Science.gov

Sample records for acid-base regulatory mechanisms

  1. Recent advances in understanding trans-epithelial acid-base regulation and excretion mechanisms in cephalopods

    PubMed Central

    Hu, Marian Y; Hwang, Pung-Pung; Tseng, Yung-Che

    2015-01-01

    Cephalopods have evolved complex sensory systems and an active lifestyle to compete with fish for similar resources in the marine environment. Their highly active lifestyle and their extensive protein metabolism has led to substantial acid-base regulatory abilities enabling these organisms to cope with CO2 induced acid-base disturbances. In convergence to teleost, cephalopods possess an ontogeny-dependent shift in ion-regulatory epithelia with epidermal ionocytes being the major site of embryonic acid-base regulation and ammonia excretion, while gill epithelia take these functions in adults. Although the basic morphology and excretory function of gill epithelia in cephalopods were outlined almost half a century ago, modern immunohistological and molecular techniques are bringing new insights to the mechanistic basis of acid-base regulation and excretion of nitrogenous waste products (e.g. NH3/NH4+) across ion regulatory epithelia of cephalopods. Using cephalopods as an invertebrate model, recent findings reveal partly conserved mechanisms but also novel aspects of acid-base regulation and nitrogen excretion in these exclusively marine animals. Comparative studies using a range of marine invertebrates will create a novel and exciting research direction addressing the evolution of pH regulatory and excretory systems. PMID:26716070

  2. Recent advances in understanding trans-epithelial acid-base regulation and excretion mechanisms in cephalopods.

    PubMed

    Hu, Marian Y; Hwang, Pung-Pung; Tseng, Yung-Che

    2015-01-01

    Cephalopods have evolved complex sensory systems and an active lifestyle to compete with fish for similar resources in the marine environment. Their highly active lifestyle and their extensive protein metabolism has led to substantial acid-base regulatory abilities enabling these organisms to cope with CO2 induced acid-base disturbances. In convergence to teleost, cephalopods possess an ontogeny-dependent shift in ion-regulatory epithelia with epidermal ionocytes being the major site of embryonic acid-base regulation and ammonia excretion, while gill epithelia take these functions in adults. Although the basic morphology and excretory function of gill epithelia in cephalopods were outlined almost half a century ago, modern immunohistological and molecular techniques are bringing new insights to the mechanistic basis of acid-base regulation and excretion of nitrogenous waste products (e.g. NH3/NH4 (+)) across ion regulatory epithelia of cephalopods. Using cephalopods as an invertebrate model, recent findings reveal partly conserved mechanisms but also novel aspects of acid-base regulation and nitrogen excretion in these exclusively marine animals. Comparative studies using a range of marine invertebrates will create a novel and exciting research direction addressing the evolution of pH regulatory and excretory systems. PMID:26716070

  3. Acid-base dysregulation and chemosensory mechanisms in panic disorder: a translational update.

    PubMed

    Vollmer, L L; Strawn, J R; Sah, R

    2015-01-01

    Panic disorder (PD), a complex anxiety disorder characterized by recurrent panic attacks, represents a poorly understood psychiatric condition which is associated with significant morbidity and an increased risk of suicide attempts and completed suicide. Recently however, neuroimaging and panic provocation challenge studies have provided insights into the pathoetiology of panic phenomena and have begun to elucidate potential neural mechanisms that may underlie panic attacks. In this regard, accumulating evidence suggests that acidosis may be a contributing factor in induction of panic. Challenge studies in patients with PD reveal that panic attacks may be reliably provoked by agents that lead to acid-base dysbalance such as CO2 inhalation and sodium lactate infusion. Chemosensory mechanisms that translate pH into panic-relevant fear, autonomic, and respiratory responses are therefore of high relevance to the understanding of panic pathophysiology. Herein, we provide a current update on clinical and preclinical studies supporting how acid-base imbalance and diverse chemosensory mechanisms may be associated with PD and discuss future implications of these findings. PMID:26080089

  4. Lactic acid based PEU/HA and PEU/BCP composites: Dynamic mechanical characterization of hydrolysis.

    PubMed

    Rich, Jaana; Tuominen, Jukka; Kylmä, Janne; Seppälä, Jukka; Nazhat, Showan N; Tanner, K Elizabeth

    2002-01-01

    Lactic acid based poly(ester-urethane) (PEU-BDI) and its composites with 20 and 40 vol.% bioceramic filler were characterized prior to their use as biocompatible and bioabsorbable artificial bone materials. Morphological, dynamic mechanical properties, and degradation of these either hydroxyapatite or biphasic calcium phosphate containing composites were determined. Addition of particulate bioactive filler increased the composite stiffness and the glass transition temperature, indicating strong interactions between the filler and matrix. Materials were sterilized by gamma-irradiation, which reduced the average molecular weights by 30-40%. However, dynamic mechanical properties were not significantly affected by irradiation. Specimens were immersed in 0.85 w/v saline at 37 degrees C for 5 weeks, and changes in molecular weights, mass, water absorption, and dynamic mechanical properties were recorded. All the composite materials showed promising dynamic mechanical performance over the 5 weeks of hydrolysis. Average molecular weights of PEU-BDI and its composites did not change substantially during the test period. PEU-BDI retained its modulus values relatively well, and although the moduli of the composite materials were much higher, especially at high filler content, they exhibited faster loss of mechanical integrity. PMID:12115768

  5. Stearic acid based oleogels: a study on the molecular, thermal and mechanical properties.

    PubMed

    Sagiri, S S; Singh, Vinay K; Pal, K; Banerjee, I; Basak, Piyali

    2015-03-01

    Stearic acid and its derivatives have been used as gelators in food and pharmaceutical gel formulations. However, the mechanism pertaining to the stearic acid based gelation has not been deciphered yet. Keeping that in mind, we investigated the role of stearic acid on physic-chemical properties of oleogel. For this purpose, two different oil (sesame oil and soy bean oil) formulations/oleogels were prepared. In depth analysis of gel kinetics, gel microstructure, molecular interactions, thermal and mechanical behaviors of the oleogels were done. The properties of the oleogels were dependent on the type of the vegetable oil used and the concentration of the stearic acid. Avrami analysis of DSC thermograms indicated that heterogeneous nucleation was coupled with the one-dimensional growth of gelator fibers as the key phenomenon in the formation of oleogels. Viscoelastic and pseudoplastic nature of the oleogels was analyzed in-depth by fitting the stress relaxation data in modified Peleg's model and rheological studies, respectively. Textural studies have revealed that the coexistence of hydrogen bond dissipation and formation of new bonds is possible under stress conditions in the physical oleogels. PMID:25579972

  6. Mechanical and microstructural properties of two-step acid-base catalyzed silica gels

    SciTech Connect

    Meyers, D.E.; Kirkbir, F.; Murata, H.; Chaudhuri, S.R.; Sarkar, A.

    1994-12-31

    The mechanical and microstructural properties of two-step acid-base catalyzed silica gels were examined as functions of aging time, catalyst concentration, and hydrolysis time. Cylindrical gels were prepared using Si(OC{sub 2}H{sub 5}){sub 4}, C{sub 2}H{sub 5}OH, and H{sub 2}O, with HCl followed by NH{sub 3} as catalysts. Mechanical properties were obtained from three-point bend tests, and the microstructures of dried gels were analyzed using nitrogen adsorption/desorption techniques. Gel strength initially increased with aging time at 70 C, then leveled off after about one week. When the sol was hydrolyzed for less than two hours, there were significant differences in the properties of gels catalyzed with relative molar amounts of 0.0001 and 0.0002 HCl. However, as the hydrolysis time was increased, the gels all had similar properties, independent of the amount of HCl. The amount of NH{sub 3} influenced gelation time and to a lesser extent, the strength, but had no observable effect on pore size. The two-step catalysis procedure produced gels with strength and pore size combinations intermediate to those of either single acid or base-catalyzed gels.

  7. What is the Ultimate Goal in Acid-Base Regulation?

    ERIC Educational Resources Information Center

    Balakrishnan, Selvakumar; Gopalakrishnan, Maya; Alagesan, Murali; Prakash, E. Sankaranarayanan

    2007-01-01

    It is common to see chapters on acid-base physiology state that the goal of acid-base regulatory mechanisms is to maintain the pH of arterial plasma and not arterial PCO [subscript 2] (Pa[subscript CO[subscript 2

  8. Comparative studies of gene regulatory mechanisms.

    PubMed

    Pai, Athma A; Gilad, Yoav

    2014-12-01

    It has become increasingly clear that changes in gene regulation have played an important role in adaptive evolution both between and within species. Over the past five years, comparative studies have moved beyond simple characterizations of differences in gene expression levels within and between species to studying variation in regulatory mechanisms. We still know relatively little about the precise chain of events that lead to most regulatory adaptations, but we have taken significant steps towards understanding the relative importance of changes in different mechanisms of gene regulatory evolution. In this review, we first discuss insights from comparative studies in model organisms, where the available experimental toolkit is extensive. We then focus on a few recent comparative studies in primates, where the limited feasibility of experimental manipulation dictates the approaches that can be used to study gene regulatory evolution. PMID:25215415

  9. Advances in Autophagy Regulatory Mechanisms

    PubMed Central

    Gallagher, Laura E.; Williamson, Leon E.; Chan, Edmond Y. W.

    2016-01-01

    Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK) complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1). Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1. PMID:27187479

  10. Advances in Autophagy Regulatory Mechanisms.

    PubMed

    Gallagher, Laura E; Williamson, Leon E; Chan, Edmond Y W

    2016-01-01

    Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK) complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1). Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1. PMID:27187479

  11. Chromatin insulators: regulatory mechanisms and epigenetic inheritance

    PubMed Central

    Bushey, Ashley M.; Dorman, Elizabeth R.; Corces, Victor G.

    2008-01-01

    Enhancer-blocking insulators are DNA elements that disrupt the communication between a regulatory sequence, such as an enhancer or a silencer, and a promoter. Insulators participate in both transcriptional regulation and global nuclear organization, two features of chromatin that are thought to be maintained from one generation to the next through epigenetic mechanisms. Furthermore, there are many regulatory mechanisms in place that enhance or hinder insulator activity. These modes of regulation could be used to establish cell-type specific insulator activity that is epigenetically inherited along a cell and/or organismal lineage. This review will discuss the evidence for epigenetic inheritance and regulation of insulator function. PMID:18851828

  12. Hyaluronic acid-based hydrogels crosslinked by copper-catalyzed azide-alkyne cycloaddition with tailorable mechanical properties.

    PubMed

    Piluso, Susanna; Hiebl, Bernhard; Gorb, Stanislav N; Kovalev, Alexander; Lendlein, Andreas; Neffe, Axel T

    2011-02-01

    Biopolymers of the extracellular matrix are attractive starting materials for providing degradable and biocompatible biomaterials. In this study, hyaluronic acid-based hydrogels with tunable mechanical properties were prepared by the use of copper- catalyzed azide-alkyne cycloaddition (known as "click chemistry"). Alkyne-functionalized hyaluronic acid was crosslinked with linkers having two terminal azide functionalities, varying crosslinker density as well as the lengths and rigidity of the linker molecules. By variation of the crosslinker density and crosslinker type, hydrogels with elastic moduli in the range of 0.5-4 kPa were prepared. The washed materials contained a maximum of 6.8 mg copper per kg dry weight and the eluate of the gel crosslinked with diazidostilbene did not show toxic effects on L929 cells. The hyaluronic acid-based hydrogels have potential as biomaterials for cell culture or soft tissue regeneration applications. PMID:21374560

  13. Gene regulatory mechanisms underpinning prostate cancer susceptibility.

    PubMed

    Whitington, Thomas; Gao, Ping; Song, Wei; Ross-Adams, Helen; Lamb, Alastair D; Yang, Yuehong; Svezia, Ilaria; Klevebring, Daniel; Mills, Ian G; Karlsson, Robert; Halim, Silvia; Dunning, Mark J; Egevad, Lars; Warren, Anne Y; Neal, David E; Grönberg, Henrik; Lindberg, Johan; Wei, Gong-Hong; Wiklund, Fredrik

    2016-04-01

    Molecular characterization of genome-wide association study (GWAS) loci can uncover key genes and biological mechanisms underpinning complex traits and diseases. Here we present deep, high-throughput characterization of gene regulatory mechanisms underlying prostate cancer risk loci. Our methodology integrates data from 295 prostate cancer chromatin immunoprecipitation and sequencing experiments with genotype and gene expression data from 602 prostate tumor samples. The analysis identifies new gene regulatory mechanisms affected by risk locus SNPs, including widespread disruption of ternary androgen receptor (AR)-FOXA1 and AR-HOXB13 complexes and competitive binding mechanisms. We identify 57 expression quantitative trait loci at 35 risk loci, which we validate through analysis of allele-specific expression. We further validate predicted regulatory SNPs and target genes in prostate cancer cell line models. Finally, our integrated analysis can be accessed through an interactive visualization tool. This analysis elucidates how genome sequence variation affects disease predisposition via gene regulatory mechanisms and identifies relevant genes for downstream biomarker and drug development. PMID:26950096

  14. Regulatory mechanisms link phenotypic plasticity to evolvability.

    PubMed

    van Gestel, Jordi; Weissing, Franz J

    2016-01-01

    Organisms have a remarkable capacity to respond to environmental change. They can either respond directly, by means of phenotypic plasticity, or they can slowly adapt through evolution. Yet, how phenotypic plasticity links to evolutionary adaptability is largely unknown. Current studies of plasticity tend to adopt a phenomenological reaction norm (RN) approach, which neglects the mechanisms underlying plasticity. Focusing on a concrete question - the optimal timing of bacterial sporulation - we here also consider a mechanistic approach, the evolution of a gene regulatory network (GRN) underlying plasticity. Using individual-based simulations, we compare the RN and GRN approach and find a number of striking differences. Most importantly, the GRN model results in a much higher diversity of responsive strategies than the RN model. We show that each of the evolved strategies is pre-adapted to a unique set of unseen environmental conditions. The regulatory mechanisms that control plasticity therefore critically link phenotypic plasticity to the adaptive potential of biological populations. PMID:27087393

  15. Physical and mechanical properties of extruded poly(lactic acid)-based Paulownia elongata biocomposites

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Paulownia wood flour (PWF), a byproduct of milling lumber, was tested as bio-filler with polylactic acid (PLA). Paulownia wood (PW) shavings were milled and separated into particle fractions and then blended with PLA with a single screw extruder. Mechanical and thermal properties were tested. Dif...

  16. Regulatory mechanisms link phenotypic plasticity to evolvability

    PubMed Central

    van Gestel, Jordi; Weissing, Franz J.

    2016-01-01

    Organisms have a remarkable capacity to respond to environmental change. They can either respond directly, by means of phenotypic plasticity, or they can slowly adapt through evolution. Yet, how phenotypic plasticity links to evolutionary adaptability is largely unknown. Current studies of plasticity tend to adopt a phenomenological reaction norm (RN) approach, which neglects the mechanisms underlying plasticity. Focusing on a concrete question – the optimal timing of bacterial sporulation – we here also consider a mechanistic approach, the evolution of a gene regulatory network (GRN) underlying plasticity. Using individual-based simulations, we compare the RN and GRN approach and find a number of striking differences. Most importantly, the GRN model results in a much higher diversity of responsive strategies than the RN model. We show that each of the evolved strategies is pre-adapted to a unique set of unseen environmental conditions. The regulatory mechanisms that control plasticity therefore critically link phenotypic plasticity to the adaptive potential of biological populations. PMID:27087393

  17. Structural Analysis and Mechanical Characterization of Hyaluronic Acid-Based Doubly Cross-Linked Networks

    PubMed Central

    Jha, Amit K.; Hule, Rohan A.; Jiao, Tong; Teller, Sean S.; Clifton, Rodney J.; Duncan, Randall L.; Pochan, Darrin J.; Jia, Xinqiao

    2009-01-01

    We have created a new class of hyaluronic acid (HA)-based hydrogel materials with HA hydrogel particles (HGPs) embedded in and covalently cross-linked to a secondary network. HA HGPs with an average diameter of ∼900 nm and narrow particle size distribution were synthesized using a refined reverse micelle polymerization technique. The average mesh size of the HGPs was estimated to be approximately 5.5 to 7.0 nm by a protein uptake experiment. Sodium periodate oxidation not only introduced aldehyde groups to the particles but also reduced the average particle size. The aldehyde groups generated were used as reactive handles for subsequent cross-linking with an HA derivative containing hydrazide groups. The resulting macroscopic gels contain two distinct hierarchical networks (doubly cross-linked networks, DXNs): one within individual particles and another among different particles. Bulk gels (BGs) formed by direct mixing of HA derivatives with mutually reactive groups were included for comparison. The hydrogel microstructures were collectively characterized by microscopy and neutron scattering techniques. Their viscoelasticity was quantified at low frequencies (0.1−10 Hz) using a controlled stress rheometer and at high frequencies (up to 200 Hz) with a home-built torsional wave apparatus. Both BGs and DXNs are stable elastic gels that become stiffer at higher frequencies. The HA-based DXN offers unique structural hierarchy and mechanical properties that are suitable for soft tissue regeneration. PMID:20046226

  18. Structural Analysis and Mechanical Characterization of Hyaluronic Acid-Based Doubly Cross-Linked Networks.

    PubMed

    Jha, Amit K; Hule, Rohan A; Jiao, Tong; Teller, Sean S; Clifton, Rodney J; Duncan, Randall L; Pochan, Darrin J; Jia, Xinqiao

    2009-01-01

    We have created a new class of hyaluronic acid (HA)-based hydrogel materials with HA hydrogel particles (HGPs) embedded in and covalently cross-linked to a secondary network. HA HGPs with an average diameter of ∼900 nm and narrow particle size distribution were synthesized using a refined reverse micelle polymerization technique. The average mesh size of the HGPs was estimated to be approximately 5.5 to 7.0 nm by a protein uptake experiment. Sodium periodate oxidation not only introduced aldehyde groups to the particles but also reduced the average particle size. The aldehyde groups generated were used as reactive handles for subsequent cross-linking with an HA derivative containing hydrazide groups. The resulting macroscopic gels contain two distinct hierarchical networks (doubly cross-linked networks, DXNs): one within individual particles and another among different particles. Bulk gels (BGs) formed by direct mixing of HA derivatives with mutually reactive groups were included for comparison. The hydrogel microstructures were collectively characterized by microscopy and neutron scattering techniques. Their viscoelasticity was quantified at low frequencies (0.1-10 Hz) using a controlled stress rheometer and at high frequencies (up to 200 Hz) with a home-built torsional wave apparatus. Both BGs and DXNs are stable elastic gels that become stiffer at higher frequencies. The HA-based DXN offers unique structural hierarchy and mechanical properties that are suitable for soft tissue regeneration. PMID:20046226

  19. Understanding the mechanism of amino acid-based Au nanoparticle chain formation.

    PubMed

    Sethi, Manish; Knecht, Marc R

    2010-06-15

    Understanding the surface orientation and interactions between biomolecules and nanoparticles is important in order to determine their effects on the final structure and activity. At present, limited analytical techniques are available to probe these interactions, especially for materials dispersed in solution. We recently demonstrated that arginine, a simple amino acid, is able to bind to the surface of Au nanoparticles in a segregated pattern, which produces an electronic dipole across the structure. As a result, the formation of linear chains of Au nanoparticles occurred that was dependent upon of the concentration of arginine. Here, we present new information concerning the mechanism of assembly and demonstrate unique reaction conditions that can be used to directly control the assembly rate, and thus the size of the final superstructure that is produced. The assembly process was modulated by the arginine/Au nanoparticle ratio, the temperature of the system, the dielectric of the solvent, and the solution ionic strength, all of which can be used in combination to control the process. These effects were monitored using UV-vis spectroscopy, transmission electron microscopy, and dynamic light scattering. From these results, it is suggested that the second step of the assembly process, which is the formation of nanoparticle chains mediated by Brownian motion, controls the overall assembly rate and thus the size and orientation of the final superstructure produced. Furthermore, the reaction kinetics of the system have been studied from which rate constants and activity energies have been extracted for electrostatic-based nanoparticle assembly. This analysis indicates that the assembly/organization step is likely broken into two substeps with the formation of nanoparticle dimers occurring in solution first, followed by the oligomerization of the dimers to form the linear and branched chains. The dimerization step follows traditional second-order kinetics and is

  20. The phosphate of pyridoxal-5'-phosphate is an acid/base catalyst in the mechanism of Pseudomonas fluorescens kynureninase.

    PubMed

    Phillips, Robert S; Scott, Israel; Paulose, Riya; Patel, Akshay; Barron, Taylor Colt

    2014-02-01

    Kynureninase (L-kynurenine hydrolase, EC 3.7.1.3) catalyzes the hydrolytic cleavage of L-kynurenine to L-alanine and anthranilic acid. The proposed mechanism of the retro-Claisen reaction requires extensive acid/base catalysis. Previous crystal structures showed that Tyr226 in the Pseudomonas fluorescens enzyme (Tyr275 in the human enzyme) hydrogen bonds to the phosphate of the pyridoxal-5'-phosphate (PLP) cofactor. This Tyr residue is strictly conserved in all sequences of kynureninase. The human enzyme complexed with a competitive inhibitor, 3-hydroxyhippuric acid, showed that the ligand carbonyl O is located 3.7 Å from the phenol of Tyr275 (Lima, S., Kumar, S., Gawandi, V., Momany, C. & Phillips, R. S. (2009) J. Med. Chem. 52, 389-396). We prepared a Y226F mutant of P. fluorescens kynureninase to probe the role of this residue in catalysis. The Y226F mutant has approximately 3000-fold lower activity than wild-type, and does not show the pKa values of 6.8 on kcat and 6.5 and 8.8 on k(cat)/K(m) seen for the wild-type enzyme (Koushik, S. V., Moore, J. A. III, Sundararaju, B. & Phillips, R. S. (1998) Biochemistry 37, 1376-1382). Wild-type kynureninase shows a resonance at 4.5 ppm in (31)P-NMR, which is shifted to 5.0, 3.3 and 2.0 ppm when the potent inhibitor 5-bromodihydrokynurenine is added. However, Y226F kynureninase shows resonances at 3.6 and 2.5 ppm, and no change in the peak position is seen when 5-bromodihydrokynurenine is added. Taken together, these results suggest that Tyr226 mediates proton transfer between the substrate and the phosphate, which accelerates formation of external aldimine and gem-diol intermediates. Thus, the phosphate of PLP acts as an acid/base catalyst in the mechanism of kynureninase. PMID:24304904

  1. Mechanical Behavior and Thermal Stability of Acid-Base Phosphate Cements and Composites Fabricated at Ambient Temperature

    NASA Astrophysics Data System (ADS)

    Colorado Lopera, Henry Alonso

    This dissertation presents the study of the mechanical behavior and thermal stability of acid-base phosphate cements (PCs) and composites fabricated at ambient temperature. These materials are also known as chemically bonded phosphate ceramics (CBPCs). Among other advantages of using PCs when compared with traditional cements are the better mechanical properties (compressive and flexural strength), lower density, ultra-fast (controllable) setting time, controllable pH, and an environmentally benign process. Several PCs based on wollastonite and calcium and alumino phosphates after thermal exposure up to 1000°C have been investigated. First, the thermo-mechanical and chemical stability of wollastonite-based PC (Wo-PC) exposed to temperatures up to 1000°C in air environment were studied. The effects of processing conditions on the curing and shrinkage of the wollastonite-based PC were studied. The chemical reactions and phase transformations during the fabrication and during the thermal exposure are analyzed in detail using scanning electron microscopy (SEM), X-ray diffraction (XRD), and thermo-gravimetric analysis (TGA Then, the thermo-mechanical and chemical stability of glass, carbon and basalt fiber reinforced Wo-PC composites, were studied using SEM, XRD, TGA. The flexural strength and Weibull statistics were analyzed. A significant strength degradation in the composites were found after the thermal exposure at elevated temperatures due to the interdifusion and chemical reactions across the fibers and the matrix at temperatures over 600°C. To overcome this barrier, we have developed a new PC based on calcium and alumino-phosphates (Ca-Al PCs). The Ca-Al PCs were studied in detail using SEM, XRD, TGA, curing, shrinkage, Weibull statistics, and compression tests. Our study has confirmed that this new composite material is chemically and mechanically stable at temperatures up to 1000°C. Moreover, the compression strength increases after exposure to 1000

  2. Modeling Transport and Flow Regulatory Mechanisms of the Kidney

    PubMed Central

    Layton, Anita T.

    2013-01-01

    The kidney plays an indispensable role in the regulation of whole-organism water balance, electrolyte balance, and acid-base balance, and in the excretion of metabolic wastes and toxins. In this paper, we review representative mathematical models that have been developed to better understand kidney physiology and pathophysiology, including the regulation of glomerular filtration, the regulation of renal blood flow by means of the tubuloglomerular feedback mechanisms and of the myogenic mechanism, the urine concentrating mechanism, and regulation of renal oxygen transport. We discuss how such modeling efforts have significantly expanded our understanding of renal function in both health and disease. PMID:23914303

  3. Immune Regulatory Mechanisms in Allergic Conjunctivitis

    PubMed Central

    Niederkorn, Jerry Y.

    2008-01-01

    Purpose of review This review highlights recent findings regarding the immune regulation of allergic conjunctivitis (AC). Mouse models have facilitated prospective studies that have not been possible in patients. The availability of gene knockout mice and the wealth of monoclonal antibodies have permitted exquisite dissection of the pathophysiology and immune regulation of AC. Recent findings New insights have emerged in three areas: a) role of costimulatory molecules in the induction of Th2 immune responses; b) crucial role of interferon-γ (IFN-γ) in the expression of AC; and c) the function of T regulatory cells in shaping conjunctival inflammation once the immune response has been initiated. Summary Allergic conjunctivitis involves early phase and late phase reactions. The early phase reaction (EPR) is IgE antibody-dependent, while the late phase reaction (LPR) is IgE-independent and is mediated by inflammatory cells, especially eosinophils. Recent studies in mouse models of AC have provided important insights into the immune regulation of both the EPR and LPR of AC. Mounting evidence suggests that IFN-γ is crucial for optimum expression of AC. Costimulatory molecules influence the induction of Th2 immune responses and the EPR while regulatory T cells shape the expression of the LPR of AC. PMID:18769204

  4. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    PubMed Central

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine

    2015-01-01

    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution. PMID:26184971

  5. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    NASA Astrophysics Data System (ADS)

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine

    2015-07-01

    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution.

  6. Nitrogen fixation: key genetic regulatory mechanisms.

    PubMed

    Martinez-Argudo, I; Little, R; Shearer, N; Johnson, P; Dixon, R

    2005-02-01

    The necessity to respond to the level of fixed nitrogen and external oxygen concentrations and to provide sufficient energy for nitrogen fixation imposes common regulatory principles amongst diazotrophs. The NifL-NifA system in Azotobacter vinelandii integrates the signals of redox, fixed-nitrogen and carbon status to regulate nif transcription. Multidomain signalling interactions between NifL and NifA are modulated by redox changes, ligand binding and interaction with the signal-transduction protein GlnK. Under adverse redox conditions (excess oxygen) or when fixed nitrogen is in excess, NifL forms a complex with NifA in which transcriptional activation is prevented. Oxidized NifL forms a binary complex with NifA to inhibit NifA activity. When fixed nitrogen is in excess, the non-covalently modified form of GlnK interacts with NifL to promote the formation of a GlnK-NifL-NifA ternary complex. When the cell re-encounters favourable conditions for nitrogen fixation, it is necessary to deactivate the signals to ensure that the NifL-NifA complex is dissociated so that NifA is free to activate transcription. This is achieved through interactions with 2-oxoglutarate, a key metabolic signal of the carbon status, which binds to the N-terminal GAF (cGMP-specific and stimulated phosphodiesterases, Anabaena adenylate cyclases and Escherichia coli FhlA) domain of NifA. PMID:15667291

  7. Molecular regulatory mechanism of tooth root development

    PubMed Central

    Huang, Xiao-Feng; Chai, Yang

    2012-01-01

    The root is crucial for the physiological function of the tooth, and a healthy root allows an artificial crown to function as required clinically. Tooth crown development has been studied intensively during the last few decades, but root development remains not well understood. Here we review the root development processes, including cell fate determination, induction of odontoblast and cementoblast differentiation, interaction of root epithelium and mesenchyme, and other molecular mechanisms. This review summarizes our current understanding of the signaling cascades and mechanisms involved in root development. It also sets the stage for de novo tooth regeneration. PMID:23222990

  8. [Regulatory mechanism of circulating inorganic phosphate].

    PubMed

    Michigami, Toshimi

    2016-02-01

    Circulating level of phosphate is altered by age and diet, and is also controlled by several hormones such as parathyroid hormone(PTH), 1,25-dihydroxyvitamin D[1,25(OH)2D]and fibroblast growth factor 23(FGF23). The main function of PTH and 1,25(OH)2D is maintaining calcium homeostasis, while FGF23 plays a central role in phosphate metabolism. PTH suppresses phosphate reabsorption in the proximal tubules to increase the renal phosphate wasting, while 1,25(OH)2D facilitates the intestinal phosphate absorption. FGF23 increases the renal phosphate wasting and reduces the production of 1,25(OH)2D. Of note, these hormones mutually regulate one another. The production of FGF23 is also regulated by various local factors. The mechanism for sensing the phosphate availability still remains unknown, and further investigation is required. PMID:26813498

  9. Subversion of cell cycle regulatory mechanisms by HIV

    PubMed Central

    Rice, Andrew P.; Kimata, Jason T.

    2015-01-01

    To establish a productive infection, HIV-1 must counteract cellular innate immune mechanisms and redirect cellular process towards viral replication. Recent studies have discovered that HIV-1 and other primate immunodeficiency viruses subvert cell cycle regulatory mechanisms to achieve these ends. The viral Vpr and Vpx proteins target cell cycle controls to counter innate immunity. The cell cycle-related protein Cyclin L2 is also utilized to counter innate immunity. The viral Tat protein utilizes Cyclin T1 to activated proviral transcription, and regulation of Cyclin T1 levels in CD4+ T cells has important consequences for viral replication and latency. This review will summarize this emerging evidence that primate immunodeficiency viruses subvert cell cycle regulatory mechanisms to enhance replication. PMID:26067601

  10. Structural and catalytic effects of an invariant purine substitution in the hammerhead ribozyme: implications for the mechanism of acid-base catalysis.

    PubMed

    Schultz, Eric P; Vasquez, Ernesto E; Scott, William G

    2014-09-01

    The hammerhead ribozyme catalyzes RNA cleavage via acid-base catalysis. Whether it does so by general acid-base catalysis, in which the RNA itself donates and abstracts protons in the transition state, as is typically assumed, or by specific acid-base catalysis, in which the RNA plays a structural role and proton transfer is mediated by active-site water molecules, is unknown. Previous biochemical and crystallographic experiments implicate an invariant purine in the active site, G12, as the general base. However, G12 may play a structural role consistent with specific base catalysis. To better understand the role of G12 in the mechanism of hammerhead catalysis, a 2.2 Å resolution crystal structure of a hammerhead ribozyme from Schistosoma mansoni with a purine substituted for G12 in the active site of the ribozyme was obtained. Comparison of this structure (PDB entry 3zd4), in which A12 is substituted for G, with three previously determined structures that now serve as important experimental controls, allows the identification of structural perturbations that are owing to the purine substitution itself. Kinetic measurements for G12 purine-substituted schistosomal hammerheads confirm a previously observed dependence of rate on the pK(a) of the substituted purine; in both cases inosine, which is similar to G in pK(a) and hydrogen-bonding properties, is unexpectedly inactive. Structural comparisons indicate that this may primarily be owing to the lack of the exocyclic 2-amino group in the G12A and G12I substitutions and its structural effect upon both the nucleotide base and phosphate of A9. The latter involves the perturbation of a previously identified and well characterized metal ion-binding site known to be catalytically important in both minimal and full-length hammerhead ribozyme sequences. The results permit it to be suggested that G12 plays an important role in stabilizing the active-site structure. This result, although not inconsistent with the potential

  11. Hyaluronic Acid-Based Hydrogels Containing Covalently Integrated Drug Depots: Implication for Controlling Inflammation in Mechanically Stressed Tissues

    PubMed Central

    Xiao, Longxi; Tong, Zhixiang; Chen, Yingchao; Pochan, Darrin J.; Sabanayagam, Chandran R.; Jia, Xinqiao

    2013-01-01

    Synthetic hydrogels containing covalently-integrated soft and deformable drug depots capable of releasing therapeutic molecules in response to mechanical forces are attractive candidates for the treatment of degenerated tissues that are normally load bearing. Herein, radically crosslinkable block copolymer micelles (xBCM) assembled from an amphiphilic block copolymer consisting of hydrophilic poly(acrylic acid) (PAA) partially modified with 2-hydroxyethyl acrylate, and hydrophobic poly(n-butyl acryclate) (PnBA) were employed as the drug depots and the microscopic crosslinkers for the preparation of hyaluronic acid (HA)-based, hydrogels. HA hydrogels containing covalently integrated micelles (HAxBCM) were prepared by radical polymerization of glycidyl methacrylate (GMA)-modified HA (HAGMA) in the presence of xBCMs. When micelles prepared from the parent PAA-b-PnBA without any polymerizable double bonds were used, hydrogels containing physically entrapped micelles (HApBCM) were obtained. The addition of xBCMs to a HAGMA precursor solution accelerated the gelation kinetics and altered the hydrogel mechanical properties. The resultant HAxBCM gels exhibit an elastic modulus of 847 ± 43 Pa and a compressive modulus of 9.2 ± 0.7 kPa. Diffusion analysis of Nile Red (NR)-labeled xBCMs employing fluorescence correlation spectroscopy confirmed the covalent immobilization of xBCMs in HA networks. Covalent integration of dexamethasone (DEX)-loaded xBCMs in HA gels significantly reduced the initial burst release and provided sustained release over a prolonged period. Importantly, DEX release from HAxBCM gels was accelerated by intermittently-applied external compression in a strain-dependent manner. Culturing macrophages in the presence of DEX-releasing HAxBCM gels significantly reduced cellular production of inflammatory cytokines. Incorporating mechano-responsive modules in synthetic matrices offers a novel strategy to harvest mechanical stress present in the healing wounds

  12. Hyaluronic acid-based hydrogels containing covalently integrated drug depots: implication for controlling inflammation in mechanically stressed tissues.

    PubMed

    Xiao, Longxi; Tong, Zhixiang; Chen, Yingchao; Pochan, Darrin J; Sabanayagam, Chandran R; Jia, Xinqiao

    2013-11-11

    Synthetic hydrogels containing covalently integrated soft and deformable drug depots capable of releasing therapeutic molecules in response to mechanical forces are attractive candidates for the treatment of degenerated tissues that are normally load bearing. Herein, radically cross-linkable block copolymer micelles (xBCM) assembled from an amphiphilic block copolymer consisting of hydrophilic poly(acrylic acid) (PAA) partially modified with 2-hydroxyethyl acrylate, and hydrophobic poly(n-butyl acryclate) (PnBA) were employed as the drug depots and the microscopic cross-linkers for the preparation of hyaluronic acid (HA)-based, hydrogels. HA hydrogels containing covalently integrated micelles (HAxBCM) were prepared by radical polymerization of glycidyl methacrylate (GMA)-modified HA (HAGMA) in the presence of xBCMs. When micelles prepared from the parent PAA-b-PnBA without any polymerizable double bonds were used, hydrogels containing physically entrapped micelles (HApBCM) were obtained. The addition of xBCMs to a HAGMA precursor solution accelerated the gelation kinetics and altered the hydrogel mechanical properties. The resultant HAxBCM gels exhibit an elastic modulus of 847 ± 43 Pa and a compressive modulus of 9.2 ± 0.7 kPa. Diffusion analysis of Nile Red (NR)-labeled xBCMs employing fluorescence correlation spectroscopy confirmed the covalent immobilization of xBCMs in HA networks. Covalent integration of dexamethasone (DEX)-loaded xBCMs in HA gels significantly reduced the initial burst release and provided sustained release over a prolonged period. Importantly, DEX release from HAxBCM gels was accelerated by intermittently applied external compression in a strain-dependent manner. Culturing macrophages in the presence of DEX-releasing HAxBCM gels significantly reduced cellular production of inflammatory cytokines. Incorporating mechano-responsive modules in synthetic matrices offers a novel strategy to harvest mechanical stress present in the healing

  13. Regulatory mechanisms related to biofuel tolerance in producing microbes.

    PubMed

    Fu, Y; Chen, L; Zhang, W

    2016-08-01

    Production of renewable biofuels through either native or engineered microbes has drawn significant attention in recent years, mostly due to the increasing concerns on the energy crisis and the environmental consequences of the overutilization of petroleum-based fuels. Although significant progress has been achieved thus far, further advances are still necessary in order to decrease the manufacturing cost so that the producing processes can be more competitive to petroleum fuels. Among various possible approaches, the increase in biofuel tolerance in microbes has been suggested as one aspect which is important for the success of biofuel production at industry-scale. In this article, we critically summarize recent advances in deciphering regulatory mechanisms for enhancing biofuel tolerance in various micro-organisms, focusing on functions and utilization of several well-studied regulatory mechanisms in microbes, such as two-component signal transduction systems, sigma factors, transcription factors, noncoding RNA and other regulators. PMID:27123568

  14. Acid-base chemical mechanism of O-acetylserine sulfhydrylases-A and -B from pH studies.

    PubMed

    Tai, C H; Nalabolu, S R; Simmons, J W; Jacobson, T M; Cook, P F

    1995-09-26

    The pH dependence of kinetic parameters using natural and alternative reactants was determined in order to obtain information on the chemical mechanisms of the A and B isozymes of O-acetylserine sulfhydrylase (OASS) from Salmonella typhimurium. A general mechanism is proposed for OASS in which OAS binds with its alpha-amine unprotonated to carry out a nucleophilic attack on C4' of the protonated Schiff base and with the acetyl carbonyl hydrogen-bonded to a protonated enzyme group (or a water molecule), which aids in the beta-elimination of acetate. The enzyme lysine that was in Schiff base linkage with the active site pyridoxal 5'-phosphate deprotonates the alpha-carbon in the beta-elimination reaction, and a proton is likely released with the acetate product. Sulfide likely binds as HS- to undergo nucleophilic attack on the alpha-aminoacrylate intermediate, followed by protonation of the alpha-carbon by the enzyme lysine. In OASS-A, HS- is hydrogen-bonded to the enzyme group that assists in the beta-elimination of acetate, but this is not the case for OASS-B. The pH independent equilibrium constant for the first half-reaction of OASS-A is 1.6 x 10(-3), while the second half-reaction is practically irreversible. PMID:7547974

  15. Secretory pattern and regulatory mechanism of growth hormone in cattle.

    PubMed

    Kasuya, Etsuko

    2016-02-01

    The ultradian rhythm of growth hormone (GH) secretion has been known in several animal species for years and has recently been observed in cattle. Although the physiological significance of the rhythm is not yet fully understood, it appears essential for normal growth. In this review, previous studies concerning the GH secretory pattern in cattle, including its ultradian rhythm, are introduced and the regulatory mechanism is discussed on the basis of recent findings. PMID:26260675

  16. Chemical feasibility of the general acid/base mechanism of glmS ribozyme self-cleavage.

    PubMed

    Dubecký, Matúš; Walter, Nils G; Šponer, Jiří; Otyepka, Michal; Banáš, Pavel

    2015-10-01

    In numerous Gram-positive bacteria, the glmS ribozyme or catalytic riboswitch regulates the expression of glucosamine-6-phosphate (GlcN6P) synthase via site-specific cleavage of its sugar-phosphate backbone in response to GlcN6P ligand binding. Biochemical data have suggested a crucial catalytic role for an active site guanine (G40 in Thermoanaerobacter tengcongensis, G33 in Bacillus anthracis). We used hybrid quantum chemical/molecular mechanical (QM/MM) calculations to probe the mechanism where G40 is deprotonated and acts as a general base. The calculations suggest that the deprotonated guanine G40(-) is sufficiently reactive to overcome the thermodynamic penalty arising from its rare protonation state, and thus is able to activate the A-1(2'-OH) group toward nucleophilic attack on the adjacent backbone. Furthermore, deprotonation of A-1(2'-OH) and nucleophilic attack are predicted to occur as separate steps, where activation of A-1(2'-OH) precedes nucleophilic attack. Conversely, the transition state associated with the rate-determining step corresponds to concurrent nucleophilic attack and protonation of the G1(O5') leaving group by the ammonium moiety of the GlcN6P cofactor. Overall, our calculations help to explain the crucial roles of G40 (as a general base) and GlcN6P (as a general acid) during glmS ribozyme self-cleavage. In addition, we show that the QM/MM description of the glmS ribozyme self-cleavage reaction is significantly more sensitive to the size of the QM region and the quality of the QM-MM coupling than that of other small ribozymes. PMID:25858644

  17. Lewis pair polymerization by classical and frustrated Lewis pairs: acid, base and monomer scope and polymerization mechanism.

    PubMed

    Zhang, Yuetao; Miyake, Garret M; John, Mallory G; Falivene, Laura; Caporaso, Lucia; Cavallo, Luigi; Chen, Eugene Y-X

    2012-08-14

    induction period, and the polymerization is significantly catalyzed by the LA, thus pointing to a bimetallic, activated monomer propagation mechanism. Computational study on the active species formation as well as the chain initiation and propagation events involved in the LPP of MMA with some of the most representative LPs has added our understanding of fundamental steps of LPP. The main difference between NHC and PR(3) bases is in the energetics of zwitterion formation, with the NHC-based zwitterions being remarkably more stable than the PR(3)-based zwitterions. Comparison of the monometallic and bimetallic mechanisms for MMA addition shows a clear preference for the bimetallic mechanism. PMID:22614678

  18. Electrochemical characterization of surface complexes formed on Cu and Ta in succinic acid based solutions used for chemical mechanical planarization

    NASA Astrophysics Data System (ADS)

    Sulyma, Christopher M.; Roy, Dipankar

    2010-02-01

    Open-circuit potential measurements, cyclic voltammetry and Fourier transform impedance spectroscopy have been used to study pH dependent surface reactions of Cu and Ta rotating disc electrodes (RDEs) in aqueous solutions of succinic acid (SA, a complexing agent), hydrogen peroxide (an oxidizer), and ammonium dodecyl sulfate (ADS, a corrosion inhibitor for Cu). The surface chemistries of these systems are relevant for the development of a single-slurry approach to chemical mechanical planarization (CMP) of Cu lines and Ta barriers in the fabrication of semiconductor devices. It is shown that in non-alkaline solutions of H 2O 2, the SA-promoted surface complexes of Cu and Ta can potentially support chemically enhanced material removal in low-pressure CMP of surface topographies overlying fragile low-k dielectrics. ADS can suppress Cu dissolution without significantly affecting the surface chemistry of Ta. The data analysis steps are discussed in detail to demonstrate how the D.C. and A.C. electrochemical probes can be combined in the framework of the RDE technique to design and test CMP slurry solutions.

  19. Acid-base chemistry

    SciTech Connect

    Hand, C.W.; Blewit, H.L.

    1985-01-01

    The book is not a research compendium and there are no references to the literature. It is a teaching text covering the entire range of undergraduate subject matter dealing with acid-base chemistry (some of it remotely) as taught in inorganic, analytical, and organic chemistry courses. The excellent chapters VII through IX deal in detail with the quantitative aspects of aqueous acid-base equilibria (salt hydrolysis and buffer, titrations, polyprotic and amphoteric substances).

  20. Molecular regulatory mechanisms of osteoclastogenesis through cytoprotective enzymes

    PubMed Central

    Kanzaki, Hiroyuki; Shinohara, Fumiaki; Kanako, Itohiya; Yamaguchi, Yuuki; Fukaya, Sari; Miyamoto, Yutaka; Wada, Satoshi; Nakamura, Yoshiki

    2016-01-01

    It has been reported that reactive oxygen species (ROS), such as hydrogen peroxide and superoxide, take part in osteoclast differentiation as intra-cellular signaling molecules. The current assumed signaling cascade from RANK to ROS production is RANK, TRAF6, Rac1, and then Nox. The target molecules of ROS in RANKL signaling remain unclear; however, several reports support the theory that NF-κB signaling could be the crucial downstream signaling molecule of RANKL-mediated ROS signaling. Furthermore, ROS exert cytotoxic effects such as peroxidation of lipids and phospholipids and oxidative damage to proteins and DNA. Therefore, cells have several protective mechanisms against oxidative stressors that mainly induce cytoprotective enzymes and ROS scavenging. Three well-known mechanisms regulate cytoprotective enzymes including Nrf2-, FOXO-, and sirtuin-dependent mechanisms. Several reports have indicated a crosslink between FOXO- and sirtuin-dependent regulatory mechanisms. The agonists against the regulatory mechanisms are reported to induce these cytoprotective enzymes successfully. Some of them inhibit osteoclast differentiation and bone destruction via attenuation of intracellular ROS signaling. In this review article, we discuss the above topics and summarize the current information available on the relationship between cytoprotective enzymes and osteoclastogenesis. PMID:26795736

  1. Molecular regulatory mechanisms of osteoclastogenesis through cytoprotective enzymes.

    PubMed

    Kanzaki, Hiroyuki; Shinohara, Fumiaki; Kanako, Itohiya; Yamaguchi, Yuuki; Fukaya, Sari; Miyamoto, Yutaka; Wada, Satoshi; Nakamura, Yoshiki

    2016-08-01

    It has been reported that reactive oxygen species (ROS), such as hydrogen peroxide and superoxide, take part in osteoclast differentiation as intra-cellular signaling molecules. The current assumed signaling cascade from RANK to ROS production is RANK, TRAF6, Rac1, and then Nox. The target molecules of ROS in RANKL signaling remain unclear; however, several reports support the theory that NF-κB signaling could be the crucial downstream signaling molecule of RANKL-mediated ROS signaling. Furthermore, ROS exert cytotoxic effects such as peroxidation of lipids and phospholipids and oxidative damage to proteins and DNA. Therefore, cells have several protective mechanisms against oxidative stressors that mainly induce cytoprotective enzymes and ROS scavenging. Three well-known mechanisms regulate cytoprotective enzymes including Nrf2-, FOXO-, and sirtuin-dependent mechanisms. Several reports have indicated a crosslink between FOXO- and sirtuin-dependent regulatory mechanisms. The agonists against the regulatory mechanisms are reported to induce these cytoprotective enzymes successfully. Some of them inhibit osteoclast differentiation and bone destruction via attenuation of intracellular ROS signaling. In this review article, we discuss the above topics and summarize the current information available on the relationship between cytoprotective enzymes and osteoclastogenesis. PMID:26795736

  2. Lung compliance, plasma electrolyte levels and acid-base balance are affected by scorpion envenomation in anesthetized rats under mechanical ventilation.

