant in distal intestine. A number of neutral and cationic amino acid transporters expressed richly in whole intestine including B0-type amino acid transporter 1 (B0AT1), L-type amino acid transporter 2 (LAT2), T-type amino acid transporter 1 (TAT1), proton-coupled amino acid transporter 1 (PAT1), y+L-type amino acid transporter 1 (y+LAT1), and cationic amino acid transporter 2 (CAT2) while ASC amino acid transporter 2 (ASCT2), sodium-coupled neutral amino acid transporter 2 (SNAT2), and y+L-type amino acid transporter 2 (y+LAT2) abundantly expressed in stomach. In addition, system b0,+ transporters (rBAT and b0,+AT) existed richly in distal intestine. These findings comprehensively characterized the distribution of solute carrier family proteins, which revealed the relative importance of peptide and amino acid absorption through luminal membrane. Our findings are helpful to understand the mechanism of the utilization of dietary protein in fish with a short digestive tract.

  16. Overview on mechanisms of acetic acid resistance in acetic acid bacteria.

    PubMed

    Wang, Bin; Shao, Yanchun; Chen, Fusheng

    2015-02-01

    Acetic acid bacteria (AAB) are a group of gram-negative or gram-variable bacteria which possess an obligate aerobic property with oxygen as the terminal electron acceptor, meanwhile transform ethanol and sugar to corresponding aldehydes, ketones and organic acids. Since the first genus Acetobacter of AAB was established in 1898, 16 AAB genera have been recorded so far. As the main producer of a world-wide condiment, vinegar, AAB have evolved an elegant adaptive system that enables them to survive and produce a high concentration of acetic acid. Some researches and reviews focused on mechanisms of acid resistance in enteric bacteria and made the mechanisms thoroughly understood, while a few investigations did in AAB. As the related technologies with proteome, transcriptome and genome were rapidly developed and applied to AAB research, some plausible mechanisms conferring acetic acid resistance in some AAB strains have been published. In this review, the related mechanisms of AAB against acetic acid with acetic acid assimilation, transportation systems, cell morphology and membrane compositions, adaptation response, and fermentation conditions will be described. Finally, a framework for future research for anti-acid AAB will be provided.

  17. Identification of a novel sialic acid transporter in Haemophilus ducreyi.

    PubMed

    Post, Deborah M B; Mungur, Rachna; Gibson, Bradford W; Munson, Robert S

    2005-10-01

    Haemophilus ducreyi, the causative agent of chancroid, produces a lipooligosaccharide (LOS) which terminates in N-acetyllactosamine. This glycoform can be further extended by the addition of a single sialic acid residue to the terminal galactose moiety. H. ducreyi does not synthesize sialic acid, which must be acquired from the host during infection or from the culture medium when the bacteria are grown in vitro. However, H. ducreyi does not have genes that are highly homologous to the genes encoding known bacterial sialic acid transporters. In this study, we identified the sialic acid transporter by screening strains in a library of random transposon mutants for those mutants that were unable to add sialic acid to N-acetyllactosamine-containing LOS. Mutants that reacted with the monoclonal antibody 3F11, which recognizes the terminal lactosamine structure, and lacked reactivity with the lectin Maackia amurensis agglutinin, which recognizes alpha2,3-linked sialic acid, were further characterized to demonstrate that they produced a N-acetyllactosamine-containing LOS by silver-stained sodium dodecyl sulfate-polyacrylamide gel electrophoresis and mass spectrometric analyses. The genes interrupted in these mutants were mapped to a four-gene cluster with similarity to genes encoding bacterial ABC transporters. Uptake assays using radiolabeled sialic acid confirmed that the mutants were unable to transport sialic acid. This study is the first report of bacteria using an ABC transporter for sialic acid uptake.

  18. Ammonia Transporters and Their Role in Acid-Base Balance.

    PubMed

    Weiner, I David; Verlander, Jill W

    2017-04-01

    Acid-base homeostasis is critical to maintenance of normal health. Renal ammonia excretion is the quantitatively predominant component of renal net acid excretion, both under basal conditions and in response to acid-base disturbances. Although titratable acid excretion also contributes to renal net acid excretion, the quantitative contribution of titratable acid excretion is less than that of ammonia under basal conditions and is only a minor component of the adaptive response to acid-base disturbances. In contrast to other urinary solutes, ammonia is produced in the kidney and then is selectively transported either into the urine or the renal vein. The proportion of ammonia that the kidney produces that is excreted in the urine varies dramatically in response to physiological stimuli, and only urinary ammonia excretion contributes to acid-base homeostasis. As a result, selective and regulated renal ammonia transport by renal epithelial cells is central to acid-base homeostasis. Both molecular forms of ammonia, NH3 and NH4(+), are transported by specific proteins, and regulation of these transport processes determines the eventual fate of the ammonia produced. In this review, we discuss these issues, and then discuss in detail the specific proteins involved in renal epithelial cell ammonia transport.

  19. Inactivation of the glutamine/amino acid transporter ASCT2 by 1,2,3-dithiazoles: proteoliposomes as a tool to gain insights in the molecular mechanism of action and of antitumor activity

    SciTech Connect

    Oppedisano, Francesca; Catto, Marco; Koutentis, Panayiotis A.; Nicolotti, Orazio; Pochini, Lorena; Koyioni, Maria; Introcaso, Antonellina; Michaelidou, Sophia S.; Carotti, Angelo; Indiveri, Cesare

    2012-11-15

    The ASCT2 transport system catalyses a sodium-dependent antiport of glutamine and other neutral amino acids which is involved in amino acid metabolism. A library of 1,2,3-dithiazoles was designed, synthesized and evaluated as inhibitors of the glutamine/amino acid ASCT2 transporter in the model system of proteoliposomes reconstituted with the rat liver transporter. Fifteen of the tested compounds at concentration of 20 μM or below, inhibited more than 50% the glutamine/glutamine antiport catalysed by the reconstituted transporter. These good inhibitors bear a phenyl ring with electron withdrawing substituents. The inhibition was reversed by 1,4-dithioerythritol indicating that the effect was likely owed to the formation of mixed sulfides with the protein's Cys residue(s). A dose–response analysis of the most active compounds gave IC{sub 50} values in the range of 3–30 μM. Kinetic inhibition studies indicated a non-competitive inhibition, presumably because of a potential covalent interaction of the dithiazoles with cysteine thiol groups that are not located at the substrate binding site. Indeed, computational studies using a homology structural model of ASCT2 transporter, suggested as possible binding targets, Cys-207 or Cys-210, that belong to the CXXC motif of the protein. -- Highlights: ► Non‐competitive inhibition of ASCT2 by 1,2,3-dithiazoles was studied in proteoliposomes. ► Different 1,2,3-dithiazoles were synthesized and evaluated as transporter inhibitors. ► Many compounds potently inhibited the glutamine/glutamine antiport catalyzed by ASCT2. ► The inhibition was reversed by DTE indicating reaction with protein Cys. ► The most active compounds gave IC{sub 50} in the range of 3–30 μM.

  20. Molecular mechanism(s) involved in differential expression of vitamin C transporters along the intestinal tract.

    PubMed

    Subramanian, Veedamali S; Srinivasan, Padmanabhan; Wildman, Alexis J; Marchant, Jonathan S; Said, Hamid M

    2017-04-01

    Mammalian cells utilize two transporters for the uptake of ascorbic acid (AA), Na(+)-dependent vitamin C transporter SVCT-1 and SVCT-2. In the intestine, these transporters are involved in AA absorption and are expressed at the apical and basolateral membrane domains of the polarized epithelia, respectively. Little is known about the differential expression of these two transporters along the anterior-posterior axis of the intestinal tract and the molecular mechanism(s) that dictate this pattern of expression. We used mouse and human intestinal cDNAs to address these issues. The results showed a significantly lower rate of carrier-mediated AA uptake by mouse colon than jejunum. This was associated with a significantly lower level of expression of SVCT-1 and SVCT-2 at the protein, mRNA, and heterogeneous nuclear RNA (hnRNA) levels in the colon than the jejunum, implying the involvement of transcriptional mechanism(s). Similarly, expression levels of SVCT-1 and SVCT-2 mRNA and hnRNA were significantly lower in human colon. We also examined the levels of expression of hepatocyte nuclear factor 1α and specificity protein 1, which drive transcription of the Slc23a1 and Slc23a2 promoters, respectively, and found them to be markedly lower in the colon. Furthermore, significantly lower levels of the activating markers for histone (H3) modifications [H3 trimethylation of lysine 4 (H3K4me3) and H3 triacetylation of lysine 9 (H3K9ac)] were observed in the Slc23a1 and Slc23a2 promoters in the colon. These findings show, for the first time, that SVCT-1 and SVCT-2 are differentially expressed along the intestinal tract and that this pattern of expression is, at least in part, mediated via transcriptional/epigenetic mechanisms.NEW & NOTEWORTHY Our findings show, for the first time, that transporters of the water-soluble vitamin ascorbic acid (i.e., the vitamin C transporters SVCT-1 and SVCT-2) are differentially expressed along the length of the intestinal tract and that the

  1. Allosteric Mechanisms of Molecular Machines at the Membrane: Transport by Sodium-Coupled Symporters.

    PubMed

    LeVine, Michael V; Cuendet, Michel A; Khelashvili, George; Weinstein, Harel

    2016-06-08

    Solute transport across cell membranes is ubiquitous in biology as an essential physiological process. Secondary active transporters couple the unfavorable process of solute transport against its concentration gradient to the energetically favorable transport of one or several ions. The study of such transporters over several decades indicates that their function involves complex allosteric mechanisms that are progressively being revealed in atomistic detail. We focus on two well-characterized sodium-coupled symporters: the bacterial amino acid transporter LeuT, which is the prototype for the "gated pore" mechanism in the mammalian synaptic monoamine transporters, and the archaeal GltPh, which is the prototype for the "elevator" mechanism in the mammalian excitatory amino acid transporters. We present the evidence for the role of allostery in the context of a quantitative formalism that can reconcile biochemical and biophysical data and thereby connects directly to recent insights into the molecular structure and dynamics of these proteins. We demonstrate that, while the structures and mechanisms of these transporters are very different, the available data suggest a common role of specific models of allostery in their functions. We argue that such allosteric mechanisms appear essential not only for sodium-coupled symport in general but also for the function of other types of molecular machines in the membrane.

  2. Transport of aromatic amino acids by Brevibacterium linens.

    PubMed

    Boyaval, P; Moreira, E; Desmazeaud, M J

    1983-09-01

    Whole metabolizing Brevibacterium linens cells were used to study the transport of aromatic amino acids. Kinetic results followed the Michaelis-Menten equation with apparent Km values for phenylalanine, tyrosine, and tryptophan of 24, 3.5, and 1.8 microM. Transport of these amino acids was optimum at pH 7.5 and 25 degrees C for phenylalanine and pH 8.0 and 35 degrees C for tyrosine and tryptophan. Crossed inhibitions were all noncompetitive. The only marked stereospecificity was for the L form of phenylalanine. Transport was almost totally inhibited by carbonyl cyanide-m-chlorophenylhydrazone. Iodoacetate and N-ethylmaleimide were much more inhibitory for tryptophan transport than for transport of the other two aromatic amino acids.

  3. Mechanism of ochratoxin A transport in kidney

    SciTech Connect

    Sokol, P.P.; Ripich, G.; Holohan, P.D.; Ross, C.R.

    1988-08-01

    The effect of the fungal metabolite (mycotoxin) Ochratoxin A (OTA) on the transport of p-amino(/sup 3/H)hippurate (PAH), a prototypic organic anion, was examined in renal brush border (BBMV) and basolateral membrane vesicles (BLMV). OTA was as effective an inhibitor of PAH uptake in both membranes as probenecid. The dose response curves for OTA in BBMV and BLMV gave IC50 values of 20 +/- 6 and 32 +/- 7 microM, respectively. The effect was specific since the transport of the organic cation N1-methylnicotinamide was not affected. The phenomenon of counterflow was studied to establish that OTA is translocated. OTA produced trans stimulation of PAH transport in both BBMV and BLMV, demonstrating that OTA is transported across both these membranes. The data suggest that OTA interacts with the PAH transport system in both BBMV and BLMV. We conclude that OTA transport in the kidney is mediated via the renal organic anion transport system.

  4. Transport of malic acid and other dicarboxylic acids in the yeast Hansenula anomala.

    PubMed Central

    Côrte-Real, M; Leão, C

    1990-01-01

    DL-Malic acid-grown cells of the yeast Hansenula anomala formed a saturable transport system that mediated accumulative transport of L-malic acid with the following kinetic parameters at pH 5.0: Vmax, 0.20 nmol.s-1.mg (dry weight)-1; Km, 0.076 mM L-malate. Uptake of malic acid was accompanied by proton disappearance from the external medium with rates that followed Michaelis-Menten kinetics as a function of malic acid concentration. Fumaric acid, alpha-ketoglutaric acid, oxaloacetic acid, D-malic acid, and L-malic acid were competitive inhibitors of succinic acid transport, and all induced proton movements that followed Michaelis-Menten kinetics, suggesting that all of these dicarboxylates used the same transport system. Maleic acid, malonic acid, oxalic acid, and L-(+)-tartaric acid, as well as other Krebs cycle acids such as citric and isocitric acids, were not accepted by the malate transport system. Km measurements as a function of pH suggested that the anionic forms of the acids were transported by an accumulative dicarboxylate proton symporter. The accumulation ratio at pH 5.0 was about 40. The malate system was inducible and was subject to glucose repression. Undissociated succinic acid entered the cells slowly by simple diffusion. The permeability of the cells by undissociated acid increased with pH, with the diffusion constant increasing 100-fold between pH 3.0 and 6.0. PMID:2339872

  5. Molecular dynamics simulations elucidate the mechanism of proton transport in the glutamate transporter EAAT3.

    PubMed

    Heinzelmann, Germano; Kuyucak, Serdar

    2014-06-17

    The uptake of glutamate in nerve synapses is carried out by the excitatory amino acid transporters (EAATs), involving the cotransport of a proton and three Na(+) ions and the countertransport of a K(+) ion. In this study, we use an EAAT3 homology model to calculate the pKa of several titratable residues around the glutamate binding site to locate the proton carrier site involved in the translocation of the substrate. After identifying E374 as the main candidate for carrying the proton, we calculate the protonation state of this residue in different conformations of EAAT3 and with different ligands bound. We find that E374 is protonated in the fully bound state, but removing the Na2 ion and the substrate reduces the pKa of this residue and favors the release of the proton to solution. Removing the remaining Na(+) ions again favors the protonation of E374 in both the outward- and inward-facing states, hence the proton is not released in the empty transporter. By calculating the pKa of E374 with a K(+) ion bound in three possible sites, we show that binding of the K(+) ion is necessary for the release of the proton in the inward-facing state. This suggests a mechanism in which a K(+) ion replaces one of the ligands bound to the transporter, which may explain the faster transport rates of the EAATs compared to its archaeal homologs.

  6. Inhibition of ileal bile acid transporter: An emerging therapeutic strategy for chronic idiopathic constipation.

    PubMed

    Mosińska, Paula; Fichna, Jakub; Storr, Martin

    2015-06-28

    Chronic idiopathic constipation is a common disorder of the gastrointestinal tract that encompasses a wide profile of symptoms. Current treatment options for chronic idiopathic constipation are of limited value; therefore, a novel strategy is necessary with an increased effectiveness and safety. Recently, the inhibition of the ileal bile acid transporter has become a promising target for constipation-associated diseases. Enhanced delivery of bile acids into the colon achieves an accelerated colonic transit, increased stool frequency, and relief of constipation-related symptoms. This article provides insight into the mechanism of action of ileal bile acid transporter inhibitors and discusses their potential clinical use for pharmacotherapy of constipation in chronic idiopathic constipation.

  7. Mechanisms for the transport of alpha,omega-dicarboxylates through the mitochondrial inner membrane.

    PubMed

    Liu, G; Hinch, B; Beavis, A D

    1996-10-11

    alpha,omega-Dicarboxylates have antibacterial properties, have been used in the treatment of hyperpigmentary disorders, are active against various melanoma cell lines, and can also undergo beta-oxidation. Little, however, is known about their transport. In this paper, we examine the mitochondrial transport of alpha, omega-dicarboxylates ranging from oxalate (DC2) to sebacate (DC10). DC2-DC10 are transported by the inner membrane anion channel (IMAC). DC6-DC10 are also transported by an electroneutral mechanism that appears to reflect transport of the acid through the lipid bilayer. At 37 degrees C and pH 7.0, DC10 is transported very rapidly at 3 micromol/min.mg, and respiring mitochondria swell in the K+ salts of these acids. This transport mechanism is probably the major pathway by which the longer dicarboxylates enter cells, bacteria, and mitochondria. We also demonstrate that DC5-DC10 can also be transported by an electroneutral mechanism mediated by tributyltin, a potent inhibitor of IMAC. The mechanism appears to involve electroneutral exchange of a TBT-dicarboxylate-H complex for TBT-OH. Finally, we present evidence that of all the dicarboxylates tested only DC2-DC4 can be transported by the classical dicarboxylate carrier.

  8. Transport of Palmitic Acid Across the Tegument of the Entomophilic Nematode Romanomermis culicivorax

    PubMed Central

    Gordon, Roger; Burford, Ian R.

    1984-01-01

    Romanomermis culicivorax juveniles, dissected out of Aedes aegypti larvae 7 days after infection, were incubated under controlled conditions in isotonic saline containing ¹⁴C-U-palmitic acid to investigate the nature of the transport mechanism(s) used by the nematode for transcuticular uptake of palmitic acid. Net uptake of the isotope by the nematode was of a logarithmic nature with respect to time. Uptake of palmitic acid was accomplished by a combination of diffusion and a mediated process which was substrate saturable and competitively inhibited by myristic and stearic acids. Both 2,4-dinitrophenol and ouabain inhibited uptake of palmitic acid and thus supported the hypothesis that the carrier system is of the active transport variety and is coupled to a Na⁺K⁺ ATPase pump. PMID:19295867

  9. Alternating access mechanisms of LeuT-fold transporters: trailblazing towards the promised energy landscapes.

    PubMed

    Kazmier, Kelli; Claxton, Derek P; Mchaourab, Hassane S

    2016-12-29

    Secondary active transporters couple the uphill translocation of substrates to electrochemical ion gradients. Transporter conformational motion, generically referred to as alternating access, enables a central ligand binding site to change its orientation relative to the membrane. Here we review themes of alternating access and the transduction of ion gradient energy to power this process in the LeuT-fold class of transporters where crystallographic, computational and spectroscopic approaches have converged to yield detailed models of transport cycles. Specifically, we compare findings for the Na(+)-coupled amino acid transporter LeuT and the Na(+)-coupled hydantoin transporter Mhp1. Although these studies have illuminated multiple aspects of transporter structures and dynamics, a number of questions remain unresolved that so far hinder understanding transport mechanisms in an energy landscape perspective.

  10. Nucleic acids encoding metal uptake transporters and their uses

    DOEpatents

    Schroeder, Julian I.; Antosiewicz, Danuta M.; Schachtman, Daniel P.; Clemens, Stephan

    1999-01-01

    The invention provides LCT1 nucleic acids which encode metal ion uptake transporters. The invention also provides methods of modulating heavy metal and alkali metal uptake in plants. The methods involve producing transgenic plants comprising a recombinant expression cassette containing an LCT1 nucleic acid linked to a plant promoter.

  11. Modeling acid transport in chemically amplified resist films

    NASA Astrophysics Data System (ADS)

    Patil, Abhijit A.; Doxastakis, Manolis; Stein, Gila E.

    2014-03-01

    The acid-catalyzed deprotection of glassy poly(4-hydroxystyrene-co-tert butyl acrylate) films was studied with infrared absorbance spectroscopy and stochastic simulations. Experimental data were interpreted with a simple description of subdiffusive acid transport coupled to second-order acid loss. This model predicts key attributes of observed deprotection rates, such as fast reaction at short times, slow reaction at long times, and a non-linear dependence on acid loading. The degree of anomalous character is reduced by increasing the post-exposure bake temperature or adding plasticizing agents to the polymer resin. These findings indicate that the acid mobility and overall deprotection kinetics are coupled to glassy matrix dynamics. Furthermore, the acid diffusion lengths were calculated from the anomalous transport model and compared with nanopattern line widths. The consistent scaling between experiments and simulations suggests that the anomalous diffusion model could be further developed into a predictive lithography tool.

  12. Oleic acid stimulates system A amino acid transport in primary human trophoblast cells mediated by toll-like receptor 4.

    PubMed

    Lager, Susanne; Gaccioli, Francesca; Ramirez, Vanessa I; Jones, Helen N; Jansson, Thomas; Powell, Theresa L

    2013-03-01

    Obese women have an increased risk to deliver large babies. However, the mechanisms underlying fetal overgrowth in these pregnancies are not well understood. Obese pregnant women typically have elevated circulating lipid levels. We tested the hypothesis that fatty acids stimulate placental amino acid transport, mediated via toll-like receptor 4 (TLR4) and mammalian target of rapamycin (mTOR) signaling pathways. Circulating NEFA levels and placental TLR4 expression were assessed in women with varying prepregnancy body mass index (BMI). The effects of oleic acid on system A and system L amino acid transport, and on the activation of the mTOR (4EBP1, S6K1, rpS6), TLR4 (IĸB, JNK, p38 MAPK), and STAT3 signaling pathways were determined in cultured primary human trophoblast cells. Maternal circulating NEFAs (n = 33), but not placental TLR4 mRNA expression (n = 16), correlated positively with BMI (P < 0.05). Oleic acid increased trophoblast JNK and STAT3 phosphorylation (P < 0.05), whereas mTOR activity was unaffected. Furthermore, oleic acid doubled trophoblast system A activity (P < 0.05), without affecting system L activity. siRNA-mediated silencing of TLR4 expression prevented the stimulatory effect of oleic acid on system A activity. Our data suggest that maternal fatty acids can increase placental nutrient transport via TLR4, thereby potentially affecting fetal growth.

  13. Luminal Heterodimeric Amino Acid Transporter Defective in Cystinuria

    PubMed Central

    Pfeiffer, Rahel; Loffing, Jan; Rossier, Grégoire; Bauch, Christian; Meier, Christian; Eggermann, Thomas; Loffing-Cueni, Dominique; Kühn, Lukas C.; Verrey, François

    1999-01-01

    Mutations of the glycoprotein rBAT cause cystinuria type I, an autosomal recessive failure of dibasic amino acid transport (b0,+ type) across luminal membranes of intestine and kidney cells. Here we identify the permease-like protein b0,+AT as the catalytic subunit that associates by a disulfide bond with rBAT to form a hetero-oligomeric b0,+ amino acid transporter complex. We demonstrate its b0,+-type amino acid transport kinetics using a heterodimeric fusion construct and show its luminal brush border localization in kidney proximal tubule. These biochemical, transport, and localization characteristics as well as the chromosomal localization on 19q support the notion that the b0,+AT protein is the product of the gene defective in non-type I cystinuria. PMID:10588648

  14. Acid-base transport by the renal proximal tubule

    PubMed Central

    Skelton, Lara A.; Boron, Walter F.; Zhou, Yuehan

    2015-01-01

    Each day, the kidneys filter 180 L of blood plasma, equating to some 4,300 mmol of the major blood buffer, bicarbonate (HCO3−). The glomerular filtrate enters the lumen of the proximal tubule (PT), and the majority of filtered HCO3− is reclaimed along the early (S1) and convoluted (S2) portions of the PT in a manner coupled to the secretion of H+ into the lumen. The PT also uses the secreted H+ to titrate non-HCO3− buffers in the lumen, in the process creating “new HCO3−” for transport into the blood. Thus, the PT – along with more distal renal segments – is largely responsible for regulating plasma [HCO3−]. In this review we first focus on the milestone discoveries over the past 50+ years that define the mechanism and regulation of acid-base transport by the proximal tubule. Further on in the review, we will summarize research still in progress from our laboratory, work that addresses the problem of how the PT is able to finely adapt to acid–base disturbances by rapidly sensing changes in basolateral levels of HCO3− and CO2 (but not pH), and thereby to exert tight control over the acid–base composition of the blood plasma. PMID:21170887

  15. Pyrolysis Mechanisms of Aromatic Carboxylic Acids

    SciTech Connect

    Britt, P.F.; Eskay, T.P.; Buchanan, A.C. III

    1997-12-31

    Although decarboxylation of carboxylic acids is widely used in organic synthesis, there is limited mechanistic information on the uncatalyzed reaction pathways of aromatic carboxylic acids at 300-400 {degrees} C. The pyrolysis mechanisms of 1,2-(3,3-dicarboxyphenyl)ethane, 1,2-(4,4-dicarboxylphenyl)ethane, 1-(3-carboxyphenyl)-2-(4- biphenyl)ethane, and substituted benzoic acids have been investigated at 325-425 {degrees} C neat and diluted in an inert solvent. Decarboxylation is the dominant pyrolysis path. Arrhenius parameters, substituent effects, and deuterium isotope effects are consistent with decarboxylation by an electrophilic aromatic substitution reaction. Pyrolysis of benzoic acid in naphthalene, as a solvent, produces significant amounts of 1- and 2-phenylnaphthalenes. The mechanistic pathways for decarboxylation and arylation with be presented.

  16. Differential diagnosis of (inherited) amino acid metabolism or transport disorders.

    PubMed

    Blom, W; Huijmans, J G

    1992-02-01

    Disorders of amino acid metabolism or transport are most clearly expressed in urine. Nevertheless the interpretation of abnormalities in urinary amino acid excretion remains difficult. An increase or decrease of almost every amino acid in urine can be due to various etiology. To differentiate between primary and secondary aminoacido-pathies systematic laboratory investigation is necessary. Early diagnosis of disorders of amino acid metabolism or transport is very important, because most of them can be treated, leading to the prevention of (further) clinical abnormalities. In those disorders, which cannot be treated, early diagnosis in an index-patient may prevent the birth of other siblings by means of genetic counseling and prenatal diagnosis.Primary aminoacidopathies can be due to genetically determined transport disorders and enzyme deficiencies in amino acid metabolism or degradation. Secondary aminoacidopathies are the result of abnormal or deficient nutrition, intestinal dysfunction, organ pathology or other metabolic diseases like organic acidurias.A survey of amino acid metabolism and transport abnormalities will be given, illustrated with metabolic pathways and characteristic abnormal amino acid chromatograms.

  17. Intestinal transport of sugars and amino acids in diabetic rats

    PubMed Central

    Olsen, Ward A.; Rosenberg, Irwin H.

    1970-01-01

    The specificity and mechanism of altered intestinal transport of diabetic rats was studied with an everted ring technique. Increased intracellular accumulation of amino acids, as well as galactose and 3-O-methylglucose, was demonstrated in diabetes. The greater accumulation by diabetic intestine could not be attributed to a direct effect of the agent used to induce diabetes or to an alteration in food consumption. Although the changes were related to the severity of diabetes and could be reversed with treatment with insulin, they could not be modified by addition of insulin in vitro. The changes could not be induced in control intestine either with hyperglycemia from glucose infusion or preincubation with glucose in vitro. Although the higher concentration gradients of amino acids, galactose, and 3-O-methylglucose could result from increased energy utilization by diabetic intestine, an alteration of cell membrane function, as well, is suggested by the demonstration with kinetic studies of increased influx with an increase in Vmax. PMID:5409812

  18. Structural Insights into the Transport Mechanism of the Human Sodium-dependent Lysophosphatidylcholine Transporter MFSD2A.

    PubMed

    Quek, Debra Q Y; Nguyen, Long N; Fan, Hao; Silver, David L

    2016-04-29

    Major facilitator superfamily domain containing 2A (MFSD2A) was recently characterized as a sodium-dependent lysophosphatidylcholine transporter expressed at the blood-brain barrier endothelium. It is the primary route for importation of docosohexaenoic acid and other long-chain fatty acids into fetal and adult brain and is essential for mouse and human brain growth and function. Remarkably, MFSD2A is the first identified major facilitator superfamily member that uniquely transports lipids, implying that MFSD2A harbors unique structural features and transport mechanism. Here, we present three three-dimensional structural models of human MFSD2A derived by homology modeling using MelB- and LacY-based crystal structures and refined by biochemical analysis. All models revealed 12 transmembrane helices and connecting loops and represented the partially outward-open, outward-partially occluded, and inward-open states of the transport cycle. In addition to a conserved sodium-binding site, three unique structural features were identified as follows: a phosphate headgroup binding site, a hydrophobic cleft to accommodate a hydrophobic hydrocarbon tail, and three sets of ionic locks that stabilize the outward-open conformation. Ligand docking studies and biochemical assays identified Lys-436 as a key residue for transport. It is seen forming a salt bridge with the negative charge on the phosphate headgroup. Importantly, MFSD2A transported structurally related acylcarnitines but not a lysolipid without a negative charge, demonstrating the necessity of a negatively charged headgroup interaction with Lys-436 for transport. These findings support a novel transport mechanism by which lysophosphatidylcholines are "flipped" within the transporter cavity by pivoting about Lys-436 leading to net transport from the outer to the inner leaflet of the plasma membrane.

  19. Xenobiotic, Bile Acid, and Cholesterol Transporters: Function and Regulation

    PubMed Central

    Aleksunes, Lauren M.

    2010-01-01

    Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting β polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) α and β] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of regulatory

  20. Xenobiotic, bile acid, and cholesterol transporters: function and regulation.

    PubMed

    Klaassen, Curtis D; Aleksunes, Lauren M

    2010-03-01

    Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting beta polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) alpha and beta] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of

  1. Identification and functional characterization of uric acid transporter Urat1 (Slc22a12) in rats.

    PubMed

    Sato, Masanobu; Wakayama, Tomohiko; Mamada, Hideaki; Shirasaka, Yoshiyuki; Nakanishi, Takeo; Tamai, Ikumi

    2011-06-01

    Uric acid transporter URAT1 contributes significantly to reabsorption of uric acid in humans to maintain a constant serum uric acid (SUA) level. Since alteration of SUA level is associated with various diseases, it is important to clarify the mechanism of change in SUA. However, although expression of mRNA of an ortholog of URAT1 (rUrat1) in rats has been reported, functional analysis and localization have not been done. Therefore, rat rUrat1 was functionally analyzed using gene expression systems and isolated brush-border membrane vesicles (BBMVs) prepared from rat kidney, and its localization in kidney was examined immunohistochemically. Uric acid transport by rUrat1 was chloride (Cl-) susceptible with a Km of 1773μM. It was inhibited by benzbromarone and trans-stimulated by lactate and pyrazinecarboxylic acid (PZA). Cl- gradient-susceptible uric acid transport by BBMVs showed similar characteristics to those of uric acid transport by rUrat1. Moreover, rUrat1 was localized at the apical membrane in proximal tubular epithelial cells in rat kidney. Accordingly, rUrat1 is considered to be involved in uric acid reabsorption in rats in the same manner as URAT1 in humans. Therefore, rUrat1 may be a useful model to study issues related to the role of human URAT1.

  2. Functional characterization of Caenorhabditis elegans heteromeric amino acid transporters.

    PubMed

    Veljkovic, Emilija; Stasiuk, Susan; Skelly, Patrick J; Shoemaker, Charles B; Verrey, François

    2004-02-27

    Mammalian heteromeric amino acid transporters (HATs) are composed of a multi-transmembrane spanning catalytic protein covalently associated with a type II glycoprotein (e.g. 4F2hc, rBAT) through a disulfide bond. Caenorhabditis elegans has nine genes encoding close homologues of the HAT catalytic proteins. Three of these genes (designated AAT-1 to AAT-3) have a much higher degree of similarity to the mammalian homologues than the other six, including the presence of a cysteine residue at the position known to form a disulfide bridge to the glycoprotein partner in mammalian HATs. C. elegans also has two genes encoding homologues of the heteromeric amino acid transporter type II glycoprotein subunits (designated ATG-1 and ATG-2). Both ATG, and/or AAT-1, -2, -3 proteins were expressed in Xenopus oocytes and tested for amino acid transport function. This screen revealed that AAT-1 and AAT-3 facilitate amino acid transport when expressed together with ATG-2 but not with ATG-1 or the mammalian type II glycoproteins 4F2hc and rBAT. AAT-1 and AAT-3 covalently bind to both C. elegans ATG glycoproteins, but only the pairs with ATG-2 traffic to the oocyte surface. Both of these functional, surface-expressed C. elegans HATs transport most neutral amino acids and display the highest transport rate for l-Ala and l-Ser (apparent K(m) 100 microm range). Similar to their mammalian counterparts, the C. elegans HATs function as (near) obligatory amino acid exchangers. Taken together, this study demonstrates that the heteromeric structure and the amino acid exchange function of HATs have been conserved throughout the evolution of nematodes to mammals.

  3. Transported acid aerosols measured in southern Ontario

    NASA Astrophysics Data System (ADS)

    Keeler, Gerald J.; Spengler, John D.; Koutrakis, Petros; Allen, George A.; Raizenne, Mark; Stern, Bonnie

    During the period 29 June 1986-9 August 1986, a field health study assessing the acute health effects of air pollutants on children was conducted at a summer girls' camp on the northern shore of Lake Erie in SW Ontario. Continuous air pollution measurements of SO 2, O 3, NO x, particulate sulfates, light scattering, and meteorological measurements including temperature, dew point, and wind speed and direction were made. Twelve-hour integrated samples of size fractioned particles were also obtained using dichotomous samplers and Harvard impactors equipped with an ammonia denuder for subsequent hydrogen ion determination. Particulate samples were analyzed for trace elements by X-ray fluorescence and Neutron Activation, and for organic and elemental carbon by a thermal/optical technique. The measured aerosol was periodically very acidic with observed 12-h averaged H + concentrations in the range < 10-560 nmoles m -3. The aerosol H + appeared to represent the net strong acidity after H 2SO 4 reaction with NH 3(g). Average daytime concentrations were higher than night-time for aerosol H +, sulfate, fine mass and ozone. Prolonged episodes of atmospheric acidity, sulfate, and ozone were associated with air masses arriving at the measurement site from the west and from the southwest over Lake Erie. Sulfate concentrations measured at the lakeshore camp were more than twice those measured at inland sites during extreme pollution episodes. The concentration gradient observed with onshore flow was potentially due to enhanced deposition near the lakeshore caused by discontinuities in the meteorological fields in this region.

  4. Grain transport mechanics in shallow overland flow

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A physical model based on continuum multiphase flow is described to represent saltating transport of grains in shallow overland flow. The two phase continuum flow of water and sediment considers coupled St.Venant type equations. The interactive cumulative effect of grains is incorporated by a disper...

  5. Grain transport mechanics in shallow flow

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A physical model based on continuum multiphase flow is described to represent saltating transport of grains in shallow overland flows. The two-phase continuum flow of water and sediment considers coupled St.Venant type equations. The interactive cumulative effect of grains is incorporated by a dispe...

  6. Specific lysosomal transport of small neutral amino acids

    SciTech Connect

    Pisoni, R.L.; Flickinger, K.S.; Thoene, J.G.; Christensen, H.N.

    1986-05-01

    Studies of amino acid exodus from lysosomes have allowed us previously to describe transport systems specific for cystine and another for cationic amino acids in fibroblast lysosomes. They are now able to study amino acid uptake into highly purified fibroblast lysosomes obtained by separating crude granular fraction on gradients formed by centrifugation in 35% isoosmotic Percoll solutions. Analog inhibition and saturation studies indicate that L-(/sup 14/C)proline (50 ..mu..M) uptake by fibroblast lysosomes at 37/sup 0/C in 50 mM citrate/tris pH 7.0 buffer containing 0.25 M sucrose is mediated by two transport systems, one largely specific for L-proline and the other for which transport is shared with small neutral amino acids such as alanine, serine and threonine. At 7 mM, L-proline inhibits L-(/sup 14/C)proline uptake almost completely, whereas ala, ser, val, thr, gly, N-methylalanine and sarcosine inhibit proline uptake by 50-65%. The system shared by alanine, serine and threonine is further characterized by these amino acids strongly inhibiting the uptakes of each other. Lysosomal proline transport is selective for the L-isomer of the amino acid, and is scarcely inhibited by 7 mM arg, glu, asp, leu, phe, his, met, (methylamino) isobutyrate, betaine or N,N-dimethylglycine. Cis or trans-4-hydroxy-L-proline inhibit proline uptake only slightly. In sharp contrast to the fibroblast plasma membrane in which Na/sup +/ is required for most proline and alanine transport, lysosomal uptake of these amino acids occurs independently of Na/sup +/.

  7. Transport of Corilagin, Gallic Acid, and Ellagic Acid from Fructus Phyllanthi Tannin Fraction in Caco-2 Cell Monolayers

    PubMed Central

    Zhao, Hai-juan; Liang, Wen-Yi; Chen, Wen-Jing; Han, Shu-Xian; Qi, Qi; Cui, Ya-Ping; Li, Shi; Yang, Guang-Hui; Shao, Yan-Yan; Zhu, Dan

    2016-01-01

    Objective. To investigate the absorption property of the representative hydrolyzable tannin, namely corilagin, and its hydrolysates gallic acid (GA) and ellagic acid (EA) from the Fructus Phyllanthi tannin fraction (PTF) in vitro. Methods. Caco-2 cells monolayer model was established. Influences of PTF on Caco-2 cells viability were detected with MTT assay. The transport across monolayers was examined for different time points, concentrations, and secretory directions. The inhibitors of P-glycoprotein (P-gp), multidrug resistance proteins (MRPs), organic anion transporting polypeptide (OATP) and sodium/glucose cotransporter 1 (SGLT1), and tight junction modulators were used to study the transport mechanism. LC-MS method was employed to quantify the absorption concentration. Results. The apparent permeability coefficient (Papp) values of the three compounds were below 1.0 × 10−6 cm/s. The absorption of corilagin and GA were much lower than their efflux, and the uptake of both compounds was increased in the presence of inhibitors of P-gp and MRPs. The absorption of EA was decreased in the company of OATP and SGLT1 inhibitors. Moreover, the transport of corilagin, GA, and EA was enhanced by tight junction modulators. Conclusion. These observations indicated that the three compounds in PTF were transported via passive diffusion combined with protein mediated transport. P-gp and MRPs might get involved in the transport of corilagin and GA. The absorption of EA could be attributed to OATP and SGLT1 protein. PMID:27738446

  8. Mechanisms of abscisic acid-mediated control of stomatal aperture.

    PubMed

    Munemasa, Shintaro; Hauser, Felix; Park, Jiyoung; Waadt, Rainer; Brandt, Benjamin; Schroeder, Julian I

    2015-12-01

    Drought stress triggers an increase in the level of the plant hormone abscisic acid (ABA), which initiates a signaling cascade to close stomata and reduce water loss. Recent studies have revealed that guard cells control cytosolic ABA concentration through the concerted actions of biosynthesis, catabolism as well as transport across membranes. Substantial progress has been made at understanding the molecular mechanisms of how the ABA signaling core module controls the activity of anion channels and thereby stomatal aperture. In this review, we focus on our current mechanistic understanding of ABA signaling in guard cells including the role of the second messenger Ca(2+) as well as crosstalk with biotic stress responses.

  9. Statistical Mechanics of Collective Transport by Ants

    NASA Astrophysics Data System (ADS)

    Pinkoviezky, Itai; Gelblum, Aviram; Fonio, Ehud; Ghosh, Abhijit; Gov, Nir; Feinerman, Ofer

    Collective decisions and cooperation within groups are essential for the survival of many species. Conflicts within the group must be suppressed but conformism may render the system unresponsive to new information. Collective transport by ants is therefore an ideal model system to study how animal groups optimize these opposing requirements. We combine experiments and theory to characterize the collective transport. The ants are modeled as binary Ising spins, representing the two roles ants can perform during transport. It turns out that the ants poise themselves collectively near a critical point where the response to a newly attached ant is maximized. We identify the size as being proportional to an inverse effective temperature and thus the system can exhibit a mesoscopic transition between order and disorder by manipulating the size. Constraining the cargo with a string makes the system behave as a strongly non-linear pendulum. Theoretically we predict that a Hopf bifurcation occurs at a critical size followed by a global bifurcation where full swings emerge. Remarkably, these theoretical predictions were verified experimentally.

  10. Secondary metabolites in plants: transport and self-tolerance mechanisms.

    PubMed

    Shitan, Nobukazu

    2016-07-01

    Plants produce a host of secondary metabolites with a wide range of biological activities, including potential toxicity to eukaryotic cells. Plants generally manage these compounds by transport to the apoplast or specific organelles such as the vacuole, or other self-tolerance mechanisms. For efficient production of such bioactive compounds in plants or microbes, transport and self-tolerance mechanisms should function cooperatively with the corresponding biosynthetic enzymes. Intensive studies have identified and characterized the proteins responsible for transport and self-tolerance. In particular, many transporters have been isolated and their physiological functions have been proposed. This review describes recent progress in studies of transport and self-tolerance and provides an updated inventory of transporters according to their substrates. Application of such knowledge to synthetic biology might enable efficient production of valuable secondary metabolites in the future.

  11. In-stream sorption of fulvic acid in an acidic stream: A stream-scale transport experiment

    USGS Publications Warehouse

    McKnight, Diane M.; Hornberger, G.M.; Bencala, K.E.; Boyer, E.W.

    2002-01-01

    The variation of concentration and composition of dissolved organic carbon (DOC) in stream waters cannot be explained solely on the basis of soil processes in contributing subcatchments. To investigate in-stream processes that control DOC, we injected DOC-enriched water into a reach of the Snake River (Summit County, Colorado) that has abundant iron oxyhydroxides coating the streambed. The injected water was obtained from the Suwannee River (Georgia), which is highly enriched in fulvic acid. The fulvic acid from this water is the standard reference for aquatic fulvic acid for the International Humic Substances Society and has been well characterized. During the experimental injection, significant removal of sorbable fulvic acid occurred within the first 141 m of stream reach. We coinjected a conservative tracer (lithium chloride) and analyzed the results with the one-dimensional transport with inflow and storage (OTIS) stream solute transport model to quantify the physical transport mechanisms. The downstream transport of fulvic acid as indicated by absorbance was then simulated using OTIS with a first-order kinetic sorption rate constant applied to the sorbable fulvic acid. The "sorbable" fraction of injected fulvic acid was irreversibly sorbed by streambed sediments at rates (kinetic rate constants) of the order of 10-4-10-3 S-1. In the injected Suwannee River water, sorbable and nonsorbable fulvic acid had distinct chemical characteristics identified in 13C-NMR spectra. The 13C-NMR spectra indicate that during the experiment, the sorbable "signal" of greater aromaticity and carboxyl content decreased downstream; that is, these components were preferentially removed. This study illustrates that interactions between the water and the reactive surfaces will modify significantly the concentration and composition of DOC observed in streams with abundant chemically reactive surfaces on the streambed and in the hyporheic zone.

  12. ATP-dependent transport of bile acid intermediates across rat liver peroxisomal membranes.

    PubMed

    Une, Mizuho; Iguchi, Yusuke; Sakamoto, Tomoko; Tomita, Takashi; Suzuki, Yasuyuki; Morita, Masashi; Imanaka, Tsuneo

    2003-08-01

    The bile acid intermediate 3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoic acid (THCA) is converted to cholic acid exclusively in peroxisomes by the oxidative cleavage of the side chain. To investigate the mechanism by which the biosynthetic intermediates of bile acids are transported into peroxisomes, we incubated THCA or its CoA ester (THC-CoA) with isolated intact rat liver peroxisomes and analyzed their oxidation products, cholic acid and 3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoic acid. The oxidation of both THCA and THC-CoA was dependent on incubation time and peroxisomal proteins, and was stimulated by ATP. THC-CoA was efficiently oxidized to cholic acid and 3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoic acid as compared with THCA, suggesting that THC-CoA is the preferred substrate for transport into peroxisomes. The oxidation of THC-CoA was significantly inhibited by sodium azide, verapamile, and N-ethylmaleimide. Furthermore, the stimulatory effect of ATP on the oxidation was not replaced by GTP or AMP. In addition, the ATP-dependent oxidation of THC-CoA was markedly inhibited by pretreatment of peroxisomes with proteinase K when peroxisomal matrix proteins were not degraded. These results suggest that an ATP-dependent transport system for THC-CoA exists on peroxisomal membranes.

  13. Charge transport mechanism in lead oxide revealed by CELIV technique

    PubMed Central

    Semeniuk, O.; Juska, G.; Oelerich, J.-O.; Wiemer, M.; Baranovskii, S. D.; Reznik, A.

    2016-01-01

    Although polycrystalline lead oxide (PbO) belongs to the most promising photoconductors for optoelectronic and large area detectors applications, the charge transport mechanism in this material still remains unclear. Combining the conventional time-of-flight and the photo-generated charge extraction by linear increasing voltage (photo-CELIV) techniques, we investigate the transport of holes which are shown to be the faster carriers in poly-PbO. Experimentally measured temperature and electric field dependences of the hole mobility suggest a highly dispersive transport. In order to analyze the transport features quantitatively, the theory of the photo-CELIV is extended to account for the dispersive nature of charge transport. While in other materials with dispersive transport the amount of dispersion usually depends on temperature, this is not the case in poly-PbO, which evidences that dispersive transport is caused by the spatial inhomogeneity of the material and not by the energy disorder. PMID:27628537

  14. Transport of Amino Acids to the Maize Root 1

    PubMed Central

    Oaks, Ann

    1966-01-01

    When 5-mm maize root tips were excised and placed in an inorganic salts solution for 6 hours, there was a loss of alcohol-insoluble nitrogen. The levels of threonine, proline, valine, isoleucine, leucine, tyrosine, phenylalanine, and lysine in the alcohol soluble fraction were severely reduced, whereas those of glutamate, aspartate, ornithine, and alanine were scarcely affected. There was a 4-fold increase in the level of γ-aminobutyrate. Those amino acids whose synthesis appeared to be deficient in excised root tips also showed poor incorporation of acetate carbon. In addition, the results show that asparagine and the amino acids of the neutral and basic fraction were preferentially transported to the root tip region. The results therefore suggest that the synthesis of certain amino acids in the root tip region is restricted, and that this requirement for amino acids in the growing region could regulate the flow of amino acids to the root tip. PMID:16656225

  15. Mode of action of pyrazinamide: disruption of Mycobacterium tuberculosis membrane transport and energetics by pyrazinoic acid.

    PubMed

    Zhang, Ying; Wade, Mary Margaret; Scorpio, Angelo; Zhang, Hao; Sun, Zhonghe

    2003-11-01

    Pyrazinamide is an important sterilizing drug that shortens tuberculosis (TB) therapy. However, the mechanism of action of pyrazinamide is poorly understood because of its unusual properties. Here we show that pyrazinoic acid, the active moiety of pyrazinamide, disrupted membrane energetics and inhibited membrane transport function in Mycobacterium tuberculosis. The preferential activity of pyrazinamide against old non-replicating bacilli correlated with their low membrane potential and the disruption of membrane potential by pyrazinoic acid and acid pH. Inhibitors of membrane energetics increased the antituberculous activity of pyrazinamide. These findings shed new light on the mode of action of pyrazinamide and may help in the design of new drugs that shorten therapy.

  16. Transport mechanisms in Schottky diodes realized on GaN

    NASA Astrophysics Data System (ADS)

    Amor, Sarrah; Ahaitouf, Ali; Ahaitouf, Abdelaziz; Salvestrini, Jean Paul; Ougazzaden, Abdellah

    2017-03-01

    This work is focused on the conducted transport mechanisms involved on devices based in gallium nitride GaN and its alloys. With considering all conduction mechanisms of current, its possible to understanded these transport phenomena. Thanks to this methodology the current-voltage characteristics of structures with unusual behaviour are further understood and explain. Actually, the barrier height (SBH) is a complex problem since it depends on several parameters like the quality of the metal-semiconductor interface. This study is particularly interesting as solar cells are made on this material and their qualification is closely linked to their transport properties.

  17. Quantum mechanisms of density wave transport

    PubMed Central

    Miller, John H.; Wijesinghe, Asanga I.

    2012-01-01

    We report on new developments in the quantum picture of correlated electron transport in charge and spin density waves. The model treats the condensate as a quantum fluid in which charge soliton domain wall pairs nucleate above a Coulomb blockade threshold field. We employ a time-correlated soliton tunneling model, analogous to the theory of time-correlated single electron tunneling, to interpret the voltage oscillations and nonlinear current-voltage characteristics above threshold. An inverse scaling relationship between threshold field and dielectric response, originally proposed by Grüner, emerges naturally from the model. Flat dielectric and other ac responses below threshold in NbSe3 and TaS3, as well as small density wave phase displacements, indicate that the measured threshold is often much smaller than the classical depinning field. In some materials, the existence of two distinct threshold fields suggests that both soliton nucleation and classical depinning may occur. In our model, the ratio of electrostatic charging to pinning energy helps determine whether soliton nucleation or classical depinning dominates. PMID:22711979

  18. Thermodynamic evidence for a dual transport mechanism in a POT peptide transporter.

    PubMed

    Parker, Joanne L; Mindell, Joseph A; Newstead, Simon

    2014-12-02

    Peptide transport plays an important role in cellular homeostasis as a key route for nitrogen acquisition in mammalian cells. PepT1 and PepT2, the mammalian proton coupled peptide transporters (POTs), function to assimilate and retain diet-derived peptides and play important roles in drug pharmacokinetics. A key characteristic of the POT family is the mechanism of peptide selectivity, with members able to recognise and transport >8000 different peptides. In this study, we present thermodynamic evidence that in the bacterial POT family transporter PepTSt, from Streptococcus thermophilus, at least two alternative transport mechanisms operate to move peptides into the cell. Whilst tri-peptides are transported with a proton:peptide stoichiometry of 3:1, di-peptides are co-transported with either 4 or 5 protons. This is the first thermodynamic study of proton:peptide stoichiometry in the POT family and reveals that secondary active transporters can evolve different coupling mechanisms to accommodate and transport chemically and physically diverse ligands across the membrane.

  19. Fatty acid transport protein expression in human brain and potential role in fatty acid transport across human brain microvessel endothelial cells.

    PubMed

    Mitchell, Ryan W; On, Ngoc H; Del Bigio, Marc R; Miller, Donald W; Hatch, Grant M

    2011-05-01

    The blood-brain barrier (BBB), formed by the brain capillary endothelial cells, provides a protective barrier between the systemic blood and the extracellular environment of the CNS. Passage of fatty acids from the blood to the brain may occur either by diffusion or by proteins that facilitate their transport. Currently several protein families have been implicated in fatty acid transport. The focus of the present study was to identify the fatty acid transport proteins (FATPs) expressed in the brain microvessel endothelial cells and characterize their involvement in fatty acid transport across an in vitro BBB model. The major fatty acid transport proteins expressed in human brain microvessel endothelial cells (HBMEC), mouse capillaries and human grey matter were FATP-1, -4 and fatty acid binding protein 5 and fatty acid translocase/CD36. The passage of various radiolabeled fatty acids across confluent HBMEC monolayers was examined over a 30-min period in the presence of fatty acid free albumin in a 1 : 1 molar ratio. The apical to basolateral permeability of radiolabeled fatty acids was dependent upon both saturation and chain length of the fatty acid. Knockdown of various fatty acid transport proteins using siRNA significantly decreased radiolabeled fatty acid transport across the HBMEC monolayer. Our findings indicate that FATP-1 and FATP-4 are the predominant fatty acid transport proteins expressed in the BBB based on human and mouse expression studies. While transport studies in HBMEC monolayers support their involvement in fatty acid permeability, fatty acid translocase/CD36 also appears to play a prominent role in transport of fatty acids across HBMEC.

  20. Electropolymerization mechanisms of hydroxyphenylacetic acid isomers

    NASA Astrophysics Data System (ADS)

    Rodrigues, Luciano P.; Ferreira, Deusmaque C.; Sonoda, Milton Taidi; Madurro, Ana Graci B.; Abrahão, Odonírio; Madurro, João M.

    2014-08-01

    Three different films of conducting polymers with free carboxylic functional groups were obtained from 2,3 and 4-hydroxyphenylacetic acid isomers (HPA) and the respective electropolymerization mechanisms were elucidated by DFT calculations. The different properties observed at these new material characterizations, obtained by means of cyclic voltammetry on graphite, are in agreement with theoretical interpretation presented for each reaction mechanisms, which involves the different radical cation coupling and formation of aromatic polyethers with free carboxyl groups, characterized by FTIR spectrometry and electrochemical tests. The computational chemistry analysis of the radical cations spin densities and partial atomic charges variation during the monomer oxidations, indicates the most probably reactive sites for their coupling, allowing the proposition of HPA electropolymerization mechanisms. The poly(2-HPA) had the largest yield in the electropolymerization reaction and the lowest electron transfer. The poly(4-HPA) displayed the lowest yield and the largest electron transfer coefficient, with poly(3-HPA) presenting intermediate values between the former two. Therefore, poly(3-HPA) is a very promising polymer for the platform development for electronic systems, which require materials with good electronic conductivity allied to intrinsic flexibility of polymeric materials.

  1. Transport in Halobacterium Halobium: Light-Induced Cation-Gradients, Amino Acid Transport Kinetics, and Properties of Transport Carriers

    NASA Technical Reports Server (NTRS)

    Lanyi, Janos K.

    1977-01-01

    Cell envelope vesicles prepared from H. halobium contain bacteriorhodopsin and upon illumination protons are ejected. Coupled to the proton motive force is the efflux of Na(+). Measurements of Na-22 flux, exterior pH change, and membrane potential, Delta(psi) (with the dye 3,3'-dipentyloxadicarbocyanine) indicate that the means of Na(+) transport is sodium/proton exchange. The kinetics of the pH changes and other evidence suggests that the antiport is electrogenic (H(+)/Na(++ greater than 1). The resulting large chemical gradient for Na(+) (outside much greater than inside), as well as the membrane potential, will drive the transport of 18 amino acids. The I9th, glutamate, is unique in that its accumulation is indifferent to Delta(psi): this amino acid is transported only when a chemical gradient for Na(+) is present. Thus, when more and more NaCl is included in the vesicles glutamate transport proceeds with longer and longer lags. After illumination the gradient of H+() collapses within 1 min, while the large Na(+) gradient and glutamate transporting activity persists for 10- 15 min, indicating that proton motive force is not necessary for transport. A chemical gradient of Na(+), arranged by suspending vesicles loaded with KCl in NaCl, drives glutamate transport in the dark without other sources of energy, with V(sub max) and K(sub m) comparable to light-induced transport. These and other lines of evidence suggest that the transport of glutamate is facilitated by symport with Na(+), in an electrically neutral fashion, so that only the chemical component of the Na(+) gradient is a driving force.

  2. Identification of transport pathways for citric acid cycle intermediates in the human colon carcinoma cell line, Caco-2.

    PubMed

    Weerachayaphorn, Jittima; Pajor, Ana M

    2008-04-01

    Citric acid cycle intermediates are absorbed from the gastrointestinal tract through carrier-mediated mechanisms, although the transport pathways have not been clearly identified. This study examines the transport of citric acid cycle intermediates in the Caco-2 human colon carcinoma cell line, often used as a model of small intestine. Inulin was used as an extracellular volume marker instead of mannitol since the apparent volume measured with mannitol changed with time. The results show that Caco-2 cells contain at least three distinct transporters, including the Na+-dependent di- and tricarboxylate transporters, NaDC1 and NaCT, and one or more sodium-independent pathways, possibly involving organic anion transporters. Succinate transport is mediated mostly by Na+-dependent pathways, predominantly by NaDC1, but with some contribution by NaCT. RT-PCR and functional characteristics verified the expression of these transporters in Caco-2 cells. In contrast, citrate transport in Caco-2 cells occurs by a combination of Na+-independent pathways, possibly mediated by an organic anion transporter, and Na+-dependent mechanisms. The non-metabolizable dicarboxylate, methylsuccinate, is also transported by a combination of Na+-dependent and -independent pathways. In conclusion, we find that multiple pathways are involved in the transport of di- and tricarboxylates by Caco-2 cells. Since many of these pathways are not found in human intestine, this model may be best suited for studying Na+-dependent transport of succinate by NaDC1.

  3. Mechanisms of dopamine transporter regulation in normal and disease states.

    PubMed

    Vaughan, Roxanne A; Foster, James D

    2013-09-01

    The dopamine (DA) transporter (DAT) controls the spatial and temporal dynamics of DA neurotransmission by driving reuptake of extracellular transmitter into presynaptic neurons. Many diseases such as depression, bipolar disorder, Parkinson's disease (PD), and attention deficit hyperactivity disorder (ADHD) are associated with abnormal DA levels, implicating DAT as a factor in their etiology. Medications used to treat these disorders and many addictive drugs target DAT and enhance dopaminergic signaling by suppressing transmitter reuptake. We now understand that the transport and binding properties of DAT are regulated by complex and overlapping mechanisms that provide neurons with the ability to modulate DA clearance in response to physiological demands. These processes are controlled by endogenous signaling pathways and affected by exogenous transporter ligands, demonstrating their importance for normal neurotransmission, drug abuse, and disease treatments. Increasing evidence supports the disruption of these mechanisms in DA disorders, implicating dysregulation of transport in disease etiologies and suggesting these processes as potential points for therapeutic manipulation of DA availability.

  4. Transport mechanism of the sarcoplasmic reticulum Ca2+ -ATPase pump.

    PubMed

    Møller, Jesper V; Nissen, Poul; Sørensen, Thomas L-M; le Maire, Marc

    2005-08-01

    The sarcoplasmic reticulum Ca(2+)-ATPase (SERCA1a) belongs to the group of P-type ATPases, which actively transport inorganic cations across membranes at the expense of ATP hydrolysis. Three-dimensional structures of several transport intermediates of SERCA1a, stabilized by structural analogues of ATP and phosphoryl groups, are now available at atomic resolution. This has enabled the transport cycle of the protein to be described, including the coupling of Ca(2+) occlusion and phosphorylation by ATP, and of proton counter-transport and dephosphorylation. From these structures, Ca(2+)-ATPase gradually emerges as a molecular mechanical device in which some of the transmembrane segments perform Ca(2+) transport by piston-like movements and by the transmission of reciprocating movements that affect the chemical reactivity of the cytosolic globular domains.

  5. Flexible oligocholate foldamers as membrane transporters and their guest-dependent transport mechanism.

    PubMed

    Zhang, Shiyong; Zhao, Yan

    2012-01-14

    Dimeric, trimeric, and tetrameric oligocholates with flexible 4-aminobutyroyl spacers caused the efflux of hydrophilic molecules such as carboxyfluorescein (CF) and glucose from POPC/POPG liposomes. Transport was greatly suppressed across higher-melting DPPC membranes. Lipid-mixing assays and dynamic light scattering (DLS) indicated that the liposomes were intact during the transport. Kinetic analysis supported the involvement of monomeric species in the rate-limiting step of CF transport, consistent with a carrier-based mechanism. Glucose transport, on the other hand, displayed a highly unusual zero-order dependence on the oligocholate concentration at low loading of the transporter. Different selectivity was observed in the oligocholate transporters depending on the guest involved.

  6. New insights into the molecular mechanism of intestinal fatty acid absorption

    PubMed Central

    Wang, Tony Y.; Liu, Min; Portincasa, Piero; Wang, David Q.-H.

    2013-01-01

    Background Dietary fat is the most important energy source of all the nutrients. Fatty acids, stored as triacylglycerols in the body, are an important reservoir of stored energy and derive primarily from animal fats and vegetable oils. Design Although the molecular mechanisms for the transport of water-insoluble amphipathic fatty acids across cell membranes have been debated for many years, it is now believed that the dominant means for intestinal fatty acid uptake is via membrane-associated fatty acid-binding proteins, i.e., fatty acid transporters on the apical membrane of enterocytes. Results These findings indicate that intestinal fatty acid absorption is a multistep process that is regulated by multiple genes at the enterocyte level, and intestinal fatty acid absorption efficiency could be determined by factors influencing intraluminal fatty acid molecules across the brush border membrane of enterocytes. To facilitate research on intestinal, hepatic and plasma triacylglycerol metabolism, it is imperative to establish standard protocols for precisely and accurately measuring the efficiency of intestinal fatty acid absorption in humans and animal models. In this review, we will discuss the chemical structure and nomenclature of fatty acids and summarize recent progress in investigating the molecular mechanisms underlying the intestinal absorption of fatty acids, with a particular emphasis on the physical-chemistry of intestinal lipids and the molecular physiology of intestinal fatty acid transporters. Conclusions A better understanding of the molecular mechanism of intestinal fatty acid absorption should lead to novel approaches to the treatment and the prevention of fatty acid-related metabolic diseases that are prevalent worldwide. PMID:24102389

  7. The effects of the carboxyl-terminus amino acids of the Shiga toxin B-subunit on retrograde transport.

    PubMed

    Liu, Dan; Fan, Yuying; Li, Jie; Gao, Xiaoge; Hao, Miao; Xue, Huiting; Tai, Guihua

    2012-07-01

    The Shiga toxin B-subunit (STxB), from the enteric pathogen, Shigella dysenteriae, is responsible for the attachment of its receptor, globotriaosylceramide (Gb3), and navigates the retrograde pathway from the plasma membrane to the endoplasmic reticulum (ER). In this study, in order to demonstrate the role of carboxyl-terminus (C-terminus/al) amino acids of the B-fragment on the retrograde transport speed and the retrograde transport pathway, STxB was modified by site-directed mutagenesis and by the addition of an amino acid tail. The results showed that when the C-terminal amino acid, arginine [Arg (R)], was mutated to serine [Ser (S)], the speed of the B-fragment transportation into the ER at 37 ˚C was slower. When an acidic amino acid tail 'glutamine (Glu)-Ser' (ES) was added to the C-terminal amino acid 'R', the B-fragment transporting speed slowed down and remained in the Golgi apparatus. Further experiments showed that the effects induced by mutations of the amino acid tail resulted in STxB-EEEES ≥-EEES>-EES>-ES, demonstrating that the retardation effect on the tail was increased and the length of the acidic amino acid was augmented. The effect was possibly produced by an acidic amino acid tail, not only by the amino acid 'E'. The significant inhibitory effect on the speed of B-fragment retrograde transport was observed only when the mutations of the acidic amino acid tail were linked near to the C-terminus. These results may provide important insights for the study of transport mechanisms and for the development of STxB serial proteins as vectors for drug delivery.

  8. Transport mechanisms acting in toroidal devices: A theoretician's view

    SciTech Connect

    Carreras, B.A.

    1993-01-01

    Understanding the basic mechanisms of transport in toroidal confinement devices remains one of the more challenging scientific issues in magnetic confinement. At the same time, it is a critical issue for the magnetic fusion program. Recent progress in understanding fluctuations and transport has been fostered by the development and use of new diagnostics, bringing new perspectives on these studies. This has stimulated new theoretical developments. A view of the most recent issues and progress in this area is given. The role of long wavelengths in core transport and the relation between shear flows and turbulence at the plasma edge are the primary topics considered.

  9. Atmospheric transport and diffusion mechanisms in coastal circulation systems

    SciTech Connect

    Kaleel, R.J.; Shearer, D.L.; MacRae, B.L.

    1983-06-01

    This study defines the cyclical aspects of coastal atmospheric behavior that are important to the transport and diffusion (dispersion) of radionuclides. The report is developed around discussions of the meteorological dynamics of the cyclical and (cellular) atmospheric coastal phenomena and the atmospheric transport/diffusion mechanisms along with an assessment of the measurements accompanying both. Further, the efforts directed to modeling both the atmospheric and transport/diffusion processes are summarized and evaluated. Lastly, the review is summarized through a set of conclusions about the current level of understanding of coastal atmospheric phenomena. Recommendations are offered which identify certain aspects of local scale cyclical coastal phenomena that are important to the NRC.

  10. [Vesicular intracellular transport in the digestive organs. Membrane vesicle--the universal mechanism of the functional transport].

    PubMed

    Morozov, I A

    2014-01-01

    On the basis of long-term research of the morpho-functional characteristics of the cells of the stomach, small intestine and gallbladder the mechanism and function of membrane vesicles in the implementation of the main functions of these organs sets out in this article: the secretion of hydrochloric acid by parietal cells, the absorption of nutrients in the small intestine and the fluid at a concentration of bile epitheliocytes of gallbladder. Proofs of the intracellular formation of hydrochloric acid in tubulovesicles of the parietal cells and turnover of its secretory membranes in the process of secretory cycle, that has ensured the re-use and explained the extraordinary life of these unique cells are presented. The credible mechanism of HCl output oppression by H(+)-K(+)-ATPase activity blockers has set out on this basis. The article provides detailed endocytosis mechanism of the ions and nutrients absorption by enterocytes. The mechanism of participation of the apical contractile complex of brush border of epithelial cells in the initiation of endocytosis and cytoplasmic microtubules in transport of membrane vesicles in the cytoplasm was analyzed. Based on our research and numerous of the world scientific proceedings the conclusion was done about the existence of two energy dependent types of transport in the absorptive epithelium of the digestive--transmembrane (ionic and nutritive) homeostatic type which is realized by the ATP-system of the basal plasmalemma, and vesicular (endocytosis) type which is impltmented by apical contractile complex of brush border and cytoplasmic microtubules. Both types of transport are interrelated and are under constant cellular control. This observation is relevant to the majority of cells, including those involved in the secretion of various substances: hydrochloric acid by parietal cells, enzymes by main cells of the gastric glands and exocrinocytes of the pancreas, hormone by endocrine cells of the APUD system and, finally

  11. Structural basis for amino acid export by DMT superfamily transporter YddG.

    PubMed

    Tsuchiya, Hirotoshi; Doki, Shintaro; Takemoto, Mizuki; Ikuta, Tatsuya; Higuchi, Takashi; Fukui, Keita; Usuda, Yoshihiro; Tabuchi, Eri; Nagatoishi, Satoru; Tsumoto, Kouhei; Nishizawa, Tomohiro; Ito, Koichi; Dohmae, Naoshi; Ishitani, Ryuichiro; Nureki, Osamu

    2016-06-16

    The drug/metabolite transporter (DMT) superfamily is a large group of membrane transporters ubiquitously found in eukaryotes, bacteria and archaea, and includes exporters for a remarkably wide range of substrates, such as toxic compounds and metabolites. YddG is a bacterial DMT protein that expels aromatic amino acids and exogenous toxic compounds, thereby contributing to cellular homeostasis. Here we present structural and functional analyses of YddG. Using liposome-based analyses, we show that Escherichia coli and Starkeya novella YddG export various amino acids. The crystal structure of S. novella YddG at 2.4 Å resolution reveals a new membrane transporter topology, with ten transmembrane segments in an outward-facing state. The overall structure is basket-shaped, with a large substrate-binding cavity at the centre of the molecule, and is composed of inverted structural repeats related by two-fold pseudo-symmetry. On the basis of this intramolecular symmetry, we propose a structural model for the inward-facing state and a mechanism of the conformational change for substrate transport, which we confirmed by biochemical analyses. These findings provide a structural basis for the mechanism of transport of DMT superfamily proteins.

  12. cAMP increases mitochondrial cholesterol transport through the induction of arachidonic acid release inside this organelle in Leydig cells.

    PubMed

    Castillo, Ana Fernanda; Cornejo Maciel, Fabiana; Castilla, Rocío; Duarte, Alejandra; Maloberti, Paula; Paz, Cristina; Podestá, Ernesto J

    2006-11-01

    We have investigated the direct effect of arachidonic acid on cholesterol transport in intact cells or isolated mitochondria from steroidogenic cells and the effect of cyclic-AMP on the specific release of this fatty acid inside the mitochondria. We show for the first time that cyclic-AMP can regulate the release of arachidonic acid in a specialized compartment of MA-10 Leydig cells, e.g. the mitochondria, and that the fatty acid induces cholesterol transport through a mechanism different from the classical pathway. Arachidonic acid and arachidonoyl-CoA can stimulate cholesterol transport in isolated mitochondria from nonstimulated cells. The effect of arachidonoyl-CoA is inhibited by the reduction in the expression or in the activity of a mitochondrial thioesterase that uses arachidonoyl-CoA as a substrate to release arachidonic acid. cAMP-induced arachidonic acid accumulation into the mitochondria is also reduced when the mitochondrial thioesterase activity or expression is blocked. This new feature in the regulation of cholesterol transport by arachidonic acid and the release of arachidonic acid in specialized compartment of the cells could offer novel means for understanding the regulation of steroid synthesis but also would be important in other situations such as neuropathological disorders or oncology disorders, where cholesterol transport plays an important role.

  13. Neutralizing aspartate 83 modifies substrate translocation of excitatory amino acid transporter 3 (EAAT3) glutamate transporters.

    PubMed

    Hotzy, Jasmin; Machtens, Jan-Philipp; Fahlke, Christoph

    2012-06-08

    Excitatory amino acid transporters (EAATs) terminate glutamatergic synaptic transmission by removing glutamate from the synaptic cleft into neuronal and glial cells. EAATs are not only secondary active glutamate transporters but also function as anion channels. Gating of EAAT anion channels is tightly coupled to transitions within the glutamate uptake cycle, resulting in Na(+)- and glutamate-dependent anion currents. A point mutation neutralizing a conserved aspartic acid within the intracellular loop close to the end of transmembrane domain 2 was recently shown to modify the substrate dependence of EAAT anion currents. To distinguish whether this mutation affects transitions within the uptake cycle or directly modifies the opening/closing of the anion channel, we used voltage clamp fluorometry. Using three different sites for fluorophore attachment, V120C, M205C, and A430C, we observed time-, voltage-, and substrate-dependent alterations of EAAT3 fluorescence intensities. The voltage and substrate dependence of fluorescence intensities can be described by a 15-state model of the transport cycle in which several states are connected to branching anion channel states. D83A-mediated changes of fluorescence intensities, anion currents, and secondary active transport can be explained by exclusive modifications of substrate translocation rates. In contrast, sole modification of anion channel opening and closing is insufficient to account for all experimental data. We conclude that D83A has direct effects on the glutamate transport cycle and that these effects result in changed anion channel function.

  14. How to move an amphipathic molecule across a lipid bilayer: different mechanisms for different ABC transporters?

    PubMed Central

    Theodoulou, Frederica L.; Carrier, David J.; Schaedler, Theresia A.; Baldwin, Stephen A.; Baker, Alison

    2016-01-01

    Import of β-oxidation substrates into peroxisomes is mediated by ATP binding cassette (ABC) transporters belonging to subfamily D. In order to enter the β-oxidation pathway, fatty acids are activated by conversion to fatty acyl-CoA esters, a reaction which is catalysed by acyl-CoA synthetases (ACSs). Here, we present evidence for an unusual transport mechanism, in which fatty acyl-CoA substrates are accepted by ABC subclass D protein (ABCD) transporters, cleaved by the transporters during transit across the lipid bilayer to release CoA, and ultimately re-esterified in the peroxisome lumen by ACSs which interact with the transporter. We propose that this solves the biophysical problem of moving an amphipathic molecule across the peroxisomal membrane, since the intrinsic thioesterase activity of the transporter permits separate membrane translocation pathways for the hydrophobic fatty acid moiety and the polar CoA moiety. The cleavage/re-esterification mechanism also has the potential to control entry of disparate substrates into the β-oxidation pathway when coupled with distinct peroxisomal ACSs. A different solution to the movement of amphipathic molecules across a lipid bilayer is deployed by the bacterial lipid-linked oligosaccharide (LLO) flippase, PglK, in which the hydrophilic head group and the hydrophobic polyprenyl tail of the substrate are proposed to have distinct translocation pathways but are not chemically separated during transport. We discuss a speculative alternating access model for ABCD proteins based on the mammalian ABC transporter associated with antigen processing (TAP) and compare it to the novel mechanism suggested by the recent PglK crystal structures and biochemical data. PMID:27284041

  15. Coupled binding mechanism of three sodium ions and aspartate in the glutamate transporter homologue GltTk

    PubMed Central

    Guskov, Albert; Jensen, Sonja; Faustino, Ignacio; Marrink, Siewert J.; Slotboom, Dirk Jan

    2016-01-01

    Glutamate transporters catalyse the thermodynamically unfavourable transport of anionic amino acids across the cell membrane by coupling it to the downhill transport of cations. This coupling mechanism is still poorly understood, in part because the available crystal structures of these transporters are of relatively low resolution. Here we solve crystal structures of the archaeal transporter GltTk in the presence and absence of aspartate and use molecular dynamics simulations and binding assays to show how strict coupling between the binding of three sodium ions and aspartate takes place. PMID:27830699

  16. Unveiling the gating mechanism of ECF Transporter RibU

    NASA Astrophysics Data System (ADS)

    Song, Jianing; Ji, Changge; Zhang, John Z. H.

    2013-12-01

    Energy-coupling factor (ECF) transporters are responsible for uptake of micronutrients in prokaryotes. The recently reported crystal structure of an ECF transporter RibU provided a foundation for understanding the structure and transport mechanism of ECF transporters. In the present study, molecular dynamics (MD) was carried out to study the conformational changes of the S component RibU upon binding by riboflavin. Our result and analysis revealed a critically important gating mechanism, in which part of loop5 (L5') (eleven residues, missing in the crystal structure) between TM5 and TM6 is dynamically flexible and serves as a gate. Specifically, the L5' opens a large cavity accessible to riboflavin from the extracellular space in Apo-RibU and closes the cavity upon riboflavin binding through hydrophobic packing with riboflavin. Thus, L5'is proposed to be the gate for riboflavin binding. In addition, steered molecular dynamics (SMD) simulation is employed to investigate the translocation dynamics of RibU during riboflavin transport. The simulation result does not show evidence that the S component alone can carry out the transport function. Since loop regions are very flexible and therefore could not be resolved by crystallography, their dynamics are hard to predict based on crystal structure alone.

  17. Size does matter: 18 amino acids at the N-terminal tip of an amino acid transporter in Leishmania determine substrate specificity

    PubMed Central

    Schlisselberg, Doreen; Mazarib, Eldar; Inbar, Ehud; Rentsch, Doris; Myler, Peter J.; Zilberstein, Dan

    2015-01-01

    Long N-terminal tails of amino acid transporters are known to act as sensors of the internal pool of amino acids and as positive regulators of substrate flux rate. In this study we establish that N-termini of amino acid transporters can also determine substrate specificity. We show that due to alternative trans splicing, the human pathogen Leishmania naturally expresses two variants of the proline/alanine transporter, one 18 amino acid shorter than the other. We demonstrate that the longer variant (LdAAP24) translocates both proline and alanine, whereas the shorter variant (∆18LdAAP24) translocates just proline. Remarkably, co-expressing the hydrophilic N-terminal peptide of the long variant with ∆18LdAAP24 was found to recover alanine transport. This restoration of alanine transport could be mediated by a truncated N-terminal tail, though truncations exceeding half of the tail length were no longer functional. Taken together, the data indicate that the first 18 amino acids of the negatively charged N-terminal LdAAP24 tail are required for alanine transport and may facilitate the electrostatic interactions of the entire negatively charged N-terminal tail with the positively charged internal loops in the transmembrane domain, as this mechanism has been shown to underlie regulation of substrate flux rate for other transporters. PMID:26549185

  18. Generic Transport Mechanisms for Molecular Traffic in Cellular Protrusions

    NASA Astrophysics Data System (ADS)

    Graf, Isabella R.; Frey, Erwin

    2017-03-01

    Transport of molecular motors along protein filaments in a half-closed geometry is a common feature of biologically relevant processes in cellular protrusions. Using a lattice-gas model we study how the interplay between active and diffusive transport and mass conservation leads to localized domain walls and tip localization of the motors. We identify a mechanism for task sharing between the active motors (maintaining a gradient) and the diffusive motion (transport to the tip), which ensures that energy consumption is low and motor exchange mostly happens at the tip. These features are attributed to strong nearest-neighbor correlations that lead to a strong reduction of active currents, which we calculate analytically using an exact moment identity, and might prove useful for the understanding of correlations and active transport also in more elaborate systems.

  19. Aluminum in acidic surface waters: chemistry, transport, and effects.

    PubMed Central

    Driscoll, C T

    1985-01-01

    Ecologically significant concentrations of Al have been reported in surface waters draining "acid-sensitive" watersheds that are receiving elevated inputs of acidic deposition. It has been hypothesized that mineral acids from atmospheric deposition have remobilized Al previously precipitated within the soil during soil development. This Al is then thought to be transported to adjacent surface waters. Dissolved mononuclear Al occurs as aquo Al, as well as OH-, F-, SO4(2-), and organic complexes. Although past investigations have often ignored non-hydroxide complexes of Al, it appears that organic and F complexes are the predominant forms of Al in dilute (low ionic strength) acidic surface waters. The concentration of inorganic forms of Al increases exponentially with decreases in solution pH. This response is similar to the theoretical pH dependent solubility of Al mineral phases. The concentration of organic forms of Al, however, is strongly correlated with variations in organic carbon concentration of surface waters rather than pH. Elevated concentrations of Al in dilute acidic waters are of interest because: Al is an important pH buffer; Al may influence the cycling of important elements like P, organic carbon, and trace metals; and Al is potentially toxic to aquatic organisms. An understanding of the aqueous speciation of Al is essential for an evaluation of these processes. PMID:3935428

  20. Early metabolic effects and mechanism of ammonium transport in yeast

    SciTech Connect

    Pena, A.; Pardo, J.P.; Ramirez, J.

    1987-03-01

    Studies were performed to define the effects and mechanism of NH+4 transport in yeast. The following results were obtained. Glucose was a better facilitator than ethanol-H/sub 2/O/sub 2/ for ammonium transport; low concentrations of uncouplers or respiratory inhibitors could inhibit the transport with ethanol as the substrate. With glucose, respiratory inhibitors showed only small inhibitory effects, and only high concentrations of azide or trifluoromethoxy carbonylcyanide phenylhydrazone could inhibit ammonium transport. Ammonium in the free state could be concentrated approximately 200-fold by the cells. Also, the addition of ammonium produced stimulation of both respiration and fermentation; an increased rate of H+ extrusion and an alkalinization of the interior of the cell; a decrease of the membrane potential, as monitored by fluorescent cyanine; an immediate decrease of the levels of ATP and an increase of ADP, which may account for the stimulation of both fermentation and respiration; and an increase of the levels of inorganic phosphate. Ammonium was found to inhibit 86Rb+ transport much less than K+. Also, while K+ produced a competitive type of inhibition, that produced by NH4+ was of the noncompetitive type. From the distribution ratio of ammonium and the pH gradient, an electrochemical potential gradient of around -180 mV was calculated. The results indicate that ammonium is transported in yeast by a mechanism similar to that of monovalent alkaline cations, driven by a membrane potential. The immediate metabolic effects of this cation seem to be due to an increased (H+)ATPase, to which its transport is coupled. However, the carriers seem to be different. The transport system studied in this work was that of low affinity.

  1. Issues in tokamak/stellarator transport and confinement enhancement mechanisms

    SciTech Connect

    Perkins, F.W.

    1990-08-01

    At present, the mechanism for anomalous energy transport in low-{beta} toroidal plasmas -- tokamaks and stellarators -- remains unclear, although transport by turbulent E {times} B velocities associated with nonlinear, fine-scale microinstabilities is a leading candidate. This article discusses basic theoretical concepts of various transport and confinement enhancement mechanisms as well as experimental ramifications which would enable one to distinguish among them and hence identify a dominant transport mechanism. While many of the predictions of fine-scale turbulence are born out by experiment, notable contradictions exist. Projections of ignition margin rest both on the scaling properties of the confinement mechanism and on the criteria for entering enhanced confinement regimes. At present, the greatest uncertainties lie with the basis for scaling confinement enhancement criteria. A series of questions, to be answered by new experimental/theoretical work, is posed to resolve these outstanding contradictions (or refute the fine-scale turbulence model) and to establish confinement enhancement criteria. 73 refs., 4 figs., 5 tabs.

  2. [Hopping and superexchange mechanisms of charge transport to DNA].

    PubMed

    Lakhno, V D; Sultanov, V B

    2003-01-01

    A theory for charge transport in nucleobase sequences was constructed in which the hole migration proceeds via hopping between guanines. Each hop over the adenine-thymine (A-T) bridge connecting neighboring guanines occurs by means of the superexchange mechanism. The experimental data and theoretical results for various types of nucleobase sequences are compared.

  3. Mass transport mechanism in porous fuel cell electrodes

    NASA Technical Reports Server (NTRS)

    Jonsson, I.; Lindholm, I.

    1969-01-01

    Results of experiments on hydrogen-oxygen fuel cells show that higher current densities are obtained with cell anodes having a 100 micron thin active layer of porous nickel containing silver electrocatalyst. Increase in current density is attributed to a convective mass transport mechanism.

  4. Role of sodium ion in transport of folic acid in the small intestine

    SciTech Connect

    Zimmerman, J.; Selhub, J.; Rosenberg, I.H.

    1986-08-01

    The effect of sodium on folate transport across the intestinal luminal membrane was analyzed using two techniques: the influx chamber and isoalted brush-border membrane vesicles. Preincubation of tissue in Na -free medium did not have a consistent effect on folic acid influx provided that Na was present in the test solution. Replacement of Na in the test solution by choline resulted in a significant reduction of folic acid influx. However, when intestinal sheets that had been equilibrated in Na -free solution were exposed to test solutions containing either Na , Li , K , Rb , Cs , Tris , or guanidinium as main cations, folic acid influx was not significantly decreased. Concentration-dependence studies showed that replacement of Na by Rb did not affect the saturable mechanism of folate transport. Rather, a decrease in nonsaturable folic acid uptake accounted for the slightly reduced influx observed in the presence of Rb . Experiments with brush-border membrane vesicles revealed that methotrexate uptake was significantly higher in the presence of external Na than in the presence of K , but was not different from uptake in the presence of K plus valinomycin. These data suggest that 1) the saturable component of folate transport is not Na dependent, and 2) nonsaturable transport of folic acid across the luminal membrane occurs in part through a conductive pathway that involves a negatively charged species of folate and a cation whose membrane permeability affects the rate of folate transport. The importance of Na in this process in vivo derives from the fact that Na is the most permeant cation available at the absorptive site in the small intestine.

  5. Modeling of glycerol-3-phosphate transporter suggests a potential 'tilt' mechanism involved in its function.

    PubMed

    Tsigelny, Igor F; Greenberg, Jerry; Kouznetsova, Valentina; Nigam, Sanjay K

    2008-10-01

    "rocker switch" may apply to certain MFS transporters, intermediate "tilted" states may exist under certain circumstances or as transitional structures. Although wet lab experimental confirmation is required, our results suggest that transport mechanisms in this transporter family should probably not be assumed to be conserved simply based on standard structural homology considerations. Furthermore, steered molecular dynamics elucidating energetic interactions of ligands with amino acid residues in an appropriately modeled transporter may have predictive value in understanding the impact of mutations and/or polymorphisms on transporter function.

  6. Choline inhibition of amino acid transport in preimplantation mouse blastocysts

    SciTech Connect

    Campione, A.L.; Haghighat, N.; Gorman, J.; Van Winkle, L.J.

    1987-05-01

    Addition of 70 mM choline chloride to Brinster's medium (140 mM Na/sup +/) inhibited uptake of approx. 1 ..mu..M (/sup 3/H)glycine, leucine, lysine and alanine in blastocysts by about 50% each during a five-minute incubation period at 37/sup 0/C, whereas 70 mM LiCl, sodium acetate and NaCl or 140 mM mannitol had no effect. They attribute the apparent linear relationship between Gly transport in blastocysts and the square of the (Na/sup +/), observed when choline was substituted for Na/sup +/ in Brinster's medium, to concomitant, concentration-dependent enhancement and inhibition of transport by Na/sup +/ and choline, respectively. As expected, Gly uptake and the (Na/sup +/) were linearly related up to 116 mM Na/sup +/, when Na/sup +/ was replaced with Li/sup +/. The rates of Na/sup +/-independent Gly and Ala uptake were <5% and <2% of the total, respectively, and similar when either Li/sup +/ or choline replaced Na/sup +/. Therefore, neither Li/sup +/ nor choline appears to substitute for Na/sup +/ in supporting Na/sup +/-dependent transport in blastocysts. Na/sup +/-independent Leu uptake was 20 times faster than Gly or Ala uptake and appeared to be inhibited by choline in blastocysts since it was about 37% slower when choline instead of Li/sup +/ was substituted for Na/sup +/. In contrast to blastocysts, choline had no effect on amino acid transport in cleavage-stage mouse embryos. The unexpected sensitivity of transport to choline in blastocysts underscores the importance of testing the effects of this substance when it is used to replace Na/sup +/ in new transport studies.

  7. Fatty acids as an energy source for the operation of axoplasmic transport.

    PubMed

    Takenaka, Toshifumi; Hiruma, Hiromi; Hori, Hideaki; Hashimoto, Yoko; Ichikawa, Takafumi; Kawakami, Tadashi

    2003-05-16

    Fatty acids are utilized as a cellular energy source. In the present study, we investigated whether fatty acids could affect axoplasmic transport. Cultured mouse superior cervical ganglion neurons were placed in the glucose-containing medium (145 mM NaCl, 5 mM KCl, 1 mM CaCl(2), 1 mM MgCl(2), 5 mM D-glucose, 10 mM Hepes, pH 7.3, 37 degrees C), and axoplasmic transport of particles in neurites was observed under video-enhanced contrast microscopy. A variety of fatty acids (acetate (C2), caproate (C6), caprylate (C8), caprate (C10), 2-decenoate (C10:1), arachidonate (C20:4); 0.1-1 mM) caused a transient increase in the amount of particles transported in both anterograde and retrograde directions. The increasing effects of fatty acids were dose-dependent. A half-maximum effective dose (ED(50)) for acetate was 0.8 mM, which is similar to the reported K(m) value of acetyl-CoA synthetase for acetate. The ED(50) for caprylate was 28 microM, which is near the K(m) value of acyl-CoA synthetase for medium- and long-chain fatty acids. Application of 5 mM malonate, an inhibitor of the citrate cycle, induced a steady-state decrease in axoplasmic transport, indicating that energy derived from the citrate cycle is required for the maintenance of axoplasmic transport. The increasing effect of acetate (1 mM) on axoplasmic transport was completely abolished by pretreatment with malonate (5 mM), suggesting that acetate produces ATP for axoplasmic transport via the citrate cycle. Alternatively, the effect of caprate (1 mM) was retained after treatment with malonate. Thus, fatty acids except acetate produce ATP probably through both the beta-oxidation pathway and the citrate cycle, increasing axoplasmic transport. Since the effect of fatty acids was transient, certain negative feedback mechanisms might be involved. The removal of glucose from the medium resulted in a low steady-state level of axoplasmic transport. Under such condition, the acetate (1 mM)-induced transient increase in

  8. Perfluorocarboxylic acid (PFCA) atmospheric formation and transport to the Arctic.

    NASA Astrophysics Data System (ADS)

    Pike-thackray, C.; Selin, N. E.

    2015-12-01

    Perfluorocarboxylic acids (PFCAs) are highly persistent and toxic environmental contaminants that have been found in remote locations such as the Arctic, far from emission sources. These persistent organic pollutants are emitted directly to the atmosphere as well as being produced by the degradation of precursor compounds in the atmosphere, but recent trends towards increasing precursor emissions and decreasing direct emissions raise the importance of production in the atmosphere. Our work aims to improve understanding of the atmospheric degradation of fluorotelomer precursor compounds to form the long-chain PFCAs PFOA (C8) and PFNA (C9).Using the atmospheric chemical transport model GEOS-Chem, which uses assimilated meteorology to simulate the atmospheric transport of trace gas species, we investigate the interaction of the atmospheric formation of PFCAs and the atmospheric transport of their precursor species. Our simulations are a first application of the GEOS-Chem framework to PFCA chemistry. We highlight the importance of the spatial and temporal variability of background atmospheric chemical conditions experienced during transport. We find that yields and formation times of PFOA and PFNA respond differently and strongly to the photochemical conditions of the atmosphere, such as the abundance of NO, HO2, and other photochemical species.

  9. Tranexamic Acid Mechanisms and Pharmacokinetics in Traumatic Injury

    DTIC Science & Technology

    2015-10-01

    AWARD NUMBER: W81XWH-14-1-0373 TITLE: Tranexamic Acid Mechanisms and Pharmacokinetics in Traumatic Injury PRINCIPAL INVESTIGATOR: Philip C...Tranexamic Acid Mechanisms and Pharmacokinetics In Traumatic Injury 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-14-1-0373 5c. PROGRAM ELEMENT NUMBER...Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 8 Title: Tranexamic Acid Mechanisms and Pharmacokinetics In Traumatic Injury (TAMPITI Trial

  10. Structure and mechanism of the mammalian fructose transporter GLUT5

    PubMed Central

    Shimamura, Tatsuro; Nomura, Yayoi; Sonoda, Yo; Hussien, Saba Abdul; Qureshi, Aziz Abdul; Coincon, Mathieu; Sato, Yumi; Abe, Hitomi; Nakada-Nakura, Yoshiko; Hino, Tomoya; Arakawa, Takatoshi; Kusano-Arai, Osamu; Iwanari, Hiroko; Murata, Takeshi; Kobayashi, Takuya; Hamakubo, Takao; Kasahara, Michihiro; Iwata, So; Drew, David

    2015-01-01

    The altered activity of the fructose transporter GLUT5, an isoform of the facilitated-diffusion glucose transporter family, has been linked to disorders such as type 2 diabetes and obesity. GLUT5 is also overexpressed in certain tumor cells and inhibitors are potential drugs for these conditions. Here, we describe the crystal structure of GLUT5 from Rattus norvegicus and Bos taurus in open outward- and open inward-facing conformations, respectively. GLUT5 has a major facilitator superfamily fold like other homologous monosaccharide transporters. Based on a comparison of the inward-facing structures of GLUT5 and human GLUT1, a ubiquitous glucose transporter, we show that a single point mutation is enough to switch the substrate binding preference of GLUT5 from fructose to glucose. A comparison of the substrate-free structures of GLUT5 with occluded substrate-bound structures of XylE suggests that, besides global rocker-switch like re-orientation of the bundles, local asymmetric rearrangements of C-terminal bundle helices TMs 7 and 10 underlie a “gated-pore” transport mechanism in such monosaccharide transporters. PMID:26416735

  11. The 2-Hydroxycarboxylate Transporter Family: Physiology, Structure, and Mechanism

    PubMed Central

    Sobczak, Iwona; Lolkema, Juke S.

    2005-01-01

    The 2-hydroxycarboxylate transporter family is a family of secondary transporters found exclusively in the bacterial kingdom. They function in the metabolism of the di- and tricarboxylates malate and citrate, mostly in fermentative pathways involving decarboxylation of malate or oxaloacetate. These pathways are found in the class Bacillales of the low-CG gram-positive bacteria and in the gamma subdivision of the Proteobacteria. The pathways have evolved into a remarkable diversity in terms of the combinations of enzymes and transporters that built the pathways and of energy conservation mechanisms. The transporter family includes H+ and Na+ symporters and precursor/product exchangers. The proteins consist of a bundle of 11 transmembrane helices formed from two homologous domains containing five transmembrane segments each, plus one additional segment at the N terminus. The two domains have opposite orientations in the membrane and contain a pore-loop or reentrant loop structure between the fourth and fifth transmembrane segments. The two pore-loops enter the membrane from opposite sides and are believed to be part of the translocation site. The binding site is located asymmetrically in the membrane, close to the interface of membrane and cytoplasm. The binding site in the translocation pore is believed to be alternatively exposed to the internal and external media. The proposed structure of the 2HCT transporters is different from any known structure of a membrane protein and represents a new structural class of secondary transporters. PMID:16339740

  12. Antibacterial drug treatment increases intestinal bile acid absorption via elevated levels of ileal apical sodium-dependent bile acid transporter but not organic solute transporter α protein.

    PubMed

    Miyata, Masaaki; Hayashi, Kenjiro; Yamakawa, Hiroki; Yamazoe, Yasushi; Yoshinari, Kouichi

    2015-01-01

    Antibacterial drug treatment increases the bile acid pool size and hepatic bile acid concentration through the elevation of hepatic bile acid synthesis. However, the involvement of intestinal bile acid absorption in the increased bile acid pool size remains unclear. To determine whether intestinal bile acid absorption contributes to the increased bile acid pool in mice treated with antibacterial drugs, we evaluated the levels of bile acid transporter proteins and the capacity of intestinal bile acid absorption. Ileal apical sodium-dependent bile acid transporter (ASBT) mRNA and protein levels were significantly increased in ampicillin (ABPC)-treated mice, whereas organic solute transporter α (OSTα) mRNA levels, but not protein levels, significantly decreased in mice. Similar alterations in the expression levels of bile acid transporters were observed in mice treated with bacitracin/neomycin/streptomycin. The capacity for intestinal bile acid absorption was evaluated by an in situ loop method. Increased ileal absorption of taurochenodeoxycholic acid was observed in mice treated with ABPC. These results suggest that intestinal bile acid absorption is elevated in an ASBT-dependent manner in mice treated with antibacterial drugs.

  13. Intracellular dehydroascorbic acid inhibits SVCT2-dependent transport of ascorbic acid in mitochondria.

    PubMed

    Fiorani, Mara; Azzolini, Catia; Guidarelli, Andrea; Cerioni, Liana; Scotti, Maddalena; Cantoni, Orazio

    2015-09-01

    Exposure of U937 cells to low concentrations of L-ascorbic acid (AA) is associated with a prompt cellular uptake and a further mitochondrial accumulation of the vitamin. Under the same conditions, dehydroascorbic acid (DHA) uptake was followed by rapid reduction and accumulation of identical intracellular levels of AA, however, in the absence of significant mitochondrial uptake. This event was instead observed after exposure to remarkably greater concentrations of DHA. Furthermore, experiments performed in isolated mitochondria revealed that DHA transport through hexose transporters and Na(+) -dependent transport of AA were very similar. These results suggest that the different subcellular compartmentalization of the vitamin is mediated by events promoting inhibition of mitochondrial AA transport, possibly triggered by low levels of DHA. We obtained results in line with this notion in intact cells, and more direct evidence in isolated mitochondria. This inhibitory effect was promptly reversible after DHA removal and comparable with that mediated by established inhibitors, as quercetin. The results presented collectively indicate that low intracellular concentrations of DHA, because of its rapid reduction back to AA, are a poor substrate for direct mitochondrial uptake. DHA concentrations, however, appear sufficiently high to mediate inhibition of mitochondrial transport of AA/DHA-derived AA.

  14. Catalytic Mechanism of the Maltose Transporter Hydrolyzing ATP.

    PubMed

    Huang, Wenting; Liao, Jie-Lou

    2016-01-12

    We use quantum mechanical and molecular mechanical (QM/MM) simulations to study ATP hydrolysis catalyzed by the maltose transporter. This protein is a prototypical member of a large family that consists of ATP-binding cassette (ABC) transporters. The ABC proteins catalyze ATP hydrolysis to perform a variety of biological functions. Despite extensive research efforts, the precise molecular mechanism of ATP hydrolysis catalyzed by the ABC enzymes remains elusive. In this work, the reaction pathway for ATP hydrolysis in the maltose transporter is evaluated using a QM/MM implementation of the nudged elastic band method without presuming reaction coordinates. The potential of mean force along the reaction pathway is obtained with an activation free energy of 19.2 kcal/mol in agreement with experiments. The results demonstrate that the reaction proceeds via a dissociative-like pathway with a trigonal bipyramidal transition state in which the cleavage of the γ-phosphate P-O bond occurs and the O-H bond of the lytic water molecule is not yet broken. Our calculations clearly show that the Walker B glutamate as well as the switch histidine stabilizes the transition state via electrostatic interactions rather than serving as a catalytic base. The results are consistent with biochemical and structural experiments, providing novel insight into the molecular mechanism of ATP hydrolysis in the ABC proteins.

  15. Small Substrate Transport and Mechanism of a Molybdate ATP Binding Cassette Transporter in a Lipid Environment*

    PubMed Central

    Rice, Austin J.; Harrison, Alistair; Alvarez, Frances J. D.; Davidson, Amy L.; Pinkett, Heather W.

    2014-01-01

    Embedded in the plasma membrane of all bacteria, ATP binding cassette (ABC) importers facilitate the uptake of several vital nutrients and cofactors. The ABC transporter, MolBC-A, imports molybdate by passing substrate from the binding protein MolA to a membrane-spanning translocation pathway of MolB. To understand the mechanism of transport in the biological membrane as a whole, the effects of the lipid bilayer on transport needed to be addressed. Continuous wave-electron paramagnetic resonance and in vivo molybdate uptake studies were used to test the impact of the lipid environment on the mechanism and function of MolBC-A. Working with the bacterium Haemophilus influenzae, we found that MolBC-A functions as a low affinity molybdate transporter in its native environment. In periods of high extracellular molybdate concentration, H. influenzae makes use of parallel molybdate transport systems (MolBC-A and ModBC-A) to take up a greater amount of molybdate than a strain with ModBC-A alone. In addition, the movement of the translocation pathway in response to nucleotide binding and hydrolysis in a lipid environment is conserved when compared with in-detergent analysis. However, electron paramagnetic resonance spectroscopy indicates that a lipid environment restricts the flexibility of the MolBC translocation pathway. By combining continuous wave-electron paramagnetic resonance spectroscopy and substrate uptake studies, we reveal details of molybdate transport and the logistics of uptake systems that employ multiple transporters for the same substrate, offering insight into the mechanisms of nutrient uptake in bacteria. PMID:24722984

  16. Electrochemical reactivity and proton transport mechanisms in nanostructured ceria

    NASA Astrophysics Data System (ADS)

    Ding, J.; Strelcov, E.; Kalinin, S. V.; Bassiri-Gharb, N.

    2016-08-01

    Electrochemical reactivity and ionic transport at the nanoscale are essential in many energy applications. In this study, time-resolved Kelvin probe force microscopy (tr-KPFM) is utilized for surface potential mapping of nanostructured ceria, in both space and time domains. The fundamental mechanisms of proton injection and transport are studied as a function of environmental conditions and the presence or absence of triple phase boundaries. Finite element modeling is used to extract physical parameters from the experimental data, allowing not only quantification of the observed processes, but also decoupling of their contributions to the measured signal. The constructed phase diagrams of the parameters demonstrate a thermally activated proton injection reaction at the triple phase boundary, and two transport processes that are responsible for the low-temperature proton conductivity of nanostructured ceria.

  17. Transport of heptafluorostearate across model membranes. Membrane transport of long-chain fatty acid anions I.

    PubMed

    Schmider, W; Fahr, A; Blum, H E; Kurz, G

    2000-05-01

    Heptafluorostearic acid, an isogeometric derivative of stearic acid, has a pK(a) value of about 0.5. To evaluate the suitability of heptafluorostearate as model compound for anions of long-chain fatty acids in membrane transport, monolayer and liposome studies were performed with lipid mixtures containing phospholipids;-cholesterol-heptafluorostearate or stearate (100:40:20 molar ratios). Transfer of heptafluorostearate and stearate from liposomes to bovine serum albumin (BSA) was followed by measuring the intrinsic fluorescence of BSA. The percentage of heptafluorostearate, equivalent to the amount placed in their outer monolayer, transferred from liposomes (120;-130 nm diameter) to BSA was 55.7 +/- 3.7% within 10 min at 25 degrees C and 55 +/- 2% within 5 min at 37 degrees C. Slow transfer of 22.7 +/- 2.5% of heptafluorostearate at 25 degrees C followed with a half-life of 2.3 +/- 0.4 h and of 20 +/- 4% at 37 degrees C with a half-life of 0.9 +/- 0.1 h until the final equilibrium distributions between BSA and liposomes were reached, 79 +/- 6% to 21 +/- 5% at 25 degrees C and 75 +/- 5% to 25 +/- 4% at 37 degrees C. The pseudounimolecular rate constants for flip-flop of heptafluorostearate equal k(FF,25) = 0.24 +/- 0.05 h(-) and k(FF,37) = 0.6 +/- 0.1 h(-), respectively. By comparison, transfer of stearate required only 3 min to reach equilibrium distribution. The difference between heptafluorostearate and stearate may be explained by a rapid flip-flop movement of the un-ionized fatty acids which exist in different concentrations in accordance with their pK(a) values. Half-life of flip-flop of heptafluorostearate makes it suitable to study mediated membrane transport of long-chain fatty acid anions.

  18. SGLT2 inhibitor lowers serum uric acid through alteration of uric acid transport activity in renal tubule by increased glycosuria.

    PubMed

    Chino, Yukihiro; Samukawa, Yoshishige; Sakai, Soichi; Nakai, Yasuhiro; Yamaguchi, Jun-ichi; Nakanishi, Takeo; Tamai, Ikumi

    2014-10-01

    Sodium glucose cotransporter 2 (SGLT2) inhibitors have been reported to lower the serum uric acid (SUA) level. To elucidate the mechanism responsible for this reduction, SUA and the urinary excretion rate of uric acid (UE(UA)) were analysed after the oral administration of luseogliflozin, a SGLT2 inhibitor, to healthy subjects. After dosing, SUA decreased, and a negative correlation was observed between the SUA level and the UE(UA), suggesting that SUA decreased as a result of the increase in the UE(UA). The increase in UE(UA) was correlated with an increase in urinary D-glucose excretion, but not with the plasma luseogliflozin concentration. Additionally, in vitro transport experiments showed that luseogliflozin had no direct effect on the transporters involved in renal UA reabsorption. To explain that the increase in UE(UA) is likely due to glycosuria, the study focused on the facilitative glucose transporter 9 isoform 2 (GLUT9ΔN, SLC2A9b), which is expressed at the apical membrane of the kidney tubular cells and transports both UA and D-glucose. It was observed that the efflux of [(14) C]UA in Xenopus oocytes expressing the GLUT9 isoform 2 was trans-stimulated by 10 mm D-glucose, a high concentration of glucose that existed under SGLT2 inhibition. On the other hand, the uptake of [(14) C]UA by oocytes was cis-inhibited by 100 mm D-glucose, a concentration assumed to exist in collecting ducts. In conclusion, it was demonstrated that the UE(UA) could potentially be increased by luseogliflozin-induced glycosuria, with alterations of UA transport activity because of urinary glucose.

  19. Unveiling the missing transport mechanism inside the valveless micropump.

    PubMed

    Wang, An-Bang; Hsieh, Ming-Che

    2012-09-07

    It has long been held, misleadingly, that the rectifier is the only decisive element for the design of fluid transportation in a valveless micropump. We have shown here that pump performance is also critically dependent on the design of the vibration chamber, a neglected element in micropump design that has drawn almost no attention in the past. Moreover, the generally used in-line design has, surprisingly, the lowest efficiency. The transport mechanism was found to be linked to the hydraulic coupling of two asymmetric vortex pairs inside the vibration chamber. Based upon the discovered flow mechanism, the proposed design inspired by an ancient fish trap has shown extraordinary improvement in micropump performance. It could also be potentially integrated with most existing designs for further energy saving.

  20. Transport Processes from Mechanics: Minimal and Simplest Models

    NASA Astrophysics Data System (ADS)

    Bunimovich, Leonid A.; Grigo, Alexander

    2017-02-01

    We review the current state of a fundamental problem of rigorous derivation of transport processes in classical statistical mechanics from classical mechanics. Such derivations for diffusion and momentum transport (viscosities) were obtained for minimal models of these processes involving one and two particles respectively. However, a minimal model which demonstrates heat conductivity contains three particles. Its rigorous analysis is currently out of reach for existing mathematical techniques. The gas of localized balls is widely accepted as a basis for a simplest model for derivation of Fourier's law. We suggest a modification of the localized balls gas and argue that this gas of localized activated balls is a good candidate to rigorously prove Fourier's law. In particular, hyperbolicity is derived for a reduced version of this model.

  1. Transport Processes from Mechanics: Minimal and Simplest Models

    NASA Astrophysics Data System (ADS)

    Bunimovich, Leonid A.; Grigo, Alexander

    2016-12-01

    We review the current state of a fundamental problem of rigorous derivation of transport processes in classical statistical mechanics from classical mechanics. Such derivations for diffusion and momentum transport (viscosities) were obtained for minimal models of these processes involving one and two particles respectively. However, a minimal model which demonstrates heat conductivity contains three particles. Its rigorous analysis is currently out of reach for existing mathematical techniques. The gas of localized balls is widely accepted as a basis for a simplest model for derivation of Fourier's law. We suggest a modification of the localized balls gas and argue that this gas of localized activated balls is a good candidate to rigorously prove Fourier's law. In particular, hyperbolicity is derived for a reduced version of this model.

  2. Transport of the two natural auxins, indole-3-butyric acid and indole-3-acetic acid, in Arabidopsis

    NASA Technical Reports Server (NTRS)

    Rashotte, Aaron M.; Poupart, Julie; Waddell, Candace S.; Muday, Gloria K.; Brown, C. S. (Principal Investigator)

    2003-01-01

    Polar transport of the natural auxin indole-3-acetic acid (IAA) is important in a number of plant developmental processes. However, few studies have investigated the polar transport of other endogenous auxins, such as indole-3-butyric acid (IBA), in Arabidopsis. This study details the similarities and differences between IBA and IAA transport in several tissues of Arabidopsis. In the inflorescence axis, no significant IBA movement was detected, whereas IAA is transported in a basipetal direction from the meristem tip. In young seedlings, both IBA and IAA were transported only in a basipetal direction in the hypocotyl. In roots, both auxins moved in two distinct polarities and in specific tissues. The kinetics of IBA and IAA transport appear similar, with transport rates of 8 to 10 mm per hour. In addition, IBA transport, like IAA transport, is saturable at high concentrations of auxin, suggesting that IBA transport is protein mediated. Interestingly, IAA efflux inhibitors and mutations in genes encoding putative IAA transport proteins reduce IAA transport but do not alter IBA movement, suggesting that different auxin transport protein complexes are likely to mediate IBA and IAA transport. Finally, the physiological effects of IBA and IAA on hypocotyl elongation under several light conditions were examined and analyzed in the context of the differences in IBA and IAA transport. Together, these results present a detailed picture of IBA transport and provide the basis for a better understanding of the transport of these two endogenous auxins.

  3. Mechanisms of carrier transport induced by a microswimmer bath.

    PubMed

    Kaiser, Andreas; Sokolov, Andrey; Aranson, Igor S; Löwen, Hartmut

    2015-04-01

    It was shown that a wedgelike microparticle (referred to as "carrier") exhibits a directed translational motion along the wedge cusp if it is exposed to a bath of microswimmers. Here we model this effect in detail by resolving the microswimmers explicitly using interaction models with different degrees of mutual alignment. Using computer simulations we study the impact of these interactions on the transport efficiency of a V-shaped carrier. We show that the transport mechanism itself strongly depends on the degree of alignment embodied in the modeling of the individual swimmer dynamics. For weak alignment, optimal carrier transport occurs in the turbulent microswimmer state and is induced by swirl depletion inside the carrier. For strong aligning interactions, optimal transport occurs already in the dilute regime and is mediated by a polar cloud of swimmers in the carrier wake pushing the wedge-particle forward. We also demonstrate that the optimal shape of the carrier leading to maximal transport speed depends on the kind of interaction model used.

  4. Mechanisms of Carrier Transport Induced by a Microswimmer Bath

    SciTech Connect

    Kaiser, Andreas; Sokolov, Andrey; Aranson, Igor S.; Lowen, Hartmut

    2015-04-01

    Recently, it was found that a wedgelike microparticle (referred to as ”carrier”) which is only allowed to translate but not to rotate exhibits a directed translational motion along the wedge cusp if it is exposed to a bath of microswimmers. Here we model this effect in detail by resolving the microswimmers explicitly using interaction models with different degrees of mutual alignment. Using computer simulations we study the impact of these interactions on the transport efficiency of V-shaped carrier. We show that the transport mechanisms itself strongly depends on the degree of alignment embodied in the modelling of the individual swimmer dynamics. For weak alignment, optimal carrier transport occurs in the turbulent microswimmer state and is induced by swirl depletion inside the carrier. For strong aligning interactions, optimal transport occurs already in the dilute regime and is mediated by a polar cloud of swimmers in the carrier wake pushing the wedge-particle forward. We also demonstrate that the optimal shape of the carrier leading to maximal transport speed depends on the kind of interaction model used.

  5. Calcium transport in strongly calcifying laying birds: mechanisms and regulation.

    PubMed

    Bar, Arie

    2009-04-01

    Birds that lay long clutches (series of eggs laid sequentially before a "pause day"), among them the high-producing, strongly-calcifying Gallus gallus domesticus (domestic hen) and Coturnix coturnix japonica (Japanese quail), transfer about 10% of their total body calcium daily. They appear, therefore, to be the most efficient calcium-transporters among vertebrates. Such intensive transport imposes severe demands on ionic calcium (Ca2+) homeostasis, and activates at least two extremely effective mechanisms for Ca2+ transfer from food and bone to the eggshell. This review focuses on the development, action and regulation of the mechanisms associated with paracellular and transcellular Ca2+ transport in the intestine and the eggshell gland (ESG); it also considers some of the proteins (calbindin, Ca2+ATPase, Na+/Ca2+ exchange, epithelial calcium channels (TRPVs), osteopontin and carbonic anhydrase (CA) associated with this phenomenon. Calbindins are discussed in some detail, as they appear to be a major component of the transcellular transport system, and as only they have been studied extensively in birds. The review aims to gather old and new knowledge, which could form a conceptual basis, albeit not a completely accepted one, for our understanding of the mechanisms associated with this phenomenon. In the intestine, the transcellular pathway appears to compensate for low Ca2+ intake, but in birds fed adequate calcium the major drive for calcium absorption remains the electrochemical potential difference (ECPD) that facilitates paracellular transport. However, the mechanisms involved in Ca2+ transport into the ESG lumen are not yet established. In the ESG, the presence of Ca2+-ATPase and calbindin--two components of the transcellular transport pathway--and the apparently uphill transport of Ca2+ support the idea that Ca2+ is transported via the transcellular pathway. However, the positive (plasma with respect to mucosa) electrical potential difference (EPD) in the

  6. A mirror transport mechanism for use at cryogenic temperatures

    NASA Technical Reports Server (NTRS)

    Stark, Kenneth W.; Wilson, Meredith

    1986-01-01

    The Mirror Transport Mechanism (MTM), which supports a pair of dihedral mirrors and moves them in a very smooth and uniform scanning motion normal to a beamsplitter is described. Each scan is followed by a quick flyback and repeat. Material selection, design, and testing of all major components of the MTM are discussed. Flex pivot failures during vibration testing, excessive dihedral platform sag under one g operation, electronic and fiber optic characteristics, and tolerancing considerations are covered. Development of the mechanism has reached the final phase of thermal and vibration qualification. Environmental testing of the complete FIRAS experiment is just beginning.

  7. Mechanisms of vitamin K transport and metabolism in Swiss 3T3 mouse fibroblasts

    SciTech Connect

    Canfield, L.M.; Townsend, A.F.; Hibbs, D.B.

    1986-03-01

    Transport of vitamin K into isolated fibroblasts was followed using /sup 3/H vitamin K/sub 1/. The initial rate is saturable by 5 min. at 25..mu..M vitamin K with a Km(app) of 10..mu..M and V/sub max/ of 50 pmols/min/10/sup 6/ cells. Kinetics of uptake are biphasic with a second slower rate ensuing after 10 minutes. Insensitivity of the initial rate of uptake to FCCP or ouabain indicates an ATP-independent transport mechanism. Specificity of transport is shown by competition of uptake of /sup 3/H vitamin K by unlabelled vitamin and strong (>90%) inhibition of the initial rate by equimolar concentrations of the vitamin K analog, Chloro-K. In addition, following uptake, both vitamins K/sub 1/ and K/sub 2/ are metabolized to their respective epoxides. Vitamin K/sub 1/ epoxide is also transported into fibroblasts and metabolized to the parent quinone in a Warfarin-sensitive reaction. Following alkaline hydrolysis of isolated intracellular protein, the vitamin K-dependent amino acid, gamma carboxyglutamic acid (gla) was detected. It is concluded that vitamin K is specifically transported into fibroblasts and metabolized via the classical pathway described in liver with the concomitant production of vitamin K-dependent proteins.

  8. Mechanism of electrodialytic ion transport through solvent extraction membranes

    SciTech Connect

    Moskvin, L.N.; Shmatko, A.G.; Krasnoperov, V.M.

    1987-02-01

    The authors construct a mathematical model for electrodialysis and solvent extraction via an ion-selective ion exchange membrane and accounts for the electrochemical, ion exchange, and diffusional behavior of the processes including their dependence on component concentration and current and voltage. The model is tested against experimental data for the electrodialytic transport of anionic platinum complexes of chlorides from hydrochloric acid solution through tributylphosphate membranes. The platinum concentration in the aqueous solution was determined by gamma spectroscopy obtained via platinum 191 as a radiotracer.

  9. Increased Rat Placental Fatty Acid, but Decreased Amino Acid and Glucose Transporters Potentially Modify Intrauterine Programming.

    PubMed

    Nüsken, Eva; Gellhaus, Alexandra; Kühnel, Elisabeth; Swoboda, Isabelle; Wohlfarth, Maria; Vohlen, Christina; Schneider, Holm; Dötsch, Jörg; Nüsken, Kai-Dietrich

    2016-07-01

    Regulation of placental nutrient transport significantly affects fetal development and may modify intrauterine growth restriction (IUGR) and fetal programming. We hypothesized that placental nutrient transporters are differentially affected both by utero-placental insufficiency and prenatal surgical stress. Pregnant rats underwent bilateral uterine artery and vein ligation (LIG), sham operation (SOP) or no operation (controls, C) on gestational day E19. Placentas were obtained by caesarean section 4 h (LIG, n=20 placentas; SOP, n=24; C, n=12), 24 h (LIG, n=28; SOP, n=20; C, n=12) and 72 h (LIG, n=20; SOP, n=20; C, n=24) after surgery. Gene and protein expression of placental nutrient transporters for fatty acids (h-FABP, CD36), amino acids (SNAT1, SNAT2) and glucose (GLUT-1, Connexin 26) were examined by qRT-PCR, western blot and immunohistochemistry. Interestingly, the mean protein expression of h-FABP was doubled in placentas of LIG and SOP animals 4, 24 (SOP significant) and 72 h (SOP significant) after surgery. CD36 protein was significantly increased in LIG after 72 h. SNAT1 and SNAT2 protein and gene expressions were significantly reduced in LIG and SOP after 24 h. Further significantly reduced proteins were GLUT-1 in LIG (4 h, 72 h) and SOP (24 h), and Connexin 26 in LIG (72 h). In conclusion, placental nutrient transporters are differentially affected both by reduced blood flow and stress, probably modifying the already disturbed intrauterine milieu and contributing to IUGR and fetal programming. Increased fatty acid transport capacity may affect energy metabolism and could be a compensatory reaction with positive effects on brain development. J. Cell. Biochem. 117: 1594-1603, 2016. © 2015 Wiley Periodicals, Inc.

  10. Insights into transport mechanism from LeuT engineered to transport tryptophan.

    PubMed

    Piscitelli, Chayne L; Gouaux, Eric

    2012-01-04

    LeuT is a bacterial homologue of the neurotransmitter:sodium symporter (NSS) family and, being the only NSS member to have been structurally characterized by X-ray crystallography, is a model protein for studying transporter structure and mechanism. Transport activity in LeuT was hypothesized to require structural transitions between open-to-out and occluded conformations dependent upon protein:ligand binding complementarity. Here, using crystallographic and functional analysis, we show that binding site modification produces changes in both structure and activity that are consistent with complementarity-dependent structural transitions to the occluded state. The mutation I359Q converts the activity of tryptophan from inhibitor to transportable substrate. This mutation changes the local environment of the binding site, inducing the bound tryptophan to adopt a different conformer than in the wild-type complex. Instead of trapping the transporter open, tryptophan binding now allows the formation of an occluded state. Thus, transport activity is correlated to the ability of the ligand to promote the structural transition to the occluded state, a step in the transport cycle that is dependent on protein:ligand complementarity in the central binding site.

  11. Insights into transport mechanism from LeuT engineered to transport tryptophan

    SciTech Connect

    Piscitelli, Chayne L.; Gouaux, Eric

    2012-01-10

    LeuT is a bacterial homologue of the neurotransmitter:sodium symporter (NSS) family and, being the only NSS member to have been structurally characterized by X-ray crystallography, is a model protein for studying transporter structure and mechanism. Transport activity in LeuT was hypothesized to require structural transitions between open-to-out and occluded conformations dependent upon protein:ligand binding complementarity. Here, using crystallographic and functional analysis, we show that binding site modification produces changes in both structure and activity that are consistent with complementarity-dependent structural transitions to the occluded state. The mutation I359Q converts the activity of tryptophan from inhibitor to transportable substrate. This mutation changes the local environment of the binding site, inducing the bound tryptophan to adopt a different conformer than in the wild-type complex. Instead of trapping the transporter open, tryptophan binding now allows the formation of an occluded state. Thus, transport activity is correlated to the ability of the ligand to promote the structural transition to the occluded state, a step in the transport cycle that is dependent on protein:ligand complementarity in the central binding site.

  12. Assessment of Amino Acid/Drug Transporters for Renal Transport of [18F]Fluciclovine (anti-[18F]FACBC) in Vitro

    PubMed Central

    Ono, Masahiro; Baden, Atsumi; Okudaira, Hiroyuki; Kobayashi, Masato; Kawai, Keiichi; Oka, Shuntaro; Yoshimura, Hirokatsu

    2016-01-01

    [18F]Fluciclovine (trans-1-amino-3-[18F]fluorocyclobutanecarboxylic acid; anti-[18F]FACBC), a positron emission tomography tracer used for the diagnosis of recurrent prostate cancer, is transported via amino acid transporters (AATs) with high affinity (Km: 97–230 μM). However, the mechanism underlying urinary excretion is unknown. In this study, we investigated the involvement of AATs and drug transporters in renal [18F]fluciclovine reuptake. [14C]Fluciclovine (trans-1-amino-3-fluoro[1-14C]cyclobutanecarboxylic acid) was used because of its long half-life. The involvement of AATs in [14C]fluciclovine transport was measured by apical-to-basal transport using an LLC-PK1 monolayer as model for renal proximal tubules. The contribution of drug transporters herein was assessed using vesicles/cells expressing the drug transporters P-glycoprotein (P-gp), breast cancer resistance protein (BCRP), multidrug resistance-associated protein 4 (MRP4), organic anion transporter 1 (OAT1), organic anion transporter 3 (OAT3) , organic cation transporter 2 (OCT2), organic anion transporting polypeptide 1B1 (OATP1B1), and organic anion transporting polypeptide 1B3 (OATP1B3). The apical-to-basal transport of [14C]fluciclovine was attenuated by l-threonine, the substrate for system alanine-serine-cysteine (ASC) AATs. [14C]Fluciclovine uptake by drug transporter-expressing vesicles/cells was not significantly different from that of control vesicles/cells. Fluciclovine inhibited P-gp, MRP4, OAT1, OCT2, and OATP1B1 (IC50 > 2.95 mM). Therefore, system ASC AATs may be partly involved in the renal reuptake of [18F]fluciclovine. Further, given that [18F]fluciclovine is recognized as an inhibitor with millimolar affinity for the tested drug transporters, slow urinary excretion of [18F]fluciclovine may be mediated by system ASC AATs, but not by drug transporters. PMID:27754421

  13. Induction of amino acid transporters expression by endurance exercise in rat skeletal muscle

    SciTech Connect

    Murakami, Taro Yoshinaga, Mariko

    2013-10-04

    Highlights: •Regulation of amino acid transporter expression in working muscle remains unclear. •Expression of amino acid transporters for leucine were induced by a bout of exercise. •Requirement of leucine in muscle cells might regulate expression of its transporters. •This information is beneficial for understanding the muscle remodeling by exercise. -- Abstract: We here investigated whether an acute bout of endurance exercise would induce the expression of amino acid transporters that regulate leucine transport across plasma and lysosomal membranes in rat skeletal muscle. Rats ran on a motor-driven treadmill at a speed of 28 m/min for 90 min. Immediately after the exercise, we observed that expression of mRNAs encoding L-type amino acid transporter 1 (LAT1) and CD98 was induced in the gastrocnemius, soleus, and extensor digitorum longus (EDL) muscles. Sodium-coupled neutral amino acid transporter 2 (SNAT2) mRNA was also induced by the exercise in those three muscles. Expression of proton-assisted amino acid transporter 1 (PAT1) mRNA was slightly but not significantly induced by a single bout of exercise in soleus and EDL muscles. Exercise-induced mRNA expression of these amino acid transporters appeared to be attenuated by repeated bouts of the exercise. These results suggested that the expression of amino acid transporters for leucine may be induced in response to an increase in the requirement for this amino acid in the cells of working skeletal muscles.

  14. A branched chain amino acid metabolite drives vascular transport of fat and causes insulin resistance

    PubMed Central

    Jang, Cholsoon; Oh, Sungwhan F; Wada, Shogo; Rowe, Glenn C; Liu, Laura; Chan, Mun Chun; Rhee, James; Hoshino, Atsushi; Kim, Boa; Ibrahim, Ayon; Baca, Luisa G; Kim, Esl; Ghosh, Chandra C; Parikh, Samir M; Jiang, Aihua; Chu, Qingwei; Forman, Daniel E.; Lecker, Stewart H.; Krishnaiah, Saikumari; Rabinowitz, Joshua D; Weljie, Aalim M; Baur, Joseph A; Kasper, Dennis L; Arany, Zoltan

    2016-01-01

    Epidemiological and experimental data implicate branched chain amino acids (BCAAs) in the development of insulin resistance, but the mechanisms underlying this link remain unclear.1–3 Insulin resistance in skeletal muscle stems from excess accumulation of lipid species4, a process that requires blood-borne lipids to first traverse the blood vessel wall. Little is known, however, of how this trans-endothelial transport occurs or is regulated. Here, we leverage PGC-1α, a transcriptional coactivator that regulates broad programs of FA consumption, to identify 3-hydroxy-isobutyrate (3-HIB), a catabolic intermediate of the BCAA valine, as a novel paracrine regulator of trans-endothelial fatty acids (FA) transport. 3-HIB is secreted from muscle cells, activates endothelial FA transport, stimulates muscle FA uptake in vivo, and promotes muscle lipid accumulation and insulin resistance in animals. Conversely, inhibiting the synthesis of 3-HIB in muscle cells blocks the promotion of endothelial FA uptake. 3-HIB levels are elevated in muscle from db/db mice and from subjects with diabetes. These data thus unveil a novel mechanism that regulates trans-endothelial flux of FAs, revealing 3-HIB as a new bioactive signaling metabolite that links the regulation of FA flux to BCAA catabolism and provides a mechanistic explanation for how increased BCAA catabolic flux can cause diabetes. PMID:26950361

  15. Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120

    PubMed Central

    Pernil, Rafael; Picossi, Silvia; Herrero, Antonia; Flores, Enrique; Mariscal, Vicente

    2015-01-01

    Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium that can use inorganic compounds such as nitrate or ammonium as nitrogen sources. In the absence of combined nitrogen, it can fix N2 in differentiated cells called heterocysts. Anabaena also shows substantial activities of amino acid uptake, and three ABC-type transporters for amino acids have been previously characterized. Seven new loci encoding predicted amino acid transporters were identified in the Anabaena genomic sequence and inactivated. Two of them were involved in amino acid uptake. Locus alr2535-alr2541 encodes the elements of a hydrophobic amino acid ABC-type transporter that is mainly involved in the uptake of glycine. ORF all0342 encodes a putative transporter from the dicarboxylate/amino acid:cation symporter (DAACS) family whose inactivation resulted in an increased uptake of a broad range of amino acids. An assay to study amino acid release from Anabaena filaments to the external medium was set up. Net release of the alanine analogue α-aminoisobutyric acid (AIB) was observed when transport system N-I (a hydrophobic amino acid ABC-type transporter) was engaged in the uptake of a specific substrate. The rate of AIB release was directly proportional to the intracellular AIB concentration, suggesting leakage from the cells by diffusion. PMID:25915115

  16. Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120.