    PubMed

    Andrade, Marcus V; Caramez, Maria Paula R; Abreu, Elnara Marcia N N; Dolnikoff, Marisa; Omar, Erick D; Velasco, Irineu T; Cunha-Melo, José R

    2004-05-01

    To determine the effects of Tityus serrulatus scorpion toxin on lung compliance and resistance, ionic equilibrium and acid-base balance over time in anesthetized and mechanically ventilated rats, we measured air flow, tracheal and esophageal pressure. Lung volume was obtained by electronic integration of airflow signal. Arterial blood samples were collected through a catheter at baseline (before) and 5, 15, 30 and 60 min after scorpion toxin injection for arterial blood gases, bicarbonate, and alkali reserve levels as well as for, sodium, potassium, magnesium, glucose, lactate, hematocrit, and osmolality analysis. Injection of the gamma fraction of the T. serrulatus scorpion venom in rats under mechanical ventilatory support leads to a continuous decrease in lung compliance secondary to pulmonary edema, but no change in airway resistance. The changes in arterial blood gases characterizing metabolic acidosis were accompanied by an increase in arterial lactate and glucose values, suggesting a scorpion toxin-induced lactic acidosis, in association with poor tissue perfusion (hypotension and low cardiac output). Moreover, scorpion toxin injection resulted in hyperosmolality, hyperkalemia, hypermagnesemia and an increase in hematocrit. The experiments have shown a clinically relevant animal model to study severe scorpion envenoming and may help to better understand the scorpion envenoming syndrome. PMID:15313452

  3. Regulatory mechanisms of EGFR signalling during Drosophila eye development.

    PubMed

    Malartre, Marianne

    2016-05-01

    EGFR signalling is a well-conserved signalling pathway playing major roles during development and cancers. This review explores what studying the EGFR pathway during Drosophila eye development has taught us in terms of the diversity of its regulatory mechanisms. This model system has allowed the identification of numerous positive and negative regulators acting at specific time and place, thus participating to the tight control of signalling. EGFR signalling regulation is achieved by a variety of mechanisms, including the control of ligand processing, the availability of the receptor itself and the transduction of the cascade in the cytoplasm. Ultimately, the transcriptional responses contribute to the establishment of positive and negative feedback loops. The combination of these multiple mechanisms employed to regulate the EGFR pathway leads to specific cellular outcomes involved in functions as diverse as the acquisition of cell fate, proliferation, survival, adherens junction remodelling and morphogenesis. PMID:26935860

  4. Molecular and Cellular Regulatory Mechanisms of Tongue Myogenesis

    PubMed Central

    Parada, C.; Han, D.; Chai, Y.

    2012-01-01

    The tongue exerts crucial functions in our daily life. However, we know very little about the regulatory mechanisms of mammalian tongue development. In this review, we summarize recent findings of the molecular and cellular mechanisms that control tissue-tissue interactions during tongue morphogenesis. Specifically, cranial neural crest cells (CNCC) lead the initiation of tongue bud formation and contribute to the interstitial connective tissue, which ultimately compartmentalizes tongue muscles and serves as their attachments. Occipital somite-derived cells migrate into the tongue primordium and give rise to muscle cells in the tongue. The intimate relationship between CNCC- and mesoderm-derived cells, as well as growth and transcription factors that have been shown to be crucial for tongue myogenesis, clearly indicate that tissue-tissue interactions play an important role in regulating tongue morphogenesis. PMID:22219210

  5. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms.

    PubMed

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-03-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  6. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms

    PubMed Central

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-01-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  7. Acid-Base Homeostasis

    PubMed Central

    Nakhoul, Nazih; Hering-Smith, Kathleen S.

    2015-01-01

    Acid-base homeostasis and pH regulation are critical for both normal physiology and cell metabolism and function. The importance of this regulation is evidenced by a variety of physiologic derangements that occur when plasma pH is either high or low. The kidneys have the predominant role in regulating the systemic bicarbonate concentration and hence, the metabolic component of acid-base balance. This function of the kidneys has two components: reabsorption of virtually all of the filtered HCO3− and production of new bicarbonate to replace that consumed by normal or pathologic acids. This production or generation of new HCO3− is done by net acid excretion. Under normal conditions, approximately one-third to one-half of net acid excretion by the kidneys is in the form of titratable acid. The other one-half to two-thirds is the excretion of ammonium. The capacity to excrete ammonium under conditions of acid loads is quantitatively much greater than the capacity to increase titratable acid. Multiple, often redundant pathways and processes exist to regulate these renal functions. Derangements in acid-base homeostasis, however, are common in clinical medicine and can often be related to the systems involved in acid-base transport in the kidneys. PMID:26597304

  8. The Molecular Mechanisms of Regulatory T Cell Immunosuppression

    PubMed Central

    Pandiyan, Pushpa; Zheng, Lixin; Lenardo, Michael J.

    2011-01-01

    CD4+CD25+Foxp3+ T lymphocytes, known as regulatory T cells or Tregs, have been proposed to be a lineage of professional immune suppressive cells that exclusively counteract the effects of the immunoprotective “helper” and “cytotoxic” lineages of T lymphocytes. Here we discuss new concepts on the mechanisms and functions of Tregs. There are several key points we emphasize: 1. Tregs exert suppressive effects both directly on effector T cells and indirectly through antigen-presenting cells; 2. Regulation can occur through a novel mechanism of cytokine consumption to regulate as opposed to the usual mechanism of cytokine/chemokine production; 3. In cases where CD4+ effector T cells are directly inhibited by Tregs, it is chiefly through a mechanism of lymphokine withdrawal apoptosis leading to polyclonal deletion; and 4. Contrary to the current view, we discuss new evidence that Tregs, similar to other T-cells lineages, can promote protective immune responses in certain infectious contexts (Chen et al., 2011; Pandiyan et al., 2011). Although these points are at variance to varying degrees with the standard model of Treg behavior, we will recount developing findings that support these new concepts. PMID:22566849

  9. The prion hypothesis: from biological anomaly to basic regulatory mechanism

    PubMed Central

    Tuite, Mick F; Serio, Tricia R

    2010-01-01

    Preface Prions are unusual proteinaceous infectious agents that are typically associated with a class of fatal degenerative diseases of the mammalian brain. However, the discovery of fungal prions, which are not associated with disease, suggests that we must now consider the impact of these factors on basic cellular physiology in a different light. Fungal prions are epigenetic determinants that can alter a range of cellular processes, including metabolism and gene expression pathways, and these changes can lead to a range of prion-associated phenotypes. The mechanistic similarities between prion propagation in mammals and fungi suggest that prions are not a biological anomaly but instead are a new appreciated and perhaps ubiquitous regulatory mechanism. PMID:21081963

  10. Emerging regulatory mechanisms in ubiquitin-dependent cell cycle control

    PubMed Central

    Mocciaro, Annamaria; Rape, Michael

    2012-01-01

    The covalent modification of proteins with ubiquitin is required for accurate cell division in all eukaryotes. Ubiquitylation depends on an enzymatic cascade, in which E3 enzymes recruit specific substrates for modification. Among ~600 human E3s, the SCF (Skp1–cullin1–F-box) and the APC/C (anaphase-promoting complex/cyclosome) are known for driving the degradation of cell cycle regulators to accomplish irreversible cell cycle transitions. The cell cycle machinery reciprocally regulates the SCF and APC/C through various mechanisms, including the modification of these E3s or the binding of specific inhibitors. Recent studies have provided new insight into the intricate relationship between ubiquitylation and the cell division apparatus as they revealed roles for atypical ubiquitin chains, new mechanisms of substrate and E3 regulation, as well as extensive crosstalk between ubiquitylation enzymes. Here, we review these emerging regulatory mechanisms of ubiquitin-dependent cell cycle control and discuss how their manipulation might provide therapeutic benefits in the future. PMID:22357967

  11. Acid-base homeostasis in the human system

    NASA Technical Reports Server (NTRS)

    White, R. J.

    1974-01-01

    Acid-base regulation is a cooperative phenomena in vivo with body fluids, extracellular and intracellular buffers, lungs, and kidneys all playing important roles. The present account is much too brief to be considered a review of present knowledge of these regulatory systems, and should be viewed, instead, as a guide to the elements necessary to construct a simple model of the mutual interactions of the acid-base regulatory systems of the body.

  12. Mechanisms of regulatory volume increase in collecting duct cells.

    PubMed

    Fu, W J; Kuwahara, M; Cragoe, E J; Marumo, F

    1993-01-01

    To examine the mechanisms of cell volume regulation in response to hyperosmolality, segments of the inner stripe of rabbit outer medullary collecting duct (OMCDi) were perfused in vitro. The cross-sectional area of the tubule was monitored as an index of the relative cell volume. When luminal and basolateral osmolalities were increased from 290 to 390 mOsm simultaneously, the tubule cell shrank instantaneously and reswelled gradually, showing the so-called regulatory volume increase (RVI). Basolateral Na+ removal and addition of basolateral ethyl isopropyl amiloride (EIPA) decreased the RVI response by 76 and 66%, respectively. By contrast, apical Na+ removal had no effect on this response. RVI response was also inhibited by basolateral, but not luminal, Cl- removal (-63%), by total HCO3- removal (-74%), and by adding basolateral 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS) (-62%). Intracellular pH did not change significantly during RVI. Vasopressin increased RVI response by 56%. However, this increase was abolished in the absence of basolateral Na+ and Cl-, and in the presence of basolateral EIPA and DIDS. These results suggest that major mechanisms responsible for RVI are Na(+)-H+ and Cl(-)-HCO3- exchange systems in the basolateral membrane, and that these systems are stimulated by vasopressin in rabbit OMCDi. PMID:8007444

  13. T-cell regulatory mechanisms in specific immunotherapy.

    PubMed

    Jutel, Marek; Akdis, Cezmi A

    2008-01-01

    Allergen-specific immunotherapy (SIT) is the only treatment which leads to a lifelong tolerance against previously disease-causing allergens due to restoration of normal immunity against allergens. The description of T-regulatory (Treg) cells being involved in prevention of sensitization to allergens has led to great interest whether they represent a major target for allergen-SIT and whether it would be possible to manipulate Treg cells to increase its efficacy. Activationinduced cell death, anergy and/or immune response modulation by Treg cells are essential mechanisms of peripheral T-cell tolerance. There is growing evidence that anergy, tolerance and active suppression are not entirely distinct, but rather represent linked mechanisms possibly involving the same cells and multiple suppressor mechanisms. Skewing of allergen-specific effector T cells to Treg cells appears as a crucial event in the control of healthy immune response to allergens and successful allergen-SIT. The Treg cell response is characterized by abolished allergen- induced specific T-cell proliferation and suppressed Thelper (Th)1- and Th2-type cytokine secretion. In addition, mediators of allergic inflammation that trigger cAMP-associated G-protein-coupled receptors, such as histamine receptor-2, may contribute to peripheral tolerance mechanisms. The increased levels of interleukin-10 and transforming growth factor-Beta that are produced by Treg cells potently suppress IgE production, while simultaneously increasing production of non-inflammatory isotypes IgG4 and IgA, respectively. In addition, Treg cells directly or indirectly suppress effector cells of allergic inflammation such as mast cells, basophils and eosinophils. In conclusion, peripheral tolerance to allergens is controlled by multiple active suppression mechanisms. It is associated with regulation of antibody isotypes and effector cells to the direction of a healthy immune response. By the application of the recent knowledge in Treg

  14. Redox-switch regulatory mechanism of thiolase from Clostridium acetobutylicum

    PubMed Central

    Kim, Sangwoo; Jang, Yu-Sin; Ha, Sung-Chul; Ahn, Jae-Woo; Kim, Eun-Jung; Hong Lim, Jae; Cho, Changhee; Shin Ryu, Yong; Kuk Lee, Sung; Lee, Sang Yup; Kim, Kyung-Jin

    2015-01-01

    Thiolase is the first enzyme catalysing the condensation of two acetyl-coenzyme A (CoA) molecules to form acetoacetyl-CoA in a dedicated pathway towards the biosynthesis of n-butanol, an important solvent and biofuel. Here we elucidate the crystal structure of Clostridium acetobutylicum thiolase (CaTHL) in its reduced/oxidized states. CaTHL, unlike those from other aerobic bacteria such as Escherichia coli and Zoogloea ramegera, is regulated by the redox-switch modulation through reversible disulfide bond formation between two catalytic cysteine residues, Cys88 and Cys378. When CaTHL is overexpressed in wild-type C. acetobutylicum, butanol production is reduced due to the disturbance of acidogenic to solventogenic shift. The CaTHLV77Q/N153Y/A286K mutant, which is not able to form disulfide bonds, exhibits higher activity than wild-type CaTHL, and enhances butanol production upon overexpression. On the basis of these results, we suggest that CaTHL functions as a key enzyme in the regulation of the main metabolism of C. acetobutylicum through a redox-switch regulatory mechanism. PMID:26391388

  15. A fundamental approach to adhesion: Synthesis, surface analysis, thermodynamics and mechanics. [acid-base properties of titanium 6-4 surfaces

    NASA Technical Reports Server (NTRS)

    Siriwardane, R.; Wightman, J. P.

    1980-01-01

    The acid-base properties of titanium 6-4 plates (low surface area) were investigated after three different pretreatments, namely Turco, phosphate-fluoride and Pasa-Jell. A series of indicators was used and color changes were detected using diffuse reflectance visible spectroscopy. Electron spectroscopy for chemical analysis was used to examine the indicator on the Ti 6-4 surface. Specular reflectance infra-red spectroscopy was used to study the adsorption of stearic acid from cyclohexane solutions on the Ti 6-4 surface.

  16. The Cellular and Molecular Mechanisms of Immuno-Suppression by Human Type 1 Regulatory T Cells

    PubMed Central

    Gregori, Silvia; Goudy, Kevin S.; Roncarolo, Maria Grazia

    2011-01-01

    The immuno-regulatory mechanisms of IL-10-producing type 1 regulatory T (Tr1) cells have been widely studied over the years. However, several recent discoveries have shed new light on the cellular and molecular mechanisms that human Tr1 cells use to control immune responses and induce tolerance. In this review we outline the well known and newly discovered regulatory properties of human Tr1 cells and provide an in-depth comparison of the known suppressor mechanisms of Tr1 cells with FOXP3+ Treg. We also highlight the role that Tr1 cells play in promoting and maintaining tolerance in autoimmunity, allergy, and transplantation. PMID:22566914

  17. Structural imprints in vivo decode RNA regulatory mechanisms

    PubMed Central

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-01-01

    Visualizing the physical basis for molecular behavior inside living cells is a grand challenge in biology. RNAs are central to biological regulation, and RNA’s ability to adopt specific structures intimately controls every step of the gene expression program1. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles view only two of four nucleotides that make up RNA2,3. Here we present a novel biochemical approach, In Vivo Click SHAPE (icSHAPE), that enables the first global view of RNA secondary structures of all four bases in living cells. icSHAPE of mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguishes different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA binding proteins or RNA modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome-wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression. PMID:25799993

  18. Structural imprints in vivo decode RNA regulatory mechanisms

    NASA Astrophysics Data System (ADS)

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-03-01

    Visualizing the physical basis for molecular behaviour inside living cells is a great challenge for biology. RNAs are central to biological regulation, and the ability of RNA to adopt specific structures intimately controls every step of the gene expression program. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles include only two of the four nucleotides that make up RNA. Here we present a novel biochemical approach, in vivo click selective 2'-hydroxyl acylation and profiling experiment (icSHAPE), which enables the first global view, to our knowledge, of RNA secondary structures in living cells for all four bases. icSHAPE of the mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguish different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro conditions, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA-binding proteins or RNA-modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression.

  19. Transcription factor-microRNA synergistic regulatory network revealing the mechanism of polycystic ovary syndrome

    PubMed Central

    LIU, HAI-YING; HUANG, YU-LING; LIU, JIAN-QIAO; HUANG, QING

    2016-01-01

    Polycystic ovary syndrome (PCOS) is the most common type of endocrine disorder, affecting 5–11% of women of reproductive age worldwide. Transcription factors (TFs) and microRNAs are considered to have crucial roles in the developmental process of several diseases and have synergistic regulatory actions. However, the effects of TFs and microRNAs, and the patterns of their cooperation in the synergistic regulatory network of PCOS, remain to be elucidated. The present study aimed to determine the possible mechanism of PCOS, based on a TF-microRNA synergistic regulatory network. Initially, the differentially expressed genes (DEGs) in PCOS were identified using microarray data of the GSE34526 dataset. Subsequently, the TFs and microRNAs which regulated the DEGs of PCOS were identified, and a PCOS-associated TF-microRNA synergistic regulatory network was constructed. This network included 195 DEGs, 136 TFs and 283 microRNAs, and the DEGs were regulated by TFs and microRNAs. Based on topological and functional enrichment analyses, SP1, mir-355-5p and JUN were identified as potentially crucial regulators in the development of PCOS and in characterizing the regulatory mechanism. In conclusion, the TF-microRNA synergistic regulatory network constructed in the present study provides novel insight on the molecular mechanism of PCOS in the form of synergistic regulated model. PMID:27035648

  20. Transcription factor‑microRNA synergistic regulatory network revealing the mechanism of polycystic ovary syndrome.

    PubMed

    Liu, Hai-Ying; Huang, Yu-Ling; Liu, Jian-Qiao; Huang, Qing

    2016-05-01

    Polycystic ovary syndrome (PCOS) is the most common type of endocrine disorder, affecting 5‑11% of women of reproductive age worldwide. Transcription factors (TFs) and microRNAs are considered to have crucial roles in the developmental process of several diseases and have synergistic regulatory actions. However, the effects of TFs and microRNAs, and the patterns of their cooperation in the synergistic regulatory network of PCOS, remain to be elucidated. The present study aimed to determine the possible mechanism of PCOS, based on a TF‑microRNA synergistic regulatory network. Initially, the differentially expressed genes (DEGs) in PCOS were identified using microarray data of the GSE34526 dataset. Subsequently, the TFs and microRNAs which regulated the DEGs of PCOS were identified, and a PCOS‑associated TF‑microRNA synergistic regulatory network was constructed. This network included 195 DEGs, 136 TFs and 283 microRNAs, and the DEGs were regulated by TFs and microRNAs. Based on topological and functional enrichment analyses, SP1, mir‑355‑5p and JUN were identified as potentially crucial regulators in the development of PCOS and in characterizing the regulatory mechanism. In conclusion, the TF‑microRNA synergistic regulatory network constructed in the present study provides novel insight on the molecular mechanism of PCOS in the form of synergistic regulated model. PMID:27035648

  1. Translational regulatory mechanisms in persistent forms of synaptic plasticity.

    PubMed

    Kelleher, Raymond J; Govindarajan, Arvind; Tonegawa, Susumu

    2004-09-30

    Memory and synaptic plasticity exhibit distinct temporal phases, with long-lasting forms distinguished by their dependence on macromolecular synthesis. Prevailing models for the molecular mechanisms underlying long-lasting synaptic plasticity have largely focused on transcriptional regulation. However, a growing body of evidence now supports a crucial role for neuronal activity-dependent mRNA translation, which may occur in dendrites for a subset of neuronal mRNAs. Recent work has begun to define the signaling mechanisms coupling synaptic activation to the protein synthesis machinery. The ERK and mTOR signaling pathways have been shown to regulate the activity of the general translational machinery, while the translation of particular classes of mRNAs is additionally controlled by gene-specific mechanisms. Rapid enhancement of the synthesis of a diverse array of neuronal proteins through such mechanisms provides the components necessary for persistent forms of LTP and LTD. These findings have important implications for the synapse specificity and associativity of protein synthesis-dependent changes in synaptic strength. PMID:15450160

  2. Potential self-regulatory mechanisms of yoga for psychological health

    PubMed Central

    Gard, Tim; Noggle, Jessica J.; Park, Crystal L.; Vago, David R.; Wilson, Angela

    2014-01-01

    Research suggesting the beneficial effects of yoga on myriad aspects of psychological health has proliferated in recent years, yet there is currently no overarching framework by which to understand yoga’s potential beneficial effects. Here we provide a theoretical framework and systems-based network model of yoga that focuses on integration of top-down and bottom-up forms of self-regulation. We begin by contextualizing yoga in historical and contemporary settings, and then detail how specific components of yoga practice may affect cognitive, emotional, behavioral, and autonomic output under stress through an emphasis on interoception and bottom-up input, resulting in physical and psychological health. The model describes yoga practice as a comprehensive skillset of synergistic process tools that facilitate bidirectional feedback and integration between high- and low-level brain networks, and afferent and re-afferent input from interoceptive processes (somatosensory, viscerosensory, chemosensory). From a predictive coding perspective we propose a shift to perceptual inference for stress modulation and optimal self-regulation. We describe how the processes that sub-serve self-regulation become more automatized and efficient over time and practice, requiring less effort to initiate when necessary and terminate more rapidly when no longer needed. To support our proposed model, we present the available evidence for yoga affecting self-regulatory pathways, integrating existing constructs from behavior theory and cognitive neuroscience with emerging yoga and meditation research. This paper is intended to guide future basic and clinical research, specifically targeting areas of development in the treatment of stress-mediated psychological disorders. PMID:25368562

  3. The beginning of a seed: regulatory mechanisms of double fertilization

    PubMed Central

    Bleckmann, Andrea; Alter, Svenja; Dresselhaus, Thomas

    2014-01-01

    The launch of seed development in flowering plants (angiosperms) is initiated by the process of double fertilization: two male gametes (sperm cells) fuse with two female gametes (egg and central cell) to form the precursor cells of the two major seed components, the embryo and endosperm, respectively. The immobile sperm cells are delivered by the pollen tube toward the ovule harboring the female gametophyte by species-specific pollen tube guidance and attraction mechanisms. After pollen tube burst inside the female gametophyte, the two sperm cells fuse with the egg and central cell initiating seed development. The fertilized central cell forms the endosperm while the fertilized egg cell, the zygote, will form the actual embryo and suspensor. The latter structure connects the embryo with the sporophytic maternal tissues of the developing seed. The underlying mechanisms of double fertilization are tightly regulated to ensure delivery of functional sperm cells and the formation of both, a functional zygote and endosperm. In this review we will discuss the current state of knowledge about the processes of directed pollen tube growth and its communication with the synergid cells resulting in pollen tube burst, the interaction of the four gametes leading to cell fusion and finally discuss mechanisms how flowering plants prevent multiple sperm cell entry (polyspermy) to maximize their reproductive success. PMID:25309552

  4. Genetic control and regulatory mechanisms of succinoglycan and curdlan biosynthesis in genus Agrobacterium.

    PubMed

    Wu, Dan; Li, Ang; Ma, Fang; Yang, Jixian; Xie, Yutong

    2016-07-01

    Agrobacterium is a genus of gram-negative bacteria that can produce several typical exopolysaccharides with commercial uses in the food and pharmaceutical fields. In particular, succinoglycan and curdlan, due to their good quality in high yield, have been employed on an industrial scale comparatively early. Exopolysaccharide biosynthesis is a multiple-step process controlled by different functional genes, and various environmental factors cause changes in exopolysaccharide biosynthesis through regulatory mechanisms. In this mini-review, we focus on the genetic control and regulatory mechanisms of succinoglycan and curdlan produced by Agrobacterium. Some key functional genes and regulatory mechanisms for exopolysaccharide biosynthesis are described, possessing a high potential for application in metabolic engineering to modify exopolysaccharide production and physicochemical properties. This review may contribute to the understanding of exopolysaccharide biosynthesis and exopolysaccharide modification by metabolic engineering methods in Agrobacterium. PMID:27255488

  5. Structure of the TRPA1 ion channel suggests regulatory mechanisms

    PubMed Central

    Paulsen, Candice E.; Armache, Jean-Paul; Gao, Yuan; Cheng, Yifan; Julius, David

    2015-01-01

    The TRPA1 ion channel (a.k.a the ‘wasabi receptor’) is a detector of noxious chemical agents encountered in our environment or produced endogenously during tissue injury or drug metabolism. These include a broad class of electrophiles that activate the channel through covalent protein modification. TRPA1 antagonists hold potential for treating neurogenic inflammatory conditions provoked or exacerbated by irritant exposure. Despite compelling reasons to understand TRPA1 function, structural mechanisms underlying channel regulation remain obscure. Here, we use single-particle electron cryo-microscopy to determine the structure of full-length human TRPA1 to ~4Å resolution in the presence of pharmacophores, including a potent antagonist. A number of unexpected features are revealed, including an extensive coiled-coil assembly domain stabilized by polyphosphate co-factors and a highly integrated nexus that converges on an unpredicted TRP-like allosteric domain. These findings provide novel insights into mechanisms of TRPA1 regulation, and establish a blueprint for structure-based design of analgesic and anti-inflammatory agents. PMID:25855297

  6. Salt secretion is linked to acid-base regulation of ionocytes in seawater-acclimated medaka: new insights into the salt-secreting mechanism.

    PubMed

    Liu, Sian-Tai; Horng, Jiun-Lin; Chen, Po-Yen; Hwang, Pung-Pung; Lin, Li-Yih

    2016-01-01

    Ionocytes in the skin and gills of seawater (SW) teleosts are responsible for both salt and acid secretion. However, the mechanism through which ionocytes secrete acid is still unclear. Here, we hypothesized that apical Na(+)/H(+) exchangers (NHE2/3), carbonic anhydrase (CA2-like), and basolateral HCO3(-)/Cl(-) exchanger (AE1) are involved in acid secretion. In addition, the hypothesized involvement of basolateral AE1 suggested that acid secretion may be linked to Cl(-) secretion by ionocytes. The scanning ion-selective electrode technique (SIET) was used to measure H(+) and Cl(-) secretion by ionocytes in the skin of medaka larvae acclimated to SW. Treatment with inhibitors of NHE, CA, and AE suppressed both H(+) and Cl(-) secretion by ionocytes. Short-term exposure to hypercapnic SW stimulated both H(+) and Cl(-) secretion. mRNA of CA2-like and AE1 were localized to ionocytes in the skin. Branchial mRNA levels of NKCC1a, CA2-like, and AE1a increased together with the salinity to which fish were acclimated. In addition, both AE1a and AE1b mRNA increased in fish acclimated to acidified (pH 7) SW; NKCC1a mRNA increased in fish acclimated to pH 9 SW. This study reveals the mechanism of H(+) secretion by ionocytes, and refines our understanding of the well-established mechanism of Cl(-) secretion by ionocytes of SW fish. PMID:27511107

  7. Salt secretion is linked to acid-base regulation of ionocytes in seawater-acclimated medaka: new insights into the salt-secreting mechanism

    PubMed Central

    Liu, Sian-Tai; Horng, Jiun-Lin; Chen, Po-Yen; Hwang, Pung-Pung; Lin, Li-Yih

    2016-01-01

    Ionocytes in the skin and gills of seawater (SW) teleosts are responsible for both salt and acid secretion. However, the mechanism through which ionocytes secrete acid is still unclear. Here, we hypothesized that apical Na+/H+ exchangers (NHE2/3), carbonic anhydrase (CA2-like), and basolateral HCO3−/Cl− exchanger (AE1) are involved in acid secretion. In addition, the hypothesized involvement of basolateral AE1 suggested that acid secretion may be linked to Cl− secretion by ionocytes. The scanning ion-selective electrode technique (SIET) was used to measure H+ and Cl− secretion by ionocytes in the skin of medaka larvae acclimated to SW. Treatment with inhibitors of NHE, CA, and AE suppressed both H+ and Cl− secretion by ionocytes. Short-term exposure to hypercapnic SW stimulated both H+ and Cl− secretion. mRNA of CA2-like and AE1 were localized to ionocytes in the skin. Branchial mRNA levels of NKCC1a, CA2-like, and AE1a increased together with the salinity to which fish were acclimated. In addition, both AE1a and AE1b mRNA increased in fish acclimated to acidified (pH 7) SW; NKCC1a mRNA increased in fish acclimated to pH 9 SW. This study reveals the mechanism of H+ secretion by ionocytes, and refines our understanding of the well-established mechanism of Cl− secretion by ionocytes of SW fish. PMID:27511107

  8. Ser/Thr phosphorylation as a regulatory mechanism in bacteria

    PubMed Central

    Dworkin, Jonathan

    2015-01-01

    This review will discuss some recent work describing the role of Ser/Thr phosphorylation as a post-translational mechanism of regulation in bacteria. I will discuss the interaction between bacterial eukaryotic-like Ser/Thr kinases (eSTKs) and two-component systems as well as hints as to physiological function of eSTKs and their cognate eukaryotic-like phosphatases (eSTPs). In particular, I will highlight the role of eSTKs and eSTPs in the regulation of peptidoglycan metabolism and protein synthesis. In addition, I will discuss how data from phosphoproteomic surveys suggests that Ser/Thr phosphorylation plays a much more significant physiological role than would be predicted simply based on in vivo and in vitro analyses of individual kinases. PMID:25625314

  9. Gap junction-mediated electrical transmission: regulatory mechanisms and plasticity

    PubMed Central

    Pereda, Alberto E.; Curti, Sebastian; Hoge, Gregory; Cachope, Roger; Flores, Carmen E.; Rash, John E.

    2012-01-01

    The term synapse applies to cellular specializations that articulate the processing of information within neural circuits by providing a mechanism for the transfer of information between two different neurons. There are two main modalities of synaptic transmission: chemical and electrical. While most efforts have been dedicated to the understanding of the properties and modifiability of chemical transmission, less is still known regarding the plastic properties of electrical synapses, whose structural correlate is the gap junction. A wealth of data indicates that, rather than passive intercellular channels, electrical synapses are more dynamic and modifiable than was generally perceived. This article will discuss the factors determining the strength of electrical transmission and review current evidence demonstrating its dynamic properties. Like their chemical counterparts, electrical synapses can also be plastic and modifiable. PMID:22659675

  10. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    PubMed Central

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  11. Novel RNA regulatory mechanisms revealed in the epitranscriptome.

    PubMed

    Saletore, Yogesh; Chen-Kiang, Selina; Mason, Christopher E

    2013-03-01

    Methyl-6-adenosine (m (6)A) has been hypothesized to exist since the 1970s, (1) but little has been known about the specific RNAs, or sites within them, that are affected by this RNA modification. Here, we report that recent work has shown RNA modifications like m (6)A, collectively called the "epitranscriptome," are a pervasive feature of mammalian cells and likely play a role in development and disease. An enrichment of m (6)A near the last CDS of thousands of genes has implicated m (6)A in transcript processing, translational regulation and potentially a mechanism for regulating miRNA maturation. Also, because the sites of m (6)A show strong evolutionary conservation and have been replicated in nearly identical sites between mouse and human, strong evolutionary pressures are likely being maintained for this mark. (2)(,) (3) Finally, we note that m (6)A is one of over 100 modifications of RNA that have been reported, (4) and with the combination of high-throughput, next-generation sequencing (NGS) techniques, immunoprecipitation with appropriate antibodies and splicing-aware peak-finding, the dynamics of the epitranscriptome can now be mapped and characterized to discern their specific cellular roles. PMID:23434792

  12. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus.

    PubMed

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  13. Cis-regulatory mechanisms governing stem and progenitor cell transitions

    PubMed Central

    Johnson, Kirby D.; Kong, Guangyao; Gao, Xin; Chang, Yuan-I; Hewitt, Kyle J.; Sanalkumar, Rajendran; Prathibha, Rajalekshmi; Ranheim, Erik A.; Dewey, Colin N.; Zhang, Jing; Bresnick, Emery H.

    2015-01-01

    Cis-element encyclopedias provide information on phenotypic diversity and disease mechanisms. Although cis-element polymorphisms and mutations are instructive, deciphering function remains challenging. Mutation of an intronic GATA motif (+9.5) in GATA2, encoding a master regulator of hematopoiesis, underlies an immunodeficiency associated with myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). Whereas an inversion relocalizes another GATA2 cis-element (−77) to the proto-oncogene EVI1, inducing EVI1 expression and AML, whether this reflects ectopic or physiological activity is unknown. We describe a mouse strain that decouples −77 function from proto-oncogene deregulation. The −77−/− mice exhibited a novel phenotypic constellation including late embryonic lethality and anemia. The −77 established a vital sector of the myeloid progenitor transcriptome, conferring multipotentiality. Unlike the +9.5−/− embryos, hematopoietic stem cell genesis was unaffected in −77−/− embryos. These results illustrate a paradigm in which cis-elements in a locus differentially control stem and progenitor cell transitions, and therefore the individual cis-element alterations cause unique and overlapping disease phenotypes. PMID:26601269

  14. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  15. Mechanical properties of a waterborne pressure-sensitive adhesive with a percolating poly(acrylic acid)-based diblock copolymer network: effect of pH.

    PubMed

    Gurney, Robert S; Morse, Andrew; Siband, Elodie; Dupin, Damien; Armes, Steven P; Keddie, Joseph L

    2015-06-15

    Copolymerizing an acrylic acid comonomer is often beneficial for the adhesive properties of waterborne pressure-sensitive adhesives (PSAs). Here, we demonstrate a new strategy in which poly(acrylic acid) (PAA) is distributed as a percolating network within a PSA film formed from a polymer colloid. A diblock copolymer composed of PAA and poly(n-butyl acrylate) (PBA) blocks was synthesized using reversible addition-fragmentation chain transfer (RAFT) polymerization and adsorbed onto soft acrylic latex particles prior to their film formation. The thin adsorbed shells on the particles create a percolating network that raises the elastic modulus, creep resistance and tensile strength of the final film. When the film formation occurs at pH 10, ionomeric crosslinking occurs, and high tack adhesion is obtained in combination with high creep resistance. The results show that the addition of an amphiphilic PAA-b-PBA diblock copolymer (2.0 wt.%) to a soft latex provides a simple yet effective means of adjusting the mechanical and adhesive properties of the resulting composite film. PMID:25706199

  16. Multiple regulatory mechanisms in the chloroplast of green algae: relation to hydrogen production.

    PubMed

    Antal, Taras K; Krendeleva, Tatyana E; Tyystjärvi, Esa

    2015-09-01

    A complex regulatory network in the chloroplast of green algae provides an efficient tool for maintenance of energy and redox balance in the cell under aerobic and anaerobic conditions. In this review, we discuss the structural and functional organizations of electron transport pathways in the chloroplast, and regulation of photosynthesis in the green microalga Chlamydomonas reinhardtii. The focus is on the regulatory mechanisms induced in response to nutrient deficiency stress and anoxia and especially on the role of a hydrogenase-mediated reaction in adaptation to highly reducing conditions and ATP deficiency in the cell. PMID:25986411

  17. Control and regulatory mechanisms associated with thermogenesis in flying insects and birds.

    PubMed

    Loli, Denise; Bicudo, José Eduardo P W

    2005-01-01

    Most insects and birds are able to fly. The chitin made exoskeleton of insects poses them several constraints, and this is one the reasons they are in general small sized animals. On the other hand, because birds possess an endoskeleton made of bones they may grow much larger when compared to insects. The two taxa are quite different with regards to their general "design" platform, in particular with respect to their respiratory and circulatory systems. However, because they fly, they may share in common several traits, namely those associated with the control and regulatory mechanisms governing thermogenesis. High core temperatures are essential for animal flight irrespective of the taxa they belong to. Birds and insects have thus evolved mechanisms which allowed them to control and regulate high rates of heat fluxes. This article discusses possible convergent thermogenic control and regulatory mechanisms associated with flight in insects and birds. PMID:16283551

  18. Regulatory mechanisms of immune tolerance in type 1 diabetes and their failures.

    PubMed

    Kuhn, Chantal; Besançon, Alix; Lemoine, Sébastien; You, Sylvaine; Marquet, Cindy; Candon, Sophie; Chatenoud, Lucienne

    2016-07-01

    In this brief review we propose to discuss salient data showing the importance of immune regulatory mechanisms, and in particular of Treg, for the control of pathogenic anti-β-cell response in autoimmune diabetes. Disease progression that culminates with the massive destruction of insulin-secreting β-cells and advent of hyperglycemia and glycosuria tightly correlates with a functional deficit in immune regulation. Better dissection of the cellular and molecular mechanisms through which the immune system normally sustains tolerance to "self", and which become defective when autoimmune aggression is overt, is the only direct and robust way to learn how to harness these effectively, so as to restore immune tolerance in patients with insulin-dependent type 1 diabetes. No doubt that regulatory T cells are a privileged mechanism underlying this self-tolerance in the periphery. The discovery of the key role of the transcription factor FoxP3, represented the cornerstone leading to the great advances in the field we are witnessing today. Type 1 diabetes is certainly one of the prototypic T cell-mediated autoimmune diseases where immune regulatory mechanisms relying on specialized subsets of T cells have been the most thoroughly analyzed from the fundamental point of view and also largely exploited in a translational therapeutic perspective. PMID:27216249

  19. Modeling the Regulatory Mechanisms by Which NLRX1 Modulates Innate Immune Responses to Helicobacter pylori Infection

    PubMed Central

    Philipson, Casandra W.; Bassaganya-Riera, Josep; Viladomiu, Monica; Kronsteiner, Barbara; Abedi, Vida; Hoops, Stefan; Michalak, Pawel; Kang, Lin; Girardin, Stephen E.; Hontecillas, Raquel

    2015-01-01

    Helicobacter pylori colonizes half of the world’s population as the dominant member of the gastric microbiota resulting in a lifelong chronic infection. Host responses toward the bacterium can result in asymptomatic, pathogenic or even favorable health outcomes; however, mechanisms underlying the dual role of H. pylori as a commensal versus pathogenic organism are not well characterized. Recent evidence suggests mononuclear phagocytes are largely involved in shaping dominant immunity during infection mediating the balance between host tolerance and succumbing to overt disease. We combined computational modeling, bioinformatics and experimental validation in order to investigate interactions between macrophages and intracellular H. pylori. Global transcriptomic analysis on bone marrow-derived macrophages (BMDM) in a gentamycin protection assay at six time points unveiled the presence of three sequential host response waves: an early transient regulatory gene module followed by sustained and late effector responses. Kinetic behaviors of pattern recognition receptors (PRRs) are linked to differential expression of spatiotemporal response waves and function to induce effector immunity through extracellular and intracellular detection of H. pylori. We report that bacterial interaction with the host intracellular environment caused significant suppression of regulatory NLRC3 and NLRX1 in a pattern inverse to early regulatory responses. To further delineate complex immune responses and pathway crosstalk between effector and regulatory PRRs, we built a computational model calibrated using time-series RNAseq data. Our validated computational hypotheses are that: 1) NLRX1 expression regulates bacterial burden in macrophages; and 2) early host response cytokines down-regulate NLRX1 expression through a negative feedback circuit. This paper applies modeling approaches to characterize the regulatory role of NLRX1 in mechanisms of host tolerance employed by macrophages to

  20. Type 1 regulatory T cells: a new mechanism of peripheral immune tolerance.

    PubMed

    Zeng, Hanyu; Zhang, Rong; Jin, Boquan; Chen, Lihua

    2015-09-01

    The lack of immune response to an antigen, a process known as immune tolerance, is essential for the preservation of immune homeostasis. To date, two mechanisms that drive immune tolerance have been described extensively: central tolerance and peripheral tolerance. Under the new nomenclature, thymus-derived regulatory T (tT(reg)) cells are the major mediators of central immune tolerance, whereas peripherally derived regulatory T (pT(reg)) cells function to regulate peripheral immune tolerance. A third type of T(reg) cells, termed iT(reg), represents only the in vitro-induced T(reg) cells(1). Depending on whether the cells stably express Foxp3, pT(reg), and iT(reg) cells may be divided into two subsets: the classical CD4(+)Foxp3(+) T(reg) cells and the CD4(+)Foxp3(-) type 1 regulatory T (Tr1) cells(2). This review focuses on the discovery, associated biomarkers, regulatory functions, methods of induction, association with disease, and clinical trials of Tr1 cells. PMID:26051475

  1. A SerpinB1 regulatory mechanism is essential for restricting NETosis

    PubMed Central

    Farley, Kalamo; Stolley, J Michael; Zhao, Picheng; Cooley, Jessica; Remold-O’Donnell, Eileen

    2014-01-01

    NETosis (NET generation), a programmed death pathway initiated in mature neutrophils by pathogens and inflammatory mediators, can be a protective process that sequesters microbes and prevents spread of infection, but can also be a pathological process that causes inflammation and serious tissue injury. Little is known about the regulatory mechanism. Previously we demonstrated that serpinb1-deficient mice are highly susceptible to pulmonary bacterial and viral infections due to inflammation and tissue injury associated with increased neutrophilic death. Here we used in vitro and in vivo approaches to investigate whether SerpinB1 regulates NETosis. We found that serpinb1-deficient bone marrow and lung neutrophils are hyper-susceptible to NETosis induced by multiple mediators in both NADPH-dependent and independent manner, indicating a deeply rooted regulatory role in NETosis. This role is further supported by increased nuclear expansion (representing chromatin decondensation) of PMA-treated serpinb-1-deficient neutrophils compared to wild-type, by migration of SerpinB1 from the cytoplasm to the nucleus of human neutrophils coincident with, or before, early conversion of lobulated (segmented) nuclei to delobulated (spherical) morphology, and by finding that exogenous rSerpinB1 abrogates NET production. NETosis of serpinb1-deficient neutrophils is also increased in vivo during Pseudomonas aeruginosa lung infection. The findings identify a previously unrecognized regulatory mechanism involving SerpinB1 that restricts the production of NETs. PMID:23002442

  2. Metabolic and transcriptional regulatory mechanisms underlying the anoxic adaptation of rice coleoptile.

    PubMed

    Lakshmanan, Meiyappan; Mohanty, Bijayalaxmi; Lim, Sun-Hyung; Ha, Sun-Hwa; Lee, Dong-Yup

    2014-01-01

    The ability of rice to germinate under anoxia by extending the coleoptile is a highly unusual characteristic and a key feature underpinning the ability of rice seeds to establish in such a stressful environment. The process has been a focal point for research for many years. However, the molecular mechanisms underlying the anoxic growth of the coleoptile still remain largely unknown. To unravel the key regulatory mechanisms of rice germination under anoxic stress, we combined in silico modelling with gene expression data analysis. Our initial modelling analysis via random flux sampling revealed numerous changes in rice primary metabolism in the absence of oxygen. In particular, several reactions associated with sucrose metabolism and fermentation showed a significant increase in flux levels, whereas reaction fluxes across oxidative phosphorylation, the tricarboxylic acid cycle and the pentose phosphate pathway were down-regulated. The subsequent comparative analysis of the differences in calculated fluxes with previously published gene expression data under air and anoxia identified at least 37 reactions from rice central metabolism that are transcriptionally regulated. Additionally, cis-regulatory content analyses of these transcriptionally controlled enzymes indicate a regulatory role for transcription factors such as MYB, bZIP, ERF and ZnF in transcriptional control of genes that are up-regulated during rice germination and coleoptile elongation under anoxia. PMID:24894389

  3. Novel Regulatory Mechanisms of Pathogenicity and Virulence to Combat MDR in Candida albicans

    PubMed Central

    Hameed, Saif; Fatima, Zeeshan

    2013-01-01

    Continuous deployment of antifungals in treating infections caused by dimorphic opportunistic pathogen Candida albicans has led to the emergence of drug resistance resulting in cross-resistance to many unrelated drugs, a phenomenon termed multidrug resistance (MDR). Despite the current understanding of major factors which contribute to MDR mechanisms, there are many lines of evidence suggesting that it is a complex interplay of multiple factors which may be contributed by still unknown mechanisms. Coincidentally with the increased usage of antifungal drugs, the number of reports for antifungal drug resistance has also increased which further highlights the need for understanding novel molecular mechanisms which can be explored to combat MDR, namely, ROS, iron, hypoxia, lipids, morphogenesis, and transcriptional and signaling networks. Considering the worrying evolution of MDR and significance of C. albicans being the most prevalent human fungal pathogen, this review summarizes these new regulatory mechanisms which could be exploited to prevent MDR development in C. albicans as established from recent studies. PMID:24163696

  4. Multiple posttranscriptional regulatory mechanisms partner to control ethanolamine utilization in Enterococcus faecalis

    PubMed Central

    Fox, Kristina A.; Ramesh, Arati; Stearns, Jennifer E.; Bourgogne, Agathe; Reyes-Jara, Angelica; Winkler, Wade C.; Garsin, Danielle A.

    2009-01-01

    Ethanolamine, a product of the breakdown of phosphatidylethanolamine from cell membranes, is abundant in the human intestinal tract and in processed foods. Effective utilization of ethanolamine as a carbon and nitrogen source may provide a survival advantage to bacteria that inhabit the gastrointestinal tract and may influence the virulence of pathogens. In this work, we describe a unique series of posttranscriptional regulatory strategies that influence expression of ethanolamine utilization genes (eut) in Enterococcus, Clostridium, and Listeria species. One of these mechanisms requires an unusual 2-component regulatory system. Regulation involves specific sensing of ethanolamine by a sensor histidine kinase (EutW), resulting in autophosphorylation and subsequent phosphoryl transfer to a response regulator (EutV) containing a RNA-binding domain. Our data suggests that EutV is likely to affect downstream gene expression by interacting with conserved transcription termination signals located within the eut locus. Breakdown of ethanolamine requires adenosylcobalamin (AdoCbl) as a cofactor, and, intriguingly, we also identify an intercistronic AdoCbl riboswitch that has a predicted structure different from previously established AdoCbl riboswitches. We demonstrate that association of AdoCbl to this riboswitch prevents formation of an intrinsic transcription terminator element located within the intercistronic region. Together, these results suggest an intricate and carefully coordinated interplay of multiple regulatory strategies for control of ethanolamine utilization genes. Gene expression appears to be directed by overlapping posttranscriptional regulatory mechanisms, each responding to a particular metabolic signal, conceptually akin to regulation by multiple DNA-binding transcription factors. PMID:19246383

  5. Regulatory mechanism of human vascular smooth muscle cell phenotypic transformation induced by NELIN.

    PubMed

    Pei, Changan; Qin, Shiyong; Wang, Minghai; Zhang, Shuguang

    2015-11-01

    Vascular disorders, including hypertension, atherosclerosis and restenosis, arise from dysregulation of vascular smooth muscle cell (VSMC) differentiation, which can be controlled by regulatory factors. The present study investigated the regulatory mechanism of the phenotypic transformation of human VSMCs by NELIN in order to evaluate its potential as a preventive and therapeutic of vascular disorders. An in vitro model of NELIN‑overexpressing VSMCs was prepared by transfection with a lentiviral (LV) vector (NELIN‑VSMCs) and NELIN was slienced using an a lentiviral vector with small interfering (si)RNA in another group (LV‑NELIN‑siRNA‑VSMCs). The effects of NELIN overexpression or knockdown on the phenotypic transformation of human VSMCs were observed, and its regulatory mechanism was studied. Compared with the control group, cells in the NELIN‑VSMCs group presented a contractile phenotype with a significant increase of NELIN mRNA, NELIN protein, smooth muscle (SM)α‑actin and total Ras homolog gene family member A (RhoA) protein expression. The intra‑nuclear translocation of SMα‑actin‑serum response factor (SMα‑actin‑SRF) occurred in these cells simultaneously. Following exposure to Rho kinsase inhibitor Y‑27632, SRF and SMα‑actin expression decreased. However, cells in the LV‑NELIN‑siRNA‑VSMCs group presented a synthetic phenotype, and the expression of NELIN mRNA, NELIN protein, SMα‑actin protein and total RhoA protein was decreased. The occurrence of SRF extra‑nuclear translocation was observed. In conclusion, the present study suggested that NELIN was able to activate regulatory factors of SMα‑actin, RhoA and SRF successively in human VSMCs cultured in vitro. Furthermore, NELIN‑induced phenotypic transformation of human VSMCs was regulated via the RhoA/SRF signaling pathway. The results of the present study provide a foundation for the use of NELIN in preventive and therapeutic treatment of vascular remodeling

  6. Identification of genes involved in regulatory mechanism of pigments in broiler chickens.

    PubMed

    Tarique, T M; Yang, S; Mohsina, Z; Qiu, J; Yan, Z; Chen, G; Chen, A

    2014-01-01

    Chicken is an important model organism that unites the evolutionary gap between mammals and other vertebrates and provide major source of protein from meat and eggs for all over the world population. However, specific genes underlying the regulatory mechanism of broiler pigmentation have not yet been determined. In order to better understand the genes involved in the mechanism of pigmentation in the muscle tissues of broilers, the Affymetrix microarray hybridization experiment platform was used to identify gene expression profiles at 7 weeks of age. Broilers fed canthaxanthin, natural lutein, and orangeII pigments (100 mg/kg) were used to explore gene expression profiles). Our data showed that the 7th week of age was a very important phase with regard to gene expression profiles. We identified a number of differentially expressed genes; in canthaxanthin, natural lutein, and orangeII, there were 54 (32 upregulated and 22 downregulated), 23 (15 upregulated and 8 downregulated), and 7 (5 upregulated and 2 downregulated) known genes, respectively. Our data indicate that the numbers of differentially expressed genes were more upregulated than downregulated, and several genes showed conserved signaling to previously known functions. Thus, functional characterization of differentially expressed genes revealed several categories that are involved in important biological processes, including pigmentation, growth, molecular mechanisms, fat metabolism, cell proliferation, immune response, lipid metabolism, and protein synthesis and degradation. The results of the present study demonstrate that the genes associated with canthaxanthin, natural lutein, and orangeII are key regulatory genes that control the regulatory mechanisms of pigmentation. PMID:25222226

  7. USP1 deubiquitinase: cellular functions, regulatory mechanisms and emerging potential as target in cancer therapy

    PubMed Central

    2013-01-01

    Reversible protein ubiquitination is emerging as a key process for maintaining cell homeostasis, and the enzymes that participate in this process, in particular E3 ubiquitin ligases and deubiquitinases (DUBs), are increasingly being regarded as candidates for drug discovery. Human DUBs are a group of approximately 100 proteins, whose cellular functions and regulatory mechanisms remain, with some exceptions, poorly characterized. One of the best-characterized human DUBs is ubiquitin-specific protease 1 (USP1), which plays an important role in the cellular response to DNA damage. USP1 levels, localization and activity are modulated through several mechanisms, including protein-protein interactions, autocleavage/degradation and phosphorylation, ensuring that USP1 function is carried out in a properly regulated spatio-temporal manner. Importantly, USP1 expression is deregulated in certain types of human cancer, suggesting that USP1 could represent a valid target in cancer therapy. This view has gained recent support with the finding that USP1 inhibition may contribute to revert cisplatin resistance in an in vitro model of non-small cell lung cancer (NSCLC). Here, we describe the current knowledge on the cellular functions and regulatory mechanisms of USP1. We also summarize USP1 alterations found in cancer, combining data from the literature and public databases with our own data. Finally, we discuss the emerging potential of USP1 as a target, integrating published data with our novel findings on the effects of the USP1 inhibitor pimozide in combination with cisplatin in NSCLC cells. PMID:23937906

  8. Regulatory role of collagen V in establishing mechanical properties of tendons and ligaments is tissue dependent.

    PubMed

    Connizzo, Brianne K; Freedman, Benjamin R; Fried, Joanna H; Sun, Mei; Birk, David E; Soslowsky, Louis J

    2015-06-01

    Patients with classic (type I) Ehlers-Danlos syndrome (EDS), characterized by heterozygous mutations in the Col5a1 and Col5a2 genes, exhibit connective tissue hyperelasticity and recurrent joint dislocations, indicating a potential regulatory role for collagen V in joint stabilizing soft tissues. This study asked whether the contribution of collagen V to the establishment of mechanical properties is tissue dependent. We mechanically tested four different tissues from wild type and targeted collagen V-null mice: the flexor digitorum longus (FDL) tendon, Achilles tendon (ACH), the anterior cruciate ligament (ACL), and the supraspinatus tendon (SST). Area was significantly reduced in the Col5a1(ΔTen/ΔTen) group in the FDL, ACH, and SST. Maximum load and stiffness were reduced in the Col5a1(ΔTen/ΔTen) group for all tissues. However, insertion site and midsubstance modulus were reduced only for the ACL and SST. This study provides evidence that the regulatory role of collagen V in extracellular matrix assembly is tissue dependent and that joint instability in classic EDS may be caused in part by insufficient mechanical properties of the tendons and ligaments surrounding each joint. PMID:25876927

  9. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci.

    PubMed

    Miller, Clint L; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K; Majmudar, Deshna; Kim, Juyong B; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L; Montgomery, Stephen B; Schadt, Eric E; Björkegren, Johan L M; Quertermous, Thomas

    2016-01-01

    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  10. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci

    PubMed Central

    Miller, Clint L.; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D.; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K.; Majmudar, Deshna; Kim, Juyong B.; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L.; Montgomery, Stephen B.; Schadt, Eric E.; Björkegren, Johan L.M.; Quertermous, Thomas

    2016-01-01

    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  11. Biosafety, biosecurity and internationally mandated regulatory regimes: compliance mechanisms for education and global health security

    PubMed Central

    Sture, Judi; Whitby, Simon; Perkins, Dana

    2015-01-01

    This paper highlights the biosafety and biosecurity training obligations that three international regulatory regimes place upon states parties. The duty to report upon the existence of such provisions as evidence of compliance is discussed in relation to each regime. We argue that such mechanisms can be regarded as building blocks for the development and delivery of complementary biosafety and biosecurity teaching and training materials. We show that such building blocks represent foundations upon which life and associated scientists – through greater awareness of biosecurity concerns – can better fulfil their responsibilities to guard their work from misuse in the future. PMID:24494580

  12. The human sperm acrosome reaction: physiology and regulatory mechanisms. An update.

    PubMed

    Brucker, C; Lipford, G B

    1995-01-01

    The acrosome reaction is a crucial step during gamete interaction in all species, including man. It allows spermatozoa to penetrate the zona pellucida and fuse with the oocyte membrane. Spermatozoa unable to undergo the acrosome reaction will not fertilize intact oocytes. This article concentrates on the characteristics and regulatory mechanisms of the acrosome reaction in human spermatozoa. During recent years, various entities found in the vicinity of the ovulated oocyte have been identified as stimulators of the acrosome reaction, of which zona protein is considered the prime physiological inducer in vivo. The steroid hormone progesterone has been shown to evoke critical responses in sperm cells leading to the acrosome reaction. Calcium has also been shown to play a central role during the acrosome reaction. Calcium flux is induced specifically by progesterone in capacitated and uncapacitated sperm cells, whereas only capacitated spermatozoa are able to subsequently complete the acrosome reaction. Progesterone as well as zona protein has been shown to evoke crucial responses within human spermatozoa, shedding light on the cascade of intracellular signalling events leading to the completion of the acrosome reaction. Furthermore, chemical agents which bring about the reaction in vitro, such as the ionophores ionomycin or A23187, have been used to shed light on its regulatory mechanisms. A number of molecules have been postulated to regulate the acrosome reaction in mammals, for example a galactosyl-transferase and a sperm protein tyrosine kinase. In addition, a novel protein, termed SAA-1, that was first detected on human spermatozoa is discussed with respect to its potential role as a regulatory protein closely involved in the initiation of the acrosome reaction. PMID:9080206

  13. Molten fatty acid based microemulsions.

    PubMed

    Noirjean, Cecile; Testard, Fabienne; Dejugnat, Christophe; Jestin, Jacques; Carriere, David

    2016-06-21

    We show that ternary mixtures of water (polar phase), myristic acid (MA, apolar phase) and cetyltrimethylammonium bromide (CTAB, cationic surfactant) studied above the melting point of myristic acid allow the preparation of microemulsions without adding a salt or a co-surfactant. The combination of SANS, SAXS/WAXS, DSC, and phase diagram determination allows a complete characterization of the structures and interactions between components in the molten fatty acid based microemulsions. For the different structures characterized (microemulsion, lamellar or hexagonal phases), a similar thermal behaviour is observed for all ternary MA/CTAB/water monophasic samples and for binary MA/CTAB mixtures without water: crystalline myristic acid melts at 52 °C, and a thermal transition at 70 °C is assigned to the breaking of hydrogen bounds inside the mixed myristic acid/CTAB complex (being the surfactant film in the ternary system). Water determines the film curvature, hence the structures observed at high temperature, but does not influence the thermal behaviour of the ternary system. Myristic acid is partitioned in two "species" that behave independently: pure myristic acid and myristic acid associated with CTAB to form an equimolar complex that plays the role of the surfactant film. We therefore show that myristic acid plays the role of a solvent (oil) and a co-surfactant allowing the fine tuning of the structure of oil and water mixtures. This solvosurfactant behaviour of long chain fatty acid opens the way for new formulations with a complex structure without the addition of any extra compound. PMID:27241163

  14. Deletional and regulatory mechanisms coalesce to drive transplantation tolerance through mixed chimerism.

    PubMed

    Hock, Karin; Mahr, Benedikt; Schwarz, Christoph; Wekerle, Thomas

    2015-09-01

    Establishing donor-specific immunological tolerance could improve long-term outcome by obviating the need for immunosuppressive drug therapy, which is currently required to control alloreactivity after organ transplantation. Mixed chimerism is defined as the engraftment of donor hematopoietic stem cells in the recipient, leading to viable coexistence of both donor and recipient leukocytes. In numerous experimental models, cotransplantation of donor bone marrow (BM) into preconditioned (e.g., through irradiation or cytotoxic drugs) recipients leads to transplantation tolerance through (mixed) chimerism. Mixed chimerism offers immunological advantages for clinical translation; pilot trials have established proof of concept by deliberately inducing tolerance in humans. Widespread clinical application is prevented, however, by the harsh preconditioning currently necessary for permitting BM engraftment. Recently, the immunological mechanisms inducing and maintaining tolerance in experimental mixed chimerism have been defined, revealing a more prominent role for regulation than historically assumed. The evidence from murine models suggests that both deletional and regulatory mechanisms are critical in promoting complete tolerance, encompassing also the minor histocompatibility antigens. Here, we review the current understanding of tolerance through mixed chimerism and provide an outlook on how to realize widespread clinical translation based on mechanistic insights gained from chimerism protocols, including cell therapy with polyclonal regulatory T cells. PMID:26200095

  15. Mechanism of natural killer (NK) cell regulatory role in experimental autoimmune encephalomyelitis.

    PubMed

    Xu, Wen; Fazekas, Gyorgy; Hara, Hideo; Tabira, Takeshi

    2005-06-01

    The mechanism of natural killer (NK) cell regulatory role in experimental autoimmune encephalomyelitis (EAE) was studied in SJL/J mice. In vivo experiments showed that NK cell depletion by anti-NK1.1 monoclonal antibody treatment enhanced EAE in mice. To investigate the mechanism, we cultured proteolipid protein (PLP)136-150 peptide-specific, encephalitogenic T cell lines, which were used as the NK cell target. Our results show that NK cells exert a direct cytotoxic effect on autoantigen-specific, encephalitogenic T cells. Furthermore, cytotoxicity to PLP-specific, encephalitogenic T line cells was enhanced by using enriched NK cells as effector cells. However, the cytotoxic effect of NK cells to ovalbumin-specific T line cells and ConA-stimulated T cells could also be detected with a lesser efficiency. Our studies indicate that NK cells play a regulatory role in EAE through killing of syngeneic T cells which include myelin antigen-specific, encephalitogenic T cells, and thus ameliorate EAE. PMID:15885305

  16. Gene expression in maturing neurons: regulatory mechanisms and related neurodevelopmental disorders.

    PubMed

    Ding, Baojin

    2015-04-25

    During the central nervous system (CNS) development, the interactions between intrinsic genes and extrinsic environment ensure that each neuronal developmental stage (eg. neuronal proliferation, differentiation, migration, axon extension, dendritogenesis and formation of functional synapses) occurs in the proper timing and sequence. The successful coordination requires that numerous groups of genes are exquisitely regulated in a spatiotemporal manner by various regulatory mechanisms, including sequence-specific DNA-binding proteins, histone modifications, DNA methylation, chromatin remodeling, and microRNAs (miRNAs). By targeting chromatin structure, transcription and translation processes, these mechanisms form a regulatory network to accomplish the fine regulation of gene expression in response to environmental stimuli at different developmental stages. Dysregulation of the gene expression during neuronal development has been shown to be implicated in a number of neurodevelopmental disorders, such as autism spectrum disorders (ASD), Rett syndrome (RTT), Fragile-X syndrome (FXS) and other genetic diseases. The further understanding of the regulation of gene expression during neuronal development may provide new approaches for the diagnosis and treatment of these disorders. PMID:25896042

  17. Elucidating the biosynthetic and regulatory mechanisms of flavonoid-derived bioactive components in Epimedium sagittatum

    PubMed Central

    Huang, Wenjun; Zeng, Shaohua; Xiao, Gong; Wei, Guoyan; Liao, Sihong; Chen, Jianjun; Sun, Wei; Lv, Haiyan; Wang, Ying

    2015-01-01

    Herba epimedii (Epimedium), a traditional Chinese medicine, has been widely used as a kidney tonic and antirheumatic medicine for thousands of years. In Epimedium, flavonoids have been demonstrated to be the main bioactive components (BCs). However, the molecular biosynthetic and regulatory mechanisms of flavonoid-derived BCs remain obscure. In this study, we isolated 12 structural genes and two putative transcription factors (TFs) in the flavonoid pathway. Phytochemical analysis showed that the total content of four representative BCs (epimedin A, B, C, and icariin) decreased slightly or dramatically in two lines of Epimedium sagittatum during leaf development. Transcriptional analysis revealed that two R2R3-MYB TFs (EsMYBA1 and EsMYBF1), together with a bHLH TF (EsGL3) and WD40 protein (EsTTG1), were supposed to coordinately regulate the anthocyanin and flavonol-derived BCs biosynthesis in leaves. Overexpression of EsFLS (flavonol synthase) in tobacco resulted in increased flavonols content and decreased anthocyanins content in flowers. Moreover, EsMYB12 negatively correlated with the accumulation of the four BCs, and might act as a transcriptional repressor in the flavonoid pathway. Therefore, the anthocyanin pathway may coordinate with the flavonol-derived BCs pathway in Epimedium leaves. A better understanding of the flavonoid biosynthetic and regulatory mechanisms in E. sagittatum will facilitate functional characterization, metabolic engineering, and molecular breeding studies of Epimedium species. PMID:26388888

  18. The Kidney and Acid-Base Regulation

    ERIC Educational Resources Information Center

    Koeppen, Bruce M.

    2009-01-01

    Since the topic of the role of the kidneys in the regulation of acid base balance was last reviewed from a teaching perspective (Koeppen BM. Renal regulation of acid-base balance. Adv Physiol Educ 20: 132-141, 1998), our understanding of the specific membrane transporters involved in H+, HCO , and NH transport, and especially how these…

  19. The Conjugate Acid-Base Chart.

    ERIC Educational Resources Information Center

    Treptow, Richard S.

    1986-01-01

    Discusses the difficulties that beginning chemistry students have in understanding acid-base chemistry. Describes the use of conjugate acid-base charts in helping students visualize the conjugate relationship. Addresses chart construction, metal ions, buffers and pH titrations, and the organic functional groups and nonaqueous solvents. (TW)

  20. Innovation of a Regulatory Mechanism Modulating Semi-determinate Stem Growth through Artificial Selection in Soybean.

    PubMed

    Liu, Yunfeng; Zhang, Dajian; Ping, Jieqing; Li, Shuai; Chen, Zhixiang; Ma, Jianxin

    2016-01-01

    It has been demonstrated that Terminal Flowering 1 (TFL1) in Arabidopsis and its functional orthologs in other plants specify indeterminate stem growth through their specific expression that represses floral identity genes in shoot apical meristems (SAMs), and that the loss-of-function mutations at these functional counterparts result in the transition of SAMs from the vegetative to reproductive state that is essential for initiation of terminal flowering and thus formation of determinate stems. However, little is known regarding how semi-determinate stems, which produce terminal racemes similar to those observed in determinate plants, are specified in any flowering plants. Here we show that semi-determinacy in soybean is modulated by transcriptional repression of Dt1, the functional ortholog of TFL1, in SAMs. Such repression is fulfilled by recently enabled spatiotemporal expression of Dt2, an ancestral form of the APETALA1/FRUITFULL orthologs, which encodes a MADS-box factor directly binding to the regulatory sequence of Dt1. In addition, Dt2 triggers co-expression of the putative SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (GmSOC1) in SAMs, where GmSOC1 interacts with Dt2, and also directly binds to the Dt1 regulatory sequence. Heterologous expression of Dt2 and Dt1 in determinate (tfl1) Arabidopsis mutants enables creation of semi-determinacy, but the same forms of the two genes in the tfl1 and soc1 background produce indeterminate stems, suggesting that Dt2 and SOC1 both are essential for transcriptional repression of Dt1. Nevertheless, the expression of Dt2 is unable to repress TFL1 in Arabidopsis, further demonstrating the evolutionary novelty of the regulatory mechanism underlying stem growth in soybean. PMID:26807727

  1. Innovation of a Regulatory Mechanism Modulating Semi-determinate Stem Growth through Artificial Selection in Soybean

    PubMed Central

    Ping, Jieqing; Li, Shuai; Chen, Zhixiang; Ma, Jianxin

    2016-01-01

    It has been demonstrated that Terminal Flowering 1 (TFL1) in Arabidopsis and its functional orthologs in other plants specify indeterminate stem growth through their specific expression that represses floral identity genes in shoot apical meristems (SAMs), and that the loss-of-function mutations at these functional counterparts result in the transition of SAMs from the vegetative to reproductive state that is essential for initiation of terminal flowering and thus formation of determinate stems. However, little is known regarding how semi-determinate stems, which produce terminal racemes similar to those observed in determinate plants, are specified in any flowering plants. Here we show that semi-determinacy in soybean is modulated by transcriptional repression of Dt1, the functional ortholog of TFL1, in SAMs. Such repression is fulfilled by recently enabled spatiotemporal expression of Dt2, an ancestral form of the APETALA1/FRUITFULL orthologs, which encodes a MADS-box factor directly binding to the regulatory sequence of Dt1. In addition, Dt2 triggers co-expression of the putative SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (GmSOC1) in SAMs, where GmSOC1 interacts with Dt2, and also directly binds to the Dt1 regulatory sequence. Heterologous expression of Dt2 and Dt1 in determinate (tfl1) Arabidopsis mutants enables creation of semi-determinacy, but the same forms of the two genes in the tfl1 and soc1 background produce indeterminate stems, suggesting that Dt2 and SOC1 both are essential for transcriptional repression of Dt1. Nevertheless, the expression of Dt2 is unable to repress TFL1 in Arabidopsis, further demonstrating the evolutionary novelty of the regulatory mechanism underlying stem growth in soybean. PMID:26807727

  2. Phenotype Specific Analyses Reveal Distinct Regulatory Mechanism for Chronically Activated p53

    PubMed Central

    Cairns, Jonathan M.; Menon, Suraj; Pérez-Mancera, Pedro A.; Tomimatsu, Kosuke; Bermejo-Rodriguez, Camino; Ito, Yoko; Chandra, Tamir; Narita, Masako; Lyons, Scott K.; Lynch, Andy G.; Kimura, Hiroshi; Ohbayashi, Tetsuya; Tavaré, Simon; Narita, Masashi

    2015-01-01

    The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage) and chronically activated (in senescent or pro-apoptotic conditions) p53. Compared to the classical ‘acute’ p53 binding profile, ‘chronic’ p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory ‘p53 hubs’ where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the ‘lipogenic phenotype’, a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms. PMID:25790137

  3. Global analysis of p53-regulated transcription identifies its direct targets and unexpected regulatory mechanisms

    PubMed Central

    Allen, Mary Ann; Andrysik, Zdenek; Dengler, Veronica L; Mellert, Hestia S; Guarnieri, Anna; Freeman, Justin A; Sullivan, Kelly D; Galbraith, Matthew D; Luo, Xin; Kraus, W Lee; Dowell, Robin D; Espinosa, Joaquin M

    2014-01-01

    The p53 transcription factor is a potent suppressor of tumor growth. We report here an analysis of its direct transcriptional program using Global Run-On sequencing (GRO-seq). Shortly after MDM2 inhibition by Nutlin-3, low levels of p53 rapidly activate ∼200 genes, most of them not previously established as direct targets. This immediate response involves all canonical p53 effector pathways, including apoptosis. Comparative global analysis of RNA synthesis vs steady state levels revealed that microarray profiling fails to identify low abundance transcripts directly activated by p53. Interestingly, p53 represses a subset of its activation targets before MDM2 inhibition. GRO-seq uncovered a plethora of gene-specific regulatory features affecting key survival and apoptotic genes within the p53 network. p53 regulates hundreds of enhancer-derived RNAs. Strikingly, direct p53 targets harbor pre-activated enhancers highly transcribed in p53 null cells. Altogether, these results enable the study of many uncharacterized p53 target genes and unexpected regulatory mechanisms. DOI: http://dx.doi.org/10.7554/eLife.02200.001 PMID:24867637

  4. Visual- and Vestibular-Autonomic Influence on Short-Term Cardiovascular Regulatory Mechanisms

    NASA Technical Reports Server (NTRS)

    Mullen, Thomas J.; Ramsdell, Craig D.

    1999-01-01

    This synergy project was a one-year effort conducted cooperatively by members of the NSBRI Cardiovascular Alterations and Neurovestibular Adaptation Teams in collaboration with NASA Johnson Space Center (JSC) colleagues. The objective of this study was to evaluate visual autonomic interactions on short-term cardiovascular regulatory mechanisms. Based on established visual-vestibular and vestibular-autonomic shared neural pathways, we hypothesized that visually induced changes in orientation will trigger autonomic cardiovascular reflexes. A second objective was to compare baroreflex changes during postural changes as measured with the new Cardiovascular System Identification (CSI) technique with those measured using a neck barocuff. While the neck barocuff stimulates only the carotid baroreceptors, CSI provides a measure of overall baroreflex responsiveness. This study involved a repeated measures design with 16 healthy human subjects (8 M, 8 F) to examine cardiovascular regulatory responses during actual and virtual head-upright tilts. Baroreflex sensitivity was first evaluated with subjects in supine and upright positions during actual tilt-table testing using both neck barocuff and CSI methods. The responses to actual tilts during this first session were then compared to responses during visually induced tilt and/or rotation obtained during a second session.

  5. Potential impact of gene regulatory mechanisms on the evolution of multicellularity in the volvocine algae.

    PubMed

    Kianianmomeni, Arash

    2015-01-01

    A fundamental question in biology is how multicellular organisms can arise from their single-celled precursors. The evolution of multicellularity requires the adoption of new traits in unicellular ancestors that allows the generation of form by, for example, increasing the size and developing new cell types. But what are the genetic, cellular and biochemical bases underlying the evolution of multicellularity? Recent advances in evolutionary developmental biology suggest that the regulation of gene expression by cis-regulatory factors, gene duplication and alternative splicing contribute to phenotypic evolution. These mechanisms enable different degrees of phenotypic divergence and complexity with variation in traits from genomes with similar gene contents. In addition, signaling pathways specific to cell types are developed to guarantee the modulation of cellular and developmental processes matched to the cell types as well as the maintenance of multicellularity. PMID:26479715

  6. Regulatory motifs on ISWI chromatin remodelers: molecular mechanisms and kinetic proofreading

    NASA Astrophysics Data System (ADS)

    Brysbaert, Guillaume; Lensink, Marc F.; Blossey, Ralf

    2015-02-01

    Recently, kinetic proofreading scenarios have been proposed for the regulation of chromatin remodeling, first on purely theoretical grounds (Blossey and Schiessel 2008 HFSP J. 2 167-70) and deduced from experiments on the ISWI/ACF system (Narlikar 2010 Curr. Opin. Chem. Biol. 14 660). In the kinetic proofreading scenario of chromatin remodeling, the combination of the recognition of a histone tail state and ATP-hydrolysis in the remodeler motor act together to select (i.e. proofread) a nucleosomal substrate. ISWI remodelers have recently been shown to have an additional level of regulation as they contain auto-inhibitory motifs which need to be inactivated through an interaction with the nucleosome. In this paper we show that the auto-regulatory effect enhances substrate recognition in kinetic proofreading. We further report some suggestive additional insights into the molecular mechanism underlying ISWI-autoregulation.

  7. Transcriptional Control of Photosynthesis Genes: The Evolutionarily Conserved Regulatory Mechanism in Plastid Genome Function

    PubMed Central

    Puthiyaveetil, Sujith; Ibrahim, Iskander M.; Jeličić, Branka; Tomašić, Ana; Fulgosi, Hrvoje; Allen, John F.

    2010-01-01

    Chloroplast sensor kinase (CSK) is a bacterial-type sensor histidine kinase found in chloroplasts—photosynthetic plastids—in eukaryotic plants and algae. Using a yeast two-hybrid screen, we demonstrate recognition and interactions between: CSK, plastid transcription kinase (PTK), and a bacterial-type RNA polymerase sigma factor-1 (SIG-1). CSK interacts with itself, with SIG-1, and with PTK. PTK also interacts directly with SIG-1. PTK has previously been shown to catalyze phosphorylation of plastid-encoded RNA polymerase (PEP), suppressing plastid transcription nonspecifically. Phospho-PTK is inactive as a PEP kinase. Here, we propose that phospho-CSK acts as a PTK kinase, releasing PTK repression of chloroplast transcription, while CSK also acts as a SIG-1 kinase, blocking transcription specifically at the gene promoter of chloroplast photosystem I. Oxidation of the photosynthetic electron carrier plastoquinone triggers phosphorylation of CSK, inducing chloroplast photosystem II while suppressing photosystem I. CSK places photosystem gene transcription under the control of photosynthetic electron transport. This redox signaling pathway has its origin in cyanobacteria, photosynthetic prokaryotes from which chloroplasts evolved. The persistence of this mechanism in cytoplasmic organelles of photosynthetic eukaryotes is in precise agreement with the CoRR hypothesis for the function of organellar genomes: the plastid genome and its primary gene products are Co-located for Redox Regulation. Genes are retained in plastids primarily in order for their expression to be subject to this rapid and robust redox regulatory transcriptional control mechanism, whereas plastid genes also encode genetic system components, such as some ribosomal proteins and RNAs, that exist in order to support this primary, redox regulatory control of photosynthesis genes. Plastid genome function permits adaptation of the photosynthetic apparatus to changing environmental conditions of light

  8. The regulatory mechanisms of myogenin expression in doxorubicin-treated rat cardiomyocytes

    PubMed Central

    Yen, Li-Chen; Huang, Chi-Jung; Lin, Wei-Shiang; Chan, James Yi-Hsin

    2015-01-01

    Doxorubicin, an anthracycline antibiotic, has been used as an anti-neoplastic drug for almost 60 years. However, the mechanism(s) by which anthracyclines cause irreversible myocardial injury remains unclear. In order to delineate possible molecular signals involved in the myocardial toxicity, we assessed candidate genes using mRNA expression profiling in the doxorubicin-treated rat cardiomyocyte H9c2 cell line. In the study, it was confirmed that myogenin, an important transcriptional factor for muscle terminal differentiation, was significantly reduced by doxorubicin in a dose-dependent manner using both RT-PCR and western blot analyses. Also, it was identified that the doxorubicin-reduced myogenin gene level could not be rescued by most cardio-protectants. Furthermore, it was demonstrated how the signaling of the decreased myogenin expression by doxorubicin was altered at the transcriptional, post-transcriptional and translational levels. Based on these findings, a working model was proposed for relieving doxorubicin-associated myocardial toxicity by down-regulating miR-328 expression and increasing voltage-gated calcium channel β1 expression, which is a repressor of myogenin gene regulation. In summary, this study provides several lines of evidence indicating that myogenin is the target for doxorubicin-induced cardio-toxicity and a novel therapeutic strategy for doxorubicin clinical applications based on the regulatory mechanisms of myogenin expression. PMID:26452256

  9. Heritability of symbiont density reveals distinct regulatory mechanisms in a tripartite symbiosis.

    PubMed

    Parkinson, Jasmine F; Gobin, Bruno; Hughes, William O H

    2016-04-01

    Beneficial eukaryotic-bacterial partnerships are integral to animal and plant evolution. Understanding the density regulation mechanisms behind bacterial symbiosis is essential to elucidating the functional balance between hosts and symbionts. Citrus mealybugs, Planococcus citri (Risso), present an excellent model system for investigating the mechanisms of symbiont density regulation. They contain two obligate nutritional symbionts, Moranella endobia, which resides inside Tremblaya princeps, which has been maternally transmitted for 100-200 million years. We investigate whether host genotype may influence symbiont density by crossing mealybugs from two inbred laboratory-reared populations that differ substantially in their symbiont density to create hybrids. The density of the M. endobia symbiont in the hybrid hosts matched that of the maternal parent population, in keeping with density being determined either by the symbiont or the maternal genotype. However, the density of the T. princeps symbiont was influenced by the paternal host genotype. The greater dependency of T. princeps on its host may be due to its highly reduced genome. The decoupling of T. princeps and M. endobia densities, in spite of their intimate association, suggests that distinct regulatory mechanisms can be at work in symbiotic partnerships, even when they are obligate and mutualistic. PMID:27099709

  10. Use of an Acid-Base Table.

    ERIC Educational Resources Information Center

    Willis, Grover; And Others

    1986-01-01

    Identifies several ways in which an acid-base table can provide students with information about chemical reactions. Cites examples of the chart's use and includes a table which indicates the strengths of some common acids and bases. (ML)

  11. MYCN-driven regulatory mechanisms controlling LIN28B in neuroblastoma

    PubMed Central

    Beckers, Anneleen; Van Peer, Gert; Carter, Daniel R.; Gartlgruber, Moritz; Herrmann, Carl; Agarwal, Saurabh; Helsmoortel, Hetty H.; Althoff, Kristina; Molenaar, Jan J.; Cheung, Belamy B.; Schulte, Johannes H.; Benoit, Yves; Shohet, Jason M.; Westermann, Frank; Marshall, Glenn M.; Vandesompele, Jo; De Preter, Katleen; Speleman, Frank

    2016-01-01

    LIN28B has been identified as an oncogene in various tumor entities, including neuroblastoma, a childhood cancer that originates from neural crest-derived cells, and is characterized by amplification of the MYCN oncogene. Recently, elevated LIN28B expression levels were shown to contribute to neuroblastoma tumorigenesis via let-7 dependent de-repression of MYCN. However, additional insight in the regulation of LIN28B in neuroblastoma is lacking. Therefore, we have performed a comprehensive analysis of the regulation of LIN28B in neuroblastoma, with a specific focus on the contribution of miRNAs. We show that MYCN regulates LIN28B expression in neuroblastoma tumors via two distinct parallel mechanisms. First, through an unbiased LIN28B-3′UTR reporter screen, we found that miR-26a-5p and miR-26b-5p regulate LIN28B expression. Next, we demonstrated that MYCN indirectly affects the expression of miR-26a-5p, and hence regulates LIN28B, therefor establishing a MYCN-miR-26a-5p-LIN28B regulatory axis. Second, we provide evidence that MYCN regulates LIN28B expression via interaction with the LIN28B promotor, establishing a direct MYCN-LIN28B regulatory axis. We believe that these findings mark LIN28B as an important effector of the MYCN oncogenic phenotype and underlines the importance of MYCN-regulated miRNAs in establishing the MYCN-driven oncogenic process. PMID:26123663

  12. Structural insights into the regulatory mechanism of the Pseudomonas aeruginosa YfiBNR system.

    PubMed

    Xu, Min; Yang, Xuan; Yang, Xiu-An; Zhou, Lei; Liu, Tie-Zheng; Fan, Zusen; Jiang, Tao

    2016-06-01

    YfiBNR is a recently identified bis-(3'-5')-cyclic dimeric GMP (c-di-GMP) signaling system in opportunistic pathogens. It is a key regulator of biofilm formation, which is correlated with prolonged persistence of infection and antibiotic drug resistance. In response to cell stress, YfiB in the outer membrane can sequester the periplasmic protein YfiR, releasing its inhibition of YfiN on the inner membrane and thus provoking the diguanylate cyclase activity of YfiN to induce c-di-GMP production. However, the detailed regulatory mechanism remains elusive. Here, we report the crystal structures of YfiB alone and of an active mutant YfiB(L43P) complexed with YfiR with 2:2 stoichiometry. Structural analyses revealed that in contrast to the compact conformation of the dimeric YfiB alone, YfiB(L43P) adopts a stretched conformation allowing activated YfiB to penetrate the peptidoglycan (PG) layer and access YfiR. YfiB(L43P) shows a more compact PG-binding pocket and much higher PG binding affinity than wild-type YfiB, suggesting a tight correlation between PG binding and YfiB activation. In addition, our crystallographic analyses revealed that YfiR binds Vitamin B6 (VB6) or L-Trp at a YfiB-binding site and that both VB6 and L-Trp are able to reduce YfiB(L43P)-induced biofilm formation. Based on the structural and biochemical data, we propose an updated regulatory model of the YfiBNR system. PMID:27113583

  13. Development of neurodevelopmental disorders: a regulatory mechanism involving bromodomain-containing proteins

    PubMed Central

    2013-01-01

    Neurodevelopmental disorders are classified as diseases that cause abnormal functions of the brain or central nervous system. Children with neurodevelopmental disorders show impaired language and speech abilities, learning and memory damage, and poor motor skills. However, we still know very little about the molecular etiology of these disorders. Recent evidence implicates the bromodomain-containing proteins (BCPs) in the initiation and development of neurodevelopmental disorders. BCPs have a particular domain, the bromodomain (Brd), which was originally identified as specifically binding acetyl-lysine residues at the N-terminus of histone proteins in vitro and in vivo. Other domains of BCPs are responsible for binding partner proteins to form regulatory complexes. Once these complexes are assembled, BCPs alter chromosomal states and regulate gene expression. Some BCP complexes bind nucleosomes, are involved in basal transcription regulation, and influence the transcription of many genes. However, most BCPs are involved in targeting. For example, some BCPs function as a recruitment platform or scaffold through their Brds-binding targeting sites. Others are recruited to form a complex to bind the targeting sites of their partners. The regulation mediated by these proteins is especially critical during normal and abnormal development. Mutant BCPs or dysfunctional BCP-containing complexes are implicated in the initiation and development of neurodevelopmental disorders. However, the pathogenic molecular mechanisms are not fully understood. In this review, we focus on the roles of regulatory BCPs associated with neurodevelopmental disorders, including mental retardation, Fragile X syndrome (FRX), Williams syndrome (WS), Rett syndrome and Rubinstein-Taybi syndrome (RTS). A better understanding of the molecular pathogenesis, based upon the roles of BCPs, will lead to screening of targets for the treatment of neurodevelopmental disorders. PMID:23425632

  14. Development of neurodevelopmental disorders: a regulatory mechanism involving bromodomain-containing proteins.

    PubMed

    Li, Junlin; Zhao, Guifang; Gao, Xiaocai

    2013-01-01

    Neurodevelopmental disorders are classified as diseases that cause abnormal functions of the brain or central nervous system. Children with neurodevelopmental disorders show impaired language and speech abilities, learning and memory damage, and poor motor skills. However, we still know very little about the molecular etiology of these disorders. Recent evidence implicates the bromodomain-containing proteins (BCPs) in the initiation and development of neurodevelopmental disorders. BCPs have a particular domain, the bromodomain (Brd), which was originally identified as specifically binding acetyl-lysine residues at the N-terminus of histone proteins in vitro and in vivo. Other domains of BCPs are responsible for binding partner proteins to form regulatory complexes. Once these complexes are assembled, BCPs alter chromosomal states and regulate gene expression. Some BCP complexes bind nucleosomes, are involved in basal transcription regulation, and influence the transcription of many genes. However, most BCPs are involved in targeting. For example, some BCPs function as a recruitment platform or scaffold through their Brds-binding targeting sites. Others are recruited to form a complex to bind the targeting sites of their partners. The regulation mediated by these proteins is especially critical during normal and abnormal development. Mutant BCPs or dysfunctional BCP-containing complexes are implicated in the initiation and development of neurodevelopmental disorders. However, the pathogenic molecular mechanisms are not fully understood. In this review, we focus on the roles of regulatory BCPs associated with neurodevelopmental disorders, including mental retardation, Fragile X syndrome (FRX), Williams syndrome (WS), Rett syndrome and Rubinstein-Taybi syndrome (RTS). A better understanding of the molecular pathogenesis, based upon the roles of BCPs, will lead to screening of targets for the treatment of neurodevelopmental disorders. PMID:23425632

  15. Core level regulatory network of osteoblast as molecular mechanism for osteoporosis and treatment.

    PubMed

    Yuan, Ruoshi; Ma, Shengfei; Zhu, Xiaomei; Li, Jun; Liang, Yuhong; Liu, Tao; Zhu, Yanxia; Zhang, Bingbing; Tan, Shuang; Guo, Huajie; Guan, Shuguang; Ao, Ping; Zhou, Guangqian

    2016-01-26

    To develop and evaluate the long-term prophylactic treatment for chronic diseases such as osteoporosis requires a clear view of mechanism at the molecular and systems level. While molecular signaling pathway studies for osteoporosis are extensive, a unifying mechanism is missing. In this work, we provide experimental and systems-biology evidences that a tightly connected top-level regulatory network may exist, which governs the normal and osteoporotic phenotypes of osteoblast. Specifically, we constructed a hub-like interaction network from well-documented cross-talks among estrogens, glucocorticoids, retinoic acids, peroxisome proliferator-activated receptor, vitamin D receptor and calcium-signaling pathways. The network was verified with transmission electron microscopy and gene expression profiling for bone tissues of ovariectomized (OVX) rats before and after strontium gluconate (GluSr) treatment. Based on both the network structure and the experimental data, the dynamical modeling predicts calcium and glucocorticoids signaling pathways as targets for GluSr treatment. Modeling results further reveal that in the context of missing estrogen signaling, the GluSr treated state may be an outcome that is closest to the healthy state. PMID:26783964

  16. Atomistic Insights into Regulatory Mechanisms of the HER2 Tyrosine Kinase Domain: A Molecular Dynamics Study

    PubMed Central

    Telesco, Shannon E.; Radhakrishnan, Ravi

    2009-01-01

    HER2 (ErbB2/Neu) is a receptor tyrosine kinase belonging to the epidermal growth factor receptor (EGFR)/ErbB family and is overexpressed in 20–30% of human breast cancers. Although several crystal structures of ErbB kinases have been solved, the precise mechanism of HER2 activation remains unknown, and it has been suggested that HER2 is unique in its requirement for phosphorylation of Y877, a key tyrosine residue located in the activation loop. To elucidate mechanistic details of kinase domain regulation, we performed molecular dynamics simulations of a homology-modeled HER2 kinase structure in active and inactive conformations. Principal component analysis of the atomistic fluctuations reveals a tight coupling between the activation loop and catalytic loop that may contribute to alignment of residues required for catalysis in the active kinase. The free energy perturbation method is also employed to predict a role for phosphorylated Y877 in stabilizing the kinase conformations. Finally, simulation results are presented for a HER2/EGFR heterodimer and reveal that the dimeric interface induces a rearrangement of the αC helix toward the active conformation. Elucidation of the molecular regulatory mechanisms in HER2 will help establish structure-function relationships in the wild-type kinase, as well as predict mutations with a propensity for constitutive activation in HER2-mediated cancers. PMID:19289058

  17. Up-regulation of miR-98 and unraveling regulatory mechanisms in gestational diabetes mellitus.

    PubMed

    Cao, Jing-Li; Zhang, Lu; Li, Jian; Tian, Shi; Lv, Xiao-Dan; Wang, Xue-Qin; Su, Xing; Li, Ying; Hu, Yi; Ma, Xu; Xia, Hong-Fei

    2016-01-01

    MiR-98 expression was up-regulated in kidney in response to early diabetic nephropathy in mouse and down-regulated in muscle in type 2 diabetes in human. However, the expression prolife and functional role of miR-98 in human gestational diabetes mellitus (GDM) remained unclear. Here, we investigated its expression and function in placental tissues from GDM patients and the possible molecular mechanisms. The results showed that miR-98 was up-regulated in placentas from GDM patients compared with normal placentas. MiR-98 over-expression increased global DNA methylational level and miR-98 knockdown reduced global DNA methylational level. Further investigation revealed that miR-98 could inhibit Mecp2 expression by binding the 3'-untranslated region (UTR) of methyl CpG binding protein 2 (Mecp2), and then led to the expression dysregulation of canonical transient receptor potential 3 (Trpc3), a glucose uptake related gene. More importantly, in vivo analysis found that the expression level of Mecp2 and Trpc3 in placental tissues from GDM patients, relative to the increase of miR-98, was diminished, especially for GDM patients over the age of 35 years. Collectively, up-regulation of miR-98 in the placental tissues of human GDM is linked to the global DNA methylation via targeting Mecp2, which may imply a novel regulatory mechanism in GDM. PMID:27573367

  18. Up-regulation of miR-98 and unraveling regulatory mechanisms in gestational diabetes mellitus

    PubMed Central

    Cao, Jing-Li; Zhang, Lu; Li, Jian; Tian, Shi; Lv, Xiao-Dan; Wang, Xue-Qin; Su, Xing; Li, Ying; Hu, Yi; Ma, Xu; Xia, Hong-Fei

    2016-01-01

    MiR-98 expression was up-regulated in kidney in response to early diabetic nephropathy in mouse and down-regulated in muscle in type 2 diabetes in human. However, the expression prolife and functional role of miR-98 in human gestational diabetes mellitus (GDM) remained unclear. Here, we investigated its expression and function in placental tissues from GDM patients and the possible molecular mechanisms. The results showed that miR-98 was up-regulated in placentas from GDM patients compared with normal placentas. MiR-98 over-expression increased global DNA methylational level and miR-98 knockdown reduced global DNA methylational level. Further investigation revealed that miR-98 could inhibit Mecp2 expression by binding the 3′-untranslated region (UTR) of methyl CpG binding protein 2 (Mecp2), and then led to the expression dysregulation of canonical transient receptor potential 3 (Trpc3), a glucose uptake related gene. More importantly, in vivo analysis found that the expression level of Mecp2 and Trpc3 in placental tissues from GDM patients, relative to the increase of miR-98, was diminished, especially for GDM patients over the age of 35 years. Collectively, up-regulation of miR-98 in the placental tissues of human GDM is linked to the global DNA methylation via targeting Mecp2, which may imply a novel regulatory mechanism in GDM. PMID:27573367

  19. A Cell-Regulatory Mechanism Involving Feedback between Contraction and Tissue Formation Guides Wound Healing Progression

    PubMed Central

    Valero, Clara; Javierre, Etelvina; García-Aznar, José Manuel; Gómez-Benito, María José

    2014-01-01

    Wound healing is a process driven by cells. The ability of cells to sense mechanical stimuli from the extracellular matrix that surrounds them is used to regulate the forces that cells exert on the tissue. Stresses exerted by cells play a central role in wound contraction and have been broadly modelled. Traditionally, these stresses are assumed to be dependent on variables such as the extracellular matrix and cell or collagen densities. However, we postulate that cells are able to regulate the healing process through a mechanosensing mechanism regulated by the contraction that they exert. We propose that cells adjust the contraction level to determine the tissue functions regulating all main activities, such as proliferation, differentiation and matrix production. Hence, a closed-regulatory feedback loop is proposed between contraction and tissue formation. The model consists of a system of partial differential equations that simulates the evolution of fibroblasts, myofibroblasts, collagen and a generic growth factor, as well as the deformation of the extracellular matrix. This model is able to predict the wound healing outcome without requiring the addition of phenomenological laws to describe the time-dependent contraction evolution. We have reproduced two in vivo experiments to evaluate the predictive capacity of the model, and we conclude that there is feedback between the level of cell contraction and the tissue regenerated in the wound. PMID:24681636

  20. Functional role of regulatory T cells in B cell lymphoma and related mechanisms.

    PubMed

    Wu, Wei; Wan, Jun; Xia, Ruixiang; Huang, Zhenqi; Ni, Jing; Yang, Mingzhen

    2015-01-01

    B cell lymphoma (BCL) has a higher degree of malignancy and complicated pathogenic mechanism. Regulatory T cells (Treg cells) are known to exert certain immune suppression functions, in addition to immune mediating effects. Recent studies have revealed the role of Treg cells in pathogenesis and progression of multiple malignant tumors. This study therefore investigated the functional role and related mechanism of Treg cells in BCL. A cohort of thirty patients who were diagnosed with BCL in our hospital between January 2013 and December 2014. Another thirty healthy individuals were recruited. Peripheral blood mononuclear cells (PBMCs) were separated and analyzed for the ratio of CD4+/CD25+ Treg cells. The mRNA expression levels of Foxp3, transforming growth factor (TGF)-β1 and interleukin (IL)-10 genes were quantified by real-time PCR, while their serum levels were determined by enzyme-linked immunosorbent assay (ELISA). Meanwhile all laboratory indexes for patients were monitored during the complete remission (CR) stage. BCL patients significantly elevated ratio of CD4+/CD25+ Treg cells, which were decreased at CR stage. mRNA levels of Foxp3, TGF-β1 and IL-10, in addition to protein levels of TGF-β1 and IL-10 were potentiated in lymphoma patients but decreased in CR patients (P<0.05 in all cases). CD4+/CD25+ Treg cells exert immune suppressing functions in BCL via regulating cytokines, thereby facilitating the pathogenesis and progression of lymphoma. PMID:26464657

  1. Mechanisms of allergen-specific immunotherapy: T-regulatory cells and more.

    PubMed

    Verhagen, Johan; Blaser, Kurt; Akdis, Cezmi A; Akdis, Mübeccel

    2006-05-01

    Activation-induced cell death, anergy, or immune response modulation by regulatory T cells (Treg cells) are essential mechanisms of peripheral T-cell tolerance. Genetic predisposition and environmental instructions tune thresholds for the activation of T cells, other inflammatory cells, and resident tissue cells in allergic diseases. Skewing allergen-specific effector T cells to a Treg-cell phenotype seems to be crucial in maintaining a healthy immune response to allergens and successful allergen-specific immunotherapy. The Treg-cell response is characterized by an abolished allergen-specific T-cell proliferation and the suppressed secretion of T-helper 1- and T-helper 2-type cytokines. Suppressed proliferative and cytokine responses against allergens are induced by multiple suppressor factors, including cytokines such as interleukin-10 (IL-10) and transforming growth factor beta (TGF-beta), and cell surface molecules such as cytotoxic T-lymphocyte antigen-4, programmed death-1, and histamine receptor 2. The increased levels of IL-10 and TGF-beta produced by Treg cells potently suppress IgE production while simultaneously increasing the production of noninflammatory isotypes IgG4 and IgA, respectively. In addition, Treg cells directly or indirectly suppress the activity of effector cells of allergic inflammation, such as mast cells, basophils, and eosinophils. In conclusion, peripheral tolerance to allergens is controlled by multiple active suppression mechanisms on T cells, regulation of antibody isotypes, and suppression of effector cells. The application of current knowledge of Treg cells and related mechanisms of peripheral tolerance may soon lead to more rational and safer approaches to the prevention and cure of allergic disease. PMID:16701141

  2. Differential acid-base regulation in various gills of the green crab Carcinus maenas: Effects of elevated environmental pCO2.

    PubMed

    Fehsenfeld, Sandra; Weihrauch, Dirk

    2013-01-01

    Euryhaline decapod crustaceans possess an efficient regulation apparatus located in the gill epithelia, providing a high adaptation potential to varying environmental abiotic conditions. Even though many studies focussed on the osmoregulatory capacity of the gills, acid-base regulatory mechanisms have obtained much less attention. In the present study, underlying principles and effects of elevated pCO(2) on acid-base regulatory patterns were investigated in the green crab Carcinus maenas acclimated to diluted seawater. In gill perfusion experiments, all investigated gills 4-9 were observed to up-regulate the pH of the hemolymph by 0.1-0.2 units. Anterior gills, especially gill 4, were identified to be most efficient in the equivalent proton excretion rate. Ammonia excretion rates mirrored this pattern among gills, indicating a linkage between both processes. In specimen exposed to elevated pCO(2) levels for at least 7 days, mimicking a future ocean scenario as predicted until the year 2300, hemolymph K(+) and ammonia concentrations were significantly elevated, and an increased ammonia excretion rate was observed. A detailed quantitative gene expression analysis revealed that upon elevated pCO(2) exposure, mRNA levels of transcripts hypothesized to be involved in ammonia and acid-base regulation (Rhesus-like protein, membrane-bound carbonic anhydrase, Na(+)/K(+)-ATPase) were affected predominantly in the non-osmoregulating anterior gills. PMID:23022520

  3. [Kidney, Fluid, and Acid-Base Balance].