    PubMed

    Pernil, Rafael; Picossi, Silvia; Herrero, Antonia; Flores, Enrique; Mariscal, Vicente

    2015-04-23

    Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium that can use inorganic compounds such as nitrate or ammonium as nitrogen sources. In the absence of combined nitrogen, it can fix N2 in differentiated cells called heterocysts. Anabaena also shows substantial activities of amino acid uptake, and three ABC-type transporters for amino acids have been previously characterized. Seven new loci encoding predicted amino acid transporters were identified in the Anabaena genomic sequence and inactivated. Two of them were involved in amino acid uptake. Locus alr2535-alr2541 encodes the elements of a hydrophobic amino acid ABC-type transporter that is mainly involved in the uptake of glycine. ORF all0342 encodes a putative transporter from the dicarboxylate/amino acid:cation symporter (DAACS) family whose inactivation resulted in an increased uptake of a broad range of amino acids. An assay to study amino acid release from Anabaena filaments to the external medium was set up. Net release of the alanine analogue α-aminoisobutyric acid (AIB) was observed when transport system N-I (a hydrophobic amino acid ABC-type transporter) was engaged in the uptake of a specific substrate. The rate of AIB release was directly proportional to the intracellular AIB concentration, suggesting leakage from the cells by diffusion.

  17. Enhanced charge transport in highly conducting PEDOT-PSS films after acid treatment

    NASA Astrophysics Data System (ADS)

    Shiva, V. Akshaya; Bhatia, Ravi; Menon, Reghu

    The high electrical conductivity, good stability, high strength, flexibility and good transparency of poly(3,4-ethylenedioxythiophene)-poly(styrenesulfonate) (PEDOT-PSS), make it useful for many applications including polymeric anodes for organic photovoltaics, light-emitting diodes, flexible electrodes, supercapacitors, electrochromic devices, field-effect transistors and antistatic-coatings. However, the electrical conductivity of PEDOT-PSS has to be increased significantly for replacement of indium tin oxide (ITO) as the transparent electrode in optoelectronic devices. The as prepared (pristine) PEDOT-PSS film prepared from the PEDOT-PSS aqueous solution usually has conductivity below 1Scm-1, remarkably lower than ITO. Significant conductivity enhancement has been observed on transparent and conductive PEDOT-PSS films after a treatment with inorganic acids. Our study investigates the charge transport in pristine and H2SO4, HNO3, HCl treated PEDOT-PSS films. We have treated the films with various concentrations of acids to probe the effect of the acid treatment on the conduction mechanism. The study includes the measurement of dc and electric field dependent conductivity of films in the temperature range of 4.2K-300K. We have also performed magneto-resistance measurements in the range of 0-5T. An enhancement by a factor of~103 has been observed in the room temperature conductivity. The detailed magneto-transport studies explain the various mechanisms for the conductivity enhancement observed.

  18. Impact of Microbial Growth on Subsurface Perfluoroalkyl Acid Transport

    NASA Astrophysics Data System (ADS)

    Weathers, T. S.; Higgins, C. P.; Sharp, J.

    2014-12-01

    The fate and transport of poly and perfluoroalkyl substances (PFASs) in the presence of active microbial communities has not been widely investigated. These emerging contaminants are commonly utilized in aqueous film-forming foams (AFFF) and have often been detected in groundwater. This study explores the transport of a suite of perfluorocarboxylic acids and perfluoroalkylsulfonates, including perfluorooctanoic acid (PFOA) and perfluorooctane sulfonate (PFOS), in microbially active settings. Single point organic carbon normalized sorption coefficients derived by exposing inactive cellular material to PFASs result in more than an order of magnitude increase in sorption compared to soil organic carbon sorption coefficients found in literature. For example, the sorption coefficients for PFOS are 4.05±0.07 L/kg and 2.80±0.08 L/kg for cellular organic carbon and soil organic carbon respectively. This increase in sorption, coupled with enhanced extracellular polymeric substance production observed during growth of a common hydrocarbon degrading soil microbe exposed to source-level concentrations of PFASs (10 mg/L of 11 analytes, 110 mg/L total) may result in PFAS retardation in situ. To address the upscaling of this phenomenon, flow-through columns packed with low-organic carbon sediment and biostimulated with 10 mg/L glucose were exposed to PFAS concentrations from 15 μg/L to 10 mg/L of each 11 analytes. Breakthrough and tailing of each analyte was measured and modeled with Hydrus-1D to explore sorption coefficients over time for microbially active columns.

  19. Transport of. cap alpha. -aminoisobutyric acid by Streptococcus pyogenes and its derived L-form

    SciTech Connect

    Reizer, J.; Panos, C.

    1982-01-01

    We studied the uptake of ..cap alpha..-aminoisobutyric acid (AIB) in Streptococcus pyogenes and its physiologically isotonic L-form. S. pyogenes cells starved for glucose or treated with carbonyl cyanide-m-chlorophenyl hydrazone accumulated limited amounts of AIB. A high apparent K/sub m/ value characterized the glucose-independent transport of AIB. The rate and extent of AIB accumulation significantly increased in the presence of glucose. Two saturable transport components with distinct apparent K/sub m/values characterized glycolysis-coupled transport of AIB. A biphasic Lineweaver-Burk plot was also obtained for L-alanine transport by glycolyzing S. pyogenes cells. AIB seems to share a common transport system(s) with glycine, L- and D-anine, L-serine, and L-valine. This was shown by the competitive exchange efflux of accumulated AIB. About 30% of the AIB uptake was not inhibited by a saturating amount of L-valine, indicating the existence of more than one system for AIB transport, p-Chloromercuribenzoate markedly inhibited the accumulation of AIB by both glycolyzing and glucose-starved cells. In contrast, carbonyl cyanide-m-chlorophenyl hydrazone affected only metabolism-dependent uptake of AIB, which was also sensitive to dinitrophenol, N-ethylmaleimide, iodoacetate, fluoride (NaF), arsenate, and N,N'-dicyclohexylcarbodiimide. These results are interpreted according to the chemiosmotic theory of Mitchell, whereby a proton motive force constitutes the driving force for AIB accumulation. AIB was not accumulated by the L-form. However, a temporary accumulation of AIB by a counterflow mechanism and a saturable system with a low apparent affinity were demonstrated for AIB transport by this organism. We suggest that a deficiency in the coupling of energy to AIB transport is responsible for the apparent lack of active AIB accumulation by the L-form.

  20. Few Amino Acid Exchanges Expand the Substrate Spectrum of Monocarboxylate Transporter 10.

    PubMed

    Johannes, Jörg; Braun, Doreen; Kinne, Anita; Rathmann, Daniel; Köhrle, Josef; Schweizer, Ulrich

    2016-07-01

    Monocarboxylate transporters (MCTs) belong to the SLC16 family within the major facilitator superfamily of transmembrane transporters. MCT8 is a thyroid hormone transporter mutated in the Allan-Herndon-Dudley syndrome, a severe psychomotor retardation syndrome. MCT10 is closely related to MCT8 and is known as T-type amino acid transporter. Both transporters mediate T3 transport, but although MCT8 also transports rT3 and T4, these compounds are not efficiently transported by MCT10, which, in contrast, transports aromatic amino acids. Based on the 58% amino acid identity within the transmembrane regions among MCT8 and MCT10, we reasoned that substrate specificity may be primarily determined by a small number of amino acid differences between MCT8 and MCT10 along the substrate translocation channel. Inspecting the homology model of MCT8 and a structure-guided alignment between both proteins, we selected 8 amino acid positions and prepared chimeric MCT10 proteins with selected amino acids changed to the corresponding amino acids in MCT8. The MCT10 mutant harboring 8 amino acid substitutions was stably expressed in Madin-Darby canine kidney 1 cells and found to exhibit T4 transport activity. We then successively reduced the number of amino acid substitutions and eventually identified a minimal set of 2-3 amino acid exchanges which were sufficient to allow T4 transport. The resulting MCT10 chimeras exhibited KM values for T4 similar to MCT8 but transported T4 at a slower rate. The acquisition of T4 transport by MCT10 was associated with complete loss of the capacity to transport Phe, when Tyr184 was mutated to Phe.

  1. The transport mechanism of the integer quantum Hall effect

    NASA Astrophysics Data System (ADS)

    Hui, Tan; LiMing, W.; Liang, Shi-Dong

    2016-11-01

    The integer quantum Hall effect (IQHE) is analysed using a mechanism of the electron transport in the form of semi-classic wave packages in this paper. Due to the confinement of the edges of a slab the Landau levels of electrons in a strong magnetic field go up at large wave-vectors to form energy bands. The slopes of the energy bands give the group velocities of electron wave packages and thus contribute to the current. Certain magnetic fields separate the electron transport in the slab into two branches with opposite and large wave vectors, which are localized at the two edges of the slab, respectively. In this case back scattering of electrons is prohibited due to the localization of these two branches. Thus the slab exhibits zero longitudinal resistance and plateaus of Hall resistance. When the Fermi level is sweeping over a Landau level at some magnetic fields, however, the electron waves locate around the central axis of the slab and overlap each other thus back scattering of electrons takes place frequently. Then longitudinal resistance appears and the Hall resistance goes up from one plateau to a new one. This transport mechanism is much clearer and more intuitive than the conventional explanations to the IQHE.

  2. Evaporation as the transport mechanism of metals in arid regions.

    PubMed

    Lima, Ana T; Safar, Zeinab; Loch, J P Gustav

    2014-09-01

    Soils of arid regions are exposed to drought and drastic temperature oscillations throughout the year. Transport mechanisms in these soils are therefore very different from the ones in temperate regions, where rain dictates the fate of most elements in soils. Due to the low rainfall and high evaporation rates in arid regions, groundwater quality is not threatened and all soil contamination issues tend to be overlooked. But if soil contamination happens, where do contaminants go? This study tests the hypothesis of upward metal movement in soils when evaporation is the main transport mechanism. Laboratory evaporation tests were carried out with heavy metal spiked Saudi soil, using circulation of air as the driving force (Fig. 1). Main results show that loamy soil retains heavy metals quite well while evaporation drives heavy metals to the surface of a sandy soil. Evaporation transports heavy metals upward in sandy soils of arid regions, making them accumulate at the soil surface. Sand being the dominating type of soil in arid regions, soils can then be a potential source of contaminated aerosols and atmospheric pollution - a transboundary problem. Some other repercussions for this problem are foreseen, such as the public ingestion or inhalation of dust.

  3. Molecular Mechanisms of Phosphorus Metabolism and Transport during Leaf Senescence

    PubMed Central

    Stigter, Kyla A.; Plaxton, William C.

    2015-01-01

    Leaf senescence, being the final developmental stage of the leaf, signifies the transition from a mature, photosynthetically active organ to the attenuation of said function and eventual death of the leaf. During senescence, essential nutrients sequestered in the leaf, such as phosphorus (P), are mobilized and transported to sink tissues, particularly expanding leaves and developing seeds. Phosphorus recycling is crucial, as it helps to ensure that previously acquired P is not lost to the environment, particularly under the naturally occurring condition where most unfertilized soils contain low levels of soluble orthophosphate (Pi), the only form of P that roots can directly assimilate from the soil. Piecing together the molecular mechanisms that underpin the highly variable efficiencies of P remobilization from senescing leaves by different plant species may be critical for devising effective strategies for improving overall crop P-use efficiency. Maximizing Pi remobilization from senescing leaves using selective breeding and/or biotechnological strategies will help to generate P-efficient crops that would minimize the use of unsustainable and polluting Pi-containing fertilizers in agriculture. This review focuses on the molecular mechanisms whereby P is remobilized from senescing leaves and transported to sink tissues, which encompasses the action of hormones, transcription factors, Pi-scavenging enzymes, and Pi transporters. PMID:27135351

  4. Quantum-mechanical transport equation for atomic systems.

    NASA Technical Reports Server (NTRS)

    Berman, P. R.

    1972-01-01

    A quantum-mechanical transport equation (QMTE) is derived which should be applicable to a wide range of problems involving the interaction of radiation with atoms or molecules which are also subject to collisions with perturber atoms. The equation follows the time evolution of the macroscopic atomic density matrix elements of atoms located at classical position R and moving with classical velocity v. It is quantum mechanical in the sense that all collision kernels or rates which appear have been obtained from a quantum-mechanical theory and, as such, properly take into account the energy-level variations and velocity changes of the active (emitting or absorbing) atom produced in collisions with perturber atoms. The present formulation is better suited to problems involving high-intensity external fields, such as those encountered in laser physics.

  5. Molecular Transport Mechanisms for Associating and Solvating Penetrant in Polymers

    DTIC Science & Technology

    2007-11-02

    PIB ) at different vapor activities in order to understand complex diffusion mechanisms and probe molecular structures above the glass tranisition. The...the individual diffusion coefficients can be separated and that they are equal to each other for the acetic acid/ PIB system. The values of the...BOH) mixtures in polyisobutylene ( PIB ) was studied at varying mixture compositions. Diffusion coefficients and hydrogen bonding interactions were

  6. Cadmium in rice: Transport mechanisms, influencing factors, and minimizing measures.

    PubMed

    Li, Hui; Luo, Na; Li, Yan Wen; Cai, Quan Ying; Li, Hui Yuan; Mo, Ce Hui; Wong, Ming Hung

    2017-05-01

    Cadmium (Cd) accumulation in rice and its subsequent transfer to food chain is a major environmental issue worldwide. Understanding of Cd transport processes and its management aiming to reduce Cd uptake and accumulation in rice may help to improve rice growth and grain quality. Moreover, a thorough understanding of the factors influencing Cd accumulation will be helpful to derive efficient strategies to minimize Cd in rice. In this article, we reviewed Cd transport mechanisms in rice, the factors affecting Cd uptake (including physicochemical characters of soil and ecophysiological features of rice) and discussed efficient measures to immobilize Cd in soil and reduce Cd uptake by rice (including agronomic practices, bioremediation and molecular biology techniques). These findings will contribute to ensuring food safety, and reducing Cd risk on human beings.

  7. Mechanical Fatigue Testing of High Burnup Fuel for Transportation Applications

    SciTech Connect

    Wang, Jy-An John; Wang, Hong

    2015-05-01

    This report describes testing designed to determine the ability of high burnup (HBU) (>45 GWd/MTU) spent fuel to maintain its integrity under normal conditions of transportation. An innovative system, Cyclic Integrated Reversible-bending Fatigue Tester (CIRFT), has been developed at Oak Ridge National Laboratory (ORNL) to test and evaluate the mechanical behavior of spent nuclear fuel (SNF) under conditions relevant to storage and transportation. The CIRFT system is composed of a U-frame equipped with load cells for imposing the pure bending loads on the SNF rod test specimen and measuring the in-situ curvature of the fuel rod during bending using a set up with three linear variable differential transformers (LVDTs).

  8. Electron transport mechanisms in polymer-carbon sphere composites

    NASA Astrophysics Data System (ADS)

    Nieves, Cesar A.; Ramos, Idalia; Pinto, Nicholas J.; Zimbovskaya, Natalya A.

    2016-07-01

    A set of uniform carbon microspheres (CSs) whose diameters have the order of 0.125 μm to 10 μm was prepared from aqueous sucrose solution by means of hydrothermal carbonization of sugar molecules. A pressed pellet was composed by mixing CSs with polyethylene oxide (PEO). Electrical characterization of the pellet was carried out showing Ohmic current-voltage characteristics and temperature-dependent conductivity in the range of 80 K mechanisms of electron transport. It was shown that thermally induced electron tunneling between adjacent spheres may take on an important part in the electron transport through the CS/PEO composites.

  9. The transport of uric acid across mouse small intestine in vitro.

    PubMed Central

    Bronk, J R; Shaw, M I

    1986-01-01

    The in vitro recirculation technique was used to study the uptake and transport of uric acid by the jejunum of mouse small intestine. Three components of the serosal secretions appeared to be endogenously derived nucleic acid derivatives; two of these were identified as uric acid and uracil. There was no detectable metabolism of uric acid by the intestine. Uric acid transported from the lumen appeared in the serosal fluid at a concentration higher than that in the lumen. The final serosal/luminal concentration ratio of about 1.18 for exogenous uric acid was found to be constant over the concentration range studied (0.01-0.1 mM). The presence of exogenous uric acid in the lumen did not affect the production of endogenous uric acid by the intestine and its release into the serosal secretions. Mucosal concentration of exogenous uric acid was below, but the total mucosal concentration (exogenous+endogenous) was above, that in the lumen. There was no evidence for the secretion of endogenous uric acid into the lumen. Oxypurinol significantly decreased the rate of serosal appearance of exogenous uric acid. Allopurinol did not affect the transport of exogenous uric acid from the lumen and there was negligible metabolism of allopurinol to oxypurinol by the tissue. Uracil did not affect the transport of exogenous uric acid from the lumen, or the serosal appearance of endogenous uric acid. Likewise uracil transport was unaffected by luminal uric acid. PMID:3795104

  10. Mechanism of travelling-wave transport of particles

    NASA Astrophysics Data System (ADS)

    Kawamoto, Hiroyuki; Seki, Kyogo; Kuromiya, Naoyuki

    2006-03-01

    Numerical and experimental investigations have been carried out on transport of particles in an electrostatic travelling field. A three-dimensional hard-sphere model of the distinct element method was developed to simulate the dynamics of particles. Forces applied to particles in the model were the Coulomb force, the dielectrophoresis force on polarized dipole particles in a non-uniform field, the image force, gravity and the air drag. Friction and repulsion between particle-particle and particle-conveyer were included in the model to replace initial conditions after mechanical contacts. Two kinds of experiments were performed to confirm the model. One was the measurement of charge of particles that is indispensable to determine the Coulomb force. Charge distribution was measured from the locus of free-fallen particles in a parallel electrostatic field. The averaged charge of the bulk particle was confirmed by measurement with a Faraday cage. The other experiment was measurements of the differential dynamics of particles on a conveyer consisting of parallel electrodes to which a four-phase travelling electrostatic wave was applied. Calculated results agreed with measurements, and the following characteristics were clarified. (1) The Coulomb force is the predominant force to drive particles compared with the other kinds of forces, (2) the direction of particle transport did not always coincide with that of the travelling wave but changed partially. It depended on the frequency of the travelling wave, the particle diameter and the electric field, (3) although some particles overtook the travelling wave at a very low frequency, the motion of particles was almost synchronized with the wave at the low frequency and (4) the transport of some particles was delayed to the wave at medium frequency; the majority of particles were transported backwards at high frequency and particles were not transported but only vibrated at very high frequency.

  11. Butyric acid increases transepithelial transport of ferulic acid through upregulation of the monocarboxylate transporters SLC16A1 (MCT1) and SLC16A3 (MCT4).

    PubMed

    Ziegler, Kerstin; Kerimi, Asimina; Poquet, Laure; Williamson, Gary

    2016-06-01

    Ferulic acid is released by microbial hydrolysis in the colon, where butyric acid, a major by-product of fermentation, constitutes the main energy source for colonic enterocytes. We investigated how varying concentrations of this short chain fatty acid may influence the absorption of the phenolic acid. Chronic treatment of Caco-2 cells with butyric acid resulted in increased mRNA and protein abundance of the monocarboxylate transporters SLC16A1 (MCT1) and SLC16A3 (MCT4), previously proposed to facilitate ferulic acid absorption in addition to passive diffusion. Short term incubation with butyric acid only led to upregulation of MCT4 while both conditions increased transepithelial transport of ferulic acid in the apical to basolateral, but not basolateral to apical, direction. Chronic treatment also elevated intracellular concentrations of ferulic acid, which in turn gave rise to increased concentrations of ferulic acid metabolites. Immunofluorescence staining of cells revealed uniform distribution of MCT1 protein in the cell membrane, whereas MCT4 was only detected in the lateral plasma membrane sections of Caco-2 cells. We therefore propose that MCT1 may be acting as an uptake transporter and MCT4 as an efflux system across the basolateral membrane for ferulic acid, and that this process is stimulated by butyric acid.

  12. Molecular mechanism and functional significance of acid generation in the Drosophila midgut

    PubMed Central

    Overend, Gayle; Luo, Yuan; Henderson, Louise; Douglas, Angela E.; Davies, Shireen A.; Dow, Julian A. T.

    2016-01-01

    The gut of Drosophila melanogaster includes a proximal acidic region (~pH 2), however the genome lacks the H+/K+ ATPase characteristic of the mammalian gastric parietal cell, and the molecular mechanisms of acid generation are poorly understood. Here, we show that maintenance of the low pH of the acidic region is dependent on H+ V-ATPase, together with carbonic anhydrase and five further transporters or channels that mediate K+, Cl− and HCO3− transport. Abrogation of the low pH did not influence larval survival under standard laboratory conditions, but was deleterious for insects subjected to high Na+ or K+ load. Insects with elevated pH in the acidic region displayed increased susceptibility to Pseudomonas pathogens and increased abundance of key members of the gut microbiota (Acetobacter and Lactobacillus), suggesting that the acidic region has bacteriostatic or bacteriocidal activity. Conversely, the pH of the acidic region was significantly reduced in germ-free Drosophila, indicative of a role of the gut bacteria in shaping the pH conditions of the gut. These results demonstrate that the acidic gut region protects the insect and gut microbiome from pathological disruption, and shed light on the mechanisms by which low pH can be maintained in the absence of H+, K+ ATPase. PMID:27250760

  13. Low- and high-affinity transport systems for citric acid in the yeast Candida utilis.

    PubMed Central

    Cássio, F; Leáo, C

    1991-01-01

    Citric acid-grown cells of the yeast Candida utilis induced two transport systems for citric acid, presumably a proton symport and a facilitated diffusion system for the charged and the undissociated forms of the acid, respectively. Both systems could be observed simultaneously when the transport was measured at 25 degrees C with labelled citric acid at pH 3.5 with the following kinetic parameters: for the low-affinity system, Vmax, 1.14 nmol of undissociated citric acid s-1 mg (dry weight) of cells-1, and Km, 0.59 mM undissociated acid; for the high-affinity system, Vmax, 0.38 nmol of citrate s-1 mg (dry weight) of cells-1, and Km, 0.056 mM citrate. At high pH values (above 5.0), the low-affinity system was absent or not measurable. The two transport systems exhibited different substrate specificities. Isocitric acid was a competitive inhibitor of citric acid for the high-affinity system, suggesting that these tricarboxylic acids used the same transport system, while aconitic, tricarballylic, trimesic, and hemimellitic acids were not competitive inhibitors. With respect to the low-affinity system, isocitric acid, L-lactic acid, and L-malic acid were competitive inhibitors, suggesting that all of these mono-, di-, and tricarboxylic acids used the same low-affinity transport system. The two transport systems were repressed by glucose, and as a consequence diauxic growth was observed. Both systems were inducible, and not only citric acid but also lactic acid and malic acid may induce those transport systems. The induction of both systems was not dependent on the relative concentration of the anionic form(s) and of undissociated citric acid in the culture medium.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1664712

  14. Cationic amino acid transporters play key roles in the survival and transmission of apicomplexan parasites

    PubMed Central

    Rajendran, Esther; Hapuarachchi, Sanduni V.; Miller, Catherine M.; Fairweather, Stephen J.; Cai, Yeping; Smith, Nicholas C.; Cockburn, Ian A.; Bröer, Stefan; Kirk, Kiaran; van Dooren, Giel G.

    2017-01-01

    Apicomplexans are obligate intracellular parasites that scavenge essential nutrients from their hosts via transporter proteins on their plasma membrane. The identities of the transporters that mediate amino acid uptake into apicomplexans are unknown. Here we demonstrate that members of an apicomplexan-specific protein family—the Novel Putative Transporters (NPTs)—play key roles in the uptake of cationic amino acids. We show that an NPT from Toxoplasma gondii (TgNPT1) is a selective arginine transporter that is essential for parasite survival and virulence. We also demonstrate that a homologue of TgNPT1 from the malaria parasite Plasmodium berghei (PbNPT1), shown previously to be essential for the sexual gametocyte stage of the parasite, is a cationic amino acid transporter. This reveals a role for cationic amino acid scavenging in gametocyte biology. Our study demonstrates a critical role for amino acid transporters in the survival, virulence and life cycle progression of these parasites. PMID:28205520

  15. Intestinal transport of zinc and folic acid: a mutual inhibitory effect

    SciTech Connect

    Ghishan, F.K.; Said, H.M.; Wilson, P.C.; Murrell, J.E.; Greene, H.L.

    1986-02-01

    Recent observations suggest an inverse relationship between folic acid intake and zinc nutriture and indicate an interaction between folic acid and zinc at the intestinal level. To define that interaction, we designed in vivo and in vitro transport studies in which folic acid transport in the presence of zinc, as well as zinc transport in the presence of folic acid was examined. These studies show that zinc transport is significantly decreased when folate is present in the intestinal lumen. Similarly folic acid transport is significantly decreased with the presence of zinc. To determine whether this intestinal inhibition is secondary to zinc and folate-forming complexes, charcoal-binding studies were performed. These studies indicate that zinc and folate from complexes at pH 2.0, but that at pH 6.0, these complexes dissolve. Therefore, our studies suggest that under normal physiological conditions a mutual inhibition between folate and zinc exists at the site of intestinal transport.

  16. Cationic amino acid transporters play key roles in the survival and transmission of apicomplexan parasites.

    PubMed

    Rajendran, Esther; Hapuarachchi, Sanduni V; Miller, Catherine M; Fairweather, Stephen J; Cai, Yeping; Smith, Nicholas C; Cockburn, Ian A; Bröer, Stefan; Kirk, Kiaran; van Dooren, Giel G

    2017-02-16

    Apicomplexans are obligate intracellular parasites that scavenge essential nutrients from their hosts via transporter proteins on their plasma membrane. The identities of the transporters that mediate amino acid uptake into apicomplexans are unknown. Here we demonstrate that members of an apicomplexan-specific protein family-the Novel Putative Transporters (NPTs)-play key roles in the uptake of cationic amino acids. We show that an NPT from Toxoplasma gondii (TgNPT1) is a selective arginine transporter that is essential for parasite survival and virulence. We also demonstrate that a homologue of TgNPT1 from the malaria parasite Plasmodium berghei (PbNPT1), shown previously to be essential for the sexual gametocyte stage of the parasite, is a cationic amino acid transporter. This reveals a role for cationic amino acid scavenging in gametocyte biology. Our study demonstrates a critical role for amino acid transporters in the survival, virulence and life cycle progression of these parasites.

  17. Intraparticle mass transport mechanism in activated carbon adsorption of phenols

    SciTech Connect

    Furuya, E.G.; Miura, Y.; Yokomura, H.; Tajima, S.; Yamashita, S.; Chang, H.T.; Noll, K.E.

    1996-10-01

    Two parallel diffusion mechanisms, pore and surface, can control the rate of contaminant adsorption. The two mechanisms are different functions of temperature and adsorbate concentration. To develop a mechanistic design model for adsorption processes, the two mechanisms must be evaluated separately. In this paper, the authors show that the mechanisms can be separated accurately using a stepwise linearization technique. The technique can easily be incorporated in adsorption diffusion modeling. Two phenolic compounds were used in this study: p-chlorophenol (PCP) and p-nitrophenol (PNP). The application of the linearization technique is illustrated using two types of reactors: a completely mixed batch reactor and a differential reactor. The study results show that pore and surface diffusivity can be determined accurately using the linearization technique. Furthermore, the tortuosity for the absorbent can be estimated from the pore diffusivity. For PCP that is strongly adsorbed by the adsorbent, surface diffusion is the dominant mechanism controlling the intraparticle transport. For weakly adsorbed PNP, neither surface nor pore diffusion is dominant.

  18. Osmoregulation in zebrafish: ion transport mechanisms and functional regulation

    PubMed Central

    Guh, Ying-Jey; Lin, Chia-Hao; Hwang, Pung-Pung

    2015-01-01

    Fish, like mammals, have to maintain their body fluid ionic and osmotic homeostasis through sophisticated iono-/osmoregulation mechanisms, which are conducted mainly by ionocytes of the gill (the skin in embryonic stages), instead of the renal tubular cells in mammals. Given the advantages in terms of genetic database availability and manipulation, zebrafish is an emerging model for research into regulatory and integrative physiology. At least five types of ionocytes, HR, NaR, NCC, SLC26, and KS cells, have been identified to carry out Na+ uptake/H+ secretion/NH4+ excretion, Ca2+ uptake, Na+/Cl- uptake, K+ secretion, and Cl- uptake/HCO3- secretion, respectively, through distinct sets of transporters. Several hormones, namely isotocin, prolactin, cortisol, stanniocalcin-1, calcitonin, endothelin-1, vitamin D, parathyorid hormone 1, catecholamines, and the renin-angiotensin-system, have been demonstrated to positively or negatively regulate ion transport through specific receptors at different ionocytes stages, at either the transcriptional/translational or posttranslational level. The knowledge obtained using zebrafish answered many long-term contentious or unknown issues in the field of fish iono-/osmoregulation. The homology of ion transport pathways and hormone systems also means that the zebrafish model informs studies on mammals or other animal species, thereby providing insights into related fields. PMID:26600749

  19. Identification of an allosteric modulator of the serotonin transporter with novel mechanism of action.

    PubMed

    Kortagere, Sandhya; Fontana, Andreia Cristina Karklin; Rose, Deja Renée; Mortensen, Ole Valente

    2013-09-01

    Serotonin transporters (SERTs) play an essential role in the termination and regulation of serotonin signaling in the brain. SERT is also the target of antidepressants and psychostimulants. Molecules with novel activities and modes of interaction with regard to SERT function are of great scientific and clinical interest. We explored structural regions outside the putative serotonin translocation pathway to identify potential binding sites for allosteric transporter modulators (ATMs). Mutational studies revealed a pocket of amino acids outside the orthosteric substrate binding sites located in the interface between extracellular loops 1 and 3 that when mutated affect transporter function. Using the structure of the bacterial transporter homolog leucine transporter as a template, we developed a structural model of SERT. We performed molecular dynamics simulations to further characterize the allosteric pocket that was identified by site-directed mutagenesis studies and employed this pocket in a virtual screen for small-molecule modulators of SERT function. In functional transport assays, we found that one of the identified molecules, ATM7, increased the reuptake of serotonin, possibly by facilitating the interaction of serotonin with transport-ready conformations of SERT when concentrations of serotonin were low and rate limiting. In addition, ATM7 potentiates 3,4-methylenedioxy-N-methylamphetamine (MDMA, "Ecstasy")-induced reversed transport by SERT. Taking advantage of a conformationally sensitive residue in transmembrane domain 6, we demonstrate that ATM7 mechanistically stabilizes an outward-facing conformation of SERT. Taken together these observations demonstrate that ATM7 acts through a novel mechanism that involves allosteric modulation of SERT function.

  20. A Mirror Transport Mechanism for Use at Cryogenic Temperatures

    NASA Technical Reports Server (NTRS)

    Stark, Kenneth W.; Wilson, Meredith

    1986-01-01

    This report describes the Mirror Transport Mechanism (MTM), which supports a pair of dihedral mirrors and moves them in a very smooth and uniform scanning motion normal to a beamsplitter. Each scan is followed by a quick flyback and repeat. Included in the report will be material selection, design, and testing of all major components of the MTM in order to meet the stringent performance requirements under cryogenic conditions and survive the launch environment of the shuttle. Areas to be discussed in detail will be those in which failures or performance anomalies occurred and their solutions. Typically, this will include (but not to be limited to) flex pivot failures during vibration testing, excessive dihedral platform sag under one "g" operation, electronic and fiber optic characteristics, and tolerancing considerations. As of this writing, development of the mechanism has reached the final phase of thermal and vibration qualification. Environmental testing of the complete FIRAS (Far Infrared Absolute Spectrophotometer) experiment is just beginning.

  1. [Sodium ion transportation system and its possible mechanisms in bacteria].

    PubMed

    Yang, Li-Fu; Zhao, Bai-Suo; Yang, Su-Sheng

    2007-12-01

    Sodium ion with high concentration is toxic to living cells, and microorganisms adapt to the environment containing high concentration of salt by the strategies of salt-in-cytoplasm and compatible solutes. The Na+ extrusion system plays important roles in maintaining cytoplasmic Na+ homeostasis and pH level in microbial cells. Two possible mechanisms of Na+ circulation across the cytoplasmic membrane have been proposed, namely primary Na+ pump and secondary Na+/H+ antiporter. Primary sodium pumps coupled the extrusion of Na+ to respiration, and the activity of which was insensitive to uncoupler CCCP ( carbonyl-cyanide m-chlorophenylhydrazone). There were two types of secondary Na+/H+ antiporters-encoding genes designated single gene and multiple subunits, respectively. The types of transportation systems for Na+, possible mechanisms of Na+ extrusion, and projects for further study in bacteria are reviewed.

  2. Formation of dopamine adducts derived from brain polyunsaturated fatty acids: mechanism for Parkinson disease.

    PubMed

    Liu, Xuebo; Yamada, Naruomi; Maruyama, Wakako; Osawa, Toshihiko

    2008-12-12

    Oxidative stress appears to be directly involved in the pathogenesis of the neurodegeneration of dopaminergic systems in Parkinson disease. In this study, we formed four dopamine modification adducts derived from docosahexaenoic acid (C22:6/omega-3) and arachidonic acid (C18:4/omega-6), which are known as the major polyunsaturated fatty acids in the brain. Upon incubation of dopamine with fatty acid hydroperoxides and an in vivo experiment using rat brain tissue, all four dopamine adducts were detected. Furthermore, hexanoyl dopamine (HED), an arachidonic acid-derived adduct, caused severe cytotoxicity in human dopaminergic neuroblastoma SH-SY5Y cells, whereas the other adducts were only slightly affected. The HED-induced cell death was found to include apoptosis, which also seems to be mediated by reactive oxygen species generation and mitochondrial abnormality. Additionally, the experiments using monoamine transporter inhibitor and mouse embryonic fibroblast NIH-3T3 cells that lack the monoamine transporter indicate that the HED-induced cytotoxicity might specially occur in the neuronal cells. These data suggest that the formation of the docosahexaenoic acid- and arachidonic acid-derived dopamine adducts in vitro and in vivo, and HED, the arachidonic acid-derived dopamine modification adduct, which caused selective cytotoxicity of neuronal cells, may indicate a novel mechanism responsible for the pathogenesis in Parkinson disease.

  3. Phloem transport: a review of mechanisms and controls.

    PubMed

    De Schepper, Veerle; De Swaef, Tom; Bauweraerts, Ingvar; Steppe, Kathy

    2013-11-01

    It is generally believed that an osmotically generated pressure gradient drives the phloem mass flow. So far, this widely accepted Münch theory has required remarkably few adaptations, but the debate on alternative and additional hypotheses is still ongoing. Recently, a possible shortcoming of the Münch theory has been pointed out, suggesting that the Münch pressure flow is more suitable for herbs than for trees. Estimation of the phloem resistance indicates that a point might be reached in long sieve tubes where the pressure required to drive the Münch flow cannot be generated. Therefore, the relay hypothesis regained belief as it implies that the sieve tubes are shorter then the plant's axial axis. In the source phloem, three different loading strategies exist which probably result from evolutionary advantages. Passive diffusion seems to be the most primitive one, whereas active loading strategies substantially increase the growth potential. Along the transport phloem, a leakage-retrieval mechanism is observed. Appreciable amounts of carbohydrates are lost from the sieve tubes to feed the lateral sinks, while a part of these lost carbohydrates is subsequently reloaded into the sieve tubes. This mechanism is probably involved to buffer short-term irregularities in phloem turgor and gradient. In the long term, the mechanism controls the replenishment and remobilization of lateral stem storage tissues. As phloem of higher plants has multiple functions in plant development, reproduction, signalling, and growth, the fundamental understanding of the mechanisms behind phloem transport should be elucidated to increase our ability to influence plant growth and development.

  4. L-aspartic acid transport by cat erythrocytes

    SciTech Connect

    Chen, C.W.; Preston, R.L.

    1986-03-01

    Cat and dog red cells are unusual in that they have no Na/K ATPase and contain low K and high Na intracellularly. They also show significant Na dependent L-aspartate (L-asp) transport. The authors have characterized this system in cat RBCs. The influx of /sup 3/H-L-asp (typically 2..mu..M) was measured in washed RBCs incubated for 60 s at 37/sup 0/C in medium containing 140 mM NaCl, 5 mM Kcl, 2 mM CaCl/sub 2/, 15 mM MOPS pH 7.4, 5 mM glucose, and /sup 14/C-PEG as a space marker. The cells were washed 3 times in the medium immediately before incubation which was terminated by centrifuging the RBCs through a layer of dibutylphthalate. Over an L-asp concentration range of 0.5-1000..mu..M, influx obeyed Michaelis-Menten kinetics with a small added linear diffusion component. The Kt and Jmax of the saturable component were 5.40 +/- 0.34 ..mu..M and 148.8 +/- 7.2 ..mu..mol 1. cell/sup -1/h/sup -1/ respectively. Replacement of Na with Li, K, Rb, Cs or choline reduce influx to diffusion. With the addition of asp analogues (4/sup +/M L-asp, 40/sup +/M inhibitor), the following sequence of inhibition was observed (range 80% to 40% inhib.): L-glutamate > L-cysteine sulfonate > D-asp > L-cysteic acid > D-glutamate. Other amino acids such as L-alanine, L-proline, L-lysine, L-cysteine, and taurine showed no inhibition (<5%). These data suggest that cat red cells contain a high-affinity Na dependent transport system for L-asp, glutamate, and closely related analogues which resembles that found in the RBCs of other carnivores and in neural tissues.

  5. Developing Hypothetical Inhibition Mechanism of Novel Urea Transporter B Inhibitor

    NASA Astrophysics Data System (ADS)

    Li, Min; Tou, Weng Ieong; Zhou, Hong; Li, Fei; Ren, Huiwen; Chen, Calvin Yu-Chian; Yang, Baoxue

    2014-07-01

    Urea transporter B (UT-B) is a membrane channel protein that specifically transports urea. UT-B null mouse exhibited urea selective urine concentrating ability deficiency, which suggests the potential clinical applications of the UT-B inhibitors as novel diuretics. Primary high-throughput virtual screening (HTVS) of 50000 small-molecular drug-like compounds identified 2319 hit compounds. These 2319 compounds were screened by high-throughput screening using an erythrocyte osmotic lysis assay. Based on the pharmacological data, putative UT-B binding sites were identified by structure-based drug design and validated by ligand-based and QSAR model. Additionally, UT-B structural and functional characteristics under inhibitors treated and untreated conditions were simulated by molecular dynamics (MD). As the result, we identified four classes of compounds with UT-B inhibitory activity and predicted a human UT-B model, based on which computative binding sites were identified and validated. A novel potential mechanism of UT-B inhibitory activity was discovered by comparing UT-B from different species. Results suggest residue PHE198 in rat and mouse UT-B might block the inhibitor migration pathway. Inhibitory mechanisms of UT-B inhibitors and the functions of key residues in UT-B were proposed. The binding site analysis provides a structural basis for lead identification and optimization of UT-B inhibitors.

  6. Calcium transport mechanism in molting crayfish revealed by microanalysis

    SciTech Connect

    Mizuhira, V.; Ueno, M.

    1983-01-01

    Crayfish provide a good model in which to study the transport mechanism of Ca ions. During the molting stage, decalcified Ca ions are transferred into the blood and accumulate in the gastrolith epithelium, after which a gastrolith is formed on the surface of the epithelium. The gastrolith is dissolved in the stomach after molting, and the Ca is reabsorbed and redistributed throughout the newly formed exoskeleton. We studied the mechanism of Ca transport by cytochemical precipitation of Ca ions and by electron microanalysis, including X-ray microanalysis (EDX) and electron energy-loss spectroscopy (EELS), with a computer. In EDX analysis, the fine precipitates of K-antimonate in the gastrolith mitochondria clearly defined Ca with antimony; we also observed a large amount of Ca-oxalate in the mitochondria, and Ca-K X-ray pulses were clearly defined. Ca-K X-rays were also detected from fresh freeze-substituted mitochondria. Finally, we succeeded in taking a Ca-L EELS image from the mitochondria of fresh freeze-substituted thin sections. Only a very small amount of Ca was detected from the cell membrane and other organelles. Ca-adenosine triphosphatase (ATPase) and Mg-ATPase activity was also very clearly demonstrated in the mitochondria. These enzymes may play an important role in Ca metabolism.

  7. Characteristics and Possible Functions of Mitochondrial Ca2+ Transport Mechanisms

    PubMed Central

    Gunter, Thomas E.; Sheu, Shey-Shing

    2009-01-01

    Mitochondria produce around 92% of the ATP used in the typical animal cell by oxidative phosphorylation using energy from their electrochemical proton gradient. Intramitochondrial free Ca2+ concentration ([Ca2+]m) has been found to be an important component of control of the rate of this ATP production. In addition, [Ca2+]m also controls the opening of a large pore in the inner mitochondrial membrane, the permeability transition pore (PTP), which plays a role in mitochondrial control of programmed cell death or apoptosis. Therefore, [Ca2+]m can control whether the cell has sufficient ATP to fulfill its functions and survive or is condemned to death. Ca2+ is also one of the most important second messengers within the cytosol, signaling changes in cellular response through Ca2+ pulses or transients. Mitochondria can also sequester Ca2+ from these transients so as to modify the shape of Ca2+ signaling transients or control their location within the cell. All of this is controlled by the action of four or five mitochondrial Ca2+ transport mechanisms and the PTP. The characteristics of these mechanisms of Ca2+ transport and a discussion of how they might function are described in this paper. PMID:19161975

  8. Developing Hypothetical Inhibition Mechanism of Novel Urea Transporter B Inhibitor

    PubMed Central

    Li, Min; Tou, Weng Ieong; Zhou, Hong; Li, Fei; Ren, Huiwen; Chen, Calvin Yu-Chian; Yang, Baoxue

    2014-01-01

    Urea transporter B (UT-B) is a membrane channel protein that specifically transports urea. UT-B null mouse exhibited urea selective urine concentrating ability deficiency, which suggests the potential clinical applications of the UT-B inhibitors as novel diuretics. Primary high-throughput virtual screening (HTVS) of 50000 small-molecular drug-like compounds identified 2319 hit compounds. These 2319 compounds were screened by high-throughput screening using an erythrocyte osmotic lysis assay. Based on the pharmacological data, putative UT-B binding sites were identified by structure-based drug design and validated by ligand-based and QSAR model. Additionally, UT-B structural and functional characteristics under inhibitors treated and untreated conditions were simulated by molecular dynamics (MD). As the result, we identified four classes of compounds with UT-B inhibitory activity and predicted a human UT-B model, based on which computative binding sites were identified and validated. A novel potential mechanism of UT-B inhibitory activity was discovered by comparing UT-B from different species. Results suggest residue PHE198 in rat and mouse UT-B might block the inhibitor migration pathway. Inhibitory mechanisms of UT-B inhibitors and the functions of key residues in UT-B were proposed. The binding site analysis provides a structural basis for lead identification and optimization of UT-B inhibitors. PMID:25047372

  9. Structure-based ligand discovery for the Large-neutral Amino Acid Transporter 1, LAT-1

    PubMed Central

    Geier, Ethan G.; Schlessinger, Avner; Fan, Hao; Gable, Jonathan E.; Irwin, John J.; Sali, Andrej; Giacomini, Kathleen M.

    2013-01-01

    The Large-neutral Amino Acid Transporter 1 (LAT-1)—a sodium-independent exchanger of amino acids, thyroid hormones, and prescription drugs—is highly expressed in the blood–brain barrier and various types of cancer. LAT-1 plays an important role in cancer development as well as in mediating drug and nutrient delivery across the blood–brain barrier, making it a key drug target. Here, we identify four LAT-1 ligands, including one chemically novel substrate, by comparative modeling, virtual screening, and experimental validation. These results may rationalize the enhanced brain permeability of two drugs, including the anticancer agent acivicin. Finally, two of our hits inhibited proliferation of a cancer cell line by distinct mechanisms, providing useful chemical tools to characterize the role of LAT-1 in cancer metabolism. PMID:23509259

  10. Designing Novel Nanoformulations Targeting Glutamate Transporter Excitatory Amino Acid Transporter 2: Implications in Treating Drug Addiction

    PubMed Central

    Rao, PSS; Yallapu, Murali M.; Sari, Youssef; Fisher, Paul B.; Kumar, Santosh

    2015-01-01

    Chronic drug abuse is associated with elevated extracellular glutamate concentration in the brain reward regions. Deficit of glutamate clearance has been identified as a contributing factor that leads to enhanced glutamate concentration following extended drug abuse. Importantly, normalization of glutamate level through induction of glutamate transporter 1 (GLT1)/ excitatory amino acid transporter 2 (EAAT2) expression has been described in several in vivo studies. GLT1 upregulators including ceftriaxone, a beta-lactam antibiotic, have been effective in attenuating drug-seeking and drug-consumption behavior in rodent models. However, potential obstacles toward clinical translation of GLT1 (EAAT2) upregulators as treatment for drug addiction might include poor gastrointestinal absorption, serious peripheral adverse effects, and/or suboptimal CNS concentrations. Given the growing success of nanotechnology in targeting CNS ailments, nanoformulating known GLT1 (EAAT2) upregulators for selective uptake across the blood brain barrier presents an ideal therapeutic approach for treating drug addiction. In this review, we summarize the results obtained with promising GLT1 (EAAT2) inducing compounds in animal models recapitulating drug addiction. Additionally, the various nanoformulations that can be employed for selectively increasing the CNS bioavailability of GLT1 (EAAT2) upregulators are discussed. Finally, the applicability of GLT1 (EAAT2) induction via central delivery of drug-loaded nanoformulations is described. PMID:26635971

  11. Designing Novel Nanoformulations Targeting Glutamate Transporter Excitatory Amino Acid Transporter 2: Implications in Treating Drug Addiction.

    PubMed

    Rao, Pss; Yallapu, Murali M; Sari, Youssef; Fisher, Paul B; Kumar, Santosh

    Chronic drug abuse is associated with elevated extracellular glutamate concentration in the brain reward regions. Deficit of glutamate clearance has been identified as a contributing factor that leads to enhanced glutamate concentration following extended drug abuse. Importantly, normalization of glutamate level through induction of glutamate transporter 1 (GLT1)/ excitatory amino acid transporter 2 (EAAT2) expression has been described in several in vivo studies. GLT1 upregulators including ceftriaxone, a beta-lactam antibiotic, have been effective in attenuating drug-seeking and drug-consumption behavior in rodent models. However, potential obstacles toward clinical translation of GLT1 (EAAT2) upregulators as treatment for drug addiction might include poor gastrointestinal absorption, serious peripheral adverse effects, and/or suboptimal CNS concentrations. Given the growing success of nanotechnology in targeting CNS ailments, nanoformulating known GLT1 (EAAT2) upregulators for selective uptake across the blood brain barrier presents an ideal therapeutic approach for treating drug addiction. In this review, we summarize the results obtained with promising GLT1 (EAAT2) inducing compounds in animal models recapitulating drug addiction. Additionally, the various nanoformulations that can be employed for selectively increasing the CNS bioavailability of GLT1 (EAAT2) upregulators are discussed. Finally, the applicability of GLT1 (EAAT2) induction via central delivery of drug-loaded nanoformulations is described.

  12. Retinoic acid induces expression of the thyroid hormone transporter, monocarboxylate transporter 8 (Mct8).

    PubMed

    Kogai, Takahiko; Liu, Yan-Yun; Richter, Laura L; Mody, Kaizeen; Kagechika, Hiroyuki; Brent, Gregory A

    2010-08-27

    Retinoic acid (RA) and thyroid hormone are critical for differentiation and organogenesis in the embryo. Mct8 (monocarboxylate transporter 8), expressed predominantly in the brain and placenta, mediates thyroid hormone uptake from the circulation and is required for normal neural development. RA induces differentiation of F9 mouse teratocarcinoma cells toward neurons as well as extraembryonal endoderm. We hypothesized that Mct8 is functionally expressed in F9 cells and induced by RA. All-trans-RA (tRA) and other RA receptor (RAR) agonists dramatically (>300-fold) induced Mct8. tRA treatment significantly increased uptake of triiodothyronine and thyroxine (4.1- and 4.3-fold, respectively), which was abolished by a selective Mct8 inhibitor, bromosulfophthalein. Sequence inspection of the Mct8 promoter region and 5'-rapid amplification of cDNA ends PCR analysis in F9 cells identified 11 transcription start sites and a proximal Sp1 site but no TATA box. tRA significantly enhanced Mct8 promoter activity through a consensus RA-responsive element located 6.6 kilobases upstream of the coding region. A chromatin immunoprecipitation assay demonstrated binding of RAR and retinoid X receptor to the RA response element. The promotion of thyroid hormone uptake through the transcriptional up-regulation of Mct8 by RAR is likely to be important for extraembryonic endoderm development and neural differentiation. This finding demonstrates cross-talk between RA signaling and thyroid hormone signaling in early development at the level of the thyroid hormone transporter.

  13. Fatty Acid Transport Protein-2 inhibitor Grassofermata/CB5 protects cells against lipid accumulation and toxicity

    PubMed Central

    Saini, Nipun; Black, Paul N.; Montefusco, David; DiRusso, Concetta C.

    2015-01-01

    The inhibition of the fatty acid uptake into non-adipose tissues provides an attractive target for prevention of lipotoxicity leading to obesity-associated non-alcoholic fatty liver disease and type 2 diabetes. Fatty acid transport proteins (FATPs) are bifunctional proteins involved in the uptake and activation of fatty acids by esterification with coenzyme A. Here we characterize Grassofermata/CB5, previously identified as a fatty acid uptake inhibitor directed against HsFATP2. The compound was effective in inhibiting the uptake of fatty acids in the low micro-molar range (IC50 8–11μM) and prevented palmitate-mediated lipid accumulation and cell death in cell lines that are models for intestines, liver, muscle and pancreas. In adipocytes, uptake inhibition was less effective (IC50 58μM). Inhibition was specific for long chain fatty acids and was ineffective toward medium chain fatty acids, which are transported by diffusion. Kinetic analysis of Grassofermata-dependent FA transport inhibition verified a non-competitive mechanism. By comparison with Grassofermata, several atypical antipsychotic drugs previously implicated as inhibitors of FA uptake were ineffectual. In mice Grassofermata decreased absorption of 13C-oleate demonstrating its potential as a therapeutic agent. PMID:26284975

  14. Mechanisms of calcium transport in human colonic basolateral membrane vesicles.

    PubMed

    Saksena, Seema; Ammar, Mohammad S; Tyagi, Sangeeta; Elsharydah, Ahmed; Gill, Ravinder K; Ramaswamy, Krishnamurthy; Dudeja, Pradeep K

    2002-10-01

    Human colon has been suggested to play an important role in calcium absorption especially after extensive disease or resection of the small intestine. We have previously demonstrated the presence of a carrier-mediated calcium uptake mechanism in the human colonic luminal membrane vesicles. Current studies were, therefore, undertaken to investigate the mechanism(s) of calcium exit across the basolateral membrane domain of the human colon. Human colonic basolateral membrane vesicles (BLMVs) were isolated and purified from mucosal scrapings of organ donor colons, utilizing a technique developed in our laboratory. 45Ca uptake was measured by a rapid filtration technique. 45Ca uptake represented transport into the intravesicular space as evidenced by an osmolarity study and by the demonstration of Ca2' efflux from calcium preloaded vesicles by Ca2+ ionophore A23187. Calcium uptake was stimulated by Mg2+ ATP. The kinetic parameters for ATP-dependent Ca2+ uptake revealed saturation kinetics with Michaelis constant (Km) of 0.22 +/- 0.04 microM and a maximum rate of uptake (Vmax) of 0.38 +/- 0.12 nmol/mg protein/min. The Km of ATP concentration required for half maximal Ca2+ uptake was 0.39 +/- 0.04 mM. ATP-stimulated calcium uptake into these vesicles was further stimulated in the presence of calmodulin and was inhibited by calmodulin antagonist, trifluoperazine. Uptake of 45Ca into BLMVs was markedly inhibited by cis-Na+ but was significantly stimulated by trans-Na+ (40-50% stimulation). Our results demonstrate the presence of a Mg2+/ATP-dependent calmodulin-regulated Ca2+ transport system and a Na+-Ca2+ exchange process in the human colonic basolateral membranes.

  15. Thiamine transport in Escherichia coli: the mechanism of inhibition by the sulfhydryl-specific modifier N-ethylmaleimide.

    PubMed

    Hollenbach, Andrew D; Dickson, Kimberly A; Washabaugh, Michael W

    2002-08-31

    Active transport of thiamin (vitamin B(1)) into Escherichia coli occurs through a member of the superfamily of transporters known as ATP-binding cassette (ABC) transporters. Although it was demonstrated that the sulfhydryl-specific modifier N-ethylmaleimide (NEM) inhibited thiamin transport, the exact mechanism of this inhibition is unknown. Therefore, we have carried out a kinetic analysis of thiamin transport to determine the mechanism of inhibition by NEM. Thiamin transport in vivo exhibits Michaelis-Menten kinetics with K(M)=15 nM and V(max)=46 U mg(-1). Treatment of intact E. coli KG33 with saturating NEM exhibited apparent noncompetitive inhibition, decreasing V(max) by approximately 50% without effecting K(M) or the apparent first-order rate constant (k(obsd)). Apparent noncompetitive inhibition is consistent with an irreversible covalent modification of a cysteine(s) that is critical for the transport process. A primary amino acid analysis of the subunits of the thiamin permease combined with our kinetic analysis suggests that inhibition of thiamin transport by NEM is different from other ABC transporters and occurs at the level of protein-protein interactions between the membrane-bound carrier protein and the ATPase subunit.

  16. Properties of an Inducible C4-Dicarboxylic Acid Transport System in Bacillus subtilis

    PubMed Central

    Ghei, Om. K.; Kay, William W.

    1973-01-01

    The transport of the tricarboxylic acid cycle C4-dicarboxylic acids was studied in both the wild-type strain and tricarboxylic acid cycle mutants of Bacillus subtilis. Active transport of malate, fumarate, and succinate was found to be inducible by these dicarboxylic acids or by precursors to them, whereas glucose or closely related metabolites catabolite-repressed their uptake. l-Malate was found to be the best dicarboxylic acid transport inducer in succinic dehydrogenase, fumarase, and malic dehydrogenase mutants. Succinate and fumarate are accumulated over 100-fold in succinic dehydrogenase and fumarase mutants, respectively, whereas mutants lacking malate dehydrogenase were unable to accumulate significant quantities of the C4-dicarboxylic acids. The stereospecificity of this transport system was studied from a comparison of the rates of competitive inhibition of both succinate uptake and efflux in a succinate dehydrogenase mutant by utilizing thirty dicarboxylic acid analogues. The system was specific for the C4-dicarboxylic acids of the tricarboxylic acid cycle, neither citrate nor α-ketoglutarate were effective competitive inhibitors. Of a wide variety of metabolic inhibitors tested, inhibiors of oxidative phosphorylation and of the formation of proton gradients were the most potent inhibitors of transport. From the kinetics of dicarboxylic acid transport (Km approximately 10−4 M for succinate or fumarate in succinic acid dehydrogenase and fumarase mutants) and from the competitive inhibition studies, it was concluded that an inducible dicarboxylic acid transport system mediates the entry of malate, fumarate, or succinate into B. subtilis. Mutants devoid of α-ketoglutarate dehydrogenase were shown to accumulate both α-ketoglutarate and glutamate, and these metabolites subsequently inhibited the transport of all the C4-dicarboxylic acids, suggesting a regulatory role. Images PMID:4633350

  17. Adsorption and transport of polymaleic acid on Callovo-Oxfordian clay stone: batch and transport experiments.

    PubMed

    Durce, Delphine; Landesman, Catherine; Grambow, Bernd; Ribet, Solange; Giffaut, Eric

    2014-08-01

    Dissolved Organic Matter (DOM) can affect the mobility of radionuclides in pore water of clay-rich geological formations, such as those intended to be used for nuclear waste disposal. The present work studies the adsorption and transport properties of a polycarboxylic acid, polymaleic acid (PMA, Mw=1.9kDa), on Callovo-Oxfordian argillite samples (COx). Even though this molecule is rather different from the natural organic matter found in clay rock, the study of its retention properties on both dispersed and intact samples allows assessing to which extent organic acids may undergo sorption under natural conditions (pH7) and what could be the impact on their mobility. PMA sorption and desorption were investigated in dispersed systems. The degree of sorption was measured after 1, 8 and 21days and for a range of PMA initial concentrations from 4.5×10(-7) to 1.4×10(-3)mol.L(-1). The reversibility of the sorption process was estimated by desorption experiments performed after the sorption experiments. At the sorption steady state, the sorption was described by a two-site Langmuir model. A total sorption capacity of COx for PMA was found to be 1.01×10(-2) mol.kg(-1) distributed on two sorption sites, one weak and one strong. The desorption of PMA was incomplete, independently of the duration of the sorption phase. The amount of desorbable PMA even appeared to decrease for sorption phases from 1 to 21days. To describe the apparent desorption hysteresis, two conceptual models were applied. The two-box diffusion model accounted for intraparticle diffusion and more generally for nonequilibrium processes. The two-box first-order non-reversible model accounted for a first-order non-reversible sorption and more generally for kinetically-controlled irreversible sorption processes. The use of the two models revealed that desorption hysteresis was not the result of nonequilibrium processes but was due to irreversible sorption. Irreversible sorption on the strong site was

  18. Adsorption and transport of polymaleic acid on Callovo-Oxfordian clay stone: Batch and transport experiments

    NASA Astrophysics Data System (ADS)

    Durce, Delphine; Landesman, Catherine; Grambow, Bernd; Ribet, Solange; Giffaut, Eric

    2014-08-01

    Dissolved Organic Matter (DOM) can affect the mobility of radionuclides in pore water of clay-rich geological formations, such as those intended to be used for nuclear waste disposal. The present work studies the adsorption and transport properties of a polycarboxylic acid, polymaleic acid (PMA, Mw = 1.9 kDa), on Callovo-Oxfordian argillite samples (COx). Even though this molecule is rather different from the natural organic matter found in clay rock, the study of its retention properties on both dispersed and intact samples allows assessing to which extent organic acids may undergo sorption under natural conditions (pH 7) and what could be the impact on their mobility. PMA sorption and desorption were investigated in dispersed systems. The degree of sorption was measured after 1, 8 and 21 days and for a range of PMA initial concentrations from 4.5 × 10- 7 to 1.4 × 10- 3 mol.L- 1. The reversibility of the sorption process was estimated by desorption experiments performed after the sorption experiments. At the sorption steady state, the sorption was described by a two-site Langmuir model. A total sorption capacity of COx for PMA was found to be 1.01×10- 2 mol.kg- 1 distributed on two sorption sites, one weak and one strong. The desorption of PMA was incomplete, independently of the duration of the sorption phase. The amount of desorbable PMA even appeared to decrease for sorption phases from 1 to 21 days. To describe the apparent desorption hysteresis, two conceptual models were applied. The two-box diffusion model accounted for intraparticle diffusion and more generally for nonequilibrium processes. The two-box first-order non-reversible model accounted for a first-order non-reversible sorption and more generally for kinetically-controlled irreversible sorption processes. The use of the two models revealed that desorption hysteresis was not the result of nonequilibrium processes but was due to irreversible sorption. Irreversible sorption on the strong site was

  19. Fatty Acid-Binding Protein 5 Facilitates the Blood-Brain Barrier Transport of Docosahexaenoic Acid.

    PubMed

    Pan, Yijun; Scanlon, Martin J; Owada, Yuji; Yamamoto, Yui; Porter, Christopher J H; Nicolazzo, Joseph A

    2015-12-07

    The brain has a limited ability to synthesize the essential polyunsaturated fatty acid (PUFA) docosahexaenoic acid (DHA) from its omega-3 fatty acid precursors. Therefore, to maintain brain concentrations of this PUFA at physiological levels, plasma-derived DHA must be transported across the blood-brain barrier (BBB). While DHA is able to partition into the luminal membrane of brain endothelial cells, its low aqueous solubility likely limits its cytosolic transfer to the abluminal membrane, necessitating the requirement of an intracellular carrier protein to facilitate trafficking of this PUFA across the BBB. As the intracellular carrier protein fatty acid-binding protein 5 (FABP5) is expressed at the human BBB, the current study assessed the putative role of FABP5 in the brain endothelial cell uptake and BBB transport of DHA in vitro and in vivo, respectively. hFAPB5 was recombinantly expressed and purified from Escherichia coli C41(DE3) cells and the binding affinity of DHA to hFABP5 assessed using isothermal titration calorimetry. The impact of FABP5 siRNA on uptake of (14)C-DHA into immortalized human brain microvascular endothelial (hCMEC/D3) cells was assessed. An in situ transcardiac perfusion method was optimized in C57BL/6 mice and subsequently used to compare the BBB influx rate (Kin) of (14)C-DHA between FABP5-deficient (FABP5(-/-)) and wild-type (FABP5(+/+)) C57BL/6 mice. DHA bound to hFABP5 with an equilibrium dissociation constant of 155 ± 8 nM (mean ± SEM). FABP5 siRNA transfection decreased hCMEC/D3 mRNA and protein expression of FABP5 by 53.2 ± 5.5% and 44.8 ± 13.7%, respectively, which was associated with a 14.1 ± 2.7% reduction in (14)C-DHA cellular uptake. By using optimized conditions for the in situ transcardiac perfusion (a 1 min preperfusion (10 mL/min) followed by perfusion of (14)C-DHA (1 min)), the Kin of (14)C-DHA was 0.04 ± 0.01 mL/g/s. Relative to FABP5(+/+) mice, the Kin of (14)C-DHA decreased 36.7 ± 12.4% in FABP5(-/-) mice

  20. Trypanocidal Effect of Isotretinoin through the Inhibition of Polyamine and Amino Acid Transporters in Trypanosoma cruzi.

    PubMed

    Reigada, Chantal; Valera-Vera, Edward A; Sayé, Melisa; Errasti, Andrea E; Avila, Carla C; Miranda, Mariana R; Pereira, Claudio A

    2017-03-01

    Polyamines are essential compounds to all living organisms and in the specific case of Trypanosoma cruzi, the causative agent of Chagas disease, they are exclusively obtained through transport processes since this parasite is auxotrophic for polyamines. Previous works reported that retinol acetate inhibits Leishmania growth and decreases its intracellular polyamine concentration. The present work describes a combined strategy of drug repositioning by virtual screening followed by in vitro assays to find drugs able to inhibit TcPAT12, the only polyamine transporter described in T. cruzi. After a screening of 3000 FDA-approved drugs, 7 retinoids with medical use were retrieved and used for molecular docking assays with TcPAT12. From the docked molecules, isotretinoin, a well-known drug used for acne treatment, showed the best interaction score with TcPAT12 and was selected for further in vitro studies. Isotretinoin inhibited the polyamine transport, as well as other amino acid transporters from the same protein family (TcAAAP), with calculated IC50 values in the range of 4.6-10.3 μM. It also showed a strong inhibition of trypomastigote burst from infected cells, with calculated IC50 of 130 nM (SI = 920) being significantly less effective on the epimastigote stage (IC50 = 30.6 μM). The effect of isotretinoin on the parasites plasma membrane permeability and on mammalian cell viability was tested, and no change was observed. Autophagosomes and apoptotic bodies were detected as part of the mechanisms of isotretinoin-induced death indicating that the inhibition of transporters by isotretinoin causes nutrient starvation that triggers autophagic and apoptotic processes. In conclusion, isotretinoin is a promising trypanocidal drug since it is a multi-target inhibitor of essential metabolites transporters, in addition to being an FDA-approved drug largely used in humans, which could reduce significantly the requirements for its possible application in the treatment of

  1. Trypanocidal Effect of Isotretinoin through the Inhibition of Polyamine and Amino Acid Transporters in Trypanosoma cruzi

    PubMed Central

    Reigada, Chantal; Valera-Vera, Edward A.; Sayé, Melisa; Errasti, Andrea E.; Avila, Carla C.; Miranda, Mariana R.; Pereira, Claudio A.

    2017-01-01

    Polyamines are essential compounds to all living organisms and in the specific case of Trypanosoma cruzi, the causative agent of Chagas disease, they are exclusively obtained through transport processes since this parasite is auxotrophic for polyamines. Previous works reported that retinol acetate inhibits Leishmania growth and decreases its intracellular polyamine concentration. The present work describes a combined strategy of drug repositioning by virtual screening followed by in vitro assays to find drugs able to inhibit TcPAT12, the only polyamine transporter described in T. cruzi. After a screening of 3000 FDA-approved drugs, 7 retinoids with medical use were retrieved and used for molecular docking assays with TcPAT12. From the docked molecules, isotretinoin, a well-known drug used for acne treatment, showed the best interaction score with TcPAT12 and was selected for further in vitro studies. Isotretinoin inhibited the polyamine transport, as well as other amino acid transporters from the same protein family (TcAAAP), with calculated IC50 values in the range of 4.6–10.3 μM. It also showed a strong inhibition of trypomastigote burst from infected cells, with calculated IC50 of 130 nM (SI = 920) being significantly less effective on the epimastigote stage (IC50 = 30.6 μM). The effect of isotretinoin on the parasites plasma membrane permeability and on mammalian cell viability was tested, and no change was observed. Autophagosomes and apoptotic bodies were detected as part of the mechanisms of isotretinoin-induced death indicating that the inhibition of transporters by isotretinoin causes nutrient starvation that triggers autophagic and apoptotic processes. In conclusion, isotretinoin is a promising trypanocidal drug since it is a multi-target inhibitor of essential metabolites transporters, in addition to being an FDA-approved drug largely used in humans, which could reduce significantly the requirements for its possible application in the treatment of

  2. Functional characterization of folic acid transport in the intestine of the laying hen using the everted intestinal sac model.

    PubMed

    Tactacan, G B; Rodriguez-Lecompte, J C; Karmin, O; House, J D

    2011-01-01

    Absorption at the level of the intestine is likely a primary regulatory mechanism for the deposition of dietary supplemented folic acid into the chicken egg. Therefore, factors affecting the intestinal transport of folic acid in the laying hen may influence the level of egg folate concentrations. To this end, a series of experiments using intestinal everted sacs were conducted to characterize intestinal folic acid absorption processes in laying hens. Effects of naturally occurring folate derivatives (5-methyl and 10-formyltetrahydrofolate) as well as heme on folic acid absorption were also investigated. Folic acid absorption was measured based on the rate of uptake of (3)H-labeled folic acid in the everted sac from various segments of the small and large intestines. Folic acid concentration, incubation length, and pH condition were optimized before the performance of uptake experiments. The distribution profile of folic acid transport along the intestine was highest in the upper half of the small intestine. Maximum uptake rate (nmol·100 g tissue(-1)·min(-1)) was observed in the duodenum (20.6 ± 1.9) and jejunum (22.3 ± 2.0) and decreased significantly in the ileum (15.3 ± 1.1) and cecum (9.3 ± 0.9). Transport increased proportionately (P < 0.05) between 0.0001 and 0.1 µM folic acid. Above 0.1 µM, the slope of the regression line was not significantly different from zero (P < 0.137). Folic acid uptake in the jejunum showed a maximum rate of transport at pH 6.0, but was lowest at pH 7.5. The presence of 5-methyl and 10-formyltetrahydrofolate as well as heme impeded folic acid uptake, reducing intestinal folic acid absorption when added at concentrations ranging from 0 to 100 µM. Overall, these data indicated the presence of a folic acid transport system in the entire intestine of the laying hen. Uptake of folic acid in the cecum raises the likelihood of absorption of bacterial-derived folate.

  3. Amino acid- and lipid-induced insulin resistance in rat heart: molecular mechanisms.

    PubMed

    Terruzzi, Ileana; Allibardi, Sonia; Bendinelli, Paola; Maroni, Paola; Piccoletti, Roberta; Vesco, Flavio; Samaja, Michele; Luzi, Livio

    2002-04-25

    Lipids compete with glucose for utilization by the myocardium. Amino acids are an important energetic substrate in the heart but it is unknown whether they reduce glucose disposal. The molecular mechanisms by which lipids and amino acids impair insulin-mediated glucose disposal in the myocardium are unknown. We evaluated the effect of lipids and amino acids on the insulin stimulated glucose uptake in the isolated rat heart and explored the involved target proteins. The hearts were perfused with 16 mM glucose alone or with 6% lipid or 10% amino acid solutions at the rate of 15 ml/min. After 1 h of perfusion (basal period), insulin (240 nmol/l) was added and maintained for an additional hour. Both lipids and amino acids blocked the insulin effect on glucose uptake (P<0.01) and reduced the activity of the IRSs/PI 3-kinase/Akt/GSK3 axis leading to the activation of glucose transport and glycogen synthesis. Amino acids, but not lipids, increased the activity of the p70 S6 kinase leading to the stimulation of protein synthesis. Amino acids induce myocardial insulin resistance recruiting the same molecular mechanisms as lipids. Amino acids retain an insulin-like stimulatory effect on p70 S6 kinase, which is independent from the PI 3-Kinase downstream effectors.

  4. Mechanism of transport and distribution of organic solvents in blood

    NASA Technical Reports Server (NTRS)

    Lam, C. W.; Galen, T. J.; Boyd, J. F.; Pierson, D. L.

    1990-01-01

    Little is known about the mechanism of transport and distribution of volatile organic compounds in blood. Studies were conducted on five typical organic solvents to investigate how these compounds are transported and distributed in blood. Groups of four to five rats were exposed for 2 hr to 500 ppm of n-hexane, toluene, chloroform, methyl isobutyl ketone (MIBK), or diethyl ether vapor; 94, 66, 90, 51, or 49%, respectively, of these solvents in the blood were found in the red blood cells (RBCs). Very similar results were obtained in vitro when aqueous solutions of these solvents were added to rat blood. In vitro studies were also conducted on human blood with these solvents; 66, 43, 65, 49, or 46%, respectively, of the added solvent was taken up by the RBCs. These results indicate that RBCs from humans and rats exhibited substantial differences in affinity for the three more hydrophobic solvents studied. When solutions of these solvents were added to human plasma and RBC samples, large fractions (51-96%) of the solvents were recovered from ammonium sulfate-precipitated plasma proteins and hemoglobin. Smaller fractions were recovered from plasma water and red cell water. Less than 10% of each of the added solvents in RBC samples was found in the red cell membrane ghosts. These results indicate that RBCs play an important role in the uptake and transport of these solvents. Proteins, chiefly hemoglobin, are the major carriers of these compounds in blood. It can be inferred from the results of the present study that volatile lipophilic organic solvents are probably taken up by the hydrophobic sites of blood proteins.

  5. Study of Tranexamic Acid During Air Medical Prehospital Transport Trial (STAAMP trial)

    DTIC Science & Technology

    2015-10-01

    AWARD NUMBER: W81XWH-13-2-0080 TITLE: Study of Tranexamic Acid During Air Medical Prehospital Transport Trial (STAAMP trial) PRINCIPAL INVESTIGATOR...TITLE AND SUBTITLE 5a. CONTRACT NUMBER Study of Tranexamic Acid During Air Medical Prehospital Transport Trial (STAAMP trial) 5b. GRANT NUMBER W81XWH...IRB approval regarding changes to the protocol language. 15. SUBJECT TERMS Prehospital; Tranexamic acid 16. SECURITY CLASSIFICATION OF: 17. LIMITATION

  6. Hyporheic flow and transport processes: Mechanisms, models, and biogeochemical implications

    NASA Astrophysics Data System (ADS)

    Boano, F.; Harvey, J. W.; Marion, A.; Packman, A. I.; Revelli, R.; Ridolfi, L.; Wörman, A.

    2014-12-01

    Fifty years of hyporheic zone research have shown the important role played by the hyporheic zone as an interface between groundwater and surface waters. However, it is only in the last two decades that what began as an empirical science has become a mechanistic science devoted to modeling studies of the complex fluid dynamical and biogeochemical mechanisms occurring in the hyporheic zone. These efforts have led to the picture of surface-subsurface water interactions as regulators of the form and function of fluvial ecosystems. Rather than being isolated systems, surface water bodies continuously interact with the subsurface. Exploration of hyporheic zone processes has led to a new appreciation of their wide reaching consequences for water quality and stream ecology. Modern research aims toward a unified approach, in which processes occurring in the hyporheic zone are key elements for the appreciation, management, and restoration of the whole river environment. In this unifying context, this review summarizes results from modeling studies and field observations about flow and transport processes in the hyporheic zone and describes the theories proposed in hydrology and fluid dynamics developed to quantitatively model and predict the hyporheic transport of water, heat, and dissolved and suspended compounds from sediment grain scale up to the watershed scale. The implications of these processes for stream biogeochemistry and ecology are also discussed.

  7. Transport mechanisms of small molecules through polyamide 12/montmorillonite nanocomposites.

    PubMed

    Alexandre, B; Colasse, L; Langevin, D; Médéric, P; Aubry, T; Chappey, C; Marais, S

    2010-07-15

    The aim of this work is to study the transport of small molecules through the hybrid systems polyamide 12 (PA12)/organo-modified montmorillonite (Cloisite 30B, C30B) prepared by melt blending, using two blending conditions. The transport mechanisms were investigated by using three probe molecules: nitrogen, water, and toluene. While a barrier effect appears clearly with nitrogen, this effect changes with the amount of fillers for water and disappears for toluene. The reduction of permeability for nitrogen is mainly due to the increase of tortuosity. For water and toluene, the permeation kinetics reveals many concomitant phenomena responsible for the permeation behavior. Despite the tortuosity effect, the toluene permeability of nanocomposites increases with C30B fraction. The water and toluene molecules interact differently with fillers according to their hydrophilic/hydrophobic character. Moreover, the plasticization effect of water and toluene in the matrix, involving a concentration-dependent diffusion coefficient, is correctly described by the law D = D(0)e(gammaC). On the basis of Nielsen's tortuosity concept, we suggest a new approach for relative permeability modeling, not only based on the geometrical parameters (aspect ratio, orientation, recovery) but also including phenomenological parameters deduced from structural characterization and permeation kinetics.

  8. Transport Mechanism of Nicotine in Primary Cultured Alveolar Epithelial Cells.

    PubMed

    Takano, Mikihisa; Nagahiro, Machi; Yumoto, Ryoko

    2016-02-01

    Nicotine is absorbed from the lungs into the systemic circulation during cigarette smoking. However, there is little information concerning the transport mechanism of nicotine in alveolar epithelial cells. In this study, we characterized the uptake of nicotine in rat primary cultured type II (TII) and transdifferentiated type I-like (TIL) epithelial cells. In both TIL and TII cells, [(3)H]nicotine uptake was time and temperature-dependent, and showed saturation kinetics. [(3)H]Nicotine uptake in these cells was not affected by Na(+), but was sensitive to extracellular and intracellular pH, suggesting the involvement of a nicotine/proton antiport system. The uptake of [(3)H]nicotine in these cells was potently inhibited by organic cations such as clonidine, diphenhydramine, and pyrilamine, but was not affected by substrates and/or inhibitors of known organic cation transporters such as carnitine, 1-methyl-4-phenylpyridinium, and tetraethylammonium. In addition, the uptake of [(3)H]nicotine in TIL cells was stimulated by preloading the cells with unlabeled nicotine, pyrilamine, and diphenhydramine, but not with tetraethylammonium. These results suggest that a novel proton-coupled antiporter is involved in the uptake of nicotine in alveolar epithelial cells and its absorption from the lungs into the systemic circulation.

  9. Hyporheic flow and transport processes: mechanisms, models, and biogeochemical implications

    USGS Publications Warehouse

    Boano, Fulvio; Harvey, Judson W.; Marion, Andrea; Packman, Aaron I.; Revelli, Roberto; Ridolfi, Luca; Anders, Wörman

    2014-01-01

    Fifty years of hyporheic zone research have shown the important role played by the hyporheic zone as an interface between groundwater and surface waters. However, it is only in the last two decades that what began as an empirical science has become a mechanistic science devoted to modeling studies of the complex fluid dynamical and biogeochemical mechanisms occurring in the hyporheic zone. These efforts have led to the picture of surface-subsurface water interactions as regulators of the form and function of fluvial ecosystems. Rather than being isolated systems, surface water bodies continuously interact with the subsurface. Exploration of hyporheic zone processes has led to a new appreciation of their wide reaching consequences for water quality and stream ecology. Modern research aims toward a unified approach, in which processes occurring in the hyporheic zone are key elements for the appreciation, management, and restoration of the whole river environment. In this unifying context, this review summarizes results from modeling studies and field observations about flow and transport processes in the hyporheic zone and describes the theories proposed in hydrology and fluid dynamics developed to quantitatively model and predict the hyporheic transport of water, heat, and dissolved and suspended compounds from sediment grain scale up to the watershed scale. The implications of these processes for stream biogeochemistry and ecology are also discussed."

  10. Flexible Mechanical Conveyors for Regolith Extraction and Transport

    NASA Technical Reports Server (NTRS)

    Walton, Otis R.; Vollmer, Hubert J.

    2013-01-01

    A report describes flexible mechanical conveying systems for transporting fine cohesive regolith under microgravity and vacuum conditions. They are totally enclosed, virtually dust-free, and can include enough flexibility in the conveying path to enable an expanded range of extraction and transport scenarios, including nonlinear drill-holes and excavation of enlarged subsurface openings without large entry holes. The design of the conveyors is a modification of conventional screw conveyors such that the central screw-shaft and the outer housing or conveyingtube have a degree of bending flexibility, allowing the conveyors to become nonlinear conveying systems that can convey around gentle bends. The central flexible shaft is similar to those used in common tools like a weed whacker, consisting of multiple layers of tightly wound wires around a central wire core. Utilization of compliant components (screw blade or outer wall) increases the robustness of the conveying, allowing an occasional oversized particle to pass hough the conveyor without causing a jam or stoppage

  11. Ursolic Acid Inhibits Na+/K+-ATPase Activity and Prevents TNF-α-Induced Gene Expression by Blocking Amino Acid Transport and Cellular Protein Synthesis

    PubMed Central

    Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao

    2011-01-01

    Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122

  12. Mechanism of arylboronic acid-catalyzed amidation reaction between carboxylic acids and amines.

    PubMed

    Wang, Chen; Yu, Hai-Zhu; Fu, Yao; Guo, Qing-Xiang

    2013-04-07

    Arylboronic acids were found to be efficient catalysts for the amidation reactions between carboxylic acids and amines. Theoretical calculations have been carried out to investigate the mechanism of this catalytic process. It is found that the formation of the acyloxyboronic acid intermediates from the carboxylic acid and the arylboronic acid is kinetically facile but thermodynamically unfavorable. Removal of water (as experimentally accomplished by using molecular sieves) is therefore essential for overall transformation. Subsequently C-N bond formation between the acyloxyboronic acid intermediates and the amine occurs readily to generate the desired amide product. The cleavage of the C-O bond of the tetracoordinate acyl boronate intermediates is the rate-determining step in this process. Our analysis indicates that the mono(acyloxy)boronic acid is the key intermediate. The high catalytic activity of ortho-iodophenylboronic acid is attributed to the steric effect as well as the orbital interaction between the iodine atom and the boron atom.

  13. Berberine stimulates glucose transport through a mechanism distinct from insulin.

    PubMed

    Zhou, Libin; Yang, Ying; Wang, Xiao; Liu, Shangquan; Shang, Wenbin; Yuan, Guoyue; Li, Fengying; Tang, Jinfeng; Chen, Mingdao; Chen, Jialun

    2007-03-01

    Berberine exerts a hypoglycemic effect, but the mechanism remains unknown. In the present study, the effect of berberine on glucose uptake was characterized in 3T3-L1 adipocytes. It was revealed that berberine stimulated glucose uptake in 3T3-L1 adipocytes in a dose- and time-dependent manner with the maximal effect at 12 hours. Glucose uptake was increased by berberine in 3T3-L1 preadipocytes as well. Berberine-stimulated glucose uptake was additive to that of insulin in 3T3-L1 adipocytes, even at the maximal effective concentrations of both components. Unlike insulin, the effect of berberine on glucose uptake was insensitive to wortmannin, an inhibitor of phosphatidylinositol 3-kinase, and SB203580, an inhibitor of p38 mitogen-activated protein kinase. Berberine activated extracellular signal-regulated kinase (ERK) 1/2, but PD98059, an ERK kinase inhibitor, only decreased berberine-stimulated glucose uptake by 32%. Berberine did not induce Ser473 phosphorylation of Akt nor enhance insulin-induced phosphorylation of Akt. Meanwhile, the expression and cellular localization of glucose transporter 4 (GLUT4) were not altered by berberine. Berberine did not increase GLUT1 gene expression. However, genistein, a tyrosine kinase inhibitor, completely blocked berberine-stimulated glucose uptake in 3T3-L1 adipocytes and preadipocytes, suggesting that berberine may induce glucose transport via increasing GLUT1 activity. In addition, berberine increased adenosine monophosphate-activated protein kinase and acetyl-coenzyme A carboxylase phosphorylation. These findings suggest that berberine increases glucose uptake through a mechanism distinct from insulin, and activated adenosine monophosphate-activated protein kinase seems to be involved in the metabolic effect of berberine.

  14. CLUB FORMATION MECHANISM FOR TRANSPORT-COMMUNITY CREDIT CARDS

    NASA Astrophysics Data System (ADS)

    Ding, Yue; Kobayashi, Kiyoshi; Nishida, Junji; Yoshida, Mamoru

    In this paper, the roles of transport-community cards jointly issued by a public transport firm and retails are investigated as a means to vitalize an obsolescence shopping center located in a middle of a city. When both the price of goods supplied by the retails and the transport fares affect the consumers' behavior, there exist pecuniary externality between the behaviors of the retails and transport firms. The introduction of a transport-community cards system enables to integrate a basket of goods and transport service into a single commodity; thus, the pecuniary externality can be internalized by price coordination. In addition, the paper clarifies theoretically that the transport firm initiatively decides the price of the transportation service and the retails transfer their incomes to the transport firm so that they are induced to jointly issue the transport-community cards.

  15. Modeling uranium transport in acidic contaminated groundwater with base addition.

    PubMed

    Zhang, Fan; Luo, Wensui; Parker, Jack C; Brooks, Scott C; Watson, David B; Jardine, Philip M; Gu, Baohua

    2011-06-15

    This study investigates reactive transport modeling in a column of uranium(VI)-contaminated sediments with base additions in the circulating influent. The groundwater and sediment exhibit oxic conditions with low pH, high concentrations of NO(3)(-), SO(4)(2-), U and various metal cations. Preliminary batch experiments indicate that additions of strong base induce rapid immobilization of U for this material. In the column experiment that is the focus of the present study, effluent groundwater was titrated with NaOH solution in an inflow reservoir before reinjection to gradually increase the solution pH in the column. An equilibrium hydrolysis, precipitation and ion exchange reaction model developed through simulation of the preliminary batch titration experiments predicted faster reduction of aqueous Al than observed in the column experiment. The model was therefore modified to consider reaction kinetics for the precipitation and dissolution processes which are the major mechanism for Al immobilization. The combined kinetic and equilibrium reaction model adequately described variations in pH, aqueous concentrations of metal cations (Al, Ca, Mg, Sr, Mn, Ni, Co), sulfate and U(VI). The experimental and modeling results indicate that U(VI) can be effectively sequestered with controlled base addition due to sorption by slowly precipitated Al with pH-dependent surface charge. The model may prove useful to predict field-scale U(VI) sequestration and remediation effectiveness.

  16. Molecular Mechanisms for Sweet-suppressing Effect of Gymnemic Acids*

    PubMed Central

    Sanematsu, Keisuke; Kusakabe, Yuko; Shigemura, Noriatsu; Hirokawa, Takatsugu; Nakamura, Seiji; Imoto, Toshiaki; Ninomiya, Yuzo

    2014-01-01

    Gymnemic acids are triterpene glycosides that selectively suppress taste responses to various sweet substances in humans but not in mice. This sweet-suppressing effect of gymnemic acids is diminished by rinsing the tongue with γ-cyclodextrin (γ-CD). However, little is known about the molecular mechanisms underlying the sweet-suppressing effect of gymnemic acids and the interaction between gymnemic acids versus sweet taste receptor and/or γ-CD. To investigate whether gymnemic acids directly interact with human (h) sweet receptor hT1R2 + hT1R3, we used the sweet receptor T1R2 + T1R3 assay in transiently transfected HEK293 cells. Similar to previous studies in humans and mice, gymnemic acids (100 μg/ml) inhibited the [Ca2+]i responses to sweet compounds in HEK293 cells heterologously expressing hT1R2 + hT1R3 but not in those expressing the mouse (m) sweet receptor mT1R2 + mT1R3. The effect of gymnemic acids rapidly disappeared after rinsing the HEK293 cells with γ-CD. Using mixed species pairings of human and mouse sweet receptor subunits and chimeras, we determined that the transmembrane domain of hT1R3 was mainly required for the sweet-suppressing effect of gymnemic acids. Directed mutagenesis in the transmembrane domain of hT1R3 revealed that the interaction site for gymnemic acids shared the amino acid residues that determined the sensitivity to another sweet antagonist, lactisole. Glucuronic acid, which is the common structure of gymnemic acids, also reduced sensitivity to sweet compounds. In our models, gymnemic acids were predicted to dock to a binding pocket within the transmembrane domain of hT1R3. PMID:25056955

  17. [Human peritoneum in vitro: changes in urate transport after administration of pyrazinoic acid].

    PubMed

    Czyzewska, K; Grzegorzewska, A; Stawny, B; Knapowski, J

    1989-01-01

    The article is an analysis of the dynamics of two-direction transportation of uric acid (UA) through the human peritoneum in vitro, and also changes of the dynamics under the influence of pyrazinoic++ acid. The peritoneum was taken from the anterior abdominal wall of patients undergoing planned abdominal surgery. It was found that the transportation of UA both from the vascular to the mesothelial side of the peritoneal membrane and in the opposite direction remained on a stable level for 120 minutes. The introduction of pyrazinoic++ acid decreased the transportation of UA from the vascular to the mesothelial side of the peritoneum on the average by 50 per cent. The transportation in the opposite direction did not change. The results obtained are consistent with results of clinical examinations. One may suppose that pyrazinoic++ acid induces changes in transportation qualities of the peritoneum.

  18. Fatty acid transport protein-2 inhibitor Grassofermata/CB5 protects cells against lipid accumulation and toxicity

    SciTech Connect

    Saini, Nipun; Black, Paul N.; Montefusco, David; DiRusso, Concetta C.

    2015-09-25

    The inhibition of the fatty acid uptake into non-adipose tissues provides an attractive target for prevention of lipotoxicity leading to obesity-associated non-alcoholic fatty liver disease and type 2 diabetes. Fatty acid transport proteins (FATPs) are bifunctional proteins involved in the uptake and activation of fatty acids by esterification with coenzyme A. Here we characterize Grassofermata/CB5, previously identified as a fatty acid uptake inhibitor directed against HsFATP2. The compound was effective in inhibiting the uptake of fatty acids in the low micro-molar range (IC{sub 50} 8–11 μM) and prevented palmitate-mediated lipid accumulation and cell death in cell lines that are models for intestines, liver, muscle and pancreas. In adipocytes, uptake inhibition was less effective (IC{sub 50} 58 μM). Inhibition was specific for long chain fatty acids and was ineffective toward medium chain fatty acids, which are transported by diffusion. Kinetic analysis of Grassofermata-dependent FA transport inhibition verified a non-competitive mechanism. By comparison with Grassofermata, several atypical antipsychotic drugs previously implicated as inhibitors of FA uptake were ineffectual. In mice Grassofermata decreased absorption of {sup 13}C-oleate demonstrating its potential as a therapeutic agent. - Highlights: • Grassofermata is a small compound inhibitor of FATP2. • Uptake inhibition is specific for long chain fatty acids. • Uptake kinetics shows low specificity for adipocytes compared to other cell types. • Inhibition is by a non-competitive mechanism. • Atypical antipsychotics do not inhibit FA uptake by comparison with Grassofermata.

  19. Decoupling Mechanical and Ion Transport Properties in Polymer Electrolyte Membranes

    NASA Astrophysics Data System (ADS)

    McIntosh, Lucas D.

    Polymer electrolytes are mixtures of a polar polymer and salt, in which the polymer replaces small molecule solvents and provides a dielectric medium so that ions can dissociate and migrate under the influence of an external electric field. Beginning in the 1970s, research in polymer electrolytes has been primarily motivated by their promise to advance electrochemical energy storage and conversion devices, such as lithium ion batteries, flexible organic solar cells, and anhydrous fuel cells. In particular, polymer electrolyte membranes (PEMs) can improve both safety and energy density by eliminating small molecule, volatile solvents and enabling an all-solid-state design of electrochemical cells. The outstanding challenge in the field of polymer electrolytes is to maximize ionic conductivity while simultaneously addressing orthogonal mechanical properties, such as modulus, fracture toughness, or high temperature creep resistance. The crux of the challenge is that flexible, polar polymers best-suited for polymer electrolytes (e.g., poly(ethylene oxide)) offer little in the way of mechanical robustness. Similarly, polymers typically associated with superior mechanical performance (e.g., poly(methyl methacrylate)) slow ion transport due to their glassy polymer matrix. The design strategy is therefore to employ structured electrolytes that exhibit distinct conducting and mechanically robust phases on length scales of tens of nanometers. This thesis reports a remarkably simple, yet versatile synthetic strategy---termed polymerization-induced phase separation, or PIPS---to prepare PEMs exhibiting an unprecedented combination of both high conductivity and high modulus. This performance is enabled by co-continuous, isotropic networks of poly(ethylene oxide)/ionic liquid and highly crosslinked polystyrene. A suite of in situ, time-resolved experiments were performed to investigate the mechanism by which this network morphology forms, and it appears to be tied to the

  20. Simulation of Electrical Transport in Rocks under Mechanical Action

    NASA Astrophysics Data System (ADS)

    Salgueiro da Silva, M. A.; Seixas, T. M.

    2015-12-01

    Rock's electrical properties can be changed by mechanical action, especially when deformation is accompanied by micro-fracturing processes. Knowing how electrical charge is generated in inelastically deformed rocks, the nature and properties of the generated charge carriers, and their spatial distribution and propagation is crucial to gain insight into the origin of seismo-electromagnetic signals. In this work, we describe briefly a model for the numerical simulation of electrical transport in rocks under mechanical action, assuming that high and low mobility charge carriers of opposite signs can be simultaneously generated by micro-fracturing processes and recombine, diffuse and drift across the sample rock. The electrical behavior can then be described using an adaptation of the formalism applied to semiconductors. We provide simulation results on a one-dimensional lattice using finite-difference discretization. Our results show that a large mobility contrast among charge carriers allows charge separation inside the deformation region, which leads to the formation of charged layers of alternate signs. Inside these layers, rapid electric field variations are observed which can lead to the emission of electromagnetic radiation. With proper positioning of current electrodes inside the deformation region, it is possible to collect electrical current even without any applied voltage. We discuss our results in the light of available experimental results on the generation of electrical and electromagnetic signals in deformed rocks.

  1. Interaction of sulfuric acid corrosion and mechanical wear of iron

    NASA Technical Reports Server (NTRS)

    Rengstorff, G. W. P.; Miyoshi, K.; Buckley, D. H.

    1984-01-01

    Friction and wear experiments were conducted with elemental iron sliding on aluminum oxide in aerated sulfuric acid at concentrations ranging from very dilute (0.00007 N; i.e., 4 ppm) to very concentrated (96 percent acid). Load and reciprocating sliding speed were kept constant. With the most dilute acid concentration of 0.00007 to 0.0002 N, a complex corrosion product formed that was friable and often increased friction and wear. At slightly higher concentrations of 0.001 N, metal losses were essentially by wear alone. Because no buildup of corrosion products occurred, this acid concentration became the standard from which to separate metal loss from direct corrosion and mechanical wear losses. When the acid concentration was increased to 5 percent (1 N), the well-established high corrosion rate of iron in sulfuric acid strongly dominated the total wear loss. This strong corrosion increased to 30 percent acid and decreased somewhat to 50 percent acid in accordance with expectations. However, the low corrosion of iron expected at acid concentrations of 65 to 96 percent was not observed in the wear area. It was apparent that the normal passivating film was being worn away and a galvanic cell established that rapidly attacked the wear area. Under the conditions where direct corrosion losses were highest, the coefficient of friction was the lowest.

  2. Interaction of sulfuric acid corrosion and mechanical wear of iron

    NASA Technical Reports Server (NTRS)

    Rengstorff, G. W. P.; Miyoshi, K.; Buckley, D. H.

    1986-01-01

    Friction and wear experiment were conducted with elemental iron sliding on aluminum oxide in aerated sulfuric acid at concentrations ranging from very dilute (0.00007 N; i.e., 4 ppm) to very concentrated (96 percent acid). Load and reciprocating sliding speed were kept constant. With the most dilute acid concentration of 0.00007 to 0.0002 N, a complex corrosion product formed that was friable and often increased friction and wear. At slightly higher concentrations of 0.001 N, metal losses were essentially by wear alone. Because no buildup of corrosion products occurred, this acid concentration became the standard from which to separate metal loss from direct corrosion and mechanical wear losses. When the acid concentration was increased to 5 percent (1 N), the well-established high corrosion rate of iron in sulfuric acid strongly dominated the total wear loss. This strong corrosion increased to 30 percent acid and decreased somewhat to 50 percent acid in accordance with expectations. However, the low corrosion of iron expected at acid concentrations of 65 to 96 percent was not observed in the wear area. It was apparent that the normal passivating film was being worn away and a galvanic cell established that rapidly attacked the wear area. Under the conditions where direct corrosion losses were highest, the coefficient of friction was the lowest.

  3. Fishy Business: Effect of Omega-3 Fatty Acids on Zinc Transporters and Free Zinc Availability in Human Neuronal Cells

    PubMed Central

    De Mel, Damitha; Suphioglu, Cenk

    2014-01-01

    Omega-3 (ω-3) fatty acids are one of the two main families of long chain polyunsaturated fatty acids (PUFA). The main omega-3 fatty acids in the mammalian body are α-linolenic acid (ALA), docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA). Central nervous tissues of vertebrates are characterized by a high concentration of omega-3 fatty acids. Moreover, in the human brain, DHA is considered as the main structural omega-3 fatty acid, which comprises about 40% of the PUFAs in total. DHA deficiency may be the cause of many disorders such as depression, inability to concentrate, excessive mood swings, anxiety, cardiovascular disease, type 2 diabetes, dry skin and so on. On the other hand, zinc is the most abundant trace metal in the human brain. There are many scientific studies linking zinc, especially excess amounts of free zinc, to cellular death. Neurodegenerative diseases, such as Alzheimer’s disease, are characterized by altered zinc metabolism. Both animal model studies and human cell culture studies have shown a possible link between omega-3 fatty acids, zinc transporter levels and free zinc availability at cellular levels. Many other studies have also suggested a possible omega-3 and zinc effect on neurodegeneration and cellular death. Therefore, in this review, we will examine the effect of omega-3 fatty acids on zinc transporters and the importance of free zinc for human neuronal cells. Moreover, we will evaluate the collective understanding of mechanism(s) for the interaction of these elements in neuronal research and their significance for the diagnosis and treatment of neurodegeneration. PMID:25195602

  4. Mitochondrial ascorbic acid transport is mediated by a low-affinity form of the sodium-coupled ascorbic acid transporter-2.

    PubMed

    Muñoz-Montesino, Carola; Roa, Francisco J; Peña, Eduardo; González, Mauricio; Sotomayor, Kirsty; Inostroza, Eveling; Muñoz, Carolina A; González, Iván; Maldonado, Mafalda; Soliz, Carlos; Reyes, Alejandro M; Vera, Juan Carlos; Rivas, Coralia I

    2014-05-01

    Despite the fundamental importance of the redox metabolism of mitochondria under normal and pathological conditions, our knowledge regarding the transport of vitamin C across mitochondrial membranes remains far from complete. We report here that human HEK-293 cells express a mitochondrial low-affinity ascorbic acid transporter that molecularly corresponds to SVCT2, a member of the sodium-coupled ascorbic acid transporter family 2. The transporter SVCT1 is absent from HEK-293 cells. Confocal colocalization experiments with anti-SVCT2 and anti-organelle protein markers revealed that most of the SVCT2 immunoreactivity was associated with mitochondria, with minor colocalization at the endoplasmic reticulum and very low immunoreactivity at the plasma membrane. Immunoblotting of proteins extracted from highly purified mitochondrial fractions confirmed that SVCT2 protein was associated with mitochondria, and transport analysis revealed a sigmoidal ascorbic acid concentration curve with an apparent ascorbic acid transport Km of 0.6mM. Use of SVCT2 siRNA for silencing SVCT2 expression produced a major decrease in mitochondrial SVCT2 immunoreactivity, and immunoblotting revealed decreased SVCT2 protein expression by approximately 75%. Most importantly, the decreased protein expression was accompanied by a concomitant decrease in the mitochondrial ascorbic acid transport rate. Further studies using HEK-293 cells overexpressing SVCT2 at the plasma membrane revealed that the altered kinetic properties of mitochondrial SVCT2 are due to the ionic intracellular microenvironment (low in sodium and high in potassium), with potassium acting as a concentration-dependent inhibitor of SVCT2. We discarded the participation of two glucose transporters previously described as mitochondrial dehydroascorbic acid transporters; GLUT1 is absent from mitochondria and GLUT10 is not expressed in HEK-293 cells. Overall, our data indicate that intracellular SVCT2 is localized in mitochondria, is

  5. Review: Mechanisms of How the Intestinal Microbiota Alters the Effects of Drugs and Bile Acids

    PubMed Central

    Cui, Julia Yue

    2015-01-01

    Information on the intestinal microbiota has increased exponentially this century because of technical advancements in genomics and metabolomics. Although information on the synthesis of bile acids by the liver and their transformation to secondary bile acids by the intestinal microbiota was the first example of the importance of the intestinal microbiota in biotransforming chemicals, this review will discuss numerous examples of the mechanisms by which the intestinal microbiota alters the pharmacology and toxicology of drugs and other chemicals. More specifically, the altered pharmacology and toxicology of salicylazosulfapridine, digoxin, l-dopa, acetaminophen, caffeic acid, phosphatidyl choline, carnitine, sorivudine, irinotecan, nonsteroidal anti-inflammatory drugs, heterocyclic amines, melamine, nitrazepam, and lovastatin will be reviewed. In addition, recent data that the intestinal microbiota alters drug metabolism of the host, especially Cyp3a, as well as the significance and potential mechanisms of this phenomenon are summarized. The review will conclude with an update of bile acid research, emphasizing the bile acid receptors (FXR and TGR5) that regulate not only bile acid synthesis and transport but also energy metabolism. Recent data indicate that by altering the intestinal microbiota, either by diet or drugs, one may be able to minimize the adverse effects of the Western diet by altering the composition of bile acids in the intestine that are agonists or antagonists of FXR and TGR5. Therefore, it may be possible to consider the intestinal microbiota as another drug target. PMID:26261286

  6. Review: Mechanisms of How the Intestinal Microbiota Alters the Effects of Drugs and Bile Acids.

    PubMed

    Klaassen, Curtis D; Cui, Julia Yue

    2015-10-01

    Information on the intestinal microbiota has increased exponentially this century because of technical advancements in genomics and metabolomics. Although information on the synthesis of bile acids by the liver and their transformation to secondary bile acids by the intestinal microbiota was the first example of the importance of the intestinal microbiota in biotransforming chemicals, this review will discuss numerous examples of the mechanisms by which the intestinal microbiota alters the pharmacology and toxicology of drugs and other chemicals. More specifically, the altered pharmacology and toxicology of salicylazosulfapridine, digoxin, l-dopa, acetaminophen, caffeic acid, phosphatidyl choline, carnitine, sorivudine, irinotecan, nonsteroidal anti-inflammatory drugs, heterocyclic amines, melamine, nitrazepam, and lovastatin will be reviewed. In addition, recent data that the intestinal microbiota alters drug metabolism of the host, especially Cyp3a, as well as the significance and potential mechanisms of this phenomenon are summarized. The review will conclude with an update of bile acid research, emphasizing the bile acid receptors (FXR and TGR5) that regulate not only bile acid synthesis and transport but also energy metabolism. Recent data indicate that by altering the intestinal microbiota, either by diet or drugs, one may be able to minimize the adverse effects of the Western diet by altering the composition of bile acids in the intestine that are agonists or antagonists of FXR and TGR5. Therefore, it may be possible to consider the intestinal microbiota as another drug target.

  7. Regulation of amino acid transporter trafficking by mTORC1 in primary human trophoblast cells is mediated by the ubiquitin ligase Nedd4-2.

    PubMed

    Rosario, Fredrick J; Dimasuay, Kris Genelyn; Kanai, Yoshikatsu; Powell, Theresa L; Jansson, Thomas

    2016-04-01

    Changes in placental amino acid transfer directly contribute to altered fetal growth, which increases the risk for perinatal complications and predisposes for the development of obesity, diabetes and cardiovascular disease later in life. Placental amino acid transfer is critically dependent on the expression of specific transporters in the plasma membrane of the trophoblast, the transporting epithelium of the human placenta. However, the molecular mechanisms regulating this process are largely unknown. Nedd4-2 is an ubiquitin ligase that catalyses the ubiquitination of proteins, resulting in proteasomal degradation. We hypothesized that inhibition of mechanistic target of rapamycin complex 1 (mTORC1) decreases amino acid uptake in primary human trophoblast (PHT) cells by activation of Nedd4-2, which increases transporter ubiquitination resulting in decreased transporter expression in the plasma membrane. mTORC 1 inhibition increased the expression of Nedd4-2, promoted ubiquitination and decreased the plasma membrane expression of SNAT2 (an isoform of the System A amino acid transporter) and LAT1 (a System L amino acid transporter isoform), resulting in decreased cellular amino acid uptake. Nedd4-2 silencing markedly increased the trafficking of SNAT2 and LAT1 to the plasma membrane, which stimulated cellular amino acid uptake. mTORC1 inhibition by silencing of raptor failed to decrease amino acid transport following Nedd4-2 silencing. In conclusion, we have identified a novel link between mTORC1 signalling and ubiquitination, a common posttranslational modification. Because placental mTORC1 is inhibited in fetal growth restriction and activated in fetal overgrowth, we propose that regulation of placental amino acid transporter ubiquitination by mTORC1 and Nedd4-2 constitutes a molecular mechanisms underlying abnormal fetal growth.

  8. AXONAL TRANSPORT: CARGO-SPECIFIC MECHANISMS OF MOTILITY AND REGULATION

    PubMed Central

    Maday, Sandra; Twelvetrees, Alison E.; Moughamian, Armen J.; Holzbaur, Erika L. F.

    2014-01-01

    Axonal transport is essential for neuronal function, and many neurodevelopmental and neurodegenerative diseases result from mutations in the axonal transport machinery. Anterograde transport supplies distal axons with newly synthesized proteins and lipids, including synaptic components required to maintain presynaptic activity. Retrograde transport is required to maintain homeostasis by removing aging proteins and organelles from the distal axon for degradation and recycling of components. Retrograde axonal transport also plays a major role in neurotrophic and injury response signaling. This review provides an overview of the axonal transport pathway and discusses its role in neuronal function. PMID:25374356

  9. Palmitate stimulates glucose transport in rat adipocytes by a mechanism involving translocation of the insulin sensitive glucose transporter (GLUT4)

    NASA Technical Reports Server (NTRS)

    Hardy, R. W.; Ladenson, J. H.; Henriksen, E. J.; Holloszy, J. O.; McDonald, J. M.

    1991-01-01

    In rat adipocytes, palmitate: a) increases basal 2-deoxyglucose transport 129 +/- 27% (p less than 0.02), b) decreases the insulin sensitive glucose transporter (GLUT4) in low density microsomes and increases GLUT4 in plasma membranes and c) increases the activity of the insulin receptor tyrosine kinase. Palmitate-stimulated glucose transport is not additive with the effect of insulin and is not inhibited by the protein kinase C inhibitors staurosporine and sphingosine. In rat muscle, palmitate: a) does not affect basal glucose transport in either the soleus or epitrochlearis and b) inhibits insulin-stimulated glucose transport by 28% (p less than 0.005) in soleus but not in epitrochlearis muscle. These studies demonstrate a potentially important differential role for fatty acids in the regulation of glucose transport in different insulin target tissues.

  10. Salicylic acid transport in Ricinus communis involves a pH-dependent carrier system in addition to diffusion.

    PubMed

    Rocher, Françoise; Chollet, Jean-François; Legros, Sandrine; Jousse, Cyril; Lemoine, Rémi; Faucher, Mireille; Bush, Daniel R; Bonnemain, Jean-Louis

    2009-08-01

    Despite its important functions in plant physiology and defense, the membrane transport mechanism of salicylic acid (SA) is poorly documented due to the general assumption that SA is taken up by plant cells via the ion trap mechanism. Using Ricinus communis seedlings and modeling tools (ACD LogD and Vega ZZ softwares), we show that phloem accumulation of SA and hydroxylated analogs is completely uncorrelated with the physicochemical parameters suitable for diffusion (number of hydrogen bond donors, polar surface area, and, especially, LogD values at apoplastic pHs and Delta LogD between apoplast and phloem sap pH values). These and other data (such as accumulation in phloem sap of the poorly permeant dissociated form of monohalogen derivatives from apoplast and inhibition of SA transport by the thiol reagent p-chloromercuribenzenesulfonic acid [pCMBS]) lead to the following conclusions. As in intestinal cells, SA transport in Ricinus involves a pH-dependent carrier system sensitive to pCMBS; this carrier can translocate monohalogen analogs in the anionic form; the efficiency of phloem transport of hydroxylated benzoic acid derivatives is tightly dependent on the position of the hydroxyl group on the aromatic ring (SA corresponds to the optimal position) but moderately affected by halogen addition in position 5, which is known to increase plant defense. Furthermore, combining time-course experiments and pCMBS used as a tool, we give information about the localization of the SA carrier. SA uptake by epidermal cells (i.e. the step preceding the symplastic transport to veins) insensitive to pCMBS occurs via the ion-trap mechanism, whereas apoplastic vein loading involves a carrier-mediated mechanism (which is targeted by pCMBS) in addition to diffusion.

  11. The role of L-type amino acid transporter 1 in human tumors

    PubMed Central

    Zhao, Yu; Wang, Lin; Pan, Jihong

    2015-01-01

    Summary L-type amino acid transporter 1 (LAT1) is an L-type amino acid transporter and transports large neutral amino acids such as leucine, isoleucine, valine, phenylalanine, tyrosine, tryptophan, methionine, and histidine. LAT1 was found to be highly expressed especially in human cancer tissues, and up-regulated LAT1 can lead to dysfunction in human tumor cells. These findings suggest that LAT1 plays an important role in human tumors. This review provides an overview of the current understanding of LAT1 expression and its clinical significance and function in tumors. PMID:26668776

  12. Increased ubiquitination and reduced plasma membrane trafficking of placental amino acid transporter SNAT-2 in human IUGR

    PubMed Central

    Rosario, Fredrick J.; Shehab, Majida Abu; Powell, Theresa L.; Gupta, Madhulika B.; Jansson, Thomas

    2015-01-01

    Placental amino acid transport is decreased in intrauterine growth restriction (IUGR); however, the underlying mechanisms remain largely unknown. We have shown that mechanistic target of rapamycin (mTOR) signalling regulates system A amino acid transport by modulating the ubiquitination and plasma membrane trafficking of sodium-coupled neutral amino acid transporter 2 (SNAT-2) in cultured primary human trophoblast cells. We hypothesize that IUGR is associated with (1) inhibition of placental mTORC1 and mTORC2 signalling pathways, (2) increased amino acid transporter ubiquitination in placental homogenates and (3) decreased protein expression of SNAT-2 in the syncytiotrophoblast microvillous plasma membrane (MVM). To test this hypothesis, we collected placental tissue and isolated MVM from women with pregnancies complicated by IUGR (n=25) and gestational age-matched women with appropriately grown control infants (n=19, birth weights between the twenty-fifth to seventy-fifth percentiles). The activity of mTORC1 and mTORC2 was decreased whereas the protein expression of the ubiquitin ligase NEDD4-2 (neural precursor cell expressed developmentally down-regulated protein 4-2; +72%, P<0.0001) and the ubiquitination of SNAT-2 (+180%, P<0.05) were increased in homogenates of IUGR placentas. Furthermore, IUGR was associated with decreased system A amino acid transport activity (–72%, P<0.0001) and SNAT-1 (–42%, P<0.05) and SNAT-2 (–31%, P<0.05) protein expression in MVM. In summary, these findings are consistent with the possibility that decreased placental mTOR activity causes down-regulation of placental system A activity by shifting SNAT-2 trafficking towards proteasomal degradation, thereby contributing to decreased fetal amino acid availability and restricted fetal growth in IUGR. PMID:26374858

  13. Increased ubiquitination and reduced plasma membrane trafficking of placental amino acid transporter SNAT-2 in human IUGR.

    PubMed

    Chen, Yi-Yung; Rosario, Fredrick J; Shehab, Majida Abu; Powell, Theresa L; Gupta, Madhulika B; Jansson, Thomas

    2015-12-01

    Placental amino acid transport is decreased in intrauterine growth restriction (IUGR); however, the underlying mechanisms remain largely unknown. We have shown that mechanistic target of rapamycin (mTOR) signalling regulates system A amino acid transport by modulating the ubiquitination and plasma membrane trafficking of sodium-coupled neutral amino acid transporter 2 (SNAT-2) in cultured primary human trophoblast cells. We hypothesize that IUGR is associated with (1) inhibition of placental mTORC1 and mTORC2 signalling pathways, (2) increased amino acid transporter ubiquitination in placental homogenates and (3) decreased protein expression of SNAT-2 in the syncytiotrophoblast microvillous plasma membrane (MVM). To test this hypothesis, we collected placental tissue and isolated MVM from women with pregnancies complicated by IUGR (n=25) and gestational age-matched women with appropriately grown control infants (n=19, birth weights between the twenty-fifth to seventy-fifth percentiles). The activity of mTORC1 and mTORC2 was decreased whereas the protein expression of the ubiquitin ligase NEDD4-2 (neural precursor cell expressed developmentally down-regulated protein 4-2; +72%, P<0.0001) and the ubiquitination of SNAT-2 (+180%, P<0.05) were increased in homogenates of IUGR placentas. Furthermore, IUGR was associated with decreased system A amino acid transport activity (-72%, P<0.0001) and SNAT-1 (-42%, P<0.05) and SNAT-2 (-31%, P<0.05) protein expression in MVM. In summary, these findings are consistent with the possibility that decreased placental mTOR activity causes down-regulation of placental system A activity by shifting SNAT-2 trafficking towards proteasomal degradation, thereby contributing to decreased fetal amino acid availability and restricted fetal growth in IUGR.

  14. Fluorescence measurement of chloride transport in monolayer cultured cells. Mechanisms of chloride transport in fibroblasts.

    PubMed

    Chao, A C; Dix, J A; Sellers, M C; Verkman, A S

    1989-12-01

    The methodology has been developed to measure Cl activity and transport in cultured cells grown on a monolayer using the entrapped Cl-sensitive fluorophore 6-methoxy-N-[3-sulfopropyl] quinolinium (SPQ). The method was applied to a renal epithelial cell line, LLC-PKI, and a nonepithelial cell line, Swiss 3T3 fibroblasts. SPQ was nontoxic to cells when present for greater than h in the culture media. To load with SPQ (5 mM), cells were made transiently permeable by exposure to hypotonic buffer (150 mOsm, 4 min). Intracellular fluorescence was monitored continuously by epifluorescence microscopy using low illumination intensity at 360 +/- 5 nm excitation wavelength and photomultiplier detection at greater than 410 nm. Over 60 min at 37 degrees C, there was no photobleaching and less than 10% leakage of SPQ out of cells; intracellular SPQ fluorescence was uniform. SPQ fluorescence was calibrated against intracellular [Cl] using high K solutions containing the ionophores nigericin and tributyltin. The Stern-Volmer constant (Kq) for quenching of intracellular SPQ by Cl was 13 M-1 for fibroblasts and LLC-PKl cells. In the absence of Cl, SPQ lifetime was 26 ns in aqueous solution and 3.7 +/- 0.6 ns in cells, showing that the lower Kq in cells than in free solution (Kq = 118 M-1) was due to SPQ quenching by intracellular anions. To examine Cl transport mechanisms, the time course of intracellular [Cl] was measured in response to rapid Cl addition and removal in the presence of ion or pH gradients. In fibroblasts, three distinct Cl transporting systems were identified: a stilbeneinhibitable Cl/HCO3 exchanger, a furosemide-sensitive Na/K/2Cl cotransporter, and a Ca-regulated Cl conductance. These results establish a direct optical method to measure intracellular [Cl] continuously in cultured cells.

  15. Avidity Mechanism of Dendrimer–Folic Acid Conjugates

    PubMed Central

    2015-01-01

    Multivalent conjugation of folic acid has been employed to target cells overexpressing folate receptors. Such polymer conjugates have been previously demonstrated to have high avidity to folate binding protein. However, the lack of a monovalent folic acid–polymer material has prevented a full binding analysis of these conjugates, as multivalent binding mechanisms and polymer-mass mechanisms are convoluted in samples with broad distributions of folic acid-to-dendrimer ratios. In this work, the synthesis of a monovalent folic acid–dendrimer conjugate allowed the elucidation of the mechanism for increased binding between the folic acid–polymer conjugate and a folate binding protein surface. The increased avidity is due to a folate-keyed interaction between the dendrimer and protein surfaces that fits into the general framework of slow-onset, tight-binding mechanisms of ligand/protein interactions. PMID:24725205

  16. Molecular mechanisms beyond glucose transport in diabetes-related male infertility.

    PubMed

    Alves, M G; Martins, A D; Rato, L; Moreira, P I; Socorro, S; Oliveira, P F

    2013-05-01

    Diabetes mellitus (DM) is one of the greatest public health threats in modern societies. Although during a few years it was suggested that DM had no significant effect in male reproductive function, this view has been challenged in recent years. The increasing incidence of DM worldwide will inevitably result in a higher prevalence of this pathology in men of reproductive age and subfertility or infertility associated with DM is expected to dramatically rise in upcoming years. From a clinical perspective, the evaluation of semen parameters, as well as spermatozoa deoxyribonucleic acid (DNA) integrity, are often studied due to their direct implications in natural and assisted conception. Nevertheless, recent studies based on the molecular mechanisms beyond glucose transport in testicular cells provide new insights in DM-induced alterations in male reproductive health. Testicular cells have their own glucose sensing machinery that react to hormonal fluctuations and have several mechanisms to counteract hyper- and hypoglycemic events. Moreover, the metabolic cooperation between testicular cells is crucial for normal spermatogenesis. Sertoli cells (SCs), which are the main components of blood-testis barrier, are not only responsible for the physical support of germ cells but also for lactate production that is then metabolized by the developing germ cells. Any alteration in this tied metabolic cooperation may have a dramatic consequence in male fertility potential. Therefore, we present an overview of the clinical significance of DM in the male reproductive health with emphasis on the molecular mechanisms beyond glucose fluctuation and transport in testicular cells.

  17. Improvement of Transmembrane Transport Mechanism Study of Imperatorin on P-Glycoprotein-Mediated Drug Transport.

    PubMed

    Liao, Zheng-Gen; Tang, Tao; Guan, Xue-Jing; Dong, Wei; Zhang, Jing; Zhao, Guo-Wei; Yang, Ming; Liang, Xin-Li

    2016-11-24

    P-glycoprotein (P-gp) affects the transport of many drugs; including puerarin and vincristine. Our previous study demonstrated that imperatorin increased the intestinal absorption of puerarin and vincristine by inhibiting P-gp-mediated drug efflux. However; the underlying mechanism was not known. The present study investigated the mechanism by which imperatorin promotes P-gp-mediated drug transport. We used molecular docking to predict the binding force between imperatorin and P-gp and the effect of imperatorin on P-gp activity. P-gp efflux activity and P-gp ATPase activity were measured using a rhodamine 123 (Rh-123) accumulation assay and a Pgp-Glo™ assay; respectively. The fluorescent probe 1,6-diphenyl-1,3,5-hexatriene (DPH) was used to assess cellular membrane fluidity in MDCK-MDR1 cells. Western blotting was used to analyze the effect of imperatorin on P-gp expression; and P-gp mRNA levels were assessed by qRT-PCR. Molecular docking results demonstrated that the binding force between imperatorin and P-gp was much weaker than the force between P-gp and verapamil (a P-gp substrate). Imperatorin activated P-gp ATPase activity; which had a role in the inhibition of P-gp activity. Imperatorin promoted Rh-123 accumulation in MDCK-MDR1 cells and decreased cellular membrane fluidity. Western blotting demonstrated that imperatorin inhibited P-gp expression; and qRT-PCR revealed that imperatorin down-regulated P-gp (MDR1) gene expression. Imperatorin decreased P-gp-mediated drug efflux by inhibiting P-gp activity and the expression of P-gp mRNA and protein. Our results suggest that imperatorin could down-regulate P-gp expression to overcome multidrug resistance in tumors.

  18. Functional domains of the fatty acid transport proteins: studies using protein chimeras.

    PubMed

    DiRusso, Concetta C; Darwis, Dina; Obermeyer, Thomas; Black, Paul N

    2008-03-01

    Fatty acid transport proteins (FATP) function in fatty acid trafficking pathways, several of which have been shown to participate in the transport of exogenous fatty acids into the cell. Members of this protein family also function as acyl CoA synthetases with specificity towards very long chain fatty acids or bile acids. These proteins have two identifying sequence motifs: The ATP/AMP motif, an approximately 100 amino acid segment required for ATP binding and common to members of the adenylate-forming super family of proteins, and the FATP/VLACS motif that consists of approximately 50 amino acid residues and is restricted to members of the FATP family. This latter motif has been implicated in fatty acid transport in the yeast FATP orthologue Fat1p. In the present studies using a yeast strain containing deletions in FAT1 (encoding Fat1p) and FAA1 (encoding the major acyl CoA synthetase (Acsl) Faa1p) as an experimental platform, the phenotypic and functional properties of specific murine FATP1-FATP4 and FATP6-FATP4 protein chimeras were evaluated in order to define elements within these proteins that further distinguish the fatty acid transport and activation functions. As expected from previous work FATP1 and FATP4 were functional in the fatty acid transport pathway, while and FATP6 was not. All three isoforms were able to activate the very long chain fatty acids arachidonate (C(20:4)) and lignocerate (C(24:0)), but with distinguishing activities between saturated and highly unsaturated ligands. A 73 amino acid segment common to FATP1 and FATP4 and between the ATP/AMP and FATP/VLACS motifs was identified by studying the chimeras, which is hypothesized to contribute to the transport function.

  19. LAT1 is the transport competent unit of the LAT1/CD98 heterodimeric amino acid transporter.

    PubMed

    Napolitano, Lara; Scalise, Mariafrancesca; Galluccio, Michele; Pochini, Lorena; Albanese, Leticia Maria; Indiveri, Cesare

    2015-10-01

    LAT1 (SLC7A5) and CD98 (SLC3A2) constitute a heterodimeric transmembrane protein complex that catalyzes amino acid transport. Whether one or both subunits are competent for transport is still unclear. The present work aims to solve this question using different experimental strategies. Firstly, LAT1 and CD98 were immuno-detected in protein extracts from SiHa cells. Under oxidizing conditions, i.e., without addition of SH (thiol) reducing agent DTE, both proteins were revealed as a 120kDa major band. Upon DTE treatment separated bands, corresponding to LAT1(35kDa) or CD98(80kDa), were detected. LAT1 function was evaluated in intact cells as BCH sensitive [(3)H]His transport inhibited by hydrophobic amino acids. Antiport of [(3)H]His was measured in proteoliposomes reconstituted with SiHa cell extract in presence of internal His. Transport was increased by DTE. Hydrophobic amino acids were best inhibitors in addition to hydrophilic Tyr, Gln, Asn and Lys. Cys, Tyr and Gln, included in the intraliposomal space, were transported in antiport with external [(3)H]His. Similar experiments were performed in proteoliposomes reconstituted with the recombinant purified hLAT1. Results overlapping those obtained with native protein were achieved. Lower transport of [(3)H]Leu and [(3)H]Gln with respect to [(3)H]His was detected. Kinetic asymmetry was found with external Km for His lower than internal one. No transport was detected in proteoliposomes reconstituted with recombinant hCD98. The experimental data demonstrate that LAT1 is the sole transport competent subunit of the heterodimer. This conclusion has important outcome for following studies on functional characterization and identification of specific inhibitors with potential application in human therapy.

  20. Bile acid transport in sister of P-glycoprotein (ABCB11) knockout mice.

    PubMed

    Lam, Ping; Wang, Renxue; Ling, Victor

    2005-09-20

    In vertebrates, bile flow is essential for movement of water and solutes across liver canalicular membranes. In recent years, the molecular motor of canalicular bile acid secretion has been identified as a member of the ATP binding cassette transporter (ABC) superfamily, known as sister of P-glycoprotein (Spgp) or bile salt export pump (Bsep, ABCB11). In humans, mutations in the BSEP gene are associated with a very low level of bile acid secretion and severe cholestasis. However, as reported previously, because the spgp(-)(/)(-) knockout mice do not express severe cholestasis and have substantial bile acid secretion, we investigated the "alternative transport system" that allows these mice to be physiologically relatively normal. We examined the expression levels of several ABC transporters in spgp(-)(/)(-) mice and found that the level of multidrug resistance Mdr1 (P-glycoprotein) was strikingly increased while those of Mdr2, Mrp2, and Mrp3 were increased to only a moderate extent. We hypothesize that an elevated level of Mdr1 in the spgp(-)(/)(-) knockout mice functions as an alternative pathway to transport bile acids and protects hepatocytes from bile acid-induced cholestasis. In support of this hypothesis, we showed that plasma membrane vesicles isolated from a drug resistant cell line expressing high levels of P-glycoprotein were capable of transporting bile acids, albeit with a 5-fold lower affinity compared to Spgp. This finding is the first direct evidence that P-glycoprotein (Mdr1) is capable of transporting bile acids.