    PubMed

    Shioji, Naohiro; Hayashi, Masao; Morimatsu, Hiroshi

    2016-05-01

    Kidneys play an important role to maintain human homeostasis. They contribute to maintain body fluid, electrolytes, and acid-base balance. Especially in fluid control, we, physicians can intervene body fluid balance using fluid resuscitation and diuretics. In recent years, one type of fluid resuscitation, hydroxyl ethyl starch has been extensively studied in the field of intensive care. Although their effects on fluid resuscitation are reasonable, serious complications such as kidney injury requiring renal replacement therapy occur frequently. Now we have to pay more attention to this important complication. Another topic of fluid management is tolvaptan, a selective vasopressin-2 receptor antagonist Recent randomized trial suggested that tolvaptan has a similar supportive effect for fluid control and more cost effective compared to carperitide. In recent years, Stewart approach is recognized as one important tool to assess acid-base balance in critically ill patients. This approach has great value, especially to understand metabolic components in acid-base balance. Even for assessing the effects of kidneys on acid-base balance, this approach gives us interesting insight. We should appropriately use this new approach to treat acid-base abnormality in critically ill patients. PMID:27319095

  4. Molecular interactions of the Saccharomyces cerevisiae Atg1 complex provide insights into assembly and regulatory mechanisms

    PubMed Central

    Chew, Leon H; Lu, Shan; Liu, Xu; Li, Franco Kk; Yu, Angela Yh; Klionsky, Daniel J; Dong, Meng-Qiu; Yip, Calvin K

    2015-01-01

    The Atg1 complex, which contains 5 major subunits: Atg1, Atg13, Atg17, Atg29, and Atg31, regulates the induction of autophagy and autophagosome formation. To gain a better understanding of the overall architecture and assembly mechanism of this essential autophagy regulatory complex, we have reconstituted a core assembly of the Saccharomyces cerevisiae Atg1 complex composed of full-length Atg17, Atg29, and Atg31, along with the C-terminal domains of Atg1 (Atg1[CTD]) and Atg13 (Atg13[CTD]). Using chemical-crosslinking coupled with mass spectrometry (CXMS) analysis we systematically mapped the intersubunit interaction interfaces within this complex. Our data revealed that the intrinsically unstructured C-terminal domain of Atg29 interacts directly with Atg17, whereas Atg17 interacts with Atg13 in 2 distinct intrinsically unstructured regions, including a previously unknown motif that encompasses several putative phosphorylation sites. The Atg1[CTD] crosslinks exclusively to the Atg13[CTD] and does not appear to make direct contact with the Atg17-Atg31-Atg29 scaffold. Finally, single-particle electron microscopy analysis revealed that both the Atg13[CTD] and Atg1[CTD] localize to the tip regions of Atg17-Atg31-Atg29 and do not alter the distinct curvature of this scaffolding subcomplex. This work provides a comprehensive understanding of the subunit interactions in the fully assembled Atg1 core complex, and uncovers the potential role of intrinsically disordered regions in regulating complex integrity. PMID:25998554

  5. Cardiovascular Risk in Systemic Autoimmune Diseases: Epigenetic Mechanisms of Immune Regulatory Functions

    PubMed Central

    López-Pedrera, Chary; Pérez-Sánchez, Carlos; Ramos-Casals, Manuel; Santos-Gonzalez, Monica; Rodriguez-Ariza, Antonio; José Cuadrado, Ma

    2012-01-01

    Autoimmune diseases (AIDs) have been associated with accelerated atherosclerosis (AT) leading to increased cardio- and cerebrovascular disease risk. Traditional risk factors, as well as systemic inflammation mediators, including cytokines, chemokines, proteases, autoantibodies, adhesion receptors, and others, have been implicated in the development of these vascular pathologies. Yet, the characteristics of vasculopathies may significantly differ depending on the underlying disease. In recent years, many new genes and signalling pathways involved in autoimmunity with often overlapping patterns between different disease entities have been further detected. Epigenetics, the control of gene packaging and expression independent of alterations in the DNA sequence, is providing new directions linking genetics and environmental factors. Epigenetic regulatory mechanisms comprise DNA methylation, histone modifications, and microRNA activity, all of which act upon gene and protein expression levels. Recent findings have contributed to our understanding of how epigenetic modifications could influence AID development, not only showing differences between AID patients and healthy controls, but also showing how one disease differs from another and even how the expression of key proteins involved in the development of each disease is regulated. PMID:21941583

  6. Regulatory mechanism of the flavoprotein Tah18-dependent nitric oxide synthesis and cell death in yeast.

    PubMed

    Yoshikawa, Yuki; Nasuno, Ryo; Kawahara, Nobuhiro; Nishimura, Akira; Watanabe, Daisuke; Takagi, Hiroshi

    2016-07-01

    Nitric oxide (NO) is a ubiquitous signaling molecule involved in the regulation of a large number of cellular functions. The regulatory mechanism of NO generation in unicellular eukaryotic yeast cells is poorly understood due to the lack of mammalian and bacterial NO synthase (NOS) orthologues, even though yeast produces NO under oxidative stress conditions. Recently, we reported that the flavoprotein Tah18, which was previously shown to transfer electrons to the iron-sulfur cluster protein Dre2, is involved in NOS-like activity in the yeast Saccharomyces cerevisiae. On the other hand, Tah18 was reported to promote apoptotic cell death after exposure to hydrogen peroxide (H2O2). Here, we showed that NOS-like activity requiring Tah18 induced cell death upon treatment with H2O2. Our experimental results also indicate that Tah18-dependent NO production and cell death are suppressed by enhancement of the interaction between Tah18 and its molecular partner Dre2. Our findings indicate that the Tah18-Dre2 complex regulates cell death as a molecular switch via Tah18-dependent NOS-like activity in response to environmental changes. PMID:27178802

  7. Identification of regulatory mechanisms of intestinal folate transport in condition of folate deficiency.

    PubMed

    Thakur, Shilpa; Rahat, Beenish; Hamid, Abid; Najar, Rauf Ahmad; Kaur, Jyotdeep

    2015-10-01

    Folic acid is an essential micronutrient, deficiency of which can lead to disturbance in various metabolic processes of cell. Folate transport across intestine occurs via the involvement of specialized folate transporters viz. proton coupled folate transporter (PCFT) and reduced folate carrier (RFC), which express at the membrane surfaces. The current study was designed to identify the regulatory mechanisms underlying the effects of folate deficiency (FD) on folate transport in human intestinal cell line as well as in rats and to check the reversibility of such effects. Caco-2 cells were grown for five generations in control and FD medium. Following treatment, one subgroup of cells was shifted on folate sufficient medium and grown for three more generations. Similarly, rats were fed an FD diet for 3 and 5 months, and after 3 months of FD treatment, one group of rats were shifted on normal folate-containing diet. Increase in folate transport and expression of folate transporters were observed on FD treatment. However, when cells and rats were shifted to control conditions after treatment, transport and expression of these genes restored to the control level. FD was found to have no impact on promoter methylation of PCFT and RFC; however, messenger RNA stability of transporters was found to be decreased, suggesting some adaptive response. Overall, increased expression of transporters under FD conditions can be attributed to enhanced rate of transcription of folate transporters and also to the increased binding of specificity protein 1 transcription factor to the RFC promoter only. PMID:26168702

  8. A mechanism for expansion of regulatory T cell repertoire and its role in self tolerance

    PubMed Central

    Shugay, Mikhail; Putintseva, Ekaterina V; Osmanbeyoglu, Hatice U; Dikiy, Stanislav; Hoyos, Beatrice E; Moltedo, Bruno; Hemmers, Saskia; Treuting, Piper; Leslie, Christina S; Chudakov, Dmitriy M; Rudensky, Alexander Y

    2015-01-01

    SUMMARY T cell receptor (TCR) signaling plays a key role in T cell fate determination. Precursor cells expressing TCRs within a certain low affinity range for self peptide-MHC complexes undergo positive selection and differentiate into naïve T cells expressing a highly diverse self-MHC restricted TCR repertoire. In contrast, precursors displaying TCRs with a high affinity for “self” are either eliminated through TCR agonist induced apoptosis (negative selection)1 or restrained by regulatory CD4+ T (Treg) cells, whose differentiation and function are controlled by the X-chromosome encoded transcription factor Foxp3 (review2). Foxp3 is expressed in a fraction of self-reactive T cells that escape negative selection in response to agonist driven TCR signals combined with interleukin-2 (IL-2) receptor signaling. In addition to Treg cells, TCR agonist-driven selection results in the generation of several other specialized T cell lineages like NKT and MAIT cells3. Although the latter exhibit a restricted TCR repertoire, Treg cells display a highly diverse collection of TCRs4-6, Here we explored whether a specialized mechanism enables agonist driven selection of Treg cells with a diverse TCR repertoire and its significance for self-tolerance. We found that intronic Foxp3 enhancer CNS3 acts as an epigenetic switch that confers a poised state to the Foxp3 promoter in precursor cells to make Treg cell lineage commitment responsive to a broad range of TCR stimuli, particularly to suboptimal ones. CNS3-dependent expansion of the TCR repertoire enables Treg cells to effectively control self-reactive T cells, especially when thymic negative selection was genetically impaired. Our findings highlight the complementary roles of these two main mechanisms of self-tolerance. PMID:26605529

  9. Renal acid-base metabolism after ischemia.

    PubMed

    Holloway, J C; Phifer, T; Henderson, R; Welbourne, T C

    1986-05-01

    The response of the kidney to ischemia-induced cellular acidosis was followed over the immediate one hr post-ischemia reflow period. Clearance and extraction experiments as well as measurement of cortical intracellular pH (pHi) were performed on Inactin-anesthetized Sprague-Dawley rats. Arteriovenous concentration differences and para-aminohippurate extraction were obtained by cannulating the left renal vein. Base production was monitored as bicarbonate released into the renal vein and urine; net base production was related to the renal handling of glutamine and ammonia as well as to renal oxygen consumption and pHi. After a 15 min control period, the left renal artery was snared for one-half hr followed by release and four consecutive 15 min reflow periods. During the control period, cortical cell pHi measured by [14C]-5,5-Dimethyl-2,4-Oxazolidinedione distribution was 7.07 +/- 0.08, and Q-O2 was 14.1 +/- 2.2 micromoles/min; neither net glutamine utilization nor net bicarbonate generation occurred. After 30 min of ischemia, renal tissue pH fell to 6.6 +/- 0.15. However, within 45 min of reflow, cortical cell pH returned and exceeded the control value, 7.33 +/- 0.06 vs. 7.15 +/- 0.08. This increase in pHi was associated with a significant rise in cellular metabolic rate, Q-O2 increased to 20.3 +/- 6.4 micromoles/min. Corresponding with cellular alkalosis was a net production of bicarbonate and a net ammonia uptake and glutamine release; urinary acidification was abolished. These results are consistent with a nonexcretory renal metabolic base generating mechanism governing cellular acid base homeostasis following ischemia. PMID:3723929

  10. Luteal regression vs. prepartum luteolysis: regulatory mechanisms governing canine corpus luteum function.

    PubMed

    Kowalewski, Mariusz P

    2014-04-01

    Canine reproductive physiology exhibits several unusual features. Among the most interesting of these are the lack of an acute luteolytic mechanism, coinciding with the apparent luteal independency of a uterine luteolysin in absence of pregnancy, contrasting with the acute prepartum luteolysis observed in pregnant animals. These features indicate the existence of mechanisms different from those in other species for regulating the extended luteal regression observed in non-pregnant dogs, and the actively regulated termination of luteal function observed prepartum as a prerequisite for parturition. Nevertheless, the supply of progesterone (P4) depends on corpora lutea (CL) as its primary source in both conditions, resulting in P4 levels that are similar in pregnant and non-pregnant bitches during almost the entire luteal life span prior to the prepartum luteolysis. Consequently, the duration of the prolonged luteal phase in non-pregnant bitches frequently exceeds that of pregnant ones, which is a peculiarity when compared with other domestic animal species. Both LH and prolactin (PRL) are endocrine luteotrophic factors in the dog, the latter being the predominant one. In spite of increased availability of these hormones, luteal regression/luteolysis still takes place. Recently, possible mechanisms regulating the expression and function of PRL receptor have been implicated in the local, i.e., intraluteal regulation of PRL bioavailability and thus its steroidogenic potential. Similar mechanisms may relate to the luteal LH receptor. Most recently, evidence has been provided for an autocrine/paracrine role of prostaglandin E2 (PGE2) as a luteotrophic factor in the canine CL acting at the level of steroidogenic acute regulatory (STAR)-protein mediated supply of steroidogenic substrate, without having a significant impact on the enzymatic activity of the respective steroidogenic enzymes, 3β-hydroxysteroid-dehydrogenase (3βHSD, HSD3B2) and cytochrome P450 side

  11. Going Beyond, Going Further: The Preparation of Acid-Base Titration Curves.

    ERIC Educational Resources Information Center

    McClendon, Michael

    1984-01-01

    Background information, list of materials needed, and procedures used are provided for a simple technique for generating mechanically plotted acid-base titration curves. The method is suitable for second-year high school chemistry students. (JN)

  12. Nucleic acid-based approaches to STAT inhibition.

    PubMed

    Sen, Malabika; Grandis, Jennifer R

    2012-10-01

    Silencing of abnormally activated genes can be accomplished in a highly specific manner using nucleic acid based approaches. The focus of this review includes the different nucleic acid based inhibition strategies such as antisense oligodeoxynucleotides, small interfering RNA (siRNA), dominant-negative constructs, G-quartet oligonucleotides and decoy oligonucleotides, their mechanism of action and the effectiveness of these approaches to targeting the STAT (signal transducer and activator of transcription) proteins in cancer. Among the STAT proteins, especially STAT3, followed by STAT5, are the most frequently activated oncogenic STATs, which have emerged as plausible therapeutic cancer targets. Both STAT3 and STAT5 have been shown to regulate numerous oncogenic signaling pathways including proliferation, survival, angiogenesis and migration/invasion. PMID:24058785

  13. Controlling the fire--tissue-specific mechanisms of effector regulatory T-cell homing.

    PubMed

    Chow, Zachary; Banerjee, Ashish; Hickey, Michael J

    2015-04-01

    Regulatory T cells have essential roles in regulating immune responses and limiting inappropriate inflammation. Evidence now indicates that to achieve this function, regulatory T cells must be able to migrate to the most appropriate locations within both lymphoid and non-lymphoid organs. This function is achieved via the spatiotemporally controlled expression of adhesion molecules and chemokine receptors, varying according to the developmental stage of the regulatory T cell and the location and environment where they undergo activation. In this Review, we summarise information on the roles of adhesion molecules and chemokine receptors in mediating regulatory T-cell migration and function throughout the body under homeostatic and inflammatory conditions. In addition, we review recent studies that have used in vivo imaging to examine the actions of regulatory T cells in vivo, in lymph nodes, in the microvasculature and in the interstitium of peripheral organs. These studies reveal that the capacity of regulatory T cells to undergo selective migration serves a critical role in their ability to suppress immune responses. As such, the cellular and molecular requirements of regulatory T-cell migration need to be completely understood to enable the most effective use of these cells in clinical settings. PMID:25582339

  14. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk

    PubMed Central

    Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems. PMID:25694852

  15. microRNA regulatory mechanism by which PLLA aligned nanofibers influence PC12 cell differentiation

    NASA Astrophysics Data System (ADS)

    Yu, Yadong; Lü, Xiaoying; Ding, Fei

    2015-08-01

    Objective. Aligned nanofibers (AFs) are regarded as promising biomaterials in nerve tissue engineering. However, a full understanding of the biocompatibility of AFs at the molecular level is still challenging. Therefore, the present study focused on identifying the microRNA (miRNA)-mediated regulatory mechanism by which poly-L-lactic acid (PLLA) AFs influence PC12 cell differentiation. Approach. Firstly, the effects of PLLA random nanofibers (RFs)/AFs and PLLA films (control) on the biological responses of PC12 cells that are associated with neuronal differentiation were examined. Then, SOLiD sequencing and cDNA microarray were employed to profile the expressions of miRNAs and mRNAs. The target genes of the misregulated miRNAs were predicted and compared with the mRNA profile data. Functions of the matched target genes (the intersection between the predicted target genes and the experimentally-determined, misregulated genes) were analyzed. Main results. The results revealed that neurites spread in various directions in control and RF groups. In the AF group, most neurites extended in parallel with each other. The glucose consumption and lactic acid production in the RF and AF groups were higher than those in the control group. Compared with the control group, 42 and 94 miRNAs were significantly dysregulated in the RF and AF groups, respectively. By comparing the predicted target genes with the mRNA profile data, five and 87 matched target genes were found in the RF and AF groups, respectively. Three of the matched target genes in the AF group were found to be associated with neuronal differentiation, whereas none had this association in the RF group. The PLLA AFs induced the dysregulation of miRNAs that regulate many biological functions, including axonal guidance, lipid metabolism and long-term potentiation. In particular, two miRNA-matched target gene-biological function modules associated with neuronal differentiation were identified as follows: (1) miR-23b, mi

  16. Deciphering Transcriptional Regulatory Mechanisms Associated with Hemicellulose Degradation in Neurospora crassa

    PubMed Central

    Sun, Jianping; Tian, Chaoguang; Diamond, Spencer

    2012-01-01

    Hemicellulose, the second most abundant plant biomass fraction after cellulose, is widely viewed as a potential substrate for the production of liquid fuels and other value-added materials. Degradation of hemicellulose by filamentous fungi requires production of many different enzymes, which are induced by biopolymers or its derivatives and regulated mainly at the transcriptional level through transcription factors (TFs). Neurospora crassa, a model filamentous fungus, expresses and secretes enzymes required for plant cell wall deconstruction. To better understand genes specifically associated with degradation of hemicellulose, we applied secretome and transcriptome analysis to N. crassa grown on beechwood xylan. We identified 34 secreted proteins and 353 genes with elevated transcription on xylan. The xylanolytic phenotype of strains with deletions in genes identified from the secretome and transcriptome analysis of the wild type was assessed, revealing functions for known and unknown proteins associated with hemicellulose degradation. By evaluating phenotypes of strains containing deletions of predicted TF genes in N. crassa, we identified a TF (XLR-1; xylan degradation regulator 1) essential for hemicellulose degradation that is an ortholog to XlnR/XYR1 in Aspergillus and Trichoderma species, respectively, a major transcriptional regulator of genes encoding both cellulases and hemicellulases. Deletion of xlr-1 in N. crassa abolished growth on xylan and xylose, but growth on cellulose and cellulolytic activity were only slightly affected. To determine the regulatory mechanisms for hemicellulose degradation, we explored the transcriptional regulon of XLR-1 under xylose, xylanolytic, and cellulolytic conditions. XLR-1 regulated only some predicted hemicellulase genes in N. crassa and was required for a full induction of several cellulase genes. Hemicellulase gene expression was induced by a combination of release from carbon catabolite repression (CCR) and induction

  17. An examination of the regulatory mechanism of Pxdn mutation-induced eye disorders using microarray analysis

    PubMed Central

    YANG, YANG; XING, YIQIAO; LIANG, CHAOQUN; HU, LIYA; XU, FEI; MEI, QI

    2016-01-01

    The present study aimed to identify biomarkers for peroxidasin (Pxdn) mutation-induced eye disorders and study the underlying mechanisms involved in this process. The microarray dataset GSE49704 was used, which encompasses 4 mouse samples from embryos with Pxdn mutation and 4 samples from normal tissues. After data preprocessing, the differentially expressed genes (DEGs) between Pxdn mutation and normal tissues were identified using the t-test in the limma package, followed by functional enrichment analysis. The protein-protein interaction (PPI) network was constructed based on the STRING database, and the transcriptional regulatory (TR) network was established using the GeneCodis database. Subsequently, the overlapping DEGs with high degrees in two networks were identified, as well as the sub-network extracted from the TR network. In total, 121 (75 upregulated and 46 downregulated) DEGs were identified, and these DEGs play important roles in biological processes (BPs), including neuron development and differentiation. A PPI network containing 25 nodes such as actin, alpha 1, skeletal muscle (Acta1) and troponin C type 2 (fast) (Tnnc2), and a TR network including 120 nodes were built. By comparing the two networks, seven crucial genes which overlapped were identified, including cyclin-dependent kinase inhibitor 1B (Cdkn1b), Acta1 and troponin T type 3 (Tnnt3). In the sub-network, Cdkn1b was predicted as the target of miRNAs such as mmu-miR-24 and transcription factors (TFs) including forkhead box O4 (FOXO4) and activating enhancer binding protein 4 (AP4). Thus, we suggest that seven crucial genes, including Cdkn1b, Acta1 and Tnnt3, play important roles in the progression of eye disorders such as glaucoma. We suggest that Cdkn1b exert its effects via the inhibition of proliferation and is mediated by mmu-miR-24 and targeted by the TFs FOXO4 and AP4. PMID:27121343

  18. Regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor-α genetic variations

    PubMed Central

    LIU, YANGZHOU; HAN, NING; LI, QINCHUAN; LI, ZENGCHUN

    2016-01-01

    The present study aimed to investigate the regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor (TNF)-α genetic variations. The GSE5760 expression profile data, which was downloaded from the Gene Expression Omnibus database, contained 30 wild-type (WT) and 28 mutation (MUT) samples. Differentially expressed genes (DEGs) between the two types of samples were identified using the Student's t-test, and the corresponding microRNAs (miRNAs) were screened using WebGestalt software. An integrated miRNA-DEG network was constructed using the Cytoscape software, based on the interactions between the DEGs, as identified using the Search Tool for the Retrieval of Interacting Genes/Proteins database, and the correlation between miRNAs and their target genes. Furthermore, Gene Ontology and pathway enrichment analyses were conducted for the DEGs using the Database for Annotation, Visualization and Integrated Discovery and the KEGG Orthology Based Annotation System, respectively. A total of 390 DEGS between the WT and MUT samples, along with 11 -associated miRNAs, were identified. The integrated miRNA-DEG network consisted of 38 DEGs and 11 miRNAs. Within this network, COPS2 was found to be associated with transcriptional functions, while FUS was found to be involved in mRNA metabolic processes. Other DEGs, including FBXW7 and CUL3, were enriched in the ubiquitin-mediated proteolysis pathway. In addition, miR-15 was predicted to target COPS2 and CUL3. The results of the present study suggested that COPS2, FUS, FBXW7 and CUL3 may be associated with sepsis in patients with TNF-α genetic variations. In the progression of sepsis, FBXW7 and CUL3 may participate in the ubiquitin-mediated proteolysis pathway, whereas COPS2 may regulate the phosphorylation and ubiquitination of the FUS protein. Furthermore, COPS2 and CUL3 may be novel targets of miR-15. PMID:27347057

  19. Nitrous Oxide Metabolism in Nitrate-Reducing Bacteria: Physiology and Regulatory Mechanisms.

    PubMed

    Torres, M J; Simon, J; Rowley, G; Bedmar, E J; Richardson, D J; Gates, A J; Delgado, M J

    2016-01-01

    Nitrous oxide (N2O) is an important greenhouse gas (GHG) with substantial global warming potential and also contributes to ozone depletion through photochemical nitric oxide (NO) production in the stratosphere. The negative effects of N2O on climate and stratospheric ozone make N2O mitigation an international challenge. More than 60% of global N2O emissions are emitted from agricultural soils mainly due to the application of synthetic nitrogen-containing fertilizers. Thus, mitigation strategies must be developed which increase (or at least do not negatively impact) on agricultural efficiency whilst decrease the levels of N2O released. This aim is particularly important in the context of the ever expanding population and subsequent increased burden on the food chain. More than two-thirds of N2O emissions from soils can be attributed to bacterial and fungal denitrification and nitrification processes. In ammonia-oxidizing bacteria, N2O is formed through the oxidation of hydroxylamine to nitrite. In denitrifiers, nitrate is reduced to N2 via nitrite, NO and N2O production. In addition to denitrification, respiratory nitrate ammonification (also termed dissimilatory nitrate reduction to ammonium) is another important nitrate-reducing mechanism in soil, responsible for the loss of nitrate and production of N2O from reduction of NO that is formed as a by-product of the reduction process. This review will synthesize our current understanding of the environmental, regulatory and biochemical control of N2O emissions by nitrate-reducing bacteria and point to new solutions for agricultural GHG mitigation. PMID:27134026

  20. Sleep-wake states and their regulatory mechanisms throughout early human development.

    PubMed

    Peirano, Patricio; Algarín, Cecilia; Uauy, Ricardo

    2003-10-01

    The emergence of sleep states is one of the most significant aspects of development. Descriptions of both neonatal and late fetal behavior and studies on the organization of sleep have shown that fetus and newborns exhibit spontaneously discrete and cyclic patterns of active sleep (AS) and quiet sleep (QS). Human fetuses and neonates sleep most of their life, and AS is the prevailing state even during the first postnatal months. Several hypotheses to explain central nervous system development consider that AS is the expression of a basic activation program for the central nervous system that increases the functional competence of neurons, circuits, and complex patterns before the organism is called on to use them. Current results indicate the maturation of QS not only coincides with the formation of thalamocortical and intracortical patterns of innervation and periods of heightened synaptogenesis, since this sleep state is also associated with important processes in synaptic remodeling. In fact, several studies suggest that the information acquired during wakefulness is further processed during AS and QS. This article reviews the processes involved in the timing of both AS/QS and sleep/wake alternating patterns throughout early human development. A growing body of evidence indicates that the duration of unmodulated parental care and noncircadian environmental conditions may be detrimental for the establishment of these basic rhythmicities. As a consequence, alterations in parental/environmental entraining factors may well contribute to disturb sleep and feeding commonly experienced by preterm infants. Further knowledge on the early establishment of sleep-wake states regulatory mechanisms is needed to improve modalities for appropriate stimulation in the developing human being. PMID:14597916

  1. Analysis of regulatory mechanism after ErbB4 gene mutation based on local modeling methodology.

    PubMed

    Chen, C L; Zhao, J W

    2016-01-01

    ErbB4 is an oncogene belonging to the epidermal growth factor receptor family and contributes to the occurrence and development of multiple cancers, such as gastric, breast, and colorectal cancers. Therefore, studies of the regulation of ErbB4 in cancerigenic pathway will advance molecular targeted therapy. Advanced bioinformatic analysis softwares, such as ExPASy, Predictprotei, QUARK, and I-TASSER, were used to analyze the regulatory mechanism after ErbB4 gene mutation in terms of amino acid sequence, primary, secondary, and tertiary structure of the protein and upstream-downstream receptor/ligands. Mutation of the 19th and 113th amino acids at the carboxyl terminus of ErbB4 protein did not affect its biological nature, but its secondary structure changed and protein binding sites were near 2 mutational sites; moreover, after mutation introduction, additional binding sites were observed. Tertiary structure modeling indicated that local structure of ErbB4 was changed from an α helical conformation into a β chain folding structure; the α helical conformation is the functional site of protein, while active sites are typically near junctions between helical regions, thus the helical structures are easily destroyed and change into folding structures or other structures after stretching. Mutable sites of ErbB4 is exact binding sites where dimer formed with other epidermal growth factor family proteins; mutation enabled the ErbB4 receptor to bind to neuregulin 1 ligand without dimer formation, disrupting the signal transduction pathway and affecting ErbB4 function. PMID:27323039

  2. Jigsaw Cooperative Learning: Acid-Base Theories

    ERIC Educational Resources Information Center

    Tarhan, Leman; Sesen, Burcin Acar

    2012-01-01

    This study focused on investigating the effectiveness of jigsaw cooperative learning instruction on first-year undergraduates' understanding of acid-base theories. Undergraduates' opinions about jigsaw cooperative learning instruction were also investigated. The participants of this study were 38 first-year undergraduates in chemistry education…

  3. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-01-01

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  4. [Progress of research in osteoarthritis. Gene expression and its regulatory mechanisms in the degenerative cartilage in osteoarthritis].

    PubMed

    Okazaki, Ken; Iwamoto, Yukihide

    2009-11-01

    Spatiotemporal variations of pathological changes were observed in the osteoarthritis joints. Gene expressions vary depending on the zones in the cartilage. For example, the expressions of degradative enzymes such as matrix metalloproteinases were enhanced in the superficial zone whereas the expression of matrix proteins enhanced at the deep zone. Many factors such as mechanical stress, aging, genetic background, inflammation and phenotypic changes of chondrocytes influence the pathogenesis of osteoarthritis, suggesting the involvement of many regulatory mechanisms in the gene expression. However, discoveries of regulatory factors that provide common pathways for the various phenomenon observed in the osteoarthritis cartilage suggest the interaction and co-operation of these important factors to conduct the pathology of degenerative cartilage. PMID:19880989

  5. Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence

    PubMed Central

    Kinney, Justin B.; Murugan, Anand; Callan, Curtis G.; Cox, Edward C.

    2010-01-01

    Cells use protein-DNA and protein-protein interactions to regulate transcription. A biophysical understanding of this process has, however, been limited by the lack of methods for quantitatively characterizing the interactions that occur at specific promoters and enhancers in living cells. Here we show how such biophysical information can be revealed by a simple experiment in which a library of partially mutated regulatory sequences are partitioned according to their in vivo transcriptional activities and then sequenced en masse. Computational analysis of the sequence data produced by this experiment can provide precise quantitative information about how the regulatory proteins at a specific arrangement of binding sites work together to regulate transcription. This ability to reliably extract precise information about regulatory biophysics in the face of experimental noise is made possible by a recently identified relationship between likelihood and mutual information. Applying our experimental and computational techniques to the Escherichia coli lac promoter, we demonstrate the ability to identify regulatory protein binding sites de novo, determine the sequence-dependent binding energy of the proteins that bind these sites, and, importantly, measure the in vivo interaction energy between RNA polymerase and a DNA-bound transcription factor. Our approach provides a generally applicable method for characterizing the biophysical basis of transcriptional regulation by a specified regulatory sequence. The principles of our method can also be applied to a wide range of other problems in molecular biology. PMID:20439748

  6. An examination of the regulatory mechanism of Pxdn mutation-induced eye disorders using microarray analysis.

    PubMed

    Yang, Yang; Xing, Yiqiao; Liang, Chaoqun; Hu, Liya; Xu, Fei; Mei, Qi

    2016-06-01

    The present study aimed to identify biomarkers for peroxidasin (Pxdn) mutation-induced eye disorders and study the underlying mechanisms involved in this process. The microarray dataset GSE49704 was used, which encompasses 4 mouse samples from embryos with Pxdn mutation and 4 samples from normal tissues. After data preprocessing, the differentially expressed genes (DEGs) between Pxdn mutation and normal tissues were identified using the t-test in the limma package, followed by functional enrichment analysis. The protein-protein interaction (PPI) network was constructed based on the STRING database, and the transcriptional regulatory (TR) network was established using the GeneCodis database. Subsequently, the overlapping DEGs with high degrees in two networks were identified, as well as the sub-network extracted from the TR network. In total, 121 (75 upregulated and 46 downregulated) DEGs were identified, and these DEGs play important roles in biological processes (BPs), including neuron development and differentiation. A PPI network containing 25 nodes such as actin, alpha 1, skeletal muscle (Acta1) and troponin C type 2 (fast) (Tnnc2), and a TR network including 120 nodes were built. By comparing the two networks, seven crucial genes which overlapped were identified, including cyclin‑dependent kinase inhibitor 1B (Cdkn1b), Acta1 and troponin T type 3 (Tnnt3). In the sub-network, Cdkn1b was predicted as the target of miRNAs such as mmu-miR-24 and transcription factors (TFs) including forkhead box O4 (FOXO4) and activating enhancer binding protein 4 (AP4). Thus, we suggest that seven crucial genes, including Cdkn1b, Acta1 and Tnnt3, play important roles in the progression of eye disorders such as glaucoma. We suggest that Cdkn1b exert its effects via the inhibition of proliferation and is mediated by mmu-miR-24 and targeted by the TFs FOXO4 and AP4. PMID:27121343

  7. Identification and characterization of the novel Col10a1 regulatory mechanism during chondrocyte hypertrophic differentiation.

    PubMed

    Gu, J; Lu, Y; Li, F; Qiao, L; Wang, Q; Li, N; Borgia, J A; Deng, Y; Lei, G; Zheng, Q

    2014-01-01

    hypertrophic MCT cells. Electrophoretic mobility shift assay and chromatin immunoprecipitation assays confirmed the interaction between Cox-2 and Col10a1 cis-enhancer, supporting its role as a candidate Col10a1 regulator. Together, our data support a Cox-2-containing, Runx2-centered Col10a1 regulatory mechanism, during chondrocyte hypertrophic differentiation. PMID:25321476

  8. Probing the chemical mechanism and critical regulatory amino acid residues of Drosophila melanogaster arylalkylamine N-acyltransferase like 2.

    PubMed

    Dempsey, Daniel R; Carpenter, Anne-Marie; Ospina, Santiago Rodriguez; Merkler, David J

    2015-11-01

    Arylalkylamine N-acyltransferase like 2 (AANATL2) catalyzes the formation of N-acylarylalkylamides from the corresponding acyl-CoA and arylalkylamine. The N-acylation of biogenic amines in Drosophila melanogaster is a critical step for the inactivation of neurotransmitters, cuticle sclerotization, and melatonin biosynthesis. In addition, D. melanogaster has been used as a model system to evaluate the biosynthesis of fatty acid amides: a family of potent cell signaling lipids. We have previously showed that AANATL2 catalyzes the formation of N-acylarylakylamides, including long-chain N-acylserotonins and N-acyldopamines. Herein, we define the kinetic mechanism for AANATL2 as an ordered sequential mechanism with acetyl-CoA binding first followed by tyramine to generate the ternary complex prior to catalysis. Bell shaped kcat,app - acetyl-CoA and (kcat/Km)app - acetyl-CoA pH-rate profiles identified two apparent pKa,app values of ∼7.4 and ∼8.9 that are critical to catalysis, suggesting the AANATL2-catalyzed formation of N-acetyltyramine occurs through an acid/base chemical mechanism. Site-directed mutagenesis of a conserved glutamate that corresponds to the catalytic base for other D. melanogaster AANATL enzymes did not produce a substantial depression in the kcat,app value nor did it abolish the pKa,app value attributed to the general base in catalysis (pKa ∼7.4). These data suggest that AANATL2 catalyzes the formation of N-acylarylalkylamides using either different catalytic residues or a different chemical mechanism relative to other D. melanogaster AANATL enzymes. In addition, we constructed other site-directed mutants of AANATL2 to help define the role of targeted amino acids in substrate binding and/or enzyme catalysis. PMID:26476413

  9. CHOOSING A CHEMICAL MECHANISM FOR REGULATORY AND RESEARCH AIR QUALITY MODELING APPLICATIONS

    EPA Science Inventory

    There are numerous, different chemical mechanisms currently available for use in air quality models, and new mechanisms and versions of mechanisms are continually being developed. The development of Morphecule-type mechanisms will add a near-infinite number of additional mecha...

  10. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms.

    PubMed

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R

    2014-08-01

    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix. PMID:24988880

  11. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms

    PubMed Central

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R

    2014-01-01

    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix. PMID:24988880

  12. De Novo Evolution of Complex, Global and Hierarchical Gene Regulatory Mechanisms

    PubMed Central

    Jenkins, Dafyd J.

    2010-01-01

    Gene regulatory networks exhibit complex, hierarchical features such as global regulation and network motifs. There is much debate about whether the evolutionary origins of such features are the results of adaptation, or the by-products of non-adaptive processes of DNA replication. The lack of availability of gene regulatory networks of ancestor species on evolutionary timescales makes this a particularly difficult problem to resolve. Digital organisms, however, can be used to provide a complete evolutionary record of lineages. We use a biologically realistic evolutionary model that includes gene expression, regulation, metabolism and biosynthesis, to investigate the evolution of complex function in gene regulatory networks. We discover that: (i) network architecture and complexity evolve in response to environmental complexity, (ii) global gene regulation is selected for in complex environments, (iii) complex, inter-connected, hierarchical structures evolve in stages, with energy regulation preceding stress responses, and stress responses preceding growth rate adaptations and (iv) robustness of evolved models to mutations depends on hierarchical level: energy regulation and stress responses tend not to be robust to mutations, whereas growth rate adaptations are more robust and non-lethal when mutated. These results highlight the adaptive and incremental evolution of complex biological networks, and the value and potential of studying realistic in silico evolutionary systems as a way of understanding living systems. Electronic supplementary material The online version of this article (doi:10.1007/s00239-010-9369-4) contains supplementary material, which is available to authorized users. PMID:20680619

  13. Mathematical modeling of acid-base physiology

    PubMed Central

    Occhipinti, Rossana; Boron, Walter F.

    2015-01-01

    pH is one of the most important parameters in life, influencing virtually every biological process at the cellular, tissue, and whole-body level. Thus, for cells, it is critical to regulate intracellular pH (pHi) and, for multicellular organisms, to regulate extracellular pH (pHo). pHi regulation depends on the opposing actions of plasma-membrane transporters that tend to increase pHi, and others that tend to decrease pHi. In addition, passive fluxes of uncharged species (e.g., CO2, NH3) and charged species (e.g., HCO3− , NH4+) perturb pHi. These movements not only influence one another, but also perturb the equilibria of a multitude of intracellular and extracellular buffers. Thus, even at the level of a single cell, perturbations in acid-base reactions, diffusion, and transport are so complex that it is impossible to understand them without a quantitative model. Here we summarize some mathematical models developed to shed light onto the complex interconnected events triggered by acids-base movements. We then describe a mathematical model of a spherical cell–which to our knowledge is the first one capable of handling a multitude of buffer reaction–that our team has recently developed to simulate changes in pHi and pHo caused by movements of acid-base equivalents across the plasma membrane of a Xenopus oocyte. Finally, we extend our work to a consideration of the effects of simultaneous CO2 and HCO3− influx into a cell, and envision how future models might extend to other cell types (e.g., erythrocytes) or tissues (e.g., renal proximal-tubule epithelium) important for whole-body pH homeostasis. PMID:25617697

  14. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands

    PubMed Central

    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo

    2015-01-01

    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1. PMID:26375462

  15. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands.

    PubMed

    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo

    2015-01-01

    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1. PMID:26375462

  16. Regulatory Role of Collagen V in Establishing Mechanical Properties of Tendons and Ligaments is Tissue-Dependent

    PubMed Central

    Connizzo, Brianne K.; Freedman, Benjamin R.; Fried, Joanna H.; Sun, Mei; Birk, David E.; Soslowsky, Louis J.

    2015-01-01

    Patients with classic (type I) Ehlers-Danlos Syndrome (EDS), characterized by heterozygous mutations in the Col5a1 and Col5a2 genes, exhibit connective tissue hyperelasticity and recurrent joint dislocations, indicating a potential regulatory role for collagen V in joint stabilizing soft tissues. This study asked whether the contribution of collagen V to the establishment of mechanical properties is tissue-dependent. We mechanically tested four different tissues from wild type and targeted collagen V-null mice: the flexor digitorum longus tendon (FDL), Achilles tendon (ACH), the anterior cruciate ligament (ACL) and the supraspinatus tendon (SST). Area was significantly reduced in the Col5a1ΔTen/ΔTen group in the FDL, ACH, and SST. Maximum load and stiffness were reduced in the Col5a1ΔTen/ΔTen group for all tissues. However, insertion site and midsubstance modulus were reduced only for the ACL and SST. This study provides evidence that the regulatory role of collagen V in extracellular matrix assembly is tissue-dependent and that joint instability in classic EDS may be caused in part by insufficient mechanical properties of the tendons and ligaments surrounding each joint. PMID:25876927

  17. Mechanisms of diabetic autoimmunity: II--Is diabetes a central or peripheral disorder of effector and regulatory cells?

    PubMed

    Askenasy, Nadir

    2016-02-01

    Two competing hypotheses aiming to explain the onset of autoimmune reactions are discussed in the context of genetic and environmental predisposition to type 1 diabetes (T1D). The first hypothesis has evolved along characterization of the mechanisms of self-discrimination and attributes diabetic autoimmunity to escape of reactive T cells from central regulation in the thymus. The second considers frequent occurrence of autoimmune reactions within the immune homunculus, which are adequately suppressed by regulatory T cells originating from the thymus, and occasionally, insufficient suppression results in autoimmunity. Besides thymic dysfunction, deregulation of both effector and suppressor cells can in fact result from homeostatic aberrations at the peripheral level during initial stages of evolution of adaptive immunity. Pathogenic cells sensitized in the islets are efficiently expanded in the target tissue and pancreatic lymph nodes of lymphopenic neonates. In parallel, the same mechanisms of peripheral sensitization contribute to tolerization through education of naïve/effector T cells and expansion of regulatory T cells. Experimental evidence presented for each individual mechanism implies that T1D may result from a primary effector or suppressor immune abnormality. Disturbed self-tolerance leading to T1D may well result from peripheral deregulation of innate and adaptive immunity, with variable contribution of central thymic dysfunction. PMID:26482052

  18. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp

    PubMed Central

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-01-01

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5′-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism. PMID:26459861

  19. Mosaic gene network modelling identified new regulatory mechanisms in HCV infection.

    PubMed

    Popik, Olga V; Petrovskiy, Evgeny D; Mishchenko, Elena L; Lavrik, Inna N; Ivanisenko, Vladimir A

    2016-06-15

    Modelling of gene networks is widely used in systems biology to study the functioning of complex biological systems. Most of the existing mathematical modelling techniques are useful for analysis of well-studied biological processes, for which information on rates of reactions is available. However, complex biological processes such as those determining the phenotypic traits of organisms or pathological disease processes, including pathogen-host interactions, involve complicated cross-talk between interacting networks. Furthermore, the intrinsic details of the interactions between these networks are often missing. In this study, we developed an approach, which we call mosaic network modelling, that allows the combination of independent mathematical models of gene regulatory networks and, thereby, description of complex biological systems. The advantage of this approach is that it allows us to generate the integrated model despite the fact that information on molecular interactions between parts of the model (so-called mosaic fragments) might be missing. To generate a mosaic mathematical model, we used control theory and mathematical models, written in the form of a system of ordinary differential equations (ODEs). In the present study, we investigated the efficiency of this method in modelling the dynamics of more than 10,000 simulated mosaic regulatory networks consisting of two pieces. Analysis revealed that this approach was highly efficient, as the mean deviation of the dynamics of mosaic network elements from the behaviour of the initial parts of the model was less than 10%. It turned out that for construction of the control functional, data on perturbation of one or two vertices of the mosaic piece are sufficient. Further, we used the developed method to construct a mosaic gene regulatory network including hepatitis C virus (HCV) as the first piece and the tumour necrosis factor (TNF)-induced apoptosis and NF-κB induction pathways as the second piece. Thus

  20. Bipolar Membranes for Acid Base Flow Batteries

    NASA Astrophysics Data System (ADS)

    Anthamatten, Mitchell; Roddecha, Supacharee; Jorne, Jacob; Coughlan, Anna

    2011-03-01

    Rechargeable batteries can provide grid-scale electricity storage to match power generation with consumption and promote renewable energy sources. Flow batteries offer modular and flexible design, low cost per kWh and high efficiencies. A novel flow battery concept will be presented based on acid-base neutralization where protons (H+) and hydroxyl (OH-) ions react electrochemically to produce water. The large free energy of this highly reversible reaction can be stored chemically, and, upon discharge, can be harvested as usable electricity. The acid-base flow battery concept avoids the use of a sluggish oxygen electrode and utilizes the highly reversible hydrogen electrode, thus eliminating the need for expensive noble metal catalysts. The proposed flow battery is a hybrid of a battery and a fuel cell---hydrogen gas storing chemical energy is produced at one electrode and is immediately consumed at the other electrode. The two electrodes are exposed to low and high pH solutions, and these solutions are separated by a hybrid membrane containing a hybrid cation and anion exchange membrane (CEM/AEM). Membrane design will be discussed, along with ion-transport data for synthesized membranes.

  1. Teaching Acid/Base Physiology in the Laboratory

    ERIC Educational Resources Information Center

    Friis, Ulla G.; Plovsing, Ronni; Hansen, Klaus; Laursen, Bent G.; Wallstedt, Birgitta

    2010-01-01

    Acid/base homeostasis is one of the most difficult subdisciplines of physiology for medical students to master. A different approach, where theory and practice are linked, might help students develop a deeper understanding of acid/base homeostasis. We therefore set out to develop a laboratory exercise in acid/base physiology that would provide…

  2. Using Willie's Acid-Base Box for Blood Gas Analysis

    ERIC Educational Resources Information Center

    Dietz, John R.

    2011-01-01

    In this article, the author describes a method developed by Dr. William T. Lipscomb for teaching blood gas analysis of acid-base status and provides three examples using Willie's acid-base box. Willie's acid-base box is constructed using three of the parameters of standard arterial blood gas analysis: (1) pH; (2) bicarbonate; and (3) CO[subscript…

  3. Mechanisms and treatment of allergic disease in the big picture of regulatory T cells.

    PubMed

    Akdis, Cezmi A; Akdis, Mübeccel

    2009-04-01

    Various populations of regulatory T (Treg) cells have been shown to play a central role in the maintenance of peripheral homeostasis and the establishment of controlled immune responses. Their identification as key regulators of immunologic processes in peripheral tolerance to allergens has opened an important era in the prevention and treatment of allergic diseases. Both naturally occurring CD4+CD25+ Treg cells and inducible populations of allergen-specific, IL-10-secreting Treg type 1 (T(R)1) cells inhibit allergen-specific effector cells in experimental models. Skewing of allergen-specific effector T cells to a regulatory phenotype appears to be a key event in the development of healthy immune response to allergens and successful outcome in allergen-specific immunotherapy. Forkhead box protein 3-positive CD4+CD25+ Treg cells and T(R)1 cells contribute to the control of allergen-specific immune responses in several major ways, which can be summarized as suppression of dendritic cells that support the generation of effector T cells; suppression of effector T(H)1, T(H)2, and T(H)17 cells; suppression of allergen-specific IgE and induction of IgG4; suppression of mast cells, basophils, and eosinophils; interaction with resident tissue cells and remodeling; and suppression of effector T-cell migration to tissues. Current strategies for drug development and allergen-specific immunotherapy exploit these observations, with the potential for preventive therapies and cure for allergic diseases. PMID:19348912

  4. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  5. Analysis of the dual regulatory mechanisms controlling expression of the vegetative catalase gene of Bacillus subtilis.

    PubMed Central

    Bol, D K; Yasbin, R E

    1994-01-01

    The expression of a vegetative catalase gene, katA (formerly the kat-19 gene), is necessary to protect Bacillus subtilis from H2O2, presumably by removing the oxidant from the environment. Genetic analysis of katA revealed that this gene is under two distinct forms of regulation, temporal and H2O2 inducible. The results reported here demonstrate that (i) the H2O2-inducible regulation of katA gene is not a component of the SOS regulon, (ii) the regulatory genes spo0A and abrB are involved in the temporal regulation but not the H2O2-specific induction of katA gene expression, and (iii) transcription initiation for the katA gene occurs at the same site under both forms of regulation. Images PMID:7961428

  6. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis

    PubMed Central

    Jones, Danielle M.; Murray, Christian M.; Ketelaar, KassaDee J.; Thomas, Joseph J.; Villalobos, Jose A.; Wallace, Ian S.

    2016-01-01

    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  7. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis.

    PubMed

    Jones, Danielle M; Murray, Christian M; Ketelaar, KassaDee J; Thomas, Joseph J; Villalobos, Jose A; Wallace, Ian S

    2016-01-01

    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  8. Acid-base actuation of [c2]daisy chains.