  1. Active transport of amino acids by a guanidiniocarbonyl-pyrrole receptor.

    PubMed

    Urban, Christian; Schmuck, Carsten

    2010-08-16

    Herein we report the synthesis and characterization of a transporter 9 for N-acetylated amino acids. Transporter 9 is a conjugate of a guanidiniocarbonyl pyrrole cation, one of the most efficient carboxylate binding motifs reported so far, and a hydrophobic tris(dodecylbenzyl) group, which ensures solubility in organic solvents. In its protonated form, 9 binds N-acetylated amino acid carboxylates in wet organic solvents with association constants in the range of 10(4) M(-1) as estimated by extraction experiments. Aromatic amino acids are preferred due to additional cation-pi-interactions of the amino acid side chain with the guanidiniocarbonyl pyrrole moiety. U-tube experiments established efficient transport across a bulk liquid chloroform phase with fluxes approaching 10(-6) mol m(-2) s(-1). In experiments with single substrates, the release rate of the amino acid from the receptor-substrate complex at the interface with the receiving phase is rate determining. In contrast to this, in competition experiments with several substrates, the thermodynamic affinity to 9 becomes decisive. As 9 can only transport anions in its protonated form and has a pK(a) value of approximately 7, pH-driven active transport of amino acids is also possible. Transport occurs as a symport of the amino acid carboxylate and a proton.

  2. An Ekman Transport Mechanism for the Atlantic Multidecadal Oscillation

    NASA Astrophysics Data System (ADS)

    Pratt, V. R.

    2014-12-01

    Multidecadal global climate since 1850 consists of the expected greenhouse warming and two cycles of a fluctuation commonly associated with the AMO that so far has not been satisfactorily explained. In GC53C-06 at AGUFM13 we compared land and sea temperatures during the global warmings of 1860-1880 and 1910-1940 and inferred that heat flowed sea to land, ruling out aerosol-based external forcings and indicating an internal source such as an instability in the AMOC. Length of day during the past century has varied by ~4 ms inversely with the AMO. Noting that the ocean floor is some five times thinner than the continental crust, we propose here that Earth's rotation regulates heat flux through the ocean floor. One mechanism for this is centrifugal force pulling plates apart, particularly along the Mid-Atlantic Ridge and around the Ring of Fire, increasing flux by an amount that would easily pass unnoticed in the 1930s. Another mechanism, perhaps less strong, is stress from rotational acceleration increasing the thermal conductivity of the young rocks comprising the ocean floor. A difficulty is that the ocean would absorb the fluctuations before reaching the surface. We overcome this difficulty via Ekman transport. This mechanism acts on a 50 m deep layer at the surface to drive it polewards from the ITCZ at 3 cm/sec or 1000 km/yr, orders of magnitude faster than the MOC which therefore cannot interfere. This creates a suction at the ITCZ and a downwards pumping action at 30°. In order to close this cycle there must be a flow equal in volume rate towards the ITCZ at depth. We propose that the heat entering the ocean bottom between 30° S and 30° N enters these two "Ekman cells", which carry it to the surface via the ITCZ. To evaluate feasibility, take the area of the participating 50m surface layer to be 1014 m2, making the volume of the top and bottom layers 1016 m3. Only 1022 J of heat is needed to warm or cool this by 1/3.85 = 0.26 °C. Over the 30 years 1910

  3. Transporters for ammonium, amino acids and peptides are expressed in pitchers of the carnivorous plant Nepenthes.

    PubMed

    Schulze, W; Frommer, W B; Ward, J M

    1999-03-01

    Insect capture and digestion contribute substantially to the nitrogen budget of carnivorous plants. In Nepenthes, insect-derived nitrogenous compounds are imported from the pitcher fluid and transported throughout the plant via the vascular tissue to support growth. Import and distribution of nutrients may require transmembrane nitrogen transporters. Representatives of three classes of genes encoding transporters for the nitrogenous compounds ammonium, amino acids and peptides were identified in Nepenthes pitchers. The expression at the cellular level of an ammonium transporter gene, three amino acid transporter genes, and one peptide transporter gene were investigated in the insect trapping organs of Nepenthes. Expression of the ammonium transporter gene NaAMT1 was detected in the head cells of digestive glands in the lower part of the pitcher where NaAMT1 may function in ammonium uptake from the pitcher fluid. One amino acid transporter gene, NaAAP1, was expressed in bundle sheath cells surrounding the vascular tissue. To understand the locations where transmembrane transport could be required within the pitcher, symplasmic and apoplasmic continuity was probed using fluorescent dyes. Symplasmic connections were not found between cortical cells and vascular bundles. Therefore, the amino acid transporter encoded by NaAAP1 may be involved in transport of amino acids into the vascular tissue. In contrast, expression of the peptide transporter gene NaNTR1 was detected in phloem cells of the vascular tissue within pitchers. NaNTR1 may function in the export of nitrogen from the pitcher by loading peptides into the phloem.

  4. Applications of hydroxy acids: classification, mechanisms, and photoactivity

    PubMed Central

    Kornhauser, Andrija; Coelho, Sergio G; Hearing, Vincent J

    2010-01-01

    Hydroxy acids (HAs) represent a class of compounds which have been widely used in a number of cosmetic and therapeutic formulations in order to achieve a variety of beneficial effects for the skin. We review and discuss the most frequently used classes of these compounds, such as α-hydroxy acids, β-hydroxy acids, polyhydroxy acids, and bionic acids, and describe their applications as cosmetic and therapeutic agents. Special emphasis is devoted to the safety evaluation of these formulations, in particular on the effects of their prolonged use on sun-exposed skin. Furthermore, we summarize the very limited number of studies dealing with the modifications evoked by topical application of products containing HAs on photocarcinogenesis. In spite of the large number of reports on the cosmetic and clinical effects of HAs, their biological mechanism(s) of action still require more clarification. Some of these mechanisms are discussed in this article along with important findings on the effect of HAs on melanogenesis and on tanning. We also emphasize the important contribution of cosmetic vehicles in these types of studies. Thus, HAs play an important role in cosmetic formulations, as well as in many dermatologic applications, such as in treating photoaging, acne, ichthyosis, rosacea, pigmentation disorders, and psoriasis. PMID:21437068

  5. Regulation of dipeptide transport in Saccharomyces cerevisiae by micromolar amino acid concentrations

    SciTech Connect

    Island, M.D.; Naider, F.; Becker, J.M.

    1987-05-01

    Prototrophic Saccharomyces cerevisiae X2180, when grown on unsupplemented minimal medium, displayed little sensitivity to ethionine- and m-fluorophenylalanine-containing toxic dipeptides. The authors examined the influence of the 20 naturally occurring amino acids on sensitivity to toxic dipeptides. A number of these amino acids, at concentrations as low as 1 ..mu..M (leucine and tryptophan), produced large increases in sensitivity to leucyl-ethionine, alanyl-ethionine, and leucyl-m-fluorophenylalanine. Sensitivity to ethionine and m-fluorophenylalanine remained high under either set of conditions. The addition of 0.15 mM tryptophan to a growing culture resulted in the induction of dipeptide transport, as indicated by a 25-fold increase in the initial rate of L-leucyl-L(/sup 3/H)leucine accumulation. This increase, which was prevented by the addition of cycloheximide, began within 30 min and peaked approximately 240 min after a shift to medium containing tryptophan. Comparable increases in peptidase activity were not apparent in crude cell extracts form tryptophan-induced cultures. The authors concluded that S. cerevisiae possesses a specific mechanism for the induction of dipeptidetransport that can respond to very low concentrations of amino acids.

  6. Mammalian fatty acid synthase: closure on a textbook mechanism?

    PubMed

    Leadlay, Peter; Baerga-Ortiz, Abel

    2003-02-01

    Mammalian fatty acid synthase is a classic example of a chain-building multienzyme. A cornerstone of its mechanism has been the obligatory collaboration of two identical subunits, with fatty acyl intermediates transferring between them. Now, fresh evidence has upset this view.

  7. Hearing molecules, mechanism and transportation: modeled in Drosophila melanogaster.

    PubMed

    Bokolia, Naveen Prakash; Mishra, Monalisa

    2015-02-01

    Mechanosensory transduction underlies the perception of touch, sound and acceleration. The mechanical signals exist in the environment are resensed by the specialized mechanosensory cells, which convert the external forces into the electrical signals. Hearing is a magnificent example that relies on the mechanotransduction mediated by the auditory cells, for example the inner-ear hair cells in vertebrates and the Johnston's organ (JO) in fly. Previous studies have shown the fundamental physiological processes in the fly and vertebrate auditory organs are similar, suggesting that there might be a set of similar molecules underlying these processes. The molecular studies of the fly JO have been shown to be remarkably successful in discovering the developmental and functional genes that provided further implications in vertebrates. Several evolutionarily conserved molecules and signaling pathways have been shown to govern the development of the auditory organs in both vertebrates and invertebrates. The current review describes the similarities and differences between the vertebrate and fly auditory organs at developmental, structural, molecular, and transportation levels.

  8. Robustness of multidimensional Brownian ratchets as directed transport mechanisms

    NASA Astrophysics Data System (ADS)

    González-Candela, Ernesto; Romero-Rochín, Víctor; Del Río, Fernando

    2011-08-01

    Brownian ratchets have recently been considered as models to describe the ability of certain systems to locate very specific states in multidimensional configuration spaces. This directional process has particularly been proposed as an alternative explanation for the protein folding problem, in which the polypeptide is driven toward the native state by a multidimensional Brownian ratchet. Recognizing the relevance of robustness in biological systems, in this work we analyze such a property of Brownian ratchets by pushing to the limits all the properties considered essential to produce directed transport. Based on the results presented here, we can state that Brownian ratchets are able to deliver current and locate funnel structures under a wide range of conditions. As a result, they represent a simple model that solves the Levinthal's paradox with great robustness and flexibility and without requiring any ad hoc biased transition probability. The behavior of Brownian ratchets shown in this article considerably enhances the plausibility of the model for at least part of the structural mechanism behind protein folding process.

  9. A glial amino-acid transporter controls synapse strength and courtship in Drosophila.

    PubMed

    Grosjean, Yael; Grillet, Micheline; Augustin, Hrvoje; Ferveur, Jean-François; Featherstone, David E

    2008-01-01

    Mate choice is an evolutionarily critical decision that requires the detection of multiple sex-specific signals followed by central integration of these signals to direct appropriate behavior. The mechanisms controlling mate choice remain poorly understood. Here, we show that the glial amino-acid transporter genderblind controls whether Drosophila melanogaster males will attempt to mate with other males. Genderblind (gb) mutant males showed no alteration in heterosexual courtship or copulation, but were attracted to normally unappealing male species-specific chemosensory cues. As a result, genderblind mutant males courted and attempted to copulate with other Drosophila males. This homosexual behavior could be induced within hours using inducible RNAi, suggesting that genderblind controls nervous system function rather than its development. Consistent with this, and indicating that glial genderblind regulates ambient extracellular glutamate to suppress glutamatergic synapse strength in vivo, homosexual behavior could be turned on and off by altering glutamatergic transmission pharmacologically and/or genetically.

  10. Mechanisms of endothelial cell protection by hydroxycinnamic acids.

    PubMed

    Fuentes, Eduardo; Palomo, Iván

    2014-12-01

    An endothelial dysfunction generates a proatherogenic environment characterized by stimulating thrombus formation. Epidemiological studies have provided evidence of a protective role of healthy diets in the prevention of cardiovascular diseases. Hydroxycinnamic acids constitute abundant polyphenols in our diets as they are present in high levels in many widely consumed foods, such as fruit, vegetables and beverages. Therefore, it can be established that due to the hydroxycinnamic acid content (caffeic, chlorogenic, feluric and p-coumaric acids), fruit, vegetables and beverages contribute to endothelial protection (attenuates oxidative stress, improved nitric oxide bioavailability and decreased E-selectin, ICAM-1 and VCAM-1 expression, among others). In this article, we systematically examine the mechanisms of endothelium protection of hydroxycinnamic acids.

  11. Expression and purification of a functional uric acid-xanthine transporter (UapA).

    PubMed

    Leung, James; Karachaliou, Mayia; Alves, Claudia; Diallinas, George; Byrne, Bernadette

    2010-07-01

    The Nucleobase-Ascorbate Transporters (NATs) family includes carriers with fundamental functions in uptake of key cellular metabolites, such as uric acid or vitamin C. The best studied example of a NAT transporter is the uric acid-xanthine permease (UapA) from the model ascomycete Aspergillus nidulans. Detailed genetic and biochemical analyses have revealed much about the mechanism of action of this protein; however, the difficulties associated with handling eukaryotic membrane proteins have limited efforts to elucidate the precise structure-function relationships of UapA by structural analysis. In this manuscript, we describe the heterologous overexpression of functional UapA as a fusion with GFP in different strains of Saccharomyces cerevisiae. The UapA-GFP construct expressed to 2.3 mg/L in a pep4Delta deletion strain lacking a key vacuolar endopeptidase and 3.8 mg/L in an npi1-1 mutant strain with defective Rsp5 ubiquitin ligase activity. Epifluorescence microscopy revealed that the UapA-GFP was predominately localized to the plasma membrane in both strains, although a higher intensity of fluorescence was observed for the npi1-1 mutant strain plasma membrane. In agreement with these observations, the npi1-1 mutant strain demonstrated a approximately 5-fold increase in uptake of [(3)H]-xanthine compared to the pep4Delta deletion strain. Despite yielding the best results for functional expression, in-gel fluorescence of the UapA-GFP expressed in the npi1-1 mutant strain revealed that the protein was subject to significant proteolytic degradation. Large scale expression of the protein using the pep4Delta deletion strain followed by purification produced mg quantities of pure, monodispersed protein suitable for further structural and functional studies. In addition, this work has generated a yeast cell based system for performing reverse genetics and other targeted approaches, in order to further understand the mechanism of action of this important model protein.

  12. Transport of monocarboxylic acids at the blood-brain barrier: Studies with monolayers of primary cultured bovine brain capillary endothelial cells

    SciTech Connect

    Terasaki, T.; Takakuwa, S.; Moritani, S.; Tsuji, A. )

    1991-09-01

    The kinetics and mechanism of the transport of monocarboxylic acids (MCAs) were studied by using primary cultured bovine brain capillary endothelial cells. Concentration-dependent uptake of acetic acid was observed, and the kinetic parameters were estimated as follows: the Michaelis constant, Kt, was 3.41 {plus minus} 1.87 mM, the maximum uptake rate, Jmax, was 144.7 {plus minus} 55.7 nmol/mg of protein/min and the nonsaturable first-order rate constant, Kd, was 6.66 {plus minus} 1.98 microliters/mg of protein/min. At medium pH below 7.0, the uptake rate of (3H)acetic acid increased markedly with decreasing medium pH, whereas pH-independent uptake was observed in the presence of 10 mM acetic acid. An energy requirement for (3H)acetic acid uptake was also demonstrated, because metabolic inhibitors (2,4-dinitrophenol and rotenone) reduced significantly the uptake rate (P less than .05). Carbonylcyanide-p-trifluoro-methoxyphenylhydrazone, a protonophore, inhibited significantly the uptake of (3H)acetic acid at medium pH of 5.0 and 6.0, whereas 4,4{prime}-diisothiocyanostilben-2,2{prime}-disulfonic acid did not. Several MCAs inhibited significantly the uptake rate of (3H)acetic acid, whereas di- and tricarboxylic acids did not. The uptake of (3H)acetic acid was competitively inhibited by salicylic acid, with an inhibition constant, Ki, of 3.60 mM, suggesting a common transport system between acetic acid and salicylic acid. Moreover, at the medium pH of 7.4, salicylic acid and valproic acid inhibited significantly the uptake of (3H)acetic acid, demonstrating that the transport of MCA drugs could also be ascribed to the MCA transport system at the physiologic pH.

  13. Active transport of vesicles in neurons is modulated by mechanical tension

    NASA Astrophysics Data System (ADS)

    Ahmed, Wylie W.; Saif, Taher A.

    2014-03-01

    Effective intracellular transport of proteins and organelles is critical in cells, and is especially important for ensuring proper neuron functionality. In neurons, most proteins are synthesized in the cell body and must be transported through thin structures over long distances where normal diffusion is insufficient. Neurons transport subcellular cargo along axons and neurites through a stochastic interplay of active and passive transport. Mechanical tension is critical in maintaining proper function in neurons, but its role in transport is not well understood. To this end, we investigate the active and passive transport of vesicles in Aplysia neurons while changing neurite tension via applied strain, and quantify the resulting dynamics. We found that tension in neurons modulates active transport of vesicles by increasing the probability of active motion, effective diffusivity, and induces a retrograde bias. We show that mechanical tension modulates active transport processes in neurons and that external forces can couple to internal (subcellular) forces and change the overall transport dynamics.

  14. Transport and metabolic effects of alpha-aminoisobutyric acid in Saccharomyces cerevisiae.

    PubMed

    Kim, K W; Roon, R J

    1982-11-24

    alpha-Aminoisobutyric acid is actively transported into yeast cells by the general amino acid transport system. The system exhibits a Km for alpha-aminoisobutyric acid of 270 microM, a Vmax of 24 nmol/min per mg cells (dry weight), and a pH optimum of 4.1-4.3. alpha-Aminoisobutyric acid is also transported by a minor system(s) with a Vmax of 1.7 nmol/min per mg cells. Transport occurs against a concentration gradient with the concentration ratio reaching over 1000:1 (in/out). The alpha-aminoisobutyric acid is not significantly metabolized or incorporated into protein after an 18 h incubation. alpha-Aminoisobutyric acid inhibits cell growth when a poor nitrogen source such as proline is provided but not with good nitrogen sources such as NH+4. During nitrogen starvation alpha-aminoisobutyric acid strongly inhibits the synthesis of the nitrogen catabolite repression sensitive enzyme, asparaginase II. Studies with a mutant yeast strain (GDH-CR) suggest that alpha-aminoisobutyric acid inhibition of asparaginase II synthesis occurs because alpha-aminoisobutyric acid is an effective inhibitor of protein synthesis in nitrogen starved cells.

  15. Glycolic acid modulates the mechanical property and degradation of poly(glycerol, sebacate, glycolic acid).

    PubMed

    Sun, Zhi-Jie; Wu, Lan; Huang, Wei; Chen, Chang; Chen, Yan; Lu, Xi-Li; Zhang, Xiao-Lan; Yang, Bao-Feng; Dong, De-Li

    2010-01-01

    The development of biodegradable materials with controllable degradation properties is beneficial for a variety of applications. Poly(glycerol-sebacate) (PGS) is a promising candidate of biomaterials; so we synthesize a series of poly(glycerol, sebacate, glycolic acid) (PGSG) with 1:2:0, 1:2:0.2, 1:2:0.4, 1:2:0.6, 1:2:1 mole ratio of glycerol, sebacate, and glycolic acid to elucidate the relation of doped glycolic acid to the degradation rate and mechanical properties. The microstructures of the polymers with different doping of glycolic acid were dissimilar. PGSG with glycolic acid in the ratio of 0.2 displayed an integral degree of ordering, different to those with glycolic acid in the ratio of 0, 0.4, 0.6, and 1, which showed mild phase separation structure. The number, DeltaH(m), and temperature of the PGSG melting peaks tended to decrease with the increasing ratio of doped glycolic acid. In vitro and in vivo degradation tests showed that the degradation rate of PGSG with glycolic acid in the ratio of 0.2 was slowest, but in the ratio range of 0, 0.4, and 0.6, the degradation rate increased with the increase of glycolic acid. All PGSG samples displayed good tissue response and anticoagulant effects. Our data suggest that doping glycolic acid can modulate the microstructure and degree of crosslinking of PGS, thereby control the degradation rate of PGS.

  16. Characteristics of the transport of ascorbic acid into leucocytes

    SciTech Connect

    Raghoebar, M.; Huisman, J.A.M.; van den Berg, W.B.; van Ginneken, C.A.M.

    1987-02-02

    The degree and the mode of association of (/sup 14/C)-ascorbic acid with leucocytes are examined. The degree of association of ascorbic acid with polymorphonuclear leucocytes (1-3 %) is dependent on cell type, extracellular concentration of ascorbic acid, incubation temperature, intactness of the cells and the extracellular pH. All experiments are performed according to strict protocols as these compounds are labile in aqueous solutions. Further it is noticed that in all experiments an outward gradient of leucocyte endogenic ascorbic acid exists. The results suggest that the association process comprises at least one saturable pathway. The activation of polymorphonuclear leucocytes by phorbol myristate acetate increases the accumulation of ascorbic acid threefold. 30 references, 7 figures, 3 tables.

  17. Relationship between acid precipitation and three-dimensional transport associated with synoptic-scale cyclones

    SciTech Connect

    Haagenson, P.L.; Lazrus, A.L.; Kuo, Y.H.; Caldwell, G.A.

    1985-09-01

    Field data collected during APEX (Acid Precipitation Experiment) are used in combination with an isentropic trajectory model to analyze the relationship between acid precipitation and three-dimensional transport associated with cyclonic storms. Data are presented which indicate that high acidity in precipitation is often associated with slow transport speed and elevated SO2 concentrations in the dry air feeding into the precipitating regions. Conversely, low acidity is usually related to rapid transit, descending motion, and transport above the atmospheric boundary layer. The results also show that precipitation in the cold sector of a cyclone (in advance of the surface warm front) is often more acidic than that in other sectors of the storm. Four case studies are included to detail some of these meteorological effects. 19 references.

  18. The ABC transporter ABC40 encodes a phenylacetic acid export system in Penicillium chrysogenum.

    PubMed

    Weber, Stefan S; Kovalchuk, Andriy; Bovenberg, Roel A L; Driessen, Arnold J M

    2012-11-01

    The filamentous fungus Penicillium chrysogenum is used for the industrial production of β-lactam antibiotics. The pathway for β-lactam biosynthesis has been resolved and involves the enzyme phenylacetic acid CoA ligase that is responsible for the CoA activation of the side chain precursor phenylacetic acid (PAA) that is used for the biosynthesis of penicillin G. To identify ABC transporters related to β-lactam biosynthesis, we analyzed the expression of all 48 ABC transporters present in the genome of P. chryso-genum when grown in the presence and absence of PAA. ABC40 is significantly upregulated when cells are grown or exposed to high levels of PAA. Although deletion of this transporter did not affect β-lactam biosynthesis, it resulted in a significant increase in sensitivity to PAA and other weak acids. It is concluded that ABC40 is involved in weak acid detoxification in P. chrysogenum including resistance to phenylacetic acid.

  19. Niflumic acid modulates uncoupled substrate-gated conductances in the human glutamate transporter EAAT4

    PubMed Central

    Poulsen, Miguel V; Vandenberg, Robert J

    2001-01-01

    The effects of niflumic acid on the substrate-gated currents mediated by the glutamate transporter EAAT4 expressed in Xenopus laevis oocytes were examined using radiolabelled substrate flux measurements and two-electrode voltage clamp techniques. Niflumic acid significantly enhanced the substrate-gated currents in EAAT4, without affecting the affinity of the substrates towards EAAT4. At a concentration of 300 μm, niflumic acid caused a 19 ± 5 % reduction in l-[3H]glutamate uptake and no significant effect on the uptake of dl-[3H]aspartate. Thus, enhancement of the substrate-gated currents in EAAT4 does not correlate with the rate of substrate transport and suggests that the niflumic acid-induced currents are not thermodynamically coupled to the transport of substrate. Niflumic acid and arachidonic acid co-applied with substrate to EAAT4-expressing oocytes had similar functional consequences. However, niflumic acid still enhanced the l-glutamate-gated current to the same extent in the presence and absence of a saturating dose of arachidonic acid, which suggests that the sites of action of the two compounds are distinct. The EAAT4-mediated currents for the two substrates, l-glutamate and l-aspartate, were not enhanced equally by addition of the same dose of niflumic acid and the ionic composition of the niflumic acid-induced currents was not the same for the two substrates. Protons carry the l-glutamate-gated niflumic acid-induced current and both protons and chloride ions carry the l-aspartate-gated niflumic acid-induced current. These results show that niflumic acid can be used to probe the functional aspects of EAAT4 and that niflumic acid and other non-steroid anti-inflammatory drugs could be used as the basis for the development of novel modulators of glutamate transporters. PMID:11432999

  20. Niflumic acid modulates uncoupled substrate-gated conductances in the human glutamate transporter EAAT4.

    PubMed

    Poulsen, M V; Vandenberg, R J

    2001-07-01

    1. The effects of niflumic acid on the substrate-gated currents mediated by the glutamate transporter EAAT4 expressed in Xenopus laevis oocytes were examined using radiolabelled substrate flux measurements and two-electrode voltage clamp techniques. 2. Niflumic acid significantly enhanced the substrate-gated currents in EAAT4, without affecting the affinity of the substrates towards EAAT4. At a concentration of 300 microM, niflumic acid caused a 19 +/- 5 % reduction in L-[(3)H]glutamate uptake and no significant effect on the uptake of DL-[(3)H]aspartate. Thus, enhancement of the substrate-gated currents in EAAT4 does not correlate with the rate of substrate transport and suggests that the niflumic acid-induced currents are not thermodynamically coupled to the transport of substrate. 3. Niflumic acid and arachidonic acid co-applied with substrate to EAAT4-expressing oocytes had similar functional consequences. However, niflumic acid still enhanced the L-glutamate-gated current to the same extent in the presence and absence of a saturating dose of arachidonic acid, which suggests that the sites of action of the two compounds are distinct. 4. The EAAT4-mediated currents for the two substrates, L-glutamate and L-aspartate, were not enhanced equally by addition of the same dose of niflumic acid and the ionic composition of the niflumic acid-induced currents was not the same for the two substrates. Protons carry the L-glutamate-gated niflumic acid-induced current and both protons and chloride ions carry the L-aspartate-gated niflumic acid-induced current. 5. These results show that niflumic acid can be used to probe the functional aspects of EAAT4 and that niflumic acid and other non-steroid anti-inflammatory drugs could be used as the basis for the development of novel modulators of glutamate transporters.

  1. EAAT3 promotes amino acid transport and proliferation of porcine intestinal epithelial cells.

    PubMed

    Ye, Jin-Ling; Gao, Chun-Qi; Li, Xiang-Guang; Jin, Cheng-Long; Wang, Dan; Shu, Gang; Wang, Wen-Ce; Kong, Xiang-Feng; Yao, Kang; Yan, Hui-Chao; Wang, Xiu-Qi

    2016-06-21

    Excitatory amino acid transporter 3 (EAAT3, encoded by SLC1A1) is an epithelial type high-affinity anionic amino acid transporter, and glutamate is the major oxidative fuel for intestinal epithelial cells. This study investigated the effects of EAAT3 on amino acid transport and cell proliferation through activation of the mammalian target of the rapamycin (mTOR) pathway in porcine jejunal epithelial cells (IPEC-J2). Anionic amino acid and cystine (Cys) transport were increased (P<0.05) by EAAT3 overexpression and decreased (P<0.05) by EAAT3 knockdown rather than other amino acids. MTT and cell counting assays suggested that IPEC-J2 cell proliferation increased (P<0.05) with EAAT3 overexpression. Phosphorylation of mTOR (Ser2448), ribosomal protein S6 kinase-1 (S6K1, Thr389) and eukaryotic initiation factor 4E-binding protein-1 (4EBP1, Thr70) was increased by EAAT3 overexpression and decreased by EAAT3 knockdown (P<0.05), as were levels of activating transcription factor 4 (ATF4) and cystine/glutamate antiporter (xCT) (P<0.05). Our results demonstrate for the first time that EAAT3 facilitates anionic amino acid transport and activates the mTOR pathway, promoting Cys transport and IPEC-J2 cell proliferation.

  2. EAAT3 promotes amino acid transport and proliferation of porcine intestinal epithelial cells

    PubMed Central

    Jin, Cheng-long; Wang, Dan; Shu, Gang; Wang, Wen-ce; Kong, Xiang-feng; Yao, Kang; Yan, Hui-chao; Wang, Xiu-qi

    2016-01-01

    Excitatory amino acid transporter 3 (EAAT3, encoded by SLC1A1) is an epithelial type high-affinity anionic amino acid transporter, and glutamate is the major oxidative fuel for intestinal epithelial cells. This study investigated the effects of EAAT3 on amino acid transport and cell proliferation through activation of the mammalian target of the rapamycin (mTOR) pathway in porcine jejunal epithelial cells (IPEC-J2). Anionic amino acid and cystine (Cys) transport were increased (P<0.05) by EAAT3 overexpression and decreased (P<0.05) by EAAT3 knockdown rather than other amino acids. MTT and cell counting assays suggested that IPEC-J2 cell proliferation increased (P<0.05) with EAAT3 overexpression. Phosphorylation of mTOR (Ser2448), ribosomal protein S6 kinase-1 (S6K1, Thr389) and eukaryotic initiation factor 4E-binding protein-1 (4EBP1, Thr70) was increased by EAAT3 overexpression and decreased by EAAT3 knockdown (P<0.05), as were levels of activating transcription factor 4 (ATF4) and cystine/glutamate antiporter (xCT) (P<0.05). Our results demonstrate for the first time that EAAT3 facilitates anionic amino acid transport and activates the mTOR pathway, promoting Cys transport and IPEC-J2 cell proliferation. PMID:27231847

  3. Center for low-gravity fluid mechanics and transport phenomena

    NASA Technical Reports Server (NTRS)

    Kassoy, D. R.; Sani, R. L.

    1991-01-01

    Research projects in several areas are discussed. Mass transport in vapor phase systems, droplet collisions and coalescence in microgravity, and rapid solidification of undercooled melts are discussed.

  4. Electron injection and transport mechanism in organic devices based on electron transport materials

    NASA Astrophysics Data System (ADS)

    Khan, M. A.; Xu, Wei; Khizar-ul-Haq; Zhang, Xiao Wen; Bai, Yu; Jiang, X. Y.; Zhang, Z. L.; Zhu, W. Q.

    2008-11-01

    Electron injection and transport in organic devices based on electron transport (ET) materials, such as 4,7- diphyenyl-1,10-phenanthroline (Bathophenanthroline BPhen), 2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline (Bathocuproine BCP) and bipyridyl oxadiazole compound 1,3-bis [2-(2,2'-bipyridin-6-yl)-1,3,4-oxadiazol-5-yl]benzene (Bpy-OXD), have been reported. The devices are composed of ITO/ET materials (BPhen, BCP Bpy-OXD)/cathodes, where cathodes = Au, Al and Ca. Current-voltage characteristics of each ET material are performed as a function of cathodes. We have found that Ca and Al exhibit quite different J-V characteristics compared with the gold (Au) cathode. The current is more than one order of magnitude higher for the Al cathode and more than three orders of magnitude higher for Ca compared with that of the Au cathode at ~8 V for all ET materials. This is because of the relatively low energy barrier at the organic/metal interface for Ca and Al cathodes. Electron-only devices with the Au cathode show that the electron transfer limitation is located at the organic/cathode interface and the Fowler-Nordheim mechanism is qualitatively consistent with experimental data at high voltages. With Ca and Al cathodes, electron conduction is preponderant and is bulk limited. A power law dependence J ~ Vm with m > 2 is consistent with the model of trap-charge limited conduction. The total electron trap density is estimated to be ~5 × 1018 cm-3. The critical voltage (Vc) is found to be ~45 V and is almost independent of the materials.

  5. Fatty acid binding protein facilitates sarcolemmal fatty acid transport but not mitochondrial oxidation in rat and human skeletal muscle

    PubMed Central

    Holloway, Graham P; Lally, Jamie; Nickerson, James G; Alkhateeb, Hakam; Snook, Laelie A; Heigenhauser, George J F; Calles-Escandon, Jorge; Glatz, Jan F C; Luiken, Joost J F P; Spriet, Lawrence L; Bonen, Arend

    2007-01-01

    The transport of long-chain fatty acids (LCFAs) across mitochondrial membranes is regulated by carnitine palmitoyltransferase I (CPTI) activity. However, it appears that additional fatty acid transport proteins, such as fatty acid translocase (FAT)/CD36, influence not only LCFA transport across the plasma membrane, but also LCFA transport into mitochondria. Plasma membrane-associated fatty acid binding protein (FABPpm) is also known to be involved in sacrolemmal LCFA transport, and it is also present on the mitochondria. At this location, it has been identified as mitochondrial aspartate amino transferase (mAspAT), despite being structurally identical to FABPpm. Whether this protein is also involved in mitochondrial LCFA transport and oxidation remains unknown. Therefore, we have examined the ability of FABPpm/mAspAT to alter mitochondrial fatty acid oxidation. Muscle contraction increased (P < 0.05) the mitochondrial FAT/CD36 content in rat (+22%) and human skeletal muscle (+33%). By contrast, muscle contraction did not alter the content of mitochondrial FABPpm/mAspAT protein in either rat or human muscles. Electrotransfecting rat soleus muscles, in vivo, with FABPpm cDNA increased FABPpm protein in whole muscle (+150%; P < 0.05), at the plasma membrane (+117%; P < 0.05) and in mitochondria (+80%; P < 0.05). In these FABPpm-transfected muscles, palmitate transport into giant vesicles was increased by +73% (P < 0.05), and fatty acid oxidation in intact muscle was increased by +18% (P < 0.05). By contrast, despite the marked increase in mitochondrial FABPpm/mAspAT protein content (+80%), the rate of mitochondrial palmitate oxidation was not altered (P > 0.05). However, electrotransfection increased mAspAT activity by +70% (P < 0.05), and the mitochondrial FABPpm/mAspAT protein content was significantly correlated with mAspAT activity (r= 0.75). It is concluded that FABPpm has two distinct functions depending on its subcellular location: (a) it contributes to

  6. Role of organic acids in promoting colloidal transport of mercury from mine tailings

    USGS Publications Warehouse

    Slowey, A.J.; Johnson, S.B.; Rytuba, J.J.; Brown, Gordon E.

    2005-01-01

    A number of factors affect the transport of dissolved and paniculate mercury (Hg) from inoperative Hg mines, including the presence of organic acids in the rooting zone of vegetated mine waste. We examined the role of the two most common organic acids in soils (oxalic and citric acid) on Hg transport from such waste by pumping a mixed organic acid solution (pH 5.7) at 1 mL/min through Hg mine tailings columns. For the two total organic acid concentrations investigated (20 ??M and 1 mM), particle-associated Hg was mobilized, with the onset of paniculate Hg transport occurring later for the lower organic acid concentration. Chemical analyses of column effluent indicate that 98 wt % of Hg mobilized from the column was paniculate. Hg speciation was determined using extended X-ray absorption fine structure spectroscopy and transmission electron microscopy, showing that HgS minerals are dominant in the mobilized particles. Hg adsorbed to colloids is another likely mode of transport due to the abundance of Fe-(oxyhydr)oxides, Fe-sulfides, alunite, and jarosite in the tailings to which Hg(II) adsorbs. Organic acids produced by plants are likely to enhance the transport of colloid-associated Hg from vegetated Hg mine tailings by dissolving cements to enable colloid release. ?? 2005 American Chemical Society.

  7. Effect of common polymorphisms of the farnesoid X receptor and bile acid transporters on the pharmacokinetics of ursodeoxycholic acid.

    PubMed

    Hu, Miao; Fok, Benny S P; Wo, Siu-Kwan; Lee, Vincent H L; Zuo, Zhong; Tomlinson, Brian

    2016-01-01

    Ursodeoxycholic acid (UDCA), a natural, dihydroxy bile acid, promotes gallstone dissolution and has been attributed with several other beneficial effects. The farnesoid X receptor (FXR) may influence the pharmacokinetics of UDCA by modulating the expression of bile acid transporters. This exploratory study examined whether common functional polymorphisms in FXR and in bile acid transporter genes affect the pharmacokinetics of exogenous UDCA. Polymorphisms in genes for transporters involved in bile acid transport, solute carrier organic anion 1B1 (SLCO1B1) 388A>G and 521T>C, solute carrier 10A1 (SLC10A1) 800 C>T and ATP-binding cassette B11 (ABCB11) 1331T>C, and the FXR -1G>T polymorphism were genotyped in 26 male Chinese subjects who ingested single oral 500-mg doses of UDCA. Plasma concentrations of UDCA and its major conjugate metabolite glycoursodeoxycholic acid (GUDCA) were determined. The mean systemic exposure of UDCA was higher in the five subjects with one copy of the FXR -1G>T variant allele than in those homozygous for the wild-type allele (n = 21) (AUC0-24 h : 38.5 ± 28.2 vs. 20.9 ± 8.0 μg h/mL, P = 0.021), but this difference appeared mainly due to one outlier with the -1GT genotype and elevated baseline and post-treatment UDCA concentrations. After excluding the outlier, body weight was the only factor associated with plasma concentrations of UDCA and there were no significant associations with the other polymorphisms examined. None of the polymorphisms affected the pharmacokinetics of GUDCA. This study showed that the common polymorphisms in bile acid transporters had no significant effect on the pharmacokinetics of exogenous UDCA but an effect of the FXR polymorphism cannot be excluded.

  8. Estradiol augments while progesterone inhibits arginine transport in human endothelial cells through modulation of cationic amino acid transporter-1.

    PubMed

    Bentur, Ohad S; Schwartz, Doron; Chernichovski, Tamara; Ingbir, Merav; Weinstein, Talia; Chernin, Gil; Schwartz, Idit F

    2015-08-15

    Decreased generation of nitric oxide (NO) by endothelial NO synthase (eNOS) characterizes endothelial dysfunction (ECD). Delivery of arginine to eNOS by cationic amino acid transporter-1 (CAT-1) was shown to modulate eNOS activity. We found in female rats, but not in males, that CAT-1 activity is preserved with age and in chronic renal failure, two experimental models of ECD. In contrast, during pregnancy CAT-1 is inhibited. We hypothesize that female sex hormones regulate arginine transport. Arginine uptake in human umbilical vein endothelial cells (HUVEC) was determined following incubation with either 17β-estradiol (E2) or progesterone. Exposure to E2 (50 and 100 nM) for 30 min resulted in a significant increase in arginine transport and reduction in phosphorylated CAT-1 (the inactive form) protein content. This was coupled with a decrease in phosphorylated MAPK/extracellular signal-regulated kinase (ERK) 1/2. Progesterone (1 and 100 pM for 30 min) attenuated arginine uptake and increased phosphorylated CAT-1, phosphorylated protein kinase Cα (PKCα), and phosphorylated ERK1/2 protein content. GO-6976 (PKCα inhibitor) prevented the progesterone-induced decrease in arginine transport. Coincubation with both progesterone and estrogen for 30 min resulted in attenuated arginine transport. While estradiol increases arginine transport and CAT-1 activity through modulation of constitutive signaling transduction pathways involving ERK, progesterone inhibits arginine transport and CAT-1 via both PKCα and ERK1/2 phosphorylation, an effect that predominates over estradiol.

  9. Engineering rTCA pathway and C4-dicarboxylate transporter for L-malic acid production.

    PubMed

    Chen, Xiulai; Wang, Yuancai; Dong, Xiaoxiang; Hu, Guipeng; Liu, Liming

    2017-02-22

    L-Malic acid is an important component of a vast array of food additives, antioxidants, disincrustants, pharmaceuticals, and cosmetics. Here, we presented a pathway optimization strategy and a transporter modification approach to reconstruct the L-malic acid biosynthesis pathway and transport system, respectively. First, pyruvate carboxylase (pyc) and malate dehydrogenase (mdh) from Aspergillus flavus and Rhizopus oryzae were combinatorially overexpressed to construct the reductive tricarboxylic acid (rTCA) pathway for L-malic acid biosynthesis. Second, the L-malic acid transporter (Spmae) from Schizosaccharomyces pombe was engineered by removing the ubiquitination motification to enhance the L-malic acid efflux system. Finally, the L-malic acid pathway was optimized by controlling gene expression levels, and the final L-malic acid concentration, yield, and productivity were up to 30.25 g L(-1), 0.30 g g(-1), and 0.32 g L(-1) h(-1) in the resulting strain W4209 with CaCO3 as a neutralizing agent, respectively. In addition, these corresponding parameters of pyruvic acid remained at 30.75 g L(-1), 0.31 g g(-1), and 0.32 g L(-1) h(-1), respectively. The metabolic engineering strategy used here will be useful for efficient production of L-malic acid and other chemicals.

  10. Third system for neutral amino acid transport in a marine pseudomonad.

    PubMed Central

    Pearce, S M; Hildebrandt, V A; Lee, T

    1977-01-01

    Uptake of leucine by the marine pseudomonad B-16 is an energy-dependent, concentrative process. Respiratory inhibitors, uncouplers, and sulfhydryl reagents block transport. The uptake of leucine is Na+ dependent, although the relationship between the rate of leucine uptake and Na+ concentration depends, to some extent, on the ionic strength of the suspending assay medium and the manner in which cells are washed prior to assay. Leucine transport can be separated into at least two systems: a low-affinity system with an apparent Km of 1.3 X 10(-5) M, and a high-affinity system with an apparent Km of 1.9 X 10(-7) M. The high-affinity system shows a specificity unusual for bacterial systems in that both aromatic and aliphatic amino acids inhibit leucine transport, provided that they have hydrophobic side chains of a length greater than that of two carbon atoms. The system exhibits strict stereospecificity for the L form. Phenylalanine inhibition was investigated in more detail. The Ki for inhibition of leucine transport by phenylalanine is about 1.4 X 10(-7) M. Phenylalanine itself is transported by an energy-dependent process whose specificity is the same as the high-affinity leucine transport system, as is expected if both amino acids share the same transport system. Studies with protoplasts indicate that a periplasmic binding protein is not an essential part of this transport system. Fein and MacLeod (J. Bacteriol. 124:1177-1190, 1975) reported two neutral amino acid transport systems in strain B-16: the DAG system, serving glycine, D-alanine, D-serine, and alpha-aminoisobutyric acid; and the LIV system, serving L-leucine, L-isoleucine, L-valine, and L-alanine. The high-affinity system reported here is a third neutral amino acid transport system in this marine pseudomonad. We propose the name "LIV-II" system. PMID:856786

  11. Maternal bile acid transporter deficiency promotes neonatal demise

    PubMed Central

    Zhang, Yuanyuan; Li, Fei; Wang, Yao; Pitre, Aaron; Fang, Zhong-ze; Frank, Matthew W.; Calabrese, Christopher; Krausz, Kristopher W.; Neale, Geoffrey; Frase, Sharon; Vogel, Peter; Rock, Charles O.; Gonzalez, Frank J.; Schuetz, John D.

    2015-01-01

    Intrahepatic cholestasis of pregnancy (ICP) is associated with adverse neonatal survival and is estimated to impact between 0.4 and 5% of pregnancies worldwide. Here we show that maternal cholestasis (due to Abcb11 deficiency) produces neonatal death among all offspring within 24 h of birth due to atelectasis-producing pulmonary hypoxia, which recapitulates the neonatal respiratory distress of human ICP. Neonates of Abcb11-deficient mothers have elevated pulmonary bile acids and altered pulmonary surfactant structure. Maternal absence of Nr1i2 superimposed on Abcb11 deficiency strongly reduces maternal serum bile acid concentrations and increases neonatal survival. We identify pulmonary bile acids as a key factor in the disruption of the structure of pulmonary surfactant in neonates of ICP. These findings have important implications for neonatal respiratory failure, especially when maternal bile acids are elevated during pregnancy, and highlight potential pathways and targets amenable to therapeutic intervention to ameliorate this condition. PMID:26416771

  12. Myosin 1b Regulates Amino Acid Transport by Associating Transporters with the Apical Plasma Membrane of Kidney Cells.

    PubMed

    Komaba, Shigeru; Coluccio, Lynne M

    2015-01-01

    Amino acid transporters (AATers) in the brush border of the apical plasma membrane (APM) of renal proximal tubule (PT) cells mediate amino acid transport (AAT). We found that the membrane-associated class I myosin myosin 1b (Myo1b) localized at the apical brush border membrane of PTs. In opossum kidney (OK) 3B/2 epithelial cells, which are derived from PTs, expressed rat Myo1b-GFP colocalized in patched microvilli with expressed mouse V5-tagged SIT1 (SIT1-V5), which mediates neutral amino acid transport in OK cells. Lentivirus-mediated delivery of opossum Myo1b-specific shRNA resulted in knockdown (kd) of Myo1b expression, less SIT1-V5 at the APM as determined by localization studies, and a decrease in neutral AAT as determined by radioactive uptake assays. Myo1b kd had no effect on Pi transport or noticeable change in microvilli structure as determined by rhodamine phalloidin staining. The studies are the first to define a physiological role for Myo1b, that of regulating renal AAT by modulating the association of AATers with the APM.

  13. Transportation impact analysis for the shipment of low specific activity nitric acid. Revisison 1

    SciTech Connect

    Green, J.R.

    1995-05-16

    This is in support of the Plutonium-Uranium Extraction (PUREX) Facility Low Specific Activity (LSA) Nitric Acid Shipment Environmental Assessment. It analyzes potential toxicological and radiological risks associated with transportation of PUREX Facility LSA Nitric Acid from the Hanford Site to Portsmouth VA, Baltimore MD, and Port Elizabeth NJ.

  14. Uptake of 4-chloro-2-methylphenoxyacetic acid (MCPA) from the apical membrane of Caco-2 cells by the monocarboxylic acid transporter

    SciTech Connect

    Kimura, Osamu; Tsukagoshi, Kensuke; Endo, Tetsuya

    2008-03-15

    The cellular uptake mechanism of 4-chloro-2-methylphenoxyacetic acid (MCPA), a phenoxyacetic acid derivative, was investigated using Caco-2 epithelial cells. The cells were incubated with 50 {mu}M MCPA at pH 6.0 and 37 deg. C, and the uptake of MCPA from the apical membranes was measured. The uptake of MCPA was significantly decreased by incubation at low temperature (4 {sup o}C) and markedly increased by lowering the extracellular pH. Pretreatment with a protonophore, carbonylcyanide-p-(trifluoromethoxy)phenylhydrazone (25 {mu}M), or metabolic inhibitors, 2,4-dinitrophenol (1 mM) and sodium azide (10 mM), significantly decreased the uptake of MCPA by 53%, 45% and 48%, respectively. Coincubation of MCPA with 10 mM L-lactic acid or {alpha}-cyano-4-hydroxycinnamate, which is a substrate or an inhibitor of the monocarboxylic acid transporters (MCTs), significantly decreased the uptake of MCPA by 31% and 20%, respectively, and coincubation with benzoic acid profoundly decreased the uptake by 68%. In contrast, coincubation with succinic acid (a dicarboxylic acid) did not affect the uptake. Kinetic analysis of initial MCPA uptake suggested that MCPA is taken up via a carrier-mediated process [K{sub m} = 1.37 {+-} 0.15 mM, V{sub max} = 115 {+-} 6 nmol (mg protein){sup -1} (3 min){sup -1}]. Lineweaver-Burk plots show that benzoic acid competitively inhibits the uptake of MCPA with a K{sub i} value of 4.68 {+-} 1.76 mM. A trans-stimulation effect on MCPA uptake was found in cells preloaded with benzoic acid. These results suggest that the uptake of MCPA from the apical membrane of Caco-2 cells is mainly mediated by common MCTs along with benzoic acid but also in part by L-lactic acid.

  15. Experimental evidence for ternary colloid-facilitated transport of Th(IV) with hematite (α-Fe2O3) colloids and Suwannee River fulvic acid.

    PubMed

    Emerson, Hilary P; Hickok, Katherine A; Powell, Brian A

    2016-12-01

    Previous field experiments have suggested colloid-facilitated transport via inorganic and organic colloids as the primary mechanism of enhanced actinide transport in the subsurface at former nuclear weapons facilities. In this work, research was guided by the hypothesis that humic substances can enhance tetravalent actinide (An(IV)) migration by coating and mobilizing natural colloids in environmental systems and increasing An(IV) sorption to colloids. This mechanism is expected to occur under relatively acidic conditions where organic matter can sorb and coat colloid surfaces and facilitate formation of ternary colloid-ligand-actinide complexes. The objective of this work was to examine Th transport through packed columns in the presence of hematite colloids and/or Suwannee River fulvic acid (SRFA). In the presence of SRFA, with or without hematite colloids, significant transport (>60% recovery within the effluent) of thorium occurred through quartz columns. It is notable that the SRFA contributed to increased transport of both Th and hematite colloids, while insignificant transport occurred in the absence of fulvic acid. Further, in the presence of a natural sandy sediment (as opposed to pure quartz), transport is negligible in the presence of SRFA due to interactions with natural, clay-sized sediment coatings. Moreover, this data shows that the transport of Th through quartz columns is enhanced in ternary Th-colloid-SRFA and binary Th-SRFA systems as compared to a system containing only Th.

  16. Maternal micronutrients and omega 3 fatty acids affect placental fatty acid desaturases and transport proteins in Wistar rats.

    PubMed

    Wadhwani, Nisha S; Dangat, Kamini D; Joshi, Asmita A; Joshi, Sadhana R

    2013-03-01

    Adequate supply of LCPUFA from maternal plasma is crucial for fetal normal growth and development. The present study examines the effect of maternal micronutrients (folic acid and vitamin B12) and omega 3 fatty acids on placental mRNA levels of fatty acid desaturases (Δ5 and Δ6) and transport proteins. Pregnant female rats were divided into 6 groups at 2 levels of folic acid both in the presence and absence of vitamin B12. Both the vitamin B12 deficient groups were supplemented with omega 3 fatty acid. Maternal vitamin B12 deficiency reduced placental mRNA and protein levels of Δ5 desaturase, mRNA levels of FATP1 and FATP4 (p<0.05 for all) as compared to control while omega 3 fatty acid supplementation normalized the levels. Our data for the first time indicates that altered maternal micronutrients and omega 3 fatty acids play a key role in regulating fatty acid desaturase and transport protein expression in placenta.

  17. Separate responses of karyopherins to glucose and amino acid availability regulate nucleocytoplasmic transport

    PubMed Central

    Huang, Hsiao-Yun; Hopper, Anita K.

    2014-01-01

    The importin-β family members (karyopherins) mediate the majority of nucleocytoplasmic transport. Msn5 and Los1, members of the importin-β family, function in tRNA nuclear export. tRNAs move bidirectionally between the nucleus and the cytoplasm. Nuclear tRNA accumulation occurs upon amino acid (aa) or glucose deprivation. To understand the mechanisms regulating tRNA subcellular trafficking, we investigated whether Msn5 and Los1 are regulated in response to nutrient availability. We provide evidence that tRNA subcellular trafficking is regulated by distinct aa-sensitive and glucose-sensitive mechanisms. Subcellular distributions of Msn5 and Los1 are altered upon glucose deprivation but not aa deprivation. Redistribution of tRNA exportins from the nucleus to the cytoplasm likely provides one mechanism for tRNA nuclear distribution upon glucose deprivation. We extended our studies to other members of the importin-β family and found that all tested karyopherins invert their subcellular distributions upon glucose deprivation but not aa deprivation. Glucose availability regulates the subcellular distributions of karyopherins likely due to alteration of the RanGTP gradient since glucose deprivation causes redistribution of Ran. Thus nuclear–cytoplasmic distribution of macromolecules is likely generally altered upon glucose deprivation due to collapse of the RanGTP gradient and redistribution of karyopherins between the nucleus and the cytoplasm. PMID:25057022

  18. Molecular mechanism of serotonin transporter inhibition elucidated by a new flexible docking protocol.

    PubMed

    Gabrielsen, Mari; Kurczab, Rafał; Ravna, Aina W; Kufareva, Irina; Abagyan, Ruben; Chilmonczyk, Zdzisław; Bojarski, Andrzej J; Sylte, Ingebrigt

    2012-01-01

    The two main groups of antidepressant drugs, the tricyclic antidepressants (TCAs) and the selective serotonin reuptake inhibitors (SSRIs), as well as several other compounds, act by inhibiting the serotonin transporter (SERT). However, the binding mode and molecular mechanism of inhibition in SERT are not fully understood. In this study, five classes of SERT inhibitors were docked into an outward-facing SERT homology model using a new 4D ensemble docking protocol. Unlike other docking protocols, where protein flexibility is not considered or is highly dependent on the ligand structure, flexibility was here obtained by side chain sampling of the amino acids of the binding pocket using biased probability Monte Carlo (BPMC) prior to docking. This resulted in the generation of multiple binding pocket conformations that the ligands were docked into. The docking results showed that the inhibitors were stacked between the aromatic amino acids of the extracellular gate (Y176, F335) presumably preventing its closure. The inhibitors interacted with amino acids in both the putative substrate binding site and more extracellular regions of the protein. A general structure-docking-based pharmacophore model was generated to explain binding of all studied classes of SERT inhibitors. Docking of a test set of actives and decoys furthermore showed that the outward-facing ensemble SERT homology model consistently and selectively scored the majority of active compounds above decoys, which indicates its usefulness in virtual screening.

  19. Amino acid composition analysis of secondary transport proteins from Escherichia coli with relation to functional classification, ligand specificity and structure.

    PubMed

    Saidijam, Massoud; Patching, Simon G

    2015-01-01

    We have performed an amino acid composition (AAC) analysis of the complete sequences for 235 secondary transport proteins from Escherichia coli, which have functions in the uptake and export of organic and inorganic metabolites, efflux of drugs and in controlling membrane potential. This revealed the trends in content for specific amino acid types and for combinations of amino acids with similar physicochemical properties. In certain proteins or groups of proteins, the so-called spikes of high content for a specific amino acid type or combination of amino acids were identified and confirmed statistically, which in some cases could be directly related to function and ligand specificity. This was prevalent in proteins with a function of multidrug or metal ion efflux. Any tool that can help in identifying bacterial multidrug efflux proteins is important for a better understanding of this mechanism of antibiotic resistance. Phylogenetic analysis based on sequence alignments and comparison of sequences at the N- and C-terminal ends confirmed transporter Family classification. Locations of specific amino acid types in some of the proteins that have crystal structures (EmrE, LacY, AcrB) were also considered to help link amino acid content with protein function. Though there are limitations, this work has demonstrated that a basic analysis of AAC is a useful tool to use in combination with other computational and experimental methods for classifying and investigating function and ligand specificity in a large group of transport or other membrane proteins, including those that are molecular targets for development of new drugs.

  20. Analysis of acidity production during enhanced reductive dechlorination using a simplified reactive transport model

    NASA Astrophysics Data System (ADS)

    Brovelli, A.; Barry, D. A.; Robinson, C.; Gerhard, J. I.

    2012-07-01

    Build-up of fermentation products and hydrochloric acid at a contaminated site undergoing enhanced reductive dechlorination can result in groundwater acidification. Sub-optimal pH conditions can inhibit microbial activity and lead to reduced dechlorination rates. The extent of acidification likely to occur is site-specific and depends primarily on the extent of fermentation and dechlorination, the geochemical composition of soil and groundwater, and the pH-sensitivity of the active microbial populations. Here, the key chemical and physical mechanisms that control the extent of groundwater acidification in a contaminated site were examined, and the extent to which the remediation efficiency was affected by variations in groundwater pH was evaluated using a simplified process-based reactive-transport model. This model was applied successfully to a well-documented field site and was then employed in a sensitivity analysis to identify the processes likely to significantly influence acidity production and subsequent microbial inhibition. The accumulation of organic acids produced from the fermentation of the injected substrate was the main cause of the pH change. The concentration of dissolved sulphates controlled substrate utilisation efficiency because sulphate-reducing biomass competed with halo-respiring biomass for the fermentation products. It was shown further that increased groundwater velocity increases dilution and reduces the accumulation of acidic products. As a consequence, the flow rate corresponding to the highest remediation efficiency depends on the fermentation and dechlorination rates. The model enables investigation and forecasting of the extent and areal distribution of pH change, providing a means to optimise the application of reductive dechlorination for site remediation.

  1. Intracellular transport driven by cytoskeletal motors: General mechanisms and defects

    NASA Astrophysics Data System (ADS)

    Appert-Rolland, C.; Ebbinghaus, M.; Santen, L.

    2015-09-01

    Cells are the elementary units of living organisms, which are able to carry out many vital functions. These functions rely on active processes on a microscopic scale. Therefore, they are strongly out-of-equilibrium systems, which are driven by continuous energy supply. The tasks that have to be performed in order to maintain the cell alive require transportation of various ingredients, some being small, others being large. Intracellular transport processes are able to induce concentration gradients and to carry objects to specific targets. These processes cannot be carried out only by diffusion, as cells may be crowded, and quite elongated on molecular scales. Therefore active transport has to be organized. The cytoskeleton, which is composed of three types of filaments (microtubules, actin and intermediate filaments), determines the shape of the cell, and plays a role in cell motion. It also serves as a road network for a special kind of vehicles, namely the cytoskeletal motors. These molecules can attach to a cytoskeletal filament, perform directed motion, possibly carrying along some cargo, and then detach. It is a central issue to understand how intracellular transport driven by molecular motors is regulated. The interest for this type of question was enhanced when it was discovered that intracellular transport breakdown is one of the signatures of some neuronal diseases like the Alzheimer. We give a survey of the current knowledge on microtubule based intracellular transport. Our review includes on the one hand an overview of biological facts, obtained from experiments, and on the other hand a presentation of some modeling attempts based on cellular automata. We present some background knowledge on the original and variants of the TASEP (Totally Asymmetric Simple Exclusion Process), before turning to more application oriented models. After addressing microtubule based transport in general, with a focus on in vitro experiments, and on cooperative effects in the

  2. Mechanisms for stimulation of rat anterior pituitary cells by arginine and other amino acids.

    PubMed Central

    Villalobos, C; Núñez, L; García-Sancho, J

    1997-01-01

    1. Arginine and other amino acids are secretagogues for growth hormone and prolactin in the intact animal, but the mechanism of action is unclear. We have studied the effects of amino acids on cytosolic free calcium concentration ([Ca2+]i) in single rat anterior pituitary (AP) cells. Arginine elicited a large increase of [Ca2+]i) in about 40% of all the AP cells, suggesting that amino acids may modulate hormone secretion by acting directly on the pituitary. 2. Cell typing by immunofluorescence of the hormone the cells store showed that the arginine-sensitive cells are distributed uniformly within all the five AP cell types. The arginine-sensitive cells overlapped closely with the subpopulation of cells sensitive to thyrotrophin-releasing hormone. 3. Other cationic as well as several neutral (dipolar) amino acids had the same effect as arginine. The increase of [Ca2+]i was dependent on extracellular Ca2+ and blocked by dihydropyridine, suggesting that it is due to Ca2+ influx through L-type voltage-gated Ca2+ channels. The [Ca2+]i increase was also blocked by removal of extracellular Na+ but not by tetrodotoxin. The substrate specificity for stimulation of AP cells resembled closely that of the amino acid transport system B0+. We propose that electrogenic amino acid influx through this pathway depolarizes the plasma membrane with the subsequent activation of voltage-gated Ca2+ channels and Ca2+ entry. 4. Amino acids also stimulated prolactin secretion in vitro with a similar substrate specificity to that found for the [Ca2+]i increase. Existing data on the stimulation of secretion of other hormones by amino acids suggest that a similar mechanism could apply to other endocrine glands. PMID:9263921

  3. Facilitated transport of titanium dioxide nanoparticles by humic substances in saturated porous media under acidic conditions

    NASA Astrophysics Data System (ADS)

    Zhang, Ruichang; Zhang, Haibo; Tu, Chen; Hu, Xuefeng; Li, Lianzhen; Luo, Yongming; Christie, Peter

    2015-04-01

    The transport behavior of titanium dioxide nanoparticles (TiO2 NPs, 30 nm in diameter) was studied in well-defined porous media composed of clean quartz sand over a range of solution chemistry under acidic conditions. Transport of TiO2 NPs was dramatically enhanced by humic substances (HS) at acidic pH (4.0, 5.0 and 6.0), even at a low HS concentration of 0.5 mg L-1. Facilitated transport of TiO2 NPs was likely attributable to the increased stability of TiO2 NPs and repulsive interaction between TiO2 NPs and quartz sands due to the adsorbed HS. The mobility of TiO2 NPs was also increased with increasing pH from 4.0 to 6.0. Although transport of TiO2 NPs was insensitive to low ionic strength, it was significantly inhibited by high concentrations of NaCl and CaCl2. In addition, calculated Derjaguin-Landau-Verwey-Overbeek (DLVO) interaction energy indicated that high energy barriers were responsible for the high mobility of TiO2 NPs, while the secondary energy minimum could play an important role in the retention of TiO2 NPs at 100 mmol L-1 NaCl. Straining and gravitational settlement of larger TiO2 NPs aggregates at 1 mg L-1 HS, pH 5.0, and 2 mmol L-1 CaCl2 could be responsible for the significant retention even in the presence of high energy barriers. Moreover, more favorable interaction between approaching TiO2 NPs and TiO2 NPs that had been already deposited on the collector resulted in a ripening-shape breakthrough curve at 2 mmol L-1 CaCl2. Overall, a combination of mechanisms including DLVO-type force, straining, and physical filtration was involved in the retention of TiO2 NPs over the range of solution chemistry examined in this study.

  4. Light-activated amino acid transport in Halobacterium halobium envelope vesicles

    NASA Technical Reports Server (NTRS)

    Macdonald, R. E.; Lanyi, J. K.

    1977-01-01

    Vesicles prepared from Halobacterium halobium cell envelopes accumulate amino acids in response to light-induced electrical and chemical gradients. Nineteen of 20 commonly occurring amino acids have been shown to be actively accumulated by these vesicles in response to illumination or in response to an artificially created Na+ gradient. On the basis of shared common carriers the transport systems can be divided into eight classes, each responsible for the transport of one or several amino acids: arginine, lysine, histidine; asparagine, glutamine; alanine, glycine, threonine, serine; leucine, valine, isoleucine, methionine; phenylalanine, tyrosine, tryptophan; aspartate; glutamate; proline. Available evidence suggests that these carriers are symmetrical in that amino acids can be transported equally well in both directions across the vesicle membranes. A tentative working model to account for these observations is presented.

  5. Surface proton transport of fully protonated poly(aspartic acid) thin films on quartz substrates

    NASA Astrophysics Data System (ADS)

    Nagao, Yuki; Kubo, Takahiro

    2014-12-01

    Thin film structure and the proton transport property of fully protonated poly(aspartic acid) (P-Asp100) have been investigated. An earlier study assessed partially protonated poly(aspartic acid), highly oriented thin film structure and enhancement of the internal proton transport. In this study of P-Asp100, IR p-polarized multiple-angle incidence resolution (P-MAIR) spectra were measured to investigate the thin film structure. The obtained thin films, with thicknesses of 120-670 nm, had no oriented structure. Relative humidity dependence of the resistance, proton conductivity, and normalized resistance were examined to ascertain the proton transport property of P-Asp100 thin films. The obtained data showed that the proton transport of P-Asp100 thin films might occur on the surface, not inside of the thin film. This phenomenon might be related with the proton transport of the biological system.

  6. The solute carrier family 10 (SLC10): beyond bile acid transport

    PubMed Central

    da Silva, Tatiana Claro; Polli, James E.; Swaan, Peter W.

    2012-01-01

    The solute carrier (SLC) family 10 (SLC10) comprises influx transporters of bile acids, steroidal hormones, various drugs, and several other substrates. Because the seminal transporters of this family, namely, sodium/taurocholate cotransporting polypeptide (NTCP; SLC10A1) and the apical sodium-dependent bile acid transporter (ASBT; SLC10A2), were primarily bile acid transporters, the term “sodium bile salt cotransporting family” was used for the SLC10 family. However, this notion became obsolete with the finding of other SLC10 members that do not transport bile acids. For example, the sodium-dependent organic anion transporter (SOAT; SLC10A6) transports primarily sulfated steroids. Moreover, NTCP was shown to also transport steroids and xenobiotics, including HMG-CoA inhibitors (statins). The SLC10 family contains four additional members, namely, P3 (SLC10A3; SLC10A3), P4 (SLC10A4; SLC10A4), P5 (SLC10A5; SLC10A5) and SLC10A7 (SLC10A7), several of which were unknown or considered hypothetical until approximately a decade ago. While their substrate specificity remains undetermined, great progress has been made towards their characterization in recent years. SLC10A4 may participate in vesicular storage or exocytosis of neurotransmitters or mastocyte mediators, whereas SLC10A5 and SLC10A7 may be involved in solute transport and SLC10A3 may have a role as a housekeeping protein. Finally, the newly found role of bile acids in glucose and energy homeostasis, via the TGR5 receptor, sheds new light on the clinical relevance of ASBT and NTCP. The present mini-review provides a brief summary of recent progress on members of the SLC10 family. PMID:23506869

  7. Transport of acetic acid in Zygosaccharomyces bailii: effects of ethanol and their implications on the resistance of the yeast to acidic environments.

    PubMed Central

    Sousa, M J; Miranda, L; Côrte-Real, M; Leão, C

    1996-01-01

    Cells of Zygosaccharomyces bailii ISA 1307 grown in a medium with acetic acid, ethanol, or glycerol as the sole carbon and energy source transported acetic acid by a saturable transport system. This system accepted propionic and formic acids but not lactic, sorbic, and benzoic acids. When the carbon source was glucose or fructose, the cells displayed activity of a mediated transport system specific for acetic acid, apparently not being able to recognize other monocarboxylic acids. In both types of cells, ethanol inhibited the transport of labelled acetic acid. The inhibition was noncompetitive, and the dependence of the maximum transport rate on the ethanol concentration was found to be exponential. These results reinforced the belief that, under the referenced growth conditions, the acid entered the cells mainly through a transporter protein. The simple diffusion of the undissociated acid appeared to contribute, with a relatively low weight, to the overall acid uptake. It was concluded that in Z. bailii, ethanol plays a protective role against the possible negative effects of acetic acid by inhibiting its transport and accumulation. Thus, the intracellular concentration of the acid could be maintained at levels lower than those expected if the acid entered the cells only by simple diffusion. PMID:8795203

  8. Soy-dairy protein blend and whey protein ingestion after resistance exercise increases amino acid transport and transporter expression in human skeletal muscle.

    PubMed

    Reidy, P T; Walker, D K; Dickinson, J M; Gundermann, D M; Drummond, M J; Timmerman, K L; Cope, M B; Mukherjea, R; Jennings, K; Volpi, E; Rasmussen, B B

    2014-06-01

    Increasing amino acid availability (via infusion or ingestion) at rest or postexercise enhances amino acid transport into human skeletal muscle. It is unknown whether alterations in amino acid availability, from ingesting different dietary proteins, can enhance amino acid transport rates and amino acid transporter (AAT) mRNA expression. We hypothesized that the prolonged hyperaminoacidemia from ingesting a blend of proteins with different digestion rates postexercise would enhance amino acid transport into muscle and AAT expression compared with the ingestion of a rapidly digested protein. In a double-blind, randomized clinical trial, we studied 16 young adults at rest and after acute resistance exercise coupled with postexercise (1 h) ingestion of either a (soy-dairy) protein blend or whey protein. Phenylalanine net balance and transport rate into skeletal muscle were measured using stable isotopic methods in combination with femoral arteriovenous blood sampling and muscle biopsies obtained at rest and 3 and 5 h postexercise. Phenylalanine transport into muscle and mRNA expression of select AATs [system L amino acid transporter 1/solute-linked carrier (SLC) 7A5, CD98/SLC3A2, system A amino acid transporter 2/SLC38A2, proton-assisted amino acid transporter 1/SLC36A1, cationic amino acid transporter 1/SLC7A1] increased to a similar extent in both groups (P < 0.05). However, the ingestion of the protein blend resulted in a prolonged and positive net phenylalanine balance during postexercise recovery compared with whey protein (P < 0.05). Postexercise myofibrillar protein synthesis increased similarly between groups. We conclude that, while both protein sources enhanced postexercise AAT expression, transport into muscle, and myofibrillar protein synthesis, postexercise ingestion of a protein blend results in a slightly prolonged net amino acid balance across the leg compared with whey protein.

  9. Insights into the mechanisms of sterol transport between organelles.

    PubMed

    Mesmin, Bruno; Antonny, Bruno; Drin, Guillaume

    2013-09-01

    In cells, the levels of sterol vary greatly among organelles. This uneven distribution depends largely on non-vesicular routes of transfer, which are mediated by soluble carriers called lipid-transfer proteins (LTPs). These proteins have a domain with a hydrophobic cavity that accommodates one sterol molecule. However, a demonstration of their role in sterol transport in cells remains difficult. Numerous LTPs also contain membrane-binding elements, but it is not clear how these LTPs couple their ability to target organelles with lipid transport activity. This issue appears critical, since many sterol transporters are thought to act at contact sites between two membrane-bound compartments. Here, we emphasize that biochemical and structural studies provide precious insights into the mode of action of sterol-binding proteins. Recent studies on START, Osh/ORP and NPC proteins suggest models on how these proteins could transport sterol between organelles and, thereby, influence cellular functions.

  10. Differential usage of the transport systems for folic acid and methotrexate in normal human T-lymphocytes and leukemic cells.

    PubMed

    Biswal, Bijesh Kumar; Verma, Rama Shanker

    2009-11-01

    Methotrexate (MTX) has been used as an effective anti-cancer drug for a long time. Conceptually, it is accepted that MTX and folic acid are transported by folate receptors (FRs) in cancerous cells, but the exact mechanism of MTX uptake in human leukemia is unknown. The objective of this study was to investigate different transport systems for FA and MTX, and to delineate their uptake mechanism in MOLT4, K562, Hut78 leukemia cells and normal human T cells. In MOLT4, uptake of MTX was higher than FA, similar to that of K562, Hut78 and normal T cells. In MOLT4 cells, MTX uptake was maximum at pH 7.4 whereas FA uptake was maximum at pH 4.5. Uptake of FA and MTX was significantly inhibited by anions, suggesting anion-dependent transport system. FA uptake was found to be energy dependent whereas MTX uptake was energy independent. RT-PCR and immunofluorescence results demonstrated the presence of reduced folate carrier as well as proton coupled folate transporter and absence of FR in MOLT4 and normal T cells. These data suggest the existence of two separate and independent carrier-mediated transport systems for the uptake of FA and MTX in normal and leukemic human T cells.

  11. High Energy Density Nastic Structures Using Biological Transport Mechanisms

    DTIC Science & Technology

    2007-02-28

    permeable membranes . This concept is based on the pressurization of cells similar to the process that plants use to maintain homeostasis and regulate...two chambers separated by a semi-permeable membrane substrate that contains protein transporters suspended in a lipid bilayer. The protein...transporters convert biochemical energy in the form of ATP into a protein gradient across the semi- permeable membrane . The proton gradient, in turn, induces

  12. Studies on the catalytic mechanism of pig purple acid phosphatase.

    PubMed

    Wynne, C J; Hamilton, S E; Dionysius, D A; Beck, J L; de Jersey, J

    1995-05-10

    Several independent experiments failed to reveal any evidence in support of the involvement of a phosphoryl-enzyme intermediate in the catalytic mechanism of pig allantoic fluid purple acid phosphatase: (i) attempts to label enzyme with phosphate derived from [32P]p-nitrophenyl phosphate were unsuccessful; (ii) values of kcat for a series of phosphate derivative varied over a wide range, with the enzyme showing a marked preference for activated ester and anhydride substrates over those with a stable leaving group; (iii) burst titrations revealed a "burst" of p-nitrophenol from p-nitrophenyl phosphate only when the enzyme was added after the substrate, suggesting that this result was an artifact of the order of addition of reagents; (iv) transphosphorylation from p-nitrophenyl phosphate to acceptor alcohols could not be detected, even under conditions where a transphosphorylation to hydrolysis ratio as low as 0.015 could have been measured; (v) enzyme-catalyzed exchange of 180 between phosphate and water was demonstrated, although at a rate much slower than that observed for other phosphatases where the involvement of a phosphoryl-enzyme intermediate in the mechanism has been clearly established. The present results are compared with those obtained in similar studies on other phosphatases, particularly the highly homologous beef spleen purple acid phosphatase, and their implications for the catalytic mechanism of the purple acid phosphatases are discussed.

  13. Naringenin inhibits seed germination and seedling root growth through a salicylic acid-independent mechanism in Arabidopsis thaliana.

    PubMed

    Hernández, Iker; Munné-Bosch, Sergi

    2012-12-01

    Flavonoids fulfill an enormous range of biological functions in plants. In seeds, these compounds play several roles; for instance proanthocyanidins protect them from moisture, pathogen attacks, mechanical stress, UV radiation, etc., and flavonols have been suggested to protect the embryo from oxidative stress. The present study aimed at determining the role of flavonoids in Arabidopsis thaliana (L.) seed germination, and the involvement of salicylic acid (SA) and auxin (indole-3-acetic acid), two phytohormones with the same biosynthetic origin as flavonoids, the shikimate pathway, in such a putative role. We show that naringenin, a flavanone, strongly inhibits the germination of A. thaliana seeds in a dose-dependent and SA-independent manner. Altered auxin levels do not affect seed germination in Arabidopsis, but impaired auxin transport does, although to a minor extent. Naringenin and N-1-naphthylphthalamic acid (NPA) impair auxin transport through the same mechanisms, so the inhibition of germination by naringenin might involve impaired auxin transport among other mechanisms. From the present study it is concluded that naringenin inhibits the germination of Arabidopsis seeds in a dose-dependent and SA-independent manner, and the results also suggest that such effects are exerted, at least to some extent, through impaired auxin transport, although additional mechanisms seem to operate as well.

  14. Permeability of membranes to amino acids and modified amino acids: mechanisms involved in translocation

    NASA Technical Reports Server (NTRS)

    Chakrabarti, A. C.; Deamer, D. W. (Principal Investigator); Miller, S. L. (Principal Investigator)

    1994-01-01

    The amino acid permeability of membranes is of interest because they are one of the key solutes involved in cell function. Membrane permeability coefficients (P) for amino acid classes, including neutral, polar, hydrophobic, and charged species, have been measured and compared using a variety of techniques. Decreasing lipid chain length increased permeability slightly (5-fold), while variations in pH had only minor effects on the permeability coefficients of the amino acids tested in liposomes. Increasing the membrane surface charge increased the permeability of amino acids of the opposite charge, while increasing the cholesterol content decreased membrane permeability. The permeability coefficients for most amino acids tested were surprisingly similar to those previously measured for monovalent cations such as sodium and potassium (approximately 10(-12)-10(-13) cm s-1). This observation suggests that the permeation rates for the neutral, polar and charged amino acids are controlled by bilayer fluctuations and transient defects, rather than partition coefficients and Born energy barriers. Hydrophobic amino acids were 10(2) more permeable than the hydrophilic forms, reflecting their increased partition coefficient values. External pH had dramatic effects on the permeation rates for the modified amino acid lysine methyl ester in response to transmembrane pH gradients. It was established that lysine methyl ester and other modified short peptides permeate rapidly (P = 10(-2) cm s-1) as neutral (deprotonated) molecules. It was also shown that charge distributions dramatically alter permeation rates for modified di-peptides. These results may relate to the movement of peptides through membranes during protein translocation and to the origin of cellular membrane transport on the early Earth.

  15. Exciton transport, charge extraction, and loss mechanisms in organic photovoltaics

    NASA Astrophysics Data System (ADS)

    Scully, Shawn Ryan

    Organic photovoltaics have attracted significant interest over the last decade due to their promise as clean low-cost alternatives to large-scale electric power generation such as coal-fired power, natural gas, and nuclear power. Many believe power conversion efficiency targets of 10-15% must be reached before commercialization is possible. Consequently, understanding the loss mechanisms which currently limit efficiencies to 4-5% is crucial to identify paths to reach higher efficiencies. In this work, we investigate the dominant loss mechanisms in some of the leading organic photovoltaic architectures. In the first class of architectures, which include planar heterojunctions and bulk heterojunctions with large domains, efficiencies are primarily limited by the distance photogenerated excitations (excitons) can be transported (termed the exciton diffusion length) to a heterojunction where the excitons may dissociate. We will discuss how to properly measure the exciton diffusion length focusing on the effects of optical interference and of energy transfer when using fullerenes as quenching layers and show how this explains the variety of diffusion lengths reported for the same material. After understanding that disorder and defects limit exciton diffusion lengths, we suggest some approaches to overcome this. We then extensively investigate the use of long-range resonant energy transfer to increase exciton harvesting. Using simulations and experiments as support, we discuss how energy transfer can be engineered into architectures to increase the distance excitons can be harvested. In an experimental model system, DOW Red/PTPTB, we will show how the distance excitons are harvested can be increased by almost an order of magnitude up to 27 nm from a heterojunction and give design rules and extensions of this concept for future architectures. After understanding exciton harvesting limitations we will look at other losses that are present in planar heterojunctions. One of

  16. Regulation of beta-galactoside transport and accumulation in heterofermentative lactic acid bacteria.

    PubMed Central

    Romano, A H; Brino, G; Peterkofsky, A; Reizer, J

    1987-01-01

    Galactose-grown cells of the heterofermentative lactic acid bacteria Lactobacillus brevis and Lactobacillus buchneri transported methyl-beta-D-thiogalactopyranoside (TMG) by an active transport mechanism and accumulated intracellular free TMG when provided with an exogenous source of energy, such as arginine. The intracellular concentration of TMG resultant under these conditions was approximately 20-fold higher than that in the medium. In contrast, the provision of energy by metabolism of glucose, gluconate, or glucosamine promoted a rapid but transient uptake of TMG followed by efflux that established a low cellular concentration of the galactoside, i.e., only two- to fourfold higher than that in the medium. Furthermore, the addition of glucose to cells preloaded with TMG in the presence of arginine elicited a rapid efflux of the intracellular galactoside. The extent of cellular TMG displacement and the duration of the transient effect of glucose on TMG transport were related to the initial concentration of glucose in the medium. Exhaustion of glucose from the medium restored uptake and accumulation of TMG, providing arginine was available for ATP generation. The nonmetabolizable sugar 2-deoxyglucose elicited efflux of TMG from preloaded cells of L. buchneri but not from those of L. brevis. Phosphorylation of this glucose analog was catalyzed by cell extracts of L. buchneri but not by those of L. brevis. Iodoacetate, at a concentration that inhibits growth and ATP production from glucose, did not prevent efflux of cellular TMG elicited by glucose. The results suggested that a phosphorylated metabolite(s) at or above the level of glyceraldehyde-3-phosphate was required to evoke displacement of intracellular TMG from the cells. Counterflow experiments suggested that glucose converted the active uptake of TMG in L. brevis to a facilitated diffusion mechanism that allowed equilibrium of TMG between the extra- and intracellular milieux. The means by which glucose

  17. 1/f fluctuations of amino acids regulate water transportation in aquaporin 1

    NASA Astrophysics Data System (ADS)

    Yamamoto, Eiji; Akimoto, Takuma; Hirano, Yoshinori; Yasui, Masato; Yasuoka, Kenji

    2014-02-01

    Aquaporins (AQPs), which transport water molecules across cell membranes, are involved in many physiological processes. Recently, it is reported that the water-water interactions within the channel are broken at the aromatic/arginine selectivity filter (ar/R region), which prevents proton transportation [U. K. Eriksson et al., Science 340, 1346 (2013), 10.1126/science.1234306]. However, the effects of the conformational fluctuations of amino acids on water transportation remain unclear. Using all-atom molecular dynamics simulations, we analyze water transportation and fluctuations of amino acids within AQP1. The amino acids exhibit 1/f fluctuations, indicating possession of long-term memory. Moreover, we find that water molecules crossing the ar/R region obey a non-Poisson process. To investigate the effect of 1/f fluctuations on water transportation, we perform restrained molecular dynamics simulations of AQP1 and simple Langevin stochastic simulations. As a result, we confirm that 1/f fluctuations of amino acids contribute to water transportation in AQP1. These findings appreciably enhance our understanding of AQPs and suggest possibilities for developing biomimetic nanopores.

  18. Coupling of hydrologic transport and chemical reactions in a stream affected by acid mine drainage

    USGS Publications Warehouse

    Kimball, B.A.; Broshears, R.E.; Bencala, K.E.; McKnight, Diane M.

    1994-01-01

    Experiments in St. Kevin Gulch, an acid mine drainage stream, examined the coupling of hydrologic transport to chemical reactions affecting metal concentrations. Injection of LiCl as a conservative tracer was used to determine discharge and residence time along a 1497-m reach. Transport of metals downstream from inflows of acidic, metal-rich water was evaluated based on synoptic samples of metal concentrations and the hydrologic characteristics of the stream. Transport of SO4 and Mn was generally conservative, but in the subreaches most affected by acidic inflows, transport was reactive. Both 0.1-??m filtered and particulate Fe were reactive over most of the stream reach. Filtered Al partitioned to the particulate phase in response to high instream concentrations. Simulations that accounted for the removal of SO4, Mn, Fe, and Al with first-order reactions reproduced the steady-state profiles. The calculated rate constants for net removal used in the simulations embody several processes that occur on a stream-reach scale. The comparison between rates of hydrologie transport and chemical reactions indicates that reactions are only important over short distances in the stream near the acidic inflows, where reactions occur on a comparable time scale with hydrologic transport and thus affect metal concentrations.

  19. Bibliography for acid-rock drainage and selected acid-mine drainage issues related to acid-rock drainage from transportation activities

    USGS Publications Warehouse

    Bradley, Michael W.; Worland, Scott C.

    2015-01-01

    Acid-rock drainage occurs through the interaction of rainfall on pyrite-bearing formations. When pyrite (FeS2) is exposed to oxygen and water in mine workings or roadcuts, the mineral decomposes and sulfur may react to form sulfuric acid, which often results in environmental problems and potential damage to the transportation infrastructure. The accelerated oxidation of pyrite and other sulfidic minerals generates low pH water with potentially high concentrations of trace metals. Much attention has been given to contamination arising from acid mine drainage, but studies related to acid-rock drainage from road construction are relatively limited. The U.S. Geological Survey, in cooperation with the Tennessee Department of Transportation, is conducting an investigation to evaluate the occurrence and processes controlling acid-rock drainage and contaminant transport from roadcuts in Tennessee. The basic components of acid-rock drainage resulting from transportation activities are described and a bibliography, organized by relevant categories (remediation, geochemical, microbial, biological impact, and secondary mineralization) is presented.

  20. Humic acid transport in saturated porous media: influence of flow velocity and influent concentration.

    PubMed

    Wei, Xiaorong; Shao, Mingan; Du, Lina; Horton, Robert

    2014-12-01

    Understanding the transport of humic acids (HAs) in porous media can provide important and practical evidence needed for accurate prediction of organic/inorganic contaminant transport in different environmental media and interfaces. A series of column transport experiments was conducted to evaluate the transport of HA in different porous media at different flow velocities and influent HA concentrations. Low flow velocity and influent concentration were found to favor the adsorption and deposition of HA onto sand grains packed into columns and to give higher equilibrium distribution coefficients and deposition rate coefficients, which resulted in an increased fraction of HA being retained in columns. Consequently, retardation factors were increased and the transport of HA through the columns was delayed. These results suggest that the transport of HA in porous media is primarily controlled by the attachment of HA to the solid matrix. Accordingly, this attachment should be considered in studies of HA behavior in porous media.

  1. Prohibitin/annexin 2 interaction regulates fatty acid transport in adipose tissue

    PubMed Central

    Salameh, Ahmad; Daquinag, Alexes C.; Staquicini, Daniela I.; An, Zhiqiang; Pasqualini, Renata; Kolonin, Mikhail G.

    2016-01-01

    We have previously identified prohibitin (PHB) and annexin A2 (ANX2) as proteins interacting on the surface of vascular endothelial cells in white adipose tissue (WAT) of humans and mice. Here, we demonstrate that ANX2 and PHB also interact in adipocytes. Mice lacking ANX2 have normal WAT vascularization, adipogenesis, and glucose metabolism but display WAT hypotrophy due to reduced fatty acid uptake by WAT endothelium and adipocytes. By using cell culture systems in which ANX2/PHB binding is disrupted either genetically or through treatment with a blocking peptide, we show that fatty acid transport efficiency relies on this protein complex. We also provide evidence that the interaction between ANX2 and PHB mediates fatty acid transport from the endothelium into adipocytes. Moreover, we demonstrate that ANX2 and PHB form a complex with the fatty acid transporter CD36. Finally, we show that the colocalization of PHB and CD36 on adipocyte surface is induced by extracellular fatty acids. Together, our results suggest that an unrecognized biochemical interaction between ANX2 and PHB regulates CD36-mediated fatty acid transport in WAT, thus revealing a new potential pathway for intervention in metabolic diseases. PMID:27468426

  2. Origin of traps and charge transport mechanism in hafnia

    SciTech Connect

    Islamov, D. R. Gritsenko, V. A.; Cheng, C. H.; Chin, A.

    2014-12-01

    In this study, we demonstrated experimentally and theoretically that oxygen vacancies are responsible for the charge transport in HfO{sub 2}. Basing on the model of phonon-assisted tunneling between traps, and assuming that the electron traps are oxygen vacancies, good quantitative agreement between the experimental and theoretical data of current-voltage characteristics was achieved. The thermal trap energy of 1.25 eV in HfO{sub 2} was determined based on the charge transport experiments.

  3. Atomistic mechanisms of rapid energy transport in light-harvesting molecules

    NASA Astrophysics Data System (ADS)

    Ohmura, Satoshi; Koga, Shiro; Akai, Ichiro; Shimojo, Fuyuki; Kalia, Rajiv K.; Nakano, Aiichiro; Vashishta, Priya

    2011-03-01

    Synthetic supermolecules such as π-conjugated light-harvesting dendrimers efficiently harvest energy from sunlight, which is of significant importance for the global energy problem. Key to their success is rapid transport of electronic excitation energy from peripheral antennas to photochemical reaction cores, the atomistic mechanisms of which remains elusive. Here, quantum-mechanical molecular dynamics simulation incorporating nonadiabatic electronic transitions reveals the key molecular motion that significantly accelerates the energy transport based on the Dexter mechanism.

  4. Acid-induced unfolding mechanism of recombinant human endostatin.

    PubMed

    Li, Bing; Wu, Xiaoyu; Zhou, Hao; Chen, Qianjie; Luo, Yongzhang

    2004-03-09

    Endostatin is a potent angiogenesis inhibitor. The structure of endostatin is unique in that its secondary structure is mainly irregular loops and beta-sheets and contains only a small fraction of alpha-helices with two pairs of disulfide bonds in a nested pattern. We choose human endostatin as a model system to study the folding mechanism of this kind. Nuclear magnetic resonance (NMR), tryptophan emission fluorescence, and circular dichroism (CD) were used to monitor the unfolding process of endostatin upon acid titration. Urea-induced unfolding was used to measure the stability of endostatin under different conditions. Our results show that endostatin is very acid-resistant; some native structure still remains even at pH 2 as evidenced by (1)H NMR. Trifluoroethanol (TFE) destabilizes native endostatin, while it makes endostatin even more acid-resistant in the low pH region. Stability measurement of endostatin suggests that endostatin is still in native structure at pH 3.5 despite the decreased stability. Acid-induced unfolding of endostatin is reversible, although it requires a long time to reach equilibrium below pH 3. Surprisingly, the alpha-helical content of endostatin is increased when it is unfolded at pH 1.6, and the alpha-helical content of the polypeptide chain of unfolded endostatin increases linearly with TFE concentration in the range of 0-30%. This observation indicates that the polypeptide chain of unfolded endostatin has an intrinsic alpha-helical propensity. Our discoveries may provide clues for refolding endostatin more efficiently. The acid-resistance property of endostatin may have biological significance in that it cannot be easily digested by proteases in an acidic environment such as in a lysosome in the cell.

  5. Computational models for drug inhibition of the human apical sodium-dependent bile acid transporter.

    PubMed

    Zheng, Xiaowan; Ekins, Sean; Raufman, Jean-Pierre; Polli, James E

    2009-01-01

    The human apical sodium-dependent bile acid transporter (ASBT; SLC10A2) is the primary mechanism for intestinal bile acid reabsorption. In the colon, secondary bile acids increase the risk of cancer. Therefore, drugs that inhibit ASBT have the potential to increase the risk of colon cancer. The objectives of this study were to identify FDA-approved drugs that inhibit ASBT and to derive computational models for ASBT inhibition. Inhibition was evaluated using ASBT-MDCK monolayers and taurocholate as the model substrate. Computational modeling employed a HipHop qualitative approach, a Hypogen quantitative approach, and a modified Laplacian Bayesian modeling method using 2D descriptors. Initially, 30 compounds were screened for ASBT inhibition. A qualitative pharmacophore was developed using the most potent 11 compounds and applied to search a drug database, yielding 58 hits. Additional compounds were tested, and their K(i) values were measured. A 3D-QSAR and a Bayesian model were developed using 38 molecules. The quantitative pharmacophore consisted of one hydrogen bond acceptor, three hydrophobic features, and five excluded volumes. Each model was further validated with two external test sets of 30 and 19 molecules. Validation analysis showed both models exhibited good predictability in determining whether a drug is a potent or nonpotent ASBT inhibitor. The Bayesian model correctly ranked the most active compounds. In summary, using a combined in vitro and computational approach, we found that many FDA-approved drugs from diverse classes, such as the dihydropyridine calcium channel blockers and HMG CoA-reductase inhibitors, are ASBT inhibitors.

  6. Computational Models for Drug Inhibition of the Human Apical Sodium-dependent Bile Acid Transporter

    PubMed Central

    Zheng, Xiaowan; Ekins, Sean; Raufman, Jean-Pierre; Polli, James E.

    2009-01-01

    The human apical sodium-dependent bile acid transporter (ASBT; SLC10A2) is the primary mechanism for intestinal bile acid re-absorption. In the colon, secondary bile acids increase the risk of cancer. Therefore, drugs that inhibit ASBT have the potential to increase the risk of colon cancer. The objectives of this study were to identify FDA-approved drugs that inhibit ASBT and to derive computational models for ASBT inhibition. Inhibition was evaluated using ASBT-MDCK monolayers and taurocholate as the model substrate. Computational modeling employed a HipHop qualitative approach, a Hypogen quantitative approach, as well as a modified Laplacian Bayesian modeling method using 2D descriptors. Initially, 30 compounds were screened for ASBT inhibition. A qualitative pharmacophore was developed using the most potent 11 compounds and applied to search a drug database, yielding 58 hits. Additional compounds were tested and their Ki values were measured. A 3D-QSAR and a Bayesian model were developed using 38 molecules. The quantitative pharmacophore consisted of one hydrogen bond acceptor, three hydrophobic features, and five excluded volumes. Each model was further validated with two external test sets of 30 and 19 molecules. Validation analysis showed both models exhibited good predictability in determining whether a drug is a potent or non-potent ASBT inhibitor. The Bayesian model correctly ranked the most active compounds. In summary, using a combined in vitro and computational approach, we found that many FDA-approved drugs from diverse classes, such as the dihydropyridine calcium channel blockers and HMG CoA-reductase inhibitors, are ASBT inhibitors. PMID:19673539

  7. Proton transport in triflic acid hydrates studied via path integral car-parrinello molecular dynamics.

    PubMed

    Hayes, Robin L; Paddison, Stephen J; Tuckerman, Mark E

    2009-12-31

    The mono-, di-, and tetrahydrates of trifluoromethanesulfonic acid, which contain characteristic H(3)O(+), H(5)O(2)(+), and H(9)O(4)(+) structures, provide model systems for understanding proton transport in materials with high perfluorosulfonic acid density such as perfluorosulfonic acid membranes commonly employed in hydrogen fuel cells. Ab initio molecular dynamics simulations indicate that protons in these solids are predisposed to transfer to the water most strongly bound to sulfonate groups via a Grotthuss-type mechanism, but quickly return to the most solvated defect structure either due to the lack of a nearby species to stabilize the new defect or a preference for the proton to be maximally hydrated. Path integral molecular dynamics of the mono- and dihydrate reveal significant quantum effects that facilitate proton transfer to the "presolvated" water or SO(3)(-) in the first solvation shell and increase the Zundel character of all the defects. These trends are quantified in free energy profiles for each bonding environment. Hydrogen bonding criteria for HOH-OH(2) and HOH-O(3)S are extracted from the two-dimensional potential of mean force. The quantum radial distribution function, radius of gyration, and root-mean-square displacement position correlation function show that the protonic charge is distributed over two or more water molecules. Metastable structural defects with one excess proton shared between two sulfonate groups and another Zundel or Eigen type cation defect are found for the mono- and dihydrate but not for the tetrahydrate crystal. Results for the tetrahydrate native crystal exhibit minor differences at 210 and 250 K. IR spectra are calculated for all native and stable defect structures. Graph theory techniques are used to characterize the chain lengths and ring sizes in the hydrogen bond network. Low conductivities when limited water is present may be attributable to trapping of protons between SO(3)(-) groups and the increased

  8. Role of a major facilitator superfamily transporter in adaptation capacity of Penicillium funiculosum under extreme acidic stress.

    PubMed

    Xu, Xiaoxue; Chen, Jinyin; Xu, Houjuan; Li, Duochuan

    2014-08-01

    Fungal species present in extreme low pH environments are expected to have adapted for tolerance to high H(+) concentrations. However, their adaptability mechanism is unclear. In this study, we isolated an acid-tolerant strain of Penicillium funiculosum, which can grow actively at pH 1.0 and thrived in pH 0.6. A major facilitator superfamily transporter (PfMFS) was isolated from an acid-sensitive random insertional mutant (M4) of the fungus. It encodes a putative protein of 551 residues and contains 14 transmembrane-spanning segments. A targeted mutant (M7) carrying an inactivated copy of PfMFS showed an obvious reduction of growth compared with the wild type (WT) and complementation of M7 with PfMFS restored the wild-type level of growth at pH 1.0. Further data showed that the wild-type showed higher intracellular pH than M7 in response to pH 1. Subcellular localization showed that PfMFS was a cell membrane protein. Homology modeling showed structural similarity with an MFS transporter EmrD from Escherichiacoli. These results demonstrate that the PfMFS transporter is involved in the acid resistance and intracellular pH homeostasis of P. funiculosum.

  9. Mechanisms of molecular transport through the urea channel of Helicobacter pylori

    NASA Astrophysics Data System (ADS)

    McNulty, Reginald; Ulmschneider, Jakob P.; Luecke, Hartmut; Ulmschneider, Martin B.

    2013-12-01

    Helicobacter pylori survival in acidic environments relies on cytoplasmic hydrolysis of gastric urea into ammonia and carbon dioxide, which buffer the pathogen’s periplasm. Urea uptake is greatly enhanced and regulated by HpUreI, a proton-gated inner membrane channel protein essential for gastric survival of H. pylori. The crystal structure of HpUreI describes a static snapshot of the channel with two constriction sites near the center of the bilayer that are too narrow to allow passage of urea or even water. Here we describe the urea transport mechanism at atomic resolution, revealed by unrestrained microsecond equilibrium molecular dynamics simulations of the hexameric channel assembly. Two consecutive constrictions open to allow conduction of urea, which is guided through the channel by interplay between conserved residues that determine proton rejection and solute selectivity. Remarkably, HpUreI conducts water at rates equivalent to aquaporins, which might be essential for efficient transport of urea at small concentration gradients.

  10. Chemically- and mechanically-mediated influences on the transport and mechanical characteristics of rock fractures

    SciTech Connect

    Min, K.-B.; Rutqvist, J.; Elsworth, D.

    2009-02-01

    A model is presented to represent changes in the mechanical and transport characteristics of fractured rock that result from coupled mechanical and chemical effects. The specific influence is the elevation of dissolution rates on contacting asperities, which results in a stress- and temperature-dependent permanent closure. A model representing this pressure-dissolution-like behavior is adapted to define the threshold and resulting response in terms of fundamental thermodynamic properties of a contacting fracture. These relations are incorporated in a stress-stiffening model of fracture closure to define the stress- and temperature-dependency of aperture loss and behavior during stress and temperature cycling. These models compare well with laboratory and field experiments, representing both decoupled isobaric and isothermal responses. The model was applied to explore the impact of these responses on heated structures in rock. The result showed a reduction in ultimate induced stresses over the case where chemical effects were not incorporated, with permanent reduction in final stresses after cooling to ambient conditions. Similarly, permeabilities may be lower than they were in the case where chemical effects were not considered, with a net reduction apparent even after cooling to ambient temperature. These heretofore-neglected effects may have a correspondingly significant impact on the performance of heated structures in rock, such as repositories for the containment of radioactive wastes.

  11. Functional specialization and differential regulation of short-chain carboxylic acid transporters in the pathogen Candida albicans

    PubMed Central

    Vieira, Neide; Casal, Margarida; Johansson, Björn; MacCallum, Donna M; Brown, Alistair JP; Paiva, Sandra

    2010-01-01

    The major fungal pathogen Candida albicans has the metabolic flexibility to assimilate a wide range of nutrients in its human host. Previous studies have suggested that C. albicans can encounter glucose-poor microenvironments during infection and that the ability to use alternative non-fermentable carbon sources contributes to its virulence. JEN1 encodes a monocarboxylate transporter in C. albicans and we show that its paralogue, JEN2, encodes a novel dicarboxylate plasma membrane transporter, subjected to glucose repression. A strain deleted in both genes lost the ability to transport lactic, malic and succinic acids by a mediated mechanism and it displayed a growth defect on these substrates. Although no significant morphogenetic or virulence defects were found in the double mutant strain, both JEN1 and JEN2 were strongly induced during infection. Jen1-GFP (green fluorescent protein) and Jen2-GFP were upregulated following the phagocytosis of C. albicans cells by neutrophils and macrophages, displaying similar behaviour to an Icl1-GFP fusion. In the murine model of systemic candidiasis approximately 20–25% of C. albicans cells infecting the kidney expressed Jen1-GFP and Jen2-GFP. Our data suggest that Jen1 and Jen2 are expressed in glucose-poor niches within the host, and that these short-chain carboxylic acid transporters may be important in the early stages of infection. PMID:19968788

  12. Expression, Purification, and Structural Insights for the Human Uric Acid Transporter, GLUT9, Using the Xenopus laevis Oocytes System

    PubMed Central

    Clémençon, Benjamin; Lüscher, Benjamin P.; Fine, Michael; Baumann, Marc U.; Surbek, Daniel V.; Bonny, Olivier; Hediger, Matthias A.

    2014-01-01

    The urate transporter, GLUT9, is responsible for the basolateral transport of urate in the proximal tubule of human kidneys and in the placenta, playing a central role in uric acid homeostasis. GLUT9 shares the least homology with other members of the glucose transporter family, especially with the glucose transporting members GLUT1-4 and is the only member of the GLUT family to transport urate. The recently published high-resolution structure of XylE, a bacterial D-xylose transporting homologue, yields new insights into the structural foundation of this GLUT family of proteins. While this represents a huge milestone, it is unclear if human GLUT9 can benefit from this advancement through subsequent structural based targeting and mutagenesis. Little progress has been made toward understanding the mechanism of GLUT9 since its discovery in 2000. Before work can begin on resolving the mechanisms of urate transport we must determine methods to express, purify and analyze hGLUT9 using a model system adept in expressing human membrane proteins. Here, we describe the surface expression, purification and isolation of monomeric protein, and functional analysis of recombinant hGLUT9 using the Xenopus laevis oocyte system. In addition, we generated a new homology-based high-resolution model of hGLUT9 from the XylE crystal structure and utilized our purified protein to generate a low-resolution single particle reconstruction. Interestingly, we demonstrate that the functional protein extracted from the Xenopus system fits well with the homology-based model allowing us to generate the predicted urate-binding pocket and pave a path for subsequent mutagenesis and structure-function studies. PMID:25286413

  13. Mechanism of Calcium Lactate Facilitating Phytic Acid Degradation in Soybean during Germination.

    PubMed

    Hui, Qianru; Yang, Runqiang; Shen, Chang; Zhou, Yulin; Gu, Zhenxin

    2016-07-13

    Calcium lactate facilitates the growth and phytic acid degradation of soybean sprouts, but the mechanism is unclear. In this study, calcium lactate (Ca) and calcium lactate with lanthanum chloride (Ca+La) were used to treat soybean sprouts to reveal the relevant mechanism. Results showed that the phytic acid content decreased and the availability of phosphorus increased under Ca treatment. This must be due to the enhancement of enzyme activity related to phytic acid degradation. In addition, the energy metabolism was accelerated by Ca treatment. The energy status and energy metabolism-associated enzyme activity also increased. However, the transmembrane transport of calcium was inhibited by La(3+) and concentrated in intercellular space or between the cell wall and cell membrane; thus, Ca+La treatment showed reverse results compared with those of Ca treatment. Interestingly, gene expression did not vary in accordance with their enzyme activity. These results demonstrated that calcium lactate increased the rate of phytic acid degradation by enhancing growth, phosphorus metabolism, and energy metabolism.

  14. Unveiling the Mechanism of Arginine Transport through AdiC with Molecular Dynamics Simulations: The Guiding Role of Aromatic Residues

    PubMed Central

    Krammer, Eva-Maria; Ghaddar, Kassem; André, Bruno

    2016-01-01

    Commensal and pathogenic enteric bacteria have developed several systems to adapt to proton leakage into the cytoplasm resulting from extreme acidic conditions. One such system involves arginine uptake followed by export of the decarboxylated product agmatine, carried out by the arginine/agmatine antiporter (AdiC), which thus works as a virtual proton pump. Here, using classical and targeted molecular dynamics, we investigated at the atomic level the mechanism of arginine transport through AdiC of E. coli. Overall, our MD simulation data clearly demonstrate that global rearrangements of several transmembrane segments are necessary but not sufficient for achieving transitions between structural states along the arginine translocation pathway. In particular, local structural changes, namely rotameric conversions of two aromatic residues, are needed to regulate access to both the outward- and inward-facing states. Our simulations have also enabled identification of a few residues, overwhelmingly aromatic, which are essential to guiding arginine in the course of its translocation. Most of them belong to gating elements whose coordinated motions contribute to the alternating access mechanism. Their conservation in all known E. coli acid resistance antiporters suggests that the transport mechanisms of these systems share common features. Last but not least, knowledge of the functional properties of AdiC can advance our understanding of the members of the amino acid-carbocation-polyamine superfamily, notably in eukaryotic cells. PMID:27482712

  15. Role of different scattering mechanisms on the temperature dependence of transport in graphene

    PubMed Central

    Sarkar, Suman; Amin, Kazi Rafsanjani; Modak, Ranjan; Singh, Amandeep; Mukerjee, Subroto; Bid, Aveek

    2015-01-01

    Detailed experimental and theoretical studies of the temperature dependence of the effect of different scattering mechanisms on electrical transport properties of graphene devices are presented. We find that for high mobility devices the transport properties are mainly governed by completely screened short range impurity scattering. On the other hand, for the low mobility devices transport properties are determined by both types of scattering potentials - long range due to ionized impurities and short range due to completely screened charged impurities. The results could be explained in the framework of Boltzmann transport equations involving the two independent scattering mechanisms. PMID:26608479

  16. Incorporating Geochemical And Microbial Kinetics In Reactive Transport Models For Generation Of Acid Rock Drainage

    NASA Astrophysics Data System (ADS)

    Andre, B. J.; Rajaram, H.; Silverstein, J.

    2010-12-01

    Acid mine drainage, AMD, results from the oxidation of metal sulfide minerals (e.g. pyrite), producing ferrous iron and sulfuric acid. Acidophilic autotrophic bacteria such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans obtain energy by oxidizing ferrous iron back to ferric iron, using oxygen as the electron acceptor. Most existing models of AMD do not account for microbial kinetics or iron geochemistry rigorously. Instead they assume that oxygen limitation controls pyrite oxidation and thus focus on oxygen transport. These models have been successfully used for simulating conditions where oxygen availability is a limiting factor (e.g. source prevention by capping), but have not been shown to effectively model acid generation and effluent chemistry under a wider range of conditions. The key reactions, oxidation of pyrite and oxidation of ferrous iron, are both slow kinetic processes. Despite being extensively studied for the last thirty years, there is still not a consensus in the literature about the basic mechanisms, limiting factors or rate expressions for microbially enhanced oxidation of metal sulfides. An indirect leaching mechanism (chemical oxidation of pyrite by ferric iron to produce ferrous iron, with regeneration of ferric iron by microbial oxidation of ferrous iron) is used as the foundation of a conceptual model for microbially enhanced oxidation of pyrite. Using literature data, a rate expression for microbial consumption of ferrous iron is developed that accounts for oxygen, ferrous iron and pH limitation. Reaction rate expressions for oxidation of pyrite and chemical oxidation of ferrous iron are selected from the literature. A completely mixed stirred tank reactor (CSTR) model is implemented coupling the kinetic rate expressions, speciation calculations and flow. The model simulates generation of AMD and effluent chemistry that qualitatively agrees with column reactor and single rock experiments. A one dimensional reaction

  17. Cholesterol reduces the effects of dihydroxy bile acids and fatty acids on water and solute transport in the human jejunum.

    PubMed Central

    Broor, S L; Slota, T; Ammon, H V

    1980-01-01

    Jejunal perfusion studies were performed in 16 healthy volunteers to test the hypothesis that intraluminal cholesterol can mitigate the fluid secretion induced by dihydroxy bile acids and fatty acids. Fluid secretion in the presence of 5 mM taurodeoxycholate was somewhat reduced by 4 mM mono-olein which was used for the solubilization of cholesterol. Addition of 0.8 mM cholesterol reduced fluid secretion further (P less than 0.05). Fluid secretion induced by 4 mM oleic acid was changed to net absorption in a linear fashion with increasing cholesterol concentration in the perfusion solutions. 1 mM cholesterol reduced fluid secretion induced by 6 mM oleic acid (P less than 0.005), but had no effect on fluid secretion induced by 6 mM linolenic acid. Glucose absorption was generally affected in a similar manner as water transport. In vitro, 1 mM cholesterol reduced monomer activity of 6 mM oleic acid to 72.3 +/- 0.9% of control and that of linolenic acid to 81.1 +/- 1.7% of control. Although statistically significant (P less than 0.001), the difference in the effects of cholesterol on monomer activities of the two fatty acids was rather small and it is unlikely that changes in monomer concentration of fatty acids and bile acids account for the protective effect of cholesterol. The in vivo observations point to a new physiological role for biliary cholesterol: the modification of the response of the small intestine to the effects of dihydroxy bile acids and fatty acids. PMID:7358850

  18. [Investigation on mechanism of pyrite oxidation in acidic solutions].

    PubMed

    Wang, Nan; Yi, Xiao-Yun; Dang, Zhi; Liu, Yun

    2012-11-01

    The mechanism of pyrite oxidation in acidic solutions was investigated by electrochemical analysis methods, such as open-circuit potential, cyclic voltammetry, Tafel polarization curve and anodic polarization curve, using a pyrite-carbon paste electrode as working electrode. The results showed that the oxidation process of pyrite in acidic solutions was via a two-step reaction: the first step was the dissolution of iron moiety and formation of a passivation film composed of elemental sulphur, metal-deficient sulfide and polysulfide; the second step was the further oxidation of these intermediate products to SO4(2-). The final reaction products of pyrite oxidation were Fe3+ and SO4(2-) in acidic solutions. In addition, the open-circuit potential and corrosion potential were positively shifted, the peak current and the corrosion current were increased with the increase in concentration of H2SO4 solutions. This indicated that increased acidity of the system was advantageous to the oxidation of pyrite.

  19. Cardioprotective mechanism of omega-3 polyunsaturated fatty acids.

    PubMed

    Endo, Jin; Arita, Makoto

    2016-01-01

    Omega-3 polyunsaturated fatty acids (PUFAs), such as eicosapentaenoic acid and docosahexaenoic acid, are widely regarded as cardioprotective. Several large-scale, randomized clinical trials have shown that dietary intake of omega-3 PUFAs improves the prognosis of patients with symptomatic heart failure or recent myocardial infarction. Therefore, dietary consumption of omega-3 PUFA is recommended in international guidelines for the general population to prevent the occurrence of cardiovascular diseases (CVDs). However, the precise mechanisms underlying the cardioprotective effects of omega-3 PUFAs are not fully understood. Omega-3 PUFAs can be incorporated into the phospholipid bilayer of cell membranes and can affect membrane fluidity, lipid microdomain formation, and signaling across membranes. Omega-3 PUFAs also modulate the function of membrane ion channels, such as Na and L-type Ca channels, to prevent lethal arrhythmias. Moreover, omega-3 PUFAs also prevent the conversion of arachidonic acid into pro-inflammatory eicosanoids by serving as an alternative substrate for cyclooxygenase or lipoxygenase, resulting in the production of less potent products. In addition, a number of enzymatically oxygenated metabolites derived from omega-3 PUFAs were recently identified as anti-inflammatory mediators. These omega-3 metabolites may contribute to the beneficial effects against CVDs that are attributed to omega-3 PUFAs.

  20. Unidirectional Transport Mechanism in an ATP Dependent Exporter

    PubMed Central

    2017-01-01

    ATP-binding cassette (ABC) transporters use the energy of ATP binding and hydrolysis to move a large variety of compounds across biological membranes. P-glycoprotein, involved in multidrug resistance, is the most investigated eukaryotic family member. Although a large number of biochemical and structural approaches have provided important information, the conformational dynamics underlying the coupling between ATP binding/hydrolysis and allocrite transport remains elusive. To tackle this issue, we performed molecular dynamic simulations for different nucleotide occupancy states of Sav1866, a prokaryotic P-glycoprotein homologue. The simulations reveal an outward-closed conformation of the transmembrane domain that is stabilized by the binding of two ATP molecules. The hydrolysis of a single ATP leads the X-loop, a key motif of the ATP binding cassette, to interfere with the transmembrane domain and favor its outward-open conformation. Our findings provide a structural basis for the unidirectionality of transport in ABC exporters and suggest a ratio of one ATP hydrolyzed per transport cycle. PMID:28386603

  1. Price Analysis of Railway Freight Transport under Marketing Mechanism

    NASA Astrophysics Data System (ADS)

    Shi, Ying; Fang, Xiaoping; Chen, Zhiya

    Regarding the problems in the reform of the railway tariff system and the pricing of the transport, by means of assaying the influence of the price elasticity on the artifice used for price, this article proposed multiple regressive model which analyzed price elasticity quantitatively. This model conclude multi-factors which influences on the price elasticity, such as the averagely railway freight charge, the averagely freight haulage of proximate supersede transportation mode, the GDP per capita in the point of origin, and a series of dummy variable which can reflect the features of some productive and consume demesne. It can calculate the price elasticity of different classes in different domains, and predict the freight traffic volume on different rate levels. It can calculate confidence-level, and evaluate the relevance of each parameter to get rid of irrelevant or little relevant variables. It supplied a good theoretical basis for directing the pricing of transport enterprises in market economic conditions, which is suitable for railway freight, passenger traffic and other transportation manner as well. SPSS (Statistical Package for the Social Science) software was used to calculate and analysis the example. This article realized the calculation by HYFX system(Ministry of Railways fund).

  2. Expression of the SNAT2 amino acid transporter during the development of rat cerebral cortex.

    PubMed

    Rodríguez, Angelina; Angelina, Rodríguez; Berumen, Laura C; Francisco, Zafra; Giménez, Cecilio; Cecilio, Giménez; García-Alcocer, María Guadalupe; Guadalupe, García-Alcocer María

    2011-11-01

    The sodium-coupled neutral amino acid transporter 2 (SNAT2) is a protein that is expressed ubiquitously in mammalian tissues and that displays Na(+), voltage and pH dependent activity. This transporter mediates the passage of small zwitterionic amino acids across the cell membrane and regulates the cell homeostasis and its volume. We have examined the expression of SNAT2 mRNA and protein during the development of the rat cerebral cortex, from gestation through the postnatal stages to adulthood. Our data reveal that SNAT2 mRNA and protein expression is higher during embryogenesis, while it subsequently diminishes during postnatal development. Moreover, during embryonic period SNAT2 colocalizes with the radial glial cells marker GLAST, while in postnatal period it is mainly detected in neuronal dendrites. These findings suggest a relevant role for amino acid transport through SNAT2 in the developing embryonic brain.

  3. Carrier-mediated placental transport of cimetidine and valproic acid across differentiating JEG-3 cell layers.

    PubMed

    Ikeda, K; Ueda, C; Yamada, K; Nakamura, A; Hatsuda, Y; Kawanishi, S; Nishii, S; Ogawa, M

    2015-07-01

    Human choriocarcinoma has been used as a model to study trophoblast transcellular drug transport in the placenta. Previous models had limitations regarding low molecular weight drug transport through the intracellular gap junction. The purpose of this study was to evaluate placental carrier-mediated transport across a differentiating JEG-3 choriocarcinoma cell (DJEGs) layer model in which the intracellular gap junction was restricted. Cimetidine is the substrate of an efflux transporter, breast cancer resistance protein (BCRP). BCRP highly expressed in the placenta, and its function in the DJEGs model was investigated. In addition, the placental drug transport of another efflux transporter, multidrug resistance-associated proteins (MRPs), and an influx transporter, monocarboxylate transporter (MCT), were examined with various substrates. Cimetidine permeated from the fetal side to the maternal side at significantly high levels and saturated in a dose-dependent manner. The permeability coefficient of a MRP substrate, fluorescein, across the DJEGs model was significantly increased by inhibiting MRP function with probenecid. On the other hand, permeation in the influx direction to the fetal side with a substrate of MCT, valproic acid, had a gentle dose-dependent saturation. These findings suggest that the DJEGs model could be used to evaluate transcellular placental drug transport mediated by major placental transporters.

  4. The alternating access mechanism of transport as observed in the sodium-hydantoin transporter Mhp1

    PubMed Central

    Weyand, Simone; Shimamura, Tatsuro; Beckstein, Oliver; Sansom, Mark S. P.; Iwata, So; Henderson, Peter J. F.; Cameron, Alexander D.

    2011-01-01

    Secondary active transporters move molecules across cell membranes by coupling this process to the energetically favourable downhill movement of ions or protons along an electrochemical gradient. They function by the alternating access model of transport in which, through conformational changes, the substrate binding site alternately faces either side of the membrane. Owing to the difficulties in obtaining the crystal structure of a single transporter in different conformational states, relatively little structural information is known to explain how this process occurs. Here, the structure of the sodium-benzylhydantoin transporter, Mhp1, from Microbacterium liquefaciens, has been determined in three conformational states; from this a mechanism is proposed for switching from the outward-facing open conformation through an occluded structure to the inward-facing open state. PMID:21169684

  5. Further evaluation of the interrelationship between the hepatocellular transport of bile acids and endocytosed proteins.

    PubMed Central

    Herrera, M. C.; el-Mir, M. Y.; Monte, M. J.; Perez-Barriocanal, F.; Marin, J. J.

    1992-01-01

    Experiments on the relationship between the hepatocellular transport of endogenous or exogenously loaded bile acids (sodium taurocholate, TC, 0.5 mumol/min/100 g body wt) and horseradish peroxidase (HRP) or immunoglobulin A (IgA) (0.5 mg/100 g body wt) were carried out on anaesthetized Wistar rats. The time course of HRP excretion into bile (acceleration in the secretory peak), but not the total amount of HRP output, was affected by TC infusion. Administration of HRP was found to have no stimulatory effect on either spontaneous or TC-induced bile flow, bile acid, lecithin or cholesterol output. Spontaneous bile acid output was increased (25 and 67%, respectively) in rats that were treated for 12-h fasting or by oral administration of TC (45 mg/100 g body wt, every 12 h, for 2 days). These manoeuvres did not change the inability of HRP and IgA to increase bile acid output. Exogenous TC load had no stimulatory effect on the hepatocellular transport of endogenous bile acid pool, that was labelled by a combination of fasting and oral administration of 14C-glycocholic acid 12 h before the experiments. Therefore, exogenous bile acid load-induced stimulation of transcytosis had no effect on endogenous bile acid output. Moreover, bile secretion of both endogenous and exogenously loaded bile acids is unaffected by the administration of proteins, irrespective of whether they are endocytosed by a receptor or nonreceptor mediated process. PMID:1571280

  6. Auxin Activity of Substituted Benzoic Acids and Their Effect on Polar Auxin Transport 1

    PubMed Central

    Keitt, George W.; Baker, Robert A.

    1966-01-01

    Six dichloro-, 3 trichloro-, 2 triiodo-, and 3 heterosubstituted benzoic acids (amiben, dinoben, dicamba), and N-1-naphthylphthalamic acid have been tested for effects on growth and on polar auxin transport. Growth activity with and without kinetin was measured by effects on fresh and dry weights of 30-day cultures of fresh tobacco pith. Transport inhibition was measured by following uptake and output of IAA-2-14C through 10 mm bean epicotyl sections. The distribution of callus growth on vascularized tobacco stem segments was also observed. Avena first internode extension assays established the relative activities: dicamba > amiben > dinoben suggested by pith growth results. Growth effects of active compounds were similar with and without kinetin, except that amiben was less active with kinetin, while 2,3,6-trichlorobenzoic acid was more active with kinetin than alone. The weak auxin activity of NPA was confirmed. Transport experiments showed that NPA was the most inhibitory compound tested, followed by TIBA. Other compounds tested were at least 300 times less inhibitory to IAA transport. The best growth promoters were the least inhibitory to transport, and the most effective transport inhibitors were at best poor auxins. It is suggested that the weak auxin and auxin synergistic activity of TIBA (and perhaps 2,3-dichlorobenzoic acid) in extension growth tests arises from its inhibition of transport of endogenous or added auxin out of the sections, rather than from its intrinsic auxin activity. Chemically induced apolar callus growth on vascularized tobacco stem explants can arise from inhibition of native auxin transport, apolar growth stimulation by auxinic action of the test compound, or both. PMID:16656441

  7. Organic Anion Transporter 1 Is Inhibited by Multiple Mechanisms and Shows a Transport Mode Independent of Exchange.

    PubMed

    Hotchkiss, Adam G; Gao, Tiandai; Khan, Usman; Berrigan, Liam; Li, Mansong; Ingraham, Leslie; Pelis, Ryan M

    2015-12-01

    The mechanism by which drugs inhibit organic anion transporter 1 (OAT1) was examined. OAT1 was stably expressed in Chinese hamster ovary (CHO) cells, and para-aminohippurate (PAH) and 6-carboxyfluorescein were the substrates. Most compounds (10 of 14) inhibited competitively, increasing the Michaelis constant (Km) without affecting the maximal transport rate (Jmax). Others were mixed-type (lowering Jmax and increasing Km) or noncompetitive (lowering Jmax only) inhibitors. The interaction of a noncompetitive inhibitor (telmisartan) with OAT1 was examined further. Binding of telmisartan to OAT1 was observed, but translocation was not. Telmisartan did not alter the plasma membrane expression of OAT1, indicating that it lowers Jmax by reducing the turnover number. PAH transport after telmisartan treatment and its washout recovered faster in the presence of 10% fetal bovine serum in the washout buffer, indicating that binding of telmisartan to OAT1 and its inhibitory effect are reversible. Together, these data suggest that telmisartan binds reversibly to a site distinct from substrate and stabilizes the transporter in a conformation unfavorable for translocation. In the absence of an exchangeable extracellular substrate, PAH efflux from CHO-OAT1 cells was relatively rapid. Telmisartan slowed PAH efflux, suggesting that some transporter-mediated efflux occurs independent of exchange. Although drug-drug interaction predictions at OAT1 assume competitive inhibition, these data show that OAT1 can be inhibited by other mechanisms, which could influence the accuracy of drug-drug interaction predictions at the transporter. Telmisartan was useful for examining how a noncompetitive inhibitor can alter OAT1 transport activity and for uncovering a transport mode independent of exchange.

  8. Tuning transport selectivity of ionic species by phosphoric acid gradient in positively charged nanochannel membranes.

    PubMed

    Yang, Meng; Yang, Xiaohai; Wang, Kemin; Wang, Qing; Fan, Xin; Liu, Wei; Liu, Xizhen; Liu, Jianbo; Huang, Jin

    2015-02-03

    The transport of ionic species through a nanochannel plays important roles in fundamental research and practical applications of the nanofluidic device. Here, we demonstrated that ionic transport selectivity of a positively charged nanochannel membrane can be tuned under a phosphoric acid gradient. When phosphoric acid solution and analyte solution were connected by the positively charged nanochannel membrane, the faster-moving analyte through the positively charged nanochannel membrane was the positively charged dye (methylviologen, MV(2+)) instead of the negatively charged dye (1,5-naphthalene disulfonate, NDS(2-)). In other words, a reversed ion selectivity of the nanochannel membranes can be found. It can be explained as a result of the combination of diffusion, induced electroosmosis, and induced electrophoresis. In addition, the influencing factors of transport selectivity, including concentration of phosphoric acid, penetration time, and volume of feed solution, were also investigated. The results showed that the transport selectivity can further be tuned by adjusting these factors. As a method of tuning ionic transport selectivity by establishing phosphoric acid gradient, it will be conducive to improving the separation of ionic species.

  9. Ion transport mechanisms linked to bicarbonate secretion in the esophageal submucosal glands

    PubMed Central

    Nakhoul, Hani N.; Kalliny, Medhat I.; Gyftopoulos, Alex; Rabon, Edd; Doetjes, Rienk; Brown, Karen; Nakhoul, Nazih L.