    PubMed

    Fang, Lei; Hmadeh, Mohamad; Wu, Jishan; Olson, Mark A; Spruell, Jason M; Trabolsi, Ali; Yang, Ying-Wei; Elhabiri, Mourad; Albrecht-Gary, Anne-Marie; Stoddart, J Fraser

    2009-05-27

    A versatile synthetic strategy, which was conceived and employed to prepare doubly threaded, bistable [c2]daisy chain compounds, is described. Propargyl and 1-pentenyl groups have been grafted onto the stoppers of [c2]daisy chain molecules obtained using a template-directed synthetic protocol. Such [c2]daisy chain molecules undergo reversible extension and contraction upon treatment with acid and base, respectively. The dialkyne-functionalized [c2]daisy chain (AA) was subjected to an [AA+BB] type polymerization with an appropriate diazide (BB) to afford a linear, mechanically interlocked, main-chain polymer. The macromolecular properties of this polymer were characterized by chronocoulometry, size exclusion chromatography, and static light-scattering analysis. The acid-base switching properties of both the monomers and the polymer have been studied in solution, using (1)H NMR spectroscopy, UV/vis absorption spectroscopy, and cyclic voltammetry. The experimental results demonstrate that the functionalized [c2]daisy chains, along with their polymeric derivatives, undergo quantitative, efficient, and fully reversible switching processes in solution. Kinetics measurements demonstrate that the acid/base-promoted extension/contraction movements of the polymeric [c2]daisy chain are actually faster than those of its monomeric counterpart. These observations open the door to correlated molecular motions and to changes in material properties. PMID:19419175

  9. Physiological roles of acid-base sensors.

    PubMed

    Levin, Lonny R; Buck, Jochen

    2015-01-01

    Acid-base homeostasis is essential for life. The macromolecules upon which living organisms depend are sensitive to pH changes, and physiological systems use the equilibrium between carbon dioxide, bicarbonate, and protons to buffer their pH. Biological processes and environmental insults are constantly challenging an organism's pH; therefore, to maintain a consistent and proper pH, organisms need sensors that measure pH and that elicit appropriate responses. Mammals use multiple sensors for measuring both intracellular and extracellular pH, and although some mammalian pH sensors directly measure protons, it has recently become apparent that many pH-sensing systems measure pH via bicarbonate-sensing soluble adenylyl cyclase. PMID:25340964

  10. Regulatory mechanisms of ethylene biosynthesis in response to various stimuli during maturation and ripening in fig fruit (Ficus carica L.).

    PubMed

    Owino, W O; Manabe, Y; Mathooko, F M; Kubo, Y; Inaba, A

    2006-01-01

    In order to obtain a greater uniformity of maturation, the growth of the fig fruit (Ficus carica L.) can be stimulated by the application of either olive oil, ethrel/ethephon or auxin. The three treatments induce ethylene production in figs. In this study, we investigated the regulatory mechanisms responsible for oil, auxin and ethylene induced ethylene production in figs. The ethylene production in response to olive oil, auxin, and propylene treatments and during ripening were all induced by 1-methylcyclopropene (1-MCP) and inhibited by propylene indicating a negative feedback regulation mechanism. Three 1-aminocyclopropane-1-carboxylic acid (ACC) synthase genes (Fc-ACS1, Fc-ACS2 and Fc-ACS3) and one ACC oxidase gene (Fc-ACO1) were isolated and their expression patterns in response to either oil, propylene or auxin treatment in figs determined. The expression patterns of Fc-ACS1 and Fc-ACO1 were clearly inhibited by 1-MCP and induced by propylene in oil treated and ripe fruits indicating positive regulation by ethylene, whereas Fc-ACS2 gene expression was induced by 1-MCP and inhibited by propylene indicating negative regulation by ethylene. The Fc-ACS3 mRNA showed high level accumulation in the auxin treated fruit. The inhibition of Fc-ACS3 gene by 1-MCP in oil treated and in ripe fruits suggests that auxin and ethylene modulate the expression of this gene by multi-responsive signal transduction pathway mechanisms. We further report that the olive oil-induced ethylene in figs involves the ACC-dependent pathway and that multiple ethylene regulatory pathways are involved during maturation and ripening in figs and each specific pathway depends on the inducer/stimulus. PMID:16889975

  11. Overexpression of Heat Shock Protein 72 Attenuates NF-κB Activation Using a Combination of Regulatory Mechanisms in Microglia

    PubMed Central

    Khammash, Mustafa; Giffard, Rona G.

    2014-01-01

    Overexpression of the inducible heat shock protein 70, Hsp72, has broadly cytoprotective effects and improves outcome following stroke. A full understanding of how Hsp72 protects cells against injury is elusive, though several distinct mechanisms are implicated. One mechanism is its anti-inflammatory effects. We study the effects of Hsp72 overexpression on activation of the transcription factor NF-κB in microglia combining experimentation and mathematical modeling, using TNFα to stimulate a microglial cell line stably overexpressing Hsp72. We find that Hsp72 overexpression reduces the amount of NF-κB DNA binding activity, activity of the upstream kinase IKK, and amount of IκBα inhibitor phosphorylated following TNFα application. Simulations evaluating several proposed mechanisms suggest that inhibition of IKK activation is an essential component of its regulatory activities. Unexpectedly we find that Hsp72 overexpression reduces the initial amount of the RelA/p65 NF-κB subunit in cells, contributing to the attenuated response. Neither mechanism in isolation, however, is sufficient to attenuate the response, providing evidence that Hsp72 relies upon multiple mechanisms to attenuate NF-κB activation. An additional observation from our study is that the induced expression of IκBα is altered significantly in Hsp72 expressing cells. While the mechanism responsible for this observation is not known, it points to yet another means by which Hsp72 may alter the NF-κB response. This study illustrates the multi-faceted nature of Hsp72 regulation of NF-κB activation in microglia and offers further clues to a novel mechanism by which Hsp72 may protect cells against injury. PMID:24516376

  12. Site-specific silencing of regulatory elements as a mechanism of X inactivation.

    PubMed

    Calabrese, J Mauro; Sun, Wei; Song, Lingyun; Mugford, Joshua W; Williams, Lucy; Yee, Della; Starmer, Joshua; Mieczkowski, Piotr; Crawford, Gregory E; Magnuson, Terry

    2012-11-21

    The inactive X chromosome's (Xi) physical territory is microscopically devoid of transcriptional hallmarks and enriched in silencing-associated modifications. How these microscopic signatures relate to specific Xi sequences is unknown. Therefore, we profiled Xi gene expression and chromatin states at high resolution via allele-specific sequencing in mouse trophoblast stem cells. Most notably, X-inactivated transcription start sites harbored distinct epigenetic signatures relative to surrounding Xi DNA. These sites displayed H3-lysine27-trimethylation enrichment and DNaseI hypersensitivity, similar to autosomal Polycomb targets, yet excluded Pol II and other transcriptional hallmarks, similar to nontranscribed genes. CTCF bound X-inactivated and escaping genes, irrespective of measured chromatin boundaries. Escape from X inactivation occurred within, and X inactivation was maintained exterior to, the area encompassed by Xist in cells subject to imprinted and random X inactivation. The data support a model whereby inactivation of specific regulatory elements, rather than a simple chromosome-wide separation from transcription machinery, governs gene silencing over the Xi. PMID:23178118

  13. Site-specific silencing of regulatory elements as a mechanism of X-inactivation

    PubMed Central

    Calabrese, J. Mauro; Sun, Wei; Song, Lingyun; Mugford, Joshua W.; Williams, Lucy; Yee, Della; Starmer, Joshua; Mieczkowski, Piotr; Crawford, Gregory E.; Magnuson, Terry

    2012-01-01

    The inactive X chromosome’s (Xi) physical territory is microscopically devoid of transcriptional hallmarks and enriched in silencing-associated modifications. How these microscopic signatures relate to specific Xi sequence is unknown. Therefore, we profiled Xi gene expression and chromatin states at high resolution via allele-specific sequencing in mouse trophoblast stem cells. Most notably, X-inactivated transcription start sites harbored distinct epigenetic signatures relative to surrounding Xi DNA. These sites displayed H3-lysine27-trimethylation enrichment and DNaseI hypersensitivity, similar to autosomal Polycomb targets, yet excluded Pol II and other transcriptional hallmarks, similar to non-transcribed genes. CTCF bound X-inactivated and escaping genes, irrespective of measured chromatin boundaries. Escape from X-inactivation occurred within, and X-inactivation was maintained exterior to, the area encompassed by Xist in cells subject to imprinted and random X-inactivation. The data support a model whereby inactivation of specific regulatory elements, rather than a simple chromosome-wide separation from transcription machinery, governs gene silencing over the Xi. PMID:23178118

  14. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues

    PubMed Central

    Suzuki, Takashi; Swift, Larry L.

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5′-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5′-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  15. Transcriptome analysis reveals novel regulatory mechanisms in a genome-reduced bacterium.

    PubMed

    Mazin, Pavel V; Fisunov, Gleb Y; Gorbachev, Alexey Y; Kapitskaya, Kristina Y; Altukhov, Ilya A; Semashko, Tatiana A; Alexeev, Dmitry G; Govorun, Vadim M

    2014-12-01

    The avian bacterial pathogen Mycoplasma gallisepticum is a good model for systems studies due to small genome and simplicity of regulatory pathways. In this study, we used RNA-Seq and MS-based proteomics to accurately map coding sequences, transcription start sites (TSSs) and transcript 3'-ends (T3Es). We used obtained data to investigate roles of TSSs and T3Es in stress-induced transcriptional responses. We identified 1061 TSSs at a false discovery rate of 10% and showed that almost all transcription in M. gallisepticum is initiated from classic TATAAT promoters surrounded by A/T-rich sequences. Our analysis revealed the pronounced operon structure complexity: on average, each coding operon has one internal TSS and T3Es in addition to the primary ones. Our transcriptomic approach based on the intervals between the two nearest transcript ends allowed us to identify two classes of T3Es: strong, unregulated, hairpin-containing T3Es and weak, heat shock-regulated, hairpinless T3Es. Comparing gene expression levels under different conditions revealed widespread and divergent transcription regulation in M. gallisepticum. Modeling suggested that the core promoter structure plays an important role in gene expression regulation. We have shown that the heat stress activation of cryptic promoters combined with the hairpinless T3Es suppression leads to widespread, seemingly non-functional transcription. PMID:25361977

  16. The Hematopoietic Stem and Progenitor Cell Cistrome: GATA Factor-Dependent cis-Regulatory Mechanisms.

    PubMed

    Hewitt, K J; Johnson, K D; Gao, X; Keles, S; Bresnick, E H

    2016-01-01

    Transcriptional regulators mediate the genesis and function of the hematopoietic system by binding complex ensembles of cis-regulatory elements to establish genetic networks. While thousands to millions of any given cis-element resides in a genome, how transcriptional regulators select these sites and how site attributes dictate functional output is not well understood. An instructive system to address this problem involves the GATA family of transcription factors that control vital developmental and physiological processes and are linked to multiple human pathologies. Although GATA factors bind DNA motifs harboring the sequence GATA, only a very small subset of these abundant motifs are occupied in genomes. Mechanistic studies revealed a unique configuration of a GATA factor-regulated cis-element consisting of an E-box and a downstream GATA motif separated by a short DNA spacer. GATA-1- or GATA-2-containing multiprotein complexes at these composite elements control transcription of genes critical for hematopoietic stem cell emergence in the mammalian embryo, hematopoietic progenitor cell regulation, and erythroid cell maturation. Other constituents of the complex include the basic helix-loop-loop transcription factor Scl/TAL1, its heterodimeric partner E2A, and the Lim domain proteins LMO2 and LDB1. This chapter reviews the structure/function of E-box-GATA composite cis-elements, which collectively constitute an important sector of the hematopoietic stem and progenitor cell cistrome. PMID:27137654

  17. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues.

    PubMed

    Suzuki, Takashi; Swift, Larry L

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5'-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5'-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  18. Transcriptome analysis reveals novel regulatory mechanisms in a genome-reduced bacterium

    PubMed Central

    Mazin, Pavel V.; Fisunov, Gleb Y.; Gorbachev, Alexey Y.; Kapitskaya, Kristina Y.; Altukhov, Ilya A.; Semashko, Tatiana A.; Alexeev, Dmitry G.; Govorun, Vadim M.

    2014-01-01

    The avian bacterial pathogen Mycoplasma gallisepticum is a good model for systems studies due to small genome and simplicity of regulatory pathways. In this study, we used RNA-Seq and MS-based proteomics to accurately map coding sequences, transcription start sites (TSSs) and transcript 3′-ends (T3Es). We used obtained data to investigate roles of TSSs and T3Es in stress-induced transcriptional responses. We identified 1061 TSSs at a false discovery rate of 10% and showed that almost all transcription in M. gallisepticum is initiated from classic TATAAT promoters surrounded by A/T-rich sequences. Our analysis revealed the pronounced operon structure complexity: on average, each coding operon has one internal TSS and T3Es in addition to the primary ones. Our transcriptomic approach based on the intervals between the two nearest transcript ends allowed us to identify two classes of T3Es: strong, unregulated, hairpin-containing T3Es and weak, heat shock-regulated, hairpinless T3Es. Comparing gene expression levels under different conditions revealed widespread and divergent transcription regulation in M. gallisepticum. Modeling suggested that the core promoter structure plays an important role in gene expression regulation. We have shown that the heat stress activation of cryptic promoters combined with the hairpinless T3Es suppression leads to widespread, seemingly non-functional transcription. PMID:25361977

  19. On multiple regulatory mechanisms in the tryptophan operon system in Escherichia coli: in silico study of perturbation dynamics.

    PubMed

    Nguyen, Lan K; Kulasiri, Don

    2008-01-01

    Living organisms often exist in uncertain environments where changes are the norm. Cellular systems therefore require resilient regulatory mechanisms for timely and stable adaptation. Among various regulation motifs, multiple feedback control emerges as a common theme. The tryptophan operon system in Escherichia coli regulates the production ofintracellular tryptophan using an apparatus of three feedback mechanisms: repression, attenuation and enzyme inhibition; each provides essentially the same function but operates in distinctly different ways. Here we aim to understand the roles of each loop by studying transient dynamics of the system to perturbations of different types; to reveal the underlying relationships between individual control mechanisms and macroscopic behaviour. We develop an S-systems approximation of an existing model for the system and characterise transient dynamics by introducing two measurable quantities: maximum disturbance (MD) and recovery time (RT). Our simulation results showed that combined regulation using all three feedback mechanisms significantly increases system stability, broadening the range of kinetic parameters for stable behaviour. Enzyme inhibition was shown to directly control the disturbance level in system variables after perturbations. Attenuation, on the other hand, was found to speed up system recovery whereas repression lengthens recovery time. The method developed in this paper and the defined transient dynamics measurements can be applied to other cellular systems. PMID:19374133

  20. The regulatory role of cell mechanics for migration of differentiating myeloid cells.

    PubMed

    Lautenschläger, Franziska; Paschke, Stephan; Schinkinger, Stefan; Bruel, Arlette; Beil, Michael; Guck, Jochen

    2009-09-15

    Migration of cells is important for tissue maintenance, immune response, and often altered in disease. While biochemical aspects, including cell adhesion, have been studied in detail, much less is known about the role of the mechanical properties of cells. Previous measurement methods rely on contact with artificial surfaces, which can convolute the results. Here, we used a non-contact, microfluidic optical stretcher to study cell mechanics, isolated from other parameters, in the context of tissue infiltration by acute promyelocytic leukemia (APL) cells, which occurs during differentiation therapy with retinoic acid. Compliance measurements of APL cells reveal a significant softening during differentiation, with the mechanical properties of differentiated cells resembling those of normal neutrophils. To interfere with the migratory ability acquired with the softening, differentiated APL cells were exposed to paclitaxel, which stabilizes microtubules. This treatment does not alter compliance but reduces cell relaxation after cessation of mechanical stress six-fold, congruent with a significant reduction of motility. Our observations imply that the dynamical remodeling of cell shape required for tissue infiltration can be frustrated by stiffening the microtubular system. This link between the cytoskeleton, cell mechanics, and motility suggests treatment options for pathologies relying on migration of cells, notably cancer metastasis. PMID:19717452

  1. Understanding gene regulatory mechanisms by integrating ChIP-seq and RNA-seq data: statistical solutions to biological problems

    PubMed Central

    Angelini, Claudia; Costa, Valerio

    2014-01-01

    The availability of omic data produced from international consortia, as well as from worldwide laboratories, is offering the possibility both to answer long-standing questions in biomedicine/molecular biology and to formulate novel hypotheses to test. However, the impact of such data is not fully exploited due to a limited availability of multi-omic data integration tools and methods. In this paper, we discuss the interplay between gene expression and epigenetic markers/transcription factors. We show how integrating ChIP-seq and RNA-seq data can help to elucidate gene regulatory mechanisms. In particular, we discuss the two following questions: (i) Can transcription factor occupancies or histone modification data predict gene expression? (ii) Can ChIP-seq and RNA-seq data be used to infer gene regulatory networks? We propose potential directions for statistical data integration. We discuss the importance of incorporating underestimated aspects (such as alternative splicing and long-range chromatin interactions). We also highlight the lack of data benchmarks and the need to develop tools for data integration from a statistical viewpoint, designed in the spirit of reproducible research. PMID:25364758

  2. TGF-β-Induced Regulatory T Cells Directly Suppress B Cell Responses through a Noncytotoxic Mechanism.

    PubMed

    Xu, Anping; Liu, Ya; Chen, Weiqian; Wang, Julie; Xue, Youqiu; Huang, Feng; Rong, Liming; Lin, Jin; Liu, Dahai; Yan, Mei; Li, Quan-Zhen; Li, Bin; Song, Jianxun; Olsen, Nancy; Zheng, Song Guo

    2016-05-01

    Foxp3(+) regulatory T cells (Treg) playing a crucial role in the maintenance of immune tolerance and prevention of autoimmune diseases consist of thymus-derived naturally occurring CD4(+)Foxp3(+) Treg cells (nTreg) and those that can be induced ex vivo with TGF-β (iTreg). Although both Treg subsets share similar phenotypes and functional characteristics, they also have potential biologic differences on their biology. The role of iTreg in regulating B cells remains unclear so far. The suppression assays of Treg subsets on activation, proliferation, and Abs production of B cells were measured using a Treg and B cell coculture system in vitro. Transwell and Ab blockade experiments were performed to assess the roles of cell contact and soluble cytokines. Treg were adoptively transferred to lupus mice to assess in vivo effects on B cells. Like nTreg, iTreg subset also directly suppressed activation and proliferation of B cells. nTreg subset suppressed B cell responses through cytotoxic manner related to expression of granzyme A, granzyme B, and perforin, whereas the role of iTreg subset on B cells did not involve in cytotoxic action but depending on TGF-β signaling. Furthermore, iTreg subset can significantly suppress Ab produced by lupus B cells in vitro. Comparison experiments using autoantibodies microarrays demonstrated that adoptive transfer of iTreg had a superior effect than nTreg subset on suppressing lupus B cell responses in vivo. Our data implicate a role and advantage of iTreg subset in treating B cell-mediated autoimmune diseases, boosting the translational potential of these findings. PMID:27001954

  3. [VEGETATIVE REGULATORY MECHANISMS IN DIFFERENT GEOMAGNETIC CONDITIONS DEPENDING ON A DEGREE OF PHYSICAL CONDITIONING].

    PubMed

    Kvachadze, I; Tsibadze, A; Sanadiradze, G; Mzhavanadze, D; Chichinadze, G

    2016-04-01

    The aim of the study was to evaluate the vegetative regulatory action in healthy, untrained and trained individuals in different geomagnetic conditions. The study involved 94 healthy untrained young men aged 18-22 years - I group (control), and 60 trained volunteers aged 18-25 years - II group, who during the period of the study and for at least three years prior have been following active regular physical exercise regimen(weight lifting), but were not professional athletes. In order to evaluate the heart rate variability the following statistical indicators were studied: arithmetic mean, the arithmetic mean of the error variance, dispersion, the arithmetic mean deviation, coefficient of skewness, kurtosis, standard deviation of the mean. Geometric analysis was performed using a variation pulsometry. All the individuals were studied in natural/tranquil conditions, during naturally occuring or a simulated geomagnetic storm, which provided the use of the characteristics of vegetative balance as a marker for differential assessment of the impact of electromagnetic field (EMF). The forecast of natural geomagnetic conditions had been made at least three days before the study. Under the conditions of simulated geomagnetic storm the test subjects were placed in a solenoid with non-magnetic equipment. EMF inductance in the solenoid corresponded to the geomagnetic storm frequencies. The study had a nature of social experiment and was carried out by a single blind method: tested subjects were unaware of geomagnetic conditions during the study. This was an open, three-step, cohort, prospective study with parallel character. The results showed that under the uniform qualitative conditions (balanced, in particular) of initial state of vegetative equilibrium, the level of fitness of the human body determines the differentiated response to EMF exposure. Thus, with the possible inclusion of the EMF in the complex of therapeutic or preventive measures, it is necessary to predict

  4. Single-Nucleotide Mutations in FMR1 Reveal Novel Functions and Regulatory Mechanisms of the Fragile X Syndrome Protein FMRP

    PubMed Central

    Suhl, Joshua A.; Warren, Stephen T.

    2015-01-01

    Fragile X syndrome is a monogenic disorder and a common cause of intellectual disability. Despite nearly 25 years of research on FMR1, the gene underlying the syndrome, very few pathological mutations other than the typical CGG-repeat expansion have been reported. This is in contrast to other X-linked, monogenic, intellectual disability disorders, such as Rett syndrome, where many point mutations have been validated as causative of the disorder. As technology has improved and significantly driven down the cost of sequencing, allowing for whole genes to be sequenced with relative ease, in-depth sequencing studies on FMR1 have recently been performed. These studies have led to the identification of novel variants in FMR1, where some of which have been functionally evaluated and are likely pathogenic. In this review, we discuss recently identified FMR1 variants, the ways these novel variants cause dysfunction, and how they reveal new regulatory mechanisms and functionalities of the gene. PMID:26819560

  5. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods

    NASA Astrophysics Data System (ADS)

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay; Chatterjee, Suvro; Patra, Chitta Ranjan

    2015-05-01

    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role.Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular

  6. The Potential Regulatory Mechanisms of miR-196a in Huntington’s Disease through Bioinformatic Analyses

    PubMed Central

    Tsai, Shaw-Jeng; Lai, Yen-Yu; Chang, Yu-Fan; Cheng, Pei-Hsun; Chen, Chuan-Mu; Yang, Shang-Hsun

    2015-01-01

    High throughput screening is a powerful tool to identify the potential candidate molecules involved during disease progression. However, analysis of complicated data is one of the most challenging steps on the way to obtaining useful results from this approach. Previously, we showed that a specific miRNA, miR-196a, could ameliorate the pathological phenotypes of Huntington’s disease (HD) in different models, and performed high throughput screening by using the striatum of transgenic mice. In this study, we further tried to identify the potential regulatory mechanisms using different bioinformatic tools, including Database for Annotation, Visualization and Integrated Discovery (DAVID), Molecular Signatures Database (MSigDB), TargetScan and MetaCore. The results showed that miR-196a dominantly altered “ABC transporters”, “RIG-I-like receptor signaling pathway”, immune system”, “adaptive immune system”,“tissue remodeling and wound repair” and “cytoskeleton remodeling”. In addition, miR-196a also changed the expression of several well-defined pathways of HD, such as apoptosis and cell adhesion. Since these analyses showed the regulatory pathways are highly related to the modification of the cytoskeleton, we further confirmed that miR-196a could enhance the neurite outgrowth in neuroblastoma cells, suggesting miR-196a might provide beneficial functions through the alteration of cytoskeleton structures. Since impairment of the cytoskeleton has been reported in several neuronal diseases, this study will provide not only the potential working mechanisms of miR-196a but also insights for therapeutic strategies for use with different neuronal diseases. PMID:26376480

  7. [Research Progress of NOS3 Participation in Regulatory Mechanisms of Cardiovascular Diseases].

    PubMed

    Sun, Ting; Chi, Qingjia; Wang, Guixue

    2016-02-01

    Cardiovascular disease has been a major threat to human's health and lives for many years. It is of great importance to explore the mechanisms and develop strategies to prevent the pathogenesis. Generally, cardiovascular disease is associated with endothelial dysfunction, which is closely related to the nitric oxide (NO)-mediated vasodilatation. The release of NO is regulated by NOS3 gene in mammals' vascular system. A great deal of evidences have shown that the polymorphism and epigenetic of NOS3 gene play vital roles in the pathological process of cardiovascular disease. To gain insights into the role of NOS3 in the cardiovascular diseases, we reviewed the molecular mechanisms underlying the development of cardiovascular diseases in this paper, including the uncoupling of NOS3 protein, epigenetic and polymorphism of NOS3 gene. The review can also offer possible strategies to prevent and treat cardiovascular diseases. PMID:27382763

  8. Regulatory mechanism of the three-component system HptRSA in glucose-6-phosphate uptake in Staphylococcus aureus.

    PubMed

    Yang, Yifan; Sun, Haipeng; Liu, Xiaoyu; Wang, Mingxing; Xue, Ting; Sun, Baolin

    2016-06-01

    Glucose-6-phosphate (G6P) is a common alternative carbon source for various bacteria, and its uptake usually relies on the hexose phosphate antiporter UhpT. In the human pathogenic bacterium Staphylococcus aureus, the ability to utilize different nutrients, particularly alternative carbon source uptake in glucose-limiting conditions, is essential for its fitness in the host environment during the infectious process. It has been reported that G6P uptake in S. aureus is regulated by the three-component system HptRSA. When G6P is provided as the only carbon source, HptRSA could sense extracellular G6P and activate uhpT expression to facilitate G6P utilization. However, the regulatory mechanism of HptRSA is still unclear. In this study, we further investigated the HptRSA system in S. aureus. First, we confirmed that HptRSA is necessary for the normal growth of this pathogen in chemically defined medium with G6P supplementation, and we discovered that HptRSA could exclusively sense extracellular G6P compared to the other organophosphates we tested. Next, using isothermal titration calorimetry, we found that HptA could bind to G6P, suggesting that it may be the G6P sensor. After that experiment, using an electrophoresis mobility shift assay, we verified that the response regulator HptR could directly bind to the uhpT promoter and identified a putative binding site from -67 to -96-bp. Subsequently, we created different point mutations in the putative binding site and revealed that the entire 30-bp sequence is essential for HptR regulation. In summary, we unveiled the regulatory mechanism of the HptRSA system in S. aureus, HptA most likely functions as the G6P sensor, and HptR could implement its regulatory function by directly binding to a conserved, approximately 30-bp sequence in the uhpT promoter. PMID:26711125

  9. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods†

    PubMed Central

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay

    2016-01-01

    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role. PMID:25963768

  10. Identification of Novel Pretranslational Regulatory Mechanisms for NF-κB Activation*

    PubMed Central

    Huang, Xiao; Gong, Ren; Li, Xinyuan; Virtue, Anthony; Yang, Fan; Yang, Irene H.; Tran, Anh H.; Yang, Xiao-Feng; Wang, Hong

    2013-01-01

    NF-κB-controlled transcriptional regulation plays a central role in inflammatory and immune responses. Currently, understanding about NF-κB activation mechanism emphasizes IκB-tethered complex inactivation in the cytoplasm. In the case of NF-κB activation, IκB phosphorylation leads to its degradation, followed by NF-κB relocation to the nucleus and trans-activation of NF-κB-targeted genes. Pretranslational mechanism mediated NF-κB activation remains poorly understood. In this study, we investigated NF-κB pretranslational regulation by performing a series of database mining analyses and using six large national experimental databases (National Center of Biotechnology Information UniGene expressed sequence tag profile database, Gene Expression Omnibus database, Transcription Element Search System database, AceView database, and Epigenomics database) and TargetScan software. We reported the following findings: 1) NF-κB-signaling genes are differentially expressed in human and mouse tissues; 2) heart and vessels are the inflammation-privileged tissues and less easy to be inflamed because lacking in key NF-κB-signaling molecular expression; 3) NF-κB-signaling genes are induced by cardiovascular disease risk factors oxidized phospholipids and proinflammatory cytokines in endothelial cells; 4) transcription factors CCAAT/enhancer-binding proteins and NF-κB have higher binding site frequencies in the promoters of proinflammatory cytokine-induced NF-κB genes; 5) most NF-κB-signaling genes have multiple alternative promoters and alternatively spliced isoforms; 6) NF-κB family genes can be regulated by DNA methylation; and 7) 27 of 38 NF-κB-signaling genes can be regulated by microRNAs. Our findings provide important insight into the mechanism of NF-κB activation, which may contribute to cardiovascular disease, inflammatory diseases, and immunological disorders. PMID:23515310

  11. Photochemistry of nucleic acid bases and their thio- and aza-analogues in solution.

    PubMed

    Pollum, Marvin; Martínez-Fernández, Lara; Crespo-Hernández, Carlos E

    2015-01-01

    The steady-state and time-resolved photochemistry of the natural nucleic acid bases and their sulfur- and nitrogen-substituted analogues in solution is reviewed. Emphasis is given to the experimental studies performed over the last 3-5 years that showcase topical areas of scientific inquiry and those that require further scrutiny. Significant progress has been made toward mapping the radiative and nonradiative decay pathways of nucleic acid bases. There is a consensus that ultrafast internal conversion to the ground state is the primary relaxation pathway in the nucleic acid bases, whereas the mechanism of this relaxation and the level of participation of the (1)πσ*, (1) nπ*, and (3)ππ* states are still matters of debate. Although impressive research has been performed in recent years, the microscopic mechanism(s) by which the nucleic acid bases dissipate excess vibrational energy to their environment, and the role of the N-glycosidic group in this and in other nonradiative decay pathways, are still poorly understood. The simple replacement of a single atom in a nucleobase with a sulfur or nitrogen atom severely restricts access to the conical intersections responsible for the intrinsic internal conversion pathways to the ground state in the nucleic acid bases. It also enhances access to ultrafast and efficient inter-system crossing pathways that populate the triplet manifold in yields close to unity. Determining the coupled nuclear and electronic pathways responsible for the significantly different photochemistry in these nucleic acid base analogues serves as a convenient platform to examine the current state of knowledge regarding the photodynamic properties of the DNA and RNA bases from both experimental and computational perspectives. Further investigations should also aid in forecasting the prospective use of sulfur- and nitrogen-substituted base analogues in photochemotherapeutic applications. PMID:25238718

  12. Regulatory mechanisms of betacellulin in CXCL8 production from lung cancer cells

    PubMed Central

    2014-01-01

    Background Betacellulin (BTC), a member of the epidermal growth factor (EGF) family, binds and activates ErbB1 and ErbB4 homodimers. BTC was expressed in tumors and involved in tumor growth progression. CXCL8 (interleukin-8) was involved in tumor cell proliferation via the transactivation of the epidermal growth factor receptor (EGFR). Materials and methods The present study was designed to investigate the possible interrelation between BTC and CXCL8 in human lung cancer cells (A549) and demonstrated the mechanisms of intracellular signals in the regulation of both functions. Bio-behaviors of A549 were assessed using Cell-IQ Alive Image Monitoring System. Results We found that BTC significantly increased the production of CXCL8 through the activation of the EGFR-PI3K/Akt-Erk signal pathway. BTC induced the resistance of human lung cancer cells to TNF-α/CHX-induced apoptosis. Treatments with PI3K inhibitors, Erk1/2 inhibitor, or Erlotinib significantly inhibited BTC-induced CXCL8 production and cell proliferation and movement. Conclusion Our data indicated that CXCL8 production from lung cancer cells could be initiated by an autocrine mechanism or external sources of BTC through the EGFR–PI3K–Akt–Erk pathway to the formation of inflammatory microenvironment. BTC may act as a potential target to monitor and improve the development of lung cancer inflammation. PMID:24629040

  13. New effector functions and regulatory mechanisms of BCL6 in normal and malignant lymphocytes

    PubMed Central

    Bunting, Karen L.; Melnick, Ari M.

    2014-01-01

    The BCL6 oncogenic repressor is a master regulator of humoral immunity and B-cell lymphoma survival. Whereas much research has focused on its regulation and function in germinal center B-cells, its role in other mature lymphoid cell compartments is less clear. A novel role for BCL6 in follicular T helper cell development was recently uncovered. The latest discoveries reveal that BCL6 is also an important regulator of other specialized helper T-cell subsets within germinal centers, pre-germinal center events, and peripheral T-cells effector functions. Here, we review newly discovered roles for BCL6 in lymphocyte subsets residing within and outside of germinal centers, and discuss their implications with respect to the molecular mechanisms of BCL6 regulation and potential links to B and T-cell lymphomas. PMID:23725655

  14. The T box mechanism: tRNA as a regulatory molecule

    PubMed Central

    Green, Nicholas J.; Grundy, Frank J.; Henkin, Tina M.

    2009-01-01

    The T box mechanism is widely used in Gram-positive bacteria to regulate expression of aminoacyl-tRNA synthetase genes and genes involved in amino acid biosynthesis and uptake. Binding of a specific uncharged tRNA to a riboswitch element in the nascent transcript causes a structural change in the transcript that promotes expression of the downstream coding sequence. In most cases, this occurs by stabilization of an antiterminator element that competes with formation of a terminator helix. Specific tRNA recognition by the nascent transcript results in increased expression of genes important for tRNA aminoacylation in response to decreased pools of charged tRNA. PMID:19932103

  15. Dss1 Interaction with Brh2 as a Regulatory Mechanism for Recombinational Repair▿

    PubMed Central

    Zhou, Qingwen; Kojic, Milorad; Cao, Zhimin; Lisby, Michael; Mazloum, Nayef A.; Holloman, William K.

    2007-01-01

    Brh2, the BRCA2 ortholog in Ustilago maydis, enables recombinational repair of DNA by controlling Rad51 and is in turn regulated by Dss1. Interplay with Rad51 is conducted via the BRC element located in the N-terminal region of the protein and through an unrelated domain, CRE, at the C terminus. Mutation in either BRC or CRE severely reduces functional activity, but repair deficiency of the brh2 mutant can be complemented by expressing BRC and CRE on different molecules. This intermolecular complementation is dependent upon the presence of Dss1. Brh2 molecules associate through the region overlapping with the Dss1-interacting domain to form at least dimer-sized complexes, which in turn, can be dissociated by Dss1 to monomer. We propose that cooperation between BRC and CRE domains and the Dss1-provoked dissociation of Brh2 complexes are requisite features of Brh2's molecular mechanism. PMID:17261595

  16. [The defense and regulatory mechanisms during development of legume-Rhizobium symbiosis].

    PubMed

    Glian'ko, A K; Akimova, G P; Sokolova, M G; Makarova, L E; Vasil'eva, G G

    2007-01-01

    The roles of indolylacetic acid, the peroxidase system, catalase, active oxygen species, and phenolic compounds in the physiological and biochemical mechanisms involved in the autoregulation of nodulation in the developing legume-Rhizobium symbiosis were studied. It was inferred that the concentration of indolylacetic acid in the roots of inoculated plants, controlled by the enzymes of the peroxidase complex, is the signal permitting or limiting nodulation at the initial stages of symbiotic interaction. Presumably, the change in the level of active oxygen species is determined by an antioxidant activity of phenolic compounds. During the development of symbiosis, phytohormones, antioxidant enzymes, and active oxygen species may be involved in the regulation of infection via both a direct antibacterial action and regulation of functional activity of the host plant defense systems. PMID:17619575

  17. The Influence of Early Life Nutrition on Epigenetic Regulatory Mechanisms of the Immune System

    PubMed Central

    Paparo, Lorella; di Costanzo, Margherita; di Scala, Carmen; Cosenza, Linda; Leone, Ludovica; Nocerino, Rita; Berni Canani, Roberto

    2014-01-01

    The immune system is exquisitely sensitive to environmental changes. Diet constitutes one of the major environmental factors that exerts a profound effect on immune system development and function. Epigenetics is the study of mitotically heritable, yet potentially reversible, molecular modifications to DNA and chromatin without alteration to the underlying DNA sequence. Nutriepigenomics is an emerging discipline examining the role of dietary influences on gene expression. There is increasing evidence that the epigenetic mechanisms that regulate gene expression during immune differentiation are directly affected by dietary factors or indirectly through modifications in gut microbiota induced by different dietary habits. Short-chain fatty acids, in particular butyrate, produced by selected bacteria stains within gut microbiota, are crucial players in this network. PMID:25353665

  18. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons

    PubMed Central

    Ridyard, Marc S.; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W.

    2015-01-01

    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  19. Organization of hepatic nitrogen metabolism and its relation to acid-base homeostasis.

    PubMed

    Häussinger, D

    1990-11-16

    Hepatic and renal nitrogen metabolism are linked by an interorgan glutamine flux, coupling both renal ammoniagenesis and hepatic ureogenesis to systemic acid base regulation. This is because protein breakdown produces equimolar amounts of NH4+ and HCO3-. A hepatic role in this interorgan team effort is based upon the tissue-specific presence of urea synthesis, which represents a major irreversible pathway for removal of metabolically generated bicarbonate. A sensitive and complex control of bicarbonate disposal via ureogenesis by the extracellular acid-base status creates a feed-back control loop between the acid-base status and the rate of bicarbonate elimination. This bicarbonate-homeostatic mechanism operates without threat of hyperammonemia, because a sophisticated structural and functional organisation of ammonia-metabolizing pathways in the liver acinus uncouples urea synthesis from the vital need to eliminate potentially toxic ammonia. PMID:2126308

  20. Regulatory mechanisms, expression levels and proliferation effects of the FUS-DDIT3 fusion oncogene in liposarcoma.

    PubMed

    Åman, Pierre; Dolatabadi, Soheila; Svec, David; Jonasson, Emma; Safavi, Setareh; Andersson, Daniel; Grundevik, Pernilla; Thomsen, Christer; Ståhlberg, Anders

    2016-04-01

    Fusion oncogenes are among the most common types of oncogene in human cancers. The gene rearrangements result in new combinations of regulatory elements and functional protein domains. Here we studied a subgroup of sarcomas and leukaemias characterized by the FET (FUS, EWSR1, TAF15) family of fusion oncogenes, including FUS-DDIT3 in myxoid liposarcoma (MLS). We investigated the regulatory mechanisms, expression levels and effects of FUS-DDIT3 in detail. FUS-DDIT3 showed a lower expression than normal FUS at both the mRNA and protein levels, and single-cell analysis revealed a lack of correlation between FUS-DDIT3 and FUS expression. FUS-DDIT3 transcription was regulated by the FUS promotor, while its mRNA stability depended on the DDIT3 sequence. FUS-DDIT3 protein stability was regulated by protein interactions through the FUS part, rather than the leucine zipper containing DDIT3 part. In addition, in vitro as well as in vivo FUS-DDIT3 protein expression data displayed highly variable expression levels between individual MLS cells. Combined mRNA and protein analyses at the single-cell level showed that FUS-DDIT3 protein expression was inversely correlated to the expression of cell proliferation-associated genes. We concluded that FUS-DDIT3 is uniquely regulated at the transcriptional as well as the post-translational level and that its expression level is important for MLS tumour development. The FET fusion oncogenes are potentially powerful drug targets and detailed knowledge about their regulation and functions may help in the development of novel treatments. PMID:26865464

  1. Glucocorticoid receptor-mediated cell cycle arrest is achieved through distinct cell-specific transcriptional regulatory mechanisms.

    PubMed Central

    Rogatsky, I; Trowbridge, J M; Garabedian, M J

    1997-01-01

    Glucocorticoids inhibit proliferation of many cell types, but the events leading from the activated glucocorticoid receptor (GR) to growth arrest are not understood. Ectopic expression and activation of GR in human osteosarcoma cell lines U2OS and SAOS2, which lack endogenous receptors, result in a G1 cell cycle arrest. GR activation in U2OS cells represses expression of the cyclin-dependent kinases (CDKs) CDK4 and CDK6 as well as their regulatory partner, cyclin D3, leading to hypophosphorylation of the retinoblastoma protein (Rb). We also demonstrate a ligand-dependent reduction in the expression of E2F-1 and c-Myc, transcription factors involved in the G1-to-S-phase transition. Mitogen-activated protein kinase, CDK2, cyclin E, and the CDK inhibitors (CDIs) p27 and p21 are unaffected by receptor activation in U2OS cells. The receptor's N-terminal transcriptional activation domain is not required for growth arrest in U2OS cells. In Rb-deficient SAOS2 cells, however, the expression of p27 and p21 is induced upon receptor activation. Remarkably, in SAOS2 cells that express a GR deletion derivative lacking the N-terminal transcriptional activation domain, induction of CDI expression is abolished and the cells fail to undergo ligand-dependent cell cycle arrest. Similarly, murine S49 lymphoma cells, which, like SAOS2 cells, lack Rb, require the N-terminal activation domain for growth arrest and induce CDI expression upon GR activation. These cell-type-specific differences in receptor domains and cellular targets linking GR activation to cell cycle machinery suggest two distinct regulatory mechanisms of GR-mediated cell cycle arrest: one involving transcriptional repression of G1 cyclins and CDKs and the other involving enhanced transcription of CDIs by the activated receptor. PMID:9154817

  2. Ocean warming and acidification modulate energy budget and gill ion regulatory mechanisms in Atlantic cod (Gadus morhua).

    PubMed

    Kreiss, C M; Michael, K; Lucassen, M; Jutfelt, F; Motyka, R; Dupont, S; Pörtner, H-O

    2015-10-01

    Ocean warming and acidification are threatening marine ecosystems. In marine animals, acidification is thought to enhance ion regulatory costs and thereby baseline energy demand, while elevated temperature also increases baseline metabolic rate. Here we investigated standard metabolic rates (SMR) and plasma parameters of Atlantic cod (Gadus morhua) after 3-4 weeks of exposure to ambient and future PCO2 levels (550, 1200 and 2200 µatm) and at two temperatures (10, 18 °C). In vivo branchial ion regulatory costs were studied in isolated, perfused gill preparations. Animals reared at 18 °C responded to increasing CO2 by elevating SMR, in contrast to specimens at 10 °C. Isolated gills at 10 °C and elevated PCO2 (≥1200 µatm) displayed increased soft tissue mass, in parallel to increased gill oxygen demand, indicating an increased fraction of gill in whole animal energy budget. Altered gill size was not found at 18 °C, where a shift in the use of ion regulation mechanisms occurred towards enhanced Na(+)/H(+)-exchange and HCO3 (-) transport at high PCO2 (2200 µatm), paralleled by higher Na(+)/K(+)-ATPase activities. This shift did not affect total gill energy consumption leaving whole animal energy budget unaffected. Higher Na(+)/K(+)-ATPase activities in the warmth might have compensated for enhanced branchial permeability and led to reduced plasma Na(+) and/or Cl(-) concentrations and slightly lowered osmolalities seen at 18 °C and 550 or 2200 µatm PCO2 in vivo. Overall, the gill as a key ion regulation organ seems to be highly effective in supporting the resilience of cod to effects of ocean warming and acidification. PMID:26219611

  3. Targeted mutagenesis of intergenic regions in the Neisseria gonorrhoeae gonococcal genetic island reveals multiple regulatory mechanisms controlling type IV secretion.

    PubMed

    Ramsey, Meghan E; Bender, Tobias; Klimowicz, Amy K; Hackett, Kathleen T; Yamamoto, Ami; Jolicoeur, Adrienne; Callaghan, Melanie M; Wassarman, Karen M; van der Does, Chris; Dillard, Joseph P

    2015-09-01

    Gonococci secrete chromosomal DNA into the extracellular environment using a type IV secretion system (T4SS). The secreted DNA acts in natural transformation and initiates biofilm development. Although the DNA and its effects are detectable, structural components of the T4SS are present at very low levels, suggestive of uncharacterized regulatory control. We sought to better characterize the expression and regulation of T4SS genes and found that the four operons containing T4SS genes are transcribed at very different levels. Increasing transcription of two of the operons through targeted promoter mutagenesis did not increase DNA secretion. The stability and steady-state levels of two T4SS structural proteins were affected by a homolog of tail-specific protease. An RNA switch was also identified that regulates translation of a third T4SS operon. The switch mechanism relies on two putative stem-loop structures contained within the 5' untranslated region of the transcript, one of which occludes the ribosome binding site and start codon. Mutational analysis of these stem loops supports a model in which induction of an alternative structure relieves repression. Taken together, these results identify multiple layers of regulation, including transcriptional, translational and post-translational mechanisms controlling T4SS gene expression and DNA secretion. PMID:26076069

  4. Stimulation of rat hepatic low density lipoprotein receptors by glucagon. Evidence of a novel regulatory mechanism in vivo.

    PubMed Central

    Rudling, M; Angelin, B

    1993-01-01

    We studied the influence of glucagon on hepatic LDL receptors and plasma lipoproteins in rats. A dose-dependent (maximum, threefold) increase in LDL-receptor binding was evident already at a dose of 2 x 4 micrograms, and detectable 3 h after injection; concomitantly, cholesterol and apolipoprotein (apo) B and apoE within LDL and large HDL decreased in plasma. LDL receptor mRNA levels were however unaltered or reduced. Hepatic microsomal cholesterol was increased and the enzymatic activities of 3-hydroxy-3-methylglutaryl coenzyme A reductase and cholesterol 7 alpha-hydroxylase in hepatic microsomes were reduced. Insulin alone increased receptor binding and receptor mRNA levels twofold, but plasma cholesterol was unchanged and plasma apoE and apoB increased. Administration of insulin to glucagon-treated animals reduced the LDL-receptor binding to control levels and apoB appeared in LDL particles. Estrogen treatment increased LDL-receptor binding and mRNA levels five- and eightfold, respectively. Combined treatment with glucagon and estrogen reduced the stimulation of LDL-receptor mRNA levels by 80% although LDL-receptor binding was unchanged. Immunoblot analysis showed that glucagon increased the number of hepatic LDL receptors. We conclude that glucagon induces the number of hepatic LDL receptors by a mechanism not related to increased mRNA levels, suggesting the presence of a posttranscriptional regulatory mechanism present in the liver in vivo. Images PMID:8514887

  5. TRIENNIAL LACTATION SYMPOSIUM: Systems biology of regulatory mechanisms of nutrient metabolism in lactation.

    PubMed

    McNamara, J P

    2015-12-01

    A major role of the dairy cow is to convert low-quality plant materials into high-quality protein and other nutrients for humans. We must select and manage cows with the goal of having animals of the greatest efficiency matched to their environment. We have increased efficiency tremendously over the years, yet the variation in productive and reproductive efficiency among animals is still large. In part, this is because of a lack of full integration of genetic, nutritional, and reproductive biology into management decisions. However, integration across these disciplines is increasing as the biological research findings show specific control points at which genetics, nutrition, and reproduction interact. An ordered systems biology approach that focuses on why and how cells regulate energy and N use and on how and why organs interact through endocrine and neurocrine mechanisms will speed improvements in efficiency. More sophisticated dairy managers will demand better information to improve the efficiency of their animals. Using genetic improvement and animal management to improve milk productive and reproductive efficiency requires a deeper understanding of metabolic processes throughout the life cycle. Using existing metabolic models, we can design experiments specifically to integrate data from global transcriptional profiling into models that describe nutrient use in farm animals. A systems modeling approach can help focus our research to make faster and larger advances in efficiency and determine how this knowledge can be applied on the farms. PMID:26641166

  6. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps

    PubMed Central

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low. PMID:26751076

  7. Familial autoinflammation with neutrophilic dermatosis reveals a regulatory mechanism of pyrin activation.

    PubMed

    Masters, Seth L; Lagou, Vasiliki; Jéru, Isabelle; Baker, Paul J; Van Eyck, Lien; Parry, David A; Lawless, Dylan; De Nardo, Dominic; Garcia-Perez, Josselyn E; Dagley, Laura F; Holley, Caroline L; Dooley, James; Moghaddas, Fiona; Pasciuto, Emanuela; Jeandel, Pierre-Yves; Sciot, Raf; Lyras, Dena; Webb, Andrew I; Nicholson, Sandra E; De Somer, Lien; van Nieuwenhove, Erika; Ruuth-Praz, Julia; Copin, Bruno; Cochet, Emmanuelle; Medlej-Hashim, Myrna; Megarbane, Andre; Schroder, Kate; Savic, Sinisa; Goris, An; Amselem, Serge; Wouters, Carine; Liston, Adrian

    2016-03-30

    Pyrin responds to pathogen signals and loss of cellular homeostasis by forming an inflammasome complex that drives the cleavage and secretion of interleukin-1β (IL-1β). Mutations in the B30.2/SPRY domain cause pathogen-independent activation of pyrin and are responsible for the autoinflammatory disease familial Mediterranean fever (FMF). We studied a family with a dominantly inherited autoinflammatory disease, distinct from FMF, characterized by childhood-onset recurrent episodes of neutrophilic dermatosis, fever, elevated acute-phase reactants, arthralgia, and myalgia/myositis. The disease was caused by a mutation in MEFV, the gene encoding pyrin (S242R). The mutation results in the loss of a 14-3-3 binding motif at phosphorylated S242, which was not perturbed by FMF mutations in the B30.2/SPRY domain. However, loss of both S242 phosphorylation and 14-3-3 binding was observed for bacterial effectors that activate the pyrin inflammasome, such as Clostridium difficile toxin B (TcdB). The S242R mutation thus recapitulated the effect of pathogen sensing, triggering inflammasome activation and IL-1β production. Successful therapy targeting IL-1β has been initiated in one patient, resolving pyrin-associated autoinflammation with neutrophilic dermatosis. This disease provides evidence that a guard-like mechanism of pyrin regulation, originally identified for Nod-like receptors in plant innate immunity, also exists in humans. PMID:27030597

  8. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress

    PubMed Central

    Hossain, M. Sazzad; Dietz, Karl-Josef

    2016-01-01

    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  9. Seasonality of reproduction in mammals: intimate regulatory mechanisms and practical implications.