    2011-01-01

    The esophageal submucosal glands (SMG) secrete HCO3− and mucus into the esophageal lumen, where they contribute to acid clearance and epithelial protection. This study characterized the ion transport mechanisms linked to HCO3− secretion in SMG. We localized ion transporters using immunofluorescence, and we examined their expression by RT-PCR and in situ hybridization. We measured HCO3− secretion by using pH stat and the isolated perfused esophagus. Using double labeling with Na+-K+-ATPase as a marker, we localized Na+-coupled bicarbonate transporter (NBCe1) and Cl−-HCO3− exchanger (SLC4A2/AE2) to the basolateral membrane of duct cells. Expression of cystic fibrosis transmembrane regulator channel (CFTR) was confirmed by immunofluorescence, RT-PCR, and in situ hybridization. We identified anion exchanger SLC26A6 at the ducts' luminal membrane and Na+-K+-2Cl− (NKCC1) at the basolateral membrane of mucous and duct cells. pH stat experiments showed that elevations in cAMP induced by forskolin or IBMX increased HCO3− secretion. Genistein, an activator of CFTR, which does not increase intracellular cAMP, also stimulated HCO3− secretion, whereas glibenclamide, a Cl− channel blocker, and bumetanide, a Na+-K+-2Cl− blocker, decreased it. CFTRinh-172, a specific CFTR channel blocker, inhibited basal HCO3− secretion as well as stimulation of HCO3− secretion by IBMX. This is the first report on the presence of CFTR channels in the esophagus. The role of CFTR in manifestations of esophageal disease in cystic fibrosis patients remains to be determined. PMID:21474426

  10. Ion transport mechanisms linked to bicarbonate secretion in the esophageal submucosal glands.

    PubMed

    Abdulnour-Nakhoul, Solange; Nakhoul, Hani N; Kalliny, Medhat I; Gyftopoulos, Alex; Rabon, Edd; Doetjes, Rienk; Brown, Karen; Nakhoul, Nazih L

    2011-07-01

    The esophageal submucosal glands (SMG) secrete HCO(3)(-) and mucus into the esophageal lumen, where they contribute to acid clearance and epithelial protection. This study characterized the ion transport mechanisms linked to HCO(3)(-) secretion in SMG. We localized ion transporters using immunofluorescence, and we examined their expression by RT-PCR and in situ hybridization. We measured HCO(3)(-) secretion by using pH stat and the isolated perfused esophagus. Using double labeling with Na(+)-K(+)-ATPase as a marker, we localized Na(+)-coupled bicarbonate transporter (NBCe1) and Cl(-)-HCO(3)(-) exchanger (SLC4A2/AE2) to the basolateral membrane of duct cells. Expression of cystic fibrosis transmembrane regulator channel (CFTR) was confirmed by immunofluorescence, RT-PCR, and in situ hybridization. We identified anion exchanger SLC26A6 at the ducts' luminal membrane and Na(+)-K(+)-2Cl(-) (NKCC1) at the basolateral membrane of mucous and duct cells. pH stat experiments showed that elevations in cAMP induced by forskolin or IBMX increased HCO(3)(-) secretion. Genistein, an activator of CFTR, which does not increase intracellular cAMP, also stimulated HCO(3)(-) secretion, whereas glibenclamide, a Cl(-) channel blocker, and bumetanide, a Na(+)-K(+)-2Cl(-) blocker, decreased it. CFTR(inh)-172, a specific CFTR channel blocker, inhibited basal HCO(3)(-) secretion as well as stimulation of HCO(3)(-) secretion by IBMX. This is the first report on the presence of CFTR channels in the esophagus. The role of CFTR in manifestations of esophageal disease in cystic fibrosis patients remains to be determined.

  11. Hepatic alterations are accompanied by changes to bile acid transporter-expressing neurons in the hypothalamus after traumatic brain injury

    PubMed Central

    Nizamutdinov, Damir; DeMorrow, Sharon; McMillin, Matthew; Kain, Jessica; Mukherjee, Sanjib; Zeitouni, Suzanne; Frampton, Gabriel; Bricker, Paul Clint S.; Hurst, Jacob; Shapiro, Lee A.

    2017-01-01

    Annually, there are over 2 million incidents of traumatic brain injury (TBI) and treatment options are non-existent. While many TBI studies have focused on the brain, peripheral contributions involving the digestive and immune systems are emerging as factors involved in the various symptomology associated with TBI. We hypothesized that TBI would alter hepatic function, including bile acid system machinery in the liver and brain. The results show activation of the hepatic acute phase response by 2 hours after TBI, hepatic inflammation by 6 hours after TBI and a decrease in hepatic transcription factors, Gli 1, Gli 2, Gli 3 at 2 and 24 hrs after TBI. Bile acid receptors and transporters were decreased as early as 2 hrs after TBI until at least 24 hrs after TBI. Quantification of bile acid transporter, ASBT-expressing neurons in the hypothalamus, revealed a significant decrease following TBI. These results are the first to show such changes following a TBI, and are compatible with previous studies of the bile acid system in stroke models. The data support the emerging idea of a systemic influence to neurological disorders and point to the need for future studies to better define specific mechanisms of action. PMID:28106051

  12. Aging mechanisms and service life of lead-acid batteries

    NASA Astrophysics Data System (ADS)

    Ruetschi, Paul

    In lead-acid batteries, major aging processes, leading to gradual loss of performance, and eventually to the end of service life, are: Anodic corrosion (of grids, plate-lugs, straps or posts). Positive active mass degradation and loss of adherence to the grid (shedding, sludging). Irreversible formation of lead sulfate in the active mass (crystallization, sulfation). Short-circuits. Loss of water. Aging mechanisms are often inter-dependent. For example, corrosion of the grids will lead to increased resistance to current flow, which will in turn impede proper charge of certain parts of the active mass, resulting in sulfation. Active mass degradation may lead to short-circuits. Sulfation may be the result of a loss of water, and so forth. The rates of the different aging processes strongly depend on the type of use (or misuse) of the battery. Over-charge will lead to accelerated corrosion and also to accelerated loss of water. With increasing depth-of-discharge during cycling, positive active mass degradation is accelerated. Some aging mechanisms are occurring only upon misuse. Short-circuits across the separators, due to the formation of metallic lead dendrites, for example, are usually formed only after (excessively) deep discharge. Stationary batteries, operated under float-charge conditions, will age typically by corrosion of the positive grids. On the other hand, service life of batteries subject to cycling regimes, will typically age by degradation of the structure of the positive active mass. Starter batteries are usually aging by grid corrosion, for instance in normal passenger car use. However, starter batteries of city buses, making frequent stops, may age (prematurely) by positive active mass degradation, because the batteries are subject to numerous shallow discharge cycles. Valve-regulated batteries often fail as a result of negative active mass sulfation, or water loss. For each battery design, and type of use, there is usually a characteristic

  13. Transport mechanisms in SnO2(N+)/SiO(x)/Si(n) solar cells

    NASA Astrophysics Data System (ADS)

    Chambouleyron, I.; Marques, F. C.

    This paper refers to the transport mechanisms in SnO2(n+)/SiO(x)/Si(n) solar cells. I vs V curves at dark and under varying illumination conditions were measured in the temperature range 296-372 K. Three transport mechanisms, occurring at different biases, that dominate the electrical behavior of the cells, are identified. At low forward bias the dominant mechanism is thermoionic field emission. At intermediate bias recombination mechanism predominates. Finally at high forward biases the dominant mechanism is diffusion.

  14. Reactive iron transport in an acidic mountain stream in Summit County, Colorado: A hydrologic perspective

    USGS Publications Warehouse

    McKnight, Diane M.; Bencala, K.E.

    1989-01-01

    A pH perturbation experiment was conducted in an acidic, metal-enriched, mountain stream to identify relative rates of chemical and hydrologic processes as they influence iron transport. During the experiment the pH was lowered from 4.2 to 3.2 for three hours by injection of sulfuric acid. Amorphous iron oxides are abundant on the streambed, and dissolution and photoreduction reactions resulted in a rapid increase in the dissolved iron concentration. The increase occurred simultaneously with the decrease in pH. Ferrous iron was the major aqueous iron species. The changes in the iron concentration during the experiment indicate that variation exists in the solubility properties of the hydrous iron oxides on the streambed with dissolution of at least two compartments of hydrous iron oxides contributing to the iron pulse. Spatial variations of the hydrologic properties along the stream were quantified by simulating the transport of a coinjected tracer, lithium. A simulation of iron transport, as a conservative solute, indicated that hydrologie transport had a significant role in determining downstream changes in the iron pulse. The rapidity of the changes in iron concentration indicates that a model based on dynamic equilibrium may be adequate for simulating iron transport in acid streams. A major challenge for predictive solute transport models of geochemical processes may be due to substantial spatial and seasonal variations in chemical properties of the reactive hydrous oxides in such streams, and in the physical and hydrologic properties of the stream. ?? 1989.

  15. Amyloid-β precursor protein: Multiple fragments, numerous transport routes and mechanisms.

    PubMed

    Muresan, Virgil; Ladescu Muresan, Zoia

    2015-05-15

    This review provides insight into the intraneuronal transport of the Amyloid-β Precursor Protein (APP), the prototype of an extensively posttranslationally modified and proteolytically cleaved transmembrane protein. Uncovering the intricacies of APP transport proves to be a challenging endeavor of cell biology research, deserving increased priority, since APP is at the core of the pathogenic process in Alzheimer's disease. After being synthesized in the endoplasmic reticulum in the neuronal soma, APP enters the intracellular transport along the secretory, endocytic, and recycling routes. Along these routes, APP undergoes cleavage into defined sets of fragments, which themselves are transported - mostly independently - to distinct sites in neurons, where they exert their functions. We review the currently known routes and mechanisms of transport of full-length APP, and of APP fragments, commenting largely on the experimental challenges posed by studying transport of extensively cleaved proteins. The review emphasizes the interrelationships between the proteolytic and posttranslational modifications, the intracellular transport, and the functions of the APP species. A goal remaining to be addressed in the future is the incorporation of the various views on APP transport into a coherent picture. In this review, the disease context is only marginally addressed; the focus is on the basic biology of APP transport under normal conditions. As shown, the studies of APP transport uncovered numerous mechanisms of transport, some of them conventional, and others, novel, awaiting exploration.

  16. Amino acid composition analysis of human secondary transport proteins and implications for reliable membrane topology prediction.

    PubMed

    Saidijam, Massoud; Azizpour, Sonia; Patching, Simon G

    2016-07-08

    Secondary transporters in humans are a large group of proteins that transport a wide range of ions, metals, organic and inorganic solutes involved in energy transduction, control of membrane potential and osmotic balance, metabolic processes and in the absorption or efflux of drugs and xenobiotics. They are also emerging as important targets for development of new drugs and as target sites for drug delivery to specific organs or tissues. We have performed amino acid composition (AAC) and phylogenetic analyses and membrane topology predictions for 336 human secondary transport proteins and used the results to confirm protein classification and to look for trends and correlations with structural domains and specific substrates and/or function. Some proteins showed statistically high contents of individual amino acids or of groups of amino acids with similar physicochemical properties. One recurring trend was a correlation between high contents of charged and/or polar residues with misleading results in predictions of membrane topology, which was especially prevalent in Mitochondrial Carrier family proteins. We demonstrate how charged or polar residues located in the middle of transmembrane helices can interfere with their identification by membrane topology tools resulting in missed helices in the prediction. Comparison of AAC in the human proteins with that in 235 secondary transport proteins from Escherichia coli revealed similar overall trends along with differences in average contents for some individual amino acids and groups of similar amino acids that are presumed to result from a greater number of functions and complexity in the higher organism.

  17. Mechanism of Paroxetine (Paxil) Inhibition of the Serotonin Transporter

    PubMed Central

    Davis, Bruce A.; Nagarajan, Anu; Forrest, Lucy R.; Singh, Satinder K.

    2016-01-01

    The serotonin transporter (SERT) is an integral membrane protein that exploits preexisting sodium-, chloride-, and potassium ion gradients to catalyze the thermodynamically unfavorable movement of synaptic serotonin into the presynaptic neuron. SERT has garnered significant clinical attention partly because it is the target of multiple psychoactive agents, including the antidepressant paroxetine (Paxil), the most potent selective serotonin reuptake inhibitor known. However, the binding site and orientation of paroxetine in SERT remain controversial. To provide molecular insight, we constructed SERT homology models based on the Drosophila melanogaster dopamine transporter and docked paroxetine to these models. We tested the predicted binding configurations with a combination of radioligand binding and flux assays on wild-type and mutant SERTs. Our data suggest that the orientation of paroxetine, specifically its fluorophenyl ring, in SERT’s substrate binding site directly depends on this pocket’s charge distribution, and thereby provide an avenue toward understanding and enhancing high-affinity antidepressant activity. PMID:27032980

  18. Transport effects due to particle erosion mechanisms. [in planetary rings

    NASA Technical Reports Server (NTRS)

    Durisen, R. H.

    1984-01-01

    Various processes can erode the surfaces of planetary ring particles. Recent estimates for Saturn's rings suggest that a centimeter-thick surface layer could be eroded from an isolated ring particle in less than 1000 yr by meteoroid impacts alone. The atoms, molecules, and chips ejected from ring particles by erosion will arc across the rings along elliptical orbits. For moderate ring optical depths, ejecta will be absorbed or inelastically scattered upon reintersecting the ring plane. Continuous exchange of ejecta between different ring regions can lead to net radial transport of mass and angular momentum, to changes in particle sizes, and to the buildup of chip regoliths several centimeters deep on the surfaces of ring particles. Because most of the erosional ejecta are not lost but merely exchanged over short distances, the net erosion rate of the surfaces of these ring particles will be much less than that estimated for an isolated particle. Numerical solutions for time-dependent ballistic transport under various assumptions suggest pile-up and spillover effects especially near regions of preexisting high optical depth contrast, such as the inner edges of A and B rings. Global redistribution could be significant over billions of years. Other features in planetary ring systems may be influenced by ballistic transport.

  19. The bacterial dicarboxylate transporter, VcINDY, uses a two-domain elevator-type mechanism

    PubMed Central

    Mulligan, Christopher; Fenollar-Ferrer, Cristina; Fitzgerald, Gabriel A.; Vergara-Jaque, Ariela; Kaufmann, Desirée; Li, Yan; Forrest, Lucy R.; Mindell, Joseph A.

    2016-01-01

    Secondary transporters use alternating access mechanisms to couple uphill substrate movement to downhill ion flux. Most known transporters utilize a “rocking bundle” motion, where the protein moves around an immobile substrate binding site. However, the glutamate transporter homolog, GltPh, translocates its substrate binding site vertically across the membrane, an “elevator” mechanism. Here, we used the “repeat swap” approach to computationally predict the outward-facing state of the Na+/succinate transporter VcINDY, from Vibrio cholerae. Our model predicts a substantial “elevator”-like movement of vcINDY’s substrate binding site, with a vertical translation of ~15 Å and a rotation of ~43°; multiple disulfide crosslinks which completely inhibit transport provide experimental confirmation and demonstrate that such movement is essential. In contrast, crosslinks across the VcINDY dimer interface preserve transport, revealing an absence of large scale coupling between protomers. PMID:26828963

  20. Sediment transport mechanisms through the sustainable vegetated flow networks

    NASA Astrophysics Data System (ADS)

    Allen, Deonie; Haynes, Heather; Arthur, Scott

    2016-04-01

    Understanding the pollution treatment efficiency of a sustainable urban drainage (SuDS) asset or network requires the influx, transport, detention and discharge of the pollutant within the system. To date event specific monitoring of sediment (primarily total suspended solids) concentrations in the inflow and discharge from SuDS have been monitored. Long term analysis of where the sediment is transported to and the residency time of this pollutant within the SuDS asset or network have not been unraveled due to the difficulty in monitoring specific sediment particulate movement. Using REO tracing methodology, sediment particulate movement has become possible. In tracing sediment movement from an urban surface the internal residency and transportation of this sediment has illustrated SuDS asset differences in multi-event detention. Of key importance is the finding that sediment remains within the SuDS asset for extended periods of time, but that the location sediment detention changes. Thus, over multiple rainfall-runoff events sediment is seen to move through the SuDS assets and network proving the assumption that detained sediment is permanent and stationary to be inaccurate. Furthermore, mass balance analysis of SuDS sediment indicates that there is notable re-suspension and ongoing release of sediment from the SuDS over time and cumulative rainfall-runoff events. Continued monitoring of sediment deposition and concentration in suspension illustrates that sediment detention within SuDS decreases over time/multiple events, without stabilizing within a 12 month period. Repeated experiments show a consistent pattern of detention and release for the three SuDS networks monitored in Scotland. Through consideration of both rainfall and flow factors the drivers of sediment transport within the monitored SuDS have been identified. Within the limitation of this field study the key drivers to SuDS sediment detention efficiency (or transport of sediment through the system

  1. Water transport mechanism through open capillaries analyzed by direct surface modifications on biological surfaces

    NASA Astrophysics Data System (ADS)

    Ishii, Daisuke; Horiguchi, Hiroko; Hirai, Yuji; Yabu, Hiroshi; Matsuo, Yasutaka; Ijiro, Kuniharu; Tsujii, Kaoru; Shimozawa, Tateo; Hariyama, Takahiko; Shimomura, Masatsugu

    2013-10-01

    Some small animals only use water transport mechanisms passively driven by surface energies. However, little is known about passive water transport mechanisms because it is difficult to measure the wettability of microstructures in small areas and determine the chemistry of biological surfaces. Herein, we developed to directly analyse the structural effects of wettability of chemically modified biological surfaces by using a nanoliter volume water droplet and a hi-speed video system. The wharf roach Ligia exotica transports water only by using open capillaries in its legs containing hair- and paddle-like microstructures. The structural effects of legs chemically modified with a self-assembled monolayer were analysed, so that the wharf roach has a smart water transport system passively driven by differences of wettability between the microstructures. We anticipate that this passive water transport mechanism may inspire novel biomimetic fluid manipulations with or without a gravitational field.

  2. Water transport mechanism through open capillaries analyzed by direct surface modifications on biological surfaces.

    PubMed

    Ishii, Daisuke; Horiguchi, Hiroko; Hirai, Yuji; Yabu, Hiroshi; Matsuo, Yasutaka; Ijiro, Kuniharu; Tsujii, Kaoru; Shimozawa, Tateo; Hariyama, Takahiko; Shimomura, Masatsugu

    2013-10-23

    Some small animals only use water transport mechanisms passively driven by surface energies. However, little is known about passive water transport mechanisms because it is difficult to measure the wettability of microstructures in small areas and determine the chemistry of biological surfaces. Herein, we developed to directly analyse the structural effects of wettability of chemically modified biological surfaces by using a nanoliter volume water droplet and a hi-speed video system. The wharf roach Ligia exotica transports water only by using open capillaries in its legs containing hair- and paddle-like microstructures. The structural effects of legs chemically modified with a self-assembled monolayer were analysed, so that the wharf roach has a smart water transport system passively driven by differences of wettability between the microstructures. We anticipate that this passive water transport mechanism may inspire novel biomimetic fluid manipulations with or without a gravitational field.

  3. Alpha-aminoisobutyric acid transport into human glia and glioma cells in culture.

    PubMed

    Ronquist, G; Agren, G; Ponten, J; Westermark, B

    1976-11-01

    The AIB transport into human glia and glioma cells in culture has been studied. Because of the high affinity of AIB to the plastic culture dishes, a special washing technique had to be developed. With this technique, it was possible to perform transport experiments in a single plate containing about one million cells. The cells were viable, intact and adhered to the supporting medium throughout the experiment. The AIB transport into both types of cells was Na+-dependent and showed saturation kinetics when the small component of the transport due to diffusion had been subtracted. The AIB transport capacity of neoplastic glioma cells was 3.6 times higher than that of glia cells. This difference was related to the Vmax-values for the two types of cells. The apparent Km-values were the same. Inhibition experiments with other amino acids support the view that AIB is transported via System A in both glia and glioma cells. Sulfhydryl reagents (ethacrynic acid and NEM) and cytochalasin B clearly inhibited the AIB transport into glia cells whereas the effect on glioma cells was minimal.

  4. Micro-electro-mechanical systems phosphoric acid fuel cell

    DOEpatents

    Sopchak, David A.; Morse, Jeffrey D.; Upadhye, Ravindra S.; Kotovsky, Jack; Graff, Robert T.

    2010-12-21

    A phosphoric acid fuel cell system comprising a porous electrolyte support, a phosphoric acid electrolyte in the porous electrolyte support, a cathode electrode contacting the phosphoric acid electrolyte, and an anode electrode contacting the phosphoric acid electrolyte.

  5. Micro-electro-mechanical systems phosphoric acid fuel cell

    DOEpatents

    Sopchak, David A.; Morse, Jeffrey D.; Upadhye, Ravindra S.; Kotovsky, Jack; Graff, Robert T.

    2010-08-17

    A phosphoric acid fuel cell system comprising a porous electrolyte support, a phosphoric acid electrolyte in the porous electrolyte support, a cathode electrode contacting the phosphoric acid electrolyte, and an anode electrode contacting the phosphoric acid electrolyte.

  6. Transport and metabolism of fumaric acid in Saccharomyces cerevisiae in aerobic glucose-limited chemostat culture.

    PubMed

    Shah, Mihir V; van Mastrigt, Oscar; Heijnen, Joseph J; van Gulik, Walter M

    2016-04-01

    Currently, research is being focused on the industrial-scale production of fumaric acid and other relevant organic acids from renewable feedstocks via fermentation, preferably at low pH for better product recovery. However, at low pH a large fraction of the extracellular acid is present in the undissociated form, which is lipophilic and can diffuse into the cell. There have been no studies done on the impact of high extracellular concentrations of fumaric acid under aerobic conditions in S. cerevisiae, which is a relevant issue to study for industrial-scale production. In this work we studied the uptake and metabolism of fumaric acid in S. cerevisiae in glucose-limited chemostat cultures at a cultivation pH of 3.0 (pH < pK). Steady states were achieved with different extracellular levels of fumaric acid, obtained by adding different amounts of fumaric acid to the feed medium. The experiments were carried out with the wild-type S. cerevisiae CEN.PK 113-7D and an engineered S. cerevisiae ADIS 244 expressing a heterologous dicarboxylic acid transporter (DCT-02) from Aspergillus niger, to examine whether it would be capable of exporting fumaric acid. We observed that fumaric acid entered the cells most likely via passive diffusion of the undissociated form. Approximately two-thirds of the fumaric acid in the feed was metabolized together with glucose. From metabolic flux analysis, an increased ATP dissipation was observed only at high intracellular concentrations of fumarate, possibly due to the export of fumarate via an ABC transporter. The implications of our results for the industrial-scale production of fumaric acid are discussed.

  7. Regulation of amino acid transport in isolated rat hepatocytes during development

    SciTech Connect

    Leoni, S.; Spagnuolo, S.; Dini, L.; Devirgiliis, L.C.

    1987-01-01

    The effect of amino acid depletion or supplementation and the effect of glucagon and insulin on the amino acid transport mediated by system A were investigated by determining the uptake of either 2-amino (1-/sup 14/C)isobutyric acid (AIB) or N-methyl 2-amino (1-/sup 14/C)isobutyric acid (MeAIB) in rat hepatocytes, freshly isolated at different stages of pre- and postnatal development. The data obtained show that the Na/sup +/ -dependent uptake was higher at the earliest developmental stages, and steadily decreased until the adult level. The hormones increased AIB and MeAIB uptake enhancing the V/sub max/, while the K/sub m/ was unchanged. This effect was evident in cells from adult and 18-20-day-old fetuses, while no response was present before the 18th day of fetal life and in the prenatal period. Actinomycin D or cycloheximide abolished this hormone-dependent increase. A decrease in AIB and MeAIB transport after incubation in an amino acid-rich medium was demonstrated at all ages tested, but was particularly evident in the prenatal life. The increase in the activity of the system following amino acid starvation was shown to be mostly dependent from de novo protein synthesis in the fetal life; on the contrary in the adult the increase appeared to be more linked to the release from transinhibition of the transport.

  8. Mechanisms of triglyceride metabolism in patients with bile acid diarrhea

    PubMed Central

    Sagar, Nidhi Midhu; McFarlane, Michael; Nwokolo, Chuka; Bardhan, Karna Dev; Arasaradnam, Ramesh Pulendran

    2016-01-01

    Bile acids (BAs) are essential for the absorption of lipids. BA synthesis is inhibited through intestinal farnesoid X receptor (FXR) activity. BA sequestration is known to influence BA metabolism and control serum lipid concentrations. Animal data has demonstrated a regulatory role for the FXR in triglyceride metabolism. FXR inhibits hepatic lipogenesis by inhibiting the expression of sterol regulatory element binding protein 1c via small heterodimer primer activity. Conversely, FXR promotes free fatty acids oxidation by inducing the expression of peroxisome proliferator-activated receptor α. FXR can reduce the expression of microsomal triglyceride transfer protein, which regulates the assembly of very low-density lipoproteins (VLDL). FXR activation in turn promotes the clearance of circulating triglycerides by inducing apolipoprotein C-II, very low-density lipoproteins receptor (VLDL-R) and the expression of Syndecan-1 together with the repression of apolipoprotein C-III, which increases lipoprotein lipase activity. There is currently minimal clinical data on triglyceride metabolism in patients with bile acid diarrhoea (BAD). Emerging data suggests that a third of patients with BAD have hypertriglyceridemia. Further research is required to establish the risk of hypertriglyceridaemia in patients with BAD and elicit the mechanisms behind this, allowing for targeted treatment. PMID:27570415

  9. Boric acid inhibits embryonic histone deacetylases: a suggested mechanism to explain boric acid-related teratogenicity.

    PubMed

    Di Renzo, Francesca; Cappelletti, Graziella; Broccia, Maria L; Giavini, Erminio; Menegola, Elena

    2007-04-15

    Histone deacetylases (HDAC) control gene expression by changing histonic as well as non histonic protein conformation. HDAC inhibitors (HDACi) are considered to be among the most promising drugs for epigenetic treatment for cancer. Recently a strict relationship between histone hyperacetylation in specific tissues of mouse embryos exposed to two HDACi (valproic acid and trichostatin A) and specific axial skeleton malformations has been demonstrated. The aim of this study is to verify if boric acid (BA), that induces in rodents malformations similar to those valproic acid and trichostatin A-related, acts through similar mechanisms: HDAC inhibition and histone hyperacetylation. Pregnant mice were treated intraperitoneally with a teratogenic dose of BA (1000 mg/kg, day 8 of gestation). Western blot analysis and immunostaining were performed with anti hyperacetylated histone 4 (H4) antibody on embryos explanted 1, 3 or 4 h after treatment and revealed H4 hyperacetylation at the level of somites. HDAC enzyme assay was performed on embryonic nuclear extracts. A significant HDAC inhibition activity (compatible with a mixed type partial inhibition mechanism) was evident with BA. Kinetic analyses indicate that BA modifies substrate affinity by a factor alpha=0.51 and maximum velocity by a factor beta=0.70. This work provides the first evidence for HDAC inhibition by BA and suggests such a molecular mechanism for the induction of BA-related malformations.

  10. Boric acid inhibits embryonic histone deacetylases: A suggested mechanism to explain boric acid-related teratogenicity

    SciTech Connect

    Di Renzo, Francesca; Cappelletti, Graziella; Broccia, Maria L.; Giavini, Erminio; Menegola, Elena . E-mail: elena.menegola@unimi.it

    2007-04-15

    Histone deacetylases (HDAC) control gene expression by changing histonic as well as non histonic protein conformation. HDAC inhibitors (HDACi) are considered to be among the most promising drugs for epigenetic treatment for cancer. Recently a strict relationship between histone hyperacetylation in specific tissues of mouse embryos exposed to two HDACi (valproic acid and trichostatin A) and specific axial skeleton malformations has been demonstrated. The aim of this study is to verify if boric acid (BA), that induces in rodents malformations similar to those valproic acid and trichostatin A-related, acts through similar mechanisms: HDAC inhibition and histone hyperacetylation. Pregnant mice were treated intraperitoneally with a teratogenic dose of BA (1000 mg/kg, day 8 of gestation). Western blot analysis and immunostaining were performed with anti hyperacetylated histone 4 (H4) antibody on embryos explanted 1, 3 or 4 h after treatment and revealed H4 hyperacetylation at the level of somites. HDAC enzyme assay was performed on embryonic nuclear extracts. A significant HDAC inhibition activity (compatible with a mixed type partial inhibition mechanism) was evident with BA. Kinetic analyses indicate that BA modifies substrate affinity by a factor {alpha} = 0.51 and maximum velocity by a factor {beta} = 0.70. This work provides the first evidence for HDAC inhibition by BA and suggests such a molecular mechanism for the induction of BA-related malformations.

  11. Salmonella infection inhibits intestinal biotin transport: cellular and molecular mechanisms.

    PubMed

    Ghosal, Abhisek; Jellbauer, Stefan; Kapadia, Rubina; Raffatellu, Manuela; Said, Hamid M

    2015-07-15

    Infection with the nontyphoidal Salmonella is a common cause of food-borne disease that leads to acute gastroenteritis/diarrhea. Severe/prolonged cases of Salmonella infection could also impact host nutritional status, but little is known about its effect on intestinal absorption of vitamins, including biotin. We examined the effect of Salmonella enterica serovar Typhimurium (S. typhimurium) infection on intestinal biotin uptake using in vivo (streptomycin-pretreated mice) and in vitro [mouse (YAMC) and human (NCM460) colonic epithelial cells, and human intestinal epithelial Caco-2 cells] models. The results showed that infecting mice with wild-type S. typhimurium, but not with its nonpathogenic isogenic invA spiB mutant, leads to a significant inhibition in jejunal/colonic biotin uptake and in level of expression of the biotin transporter, sodium-dependent multivitamin transporter. In contrast, infecting YAMC, NCM460, and Caco-2 cells with S. typhimurium did not affect biotin uptake. These findings suggest that the effect of S. typhimurium infection is indirect and is likely mediated by proinflammatory cytokines, the levels of which were markedly induced in the intestine of S. typhimurium-infected mice. Consistent with this hypothesis, exposure of NCM460 cells to the proinflammatory cytokines TNF-α and IFN-γ led to a significant inhibition of biotin uptake, sodium-dependent multivitamin transporter expression, and activity of the SLC5A6 promoter. The latter effects appear to be mediated, at least in part, via the NF-κB signaling pathway. These results demonstrate that S. typhimurium infection inhibits intestinal biotin uptake, and that the inhibition is mediated via the action of proinflammatory cytokines.

  12. Salmonella infection inhibits intestinal biotin transport: cellular and molecular mechanisms

    PubMed Central

    Ghosal, Abhisek; Jellbauer, Stefan; Kapadia, Rubina; Raffatellu, Manuela

    2015-01-01

    Infection with the nontyphoidal Salmonella is a common cause of food-borne disease that leads to acute gastroenteritis/diarrhea. Severe/prolonged cases of Salmonella infection could also impact host nutritional status, but little is known about its effect on intestinal absorption of vitamins, including biotin. We examined the effect of Salmonella enterica serovar Typhimurium (S. typhimurium) infection on intestinal biotin uptake using in vivo (streptomycin-pretreated mice) and in vitro [mouse (YAMC) and human (NCM460) colonic epithelial cells, and human intestinal epithelial Caco-2 cells] models. The results showed that infecting mice with wild-type S. typhimurium, but not with its nonpathogenic isogenic invA spiB mutant, leads to a significant inhibition in jejunal/colonic biotin uptake and in level of expression of the biotin transporter, sodium-dependent multivitamin transporter. In contrast, infecting YAMC, NCM460, and Caco-2 cells with S. typhimurium did not affect biotin uptake. These findings suggest that the effect of S. typhimurium infection is indirect and is likely mediated by proinflammatory cytokines, the levels of which were markedly induced in the intestine of S. typhimurium-infected mice. Consistent with this hypothesis, exposure of NCM460 cells to the proinflammatory cytokines TNF-α and IFN-γ led to a significant inhibition of biotin uptake, sodium-dependent multivitamin transporter expression, and activity of the SLC5A6 promoter. The latter effects appear to be mediated, at least in part, via the NF-κB signaling pathway. These results demonstrate that S. typhimurium infection inhibits intestinal biotin uptake, and that the inhibition is mediated via the action of proinflammatory cytokines. PMID:25999427

  13. Docosahexaenoic Acid Reduces Amyloid β Production via Multiple Pleiotropic Mechanisms*

    PubMed Central

    Grimm, Marcus O. W.; Kuchenbecker, Johanna; Grösgen, Sven; Burg, Verena K.; Hundsdörfer, Benjamin; Rothhaar, Tatjana L.; Friess, Petra; de Wilde, Martijn C.; Broersen, Laus M.; Penke, Botond; Péter, Mária; Vígh, László; Grimm, Heike S.; Hartmann, Tobias

    2011-01-01

    Alzheimer disease is characterized by accumulation of the β-amyloid peptide (Aβ) generated by β- and γ-secretase processing of the amyloid precursor protein (APP). The intake of the polyunsaturated fatty acid docosahexaenoic acid (DHA) has been associated with decreased amyloid deposition and a reduced risk in Alzheimer disease in several epidemiological trials; however, the exact underlying molecular mechanism remains to be elucidated. Here, we systematically investigate the effect of DHA on amyloidogenic and nonamyloidogenic APP processing and the potential cross-links to cholesterol metabolism in vivo and in vitro. DHA reduces amyloidogenic processing by decreasing β- and γ-secretase activity, whereas the expression and protein levels of BACE1 and presenilin1 remain unchanged. In addition, DHA increases protein stability of α-secretase resulting in increased nonamyloidogenic processing. Besides the known effect of DHA to decrease cholesterol de novo synthesis, we found cholesterol distribution in plasma membrane to be altered. In the presence of DHA, cholesterol shifts from raft to non-raft domains, and this is accompanied by a shift in γ-secretase activity and presenilin1 protein levels. Taken together, DHA directs amyloidogenic processing of APP toward nonamyloidogenic processing, effectively reducing Aβ release. DHA has a typical pleiotropic effect; DHA-mediated Aβ reduction is not the consequence of a single major mechanism but is the result of combined multiple effects. PMID:21324907

  14. Physiological and molecular responses of the goldfish (Carassius auratus) kidney to metabolic acidosis, and potential mechanisms of renal ammonia transport.

    PubMed

    Lawrence, Michael J; Wright, Patricia A; Wood, Chris M

    2015-07-01

    Relative to the gills, the mechanisms by which the kidney contributes to ammonia and acid-base homeostasis in fish are poorly understood. Goldfish were exposed to a low pH environment (pH 4.0, 48 h), which induced a characteristic metabolic acidosis and an increase in total plasma [ammonia] but reduced plasma ammonia partial pressure (PNH3). In the kidney tissue, total ammonia, lactate and intracellular pH remained unchanged. The urinary excretion rate of net base under control conditions changed to net acid excretion under low pH, with contributions from both the NH4 (+) (∼30%) and titratable acidity minus bicarbonate (∼70%; TA-HCO3 (-)) components. Inorganic phosphate (Pi), urea and Na(+) excretion rates were also elevated while Cl(-) excretion rates were unchanged. Renal alanine aminotransferase activity increased under acidosis. The increase in renal ammonia excretion was due to significant increases in both the glomerular filtration and the tubular secretion rates of ammonia, with the latter accounting for ∼75% of the increase. There was also a 3.5-fold increase in the mRNA expression of renal Rhcg-b (Rhcg1) mRNA. There was no relationship between ammonia secretion and Na(+) reabsorption. These data indicate that increased renal ammonia secretion during acidosis is probably mediated through Rhesus (Rh) glycoproteins and occurs independently of Na(+) transport, in contrast to branchial and epidermal models of Na(+)-dependent ammonia transport in freshwater fish. Rather, we propose a model of parallel H(+)/NH3 transport as the primary mechanism of renal tubular ammonia secretion that is dependent on renal amino acid catabolism.

  15. Glycinergic-Fipronil Uptake Is Mediated by an Amino Acid Carrier System and Induces the Expression of Amino Acid Transporter Genes in Ricinus communis Seedlings.

    PubMed

    Xie, Yun; Zhao, Jun-Long; Wang, Chuan-Wei; Yu, Ai-Xin; Liu, Niu; Chen, Li; Lin, Fei; Xu, Han-Hong

    2016-05-18

    Phloem-mobile insecticides are efficient for piercing and sucking insect control. Introduction of sugar or amino acid groups to the parent compound can improve the phloem mobility of insecticides, so a glycinergic-fipronil conjugate (GlyF), 2-(3-(3-cyano-1-(2,6-dichloro-4-(trifluoromethyl)phenyl)-4-((trifluoromethyl)sulfinyl)-1H-pyrazole-5-yl)ureido) acetic acid, was designed and synthesized. Although the "Kleier model" predicted that this conjugate is not phloem mobile, GlyF can be continually detected during a 5 h collection of Ricinus communis phloem sap. Furthermore, an R. communis seedling cotyledon disk uptake experiment demonstrates that the uptake of GlyF is sensitive to pH, carbonyl cyanide m-chlorophenylhydrazone (CCCP), temperature, and p-chloromercuribenzenesulfonic acid (pCMBS) and is likely mediated by amino acid carrier system. To explore the roles of amino acid transporters (AATs) in GlyF uptake, a total of 62 AAT genes were identified from the R. communis genome in silico. Phylogenetic analysis revealed that AATs in R. communis were organized into the ATF (amino acid transporter) and APC (amino acid, polyaminem and choline transporter) superfamilies, with five subfamilies in ATF and two in APC. Furthermore, the expression profiles of 20 abundantly expressed AATs (cycle threshold (Ct) values <27) were analyzed at 1, 3, and 6 h after GlyF treatment by RT-qPCR. The results demonstrated that expression levels of four AAT genes, RcLHT6, RcANT15, RcProT2, and RcCAT2, were induced by the GlyF treatment in R. communis seedlings. On the basis of the observation that the expression profile of the four candidate genes is similar to the time course observation for GlyF foliar disk uptake, it is suggested that those four genes are possible candidates involved in the uptake of GlyF. These results contribute to a better understanding of the mechanism of GlyF uptake as well as phloem loading from a molecular biology perspective and facilitate functional

  16. ALMA Binary Data Transport Mechanism using VOTable Headers

    NASA Astrophysics Data System (ADS)

    Wicenec, A.; Meuss, H.; Pisano, J.

    2006-07-01

    ALMA will produce very large data rates and volumes. In full operation the correlator will generate up to 60 MB/s of visibility data. These data have to be transported from the correlator on the high site (5000 m) to the ALMA archive, the telescope calibration and the quick-look subsystems, which are all located at the low site (2500 m) some 40 km away. A dedicated fiber connection between the sites is under construction and the interfaces between the subsystems are under development. The actual transport format produced by the correlator has been defined and implemented and is described in this paper in more detail. The format is derived from the SOAP with attachments [1], but instead of the SOAP XML envelope it is using a slightly modified VOTable [2] to keep the description of the binary data. The VOTable uses content ID pointers (CID, RFC2111 [3]) to refer to the binary parts contained in the same Multipart/Related (RFC2387 [4]) container. Such Multipart/Related containers are constructed for each ALMA integration and sent through a multimedia streaming connection implemented in CORBA (TAO[5, 6]).

  17. Transport mechanisms in conducting polymers: do general behaviours exis

    NASA Astrophysics Data System (ADS)

    Travers, J. P.

    1998-06-01

    We review several studies of transport properties of conducting polymers (CP) as a function of a parameter related to their structure or microstructure. We show that in strongly disordered CP, electron transport is dominated by hopping between conducting grains separated by insulating barriers. Although the nature of the metal-insulator transition is still a controversial topic in weakly disordered CP, several results indicate that heterogeneities play an important role. Thus heterogeneous disorder seems to control the conductivity of a large majority of CP. Plusieurs études sur la conductivité des polymères conducteurs (PC) en relation avec la microstructure sont rassemblées. Dans les PC très désordonnés, les sauts entre grains conducteurs séparés par des barrières isolantes dominent la conduction. Bien que la situation soit moins claire dans les PC peu désordonnés, des résultats indiquent que les hétérogénéités y jouent un rôle important. Ainsi, le désordre de nature hétérogène semble contrôler la conductivité de la grande majorité des PC.

  18. Turbulence elasticity—A new mechanism for transport barrier dynamics

    NASA Astrophysics Data System (ADS)

    Guo, Z. B.; Diamond, P. H.; Kosuga, Y.; Gürcan, Ö. D.

    2014-09-01

    We present a new, unified model of transport barrier formation in "elastic" drift wave-zonal flow (DW-ZF) turbulence. A new physical quantity—the delay time (i.e., the mixing time for the DW turbulence)—is demonstrated to parameterize each stage of the transport barrier formation. Quantitative predictions for the onset of limit-cycle-oscillation (LCO) among DW and ZF intensities (also denoted as I-mode) and I-mode to high-confinement mode (H-mode) transition are also given. The LCO occurs when the ZF shearing rate (|ZF'|) enters the regime Δωk<|ZF'|<τcr-1, where Δωk is the local turbulence decorrelation rate and τcr is the threshold delay time. In the basic predator-prey feedback system, τcr is also derived. The I-H transition occurs when |E ×B'|>τcr-1, where the mean E × B shear flow driven by ion pressure "locks" the DW-ZF system to the H-mode by reducing the delay time below the threshold value.

  19. Angler awareness of aquatic nuisance species and potential transport mechanisms

    USGS Publications Warehouse

    Gates, K.K.; Guy, C.S.; Zale, A.V.; Horton, T.B.

    2009-01-01

    The role anglers play in transporting aquatic nuisance species (ANS) is important in managing infestations and preventing introductions. The objectives of this study were to: (1) quantify angler movement patterns in southwestern Montana, ANS awareness and equipment cleaning practices; and (2) quantify the amount of soil transported on boots and waders. Mean distance travelled by residents from their home to the survey site was 115 km (??17, 95% CI). Mean distance travelled by non-residents was 1738 km (??74). Fifty-one percent of residents and 49% of non-residents reported occasionally, rarely or never cleaning their boots and waders between uses. Mean weight of soil carried on one boot leg was 8.39 g (??1.50). Movement and equipment cleaning practices of anglers in southwestern Montana suggest that future control of ANS dispersal may require restricting the use of felt-soled wading boots, requiring river-specific wading equipment or providing cleaning stations and requiring their use. ?? 2009 Blackwell Publishing Ltd.

  20. Turbulence elasticity—A new mechanism for transport barrier dynamics

    SciTech Connect

    Guo, Z. B.; Diamond, P. H.; Kosuga, Y.; Gürcan, Ö. D.

    2014-09-15

    We present a new, unified model of transport barrier formation in “elastic” drift wave-zonal flow (DW-ZF) turbulence. A new physical quantity—the delay time (i.e., the mixing time for the DW turbulence)—is demonstrated to parameterize each stage of the transport barrier formation. Quantitative predictions for the onset of limit-cycle-oscillation (LCO) among DW and ZF intensities (also denoted as I-mode) and I-mode to high-confinement mode (H-mode) transition are also given. The LCO occurs when the ZF shearing rate (|〈v〉{sub ZF}{sup ′}|) enters the regime Δω{sub k}<|〈V〉{sub ZF}{sup ′}|<τ{sub cr}{sup −1}, where Δω{sub k} is the local turbulence decorrelation rate and τ{sub cr} is the threshold delay time. In the basic predator-prey feedback system, τ{sub cr} is also derived. The I-H transition occurs when |〈V〉{sub E×B}{sup ′}|>τ{sub cr}{sup −1}, where the mean E × B shear flow driven by ion pressure “locks” the DW-ZF system to the H-mode by reducing the delay time below the threshold value.

  1. The altered glucose metabolism in tumor and a tumor acidic microenvironment associated with extracellular matrix metalloproteinase inducer and monocarboxylate transporters

    PubMed Central

    Li, Xiaofeng; Yu, Xiaozhou; Dai, Dong; Song, Xiuyu; Xu, Wengui

    2016-01-01

    Extracellular matrix metalloproteinase inducer, also knowns as cluster of differentiation 147 (CD147) or basigin, is a widely distributed cell surface glycoprotein that is involved in numerous physiological and pathological functions, especially in tumor invasion and metastasis. Monocarboxylate transporters (MCTs) catalyze the proton-linked transport of monocarboxylates such as L-lactate across the plasma membrane to preserve the intracellular pH and maintain cell homeostasis. As a chaperone to some MCT isoforms, CD147 overexpression significantly contributes to the metabolic transformation of tumor. This overexpression is characterized by accelerated aerobic glycolysis and lactate efflux, and it eventually provides the tumor cells with a metabolic advantage and an invasive phenotype in the acidic tumor microenvironment. This review highlights the roles of CD147 and MCTs in tumor cell metabolism and the associated molecular mechanisms. The regulation of CD147 and MCTs may prove to be with a therapeutic potential for tumors through the metabolic modification of the tumor microenvironment. PMID:27009812

  2. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  3. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  4. Identification of a Novel Regulatory Mechanism of Nutrient Transport Controlled by TORC1-Npr1-Amu1/Par32

    PubMed Central

    Boeckstaens, Mélanie; Merhi, Ahmad; Llinares, Elisa; Van Vooren, Pascale; Springael, Jean-Yves; Wintjens, René; Marini, Anna Maria

    2015-01-01

    Fine-tuning the plasma-membrane permeability to essential nutrients is fundamental to cell growth optimization. Nutritional signals including nitrogen availability are integrated by the TORC1 complex which notably regulates arrestin-mediated endocytosis of amino-acid transporters. Ammonium is a ubiquitous compound playing key physiological roles in many, if not all, organisms. In yeast, it is a preferred nitrogen source transported by three Mep proteins which are orthologues of the mammalian Rhesus factors. By combining genetic, kinetic, biochemical and cell microscopy analyses, the current study reveals a novel mechanism enabling TORC1 to regulate the inherent activity of ammonium transport proteins, independently of arrestin-mediated endocytosis, identifying the still functional orphan Amu1/Par32 as a selective regulator intermediate. We show that, under poor nitrogen supply, the TORC1 effector kinase' Npr1' promotes phosphorylation of Amu1/Par32 which appears mainly cytosolic while ammonium transport proteins are active. Upon preferred nitrogen supplementation, like glutamine or ammonium addition, TORC1 upregulation enables Npr1 inhibition and Amu1/Par32 dephosphorylation. In these conditions, as in Npr1-lacking cells, hypophosphorylated Amu1/Par32 accumulates at the cell surface and mediates the inhibition of specific ammonium transport proteins. We show that the integrity of a conserved repeated motif of Amu1/Par32 is required for the interaction with these transport proteins. This study underscores the diversity of strategies enabling TORC1-Npr1 to selectively monitor cell permeability to nutrients by discriminating between transporters to be degraded or transiently inactivated and kept stable at the plasma membrane. This study further identifies the function of Amu1/Par32 in acute control of ammonium transport in response to variations in nitrogen availability. PMID:26172854

  5. Inhibition by Levorphanol and Related Drugs of Amino Acid Transport by Isolated Membrane Vesicles from Escherichia coli

    PubMed Central

    Holland, Mary J. C.; Simon, Eric J.

    1975-01-01

    Levorphanol inhibits the transport of the amino acids proline and lysine by cytoplasmic membrane vesicles derived from Escherichia coli. The degree of inhibition increases with increasing levorphanol concentration and ranges from 26% at 10−6 M levorphanol to 92% at 10−3 M levorphanol. The effect is independent of the energy source, since levorphanol inhibits proline uptake to the same extent in the presence of 20 mM d-lactate or 20 mM succinate and in the absence of an exogenous energy source. Levorphanol does not irreversibly alter the ability of membrane vesicles to transport proline, since incubation of membrane vesicles for 15 min in the presence of 0.25 mM levorphanol, a concentration which inhibits proline transport by more than 75%, has no effect on the rate of proline transport by these vesicles once the drug is removed. Both the maximum velocity and the Km of proline transport are modified by levorphanol, hence, the type of inhibition produced by levorphanol is mixed. The inhibitor constant (Ki) for levorphanol inhibition of proline transport is approximately 3 × 10−4 M. Membrane vesicles incubated in the presence of levorphanol accumulate much less proline at the steady state than do control vesicles. Furthermore, the addition of levorphanol to membrane vesicles preloaded to the steady state with proline produces a marked net efflux of proline. Levorphanol does not block either temperature-induced efflux or exchange of external proline with [14C]proline present in the intravesicular pool. Dextrorphan, the enantiomorph of levorphanol, and levallorphan, the N-allyl analogue of levorphanol, inhibit proline and lysine transport in a similar manner. Possible mechanisms of the effects of these drugs on cell membranes are discussed. PMID:1096802

  6. Aromatic amino acid transporter AAT-9 of Caenorhabditis elegans localizes to neurons and muscle cells.

    PubMed

    Veljkovic, Emilija; Bacconi, Andrea; Stetak, Attila; Hajnal, Alex; Stasiuk, Susan; Skelly, Patrick J; Forster, Ian; Shoemaker, Charles B; Verrey, Francois

    2004-11-19

    The Caenorhabditis elegans genome encodes nine homologues of mammalian glycoprotein-associated amino acid transporters. Two of these C. elegans proteins (AAT-1 and AAT-3) have been shown to function as catalytic subunits (light chains) of heteromeric amino acid transporters. These proteins need to associate with a glycoprotein heavy chain subunit (ATG-2) to reach the cell surface in a manner similar to that of their mammalian homologues. AAT-1 and AAT-3 contain a cysteine residue in the second putative extracellular loop through which a disulfide bridge can form with a heavy chain. In contrast, six C. elegans members of this family (AAT-4 to AAT-9) lack such a cysteine residue. We show here that one of these transporter proteins, AAT-9, reaches the cell surface in Xenopus oocytes without an exogenous heavy chain and that it functions as an exchanger of aromatic amino acids. Two-electrode voltage clamp experiments demonstrate that AAT-9 displays a substrate-activated conductance. Immunofluorescence shows that it is expressed close to the pharyngeal bulbs within C. elegans neurons. The selective expression of an aat-9 promoter-green fluorescent protein construct in several neurons of this region and in wall muscle cells around the mouth supports and extends these localization data. Taken together, the results show that AAT-9 is expressed in excitable cells of the nematode head and pharynx in which it may provide a pathway for aromatic amino acid transport.

  7. The role of membrane fatty-acid transporters in regulating skeletal muscle substrate use during exercise.

    PubMed

    Pelsers, Maurice M A L; Stellingwerff, Trent; van Loon, Luc J C

    2008-01-01

    While endogenous carbohydrates form the main substrate source during high-intensity exercise, long-chain fatty acids (LCFA) represent the main substrate source during more prolonged low- to moderate-intensity exercise. Adipose tissue lipolysis is responsible for the supply of LCFA to the contracting muscle. Once taken up by skeletal muscle tissue, LCFA can either serve as a substrate for oxidative phosphorylation or can be directed towards esterification into triacylglycerol. Myocellular uptake of LCFA comprises a complex and incompletely understood process. Although LCFA can enter the cell via passive diffusion, more recent reports indicate that LCFA uptake is tightly regulated by plasma membrane-located transport proteins (fatty acid translocase [FAT/CD36], plasmalemmal-located fatty acid binding protein [FABPpm] and fatty acid transport protein [FATP]). Depending on cardiac and skeletal muscle energy demands, some of these LCFA transporters can translocate rapidly from intracellular pools to the plasma membrane to allow greater LCFA uptake. This translocation process can be induced by insulin and/or muscle contraction. However, the precise signalling pathways responsible for activating the translocation machinery remain to be elucidated. This article will provide an overview on the effects of diet, acute exercise and exercise training on the expression and/or translocation of the various LCFA transporters in skeletal muscle tissue (FAT/CD36, FABPpm, FATP).

  8. Guide to innovative financing mechanisms for mass transportation: an update

    SciTech Connect

    Not Available

    1985-12-01

    The document provides an overview of nonstandard techniques currently being used to finance transit capital and operating expenses. An update of a study, the report focused on six types of mechanisms: assessments, taxes and user charges, use of property and property rights, issuance of debt, contracted services, and voluntary participation programs. A new section, Initiatives and Ideas, discusses local funding of community services like Montgomery County, Maryland's Ride On, franchise approaches, and nonsubsidized bus and vanpool services. The report is structured in two independant parts: the first describes the theoretical background of each technique, and is keyed to a second part, which describes typical applications of the mechanism.

  9. Recent Advances in Understanding Amino Acid Sensing Mechanisms that Regulate mTORC1

    PubMed Central

    Zheng, Liufeng; Zhang, Wei; Zhou, Yuanfei; Li, Fengna; Wei, Hongkui; Peng, Jian

    2016-01-01

    The mammalian target of rapamycin (mTOR) is the central regulator of mammalian cell growth, and is essential for the formation of two structurally and functionally distinct complexes: mTORC1 and mTORC2. mTORC1 can sense multiple cues such as nutrients, energy status, growth factors and hormones to control cell growth and proliferation, angiogenesis, autophagy, and metabolism. As one of the key environmental stimuli, amino acids (AAs), especially leucine, glutamine and arginine, play a crucial role in mTORC1 activation, but where and how AAs are sensed and signal to mTORC1 are not fully understood. Classically, AAs activate mTORC1 by Rag GTPases which recruit mTORC1 to lysosomes, where AA signaling initiates. Plasma membrane transceptor L amino acid transporter 1 (LAT1)-4F2hc has dual transporter-receptor function that can sense extracellular AA availability upstream of mTORC1. The lysosomal AA sensors (PAT1 and SLC38A9) and cytoplasmic AA sensors (LRS, Sestrin2 and CASTOR1) also participate in regulating mTORC1 activation. Importantly, AAs can be sensed by plasma membrane receptors, like G protein-coupled receptor (GPCR) T1R1/T1R3, and regulate mTORC1 without being transported into the cells. Furthermore, AA-dependent mTORC1 activation also initiates within Golgi, which is regulated by Golgi-localized AA transporter PAT4. This review provides an overview of the research progress of the AA sensing mechanisms that regulate mTORC1 activity. PMID:27690010

  10. The transport of indole-3-acetic Acid in boron- and calcium-deficient sunflower hypocotyl segments.

    PubMed

    Tang, P M; Dela Fuente, R K

    1986-06-01

    Transfer of sunflower (Helianthus annuus L. cv Russian Mammoth) seedlings from complete nutrient solution to solutions deficient in either boron or calcium resulted in a steady decline in the rate of auxin transport, compared to seedlings that remained in the complete solution. In seedlings transferred to solutions deficient in both B and Ca, the decline in auxin transport was greater than seedlings deficient in only one element. The transfer of B- or Ca-deficient seedlings back to the complete solution prevented further decline in auxin transport, but auxin transport did not increase to the same level as seedlings maintained in complete solution. The significant reduction in auxin transport during the early stages of B or Ca deficiency was not related to (a) reduced growth rate of the hypocotyl, (b) increased acropetal movement of auxin, or (c) lack of respiratory substrates in the hypocotyl. In addition, no difference was found in the water-extractable total and ionic Ca in B-deficient and control nondeficient hypocotyls, indicating a direct effect of B on auxin transport, rather than indirectly by affecting Ca absorption. The rate of auxin transport in hypocotyls deficient in either B or Ca, was inversely correlated with K(+) leakage and rate of respiration. The data presented strongly support the view that there are separate sites for B and Ca in the basipetal transport of the plant hormone indoleacetic acid.

  11. Urinary solute transport by ileal segments. I. Effects of nicotinic acid.

    PubMed

    Martínez-Piñeiro, L; Mateos, F; Montero, A; Madero, R; Martínez-Piñeiro, J A

    1993-12-01

    This study was conducted to quantify urinary solute transport by the ileum, using an in vivo human model, and to determine the effect of nicotinic acid on this process. Patients were studied under both basal conditions and niacin therapy. The rates of solute transport were established by analysis of excretion indexes for each solute. Potassium and ammonium were absorbed by the ileum, while phosphorus, sodium and bicarbonate were secreted. The percentage excretion index of sodium and bicarbonate increased by approximately 100 and 600% respectively, causing a significant rise in urinary pH. Although not statistically significant, there was a tendency for chloride to be absorbed and for water to pass into the bowel lumen. Nicotinic acid 3 g/day had no significant effect on urinary solute transport.

  12. Charge transport and structural dynamics in carboxylic-acid-based deep eutectic mixtures.

    PubMed

    Griffin, Philip J; Cosby, Tyler; Holt, Adam P; Benson, Roberto S; Sangoro, Joshua R

    2014-08-07

    Charge transport and structural dynamics in the 1:2 mol ratio mixture of lidocaine and decanoic acid (LID-DA), a model deep eutectic mixture (DEM), have been characterized over a wide temperature range using broad-band dielectric spectroscopy and depolarized dynamic light scattering. Additionally, Fourier transform infrared spectroscopy measurements were performed to assess the degree of proton transfer between the neutral parent molecules. From our detailed analysis of the dielectric spectra, we have determined that this carboxylic-acid-based DEM is approximately 25% ionic at room temperature. Furthermore, we have found that the characteristic diffusion rate of mobile charge carriers is practically identical to the rate of structural relaxation at all measured temperatures, indicating that fast proton transport does not occur in LID-DA. Our results demonstrate that while LID-DA exhibits the thermal characteristics of a DEM, its charge transport properties resemble those of a protic ionic liquid.

  13. The Emergence and Evolution of Life in a "Fatty Acid World" Based on Quantum Mechanics

    NASA Astrophysics Data System (ADS)

    Tamulis, Arvydas; Grigalavicius, Mantas

    2011-02-01

    Quantum mechanical based electron correlation interactions among molecules are the source of the weak hydrogen and Van der Waals bonds that are critical to the self-assembly of artificial fatty acid micelles. Life on Earth or elsewhere could have emerged in the form of self-reproducing photoactive fatty acid micelles, which gradually evolved into nucleotide-containing micelles due to the enhanced ability of nucleotide-coupled sensitizer molecules to absorb visible light. Comparison of the calculated absorption spectra of micelles with and without nucleotides confirmed this idea and supports the idea of the emergence and evolution of nucleotides in minimal cells of a so-called Fatty Acid World. Furthermore, the nucleotide-caused wavelength shift and broadening of the absorption pattern potentially gives these molecules an additional valuable role, other than a purely genetic one in the early stages of the development of life. From the information theory point of view, the nucleotide sequences in such micelles carry positional information providing better electron transport along the nucleotide-sensitizer chain and, in addition, providing complimentary copies of that information for the next generation. Nucleotide sequences, which in the first period of evolution of fatty acid molecules were useful just for better absorbance of the light in the longer wavelength region, later in the PNA or RNA World, took on the role of genetic information storage.

  14. Aromatic isophthalamides aggregate in lipid bilayers: evidence for a cooperative transport mechanism.

    PubMed

    Berry, Stuart N; Busschaert, Nathalie; Frankling, Charlotte L; Salter, Dale; Gale, Philip A

    2015-03-14

    The synthesis and anion transport properties of a series of transmembrane anion transporters based on an isophthalamide scaffold with phenyl, naphthyl or anthracenyl central rings are reported. Anion transport studies using POPC vesicles, showed that the compounds have Hill coefficients >1. This is indicative of higher order complex formation, evidence that leads us to suggest that the compounds are not functioning solely as mobile carriers but rather that a cooperative transport mechanism is being observed. Fluorescence spectroscopy was used to show that the compounds aggregate in the phospholipid bilayer, which provides evidence that these compounds function as a self-assembled anion-conducting aggregate.

  15. Elastic tunneling charge transport mechanisms in silicon quantum dots / Si O 2 thin films and superlattices

    NASA Astrophysics Data System (ADS)

    Illera, S.; Prades, J. D.; Cirera, A.

    2015-05-01

    The role of different charge transport mechanisms in Si / Si O 2 structures has been studied. A theoretical model based on the Transfer Hamiltonian Formalism has been developed to explain experimental current trends in terms of three different elastic tunneling processes: (1) trap assisted tunneling; (2) transport through an intermediate quantum dot; and (3) direct tunneling between leads. In general, at low fields carrier transport is dominated by the quantum dots whereas, for moderate and high fields, transport through deep traps inherent to the SiO2 is the most relevant process. Besides, current trends in Si / Si O 2 superlattice structure have been properly reproduced.

  16. Transport of Glyphosate and Aminomethylphosphonic Acid under Two Soil Management Practices in an Italian Vineyard.

    PubMed

    Napoli, Marco; Marta, Anna Dalla; Zanchi, Camillo A; Orlandini, Simone

    2016-09-01

    Worldwide, glyphosate is the most widely used herbicide in controlling the growth of annual and perennial weeds. An increasing number of studies have highlighted the environmental risk resulting from the use of this molecule in aquatic and terrestrial ecosystems. The objective of the study was to determine the transport of glyphosate and its degradation product, aminomethylphosphonic acid (AMPA), through runoff and transported sediment from a vineyard under two different soil management systems: harrowed inter-row (HR) and permanent grass covered inter-row (GR). The study was performed over a period of 4 yr. Glyphosate and AMPA concentrations were found to be higher in runoff and in transported sediment from HR compared with GR, regardless of the amount of runoff and transported sediment. The mean annual percentages of glyphosate loss, via runoff and transported sediment, were about 1.37 and 0.73% for HR and GR, respectively. Aminomethylphosphonic acid represented approximately 30.9 and 40.0% of the total glyphosate losses in GR and HR, respectively. Moreover, results suggested that rains occurring within 4 wk after treatment could cause the transport of glyphosate and AMPA in high concentrations. Soil analyses indicated that glyphosate content was below detection within 1 yr, whereas AMPA remained in the soil profiles along the vine row and in the inter-row. Results indicated that GR can reduce soil and herbicide loss by runoff in vineyard cropping system.