    PubMed

    Chemineau, P; Guillaume, D; Migaud, M; Thiéry, J C; Pellicer-Rubio, M T; Malpaux, B

    2008-07-01

    Farm mammals generally express seasonal variations in their production traits, thus inducing changing availability of fresh derived animal products (meat, milk and cheese) or performances (horses). This is due to a more or less marked seasonal birth distribution in sheep and goats, in horses but not cattle. Birth peak occurs at the end of winter-early spring, the most favourable period for the progeny to survive. Most species show seasonal variations in their ovulation frequency (presence or absence of ovulation), spermatogenic activity (from moderate decrease to complete absence of sperm production), gamete quality (variations in fertilization rates and embryo survival), and also sexual behaviour. The intimate mechanism involved is a complex combination of endogenous circannual rhythm driven and synchronized by light and melatonin. Profound and long-term neuroendocrine changes involving different neuromediator systems were described to play a role in these processes. In most species artificial photoperiodic treatments consisting of extra-light during natural short days (in sheep and goats and mares) or melatonin during long days (in sheep and goats) are extensively used to either adjust the breeding season to animal producer needs and/or to completely overcome seasonal variations of sperm production in artificial insemination centres. Pure light treatments (without melatonin), especially when applied in open barns, could be considered as non-invasive ones which fully respect animal welfare. Genetic selection could be one of the future ways to decrease seasonality in sheep and goats. PMID:18638103

  10. The regulatory mechanism underlying light-inducible production of carotenoids in nonphototrophic bacteria.

    PubMed

    Takano, Hideaki

    2016-07-01

    Light is a ubiquitous environmental factor serving as an energy source and external stimulus. Here, I review the conserved molecular mechanism of light-inducible production of carotenoids in three nonphototrophic bacteria: Streptomyces coelicolor A3(2), Thermus thermophilus HB27, and Bacillus megaterium QM B1551. A MerR family transcriptional regulator, LitR, commonly plays a central role in their light-inducible carotenoid production. Genetic and biochemical studies on LitR proteins revealed a conserved function: LitR in complex with adenosyl B12 (AdoB12) has a light-sensitive DNA-binding activity and thus suppresses the expression of the Crt biosynthesis gene cluster. The in vitro DNA-binding and transcription assays showed that the LitR-AdoB12 complex serves as a repressor allowing transcription initiation by RNA polymerase in response to illumination. The existence of novel light-inducible genes and the unique role of the megaplasmid were revealed by the transcriptomic analysis of T. thermophilus. The findings suggest that LitR is a general regulator responsible for the light-inducible carotenoid production in the phylogenetically divergent nonphototrophic bacteria, and that LitR performs diverse physiological functions in bacteria. PMID:26967471

  11. Sweat, the driving force behind normal skin: an emerging perspective on functional biology and regulatory mechanisms.

    PubMed

    Murota, Hiroyuki; Matsui, Saki; Ono, Emi; Kijima, Akiko; Kikuta, Junichi; Ishii, Masaru; Katayama, Ichiro

    2015-01-01

    The various symptoms associated with excessive or insufficient perspiration can significantly reduce a patient's quality of life. If a versatile and minimally invasive method could be established for returning sweat activity to normalcy, there is no question that it could be used in the treatment of many diseases that are believed to involve perspiration. For this reason, based on an understanding of the sweat-gland control function and sweat activity, it was necessary to conduct a comprehensive search for the factors that control sweating, such as the central and peripheral nerves that control sweat-gland function, the microenvironment surrounding the sweat glands, and lifestyle. We focused on the mechanism by which atopic dermatitis leads to hypohidrosis and confirmed that histamine inhibits acetylcholinergic sweating. Acetylcholine promotes the phosphorylation of glycogen synthesis kinase 3β (GSK3β) in the sweat-gland secretory cells and leads to sensible perspiration. By suppressing the phosphorylation of GSK3β, histamine inhibits the movement of sweat from the sweat-gland secretory cells through the sweat ducts, which could presumably be demonstrated by dynamic observations of the sweat glands using two-photon microscopy. It is expected that the discovery of new factors that control sweat-gland function can contribute to the treatment of diseases associated with dyshidrosis. PMID:25266651

  12. Fluorescence single-molecule imaging of actin turnover and regulatory mechanisms.

    PubMed

    Watanabe, Naoki

    2012-01-01

    Cells must rapidly remodel the actin filament network to achieve various cellular functions. Actin filament turnover is a dynamic process that plays crucial roles in cell adhesion, locomotion, cytokinesis, endocytosis, phagocytosis, tissue remodeling, etc., and is regulated by cell signaling cascades. Success in elucidating dynamic biological processes such as actin-based motility relies on the means enabling real time monitoring of the process. The invention of live-cell fluorescence single-molecule imaging has opened a window for direct viewing of various actin remodeling processes. In general, assembly and dissociation of actin and its regulators turned out to occur at the faster rates than previously estimated by biochemical and structural analyses. Cells undergo such fast continuous exchange of the components perhaps not only to drive actin remodeling but also to facilitate rapid response in many other cell mechanics and signaling cascades. This chapter describes how epifluorescence single-molecule imaging which visualizes deeper area than the TIRF microscopy is achieved in XTC cells, the currently best platform for this approach. PMID:22289456

  13. A Regulatory Mechanism for RSK2 NH2-Terminal Kinase Activity

    PubMed Central

    Cho, Yong-Yeon; Yao, Ke; Pugliese, Angelo; Malakhova, Margarita L.; Bode, Ann M.; Dong, Zigang

    2010-01-01

    Our previous findings indicated that RSK2 plays a critical role in proliferation and cell transformation induced by tumor promoters, such as epidermal growth factor or 12-O-tetradecanoylphorbol-13-acetate, and that kaempferol, a natural compound found in edible plants, selectively inhibits RSK2 activity. However, the molecular mechanism for RSK2 activation is unclear. Herein, we provide evidence showing that NH2-terminal kinase domain (NTD) activation of RSK2 is required for the activation of the extracellular signal-regulated kinase–mediated COOH-terminal kinase domain (CTD). We also found that the NTD plays a key role in substrate phosphorylation and that kaempferol binds with the NTD but not the CTD in both the active and inactive forms. Homology modeling of the RSK2 NH2-terminal domain and small-molecule docking, validated by mutagenesis experiments, clearly showed that Val82 and Lys100 are critical amino acids for kaempferol binding and RSK2 activity. Furthermore, immunohistofluorescence and Western blot results indicated that the RSK2 protein level is markedly higher in cancer cell lines as well as cancer tissues compared with nonmalignant cell lines or normal tissues. In addition, kaempferol inhibited proliferation of malignant human cancer cell lines, including A431, SK-MEL-5 and SK-MEL-28, and HCT-116. These results indicate that targeting RSK2 with natural compounds, such as kaempferol, might be a good strategy for chemopreventive or chemotherapeutic application. PMID:19435896

  14. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress.

    PubMed

    Hossain, M Sazzad; Dietz, Karl-Josef

    2016-01-01

    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  15. The in Silico Insight into Carbon Nanotube and Nucleic Acid Bases Interaction

    PubMed Central

    Karimi, Ali Asghar; Ghalandari, Behafarid; Tabatabaie, Seyed Saleh; Farhadi, Mohammad

    2016-01-01

    Background To explore practical applications of carbon nanotubes (CNTs) in biomedical fields the properties of their interaction with biomolecules must be revealed. Recent years, the interaction of CNTs with biomolecules is a subject of research interest for practical applications so that previous research explored that CNTs have complementary structure properties with single strand DNA (ssDNA). Objectives Hence, the quantum mechanics (QM) method based on ab initio was used for this purpose. Therefore values of binding energy, charge distribution, electronic energy and other physical properties of interaction were studied for interaction of nucleic acid bases and SCNT. Materials and Methods In this study, the interaction between nucleic acid bases and a (4, 4) single-walled carbon nanotube (SCNT) were investigated through calculations within quantum mechanics (QM) method at theoretical level of Hartree-Fock (HF) method using 6-31G basis set. Hence, the physical properties such as electronic energy, total dipole moment, charge distributions and binding energy of nucleic acid bases interaction with SCNT were investigated based on HF method. Results It has been found that the guanine base adsorption is bound stronger to the outer surface of nanotube in comparison to the other bases, consistent with the recent theoretical studies. In the other words, the results explored that guanine interaction with SCNT has optimum level of electronic energy so that their interaction is stable. Also, the calculations illustrated that SCNT interact to nucleic acid bases by noncovalent interaction because of charge distribution an electrostatic area is created in place of interaction. Conclusions Consequently, small diameter SCNT interaction with nucleic acid bases is noncovalent. Also, the results revealed that small diameter SCNT interaction especially SCNT (4, 4) with nucleic acid bases can be useful in practical application area of biomedical fields such detection and drug delivery.

  16. Regulatory mechanism of ZNF139 in multi-drug resistance of gastric cancer cells.

    PubMed

    Li, Yong; Tan, Bi-bo; Zhao, Qun; Fan, Li-qiao; Liu, Yü; Wang, Dong

    2014-06-01

    Our previous study found increased zinc finger protein 139 (ZNF139) expression in gastric cancer (GC) cells. Purpose of the study is to further clarify the role and mechanism of ZNF139 in multi-drug resistance (MDR) of GC cells. MTT assay, RT-PCR, Western blotting were employed to detect susceptibility of GC cells to chemotherapeutic agents (5-FU, L-OHP) in vitro, and expressions of ZNF139 and MDR associated genes MDR1/P-gp, MRP1, Bcl-2, Bax were also detected. siRNA specific to ZNF139 was transfected into MKN28 cells, then chemosensitivity of GC cells as well as changes of ZNF139 and MDR associated genes were detected. It's found the inhibition rate of 5-FU, L-OHP to well-differentiated GC tissues and cell line was lower than that in the poorly differentiated tissues and cell line; expressions of ZNF139 and MDR1/P-gp, MRP1 and Bcl-2 in well-differentiated GC tissues and cell line MKN28 were higher, while Bax expression was lower. After ZNF139-siRNA was transfected into MKN28, ZNF139 expression in GC cells was inhibited by 90%; inhibition rate of 5-FU, L-OHP to tumor cells increased, and expressions of MDR1/P-gp, MRP1 and Bcl-2 were down-regulated, while Bax was up-regulated. ZNF139 was involved in GC MDR by promoting expressions of MDR1/P-gp, MRP1 and Bcl-2 and inhibiting Bax simultaneously. PMID:24515389

  17. Acid-base properties of titanium-antimony oxides catalysts

    SciTech Connect

    Zenkovets, G.A.; Paukshtis, E.A.; Tarasova, D.V.; Yurchenko, E.N.

    1982-06-01

    The acid-base properties of titanium-antimony oxide catalysts were studied by the methods of back titration and ir spectroscopy. The interrelationship between the acid-base and catalytic properties in the oxidative ammonolysis of propylene was discussed. 3 figures, 1 table.

  18. A Closer Look at Acid-Base Olfactory Titrations

    ERIC Educational Resources Information Center

    Neppel, Kerry; Oliver-Hoyo, Maria T.; Queen, Connie; Reed, Nicole

    2005-01-01

    Olfactory titrations using raw onions and eugenol as acid-base indicators are reported. An in-depth investigation on olfactory titrations is presented to include requirements for potential olfactory indicators and protocols for using garlic, onions, and vanillin as acid-base olfactory indicators are tested.

  19. Regulatory effect and mechanism of gastrin and its antagonists on colorectal carcinoma

    PubMed Central

    He, Shuang-Wu; Shen, Kang-Qiang; He, Yu-Jun; Xie, Bin; Zhao, Yan-Ming

    1999-01-01

    AIM: To explore the effect and mechanism of gastrin and its an tagonists proglumide and somatostatin on colorectal carcinoma and their clinical significance. METHODS: A model of transplanted human colonic carcinoma was established from SW480 cell line in gymnomouse body. The volume and weight of transplanted carcinoma was observed under the effect of pentagatrin (PG), proglumide (PGL) and octapeptide somotostatin (SMS201-995, SMS). The cAMP content of carcinoma cell was determined by radioimmunoassay and the DNA, protein content and cell cycle were determined by flow-cytometry. The amount of viable cells was determined by MTT colorimetric analysis, IP3 content was determined by radioimmuno assay, Ca2+ concentration in cell by fluorometry and PKC activity by isotopic enzymolysis. The expression of gastrin, c-myc, c-fos and rasP21 in 48 case s of colorectal carcinoma tissue was detected by the immuno-cytochemistry SP method. Argyrophilia nucleolar organizer regions was determined with argyrophilia stain. RESULTS: The volume, weight, cAMP, DNA and protein content in carcinoma cell, cell amount and proliferation index of S and G2M phase in PG group were all significantly higher than those of control group. When PG was at the concentration of 25 mg/L, the amount of viable cells, IP3 content and Ca2+ concentration in cell and membrane PKC activity in PG group were significantly higher than those in control group; when PGL was at a concentration of 32 mg/L, they dropped to the lowest level in PG (25 mg/L) + PGL group, but without significant difference from the control group. The positive expression rate of gastrin, c-myc, c-fos and rasP21 in carcinoma tissue was 39.6%, 54.2%, 47.9% and 54.2% respectively and significantly higher than that in mucosa 3 cm and 6 cm adjacent to carcinoma tissue and normal colorectal mucosa. The positive expression rate of gastrin of highly-differentiated adenocarcinoma group was significantly higher than that of poorly-differentiated and

  20. Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis Campylobacter jejuni is a leading cause of food- and waterbourne bacterial gastroenteritis in the developed world. Although il...

  1. Myosin Light Chain Kinase (MLCK) Regulates Cell Migration in a Myosin Regulatory Light Chain Phosphorylation-independent Mechanism*

    PubMed Central

    Chen, Chen; Tao, Tao; Wen, Cheng; He, Wei-Qi; Qiao, Yan-Ning; Gao, Yun-Qian; Chen, Xin; Wang, Pei; Chen, Cai-Ping; Zhao, Wei; Chen, Hua-Qun; Ye, An-Pei; Peng, Ya-Jing; Zhu, Min-Sheng

    2014-01-01

    Myosin light chain kinase (MLCK) has long been implicated in the myosin phosphorylation and force generation required for cell migration. Here, we surprisingly found that the deletion of MLCK resulted in fast cell migration, enhanced protrusion formation, and no alteration of myosin light chain phosphorylation. The mutant cells showed reduced membrane tether force and fewer membrane F-actin filaments. This phenotype was rescued by either kinase-dead MLCK or five-DFRXXL motif, a MLCK fragment with potent F-actin-binding activity. Pull-down and co-immunoprecipitation assays showed that the absence of MLCK led to attenuated formation of transmembrane complexes, including myosin II, integrins and fibronectin. We suggest that MLCK is not required for myosin phosphorylation in a migrating cell. A critical role of MLCK in cell migration involves regulating the cell membrane tension and protrusion necessary for migration, thereby stabilizing the membrane skeleton through F-actin-binding activity. This finding sheds light on a novel regulatory mechanism of protrusion during cell migration. PMID:25122766

  2. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato.

    PubMed

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-12-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  3. Transcriptome Profiling Reveals the Regulatory Mechanism Underlying Pollination Dependent and Parthenocarpic Fruit Set Mainly Mediated by Auxin and Gibberellin

    PubMed Central

    Tang, Ning; Deng, Wei; Hu, Guojian; Hu, Nan; Li, Zhengguo

    2015-01-01

    Background Fruit set is a key process for crop production in tomato which occurs after successful pollination and fertilization naturally. However, parthenocarpic fruit development can be uncoupled from fertilization triggered by exogenous auxin or gibberellins (GAs). Global transcriptome knowledge during fruit initiation would help to characterize the molecular mechanisms by which these two hormones regulate pollination-dependent and -independent fruit set. Principal Findings In this work, digital gene expression tag profiling (DGE) technology was applied to compare the transcriptomes from pollinated and 2, 4-D/GA3-treated ovaries. Activation of carbohydrate metabolism, cell division and expansion as well as the down-regulation of MADS-box is a comprehensive regulatory pathway during pollination-dependent and parthenocarpic fruit set. The signaling cascades of auxin and GA are significantly modulated. The feedback regulations of Aux/IAAs and DELLA genes which functioned to fine-tune auxin and GA response respectively play fundamental roles in triggering fruit initiation. In addition, auxin regulates GA synthesis via up-regulation of GA20ox1 and down-regulation of KNOX. Accordingly, the effect of auxin on fruit set is mediated by GA via ARF2 and IAA9 down-regulation, suggesting that both pollination-dependent and parthenocarpic fruit set depend on the crosstalk between auxin and GA. Significance This study characterizes the transcriptomic features of ovary development and more importantly unravels the integral roles of auxin and GA on pollination-dependent and parthenocarpic fruit set. PMID:25909657

  4. Endocytosis and trafficking of BMP receptors: Regulatory mechanisms for fine-tuning the signaling response in different cellular contexts.

    PubMed

    Ehrlich, Marcelo

    2016-02-01

    Signaling by bone morphogenetic protein (BMP) receptors is regulated at multiple levels in order to ensure proper interpretation of BMP stimuli in different cellular settings. As with other signaling receptors, regulation of the amount of exposed and signaling-competent BMP receptors at the plasma-membrane is predicted to be a key mechanism in governing their signaling output. Currently, the endocytosis of BMP receptors is thought to resemble that of the structurally related transforming growth factor-β (TGF-β) receptors, as BMP receptors are constitutively internalized (independently of ligand binding), with moderate kinetics, and mostly via clathrin-mediated endocytosis. Also similar to TGF-β receptors, BMP receptors are able to signal from the plasma membrane, while internalization to endosomes may have a signal modulating effect. When at the plasma membrane, BMP receptors localize to different membrane domains including cholesterol rich domains and caveolae, suggesting a complex interplay between membrane distribution and internalization. An additional layer of complexity stems from the putative regulatory influence on the signaling and trafficking of BMP receptors exerted by ligand traps and/or co-receptors. Furthermore, the trafficking and signaling of BMP receptors are subject to alterations in cellular context. For example, genetic diseases involving changes in the expression of auxiliary factors of endocytic pathways hamper retrograde BMP signals in neurons, and perturb the regulation of synapse formation. This review summarizes current understanding of the trafficking of BMP receptors and discusses the role of trafficking in regulation of BMP signals. PMID:26776724

  5. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato

    PubMed Central

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-01-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  6. Aspects of the regulatory mechanisms of PPAR functions: analysis of a bidirectional response element and regulation by sumoylation.

    PubMed

    Shimizu, Makoto; Yamashita, Daisuke; Yamaguchi, Tomohiro; Hirose, Fumiko; Osumi, Takashi

    2006-06-01

    Peroxisome proliferator-activated receptors (PPARs) constitute a subfamily of nuclear receptor superfamily. A wide variety of compounds including hypolipidemic agents, antidiabetic drugs, and long-chain fatty acids are the potential ligands of PPARs. To approach the regulatory mechanisms of PPARs, we studied on two subjects in this work. First, we identified a functional PPAR-binding site in the spacer region between the PEX11alpha and perilipin genes, which are arranged in tandem on the mouse genome. By gene reporter assays and in vivo as well as in vitro binding assays, we show that these genes are regulated tissue-selectively through this common binding site: The PEX11alpha gene is activated by PPARalpha in the liver, whereas the perilipin gene by PPARgamma in the adipose tissue. As the second subject, we found that PPARgamma2 is conjugated with small ubiquitin-related modifier (SUMO) at a specific lysine residue in the amino-terminal region. By site-directed mutagenesis combined with gene reporter assays and sumoylation analyses, we show that sumoylation represses the ligand-independent transactivating function carried by this region, and hence negatively regulates the whole transactivating competence of PPARgamma2. In addition, phosphorylation at a specific site in the amino-terminal region represses the transactivation by PPARgamma2 possibly through enhancing sumoylation. PMID:16534556

  7. Comparative Study between Transcriptionally- and Translationally-Acting Adenine Riboswitches Reveals Key Differences in Riboswitch Regulatory Mechanisms

    PubMed Central

    Blouin, Simon; Heppell, Benoit; Bastet, Laurène; St-Pierre, Patrick; Massé, Eric; Lafontaine, Daniel A.

    2011-01-01

    Many bacterial mRNAs are regulated at the transcriptional or translational level by ligand-binding elements called riboswitches. Although they both bind adenine, the adenine riboswitches of Bacillus subtilis and Vibrio vulnificus differ by controlling transcription and translation, respectively. Here, we demonstrate that, beyond the obvious difference in transcriptional and translational modulation, both adenine riboswitches exhibit different ligand binding properties and appear to operate under different regulation regimes (kinetic versus thermodynamic). While the B. subtilis pbuE riboswitch fully depends on co-transcriptional binding of adenine to function, the V. vulnificus add riboswitch can bind to adenine after transcription is completed and still perform translation regulation. Further investigation demonstrates that the rate of transcription is critical for the B. subtilis pbuE riboswitch to perform efficiently, which is in agreement with a co-transcriptional regulation. Our results suggest that the nature of gene regulation control, that is transcription or translation, may have a high importance in riboswitch regulatory mechanisms. PMID:21283784

  8. Strong Ion Regulatory Abilities Enable the Crab Xenograpsus testudinatus to Inhabit Highly Acidified Marine Vent Systems

    PubMed Central

    Hu, Marian Y.; Guh, Ying-Jey; Shao, Yi-Ta; Kuan, Pou-Long; Chen, Guan-Lin; Lee, Jay-Ron; Jeng, Ming-Shiou; Tseng, Yung-Che

    2016-01-01

    Hydrothermal vent organisms have evolved physiological adaptations to cope with extreme abiotic conditions including temperature and pH. To date, acid-base regulatory abilities of vent organisms are poorly investigated, although this physiological feature is essential for survival in low pH environments. We report the acid-base regulatory mechanisms of a hydrothermal vent crab, Xenograpsus testudinatus, endemic to highly acidic shallow-water vent habitats with average environment pH-values ranging between 5.4 and 6.6. Within a few hours, X. testudinatus restores extracellular pH (pHe) in response to environmental acidification of pH 6.5 (1.78 kPa pCO2) accompanied by an increase in blood HCO3- levels from 8.8 ± 0.3 to 31 ± 6 mM. Branchial Na+/K+-ATPase (NKA) and V-type H+-ATPase (VHA), the major ion pumps involved in branchial acid-base regulation, showed dynamic increases in response to acidified conditions on the mRNA, protein and activity level. Immunohistochemical analyses demonstrate the presence of NKA in basolateral membranes, whereas the VHA is predominantly localized in cytoplasmic vesicles of branchial epithelial- and pillar-cells. X. testudinatus is closely related to other strong osmo-regulating brachyurans, which is also reflected in the phylogeny of the NKA. Accordingly, our results suggest that the evolution of strong ion regulatory abilities in brachyuran crabs that allowed the occupation of ecological niches in euryhaline, freshwater, and terrestrial habitats are probably also linked to substantial acid-base regulatory abilities. This physiological trait allowed X. testudinatus to successfully inhabit one of the world's most acidic marine environments. PMID:26869933

  9. Strong Ion Regulatory Abilities Enable the Crab Xenograpsus testudinatus to Inhabit Highly Acidified Marine Vent Systems.

    PubMed

    Hu, Marian Y; Guh, Ying-Jey; Shao, Yi-Ta; Kuan, Pou-Long; Chen, Guan-Lin; Lee, Jay-Ron; Jeng, Ming-Shiou; Tseng, Yung-Che

    2016-01-01

    Hydrothermal vent organisms have evolved physiological adaptations to cope with extreme abiotic conditions including temperature and pH. To date, acid-base regulatory abilities of vent organisms are poorly investigated, although this physiological feature is essential for survival in low pH environments. We report the acid-base regulatory mechanisms of a hydrothermal vent crab, Xenograpsus testudinatus, endemic to highly acidic shallow-water vent habitats with average environment pH-values ranging between 5.4 and 6.6. Within a few hours, X. testudinatus restores extracellular pH (pHe) in response to environmental acidification of pH 6.5 (1.78 kPa pCO2) accompanied by an increase in blood [Formula: see text] levels from 8.8 ± 0.3 to 31 ± 6 mM. Branchial Na(+)/K(+)-ATPase (NKA) and V-type H(+)-ATPase (VHA), the major ion pumps involved in branchial acid-base regulation, showed dynamic increases in response to acidified conditions on the mRNA, protein and activity level. Immunohistochemical analyses demonstrate the presence of NKA in basolateral membranes, whereas the VHA is predominantly localized in cytoplasmic vesicles of branchial epithelial- and pillar-cells. X. testudinatus is closely related to other strong osmo-regulating brachyurans, which is also reflected in the phylogeny of the NKA. Accordingly, our results suggest that the evolution of strong ion regulatory abilities in brachyuran crabs that allowed the occupation of ecological niches in euryhaline, freshwater, and terrestrial habitats are probably also linked to substantial acid-base regulatory abilities. This physiological trait allowed X. testudinatus to successfully inhabit one of the world's most acidic marine environments. PMID:26869933

  10. Effect and Regulatory Mechanism of Clock Gene Per1 on Biological Behaviors of Human Oral Squamous Carcinoma Cell.

    PubMed

    Han-Xue, L I; Kai, Yang; Xiao-Juan, F U; Qin, Zhao

    2016-04-10

    Objective To investigate the effect and regulatory mechanism of clock gene Per1 on the proliferation,apoptosis,migration,and invasion of human oral squamous carcinoma SCC15 cells. Methods RNA interference was used to knock down Per1 gene in human oral squamous cell carcinoma SCC15 cell line. Changes of cell proliferation and apoptosis were analyzed by flow cytometry. Transwell assay was carried out to assess cell migration and invasion. Real-time polymerase chain reaction was used to detect the mRNA expressions of Ki-67,murine double minute 2(MDM2),c-Myc,p53,Bax,Bcl-2,metalloproteinase (MMP)2,MMP9,and vascular endothelial growth factor (VEGF). Results shRNA-mediated knockdown of Per1 promoted the proliferation,migration and invasion capacity,and inhibited cell apoptosis capacity of SCC15 cells (all P<0.05). Additionally,Per1 knockdown also increased the mRNA expressions of Ki-67,MDM2,Bcl-2,MMP2,and MMP9 and decreased the mRNA expressions of c-Myc,p53,and Bax (all P<0.05);however,the VEGF mRNA expression did not differ significantly after Per1 knockdown (P>0.05). Conclusions Clock gene Perl can regulate important tumor-related genes downstream such as Ki-67,MDM2,c-Myc,p53,Bax,Bcl-2,MMP2,and MMP9,and the aberrant expression of Per1 can affect tumor cell proliferation,apoptosis,migration and invasion. An in-depth study of Per1 may further clarify the mechanism of tumorigenesis and tumor development and thus provides new effective molecular targets for cancer treatment. PMID:27181891

  11. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    DOE PAGESBeta

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-29

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations tomore » the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal mol-1. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called 'finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive

  12. The function of the RNA-binding protein TEL1 in moss reveals ancient regulatory mechanisms of shoot development.

    PubMed

    Vivancos, Julien; Spinner, Lara; Mazubert, Christelle; Charlot, Florence; Paquet, Nicolas; Thareau, Vincent; Dron, Michel; Nogué, Fabien; Charon, Céline

    2012-03-01

    The shoot represents the basic body plan in land plants. It consists of a repeated structure composed of stems and leaves. Whereas vascular plants generate a shoot in their diploid phase, non-vascular plants such as mosses form a shoot (called the gametophore) in their haploid generation. The evolution of regulatory mechanisms or genetic networks used in the development of these two kinds of shoots is unclear. TERMINAL EAR1-like genes have been involved in diploid shoot development in vascular plants. Here, we show that disruption of PpTEL1 from the moss Physcomitrella patens, causes reduced protonema growth and gametophore initiation, as well as defects in gametophore development. Leafy shoots formed on ΔTEL1 mutants exhibit shorter stems with more leaves per shoot, suggesting an accelerated leaf initiation (shortened plastochron), a phenotype shared with the Poaceae vascular plants TE1 and PLA2/LHD2 mutants. Moreover, the positive correlation between plastochron length and leaf size observed in ΔTEL1 mutants suggests a conserved compensatory mechanism correlating leaf growth and leaf initiation rate that would minimize overall changes in plant biomass. The RNA-binding protein encoded by PpTEL1 contains two N-terminus RNA-recognition motifs, and a third C-terminus non-canonical RRM, specific to TEL proteins. Removal of the PpTEL1 C-terminus (including this third RRM) or only 16-18 amino acids within it seriously impairs PpTEL1 function, suggesting a critical role for this third RRM. These results show a conserved function of the RNA-binding PpTEL1 protein in the regulation of shoot development, from early ancestors to vascular plants, that depends on the third TEL-specific RRM. PMID:22170036

  13. A mechanism for expansion of regulatory T-cell repertoire and its role in self-tolerance.

    PubMed

    Feng, Yongqiang; van der Veeken, Joris; Shugay, Mikhail; Putintseva, Ekaterina V; Osmanbeyoglu, Hatice U; Dikiy, Stanislav; Hoyos, Beatrice E; Moltedo, Bruno; Hemmers, Saskia; Treuting, Piper; Leslie, Christina S; Chudakov, Dmitriy M; Rudensky, Alexander Y

    2015-12-01

    T-cell receptor (TCR) signalling has a key role in determining T-cell fate. Precursor cells expressing TCRs within a certain low-affinity range for complexes of self-peptide and major histocompatibility complex (MHC) undergo positive selection and differentiate into naive T cells expressing a highly diverse self-MHC-restricted TCR repertoire. In contrast, precursors displaying TCRs with a high affinity for 'self' are either eliminated through TCR-agonist-induced apoptosis (negative selection) or restrained by regulatory T (Treg) cells, whose differentiation and function are controlled by the X-chromosome-encoded transcription factor Foxp3 (reviewed in ref. 2). Foxp3 is expressed in a fraction of self-reactive T cells that escape negative selection in response to agonist-driven TCR signals combined with interleukin 2 (IL-2) receptor signalling. In addition to Treg cells, TCR-agonist-driven selection results in the generation of several other specialized T-cell lineages such as natural killer T cells and innate mucosal-associated invariant T cells. Although the latter exhibit a restricted TCR repertoire, Treg cells display a highly diverse collection of TCRs. Here we explore in mice whether a specialized mechanism enables agonist-driven selection of Treg cells with a diverse TCR repertoire, and the importance this holds for self-tolerance. We show that the intronic Foxp3 enhancer conserved noncoding sequence 3 (CNS3) acts as an epigenetic switch that confers a poised state to the Foxp3 promoter in precursor cells to make Treg cell lineage commitment responsive to a broad range of TCR stimuli, particularly to suboptimal ones. CNS3-dependent expansion of the TCR repertoire enables Treg cells to control self-reactive T cells effectively, especially when thymic negative selection is genetically impaired. Our findings highlight the complementary roles of these two main mechanisms of self-tolerance. PMID:26605529

  14. Mechanisms of immune suppression by interleukin-10 and transforming growth factor-beta: the role of T regulatory cells.

    PubMed

    Taylor, Alison; Verhagen, Johan; Blaser, Kurt; Akdis, Mübeccel; Akdis, Cezmi A

    2006-04-01

    Specific immune suppression and induction of tolerance are essential processes in the regulation and circumvention of immune defence. The balance between allergen-specific type 1 regulatory (Tr1) cells and T helper (Th) 2 cells appears to be decisive in the development of allergy. Tr1 cells consistently represent the dominant subset specific for common environmental allergens in healthy individuals. In contrast, there is a high frequency of allergen-specific interleukin-4 (IL-4)-secreting T cells in allergic individuals. Allergen-specific immunotherapy can induce specific Tr1 cells that abolish allergen-induced proliferation of Th1 and Th2 cells, as well as their cytokine production. Tr1 cells utilize multiple suppressor mechanisms, such as IL-10 and transforming growth factor-beta (TGF-beta) as secreted cytokines and various surface molecules, such as cytotoxic T-lymphocyte antigen 4 and programmed death-1. IL-10 only inhibits T cells stimulated by low numbers of triggered T-cell receptors, which depend on CD28 costimulation. IL-10 inhibits CD28 tyrosine phosphorylation, preventing the binding of phosphatidylinositol 3-kinase p85 and consequently inhibiting the CD28 signalling pathway. In addition, IL-10 and TGF-beta secreted by Tr1 cells skew the antibody production from immunoglobulin E (IgE) towards the non-inflammatory isotypes IgG4 and IgA, respectively. Induction of antigen-specific Tr1 cells can thus re-direct an inappropriate immune response against allergens or auto-antigens using a broad range of suppressor mechanisms. PMID:16556256

  15. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    PubMed Central

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-01

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal/mol. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called `finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle and

  16. Regulatory Mechanisms That Prevent Re-initiation of DNA Replication Can Be Locally Modulated at Origins by Nearby Sequence Elements

    PubMed Central

    Richardson, Christopher D.; Li, Joachim J.

    2014-01-01

    Eukaryotic cells must inhibit re-initiation of DNA replication at each of the thousands of origins in their genome because re-initiation can generate genomic alterations with extraordinary frequency. To minimize the probability of re-initiation from so many origins, cells use a battery of regulatory mechanisms that reduce the activity of replication initiation proteins. Given the global nature of these mechanisms, it has been presumed that all origins are inhibited identically. However, origins re-initiate with diverse efficiencies when these mechanisms are disabled, and this diversity cannot be explained by differences in the efficiency or timing of origin initiation during normal S phase replication. This observation raises the possibility of an additional layer of replication control that can differentially regulate re-initiation at distinct origins. We have identified novel genetic elements that are necessary for preferential re-initiation of two origins and sufficient to confer preferential re-initiation on heterologous origins when the control of re-initiation is partially deregulated. The elements do not enhance the S phase timing or efficiency of adjacent origins and thus are specifically acting as re-initiation promoters (RIPs). We have mapped the two RIPs to ∼60 bp AT rich sequences that act in a distance- and sequence-dependent manner. During the induction of re-replication, Mcm2-7 reassociates both with origins that preferentially re-initiate and origins that do not, suggesting that the RIP elements can overcome a block to re-initiation imposed after Mcm2-7 associates with origins. Our findings identify a local level of control in the block to re-initiation. This local control creates a complex genomic landscape of re-replication potential that is revealed when global mechanisms preventing re-replication are compromised. Hence, if re-replication does contribute to genomic alterations, as has been speculated for cancer cells, some regions of the genome

  17. Poly (ricinoleic acid) based novel thermosetting elastomer.

    PubMed

    Ebata, Hiroki; Yasuda, Mayumi; Toshima, Kazunobu; Matsumura, Shuichi

    2008-01-01

    A novel bio-based thermosetting elastomer was prepared by the lipase-catalyzed polymerization of methyl ricinoleate with subsequent vulcanization. Some mechanical properties of the cured carbon black-filled polyricinoleate compounds were evaluated as a thermosetting elastomer. It was found that the carbon black-filled polyricinoleate compounds were readily cured by sulfur curatives to produce a thermosetting elastomer that formed a rubber-like sheet with a smooth and non-sticky surface. The curing behaviors and mechanical properties were dependent on both the molecular weight of the polyricinoleate and the amount of the sulfur curatives. Cured compounds consisting of polyricinoleate with a molecular weight of 100,800 showed good mechanical properties, such as a hardness of 48 A based on the durometer A measurements, a tensile strength at break of 6.91 MPa and an elongation at break of 350%. PMID:18469493

  18. Acid-base transport by the renal proximal tubule

    PubMed Central

    Skelton, Lara A.; Boron, Walter F.; Zhou, Yuehan

    2015-01-01

    Each day, the kidneys filter 180 L of blood plasma, equating to some 4,300 mmol of the major blood buffer, bicarbonate (HCO3−). The glomerular filtrate enters the lumen of the proximal tubule (PT), and the majority of filtered HCO3− is reclaimed along the early (S1) and convoluted (S2) portions of the PT in a manner coupled to the secretion of H+ into the lumen. The PT also uses the secreted H+ to titrate non-HCO3− buffers in the lumen, in the process creating “new HCO3−” for transport into the blood. Thus, the PT – along with more distal renal segments – is largely responsible for regulating plasma [HCO3−]. In this review we first focus on the milestone discoveries over the past 50+ years that define the mechanism and regulation of acid-base transport by the proximal tubule. Further on in the review, we will summarize research still in progress from our laboratory, work that addresses the problem of how the PT is able to finely adapt to acid–base disturbances by rapidly sensing changes in basolateral levels of HCO3− and CO2 (but not pH), and thereby to exert tight control over the acid–base composition of the blood plasma. PMID:21170887

  19. [Development of Nucleic Acid-Based Adjuvant for Cancer Immunotherapy].

    PubMed

    Kobiyama, Kouji; Ishii, Ken J

    2015-09-01

    Since the discovery of the human T cell-defined tumor antigen, the cancer immunotherapy field has rapidly progressed, with the research and development of cancer immunotherapy, including cancer vaccines, being conducted actively. However, the disadvantages of most cancer vaccines include relatively weak immunogenicity and immune escape or exhaustion. Adjuvants with innate immunostimulatory activities have been used to overcome these issues, and these agents have been shown to enhance the immunogenicity of cancer vaccines and to act as mono-therapeutic anti-tumor agents. CpG ODN, an agonist for TLR9, is one of the promising nucleic acid-based adjuvants, and it is a potent inducer of innate immune effector functions. CpG ODN suppresses tumor growth in the absence of tumor antigens and peptide administration. Therefore, CpG ODN is expected to be useful as a cancer vaccine adjuvant as well as a cancer immunotherapy agent. In this review, we discuss the potential therapeutic applications and mechanisms of CpG ODN for cancer immunotherapy. PMID:26469159

  20. Acid-base transport in pancreas—new challenges

    PubMed Central

    Novak, Ivana; Haanes, Kristian A.; Wang, Jing

    2013-01-01

    Along the gastrointestinal tract a number of epithelia contribute with acid or basic secretions in order to aid digestive processes. The stomach and pancreas are the most extreme examples of acid (H+) and base (HCO−3) transporters, respectively. Nevertheless, they share the same challenges of transporting acid and bases across epithelia and effectively regulating their intracellular pH. In this review, we will make use of comparative physiology to enlighten the cellular mechanisms of pancreatic HCO−3 and fluid secretion, which is still challenging physiologists. Some of the novel transporters to consider in pancreas are the proton pumps (H+-K+-ATPases), as well as the calcium-activated K+ and Cl− channels, such as KCa3.1 and TMEM16A/ANO1. Local regulators, such as purinergic signaling, fine-tune, and coordinate pancreatic secretion. Lastly, we speculate whether dys-regulation of acid-base transport contributes to pancreatic diseases including cystic fibrosis, pancreatitis, and cancer. PMID:24391597

  1. The Bronsted-Lowery Acid-Base Concept.

    ERIC Educational Resources Information Center

    Kauffman, George B.

    1988-01-01

    Gives the background history of the simultaneous discovery of acid-base relationships by Johannes Bronsted and Thomas Lowry. Provides a brief biographical sketch of each. Discusses their concept of acids and bases in some detail. (CW)

  2. An Olfactory Indicator for Acid-Base Titrations.

    ERIC Educational Resources Information Center

    Flair, Mark N.; Setzer, William N.

    1990-01-01

    The use of an olfactory acid-base indicator in titrations for visually impaired students is discussed. Potential olfactory indicators include eugenol, thymol, vanillin, and thiophenol. Titrations performed with each indicator with eugenol proved to be successful. (KR)

  3. Investigation of surfactant mediated acid-base charging of mineral oxide particles dispersed in apolar systems.

    PubMed

    Gacek, Matthew M; Berg, John C

    2012-12-21

    The current work examines the role of acid-base properties on particle charging in apolar media. Manipulating the polarity and magnitude of charge in such systems is of growing interest to a number of applications. A major hurdle to the implementation of this technology is that the mechanism(s) of particle charging remain a subject of debate. The authors previously conducted a study of the charging of a series of mineral oxide particles dispersed in apolar systems that contained the surfactant AOT. It was observed that there was a correlation between the particle electrophoretic mobility and the acid-base nature of the particle, as characterized by aqueous point of zero charge (PZC) or the isoelectric point (IEP). The current study investigates whether or not a similar correlation is observed with other surfactants, namely, the acidic Span 80 and the basic OLOA 11000. This is accomplished by measuring the electrophoretic mobility of a series of mineral oxides that are dispersed in Isopar-L containing various concentrations of either Span 80 or OLOA 11000. The mineral oxides used have PZC values that cover a wide range of pH, providing a systematic study of how particle and surfactant acid-base properties impact particle charge. It was found that the magnitude and polarity of particle surface charge varied linearly with the particle PZC for both surfactants used. In addition, the point at which the polarity of charge reversed for the basic surfactant OLOA 11000 was shifted to a pH of approximately 8.5, compared to the previous result of about 5 for AOT. This proves that both surfactant and particle acid-base properties are important, and provides support for the theory of acid-base charging in apolar media. PMID:23157688

  4. TRANSFUSIONS—Hazardous Acid-Base Changes with Citrated Blood

    PubMed Central

    Pedro, Jovita M. San; Iwai, Seizo; Hattori, Mitsuo; Leigh, M. Digby

    1962-01-01

    In a study of the acid-base changes in the blood of rabbits during and following transfusions of citrated blood and of heparinized blood, it was observed that, with citrated blood, pH decreased and carbon dioxide tensions rose. With heparinized blood, the acid-base balance was maintained within normal limits following transfusions. The potential hazards of rapid massive citrated blood transfusions in the anesthetized patient during operation must be kept in mind. PMID:14496706

  5. Regulatory mechanisms and the role of calcium and potassium channels controlling supercontractile crop muscles in adult Phormia regina.

    PubMed

    Solari, Paolo; Stoffolano, John G; Fitzpatrick, Joanna; Gelperin, Alan; Thomson, Alan; Talani, Giuseppe; Sanna, Enrico; Liscia, Anna

    2013-09-01

    Bioassays and electrophysiological recordings were conducted in the adult blowfly Phormia regina to provide new insights into the regulatory mechanisms governing the crop filling and emptying processes of the supercontractile crop muscles. The cibarial pump drives ingestion. Simultaneous multisite extracellular recordings show that crop lobe (P5) distension during ingestion of a 4.7 μl sugar meal does not require muscle activity by any of the other pumps of the system. Conversely, pumping of fluids toward the anterior of the crop system during crop emptying is brought about by active muscle contraction, in the form of a highly coordinated peristaltic wave starting from P5 and progressively propagating to P6, P4 and P3 pumps, with P5 contracting with a frequency about 3.4 times higher than the other pumps. The crop contraction rate is also modulated by hemolymph-borne factors such as sugars, through ligand recognition at a presumptive receptor site rather than by an osmotic effect, as assessed by both behavioural and electrophysiological experiments. In this respect, sugars of equal osmolarity produce different effects, glucose being inhibitory and mannose ineffective for crop muscles, while trehalose enhances crop activity. Finally, voltage and current clamp experiments show that the muscle action potentials (mAPs) at the P4 pump are sustained by a serotonin-sensitive calcium conductance. Serotonin enhances calcium entry into the muscle cells and this could lead, as an indirect modulatory effect, to activation of a Ca(2+)-activated K(+) conductance (IK(Ca)), which sustains the following mAP repolarization phase in such a way that further mAPs can be generated early and the frequency consequently increased. PMID:23834826

  6. The Inhibition Mechanism of Non-phosphorylated Ser768 in the Regulatory Domain of Cystic Fibrosis Transmembrane Conductance Regulator*

    PubMed Central

    Wang, Guangyu

    2011-01-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) is a member of the ATP-binding cassette transporters but serves as a chloride channel dysfunctional in cystic fibrosis. The activity of CFTR is tightly controlled not only by ATP-driven dimerization of its nucleotide-binding domains but also by phosphorylation of a unique regulatory (R) domain by protein kinase A (PKA). The R domain has multiple excitatory phosphorylation sites, but Ser737 and Ser768 are inhibitory. The underlying mechanism is unclear. Here, sulfhydryl-specific cross-linking strategy was employed to demonstrate that Ser768 or Ser737 could interact with outwardly facing hydrophilic residues of cytoplasmic loop 3 regulating channel gating. Furthermore, mutation of these residues to alanines promoted channel opening by curcumin in an ATP-dependent manner even in the absence of PKA. However, mutation of Ser768 and His950 with different hydrogen bond donors or acceptors clearly changed ATP- and PKA-dependent channel activity no matter whether curcumin was present or not. More importantly, significant activation of a double mutant H950R/S768R needed only ATP. Finally, in vitro and in vivo single channel recordings suggest that Ser768 may form a putative hydrogen bond with His950 of cytoplasmic loop 3 to prevent channel opening by ATP in the non-phosphorylated state and by subsequent cAMP-dependent phosphorylation. These observations support an electron cryomicroscopy-based structural model on which the R domain is closed to cytoplasmic loops regulating channel gating. PMID:21059651

  7. Accumulation Mechanisms of CD4(+)CD25(+)FOXP3(+) Regulatory T Cells in EBV-associated Gastric Carcinoma.

    PubMed

    Zhang, Na-na; Chen, Jian-ning; Xiao, Lin; Tang, Fang; Zhang, Zhi-gang; Zhang, Yi-wang; Feng, Zhi-ying; Jiang, Ye; Shao, Chun-kui

    2015-01-01

    Approximately 10% of gastric carcinomas are associated with Epstein-Barr virus (EBV) and are defined as EBV-associated gastric carcinomas (EBVaGCs). EBVaGCs are known to be accompanied by massive CD8(+) cytotoxic T cell (CTL) infiltration; however, adoptive cellular immunotherapy based on EBV-specific CD8(+) CTLs has been explored with limited success. Because regulatory T cells (Tregs) are regarded as a critical hurdle in anti-tumour immunity, we assessed the distribution of Tregs in 45 cases of EBVaGC and 45 cases of EBV-negative gastric carcinoma (EBVnGC) with matched clinicopathological parameters by immunohistochemistry. We showed that Tregs were significantly increased in EBVaGC compared to EBVnGC (15.92 ± 11.45/HPF vs. 8.45 ± 6.16/HPF, p = 0.001). In addition, we explored the accumulation mechanisms of Tregs in EBVaGC by using EBV (+) gastric carcinoma cell lines SNU719 and GT39 as ex vivo models. When peripheral blood mononuclear cells (PBMCs) were co-cultured with EBV (+) gastric carcinoma cell lines, the Treg frequency increased, and they underwent phenotypic and functional changes. The enhanced recruitment by CCL22 produced by EBVaGC cells, the decreased emigration due to CCR7 downregulation on the Treg surface, the higher proliferation rate, and the lower apoptosis rate of Tregs at tumour sites may promote the accumulation of Tregs in EBVaGC. PMID:26673957

  8. Soluble adenylyl cyclase is an acid-base sensor in epithelial base-secreting cells.

    PubMed

    Roa, Jinae N; Tresguerres, Martin

    2016-08-01

    Blood acid-base regulation by specialized epithelia, such as gills and kidney, requires the ability to sense blood acid-base status. Here, we developed primary cultures of ray (Urolophus halleri) gill cells to study mechanisms for acid-base sensing without the interference of whole animal hormonal regulation. Ray gills have abundant base-secreting cells, identified by their noticeable expression of vacuolar-type H(+)-ATPase (VHA), and also express the evolutionarily conserved acid-base sensor soluble adenylyl cyclase (sAC). Exposure of cultured cells to extracellular alkalosis (pH 8.0, 40 mM HCO3 (-)) triggered VHA translocation to the cell membrane, similar to previous reports in live animals experiencing blood alkalosis. VHA translocation was dependent on sAC, as it was blocked by the sAC-specific inhibitor KH7. Ray gill base-secreting cells also express transmembrane adenylyl cyclases (tmACs); however, tmAC inhibition by 2',5'-dideoxyadenosine did not prevent alkalosis-dependent VHA translocation, and tmAC activation by forskolin reduced the abundance of VHA at the cell membrane. This study demonstrates that sAC is a necessary and sufficient sensor of extracellular alkalosis in ray gill base-secreting cells. In addition, this study indicates that different sources of cAMP differentially modulate cell biology. PMID:27335168

  9. Awareness of federal regulatory mechanisms relevant to community-engaged research: survey of health disparities-oriented NIH-funded investigators

    PubMed Central

    Fullerton, Stephanie M.; Anderson, Emily E.; Cowan, Ketch; Malen, Rachel C.; Brugge, Doug

    2015-01-01

    Few studies or investigators involved in community engaged research or community-based participatory research have examined awareness and adoption of federal regulatory mechanisms. We conducted a survey of investigators affiliated with the ten National Institutes of Health (NIH) Centers for Population Health and Health Disparities. A questionnaire designed to capture experience with the conduct and oversight of community engaged research, and awareness of pertinent regulatory mechanisms, including Federalwide Assurances (FWAs), Individual Investigator Agreements (IIAs), and Institutional Review Board Authorization Agreements (IAAs), was completed by 101 respondents (68% response rate). Although most were aware of FWAs, only a minority of those surveyed reported knowledge of IAAs and IIAs and even fewer had used them in their research with community partners. Implications for future training and oversight are discussed. PMID:25742662

  10. Self-assembly pathway of peptide nanotubes formed by a glutamatic acid-based bolaamphiphile.

    PubMed

    da Silva, Emerson Rodrigo; Alves, Wendel Andrade; Castelletto, Valeria; Reza, Mehedi; Ruokolainen, Janne; Hussain, Rohanah; Hamley, Ian William

    2015-07-25

    The self-assembly of peptide nanotubes formed by an L-glutamic acid-based bolaamphiphile is shown to proceed via a remarkable mechanism where the peptide conformation changes from β-sheet to unordered. The kinetics of this process are elucidated via X-ray scattering and UV circular dichroism methods. The reverse transition from "unordered" to β-sheet structures is triggered by UV radiation. PMID:26094619

  11. Acid-Base and the Skeleton

    NASA Astrophysics Data System (ADS)

    Bushinsky, David A.

    2008-09-01

    Chronic metabolic acidosis increases urine calcium (Ca) excretion in the absence of a concomitant increase in intestinal Ca absorption resulting in a net loss of total body. The source of this additional urine Ca is almost certainly the skeleton, the primary reservoir of body Ca. In vitro metabolic acidosis, modeled as a primary reduction in medium bicarbonate concentration, acutely (<24 h) stimulates Ca efflux primarily through physicochemical mineral dissolution while at later time periods (>24 h) cell-mediated mechanisms predominate. In cultured neonatal mouse calvariae, acidosis-induced, cell-mediated Ca efflux is mediated by effects on both osteoblasts and osteoclasts. Metabolic acidosis inhibits extracellular matrix production by osteoblasts, as determined by measurement of collagen levels and levels for the non-collagenous matrix proteins osteopontin and matrix gla protein. Metabolic acidosis upregulates osteoblastic expression of RANKL (Receptor Activator of NFκB Ligand), an important osteoclastogenic and osteoclast-activating factor. Acidosis also increases osteoclastic activity as measured by release of β-glucuronidase, an enzyme whose secretion correlates with osteoclast-mediated bone resorption.

  12. Thioarsenides: A case for long-range Lewis acid-base-directed van der Waals interactions

    SciTech Connect

    Gibbs, Gerald V.; Wallace, Adam F.; Downs, R. T.; Ross, Nancy L.; Cox, David F.; Rosso, Kevin M.

    2011-04-01

    Electron density distributions, bond paths, Laplacian and local energy density properties have been calculated for a number of As4Sn (n = 3,4,5) thioarsenide molecular crystals. On the basis of the distributions, the intramolecular As-S and As-As interactions classify as shared bonded interactions and the intermolecular As-S, As-As and S-S interactions classify as closed-shell van der Waals bonded interactions. The bulk of the intermolecular As-S bond paths link regions of locally concentrated electron density (Lewis base regions) with aligned regions of locally depleted electron density (Lewis acid regions) on adjacent molecules. The paths are comparable with intermolecular paths reported for several other molecular crystals that link aligned Lewis base and acid regions in a key-lock fashion, interactions that classified as long range Lewis acid-base directed van der Waals interactions. As the bulk of the intermolecular As-S bond paths (~70%) link Lewis acid-base regions on adjacent molecules, it appears that molecules adopt an arrangement that maximizes the number of As-S Lewis acid-base intermolecular bonded interactions. The maximization of the number of Lewis acid-base interactions appears to be connected with the close-packed array adopted by molecules: distorted cubic close-packed arrays are adopted for alacránite, pararealgar, uzonite, realgar and β-AsS and the distorted hexagonal close-packed arrays adopted by α- and β-dimorphite. A growth mechanism is proposed for thioarsenide molecular crystals from aqueous species that maximizes the number of long range Lewis acid-base vdW As-S bonded interactions with the resulting directed bond paths structuralizing the molecules as a molecular crystal.

  13. Thioarsenides: a case for long-range Lewis acid-base-directed van der Waals interactions

    NASA Astrophysics Data System (ADS)

    Gibbs, G. V.; Wallace, A. F.; Downs, R. T.; Ross, N. L.; Cox, D. F.; Rosso, K. M.

    2011-04-01

    Electron density distributions, bond paths, Laplacian and local-energy density properties have been calculated for a number of As4S n ( n = 3, 4 and 5) thioarsenide molecular crystals. On the basis of the distributions, the intramolecular As-S and As-As interactions classify as shared bonded interactions, and the intermolecular As-S, As-As and S-S interactions classify as closed-shell van der Waals (vdW) bonded interactions. The bulk of the intermolecular As-S bond paths link regions of locally concentrated electron density (Lewis-base regions) with aligned regions of locally depleted electron density (Lewis-acid regions) on adjacent molecules. The paths are comparable with intermolecular paths reported for several other molecular crystals that link aligned Lewis base and acid regions in a key-lock fashion, interactions that classified as long-range Lewis acid-base-directed vdW interactions. As the bulk of the intermolecular As-S bond paths (~70%) link Lewis acid-base regions on adjacent molecules, it appears that molecules adopt an arrangement that maximizes the number of As-S Lewis acid-base intermolecular bonded interactions. The maximization of the number of Lewis acid-base interactions appears to be connected with the close-packed array adopted by molecules: distorted cubic close-packed arrays are adopted for alacránite, pararealgar, uzonite, realgar and β-AsS and the distorted hexagonal close-packed arrays adopted by α- and β-dimorphite. A growth mechanism is proposed for thioarsenide molecular crystals from aqueous species that maximizes the number of long-range Lewis acid-base vdW As-S bonded interactions with the resulting directed bond paths structuralizing the molecules as a molecular crystal.

  14. Contrasting Evolutionary Dynamics of the Developmental Regulator PAX9, among Bats, with Evidence for a Novel Post-Transcriptional Regulatory Mechanism

    PubMed Central

    Phillips, Caleb D.; Butler, Boyd; Fondon, John W.; Mantilla-Meluk, Hugo; Baker, Robert J.

    2013-01-01

    Morphological evolution can be the result of natural selection favoring modification of developmental signaling pathways. However, little is known about the genetic basis of such phenotypic diversity. Understanding these mechanisms is difficult for numerous reasons, yet studies in model organisms often provide clues about the major developmental pathways involved. The paired-domain gene, PAX9, is known to be a key regulator of development, particularly of the face and teeth. In this study, using a comparative genetics approach, we investigate PAX9 molecular evolution among mammals, focusing on craniofacially diversified (Phyllostomidae) and conserved (Vespertilionidae) bat families, and extend our comparison to other orders of mammal. Open-reading frame analysis disclosed signatures of selection, in which a small percentage of residues vary, and lineages acquire different combinations of variation through recurrent substitution and lineage specific changes. A few instances of convergence for specific residues were observed between morphologically convergent bat lineages. Bioinformatic analysis for unknown PAX9 regulatory motifs indicated a novel post-transcriptional regulatory mechanism involving a Musashi protein. This regulation was assessed through fluorescent reporter assays and gene knockdowns. Results are compatible with the hypothesis that the number of Musashi binding-elements in PAX9 mRNA proportionally regulates protein translation rate. Although a connection between morphology and binding element frequency was not apparent, results indicate this regulation would vary among craniofacially divergent bat species, but be static among conserved species. Under this model, Musashi’s regulatory control of alternative human PAX9 isoforms would also vary. The presence of Musashi-binding elements within PAX9 of all mammals examined, chicken, zebrafish, and the fly homolog of PAX9, indicates this regulatory mechanism is ancient, originating basal to much of the

  15. Regulatory mechanisms underlying oil palm fruit mesocarp maturation, ripening, and functional specialization in lipid and carotenoid metabolism.

    PubMed

    Tranbarger, Timothy J; Dussert, Stéphane; Joët, Thierry; Argout, Xavier; Summo, Marilyne; Champion, Antony; Cros, David; Omore, Alphonse; Nouy, Bruno; Morcillo, Fabienne

    2011-06-01

    Fruit provide essential nutrients and vitamins for the human diet. Not only is the lipid-rich fleshy mesocarp tissue of the oil palm (Elaeis guineensis) fruit the main source of edible oil for the world, but it is also the richest dietary source of provitamin A. This study examines the transcriptional basis of these two outstanding metabolic characters in the oil palm mesocarp. Morphological, cellular, biochemical, and hormonal features defined key phases of mesocarp development. A 454 pyrosequencing-derived transcriptome was then assembled for the developmental phases preceding and during maturation and ripening, when high rates of lipid and carotenoid biosynthesis occur. A total of 2,629 contigs with differential representation revealed coordination of metabolic and regulatory components. Further analysis focused on the fatty acid and triacylglycerol assembly pathways and during carotenogenesis. Notably, a contig similar to the Arabidopsis (Arabidopsis thaliana) seed oil transcription factor WRINKLED1 was identified with a transcript profile coordinated with those of several fatty acid biosynthetic genes and the high rates of lipid accumulation, suggesting some common regulatory features between seeds and fruits. We also focused on transcriptional regulatory networks of the fruit, in particular those related to ethylene transcriptional and GLOBOSA/PISTILLATA-like proteins in the mesocarp and a central role for ethylene-coordinated transcriptional regulation of type VII ethylene response factors during ripening. Our results suggest that divergence has occurred in the regulatory components in this monocot fruit compared with those identified in the dicot tomato (Solanum lycopersicum) fleshy fruit model. PMID:21487046

  16. Distinct Regulatory Mechanisms of the Human Ferritin Gene by Hypoxia and Hypoxia Mimetic Cobalt Chloride at the Transcriptional and Post-transcriptional Levels

    PubMed Central

    Huang, Bo-Wen; Miyazawa, Masaki; Tsuji, Yoshiaki

    2014-01-01

    Cobalt chloride has been used as a hypoxia mimetic because it stabilizes hypoxia inducible factor-1α (HIF1-α) and activates gene transcription through a hypoxia responsive element (HRE). However, differences between hypoxia and hypoxia mimetic cobalt chloride in gene regulation remain elusive. Expression of ferritin, the major iron storage protein, is regulated at the transcriptional and posttranscriptional levels through DNA and RNA regulatory elements. Here we demonstrate that hypoxia and cobalt chloride regulate ferritin heavy chain (ferritin H) expression by two distinct mechanisms. Both hypoxia and cobalt chloride increased HIF1-α but a putative HRE in the human ferritin H gene was not activated. Instead, cobalt chloride but not hypoxia activated ferritin H transcription through an antioxidant responsive element (ARE), to which Nrf2 was recruited. Intriguingly, cobalt chloride downregulated ferritin H protein expression while upregulated other ARE-regulated antioxidant genes in K562 cells. Further characterization demonstrated that cobalt chloride increased interaction between iron regulatory proteins (IRP1 and IRP2) and iron responsive element (IRE) in the 5′UTR of ferritin H mRNA, resulting in translational block of the accumulated ferritin H mRNA. In contrast, hypoxia had marginal effect on ferritin H transcription but increased its translation through decreased IRP1-IRE interaction. These results suggest that hypoxia and hypoxia mimetic cobalt chloride employ distinct regulatory mechanisms through the interplay between DNA and mRNA elements at the transcriptional and post-transcriptional levels. PMID:25172425

  17. Analysis of the low-pressure plasma pretreated polymer surface in terms of acid-base approach

    NASA Astrophysics Data System (ADS)

    Kraus, Eduard; Orf, Lukas; Baudrit, Benjamin; Heidemeyer, Peter; Bastian, Martin; Bonenberger, Ramona; Starostina, Irina; Stoyanov, Oleg

    2016-05-01

    We demonstrate the use of a modern wetting method for determining the acid-base properties of treated polymer surfaces for different plastics and adhesives. The effect of the surface treatment with low pressure plasma was evaluated from the viewpoint of acid-base approach with plastics polyoxymethylene (POM) and polyetheretherketone (PEEK). The correlations between the acid-base properties and the identified mechanical tensile strengths of adhesive bonded joints were evaluated and discussed. In the investigated range the determination coefficients for POM and PEEK were calculated to R2 = 0.93 and R2 = 0.97, respectively. These relatively high determination coefficients showed a good correlation between the mechanical strength and the acidity parameter ΔDshort for use in bonding technology for surface pretreatment of polymers with LPP.

  18. Effect of acid/base on the third-order optical nonlinearity of polypyrrole

    NASA Astrophysics Data System (ADS)

    Wang, Aijian; Zhao, Wei; Yu, Wang

    2015-11-01

    Polypyrrole (PPy) and its acid/base composites (PPy·H2SO4, PPy·HCl and PPy·NH3·H2O) were successfully synthesized and were characterized respectively by using fourier transform infrared, ultraviolet/visible absorption, X-ray diffraction, transmission electron microscopy and Raman spectroscopic techniques. The nonlinear optical properties of PPy and its acid/base composites were investigated using nanosecond Z-scan measurements at 532 nm. At the identical linear transmittance, the saturable absorption of pure PPy was changed to reverse saturable absorption by doping with acid (HCl and H2SO4) and base (NH3·H2O). The possible mechanisms for the different nonlinear properties were also discussed.

  19. Cis- and Trans-Regulatory Mechanisms of Gene Expression in the ASJ Sensory Neuron of Caenorhabditis elegans

    PubMed Central

    González-Barrios, María; Fierro-González, Juan Carlos; Krpelanova, Eva; Mora-Lorca, José Antonio; Pedrajas, José Rafael; Peñate, Xenia; Chavez, Sebastián; Swoboda, Peter; Jansen, Gert; Miranda-Vizuete, Antonio

    2015-01-01

    The identity of a given cell type is determined by the expression of a set of genes sharing common cis-regulatory motifs and being regulated by shared transcription factors. Here, we identify cis and trans regulatory elements that drive gene expression in the bilateral sensory neuron ASJ, located in the head of the nematode Caenorhabditis elegans. For this purpose, we have dissected the promoters of the only two genes so far reported to be exclusively expressed in ASJ, trx-1 and ssu-1. We hereby identify the ASJ motif, a functional cis-regulatory bipartite promoter region composed of two individual 6 bp elements separated by a 3 bp linker. The first element is a 6 bp CG-rich sequence that presumably binds the Sp family member zinc-finger transcription factor SPTF-1. Interestingly, within the C. elegans nervous system SPTF-1 is also found to be expressed only in ASJ neurons where it regulates expression of other genes in these neurons and ASJ cell fate. The second element of the bipartite motif is a 6 bp AT-rich sequence that is predicted to potentially bind a transcription factor of the homeobox family. Together, our findings identify a specific promoter signature and SPTF-1 as a transcription factor that functions as a terminal selector gene to regulate gene expression in C. elegans ASJ sensory neurons. PMID:25769980

  20. Genome-Wide Analysis of Wilms' Tumor 1-Controlled Gene Expression in Podocytes Reveals Key Regulatory Mechanisms.

    PubMed

    Kann, Martin; Ettou, Sandrine; Jung, Youngsook L; Lenz, Maximilian O; Taglienti, Mary E; Park, Peter J; Schermer, Bernhard; Benzing, Thomas; Kreidberg, Jordan A

    2015-09-01

    The transcription factor Wilms' tumor suppressor 1 (WT1) is key to podocyte development and viability; however, WT1 transcriptional networks in podocytes remain elusive. We provide a comprehensive analysis of the genome-wide WT1 transcriptional network in podocytes in vivo using chromatin immunoprecipitation followed by sequencing (ChIPseq) and RNA sequencing techniques. Our data show a specific role for WT1 in regulating the podocyte-specific transcriptome through binding to both promoters and enhancers of target genes. Furthermore, we inferred a podocyte transcription factor network consisting of WT1, LMX1B, TCF21, Fox-class and TEAD family transcription factors, and MAFB that uses tissue-specific enhancers to control podocyte gene expression. In addition to previously described WT1-dependent target genes, ChIPseq identified novel WT1-dependent signaling systems. These targets included components of the Hippo signaling system, underscoring the power of genome-wide transcriptional-network analyses. Together, our data elucidate a comprehensive gene regulatory network in podocytes suggesting that WT1 gene regulatory function and podocyte cell-type specification can best be understood in the context of transcription factor-regulatory element network interplay. PMID:25636411

  1. Acid-Base Disorders--A Computer Simulation.

    ERIC Educational Resources Information Center

    Maude, David L.

    1985-01-01

    Describes and lists a program for Apple Pascal Version 1.1 which investigates the behavior of the bicarbonate-carbon dioxide buffer system in acid-base disorders. Designed specifically for the preclinical medical student, the program has proven easy to use and enables students to use blood gas parameters to arrive at diagnoses. (DH)

  2. Soil Studies: Applying Acid-Base Chemistry to Environmental Analysis.

    ERIC Educational Resources Information Center

    West, Donna M.; Sterling, Donna R.

    2001-01-01

    Laboratory activities for chemistry students focus attention on the use of acid-base chemistry to examine environmental conditions. After using standard laboratory procedures to analyze soil and rainwater samples, students use web-based resources to interpret their findings. Uses CBL probes and graphing calculators to gather and analyze data and…

  3. Using Spreadsheets to Produce Acid-Base Titration Curves.

    ERIC Educational Resources Information Center

    Cawley, Martin James; Parkinson, John

    1995-01-01

    Describes two spreadsheets for producing acid-base titration curves, one uses relatively simple cell formulae that can be written into the spreadsheet by inexperienced students and the second uses more complex formulae that are best written by the teacher. (JRH)

  4. Students' Understanding of Acids/Bases in Organic Chemistry Contexts

    ERIC Educational Resources Information Center

    Cartrette, David P.; Mayo, Provi M.

    2011-01-01

    Understanding key foundational principles is vital to learning chemistry across different contexts. One such foundational principle is the acid/base behavior of molecules. In the general chemistry sequence, the Bronsted-Lowry theory is stressed, because it lends itself well to studying equilibrium and kinetics. However, the Lewis theory of…

  5. The Regulatory T Cell Lineage Factor Foxp3 Regulates Gene Expression through Several Distinct Mechanisms Mostly Independent of Direct DNA Binding

    PubMed Central

    Andersen, Kristian G.; Hebenstreit, Daniel; Teichmann, Sarah A.; Betz, Alexander G.

    2015-01-01

    The lineage factor Foxp3 is essential for the development and maintenance of regulatory T cells, but little is known about the mechanisms involved. Here, we demonstrate that an N-terminal proline-rich interaction region is crucial for Foxp3’s function. Subdomains within this key region link Foxp3 to several independent mechanisms of transcriptional regulation. Our study suggests that Foxp3, even in the absence of its DNA-binding forkhead domain, acts as a bridge between DNA-binding interaction partners and proteins with effector function permitting it to regulate a large number of genes. We show that, in one such mechanism, Foxp3 recruits class I histone deacetylases to the promoters of target genes, counteracting activation-induced histone acetylation and thereby suppressing their expression. PMID:26107960

  6. Whole body acid-base and fluid-electrolyte balance: a mathematical model.

    PubMed

    Wolf, Matthew B

    2013-10-15

    A cellular compartment was added to our previous mathematical model of steady-state acid-base and fluid-electrolyte chemistry to gain further understanding and aid diagnosis of complex disorders involving cellular involvement in critically ill patients. An important hypothesis to be validated was that the thermodynamic, standard free-energy of cellular H(+) and Na(+) pumps remained constant under all conditions. In addition, a hydrostatic-osmotic pressure balance was assumed to describe fluid exchange between plasma and interstitial fluid, including incorporation of compliance curves of vascular and interstitial spaces. The description of the cellular compartment was validated by close comparison of measured and model-predicted cellular pH and electrolyte changes in vitro and in vivo. The new description of plasma-interstitial fluid exchange was validated using measured changes in fluid volumes after isoosmotic and hyperosmotic fluid infusions of NaCl and NaHCO3. The validated model was used to explain the role of cells in the mechanism of saline or dilutional acidosis and acid-base effects of acidic or basic fluid infusions and the acid-base disorder due to potassium depletion. A module was created that would allow users, who do not possess the software, to determine, for free, the results of fluid infusions and urinary losses of water and solutes to the whole body. PMID:23884137

  7. Signal Transduction and Regulatory Mechanisms Involved in Control of the σS (RpoS) Subunit of RNA Polymerase

    PubMed Central

    Hengge-Aronis, Regine

    2002-01-01

    The σS (RpoS) subunit of RNA polymerase is the master regulator of the general stress response in Escherichia coli and related bacteria. While rapidly growing cells contain very little σS, exposure to many different stress conditions results in rapid and strong σS induction. Consequently, transcription of numerous σS-dependent genes is activated, many of which encode gene products with stress-protective functions. Multiple signal integration in the control of the cellular σS level is achieved by rpoS transcriptional and translational control as well as by regulated σS proteolysis, with various stress conditions differentially affecting these levels of σS control. Thus, a reduced growth rate results in increased rpoS transcription whereas high osmolarity, low temperature, acidic pH, and some late-log-phase signals stimulate the translation of already present rpoS mRNA. In addition, carbon starvation, high osmolarity, acidic pH, and high temperature result in stabilization of σS, which, under nonstress conditions, is degraded with a half-life of one to several minutes. Important cis-regulatory determinants as well as trans-acting regulatory factors involved at all levels of σS regulation have been identified. rpoS translation is controlled by several proteins (Hfq and HU) and small regulatory RNAs that probably affect the secondary structure of rpoS mRNA. For σS proteolysis, the response regulator RssB is essential. RssB is a specific direct σS recognition factor, whose affinity for σS is modulated by phosphorylation of its receiver domain. RssB delivers σS to the ClpXP protease, where σS is unfolded and completely degraded. This review summarizes our current knowledge about the molecular functions and interactions of these components and tries to establish a framework for further research on the mode of multiple signal input into this complex regulatory system. PMID:12208995

  8. New insights into ion regulation of cephalopod molluscs: a role of epidermal ionocytes in acid-base regulation during embryogenesis.

    PubMed

    Hu, Marian Y; Tseng, Yung-Che; Lin, Li-Yih; Chen, Po-Yen; Charmantier-Daures, Mireille; Hwang, Pung-Pung; Melzner, Frank

    2011-12-01

    The constraints of an active life in a pelagic habitat led to numerous convergent morphological and physiological adaptations that enable cephalopod molluscs and teleost fishes to compete for similar resources. Here, we show for the first time that such convergent developments are also found in the ontogenetic progression of ion regulatory tissues; as in teleost fish, epidermal ionocytes scattered on skin and yolk sac of cephalopod embryos appear to be responsible for ionic and acid-base regulation before gill epithelia become functional. Ion and acid-base regulation is crucial in cephalopod embryos, as they are surrounded by a hypercapnic egg fluid with a Pco(2) between 0.2 and 0.4 kPa. Epidermal ionocytes were characterized via immunohistochemistry, in situ hybridization, and vital dye-staining techniques. We found one group of cells that is recognized by concavalin A and MitoTracker, which also expresses Na(+)/H(+) exchangers (NHE3) and Na(+)-K(+)-ATPase. Similar to findings obtained in teleosts, these NHE3-rich cells take up sodium in exchange for protons, illustrating the energetic superiority of NHE-based proton excretion in marine systems. In vivo electrophysiological techniques demonstrated that acid equivalents are secreted by the yolk and skin integument. Intriguingly, epidermal ionocytes of cephalopod embryos are ciliated as demonstrated by scanning electron microscopy, suggesting a dual function of epithelial cells in water convection and ion regulation. These findings add significant knowledge to our mechanistic understanding of hypercapnia tolerance in marine organisms, as it demonstrates that marine taxa, which were identified as powerful acid-base regulators during hypercapnic challenges, already exhibit strong acid-base regulatory abilities during embryogenesis. PMID:21975645

  9. Posttranslational Modification of Maize Chloroplast Pyruvate Orthophosphate Dikinase Reveals the Precise Regulatory Mechanism of Its Enzymatic Activity.

    PubMed

    Chen, Yi-Bo; Lu, Tian-Cong; Wang, Hong-Xia; Shen, Jie; Bu, Tian-Tian; Chao, Qing; Gao, Zhi-Fang; Zhu, Xin-Guang; Wang, Yue-Feng; Wang, Bai-Chen

    2014-04-01

    In C4 plants, pyruvate orthophosphate dikinase (PPDK) activity is tightly dark/light regulated by reversible phosphorylation of an active-site threonine (Thr) residue; this process is catalyzed by PPDK regulatory protein (PDRP). Phosphorylation and dephosphorylation of PPDK lead to its inactivation and activation, respectively. Here, we show that light intensity rather than the light/dark transition regulates PPDK activity by modulating the reversible phosphorylation at Thr-527 (previously termed Thr-456) of PPDK in maize (Zea mays). The amount of PPDK (unphosphorylated) involved in C4 photosynthesis is indeed strictly controlled by light intensity, despite the high levels of PPDK protein that accumulate in mesophyll chloroplasts. In addition, we identified a transit peptide cleavage site, uncovered partial amino-terminal acetylation, and detected phosphorylation at four serine (Ser)/Thr residues, two of which were previously unknown in maize. In vitro experiments indicated that Thr-527 and Ser-528, but not Thr-309 and Ser-506, are targets of PDRP. Modeling suggests that the two hydrogen bonds between the highly conserved residues Ser-528 and glycine-525 are required for PDRP-mediated phosphorylation of the active-site Thr-527 of PPDK. Taken together, our results suggest that the regulation of maize plastid PPDK isoform (C4PPDK) activity is much more complex than previously reported. These diverse regulatory pathways may work alone or in combination to fine-tune C4PPDK activity in response to changes in lighting. PMID:24710069

  10. Regulatory RNAs

    PubMed Central

    Vazquez-Anderson, Jorge; Contreras, Lydia M

    2013-01-01

    RNAs have many important functional properties, including that they are independently controllable and highly tunable. As a result of these advantageous properties, their use in a myriad of sophisticated devices has been widely explored. Yet, the exploitation of RNAs for synthetic applications is highly dependent on the ability to characterize the many new molecules that continue to be discovered by large-scale sequencing and high-throughput screening techniques. In this review, we present an exhaustive survey of the most recent synthetic bacterial riboswitches and small RNAs while emphasizing their virtues in gene expression management. We also explore the use of these RNA components as building blocks in the RNA synthetic biology toolbox and discuss examples of synthetic RNA components used to rewire bacterial regulatory circuitry. We anticipate that this field will expand its catalog of smart devices by mimicking and manipulating natural RNA mechanisms and functions. PMID:24356572

  11. Nucleic Acid-Based Nanodevices in Biological Imaging.

    PubMed

    Chakraborty, Kasturi; Veetil, Aneesh T; Jaffrey, Samie R; Krishnan, Yamuna

    2016-06-01

    The nanoscale engineering of nucleic acids has led to exciting molecular technologies for high-end biological imaging. The predictable base pairing, high programmability, and superior new chemical and biological methods used to access nucleic acids with diverse lengths and in high purity, coupled with computational tools for their design, have allowed the creation of a stunning diversity of nucleic acid-based nanodevices. Given their biological origin, such synthetic devices have a tremendous capacity to interface with the biological world, and this capacity lies at the heart of several nucleic acid-based technologies that are finding applications in biological systems. We discuss these diverse applications and emphasize the advantage, in terms of physicochemical properties, that the nucleic acid scaffold brings to these contexts. As our ability to engineer this versatile scaffold increases, its applications in structural, cellular, and organismal biology are clearly poised to massively expand. PMID:27294440

  12. Mechanisms of impaired regulation by CD4+CD25+FOXP3+ regulatory T cells in human autoimmune diseases

    PubMed Central

    Buckner, Jane Hoyt

    2011-01-01

    A lack of regulatory T (TReg) cells that express CD4, CD25 and forkhead box P3 (FOXP3) results in severe autoimmunity in both mice and humans. Since the discovery of TReg cells, there has been intense investigation aimed at determining how they protect an organism from autoimmunity and whether defects in their number or function contribute to the development of autoimmunity in model systems. The next phase of investigation — that is, to define the role that defects in TReg cells have in human autoimmunity — is now underway. This Review summarizes our progress so far towards understanding the role of CD4+CD25+FOXP3+ TReg cells in human autoimmune diseases and the impact that this knowledge might have on the diagnosis and treatment of these diseases. PMID:21107346

  13. FarR regulates the farAB-encoded efflux pump of Neisseria gonorrhoeae via an MtrR regulatory mechanism.

    PubMed

    Lee, E-H; Rouquette-Loughlin, C; Folster, J P; Shafer, W M

    2003-12-01

    The farAB operon of Neisseria gonorrhoeae encodes an efflux pump which mediates gonococcal resistance to antibacterial fatty acids. It was previously observed that expression of the farAB operon was positively regulated by MtrR, which is a repressor of the mtrCDE-encoded efflux pump system (E.-H. Lee and W. M. Shafer, Mol. Microbiol. 33:839-845, 1999). This regulation was believed to be indirect since MtrR did not bind to the farAB promoter. In this study, computer analysis of the gonococcal genome sequence database, lacZ reporter fusions, and gel mobility shift assays were used to elucidate the regulatory mechanism by which expression of the farAB operon is modulated by MtrR in gonococci. We identified a regulatory protein belonging to the MarR family of transcriptional repressors and found that it negatively controls expression of farAB by directly binding to the farAB promoter. We designated this regulator FarR to signify its role in regulating the farAB operon. We found that MtrR binds to the farR promoter, thereby repressing farR expression. Hence, MtrR regulates farAB in a positive fashion by modulating farR expression. This MtrR regulatory cascade seems to play an important role in adjusting levels of the FarAB and MtrCDE efflux pumps to prevent their excess expression in gonococci. PMID:14645274

  14. Temperature controls on the basal emission rate of isoprene in a tropical tree Ficus septica: exploring molecular regulatory mechanisms.

    PubMed

    Mutanda, Ishmael; Inafuku, Masashi; Saitoh, Seikoh; Iwasaki, Hironori; Fukuta, Masakazu; Watanabe, Keiichi; Oku, Hirosuke

    2016-10-01

    Isoprene emission from plants is very sensitive to environmental temperature both at short-term and long-term scales. Our previous study demonstrated suppression of isoprene emission by cold temperatures in a high emitting tropical tree Ficus septica and revealed a strong correlation of emission to isoprene synthase (IspS) protein levels. When challenged with decreasing daily temperatures from 30 to 12 °C, F. septica completely stopped isoprene emission at 12 °C, only to recover on the second day after re-exposure to 30 °C. Here, we explored this regulation of isoprene emission in response to environmental temperature by a comprehensive analysis of transcriptome data, gene expressions and metabolite pools of the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. MEP pathway genes and metabolites dynamics did not support substrate-level limitations as major control over observed basal emission, but transcriptome data, network inferences and putative regulatory elements on IspS promoter suggested transcriptional regulation of IspS gene through circadian rhythm and phytohormone signalling processes. Expression levels of 29 genes involved in these pathways were examined by quantitative real-time PCR. We propose that temperature controls over basal isoprene emission at a time-scale of hours to few days are regulated by phytohormone-mediated transcriptional modulation of IspS gene under synchronization by the circadian clock. PMID:27425779

  15. Characterization of microRNA expression in bovine adipose tissues: a potential regulatory mechanism of subcutaneous adipose tissue development

    PubMed Central

    2010-01-01

    Background MicroRNAs (miRNAs), a family of small non-coding RNA molecules, appear to regulate animal lipid metabolism and preadipocyte conversion to form lipid-assimilating adipocytes (i.e. adipogenesis). However, no miRNA to date has been reported to modulate adipogenesis and lipid deposition in beef cattle. Results The expression patterns of 89 miRNAs including four bovine specific miRNAs in subcutaneous adipose tissues from three groups of crossbred steers differing in backfat thickness were compared using qRT-PCR analysis. Eighty-six miRNAs were detectable in all samples, with 42 miRNAs differing among crossbreds (P < 0.05) and 15 miRNAs differentially expressed between tissues with high and low backfat thickness (P < 0.05). The expression levels of 18 miRNAs were correlated with backfat thickness (P < 0.05). The miRNA most differentially expressed and the most strongly associated with backfat thickness was miR-378, with a 1.99-fold increase in high backfat thickness tissues (r = 0.72). Conclusions MiRNA expression patterns differed significantly in response to host genetic components. Approximately 20% of the miRNAs in this study were identified as being correlated with backfat thickness. This result suggests that miRNAs may play a regulatory role in white adipose tissue development in beef animals. PMID:20423511

  16. Digestive cells from Mytilus galloprovincialis show a partial regulatory volume decrease following acute hypotonic stress through mechanisms involving inorganic ions.

    PubMed

    Torre, Agata; Trischitta, Francesca; Corsaro, Carmelo; Mallamace, Domenico; Faggio, Caterina

    2013-08-01

    The response of isolated digestive cells of the digestive gland of Mytilus galloprovincialis to hypotonic shock was studied using videometric methods. The isolated cells exposed to a rapid change (from 1100 to 800 mosmol kg(-1) ) of the bathing solution osmolality swelled but thereafter underwent a regulatory volume decrease (RVD), tending to recover the original size. When the hypotonic stress was applied in the presence of quinine and glibenclamide, known inhibitors of swelling activated ion channels, the cells did not exhibit an RVD response; in addition, they showed a larger increase in size in respect to control cells. These observations suggest that the digestive cells of the digestive gland have the machinery to cope with the hyposmotic shock allowing them to exhibit a small but significant RVD preventing an excessive increase in cell size. The pharmacological treatment of digestive cells during the RVD experiments suggests that cell volume is regulated by K(+) and Cl(-) efflux followed by an obliged water efflux from the cell. The involvement of organic osmolytes such as taurine and betaine seems to be excluded by NMR measurement on digestive cells. PMID:23112133

  17. Mechanisms of andrographolide-induced platelet apoptosis in human platelets: regulatory roles of the extrinsic apoptotic pathway.

    PubMed

    Lien, Li-Ming; Su, Cheng-Chen; Hsu, Wen-Hsien; Lu, Wan-Jung; Chung, Chi-Li; Yen, Ting-Lin; Chiu, Hou-Chang; Sheu, Joen-Rong; Lin, Kuan-Hung

    2013-11-01

    Andrographolide, a novel nuclear factor-κB (NF-κB) inhibitor, is isolated from the leaves of Andrographis paniculata. Platelet activation is relevant to a variety of coronary heart diseases. Our recent studies revealed that andrographolide possesses potent antiplatelet activity by inhibition of the p38 MAPK/(●) HO-NF-κB-ERK2 cascade. Although platelets are anucleated cells, apoptotic machinery apparatus recently has been found to regulate platelet activation and limit platelet lifespan. Therefore, we further investigated the regulatory effects of andrographolide on platelet apoptotic events. In this study, apoptotic signaling events for caspase-3, -8, and Bid were time (10-60 min)- and dose (25-100 μΜ)-dependently activated by andrographolide in human platelets. Andrographolide could also disrupt mitrochondrial membrane potential. In addition, caspase-8 inhibitor (z-IETD-fmk, 50 μΜ) was found to reverse andrographolide-induced caspase-8 activation, whereas the antagonistic anti-Fas receptor (ZB4, 500 ng/mL) and anti-tumor necrosis factor-R1 (H398, 10 µg/mL) monoclonal antibodies did not. In conclusion, this study for the first time demonstrated that andrographolide might limit platelet lifespan by initiating the caspase-8-dependent extrinsic apoptotic pathway, in spite of no direct evidence that death receptors are involved in this process proved. Overall, the various medicinal properties of andrographolide suggest its potential value in treating patients with thromboembolic disorders. PMID:23292890

  18. Simultaneous coexpression of Borrelia burgdorferi Erp proteins occurs through a specific, erp locus-directed regulatory mechanism.

    PubMed

    El-Hage, Nazira; Stevenson, Brian

    2002-08-01

    An individual Borrelia burgdorferi bacterium can encode as many as 13 different Erp (OspE/F-related) proteins from mono-and bicistronic loci that are carried on up to 10 separate plasmids. We demonstrate through multilabel immunofluorescence analyses that individual bacteria simultaneously coexpress their entire Erp protein repertoire. While it has been proposed that B. burgdorferi controls expression of Erp and other plasmid-encoded proteins through changes in DNA topology, we observed regulated Erp expression in the absence of detectable differences in DNA supercoiling. Likewise, inhibition of DNA gyrase had no detectable effect on Erp expression. Furthermore, expression of loci physically adjacent to erp loci was observed to be independently regulated. It is concluded that Erp expression is regulated by a mechanism(s) directed at erp loci and not by a global, plasmid-wide mechanism. PMID:12142424

  19. Inference of the Arabidopsis Lateral Root Gene Regulatory Network Suggests a Bifurcation Mechanism That Defines Primordia Flanking and Central Zones[OPEN

    PubMed Central

    Lavenus, Julien; Goh, Tatsuaki; Guyomarc’h, Soazig; Hill, Kristine; Lucas, Mikael; Voß, Ute; Kenobi, Kim; Wilson, Michael H.; Farcot, Etienne; Hagen, Gretchen; Guilfoyle, Thomas J.; Fukaki, Hidehiro; Laplaze, Laurent; Bennett, Malcolm J.

    2015-01-01

    A large number of genes involved in lateral root (LR) organogenesis have been identified over the last decade using forward and reverse genetic approaches in Arabidopsis thaliana. Nevertheless, how these genes interact to form a LR regulatory network largely remains to be elucidated. In this study, we developed a time-delay correlation algorithm (TDCor) to infer the gene regulatory network (GRN) controlling LR primordium initiation and patterning in Arabidopsis from a time-series transcriptomic data set. The predicted network topology links the very early-activated genes involved in LR initiation to later expressed cell identity markers through a multistep genetic cascade exhibiting both positive and negative feedback loops. The predictions were tested for the key transcriptional regulator AUXIN RESPONSE FACTOR7 node, and over 70% of its targets were validated experimentally. Intriguingly, the predicted GRN revealed a mutual inhibition between the ARF7 and ARF5 modules that would control an early bifurcation between two cell fates. Analyses of the expression pattern of ARF7 and ARF5 targets suggest that this patterning mechanism controls flanking and central zone specification in Arabidopsis LR primordia. PMID:25944102

  20. Lysineurethanedimethacrylate--a novel generation of amino acid based monomers for bone cements and tissue repair.

    PubMed

    Müh, Ekkehard; Zimmermann, Jörg; Kneser, Ulrich; Marquardt, Jürgen; Mülhaupt, Rolf; Stark, Björn

    2002-07-01

    A novel amino acid based dimethacrylate monomer (lysineurethanedimethacrylate, LUDM) was prepared by the addition of hydroxyethylmethacrylate (HEMA) to lysinediisocyanate (LDI). The structure was confirmed by FT-IR and 1H and 13C NMR spectroscopy as well as FAB-MS. Photopolymerized LUDM exhibited low volume shrinkage upon polymerization, good mechanical properties (Young's modulus: 3740 MPa) and high thermal stability. Osteoblast adhesion and growth on polymerized LUDM samples evidenced the biocompatibility. Further improvement of the mechanical properties was obtained by using Ca-hydroxyapatite as inorganic filler varying between 10 and 30 wt%. The Young's and flexural moduli increased with increasing filler content ranging from 3740 to 5250 MPa and from 2020 to 3690 MPa, respectively. The mechanical properties and the good biocompatibility of the lysine-based methacrylate networks make them interesting materials for medical applications, e.g. bone cements, and tissue engineering. PMID:12069324

  1. History of medical understanding and misunderstanding of Acid base balance.

    PubMed

    Aiken, Christopher Geoffrey Alexander

    2013-09-01

    To establish how controversies in understanding acid base balance arose, the literature on acid base balance was reviewed from 1909, when Henderson described how the neutral reaction of blood is determined by carbonic and organic acids being in equilibrium with an excess of mineral bases over mineral acids. From 1914 to 1930, Van Slyke and others established our acid base principles. They recognised that carbonic acid converts into bicarbonate all non-volatile mineral bases not bound by mineral acids and determined therefore that bicarbonate represents the alkaline reserve of the body and should be a physiological constant. They showed that standard bicarbonate is a good measure of acidosis caused by increased production or decreased elimination of organic acids. However, they recognised that bicarbonate improved low plasma bicarbonate but not high urine acid excretion in diabetic ketoacidosis, and that increasing pCO2 caused chloride to shift into cells raising plasma titratable alkali. Both indicate that minerals influence pH. In 1945 Darrow showed that hyperchloraemic metabolic acidosis in preterm infants fed milk with 5.7 mmol of chloride and 2.0 mmol of sodium per 100 kcal was caused by retention of chloride in excess of sodium. Similar findings were made but not recognised in later studies of metabolic acidosis in preterm infants. Shohl in 1921 and Kildeberg in 1978 presented the theory that carbonic and organic acids are neutralised by mineral base, where mineral base is the excess of mineral cations over anions and organic acid is the difference between mineral base, bicarbonate and protein anion. The degree of metabolic acidosis measured as base excess is determined by deviation in both mineral base and organic acid from normal. PMID:24179938

  2. Functional nucleic-acid-based sensors for environmental monitoring.

    PubMed

    Sett, Arghya; Das, Suradip; Bora, Utpal

    2014-10-01

    Efforts to replace conventional chromatographic methods for environmental monitoring with cheaper and easy to use biosensors for precise detection and estimation of hazardous environmental toxicants, water or air borne pathogens as well as various other chemicals and biologics are gaining momentum. Out of the various types of biosensors classified according to their bio-recognition principle, nucleic-acid-based sensors have shown high potential in terms of cost, sensitivity, and specificity. The discovery of catalytic activities of RNA (ribozymes) and DNA (DNAzymes) which could be triggered by divalent metallic ions paved the way for their extensive use in detection of heavy metal contaminants in environment. This was followed with the invention of small oligonucleotide sequences called aptamers which can fold into specific 3D conformation under suitable conditions after binding to target molecules. Due to their high affinity, specificity, reusability, stability, and non-immunogenicity to vast array of targets like small and macromolecules from organic, inorganic, and biological origin, they can often be exploited as sensors in industrial waste management, pollution control, and environmental toxicology. Further, rational combination of the catalytic activity of DNAzymes and RNAzymes along with the sequence-specific binding ability of aptamers have given rise to the most advanced form of functional nucleic-acid-based sensors called aptazymes. Functional nucleic-acid-based sensors (FNASs) can be conjugated with fluorescent molecules, metallic nanoparticles, or quantum dots to aid in rapid detection of a variety of target molecules by target-induced structure switch (TISS) mode. Although intensive research is being carried out for further improvements of FNAs as sensors, challenges remain in integrating such bio-recognition element with advanced transduction platform to enable its use as a networked analytical system for tailor made analysis of environmental

  3. Reovirus μ2 Protein Inhibits Interferon Signaling through a Novel Mechanism Involving Nuclear Accumulation of Interferon Regulatory Factor 9▿

    PubMed Central

    Zurney, Jennifer; Kobayashi, Takeshi; Holm, Geoffrey H.; Dermody, Terence S.; Sherry, Barbara

    2009-01-01

    The secreted cytokine alpha/beta interferon (IFN-α/β) binds its receptor to activate the Jak-STAT signal transduction pathway, leading to formation of the heterotrimeric IFN-stimulated gene factor 3 (ISGF3) transcription complex for induction of IFN-stimulated genes (ISGs) and establishment of an antiviral state. Many viruses have evolved countermeasures to inhibit the IFN pathway, thereby subverting the innate antiviral response. Here, we demonstrate that the mildly myocarditic reovirus type 1 Lang (T1L), but not the nonmyocarditic reovirus type 3 Dearing, represses IFN induction of a subset of ISGs and that this repressor function segregates with the T1L M1 gene. Concordantly, the T1L M1 gene product, μ2, dramatically inhibits IFN-β-induced reporter gene expression. Surprisingly, T1L infection does not degrade components of the ISGF3 complex or interfere with STAT1 or STAT2 nuclear translocation as has been observed for other viruses. Instead, infection with T1L or reassortant or recombinant viruses containing the T1L M1 gene results in accumulation of interferon regulatory factor 9 (IRF9) in the nucleus. This effect has not been previously described for any virus and suggests that μ2 modulates IRF9 interactions with STATs for both ISGF3 function and nuclear export. The M1 gene is a determinant of virus strain-specific differences in the IFN response, which are linked to virus strain-specific differences in induction of murine myocarditis. We find that virus-induced myocarditis is associated with repression of IFN function, providing new insights into the pathophysiology of this disease. Together, these data provide the first report of an increase in IRF9 nuclear accumulation associated with viral subversion of the IFN response and couple virus strain-specific differences in IFN antagonism to the pathogenesis of viral myocarditis. PMID:19109390

  4. “Curcumin, the King of Spices”: Epigenetic Regulatory Mechanisms in the Prevention of Cancer, Neurological, and Inflammatory Diseases

    PubMed Central

    Boyanapalli, Sarandeep S. S.