  17. Glucocorticoid regulation of amino acid transport in anucleate rat hepatoma (HTC) cells

    PubMed Central

    1981-01-01

    The transport of alpha-aminoisobutyric acid (AIB) by rat hepatoma tissue culture (HTC) cells is rapidly and reversibly inhibited by dexamethasone and other glucocorticoids. To investigate the role of the nucleus in the regulation of transport and to determine whether steroid hormones or steroid-receptor complexes may have direct effects on cytoplasmic or membrane functions, we have examined the regulation of transport by dexamethasone in anucleate HTC cells. Cytoplasts prepared from suspension cultures of HTC cells fully retain active transport of AIB with the same kinetic properties as intact cells. However, the uptake of AIB is not inhibited by dexamethasone or other corticosteroids. Neither is the inhibited rate of transport, manifested by cytoplasts prepared from dexamethasone-treated cells, restored to normal upon removal of the hormone. Anucleate cells exhibit specific, saturable binding of [3H]dexamethasone; however, the binding is reduced compared with that of intact cells. The nucleus is thus required for the glucocorticoid regulation of amino acid transport in HTC cells. PMID:7217203

  18. Modulating Effect of Ascorbic Acid on Transport-Induced Immunosuppression in Goats

    PubMed Central

    Minka, Ndazo Salka; Ayo, Joseph Olusegun

    2011-01-01

    The effect of 12 h road transportation on some basic blood cells and the modulating role of ascorbic acid were investigated in 40 adult Red Sokoto goats during the hot dry season. The animals were divided into two groups, GI (experimental; n = 20) and GII (control; n = 20). Group 1 was administered with ascorbic acid (AA) per os at a dosage rate of 100 mg/kg body weight, while GII was given 10 mL of sterile water per goat. Forty minutes after the administration and loading, the goats were transported for 12 h. The result obtained in GII goats showed that loading, transportation, high ambient temperature (AT), and relative humidity (RH) encountered during transportation induced lymphopenia, neutrophilia, and eosinopenia, which can cause immunosuppression. In GI goats, the administration of AA prior to loading and transportation ameliorated the adverse effects of loading and transportation stress on neutrophil/lymphocyte ratio and eosinopenia of the goats. PMID:23738106

  19. Structure and permeation mechanism of a mammalian urea transporter

    SciTech Connect

    Levin, Elena J.; Cao, Yu; Enkavi, Giray; Quick, Matthias; Pan, Yaping; Tajkhorshid, Emad; Zhou, Ming

    2012-09-17

    As an adaptation to infrequent access to water, terrestrial mammals produce urine that is hyperosmotic to plasma. To prevent osmotic diuresis by the large quantity of urea generated by protein catabolism, the kidney epithelia contain facilitative urea transporters (UTs) that allow rapid equilibration between the urinary space and the hyperosmotic interstitium. Here we report the first X-ray crystal structure of a mammalian UT, UT-B, at a resolution of 2.36 {angstrom}. UT-B is a homotrimer and each protomer contains a urea conduction pore with a narrow selectivity filter. Structural analyses and molecular dynamics simulations showed that the selectivity filter has two urea binding sites separated by an approximately 5.0 kcal/mol energy barrier. Functional studies showed that the rate of urea conduction in UT-B is increased by hypoosmotic stress, and that the site of osmoregulation coincides with the location of the energy barrier.

  20. Calcium transport mechanisms in muskrat and rat hearts.

    PubMed

    McKean, T A

    2001-11-01

    Mammalian hearts experience calcium overload during extreme and prolonged hypoxia and the calcium overload may lead to enzyme activation and cell death. Several calcium transport systems were examined in muskrat hearts and compared to those found in rat hearts to determine if there is a species difference that might be related to the muskrats' superior ability to survive hypoxia. Radiolabeled nitredendipine binding was determined in rat and muskrat hearts to estimate the density of voltage gated calcium channels in surface membranes. There were no species differences. Calcium release channel density in the sarcoplasmic reticulum was estimated by the determination of radiolabeled ryanodine binding in muskrat and rat heart SR membranes. No differences were revealed between species. The SR uptake of calcium was measured in SR membranes from the hearts of the two species. No differences were found in the B(max) values, however, the muskrat SR membranes did have a slightly lower K(m) value. There were large species differences in Na(+)/Ca(2+) exchange in SL membranes with the muskrat heart having approximately 3.5 times the transport capacity of rat SL membranes. During hypoxic conditions in which there is extensive ATP depletion leading to [Na(+)](i) accumulation and discharge of cellular membrane potential, the Na(+)/Ca(2+) exchanger may operate in the reverse mode and import calcium into the cell and accelerate hypoxic damage. Prior to reaching this state a robust Na(+)/Ca(2+) exchange would facilitate the maintenance of normal diastolic calcium levels and calcium cycling. Muskrats hearts are hypoxia tolerant by virtue of their ability to reduce metabolic demand and generate ATP anaerobically thus, maintaining a favorable ATP balance. Therefore, the relative overexpression of Na(+)/Ca(2+) exchangers in muskrat hearts may be beneficial in the preservation of contractile function and calcium homeostasis in this freshwater diving mammal.

  1. Transport of Arginine and Aspartic Acid into Isolated Barley Mesophyll Vacuoles 1

    PubMed Central

    Martinoia, Enrico; Thume, Monika; Vogt, Esther; Rentsch, Doris; Dietz, Karl-Josef

    1991-01-01

    The transport of arginine into isolated barley (Hordeum vulgare L.) mesophyll vacuoles was investigated. In the absence of ATP, arginine uptake was saturable with a Km of 0.3 to 0.4 millimolar. Positively charged amino acids inhibited arginine uptake, lysine being most potent with a Ki of 1.2 millimolar. In the presence of free ATP, but not of its Mg-complex, uptake of arginine was drastically enhanced and a linear function of its concentration up to 16 millimolar. The nonhydrolyzable adenylyl imidodiphosphate, but no other nucleotide tested, could substitute for ATP. Therefore, it is suggested that this process does not require energy and does not involve the tonoplast ATPase. The ATP-dependent arginine uptake was strongly inhibited by p-chloromercuriphenylsulfonic acid. Furthermore, hydrophobic amino acids were inhibitory (I50 phenylalanine 1 millimolar). Similar characteristics were observed for the uptake of aspartic acid. However, rates of ATP-stimulated aspartic acid transport were 10-fold lower as compared to arginine transport. Uptake of aspartate in the absence of ATP was negligible. PMID:16668447

  2. Disposition and transportation of surplus radioactive low specific activity nitric acid. Volume 1, Environmental Assessment

    SciTech Connect

    1995-05-01

    DOE is deactivating the PUREX plant at Hanford; this will involve the disposition of about 692,000 liters (183,000 gallons) of surplus nitric acid contaminated with low levels of U and other radionuclides. The nitric acid, designated as low specific activity, is stored in 4 storage tanks at PUREX. Five principal alternatives were evaluated: transfer for reuse (sale to BNF plc), no action, continued storage in Hanford upgraded or new facility, consolidation of DOE surplus acid, and processing the LSA nitric acid as waste. The transfer to BNF plc is the preferred alternative. From the analysis, it is concluded that the proposed disposition and transportation of the acid does not constitute a major federal action significantly affecting the quality of the human environment within the meaning of NEPA; therefore an environmental impact statement is not required.

  3. Transport of fluorescent bile acids by the isolated perfused rat liver: kinetics, sequestration, and mobilization.

    PubMed

    Holzinger, F; Schteingart, C D; Ton-Nu, H T; Cerrè, C; Steinbach, J H; Yeh, H Z; Hofmann, A F

    1998-08-01

    Hepatocyte transport of six fluorescent bile acids containing nitrobenzoxadiazolyl (NBD) or a fluorescein derivative on the side chain was compared with that of natural bile acids using the single-pass perfused rat liver. Compounds were infused at 40 nmol/g liver min for 15 minutes; hepatic uptake and biliary recovery were measured; fractional extraction, intrinsic basolateral clearance, and sequestration (nonrecovery after 45 minutes of additional perfusion) were calculated. Fluorescent bile acids were efficiently extracted during the first 3 minutes (70%-97%), but net extraction decreased with time mostly because of regurgitation into the perfusate. For cholylglycine and ursodeoxycholylglycine (UDC-glycine), extraction was 94% to 99%, and regurgitation did not occur. Intrinsic hepatic clearance of fluorescent bile acids (2-7 mL/g liver x min) was lower than that of cholylglycine (9.0 +/- 0.6; mean +/- SD) and UDC-glycine (21.4 +/- 0.4). Sequestration at 60 minutes was 8% to 26% for fluorescent bile acids with a cholyl moiety (cholylglycylaminofluorescein [CGamF], cholyllysylfluorescein [C-L-F], cholyl-[N epsilon-NBD]-lysine [C-L-NBD], and cholylaminofluorescein [CamF]), 32% for ursodeoxycholylaminofluorescein (UDCamF), and 88% for ursodeoxycholyl-(N epsilon-NBD)lysine (UDC-L-NBD). Cholylglycine and UDC-glycine had <3% retention. Biliary secretion of sequestered UDCamF, but not of UDC-L-NBD, was induced by adding dibutyryl cyclic adenosine monophosphate (DBcAMP) to the perfusate, possibly by translocation to the canaliculus of pericanalicular vesicles containing fluorescent bile acids. Biliary secretion of UDC-L-NBD, but not of UDCamF, was induced by adding cholyltaurine or UDC-taurine, possibly by inhibition of binding to intracellular constituents or of transport into organelles. It is concluded that fluorescent bile acids are efficiently transported across the basolateral membrane, but in contrast to natural conjugated bile acids, are sequestered in the

  4. Regulation of amniotic fluid volume: mathematical model based on intramembranous transport mechanisms.

    PubMed

    Brace, Robert A; Anderson, Debra F; Cheung, Cecilia Y

    2014-11-15

    Experimentation in late-gestation fetal sheep has suggested that regulation of amniotic fluid (AF) volume occurs primarily by modulating the rate of intramembranous transport of water and solutes across the amnion into underlying fetal blood vessels. In order to gain insight into intramembranous transport mechanisms, we developed a computer model that allows simulation of experimentally measured changes in AF volume and composition over time. The model included fetal urine excretion and lung liquid secretion as inflows into the amniotic compartment plus fetal swallowing and intramembranous absorption as outflows. By using experimental flows and solute concentrations for urine, lung liquid, and swallowed fluid in combination with the passive and active transport mechanisms of the intramembranous pathway, we simulated AF responses to basal conditions, intra-amniotic fluid infusions, fetal intravascular infusions, urine replacement, and tracheoesophageal occlusion. The experimental data are consistent with four intramembranous transport mechanisms acting in concert: 1) an active unidirectional bulk transport of AF with all dissolved solutes out of AF into fetal blood presumably by vesicles; 2) passive bidirectional diffusion of solutes, such as sodium and chloride, between fetal blood and AF; 3) passive bidirectional water movement between AF and fetal blood; and 4) unidirectional transport of lactate into the AF. Further, only unidirectional bulk transport is dynamically regulated. The simulations also identified areas for future study: 1) identifying intramembranous stimulators and inhibitors, 2) determining the semipermeability characteristics of the intramembranous pathway, and 3) characterizing the vesicles that are the primary mediators of intramembranous transport.

  5. Identification of a mechanism by which the methylmercury antidotes N-acetylcysteine and dimercaptopropanesulfonate enhance urinary metal excretion: transport by the renal organic anion transporter-1.

    PubMed

    Koh, Albert S; Simmons-Willis, Tracey A; Pritchard, John B; Grassl, Steven M; Ballatori, Nazzareno

    2002-10-01

    N-Acetylcysteine (NAC) and dimercaptopropanesulfonate (DMPS) are sulfhydryl-containing compounds that produce a dramatic acceleration of urinary methylmercury (MeHg) excretion in poisoned animals, but the molecular mechanism for this effect is unknown. NAC and DMPS are themselves excreted in urine in high concentrations. The present study tested the hypothesis that the complexes formed between MeHg and these anionic chelating agents are transported from blood into proximal tubule cells by the basolateral membrane organic anion transporters (Oat) 1 and Oat3. Xenopus laevis oocytes expressing rat Oat1 showed increased uptake of [(14)C]MeHg when complexed with either NAC or DMPS but not when complexed with L-cysteine, glutathione, dimercaptosuccinate, penicillamine, or gamma-glutamylcysteine. In contrast, none of these MeHg complexes were transported by Oat3-expressing oocytes. The apparent K(m) values for Oat1-mediated transport were 31 +/- 2 microM for MeHg-NAC and 9 +/- 2 microM for MeHg-DMPS, indicating that these are relatively high-affinity substrates. Oat1-mediated uptake of [(14)C]MeHg-NAC and [(14)C]MeHg-DMPS was inhibited by prototypical substrates for Oat1, including p-aminohippurate (PAH), and was trans-stimulated when oocytes were preloaded with 2 mM glutarate but not glutamate. Conversely, efflux of [(3)H]PAH from Oat1-expressing oocytes was trans-stimulated by glutarate, PAH, NAC, DMPS, MeHg-NAC, MeHg-DMPS, and a mercapturic acid, indicating that these are transported solutes. [(3)H]PAH uptake was competitively inhibited by NAC (K(i) of 2.0 +/- 0.3 mM) and DMPS (K(i) of 0.10 +/- 0.02 mM), providing further evidence that these chelating agents are substrates for Oat1. These results indicate that the MeHg antidotes NAC and DMPS and their mercaptide complexes are transported by Oat1 but are comparatively poor substrates for Oat3. This is the first molecular identification of a transport mechanism by which these antidotes may enhance urinary excretion of

  6. Mechanism(S) Involved in the Colon-Specific Expression of the Thiamine Pyrophosphate (Tpp) Transporter.

    PubMed

    Nabokina, Svetlana M; Ramos, Mel Brendan; Said, Hamid M

    2016-01-01

    Microbiota of the large intestine synthesizes considerable amount of vitamin B1 (thiamine) in the form of thiamine pyrophosphate (TPP). We have recently demonstrated the existence of an efficient and specific carrier-mediated uptake process for TPP in human colonocytes, identified the TPP transporter (TPPT) involved (product of the SLC44A4 gene), and shown that expression of TPPT along the gastrointestinal (GI) tract is restricted to the colon. Our aim in this study was to determine the molecular basis of the colon-specific expression of TPPT focusing on a possible epigenetic mechanism. Our results showed that the CpG island predicted in the SLC44A4 promoter is non-methylated in the human colonic epithelial NCM460 cells, but is hyper-methylated in the human duodenal epithelial HuTu80 cells (as well as in the human retinal pigment epithelial ARPE19 cells). In the mouse (where TPPT expression in the GI tract is also restricted to the colon), the CpG island predicted in the Slc44a4 promoter is non-methylated in both the jejunum and colon, thus arguing against possible contribution of DNA methylation in the colon-specific expression of TPPT. A role for histone modifications in the tissue-specific pattern of Slc44a4 expression, however, was suggested by the findings that in mouse colon, histone H3 in the 5'-regulatory region of Slc44a4 is tri-methylated at lysine 4 and acetylated at lysine 9, whereas the tri-methylation at lysine 27 modification was negligible. In contrast, in the mouse jejunum, histone H3 is hyper-trimethylated at lysine 27 (repressor mark). Similarly, possible involvement of miRNA(s) in the tissue-specific expression of TPPT was also suggested by the findings that the 3'-UTR of SLC44A4 is targeted by specific miRNAs/RNA binding proteins in non-colonic, but not in colonic, epithelial cells. These studies show, for the first time, epigenetic mechanisms (histone modifications) play a role in determining the tissue-specific pattern of expression of TPPT

  7. Critical review: Radionuclide transport, sediment transport, and water quality mathematical modeling; and radionuclide adsorption/desorption mechanisms

    SciTech Connect

    Onishi, Y.; Serne, R.J.; Arnold, E.M.; Cowan, C.E.; Thompson, F.L.

    1981-01-01

    This report describes the results of a detailed literature review of radionuclide transport models applicable to rivers, estuaries, coastal waters, the Great Lakes, and impoundments. Some representatives sediment transport and water quality models were also reviewed to evaluate if they can be readily adapted to radionuclide transport modeling. The review showed that most available transport models were developed for dissolved radionuclide in rivers. These models include the mechanisms of advection, dispersion, and radionuclide decay. Since the models do not include sediment and radionuclide interactions, they are best suited for simulating short-term radionuclide migration where: (1) radionuclides have small distribution coefficients; (2) sediment concentrations in receiving water bodies are very low. Only 5 of the reviewed models include full sediment and radionuclide interactions: CHMSED developed by Fields; FETRA SERATRA, and TODAM developed by Onishi et al, and a model developed by Shull and Gloyna. The 5 models are applicable to cases where: (1) the distribution coefficient is large; (2) sediment concentrations are high; or (3) long-term migration and accumulation are under consideration. The report also discusses radionuclide absorption/desorption distribution ratios and addresses adsorption/desorption mechanisms and their controlling processes for 25 elements under surface water conditions. These elements are: Am, Sb, C, Ce, Cm, Co, Cr, Cs, Eu, I, Fe, Mn, Np, P, Pu, Pm, Ra, Ru, Sr, Tc, Th, {sup 3}H, U, Zn and Zr.

  8. Novel male-biased expression in paralogs of the aphid slimfast nutrient amino acid transporter expansion

    PubMed Central

    2011-01-01

    Background A major goal of molecular evolutionary biology is to understand the fate and consequences of duplicated genes. In this context, aphids are intriguing because the newly sequenced pea aphid genome harbors an extraordinary number of lineage-specific gene duplications relative to other insect genomes. Though many of their duplicated genes may be involved in their complex life cycle, duplications in nutrient amino acid transporters appear to be associated rather with their essential amino acid poor diet and the intracellular symbiosis aphids rely on to compensate for dietary deficits. Past work has shown that some duplicated amino acid transporters are highly expressed in the specialized cells housing the symbionts, including a paralog of an aphid-specific expansion homologous to the Drosophila gene slimfast. Previous data provide evidence that these bacteriocyte-expressed transporters mediate amino acid exchange between aphids and their symbionts. Results We report that some nutrient amino acid transporters show male-biased expression. Male-biased expression characterizes three paralogs in the aphid-specific slimfast expansion, and the male-biased expression is conserved across two aphid species for at least two paralogs. One of the male-biased paralogs has additionally experienced an accelerated rate of non-synonymous substitutions. Conclusions This is the first study to document male-biased slimfast expression. Our data suggest that the male-biased aphid slimfast paralogs diverged from their ancestral function to fill a functional role in males. Furthermore, our results provide evidence that members of the slimfast expansion are maintained in the aphid genome not only for the previously hypothesized role in mediating amino acid exchange between the symbiotic partners, but also for sex-specific roles. PMID:21917168

  9. Influence of chemical structure on hydration and gas transport mechanisms of sulfonated poly(aryl ether ketone) membranes.

    PubMed

    Simon, Sandra; Espuche, Eliane; Gouanvé, Fabrice; Chauveau, Edouard; Marestin, Catherine; Mercier, Régis

    2012-10-25

    This work reports the influence of the chemical structure of two sulfonated poly(aryl ether ketone)s (SPAEK) on the hydration and gas transport mechanism of thin membranes made thereupon. For this purpose, two sulfonated poly(aryl ether ketone)s having the same ionic exchange capacity (IEC) but bearing a different repartition of the sulfonic acid groups along the polymer backbone were prepared. These polymers were synthesized by direct copolymerization of two specific sulfonated precursors, bisphenol AF and 4,4'-difluorobenzophenone. The morphology of the membranes was studied by transmission electron microscopy, and the thermal properties of the ionomers were determined from differential scanning calorimetry and thermogravimetric analyses. A detailed analysis of the water sorption isotherms and kinetics was performed. The gas transport properties were also determined for He, H(2), and CO(2) in the full range of water activity. From the detailed analysis of the water sorption isotherm and of the relative contributions of the Fickian diffusion and relaxation phenomena, a water sorption mechanism was proposed in relation with the SPAEK architectures and polymers' chain mobility. This mechanism allowed explaining the different evolution of the gas transport properties observed as a function of the gas nature and hydration rate.

  10. Transport of some strong incompletely dissociated acids through anion-exchange membrane.

    PubMed

    Palatý, Zdenek; Záková, Alena

    2003-12-01

    Nitric and sulfuric acids belong among strong incompletely dissociated acids, so that in the description of their transport through an ion-exchange membrane, ionic equilibria have to be taken into account. The paper presents the determination of ionic mobilities and diffusivity of nondissociated form of these acids. For that purpose, data on the dialysis experiments with nitric and sulfuric acids in a batch mixed cell with an anion-exchange membrane NEOSEPTA-AFN, which have been completed by those on the membrane conductivity, have been used. The dependencies of the ionic mobilities and the diffusivity of nondissociated form of nitric acid upon the acid concentration in the membrane have been approximated by second degree polynomials. Their coefficients have been determined by numerical integration of the partial differential equation describing the concentration fields of the acids in the membrane and liquid films on both sides of the membrane, followed by an optimizing procedure. The model used is based on the Nernst-Planck electrodiffusion equation. Using all the experimental data obtained at various acid concentrations and rotational speeds of the stirrers, it has been found that ionic mobility is strongly affected by the acid concentration in the membrane and decreases in the series H(3)O(+), SO(2-)(4), NO(-)(3), HSO(-)(4).

  11. Coupling mechanical forces to electrical signaling: molecular motors and the intracellular transport of ion channels.

    PubMed

    Barry, Joshua; Gu, Chen

    2013-04-01

    Proper localization of various ion channels is fundamental to neuronal functions, including postsynaptic potential plasticity, dendritic integration, action potential initiation and propagation, and neurotransmitter release. Microtubule-based forward transport mediated by kinesin motors plays a key role in placing ion channel proteins to correct subcellular compartments. PDZ- and coiled-coil-domain proteins function as adaptor proteins linking ionotropic glutamate and GABA receptors to various kinesin motors, respectively. Recent studies show that several voltage-gated ion channel/transporter proteins directly bind to kinesins during forward transport. Three major regulatory mechanisms underlying intracellular transport of ion channels are also revealed. These studies contribute to understanding how mechanical forces are coupled to electrical signaling and illuminating pathogenic mechanisms in neurodegenerative diseases.

  12. Transport of the aromatic amino acids into isolated rat liver cells. Properties of uptake by two distinct systems.

    PubMed Central

    Salter, M; Knowles, R G; Pogson, C I

    1986-01-01

    The transport of the aromatic amino acids into isolated rat liver cells was studied. There was a rapid and substantial binding of the aromatic amino acids, L-alanine and L-leucine to the plasma membrane. This has important consequences for the determination of rates of transport and intracellular concentrations of the amino acids. Inhibition studies with a variety of substrates of various transport systems gave results consistent with aromatic amino acid transport being catalysed by two systems: a 2-aminobicyclo(2,2,1)heptane-2-carboxylic acid (BCH)-insensitive aromatic D- and L-amino acid-specific system, and the L-type system (BCH-sensitive). The BCH-insensitive component of transport was Na+-independent and facilitated non-concentrative transport of the aromatic amino acids; it was unaffected by culture of liver cells for 24 h, by 48 h starvation, dexamethasone phosphate or glucagon. Kinetic properties of the BCH-inhibitable component were similar to those previously reported for the L2-system in liver cells. The BCH-insensitive component was a comparatively low-Km low-Vmax. transport system that we suggest is similar to the T-transport system previously seen only in human red blood cells. The results are discussed with reference to the importance of the T- and L-systems in the control of aromatic L-amino acid degradation in the liver. PMID:3954748

  13. Di-acidic Motifs in the Membrane-distal C Termini Modulate the Transport of Angiotensin II Receptors from the Endoplasmic Reticulum to the Cell Surface*

    PubMed Central

    Zhang, Xiaoping; Dong, Chunmin; Wu, Qiong J.; Balch, William E.; Wu, Guangyu

    2011-01-01

    The molecular mechanisms underlying the endoplasmic reticulum (ER) export and cell surface transport of nascent G protein-coupled receptors (GPCRs) have just begun to be revealed and previous studies have shown that hydrophobic motifs in the putative amphipathic 8th α-helical region within the membrane-proximal C termini play an important role. In this study, we demonstrate that di-acidic motifs in the membrane-distal, nonstructural C-terminal portions are required for the exit from the ER and transport to the plasma membrane of angiotensin II receptors, but not adrenergic receptors. More interestingly, distinct di-acidic motifs dictate optimal export trafficking of different angiotensin II receptors and export ability of each acidic residue in the di-acidic motifs cannot be fully substituted by other acidic residue. Moreover, the function of the di-acidic motifs is likely mediated through facilitating the recruitment of the receptors onto the ER-derived COPII transport vesicles. Therefore, the di-acidic motifs located in the membrane-distal C termini may represent the first linear motifs which recruit selective GPCRs onto the COPII vesicles to control their export from the ER. PMID:21507945

  14. Detection and characterization of carrier-mediated cationic amino acid transport in lysosomes of normal and cystinotic human fibroblasts. Role in therapeutic cystine removal

    SciTech Connect

    Pisoni, R.L.; Thoene, J.G.; Christensen, H.N.

    1985-04-25

    The discovery of a trans-stimulation property associated with lysine exodus from lysosomes of human fibroblasts has enabled us to characterize a system mediating the transport of cationic amino acids across the lysosomal membrane of human fibroblasts. The cationic amino acids arginine, lysine, ornithine, diaminobutyrate, histidine, 2-aminoethylcysteine, and the mixed disulfide of cysteine and cysteamine all caused trans-stimulation of the exodus of radiolabeled lysine from the lysosomal fraction of human fibroblasts at pH 6.5. In contrast, neutral and acidic amino acids did not affect the rate of lysine exodus. Trans-stimulation of lysine exodus was observed over the pH range from 5.5 to 7.6, was specific for the L-isomer of the cationic amino acid, and was intolerant to methylation of the alpha-amino group of the amino acid. The lysosomotropic amine, chloroquine, greatly retarded lysine exodus, whereas the presence of sodium ion was without effect. The specificity and lack of Na+ dependence of this lysosomal transport system is similar to that of System y+ present on the plasma membrane of human fibroblasts. An important mechanism by which cysteamine treatment of cystinosis allows cystine escape from lysosomes may be the ability of the mixed disulfide of cysteine and cysteamine formed by sulfhydryl-disulfide exchange to migrate by this newly discovered system mediating cationic amino acid transport.

  15. Transport of indoleacetic acid in intact corn coleoptiles. [Zea mays L

    SciTech Connect

    Parker, K.E.; Briggs, W.R. )

    1990-10-01

    We have characterized the transport of ({sup 3}H)indoleacetic acid (IAA) in intact corn (Zea mays L.) coleoptiles. We have used a wide range of concentrations of added IAA (28 femtomoles to 100 picomoles taken up over 60 minutes). The shape of the transport curve varies with the concentration of added IAA, although the rate of movement of the observed front of tracer is invariant with concentration. At the lowest concentration of tracer used, the labeled IAA in the transport stream is not detectably metabolized or immobilized, curvature does not develop as a result of tracer application, and normal phototropic and gravitropic responsiveness are not affected. Therefore we believe we are observing the transport of true tracer quantities of labeled auxin at this lowest concentration.

  16. Mechanisms of quenching of Alexa fluorophores by natural amino acids.

    PubMed

    Chen, Huimin; Ahsan, Syed S; Santiago-Berrios, Mitk'El B; Abruña, Hector D; Webb, Watt W

    2010-06-02

    Quenching of fluorophores by the same proteins that they covalently label is a phenomenon that is neither well-known nor well-characterized. It is often assumed that fluorophores are unperturbed by their target proteins. However, it has been observed that attached fluorophores can be quenched by contact with amino acids within the same protein, and this property has been exploited to report on changing conformational states or intramolecular dynamics of proteins. We show in this communication that fluorescence of Alexa dyes is, in fact, quenched by interactions with Trp, Tyr, Met, and His residues through a combination of static and dynamic quenching mechanisms. In light of this finding, the potential effect of intramolecular quenching should be considered in the interpretation of data that involves quantitative measurements of fluorescence intensity in proteins.

  17. Mechanism of hepatic targeting via oral administration of DSPE–PEG–cholic acid-modified nanoliposomes

    PubMed Central

    Li, Ying; Zhu, Chunyan

    2017-01-01

    In oral administration, gastrointestinal physiological environment, gastrointestinal epithelial cell membranes, and blood circulation are typical biological barriers to hepatic delivery of ligand-modified nanoparticle drug delivery systems. To elucidate the mechanism of oral hepatic targeting of cholic acid receptor-mediated nanoliposomes (LPs) (distearoyl phosphatidylethanolamine–polyethylene glycol–cholic acid-modified LPs, CA-LPs), evaluations were performed on colon cancer Caco-2 cell monolayers, liver cancer HepG2 cells, and a rat intestinal perfusion model. CA-LPs, ~100 nm in diameter, exhibited sustained-release behavior and had the greatest stability in rat gastrointestinal fluid and serum for both size and entrapment efficiency. CA-LPs demonstrated highest transport across Caco-2 cells and highest cellular uptake by HepG2 cells. The enhanced endocytosis of CA-LPs was found to be mediated by Na+/taurocholate cotransporting polypeptide and involved the caveolin-mediated endocytosis pathway. Further, we used fluorescence resonance energy transfer (FRET) technology to show that the CA-LPs maintained their structural integrity in part during the transport across the Caco-2 cell monolayer and uptake by HepG2 cells. PMID:28280334

  18. Mechanism of unassisted ion transport across membrane bilayers

    NASA Technical Reports Server (NTRS)

    Wilson, M. A.; Pohorille, A.

    1996-01-01

    To establish how charged species move from water to the nonpolar membrane interior and to determine the energetic and structural effects accompanying this process, we performed molecular dynamics simulations of the transport of Na+ and Cl- across a lipid bilayer located between two water lamellae. The total length of molecular dynamics trajectories generated for each ion was 10 ns. Our simulations demonstrate that permeation of ions into the membrane is accompanied by the formation of deep, asymmetric thinning defects in the bilayer, whereby polar lipid head groups and water penetrate the nonpolar membrane interior. Once the ion crosses the midplane of the bilayer the deformation "switches sides"; the initial defect slowly relaxes, and a defect forms in the outgoing side of the bilayer. As a result, the ion remains well solvated during the process; the total number of oxygen atoms from water and lipid head groups in the first solvation shell remains constant. A similar membrane deformation is formed when the ion is instantaneously inserted into the interior of the bilayer. The formation of defects considerably lowers the free energy barrier to transfer of the ion across the bilayer and, consequently, increases the permeabilities of the membrane to ions, compared to the rigid, planar structure, by approximately 14 orders of magnitude. Our results have implications for drug delivery using liposomes and peptide insertion into membranes.

  19. The Mechanism of High Pressure Oxidations of Aliphatic Acids.

    DTIC Science & Technology

    ACETIC ACID , *OXIDATION), (*CARBOXYLIC ACIDS, OXIDATION), CHROMIUM ALLOYS, REACTION KINETICS, COPPER ALLOYS, NICKEL ALLOYS, TEMPERATURE, HIGH PRESSURE, CATALYSTS, GAS CHROMATOGRAPHY, VOLUMETRIC ANALYSIS, THESES

  20. Experimental Study and Reactive Transport Modeling of Boric Acid Leaching of Concrete

    NASA Astrophysics Data System (ADS)

    Pabalan, R. T.; Chiang, K.-T. K.

    2013-07-01

    Borated water leakage through spent fuel pools (SFPs) at pressurized water reactors is a concern because it could cause corrosion of reinforcement steel in the concrete structure, compromise the integrity of the structure, or cause unmonitored releases of contaminated water to the environment. Experimental data indicate that pH is a critical parameter that determines the corrosion susceptibility of rebar in borated water and the degree of concrete degradation by boric acid leaching. In this study, reactive transport modeling of concrete leaching by borated water was performed to provide information on the solution pH in the concrete crack or matrix and the degree of concrete degradation at different locations of an SFP concrete structure exposed to borated water. Simulations up to 100 years were performed using different boric acid concentrations, crack apertures, and solution flow rates. Concrete cylinders were immersed in boric acid solutions for several months and the mineralogical changes and boric acid penetration in the concrete cylinder were evaluated as a function of time. The depths of concrete leaching by boric acid solution derived from the reactive transport simulations were compared with the measured boric acid penetration depth.

  1. Large amino acid transporter 1 (LAT1) prodrugs of valproic acid: new prodrug design ideas for central nervous system delivery.

    PubMed

    Peura, Lauri; Malmioja, Kalle; Laine, Krista; Leppänen, Jukka; Gynther, Mikko; Isotalo, Antti; Rautio, Jarkko

    2011-10-03

    Central nervous system (CNS) drug delivery is a major challenge in drug development because the blood-brain barrier (BBB) efficiently restricts the entry of drug molecules into the CNS at sufficient amounts. The brain uptake of poorly penetrating drugs could be improved by utilizing the transporters at the BBB with a prodrug approach. In this study, we designed four phenylalanine derivatives of valproic acid and studied their ability to utilize a large amino acid transporter 1 (LAT1) in CNS delivery with an aim to show that the meta-substituted phenylalanine prodrugs bind to LAT1 with a higher affinity compared with the affinity of the para-substituted derivatives. All of the prodrugs crossed the BBB carrier mediatedly via LAT1 in in situ rat brain perfusion. For the first time, we introduced a novel meta-substituted phenylalanine analogue promoiety which improved the LAT1 affinity 10-fold and more importantly the rat brain uptake of the prodrug 2-fold compared with those of the para-substituted derivatives. Therefore, we have characterized a new prodrug design idea for CNS drug delivery utilizing a transporter-mediated prodrug approach.

  2. The plasma transport and metabolism of retinoic acid in the rat

    PubMed Central

    Smith, John Edgar; Milch, Peter O.; Muto, Yasutoshi; Goodman, DeWitt S.

    1973-01-01

    The transport of retinoic acid in plasma was examined in vitamin A-deficient rats maintained on small doses of radioactively labelled retinoic acid. After ultracentrifugation of serum adjusted to density 1.21, most of the radioactivity (83%) was associated with the proteins of density greater than 1.21, and not with the serum lipoproteins. Gel filtration of the labelled serum on Sephadex G-200 showed that the radioactive label was associated with protein in the molecular-weight range of serum albumin. On polyacrylamide-gel electrophoresis almost all of the recovered radioactivity migrated with serum albumin. Similar esults were obtained with serum from a normal control rat given a single oral dose of [14C]retinoic acid. These findings indicate that retinoic acid is transported in rat serum bound to serum albumin, and not by retinol-binding protein (the specific transport protein for plasma retinol). Several tissues and the entire remaining carcase of each rat were extracted with ethanol–acetone to determine the tissue distribution of retinoic acid and some of its metabolites. The total recover of radioactive compounds in in the entire body of the rat was about 7–9μg, representing less than 5% or 10% respectively of the total administered label in the two dosage groups studied. The results confirm that retinoic acid is not stored in any tissue. Most of the radioactive material was found in the carcase, rather than in the specific tissues analysed. Two-thirds of the radioactivity in the carcase appeared to represent unchanged retinoic acid. Of the tissues examined, the liver, kidneys and intestine had relatively high concentrations of radioactive compounds, whereas the testes and fat-pads had the lowest concentrations. PMID:4721615

  3. Transport of indoleacetic acid (IAA) and its conjugates in nodal stem segments of Phaseolus vulgaris L

    SciTech Connect

    Tamas, I.A.; Lim, R.

    1987-04-01

    Donor agar blocks containing either (2-acetyl-/sup 14/C) IAA; (2-acetyl-/sup 14/C) indole-3-acetyl-L-aspartate; (2-aceyl-/sup 14/) indole-3-acetyl-L-glycine; or (2-acetyl-/sup 14/C) indole-3-acetyl-L-alanine were placed on either the apical or the basal cut surface of stem segments each bearing an axillary bud in the middle. A receiver block was placed on the end opposite to the donor. After transport, the segments were divided into five equal sections plus the bud, and the radioactivity of donors, receivers and each part of the stem segments was counted. For all substances, the amount of /sup 14/C transported to the bud from the base was the same or greater than that from the apical end. After basipetal transport, the distribution of /sup 14/C in the segment declined sharply from apex to base. The opposite was true for acropetal transport. Transport for the three IAA conjugates did not different substantially from each other. The IAA transport inhibitor, naphthylphthalamic acid (NPA), inhibited basipetal /sup 14/C-IAA transport to the base of the stem segment but did not alter substantially the amount of /sup 14/C-IAA recovered from the bud. The results will be discussed in relation to axillary bud growth regulation.

  4. Mechanisms involved in the transport of mercuric ions in target tissues.

    PubMed

    Bridges, Christy C; Zalups, Rudolfs K

    2017-01-01

    Mercury exists in the environment in various forms, all of which pose a risk to human health. Despite guidelines regulating the industrial release of mercury into the environment, humans continue to be exposed regularly to various forms of this metal via inhalation or ingestion. Following exposure, mercuric ions are taken up by and accumulate in numerous organs, including brain, intestine, kidney, liver, and placenta. In order to understand the toxicological effects of exposure to mercury, a thorough understanding of the mechanisms that facilitate entry of mercuric ions into target cells must first be obtained. A number of mechanisms for the transport of mercuric ions into target cells and organs have been proposed in recent years. However, the ability of these mechanisms to transport mercuric ions and the regulatory features of these carriers have not been characterized completely. The purpose of this review is to summarize the current findings related to the mechanisms that may be involved in the transport of inorganic and organic forms of mercury in target tissues and organs. This review will describe mechanisms known to be involved in the transport of mercury and will also propose additional mechanisms that may potentially be involved in the transport of mercuric ions into target cells.

  5. Quantum-Mechanical Method for the Soliton Transported Bio-energy in Protein

    NASA Astrophysics Data System (ADS)

    Pang, Xiaofeng

    1993-07-01

    The equations of motion of the soliton transported bio-energy in the protein, were heretofore already obtained by a combination of quantum-mechanical and classical methods, but here have been derived based completely on quantum mechanics. And we point out the shortcoming of no self-consistency of the Davydov theory. Some interesting results have also been got.

  6. From Mechanical Motion to Brownian Motion, Thermodynamics and Particle Transport Theory

    ERIC Educational Resources Information Center

    Bringuier, E.

    2008-01-01

    The motion of a particle in a medium is dealt with either as a problem of mechanics or as a transport process in non-equilibrium statistical physics. The two kinds of approach are often unrelated as they are taught in different textbooks. The aim of this paper is to highlight the link between the mechanical and statistical treatments of particle…

  7. Effect of maternal micronutrients (folic acid, vitamin B12) and omega 3 fatty acids on liver fatty acid desaturases and transport proteins in Wistar rats.

    PubMed

    Wadhwani, Nisha S; Manglekar, Rupali R; Dangat, Kamini D; Kulkarni, Asmita V; Joshi, Sadhana R

    2012-01-01

    A disturbed fatty acid metabolism increases the risk of adult non-communicable diseases. This study examines the effect of maternal micronutrients on the fatty acid composition, desaturase activity, mRNA levels of fatty acid desaturases and transport proteins in the liver. Pregnant female rats were divided into 6 groups at 2 levels of folic acid both in the presence and absence of vitamin B(12). The vitamin B(12) deficient groups were supplemented with omega 3 fatty acid. An imbalance of maternal micronutrients reduces liver docosahexaenoic acid, increases Δ5 desaturase activity but decreases mRNA levels, decreases Δ6 desaturase activity but not mRNA levels as compared to control. mRNA level of Δ5 desaturase reverts back to the levels of the control group as a result of omega 3 fatty acid supplementation. Our data for the first time indicates that maternal micronutrients differentially alter the activity and expression of fatty acid desaturases in the liver.

  8. Molecular Switch Controlling the Binding of Anionic Bile Acid Conjugates to Human Apical Sodium-dependent Bile Acid Transporter

    PubMed Central

    Rais, Rana; Acharya, Chayan; Tririya, Gasirat; MacKerell, Alexander D.; Polli, James E.

    2010-01-01

    The human apical sodium-dependent bile acid transporter (hASBT) may serve as a prodrug target for oral drug absorption. Synthetic, biological, NMR and computational approaches identified the structure-activity relationships of mono- and dianionic bile acid conjugates for hASBT binding. Experimental data combined with a conformationally-sampled pharmacophore/QSAR modeling approach (CSP-SAR) predicted that dianionic substituents with intramolecular hydrogen bonding between hydroxyls on the cholane skeleton and the acid group on the conjugate's aromatic ring increased conjugate hydrophobicity and improved binding affinity. Notably, the model predicted the presence of a conformational molecular switch, where shifting the carboxylate substituent on an aromatic ring by a single position controlled binding affinity. Model validation was performed by effectively shifting the spatial location of the carboxylate by inserting a methylene adjacent to the aromatic ring, resulting in the predicted alteration in binding affinity. This work illustrates conformation as a determinant of ligand binding affinity to a biological transporter. PMID:20504026

  9. Human intestine luminal ACE2 and amino acid transporter expression increased by ACE-inhibitors.

    PubMed

    Vuille-dit-Bille, Raphael N; Camargo, Simone M; Emmenegger, Luca; Sasse, Tom; Kummer, Eva; Jando, Julia; Hamie, Qeumars M; Meier, Chantal F; Hunziker, Schirin; Forras-Kaufmann, Zsofia; Kuyumcu, Sena; Fox, Mark; Schwizer, Werner; Fried, Michael; Lindenmeyer, Maja; Götze, Oliver; Verrey, François

    2015-04-01

    Sodium-dependent neutral amino acid transporter B(0)AT1 (SLC6A19) and imino acid (proline) transporter SIT1 (SLC6A20) are expressed at the luminal membrane of small intestine enterocytes and proximal tubule kidney cells where they exert key functions for amino acid (re)absorption as documented by their role in Hartnup disorder and iminoglycinuria, respectively. Expression of B(0)AT1 was shown in rodent intestine to depend on the presence of the carboxypeptidase angiotensin-converting enzyme 2 (ACE2). This enzyme belongs to the renin-angiotensin system and its expression is induced by treatment with ACE-inhibitors (ACEIs) or angiotensin II AT1 receptor blockers (ARBs) in many rodent tissues. We show here in the Xenopus laevis oocyte expression system that human ACE2 also functionally interacts with SIT1. To investigate in human intestine the potential effect of ACEIs or ARBs on ACE2, we analysed intestinal biopsies taken during routine gastroduodenoscopy and ileocolonoscopy from 46 patients of which 9 were under ACEI and 13 ARB treatment. Analysis of transcript expression by real-time PCR and of proteins by immunofluorescence showed a co-localization of SIT1 and B(0)AT1 with ACE2 in the brush-border membrane of human small intestine enterocytes and a distinct axial expression pattern of the tested gene products along the intestine. Patients treated with ACEIs displayed in comparison with untreated controls increased intestinal mRNA levels of ACE2, peptide transporter PEPT1 (SLC15A1) and AA transporters B(0)AT1 and PAT1 (SLC36A1). This study unravels in human intestine the localization and distribution of intestinal transporters involved in amino acid absorption and suggests that ACEIs impact on their expression.

  10. Amphiphilic Lipopeptide-Mediated Transport of Insulin and Cell Membrane Penetration Mechanism.

    PubMed

    Zhang, Yu; Li, Lei; Han, Mei; Hu, Jiaoyin; Zhang, Liefeng

    2015-12-03

    Arginine octamer (R8) and its derivatives were developed in this study for the enhanced mucosal permeation of insulin. R8 was substituted with different aminos, then modified with stearic acid (SA). We found that the SAR6EW-insulin complex had stronger intermolecular interactions and higher complex stability. The amphiphilic lipopeptide (SAR6EW) was significantly more efficient for the permeation of insulin than R8 and R6EW both in vitro and in vivo. Interestingly, different cellular internalization mechanisms were observed for the complexes. When the effectiveness of the complexes in delivering insulin in vivo was examined, it was found that the SAR6EW-insulin complex provided a significant and sustained (six hours) reduction in the blood glucose levels of diabetic rats. The improved absorption could be the comprehensive result of stronger intermolecular interactions, better enzymatic stability, altered internalization pathways, and increased transportation efficacy. In addition, no sign of toxicity was observed after consecutive administrations of SAR6EW. These results demonstrate that SAR6EW is a promising epithelium permeation enhancer for insulin and suggest that the chemical modification of cell-penetrating peptides is a feasible strategy to enhance their potential.

  11. Formulating gels for decreased mucociliary transport using rheologic properties: polyacrylic acids.

    PubMed

    Shah, Ankur J; Donovan, Maureen D

    2007-04-20

    The purpose of these studies was to identify the rheologic properties of polyacrylic acid gels necessary for optimal reductions in mucociliary clearance. The mucociliary transport of 2 bioadhesive polyacrylic acid polymers, polycarbophil and carbopol, was assessed in vitro by measuring their clearance rates across explants of ciliated bovine tracheal tissue. The viscoelastic properties of polymer gels were measured in the presence of mucus using controlled stress rheometry. Combinations of apparent viscosity (eta) and complex modulus (G*) were found to be the most useful parameters in the identification of polyacrylic acid formulations capable of decreasing mucociliary transport rate (MTR). A narrow range of eta and G* values suitable for reducing mucociliary clearance, while remaining sufficiently fluid for intranasal administration, were identified. The correlations between the rheologic parameters of the polycarbophil gels and their mucociliary transport rates were used to identify other polyacrylic acid gels that also had suitable mucociliary clearance properties, demonstrating that these parameters can be used to direct the optimization of formulations using simple in vitro rheologic testing.

  12. Cationic amino acid transporters and beta-defensins in dry eye syndrome.

    PubMed

    Jäger, Kristin; Garreis, Fabian; Dunse, Matthias; Paulsen, Friedrich P

    2010-01-01

    Several diseases concomitant with L-arginine deficiency (diabetes, chronic kidney failure, psoriasis) are significantly associated with dry eye syndrome. One important factor that has so far been neglected is the y(+) transporter. In humans, y(+) accounts for nearly 80% of arginine transport, exclusively carrying the cationic amino acids L-arginine, L-lysine and L-ornithine. y(+) is represented by CAT(cationic amino acid transporter) proteins. L-arginine is a precursor of the moisturizer urea, which has been used in the treatment of dry skin diseases. Although urea has also been shown to be part of the tear film, little attention has been paid to it in this role. Moreover, L-arginine and L-lysine are major components contributing to synthesis of the antimicrobially active beta-defensins induced under dry eye conditions. The first results have demonstrated that transport of L-arginine and L-lysine into epithelial cells is limited by the y(+) transporter at the ocular surface.

  13. Clinical significance of coexpression of L-type amino acid transporter 1 (LAT1) and ASC amino acid transporter 2 (ASCT2) in lung adenocarcinoma

    PubMed Central

    Yazawa, Tomohiro; Shimizu, Kimihiro; Kaira, Kyoichi; Nagashima, Toshiteru; Ohtaki, Yoichi; Atsumi, Jun; Obayashi, Kai; Nagamori, Shushi; Kanai, Yoshikatsu; Oyama, Tetsunari; Takeyoshi, Izumi

    2015-01-01

    Background: L-type amino acid transporter 1 (LAT1) and ASC amino acid transporter 2 (ASCT2) have been associated with tumor growth and progression. However, the clinical significance of LAT1 and ASCT2 coexpression in the prognosis of patients with lung adenocarcinoma remains unclear. Methods: In total, 222 patients with surgically resected lung adenocarcinoma were investigated retrospectively. Tumor sections were stained immunohistochemically for LAT1, ASCT2, CD98, phosphorylated mammalian target-of-rapamycin (p-mTOR), and Ki-67, and microvessel density (MVD) was determined by staining for CD34. Epidermal growth factor receptor (EGFR) mutation status was also examined. Results: LAT1 and ASCT2 were positively expressed in 22% and 40% of cases, respectively. Coexpression of LAT1 and ASCT2 was observed in 12% of cases and was associated significantly with disease stage, lymphatic permeation, vascular invasion, CD98, Ki-67, and p-mTOR. Only LAT1 and ASCT2 coexpression indicated a poor prognosis for lung adenocarcinoma. Furthermore, this characteristic was recognized in early-stage patients, especially those who had wild-type, rather than mutated, EGFR. Multivariate analysis confirmed that the coexpression of LAT1 and ASCT2 was an independent factor for predicting poor outcome. Conclusions: LAT1 and ASCT2 coexpression is an independent prognostic factor for patients with lung adenocarcinoma, especially during the early stages, expressing wild-type EGFR. PMID:26279756

  14. Active zone proteins are transported via distinct mechanisms regulated by Par-1 kinase

    PubMed Central

    Barber, Kara R.; Sherman, Michael

    2017-01-01

    Disruption of synapses underlies a plethora of neurodevelopmental and neurodegenerative disease. Presynaptic specialization called the active zone plays a critical role in the communication with postsynaptic neuron. While the role of many proteins at the active zones in synaptic communication is relatively well studied, very little is known about how these proteins are transported to the synapses. For example, are there distinct mechanisms for the transport of active zone components or are they all transported in the same transport vesicle? Is active zone protein transport regulated? In this report we show that overexpression of Par-1/MARK kinase, a protein whose misregulation has been implicated in Autism spectrum disorders (ASDs) and neurodegenerative disorders, lead to a specific block in the transport of an active zone protein component- Bruchpilot at Drosophila neuromuscular junctions. Consistent with a block in axonal transport, we find a decrease in number of active zones and reduced neurotransmission in flies overexpressing Par-1 kinase. Interestingly, we find that Par-1 acts independently of Tau-one of the most well studied substrates of Par-1, revealing a presynaptic function for Par-1 that is independent of Tau. Thus, our study strongly suggests that there are distinct mechanisms that transport components of active zones and that they are tightly regulated. PMID:28222093

  15. Structure and Mechanism of the S Component of a Bacterial ECF Transporter

    SciTech Connect

    P Zhang; J Wang; Y Shi

    2011-12-31

    The energy-coupling factor (ECF) transporters, responsible for vitamin uptake in prokaryotes, are a unique family of membrane transporters. Each ECF transporter contains a membrane-embedded, substrate-binding protein (known as the S component), an energy-coupling module that comprises two ATP-binding proteins (known as the A and A' components) and a transmembrane protein (known as the T component). The structure and transport mechanism of the ECF family remain unknown. Here we report the crystal structure of RibU, the S component of the ECF-type riboflavin transporter from Staphylococcus aureus at 3.6-{angstrom} resolution. RibU contains six transmembrane segments, adopts a previously unreported transporter fold and contains a riboflavin molecule bound to the L1 loop and the periplasmic portion of transmembrane segments 4-6. Structural analysis reveals the essential ligand-binding residues, identifies the putative transport path and, with sequence alignment, uncovers conserved structural features and suggests potential mechanisms of action among the ECF transporters.

  16. Effect of peracetic acid reprocessing on the transport characteristics of polysulfone hemodialyzers.

    PubMed

    Wolff, Susanne H; Zydney, Andrew L

    2005-02-01

    Peracetic acid is used extensively for reprocessing hemodialyzers, despite several indications that reprocessing alters the dialyzer transport characteristics. The objective of this study was to obtain quantitative data for the effects of peracetic acid reprocessing on the clearance and sieving coefficients of urea, vitamin B12, and polydisperse dextrans using Fresenius F80A polysulfone dialyzers. Reprocessing restored the urea and vitamin B12 clearance to close to their original values. However, the reprocessed dialyzers had substantially lower clearance of the larger molecular weight dextrans, which was attributed to reductions in the effective pore size caused by residual plasma proteins within the membrane. Storage in peracetic acid provided some additional removal of residual proteins, although the clearance and sieving coefficients of the larger dextrans remained well below their original values. Peracetic acid caused no degradation of the membrane polymer, in sharp contrast to results obtained with bleach reprocessing.

  17. Nutrient uptake by marine invertebrates: cloning and functional analysis of amino acid transporter genes in developing sea urchins (Strongylocentrotus purpuratus).

    PubMed

    Meyer, Eli; Manahan, Donal T

    2009-08-01

    Transport of amino acids from low concentrations in seawater by marine invertebrates has been extensively studied, but few of the genes involved in this physiological process have been identified. We have characterized three amino acid transporter genes cloned from embryos of the sea urchin Strongylocentrotus purpuratus. These genes show phylogenetic proximity to classical amino acid transport systems, including Gly and B0+, and the inebriated gene (INE). Heterologous expression of these genes in frog oocytes induced a 40-fold increase in alanine transport above endogenous levels, demonstrating that these genes mediate alanine transport. Antibodies specific to one of these genes (Sp-AT1) inhibited alanine transport, confirming the physiological activity of this gene in larvae. Whole-mount antibody staining of larvae revealed expression of Sp-AT1 in the ectodermal tissues associated with amino acid transport, as independently demonstrated by autoradiographic localization of radioactive alanine. Maximum rates of alanine transport increased 6-fold during early development, from embryonic to larval stages. Analysis of gene expression during this developmental period revealed that Sp-AT1 transcript abundance remained nearly constant, while that of another transporter gene (Sp-AT2) increased 11-fold. The functional characterization of these genes establishes a molecular biological basis for amino acid transport by developmental stages of marine invertebrates.

  18. Effect of heat stress on amino acid digestibility and transporters in meat-type chickens.

    PubMed

    Habashy, W S; Milfort, M C; Adomako, K; Attia, Y A; Rekaya, R; Aggrey, S E

    2017-03-02

    The present study was conducted to investigate the effect of heat stress (HS) on performance, digestibility, and molecular transporters of amino acids in broilers. Cobb 500 chicks were raised from hatch till 13 d in floor pens. At d 14, 48 birds were randomly and equally divided between a control group (25°C) and a HS treatment group (35°C). Birds in both treatment classes were individually caged and fed ad libitum on a diet containing 18.7% CP and 3,560 Kcal ME/Kg. Five birds per treatment at one and 12 d post treatment were euthanized and the Pectoralis major (P. major) and ileum were sampled for gene expression analysis. At d 33, ileal contents were collected and used for digestibility analysis. Broilers under HS had reduced growth and feed intake compared to controls. Although the apparent ileal digestibility (AID) was consistently higher for all amino acids in the HS group, it was not significant except for hydroxylysine. The amino acid consumption and retention were significantly lower in the HS group when compared to the control group. Meanwhile, the retention of amino acids per BWG was higher in the HS group when compared to the control group except for hydroxylysine and ornithine. The dynamics of amino acid transporters in the P. major and ileum was influenced by HS. In P. major and ileum tissues at d one, transporters SNAT1, SNAT2, SNAT7, TAT1, and b0,+AT, were down-regulated in the HS group. Meanwhile, LAT4 and B0AT were down-regulated only in the P. major in the treatment group. The amino acid transporters B0AT and SNAT7 at d 12 post HS were down-regulated in the P. major and ileum, but SNAT2 was down-regulated only in the ileum and TAT1 was down-regulated only in the P. major compared with the control group. These changes in amino acid transporters may explain the reduced growth in meat type chickens under heat stress.

  19. Systematic characterization of porosity and mass transport and mechanical properties of porous polyurethane scaffolds.

    PubMed

    Wang, Yu-Fu; Barrera, Carlos M; Dauer, Edward A; Gu, Weiyong; Andreopoulos, Fotios; Huang, C-Y Charles

    2017-01-01

    One of the key challenges in porous scaffold design is to create a porous structure with desired mechanical function and mass transport properties which support delivery of biofactors and development of function tissue substitute. In recent years, polyurethane (PU) has become one of the most popular biomaterials in various tissue engineering fields. However, there are no studies fully investigating the relations between porosity and both mass transport and mechanical properties of PU porous scaffolds. In this paper, we fabricated PU scaffolds by combining phase inversion and salt (sodium chloride) leaching methods. The tensile and compressive moduli were examined on PU scaffolds fabricated with different PU concentrations (25%, 20% and 15% w/v) and salt/PU weight ratios (9/1, 6/1, 3/1 and 0/1). The mass transport properties of PU scaffolds including hydraulic permeability and glucose diffusivity were also measured. Furthermore, the relationships between the porosity and mass transport and mechanical properties of porous PU scaffold were systemically investigated. The results demonstrated that porosity is a key parameter which governs both mass transport and mechanical properties of porous PU scaffolds. With similar pore sizes, the mass transport and mechanical properties of porous PU scaffold can be described as single functions of porosity regardless of initial PU concentration. The relationships between scaffold porosity and properties can be utilized to facilitate porous PU scaffold fabrication with specific mass transport and mechanical properties. The systematic approach established in this study can be applied to characterization of other biomaterials for scaffold design and fabrication.

  20. Migration-induced variation of fatty acid transporters and cellular metabolic intensity in passerine birds.

    PubMed

    Zhang, Yufeng; King, Marisa O; Harmon, Erin; Eyster, Kathleen; Swanson, David L

    2015-10-01

    Because lipids are the main fuel supporting avian endurance activity, lipid transport and oxidation capacities may increase during migration. We measured enzyme activities, mRNA expression and protein levels in pectoralis and heart for several key steps of lipid transport and catabolism pathways to investigate whether these pathways were upregulated during migration. We used yellow-rumped (Setophaga coronata) and yellow (S. petechia) warblers and warbling vireos (Vireo gilvus) as study species because they all show migration-induced increases in organismal metabolic capacities. For yellow-rumped warblers, β-hydroxyacyl CoA-dehydrogenase (HOAD) activities and fatty acid transporter mRNA and/or protein levels were higher during spring than fall in pectoralis and heart, except that fatty acid translocase (FAT/CD36) protein levels showed the opposite pattern in heart. Lipid transporter protein levels, but not mRNA expression, in pectoralis and heart of warbling vireos were higher either during spring or fall than summer, but this was not true for HOAD activities. For yellow warblers, pectoralis, but not heart, protein levels of lipid transporters were upregulated during migration relative to summer, but this pattern was not evident for mRNA expression or HOAD activity. Finally, muscle and heart citrate synthase and carnitine palmitoyl transferase activities showed little seasonal variation for any species. These data suggest that pectoralis and heart lipid transport and catabolism capacities are often, but not universally, important correlates of elevated organismal metabolic capacity during migration. In contrast, migration-induced variation in cellular metabolic intensity and mitochondrial membrane transport are apparently not common correlates of the migratory phenotype in passerines.

  1. Organic Anion Transporting Polypeptides Contribute to the Disposition of Perfluoroalkyl Acids in Humans and Rats.

    PubMed

    Zhao, Wen; Zitzow, Jeremiah D; Weaver, Yi; Ehresman, David J; Chang, Shu-Ching; Butenhoff, John L; Hagenbuch, Bruno

    2016-12-24

    Perfluoroalkyl sulfonates (PFSAs) such as perfluorohexane sulfonate (PFHxS) and perfluorooctane sulfonate (PFOS) have very long serum elimination half-lives in humans, and preferentially distribute to serum and liver. The enterohepatic circulation of PFHxS and PFOS likely contributes to their extended elimination half-lives. We previously demonstrated that perfluorobutane sulfonate (PFBS), PFHxS, and PFOS are transported into hepatocytes both in a sodium-dependent and a sodium-independent manner. We identified Na(+)/taurocholate cotransporting polypeptide (NTCP) as the responsible sodium-dependent transporter. Furthermore, we demonstrated that the human apical sodium-dependent bile salt transporter (ASBT) contributes to the intestinal reabsorption of PFOS. However, so far no sodium-independent uptake transporters for PFSAs have been identified in human hepatocytes or enterocytes. In addition, perfluoroalkyl carboxylates (PFCAs) with 8 and 9 carbons were shown to preferentially distribute to the liver of rodents; however, no rat or human liver uptake transporters are known to transport these PFCAs. Therefore, we tested whether PFBS, PFHxS, PFOS, and PFCAs with 7-10 carbons are substrates of organic anion transporting polypeptides (OATPs). We used CHO and HEK293 cells to demonstrate that human OATP1B1, OATP1B3, and OATP2B1 can transport PFBS, PFHxS, PFOS, and the 2 PFCAs (C8 and C9). In addition, we show that rat OATP1A1, OATP1A5, OATP1B2, and OATP2B1 transport all 3 PFSAs. In conclusion, our results suggest that besides NTCP and ASBT, OATPs also are capable of contributing to the enterohepatic circulation and extended human serum elimination half-lives of the tested perfluoroalkyl acids.

  2. Genome expansion and differential expression of amino acid transporters at the aphid/Buchnera symbiotic interface.

    PubMed

    Price, Daniel R G; Duncan, Rebecca P; Shigenobu, Shuji; Wilson, Alex C C

    2011-11-01

    In insects, some of the most ecologically important symbioses are nutritional symbioses that provide hosts with novel traits and thereby facilitate exploitation of otherwise inaccessible niches. One such symbiosis is the ancient obligate intracellular symbiosis of aphids with the γ-proteobacteria, Buchnera aphidicola. Although the nutritional basis of the aphid/Buchnera symbiosis is well understood, the processes and structures that mediate the intimate interactions of symbiotic partners remain uncharacterized. Here, using a de novo approach, we characterize the complement of 40 amino acid polyamine organocation (APC) superfamily member amino acid transporters (AATs) encoded in the genome of the pea aphid, Acyrthosiphon pisum. We find that the A. pisum APC superfamily is characterized by extensive gene duplications such that A. pisum has more APC superfamily transporters than other fully sequenced insects, including a ten paralog aphid-specific expansion of the APC transporter slimfast. Detailed expression analysis of 17 transporters selected on the basis of their phylogenetic relationship to five AATs identified in an earlier bacteriocyte expressed sequence tag study distinguished a subset of eight transporters that have been recruited for amino acid transport in bacteriocyte cells at the symbiotic interface. These eight transporters include transporters that are highly expressed and/or highly enriched in bacteriocytes and intriguingly, the four AATs that show bacteriocyte-enriched expression are all members of gene family expansions, whereas three of the four that are highly expressed but not enriched in bacteriocytes retain one-to-one orthology with transporters in other genomes. Finally, analysis of evolutionary rates within the large A. pisum slimfast expansion demonstrated increased rates of molecular evolution coinciding with two major shifts in expression: 1) a loss of gut expression and possibly a gain of bacteriocyte expression and 2) loss of expression

  3. The role of L-type amino acid transporters in the uptake of glyphosate across mammalian epithelial tissues.

    PubMed

    Xu, Jiaqiang; Li, Gao; Wang, Zhuoyi; Si, Luqin; He, Sijie; Cai, Jialing; Huang, Jiangeng; Donovan, Maureen D

    2016-02-01

    Glyphosate is one of the most commonly used herbicides worldwide due to its broad spectrum of activity and reported low toxicity to humans. Glyphosate has an amino acid-like structure that is highly polar and shows low bioavailability following