    2015-01-01

    Curcumin (diferuloylmethane), a polyphenolic compound, is a component of Curcuma longa, commonly known as turmeric. It is a well-known anti-inflammatory, anti-oxidative, and anti-lipidemic agent and has recently been shown to modulate several diseases via epigenetic regulation. Many recent studies have demonstrated the role of epigenetic inactivation of pivotal genes that regulate human pathologies, such as neurocognitive disorders, inflammation, obesity, and cancers. Epigenetic changes involve changes in DNA methylation, histone modifications, or altered microRNA expression patterns which are known to be interconnected and play a key role in tumor progression and failure of conventional chemotherapy. The majority of epigenetic changes are influenced by lifestyle and diets. In this regard, dietary phytochemicals as dietary supplements have emerged as a promising source that are able to reverse these epigenetic alterations, to actively regulate gene expression and molecular targets that are known to promote tumorigenesis, and also to prevent age-related diseases through epigenetic modifications. There have been several studies which reported the role of curcumin as an epigenetic regulator in neurological disorders, inflammation, and in diabetes apart from cancers. The epigenetic regulatory roles of curcumin include (1) inhibition of DNA methyltransferases (DNMTs), which has been well defined from the recent studies on its function as a DNA hypomethylating agent; (2) regulation of histone modifications via regulation of histone acetyltransferases (HATs) and histone deacetylases (HDACs); and (3) regulation of micro RNAs (miRNA). This review summarizes the current knowledge on the effect of curcumin in the treatment and/or prevention of inflammation, neurodegenerative diseases, and cancers by regulating histone deacetylases, histone acetyltransferases, and DNA methyltransferases. PMID:26457241

  5. Autophagy Regulatory Network — A systems-level bioinformatics resource for studying the mechanism and regulation of autophagy

    PubMed Central

    Türei, Dénes; Földvári-Nagy, László; Fazekas, Dávid; Módos, Dezső; Kubisch, János; Kadlecsik, Tamás; Demeter, Amanda; Lenti, Katalin; Csermely, Péter; Vellai, Tibor; Korcsmáros, Tamás

    2015-01-01

    Autophagy is a complex cellular process having multiple roles, depending on tissue, physiological, or pathological conditions. Major post-translational regulators of autophagy are well known, however, they have not yet been collected comprehensively. The precise and context-dependent regulation of autophagy necessitates additional regulators, including transcriptional and post-transcriptional components that are listed in various datasets. Prompted by the lack of systems-level autophagy-related information, we manually collected the literature and integrated external resources to gain a high coverage autophagy database. We developed an online resource, Autophagy Regulatory Network (ARN; http://autophagy-regulation.org), to provide an integrated and systems-level database for autophagy research. ARN contains manually curated, imported, and predicted interactions of autophagy components (1,485 proteins with 4,013 interactions) in humans. We listed 413 transcription factors and 386 miRNAs that could regulate autophagy components or their protein regulators. We also connected the above-mentioned autophagy components and regulators with signaling pathways from the SignaLink 2 resource. The user-friendly website of ARN allows researchers without computational background to search, browse, and download the database. The database can be downloaded in SQL, CSV, BioPAX, SBML, PSI-MI, and in a Cytoscape CYS file formats. ARN has the potential to facilitate the experimental validation of novel autophagy components and regulators. In addition, ARN helps the investigation of transcription factors, miRNAs and signaling pathways implicated in the control of the autophagic pathway. The list of such known and predicted regulators could be important in pharmacological attempts against cancer and neurodegenerative diseases. PMID:25635527

  6. Biofuncationalized microfiber Bragg grating for acid-based sensing

    NASA Astrophysics Data System (ADS)

    Ran, Yang; Huang, Yunyun; Shen, Xiang; Sun, Dandan; Wang, Xiuxin; Jin, Long; Li, Jie; Guan, Baiou

    2014-05-01

    We demonstrate an acid-based sensor from the biofuncationalized microfiber Bragg grating. By electrostatic selfassembly layer-by-layer technique, the film consisting of sodium alginate which has hygroscopic response to the potential of hydrogen is coated on the fiber surface. Consequently, the refractive index variation of the sensing film caused by water absorption can be measured by mFBG's higher order mode peak which can be translated into pH value information. The sensitivity of the sensor is received as high as 265pm/pH.

  7. The comprehensive acid-base characterization of glutathione

    NASA Astrophysics Data System (ADS)

    Mirzahosseini, Arash; Somlyay, Máté; Noszál, Béla

    2015-02-01

    Glutathione in its thiol (GSH) and disulfide (GSSG) forms, and 4 related compounds were studied by 1H NMR-pH titrations and a case-tailored evaluation method. The resulting acid-base properties are quantified in terms of 128 microscopic protonation constants; the first complete set of such parameters for this vitally important pair of compounds. The concomitant 12 interactivity parameters were also determined. Since biological redox systems are regularly compared to the GSH-GSSG pair, the eight microscopic thiolate basicities determined this way are exclusive means for assessing subtle redox parameters in a wide pH range.

  8. Acid-Base Homeostasis: Overview for Infusion Nurses.

    PubMed

    Masco, Natalie A

    2016-01-01

    Acid-base homeostasis is essential to normal function of the human body. Even slight alterations can significantly alter physiologic processes at the tissue and cellular levels. To optimally care for patients, nurses must be able to recognize signs and symptoms that indicate deviations from normal. Nurses who provide infusions to patients-whether in acute care, home care, or infusion center settings-have a responsibility to be able to recognize the laboratory value changes that occur with the imbalance and appreciate the treatment options, including intravenous infusions. PMID:27598068

  9. The oxidative stress, antioxidant profile and acid-base status in preterm and term canine neonates.

    PubMed

    Vannucchi, C I; Kishi, D; Regazzi, F M; Silva, L C G; Veiga, G A L; Angrimani, D S R; Lucio, C F; Nichi, M

    2015-04-01

    During the initiation of neonatal pulmonary respiration, there is an exponential increase in reactive oxygen species that must be scavenged by antioxidant defences. However, neonate and preterm newborns are known to possess immature antioxidant mechanisms to neutralize these toxic effects. The purposes of this study were to compare the development of antioxidant system between preterm and term canine neonates and to evaluate the magnitude of acid-base balance during the initial 4 h of life. A prospective study was conducted involving 18 neonatal puppies assigned to Term Group (63 days of gestation; n = 5), Preterm-57 Group (57 days of gestation; n = 8) and Preterm-55 Group (55 days of gestation; n = 5). Neonates were physically examined through Apgar score and venous haemogasometry within 5 min, 2 and 4 h after birth. No difference on amniotic fluid and serum superoxide dismutase (SOD), glutathione peroxidase (GPx) and the marker of oxidative stress (thiobarbituric acid reactive substances; TBARS) was verified. Irrespective of prematurity, all neonates presented low vitality, hypothermia, acidosis, hypoxaemia and hypercapnia at birth. However, term puppies clinically evolved more rapidly than preterm newborns. During the course of the study, premature neonates presented more severe complications, such as prolonged hypoxaemia and even death. In conclusion, premature puppies have no signs of immature enzymatic mechanisms for controlling oxidative stress, although SOD and GPx may participate in achieving acid-base balance. Aside from initial unremarkable symptoms, premature puppies should be carefully followed up, as they are at high risk of succumbing to odds of prematurity. PMID:25611795

  10. The glmS Ribozyme Cofactor is a General Acid-Base Catalyst

    PubMed Central

    Viladoms, Julia; Fedor, Martha J.

    2012-01-01

    The glmS ribozyme is the first natural self-cleaving ribozyme known to require a cofactor. The D-glucosamine-6-phosphate (GlcN6P) cofactor has been proposed to serve as a general acid, but its role in the catalytic mechanism has not been established conclusively. We surveyed GlcN6P-like molecules for their ability to support self-cleavage of the glmS ribozyme and found a strong correlation between the pH dependence of the cleavage reaction and the intrinsic acidity of the cofactors. For cofactors with low binding affinities the contribution to rate enhancement was proportional to their intrinsic acidity. This linear free-energy relationship between cofactor efficiency and acid dissociation constants is consistent with a mechanism in which the cofactors participate directly in the reaction as general acid-base catalysts. A high value for the Brønsted coefficient (β ~ 0.7) indicates that a significant amount of proton transfer has already occurred in the transition state. The glmS ribozyme is the first self-cleaving RNA to use an exogenous acid-base catalyst. PMID:23113700

  11. The glmS ribozyme cofactor is a general acid-base catalyst.

    PubMed

    Viladoms, Júlia; Fedor, Martha J

    2012-11-21

    The glmS ribozyme is the first natural self-cleaving ribozyme known to require a cofactor. The d-glucosamine-6-phosphate (GlcN6P) cofactor has been proposed to serve as a general acid, but its role in the catalytic mechanism has not been established conclusively. We surveyed GlcN6P-like molecules for their ability to support self-cleavage of the glmS ribozyme and found a strong correlation between the pH dependence of the cleavage reaction and the intrinsic acidity of the cofactors. For cofactors with low binding affinities, the contribution to rate enhancement was proportional to their intrinsic acidity. This linear free-energy relationship between cofactor efficiency and acid dissociation constants is consistent with a mechanism in which the cofactors participate directly in the reaction as general acid-base catalysts. A high value for the Brønsted coefficient (β ~ 0.7) indicates that a significant amount of proton transfer has already occurred in the transition state. The glmS ribozyme is the first self-cleaving RNA to use an exogenous acid-base catalyst. PMID:23113700

  12. FGF23-Associated Tumor-Induced Osteomalacia in a Patient With Small Cell Carcinoma: A Case Report and Regulatory Mechanism Study.

    PubMed

    Sauder, Adrienne; Wiernek, Szymon; Dai, Xumin; Pereira, Renata; Yudd, Michael; Patel, Charvi; Golden, Andrew; Ahmed, Shahida; Choe, Jin; Chang, Victor; Sender, Slawomir; Cai, Donghong

    2016-04-01

    Tumor-induced osteomalacia (TIO) is typically caused by phosphaturic mesenchymal tumor (PMT) that secretes the phosphaturic hormone, fibroblast growth factor-23 (FGF23), resulting in decreased phosphate reabsorption in kidneys, hypophosphatemia, and finally osteomalacia. Rare cases of malignant tumor manifesting with TIO other than PMT had been reported, although in most of these reports, except one, circulating FGF23 levels were not evaluated and tissue expressing of FGF23 was not confirmed. In this article, we report a case of TIO in a patient with pulmonary small cell carcinoma with liver metastasis. The patient manifested with hypophosphatemia. His circulating level of FGF23 was markedly increased. The expression of FGF23 in tumor cells was confirmed. Furthermore, the regulatory mechanism of FGF23 in this patient was also investigated. PMID:26612848

  13. Stimulation of beta(1----3)glucan synthetase of various fungi by nucleoside triphosphates: generalized regulatory mechanism for cell wall biosynthesis.

    PubMed Central

    Szaniszlo, P J; Kang, M S; Cabib, E

    1985-01-01

    Particulate fractions from the taxonomically diverse fungi Achlya ambisexualis, Hansenula anomala, Neurospora crassa, Cryptococcus laurentii, Schizophyllum commune, and Wangiella dermatitidis were found to catalyze the time-dependent incorporation of glucose from UDP-[14C]glucose into a water-insoluble material. The reaction was stimulated by bovine serum albumin. The product was characterized as beta(1----3)glucan on the basis of its resistance to alpha- and beta-amylase and susceptibility to beta(1----3)glucanase. With the exception of the preparation from A. ambisexualis, all others were stimulated by nucleoside triphosphates and their analogs. The best activators were GTP and guanosine 5'-(gamma-thio)triphosphate. It is concluded that the stimulation by nucleotides, previously found with the glucan synthetase of Saccharomyces cerevisiae, is a regulatory mechanism that was well conserved during fungal evolution, presumably because of its importance in controlling cell wall biosynthesis and cell growth. PMID:3156122

  14. Potential of acute phase proteins as predictor of postpartum uterine infections during transition period and its regulatory mechanism in dairy cattle.

    PubMed

    Manimaran, A; Kumaresan, A; Jeyakumar, S; Mohanty, T K; Sejian, V; Kumar, Narender; Sreela, L; Prakash, M Arul; Mooventhan, P; Anantharaj, A; Das, D N

    2016-01-01

    Among the various systemic reactions against infection or injury, the acute phase response is the cascade of reaction and mostly coordinated by cytokines-mediated acute phase proteins (APPs) production. Since APPs are sensitive innate immune molecules, they are useful for early detection of inflammation in bovines and believed to be better discriminators than routine hematological parameters. Therefore, the possibility of using APPs as a diagnostic and prognostic marker of inflammation in major bovine health disorders including postpartum uterine infection has been explored by many workers. In this review, we discussed specifically importance of postpartum uterine infection, the role of energy balance in uterine infections and potential of APPs as a predictor of postpartum uterine infections during the transition period and its regulatory mechanism in dairy cattle. PMID:27051191

  15. Potential of acute phase proteins as predictor of postpartum uterine infections during transition period and its regulatory mechanism in dairy cattle

    PubMed Central

    Manimaran, A.; Kumaresan, A.; Jeyakumar, S.; Mohanty, T. K.; Sejian, V.; Kumar, Narender; Sreela, L.; Prakash, M. Arul; Mooventhan, P.; Anantharaj, A.; Das, D. N.

    2016-01-01

    Among the various systemic reactions against infection or injury, the acute phase response is the cascade of reaction and mostly coordinated by cytokines-mediated acute phase proteins (APPs) production. Since APPs are sensitive innate immune molecules, they are useful for early detection of inflammation in bovines and believed to be better discriminators than routine hematological parameters. Therefore, the possibility of using APPs as a diagnostic and prognostic marker of inflammation in major bovine health disorders including postpartum uterine infection has been explored by many workers. In this review, we discussed specifically importance of postpartum uterine infection, the role of energy balance in uterine infections and potential of APPs as a predictor of postpartum uterine infections during the transition period and its regulatory mechanism in dairy cattle. PMID:27051191

  16. A Computer-Based Simulation of an Acid-Base Titration

    ERIC Educational Resources Information Center

    Boblick, John M.

    1971-01-01

    Reviews the advantages of computer simulated environments for experiments, referring in particular to acid-base titrations. Includes pre-lab instructions and a sample computer printout of a student's use of an acid-base simulation. Ten references. (PR)

  17. Characterization of the liver X receptor-dependent regulatory mechanism of goat stearoyl-coenzyme A desaturase 1 gene by linoleic acid.

    PubMed

    Yao, D W; Luo, J; He, Q Y; Li, J; Wang, H; Shi, H B; Xu, H F; Wang, M; Loor, J J

    2016-05-01

    Stearoyl-coenzyme A desaturase 1 (SCD1) is a key enzyme in the biosynthesis of palmitoleic and oleic acid. Although the transcriptional regulatory mechanism of SCD1 via polyunsaturated fatty acids (PUFA) has been extensively explored in nonruminants, the existence of such mechanism in ruminant mammary gland remains unknown. In this study, we used goat genomic DNA to clone and sequence a 1,713-bp fragment of the SCD1 5' flanking region. Deletion assays revealed a core region of the promoter located between -415 and -109 bp upstream of the transcription start site, and contained the highly conserved PUFA response region. An intact PUFA response region was required for the basal transcriptional activity of SCD1. Linoleic acid reduced endogenous expression of SCD1 and sterol regulatory element binding factor-1 (SREBF1) in goat mammary epithelial cells. Further analysis indicated that both the sterol response element (SRE) and the nuclear factor Y (NF-Y) binding site in the SCD1 promoter were responsible for the inhibition effect by linoleic acid, whereas the effect was abrogated once NF-Y was deleted. In addition, SRE and NF-Y were partly responsible for the transcriptional activation induced via the liver X receptor agonist T 4506585 (Sigma-Aldrich, St. Louis, MO). When goat mammary epithelial cells were cultured with linoleic acid, addition of T 4506585 markedly increased SCD1 transcription in controls, but had no effect on cells with a deleted SRE promoter. These results demonstrated that linoleic acid can regulate SCD1 expression at the transcriptional level through SRE and NF-Y in a liver X receptor-dependent fashion in the goat mammary gland. PMID:26947306

  18. Immune-Regulatory Mechanisms of Classical and Experimental Multiple Sclerosis Drugs: A Special Focus on Helminth-Derived Treatments.

    PubMed

    Peón, Alberto N; Terrazas, Luis I

    2016-01-01

    Multiple sclerosis (MS) is the most prevalent autoimmune disease affecting the central nervous system (CNS). Its pathophysiology is centered on neuron myelin sheath destruction in a manner largely dependent upon CD4+/CD8+ T-cell autoreactivity against myelin antigens, inducing Th1/Th17 pathogenic responses with the resulting production of free radicals and soluble mediators that exhibit the effector mechanisms of neurodegeneration. The immune response responsible for this disease is complex and challenges modern medicine. Consequently, many experimental therapies have been proposed in addition to the classical array of immunoregulatory/ immunosuppressive drugs that are normally used to treat MS. In this review, we will describe the effects and mechanisms of action of widely used disease-modifying MS drugs as well as those of select treatments that are currently in the experimental phase. Special emphasis is placed on helminth-derived immunoregulators, as some of them have shown promising results. Additionally, we will compare the mechanisms of action of both the MS drugs and the helminth-derived treatments to discuss the potential importance of some signaling pathways in the control of MS. PMID:26947777

  19. To gate, or not to gate: regulatory mechanisms for intercellular protein transport and virus movement in plants.

    PubMed

    Ueki, Shoko; Citovsky, Vitaly

    2011-09-01

    Cell-to-cell signal transduction is vital for orchestrating the whole-body physiology of multi-cellular organisms, and many endogenous macromolecules, proteins, and nucleic acids function as such transported signals. In plants, many of these molecules are transported through plasmodesmata (Pd), the cell wall-spanning channel structures that interconnect plant cells. Furthermore, Pd also act as conduits for cell-to-cell movement of most plant viruses that have evolved to pirate these channels to spread the infection. Pd transport is presumed to be highly selective, and only a limited repertoire of molecules is transported through these channels. Recent studies have begun to unravel mechanisms that actively regulate the opening of the Pd channel to allow traffic. This macromolecular transport between cells comprises two consecutive steps: intracellular targeting to Pd and translocation through the channel to the adjacent cell. Here, we review the current knowledge of molecular species that are transported though Pd and the mechanisms that control this traffic. Generally, Pd traffic can occur by passive diffusion through the trans-Pd cytoplasm or through the membrane/lumen of the trans-Pd ER, or by active transport that includes protein-protein interactions. It is this latter mode of Pd transport that is involved in intercellular traffic of most signal molecules and is regulated by distinct and sometimes interdependent mechanisms, which represent the focus of this article. PMID:21746703

  20. The Allosteric Regulatory Mechanism of the Escherichia coli MetNI Methionine ATP Binding Cassette (ABC) Transporter*

    PubMed Central

    Yang, Janet G.; Rees, Douglas C.

    2015-01-01

    The MetNI methionine importer of Escherichia coli, an ATP binding cassette (ABC) transporter, uses the energy of ATP binding and hydrolysis to catalyze the high affinity uptake of d- and l-methionine. Early in vivo studies showed that the uptake of external methionine is repressed by the level of the internal methionine pool, a phenomenon termed transinhibition. Our understanding of the MetNI mechanism has thus far been limited to a series of crystal structures in an inward-facing conformation. To understand the molecular mechanism of transinhibition, we studied the kinetics of ATP hydrolysis using detergent-solubilized MetNI. We find that transinhibition is due to noncompetitive inhibition by l-methionine, much like a negative feedback loop. Thermodynamic analyses revealed two allosteric methionine binding sites per transporter. This quantitative analysis of transinhibition, the first to our knowledge for a structurally defined transporter, builds upon the previously proposed structurally based model for regulation. This mechanism of regulation at the transporter activity level could be applicable to not only ABC transporters but other types of membrane transporters as well. PMID:25678706

  1. Acid-base Balance in Acute Gastrointestinal Bleeding*

    PubMed Central

    Northfield, T. C.; Kirby, B. J.; Tattersfield, Anne E.

    1971-01-01

    Acid-base balance has been studied in 21 patients with acute upper gastrointestinal bleeding. A low plasma bicarbonate concentration was found in nine patients, accompanied in each case by a base deficit of more than 3 mEq/litre, indicating a metabolic acidosis. Three patients had a low blood pH. Hyperlactataemia appeared to be a major cause of the acidosis. This was not accompanied by a raised blood pyruvate concentration. The hyperlactataemia could not be accounted for on the basis of hyperventilation, intravenous infusion of dextrose, or arterial hypoxaemia. Before blood transfusion it was most pronounced in patients who were clinically shocked, suggesting that it may have resulted from poor tissue perfusion and anaerobic glycolysis. Blood transfusion resulted in a rise in lactate concentration in seven patients who were not clinically shocked, and failed to reverse a severe uncompensated acidosis in a patient who was clinically shocked. These effects of blood transfusion are probably due to the fact that red blood cells in stored bank blood, with added acid-citrate-dextrose solution, metabolize the dextrose anaerobically to lactic acid. Monitoring of acid-base balance is recommended in patients with acute gastrointestinal bleeding who are clinically shocked. A metabolic acidosis can then be corrected with intravenous sodium bicarbonate. PMID:5313902

  2. Chemical rescue, multiple ionizable groups, and general acid-base catalysis in the HDV genomic ribozyme.

    PubMed

    Perrotta, Anne T; Wadkins, Timothy S; Been, Michael D

    2006-07-01

    In the ribozyme from the hepatitis delta virus (HDV) genomic strand RNA, a cytosine side chain is proposed to facilitate proton transfer in the transition state of the reaction and, thus, act as a general acid-base catalyst. Mutation of this active-site cytosine (C75) reduced RNA cleavage rates by as much as one million-fold, but addition of exogenous cytosine and certain nucleobase or imidazole analogs can partially rescue activity in these mutants. However, pH-rate profiles for the rescued reactions were bell shaped, and only one leg of the pH-rate curve could be attributed to ionization of the exogenous nucleobase or buffer. When a second potential ionizable nucleobase (C41) was removed, one leg of the bell-shaped curve was eliminated in the chemical-rescue reaction. With this construct, the apparent pK(a) determined from the pH-rate profile correlated with the solution pK(a) of the buffer, and the contribution of the buffer to the rate enhancement could be directly evaluated in a free-energy or Brønsted plot. The free-energy relationship between the acid dissociation constant of the buffer and the rate constant for cleavage (Brønsted value, beta, = approximately 0.5) was consistent with a mechanism in which the buffer acted as a general acid-base catalyst. These data support the hypothesis that cytosine 75, in the intact ribozyme, acts as a general acid-base catalyst. PMID:16690998

  3. [Practical approach to complex acid-base disorders using a slide rule].

    PubMed

    Rives, E; Grimaud, D

    1986-01-01

    Diagnosis of mixed acid-base disturbances is often difficult. Nowadays it depends on biochemical and statistical interpretation, coupled with clinical data. The acid-base slide-rule is a useful tool to carry out this five step procedure, which it simplifies, giving rapidly at the patient's bed-side an objective support for the diagnosis of acid-base disturbances. PMID:3777572

  4. 78 FR 36698 - Microbiology Devices; Reclassification of Nucleic Acid-Based Systems for Mycobacterium tuberculosis

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-19

    ... Nucleic Acid-Based Systems for Mycobacterium tuberculosis Complex in Respiratory Specimens AGENCY: Food...) is proposing to reclassify nucleic acid-based in vitro diagnostic devices for the detection of... Controls Guideline: Nucleic Acid-Based In Vitro Diagnostic Devices for the Detection of...

  5. Mechanism of Regulatory Effect of MicroRNA-206 on Connexin 43 in Distant Metastasis of Breast Cancer

    PubMed Central

    Lin, Zi-Jing; Ming, Jia; Yang, Lu; Du, Jun-Ze; Wang, Ning; Luo, Hao-Jun

    2016-01-01

    Background: MicroRNA-206 (miR-206) and connexin 43 (Cx43) are related with the distant metastasis of breast cancer. It remains unclear whether the regulatory effect of miR-206 on Cx43 is involved in metastasis of breast cancer. Methods: Using quantitative real-time polymerase chain reaction and Western blot, the expressions of miR-206 and Cx43 were determined in breast cancer tissues, hepatic and pulmonary metastasis (PM), and cell lines (MCF-10A, MCF-7, and MDA-MB-231). MCF-7/MDA-M-231 cells were transfected with lentivirus-shRNA vectors to enhance/inhibit miR-206, and then Cx43 expression was observed. Cell counting kit-8 assay and Transwell method were used to detect their changes in proliferation, migration, and invasion activity. The mutant plasmids of Cx43-3’ untranslated region (3’UTR) at position 478–484 and position 1609–1615 were constructed. Luciferase reporter assay was performed to observe the effects of miR-206 on luciferase expression of different mutant plasmids and to confirm the potential binding sites of Cx43. Results: Cx43 protein expression in hepatic and PM was significantly higher than that in the primary tumor, while no significant difference was showed in messenger RNA (mRNA) expression. MiR-206 mRNA expression in hepatic and PM was significantly lower than that in the primary tumor. Cx43 mRNA and protein levels, as well as cell proliferation, migration, and invasion capabilities, were all significantly improved in MDA-MB-231 cells after reducing miR-206 expression but decreased in MCF-7 cells after elevating miR-206 expression, which demonstrated a significantly negative correlation between miR-206 and Cx43 expression (P = 0.03). MiR-206 can drastically decrease Cx43 expression of MCF-7 cells but exerts no effects on Cx43 expression in 293 cells transfected with the Cx43 coding region but the lack of Cx43-3’UTR, suggesting that Cx43-3’UTR may be the key in Cx43 regulated by miR-206. Luciferase expression showed that the

  6. Transcriptomes reveal the genetic mechanisms underlying ionic regulatory adaptations to salt in the crab-eating frog

    PubMed Central

    Shao, Yong; Wang, Li-Jun; Zhong, Li; Hong, Mei-Ling; Chen, Hong-Man; Murphy, Robert W.; Wu, Dong-Dong; Zhang, Ya-Ping; Che, Jing

    2015-01-01

    The crab-eating frog, Fejervarya cancrivora, is the only frog that lives near seas. It tolerates increased environmental concentrations of sodium, chloride and potassium partly by raising ion and urea levels in its blood plasma. The molecular mechanism of the adaptation remains rarely documented. Herein, we analyze transcriptomes of the crab-eating frog and its closely related saline-intolerant species, F. limnocharis, to explore the molecular basis of adaptations to such extreme environmental conditions. Analyses reveal the potential genetic mechanism underlying the adaptation to salinity for the crab-eating frog. Genes in categories associated with ion transport appear to have evolved rapidly in F. cancrivora. Both positively selected and differentially expressed genes exhibit enrichment in the GO category regulation of renal sodium excretion. In this category, the positively selected sites of ANPEP and AVPR2 encode CD13 and V2 receptors, respectively; they fall precisely on conserved domains. More differentially expressed rapidly evolved genes occur in the kidney of F. cancrivora than in F. limnocharis. Four genes involved in the regulation of body fluid levels show signs of positive selection and increased expression. Significant up-regulation occurs in several genes of F. cancrivora associated with renin-angiotensin system and aldosterone-regulated sodium reabsorption pathways, which relate to osmotic regulation. PMID:26619819

  7. Transcriptomes reveal the genetic mechanisms underlying ionic regulatory adaptations to salt in the crab-eating frog.

    PubMed

    Shao, Yong; Wang, Li-Jun; Zhong, Li; Hong, Mei-Ling; Chen, Hong-Man; Murphy, Robert W; Wu, Dong-Dong; Zhang, Ya-Ping; Che, Jing

    2015-01-01

    The crab-eating frog, Fejervarya cancrivora, is the only frog that lives near seas. It tolerates increased environmental concentrations of sodium, chloride and potassium partly by raising ion and urea levels in its blood plasma. The molecular mechanism of the adaptation remains rarely documented. Herein, we analyze transcriptomes of the crab-eating frog and its closely related saline-intolerant species, F. limnocharis, to explore the molecular basis of adaptations to such extreme environmental conditions. Analyses reveal the potential genetic mechanism underlying the adaptation to salinity for the crab-eating frog. Genes in categories associated with ion transport appear to have evolved rapidly in F. cancrivora. Both positively selected and differentially expressed genes exhibit enrichment in the GO category regulation of renal sodium excretion. In this category, the positively selected sites of ANPEP and AVPR2 encode CD13 and V2 receptors, respectively; they fall precisely on conserved domains. More differentially expressed rapidly evolved genes occur in the kidney of F. cancrivora than in F. limnocharis. Four genes involved in the regulation of body fluid levels show signs of positive selection and increased expression. Significant up-regulation occurs in several genes of F. cancrivora associated with renin-angiotensin system and aldosterone-regulated sodium reabsorption pathways, which relate to osmotic regulation. PMID:26619819

  8. Subchromoplast Sequestration of Carotenoids Affects Regulatory Mechanisms in Tomato Lines Expressing Different Carotenoid Gene Combinations[C][W

    PubMed Central

    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M.A.; Bramley, Peter M.; Fraser, Paul D.

    2013-01-01

    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed. PMID:24249831

  9. The Hog1 SAPK controls the Rtg1/Rtg3 transcriptional complex activity by multiple regulatory mechanisms

    PubMed Central

    Ruiz-Roig, Clàudia; Noriega, Núria; Duch, Alba; Posas, Francesc; de Nadal, Eulàlia

    2012-01-01

    Cells modulate expression of nuclear genes in response to alterations in mitochondrial function, a response termed retrograde (RTG) regulation. In budding yeast, the RTG pathway relies on Rtg1 and Rtg3 basic helix-loop-helix leucine Zipper transcription factors. Exposure of yeast to external hyperosmolarity activates the Hog1 stress-activated protein kinase (SAPK), which is a key player in the regulation of gene expression upon stress. Several transcription factors, including Sko1, Hot1, the redundant Msn2 and Msn4, and Smp1, have been shown to be directly controlled by the Hog1 SAPK. The mechanisms by which Hog1 regulates their activity differ from one to another. In this paper, we show that Rtg1 and Rtg3 transcription factors are new targets of the Hog1 SAPK. In response to osmostress, RTG-dependent genes are induced in a Hog1-dependent manner, and Hog1 is required for Rtg1/3 complex nuclear accumulation. In addition, Hog1 activity regulates Rtg1/3 binding to chromatin and transcriptional activity. Therefore Hog1 modulates Rtg1/3 complex activity by multiple mechanisms in response to stress. Overall our data suggest that Hog1, through activation of the RTG pathway, contributes to ensure mitochondrial function as part of the Hog1-mediated osmoadaptive response. PMID:22956768

  10. GTP cyclohydrolase I inhibition by the prototypic inhibitor 2, 4-diamino-6-hydroxypyrimidine. Mechanisms and unanticipated role of GTP cyclohydrolase I feedback regulatory protein.

    PubMed

    Xie, L; Smith, J A; Gross, S S

    1998-08-14

    2,4-Diamino-6-hydroxypyrimidine (DAHP) is considered to be a selective and direct-acting inhibitor of GTP cyclohydrolase I (GTPCH), the first and rate-limiting enzyme in the pathway for synthesis of tetrahydrobiopterin (BH4). Accordingly, DAHP has been widely employed to distinguish whether de novo BH4 synthesis is required in a given biological system. Although it has been assumed that DAHP inhibits GTPCH by direct competition with substrate GTP, this has never been formally demonstrated. In view of apparent structural homology between DAHP and BH4, we questioned whether DAHP may mimic BH4 in its inhibition of GTPCH by an indirect mechanism, involving interaction with a recently cloned 9.5-kDa protein termed GTPCH Feedback Regulatory Protein (GFRP). We show by reverse transcription-polymerase chain reaction that GFRP mRNA is constitutively expressed in rat aortic smooth muscle cells and further induced by treatment with immunostimulants. Moreover, functional GFRP is expressed and immunostimulant-induced BH4 accumulates in sufficient quantity to trigger feedback inhibition of GTPCH. Studies with DAHP reveal that GFRP is also essential to achieve potent inhibition of GTPCH. Indeed, DAHP inhibits GTPCH by dual mechanisms. At a relatively low concentration, DAHP emulates BH4 and engages the GFRP-dependent feedback inhibitory system; at higher concentrations, DAHP competes directly for binding with GTP substrate. This knowledge predicts that DAHP would preferably target GTPCH in tissues with abundant GFRP. PMID:9694862

  11. Control of the Inflammatory Response Mechanisms Mediated by Natural and Induced Regulatory T-Cells in HCV-, HTLV-1-, and EBV-Associated Cancers

    PubMed Central

    Moralès, Olivier; Delhem, Nadira

    2014-01-01

    Virus infections are involved in chronic inflammation and, in some cases, cancer development. Although a viral infection activates the immune system's response that eradicates the pathogen mainly through inflammatory mechanisms, it is now recognized that this inflammatory condition is also favorable to the development of tumors. Indeed, it is well described that viruses, such as hepatitis C virus (HCV), Epstein Barr virus (EBV), human papillomavirus (HPV) or human T-cell lymphotropic virus type-1 (HTLV-1), are important risk factors for tumor malignancies. The inflammatory response is a fundamental immune mechanism which involves several molecular and cellular components consisting of cytokines and chemokines that are released by various proinflammatory cells. In parallel to this process, some endogenous recruited components release anti-inflammatory mediators to restore homeostasis. The development of tools and strategies using viruses to hijack the immune response is mostly linked to the presence of regulatory T-cells (Treg) that can inhibit inflammation and antiviral responses of other effector cells. In this review, we will focus on current understanding of the role of natural and induced Treg in the control and the resolution of inflammatory response in HCV-, HTLV-1-, and EBV-associated cancers. PMID:25525301

  12. General acid-base catalysis mediated by nucleobases in the hairpin ribozyme

    PubMed Central

    Kath-Schorr, Stephanie; Wilson, Timothy J.; Li, Nan-Sheng; Lu, Jun; Piccirilli, Joseph A.; Lilley, David M. J.

    2012-01-01

    The catalytic mechanism by which the hairpin ribozyme accelerates cleavage or ligation of the phosphodiester backbone of RNA has been incompletely understood. There is experimental evidence for an important role for an adenine (A38) and a guanine (G8), and it has been proposed that these act in general acid-base catalysis. In this work we show that a large reduction in cleavage rate on substitution of A38 by purine (A38P) can be reversed by replacement of the 5′-oxygen atom at the scissile phosphate by sulfur (5′-PS), which is a much better leaving group. This is consistent with A38 acting as the general acid in the unmodified ribozyme. The rate of cleavage of the 5′-PS substrate by the A38P ribozyme increases with pH log-linearly, indicative of a requirement for a deprotonated base with a relatively high pKa. On substitution of G8 by diaminopurine, the 5′-PS substrate cleavage rate at first increases with pH and then remains at a plateau, exhibiting an apparent pKa consistent with this nucleotide acting in general base catalysis. Alternative explanations for the pH dependence of hairpin ribozyme reactivity are discussed, from which we conclude that general acid-base catalysis by A38 and G8 is the simplest and most probable explanation consistent with all the experimental data. PMID:22958171

  13. Angiotensin II modulates respiratory and acid-base responses to prolonged hypoxia in conscious dogs.

    PubMed

    Heitman, S J; Jennings, D B

    1998-08-01

    We tested the hypothesis that angiotensin II (ANG II) contributes to ventilatory and acid-base adaptations during 3-4 h of hypoxia (partial pressure of O2 in arterial blood approximately 43 Torr) in the conscious dog. Three protocols were carried out over 3-4 h in five dogs: 1) air control, 2) 12% O2 breathing, and 3) 12% O2 breathing with ANG II receptors blocked by infusion of saralasin (0. 5 microg . kg-1 . min-1). After 2 h of hypoxia, expired ventilation and alveolar ventilation progressively increased, and the partial pressure of CO2 in arterial blood and the difference between the arterial concentrations of strong cations and strong anions ([SID]) decreased. When the hypoxic chemoreceptor drive to breathe was abolished transiently for 30 s with 100% O2, the resultant central apneic time decreased between 0.5 and 2.5 h of hypoxia. All these adaptive responses to hypoxia were abolished by ANG II receptor block. Because plasma ANG II levels were lower during hypoxia and hypoxic release of arginine vasopressin from the pituitary into the plasma was prevented by ANG II receptor block, the brain renin-angiotensin system was likely involved. It is possible that ANG II mediates ventilatory and acid-base adaptive responses to prolonged hypoxia via alterations in ion transport to decrease [SID] in brain extracellular fluid rather than acting by a direct neural mechanism. PMID:9688673

  14. A Prebiotic Chemistry Experiment on the Adsorption of Nucleic Acids Bases onto a Natural Zeolite

    NASA Astrophysics Data System (ADS)

    Anizelli, Pedro R.; Baú, João Paulo T.; Gomes, Frederico P.; da Costa, Antonio Carlos S.; Carneiro, Cristine E. A.; Zaia, Cássia Thaïs B. V.; Zaia, Dimas A. M.

    2015-09-01

    There are currently few mechanisms that can explain how nucleic acid bases were synthesized, concentrated from dilute solutions, and/or protected against degradation by UV radiation or hydrolysis on the prebiotic Earth. A natural zeolite exhibited the potential to adsorb adenine, cytosine, thymine, and uracil over a range of pH, with greater adsorption of adenine and cytosine at acidic pH. Adsorption of all nucleic acid bases was decreased in artificial seawater compared to water, likely due to cation complexation. Furthermore, adsorption of adenine appeared to protect natural zeolite from thermal degradation. The C=O groups from thymine, cytosine and uracil appeared to assist the dissolution of the mineral while the NH2 group from adenine had no effect. As shown by FT-IR spectroscopy, adenine interacted with a natural zeolite through the NH2 group, and cytosine through the C=O group. A pseudo-second-order model best described the kinetics of adenine adsorption, which occurred faster in artificial seawaters.

  15. A Prebiotic Chemistry Experiment on the Adsorption of Nucleic Acids Bases onto a Natural Zeolite.

    PubMed

    Anizelli, Pedro R; Baú, João Paulo T; Gomes, Frederico P; da Costa, Antonio Carlos S; Carneiro, Cristine E A; Zaia, Cássia Thaïs B V; Zaia, Dimas A M

    2015-09-01

    There are currently few mechanisms that can explain how nucleic acid bases were synthesized, concentrated from dilute solutions, and/or protected against degradation by UV radiation or hydrolysis on the prebiotic Earth. A natural zeolite exhibited the potential to adsorb adenine, cytosine, thymine, and uracil over a range of pH, with greater adsorption of adenine and cytosine at acidic pH. Adsorption of all nucleic acid bases was decreased in artificial seawater compared to water, likely due to cation complexation. Furthermore, adsorption of adenine appeared to protect natural zeolite from thermal degradation. The C=O groups from thymine, cytosine and uracil appeared to assist the dissolution of the mineral while the NH2 group from adenine had no effect. As shown by FT-IR spectroscopy, adenine interacted with a natural zeolite through the NH2 group, and cytosine through the C=O group. A pseudo-second-order model best described the kinetics of adenine adsorption, which occurred faster in artificial seawaters. PMID:25754589

  16. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences.

    PubMed

    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M; Puisieux, Alain; Payen, Léa

    2016-06-20

    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

  17. Comparative transcriptome and metabolome provides new insights into the regulatory mechanisms of accelerated senescence in litchi fruit after cold storage.

    PubMed

    Yun, Ze; Qu, Hongxia; Wang, Hui; Zhu, Feng; Zhang, Zhengke; Duan, Xuewu; Yang, Bao; Cheng, Yunjiang; Jiang, Yueming

    2016-01-01

    Litchi is a non-climacteric subtropical fruit of high commercial value. The shelf life of litchi fruit under ambient conditions (AC) is approximately 4-6 days. Post-harvest cold storage prolongs the life of litchi fruit for up to 30 days with few changes in pericarp browning and total soluble solids. However, the shelf life of litchi fruits at ambient temperatures after pre-cold storage (PCS) is only 1-2 days. To better understand the mechanisms involved in the rapid fruit senescence induced by pre-cold storage, a transcriptome of litchi pericarp was constructed to assemble the reference genes, followed by comparative transcriptomic and metabolomic analyses. Results suggested that the senescence of harvested litchi fruit was likely to be an oxidative process initiated by ABA, including oxidation of lipids, polyphenols and anthocyanins. After cold storage, PCS fruit exhibited energy deficiency, and respiratory burst was elicited through aerobic and anaerobic respiration, which was regulated specifically by an up-regulated calcium signal, G-protein-coupled receptor signalling pathway and small GTPase-mediated signal transduction. The respiratory burst was largely associated with increased production of reactive oxygen species, up-regulated peroxidase activity and initiation of the lipoxygenase pathway, which were closely related to the accelerated senescence of PCS fruit. PMID:26763309

  18. Comparative transcriptomic analysis reveals novel genes and regulatory mechanisms of Tetragenococcus halophilus in response to salt stress.

    PubMed

    Liu, Licui; Si, Lifang; Meng, Xin; Luo, Lixin

    2015-04-01

    Tetragenococcus halophilus, a moderately halophilic Gram-positive bacterium, was isolated from Chinese style soy sauce. This species is a valuable resource for investigating salt tolerance mechanisms and improving salinity resistance in microorganisms. RNA-seq was used to sequence T. halophilus samples treated with 0 M (T1), 1 M (T2), and 3.5 M NaCl (T3). Comparative transcriptomic analyses of the different treatments were performed using gene ontology and Kyoto encyclopedia of genes and genome. The comparison of T1 and T2 by RNA-seq revealed that genes involved in transcription, translation, membrane system, and division were highly up-regulated under optimum salt condition. The comparison of T2 and T3 showed that genes related to heat shock proteins or the ATP-binding cassette transport systems were significantly up-regulated under maximum-salt condition. In addition, a considerable proportion of the significantly differently expressed genes identified in this study are novel. These data provide a crucial resource that may determine specific responses to salt stress in T. halophilus. PMID:25563971

  19. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences

    PubMed Central

    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M.; Puisieux, Alain; Payen, Léa

    2016-01-01

    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

  20. Comparative transcriptome and metabolome provides new insights into the regulatory mechanisms of accelerated senescence in litchi fruit after cold storage

    PubMed Central

    Yun, Ze; Qu, Hongxia; Wang, Hui; Zhu, Feng; Zhang, Zhengke; Duan, Xuewu; Yang, Bao; Cheng, Yunjiang; Jiang, Yueming

    2016-01-01

    Litchi is a non-climacteric subtropical fruit of high commercial value. The shelf life of litchi fruit under ambient conditions (AC) is approximately 4–6 days. Post-harvest cold storage prolongs the life of litchi fruit for up to 30 days with few changes in pericarp browning and total soluble solids. However, the shelf life of litchi fruits at ambient temperatures after pre-cold storage (PCS) is only 1–2 days. To better understand the mechanisms involved in the rapid fruit senescence induced by pre-cold storage, a transcriptome of litchi pericarp was constructed to assemble the reference genes, followed by comparative transcriptomic and metabolomic analyses. Results suggested that the senescence of harvested litchi fruit was likely to be an oxidative process initiated by ABA, including oxidation of lipids, polyphenols and anthocyanins. After cold storage, PCS fruit exhibited energy deficiency, and respiratory burst was elicited through aerobic and anaerobic respiration, which was regulated specifically by an up-regulated calcium signal, G-protein-coupled receptor signalling pathway and small GTPase-mediated signal transduction. The respiratory burst was largely associated with increased production of reactive oxygen species, up-regulated peroxidase activity and initiation of the lipoxygenase pathway, which were closely related to the accelerated senescence of PCS fruit. PMID:26763309

  1. Studies on the regulatory effect of Peony-Glycyrrhiza Decoction on prolactin hyperactivity and underlying mechanism in hyperprolactinemia rat model.

    PubMed

    Wang, Di; Wang, Wei; Zhou, Yulin; Wang, Juan; Jia, Dongxu; Wong, Hei Kiu; Zhang, Zhang-Jin

    2015-10-01

    Clinical trials have demonstrated the beneficial effects of Peony-Glycyrrhiza Decoction (PGD) in alleviating antipsychotic-induced hyperprolactinemia (hyperPRL) in schizophrenic patients. In previous experiment, PGD suppressed prolactin (PRL) level in MMQ cells, involving modulating the expression of D2 receptor (DRD2) and dopamine transporter (DAT). In the present study, hyperPRL female rat model induced by dopamine blocker metoclopramide (MCP) was applied to further confirm the anti-hyperpPRL activity of PGD and underlying mechanism. In MCP-induced hyperPRL rats, the elevated serum PRL level was significantly suppressed by either PGD (2.5-10 g/kg) or bromocriptine (BMT) (0.6 mg/kg) administration for 14 days. However, in MCP-induced rats, only PGD restored the under-expressed serum progesterone (P) to control level. Both PGD and BMT administration restore the under-expression of DRD2, DAT and TH resulted from MCP in pituitary gland and hypothalamus. Compared to untreated group, hyperPRL animals had a marked reduction on DRD2 and DAT expression in the arcuate nucleus. PGD (10 g/kg) and BMT (0.6 mg/kg) treatment significant reversed the expression of DRD2 and DAT. Collectively, the anti-hyperPRL activity of PGD associates with the modulation of dopaminergic neuronal system and the restoration of serum progesterone level. Our finding supports PGD as an effective agent against hyperPRL. PMID:26297122

  2. Nek2A phosphorylates and stabilizes SuFu: A new strategy of Gli2/Hedgehog signaling regulatory mechanism.

    PubMed

    Wang, Yao; Li, Yong; Hu, Guanghui; Huang, Xuan; Rao, Hai; Xiong, Xiangyang; Luo, Zhijun; Lu, Quqin; Luo, Shiwen

    2016-09-01

    Suppressor of Fused (SuFu) plays a conservative role in the regulation of the Gli transcription factors within the Hedgehog (Hh) signaling pathway. Despite the central importance of SuFu in the Hh pathway, little is known about its regulation. Here, we performed a GAL4-based yeast two-hybrid screen using human SuFu as bait, and identified NIMA-related expressed kinase 2A (Nek2A) as a new SuFu-interacting protein, which was also confirmed by glutathione-S-transferase pull-down and co-immunoprecipitation assays. Intriguingly, Nek2A is found to stabilize SuFu at least partly depending on its kinase activity, thereby triggering phosphorylation of the SuFu protein. Moreover, the phosphorylated SuFu inhibits the nuclear localization and transcriptional activity of Gli2/Hh signaling. These findings reveal a new mechanism of mammalian SuFu regulation, and offers novel insights into Hh signaling regulation in development and human disease. PMID:27297360

  3. Nucleic acid-based tissue biomarkers of urologic malignancies.

    PubMed

    Dietrich, Dimo; Meller, Sebastian; Uhl, Barbara; Ralla, Bernhard; Stephan, Carsten; Jung, Klaus; Ellinger, Jörg; Kristiansen, Glen

    2014-08-01

    Molecular biomarkers play an important role in the clinical management of cancer patients. Biomarkers allow estimation of the risk of developing cancer; help to diagnose a tumor, ideally at an early stage when cure is still possible; and aid in monitoring disease progression. Furthermore, they hold the potential to predict the outcome of the disease (prognostic biomarkers) and the response to therapy (predictive biomarkers). Altogether, biomarkers will help to avoid tumor-related deaths and reduce overtreatment, and will contribute to increased survival and quality of life in cancer patients due to personalized treatments. It is well established that the process of carcinogenesis is a complex interplay between genomic predisposition, acquired somatic mutations, epigenetic changes and genomic aberrations. Within this complex interplay, nucleic acids, i.e. RNA and DNA, play a fundamental role and therefore represent ideal candidates for biomarkers. They are particularly promising candidates because sequence-specific hybridization and amplification technologies allow highly accurate and sensitive assessment of these biomarker levels over a broad dynamic range. This article provides an overview of nucleic acid-based biomarkers in tissues for the management of urologic malignancies, i.e. tumors of the prostate, testis, kidney, penis, urinary bladder, renal pelvis, ureter and other urinary organs. Special emphasis is put on genomic, transcriptomic and epigenomic biomarkers (SNPs, mutations [genomic and mitochondrial], microsatellite instabilities, viral and bacterial DNA, DNA methylation and hydroxymethylation, mRNA expression, and non-coding RNAs [lncRNA, miRNA, siRNA, piRNA, snRNA, snoRNA]). Due to the multitude of published biomarker candidates, special focus is given to the general applicability of different molecular classes as biomarkers and some particularly promising nucleic acid biomarkers. Furthermore, specific challenges regarding the development and clinical

  4. Identification of a Novel Regulatory Mechanism of Nutrient Transport Controlled by TORC1-Npr1-Amu1/Par32.

    PubMed

    Boeckstaens, Mélanie; Merhi, Ahmad; Llinares, Elisa; Van Vooren, Pascale; Springael, Jean-Yves; Wintjens, René; Marini, Anna Maria

    2015-07-01

    Fine-tuning the plasma-membrane permeability to essential nutrients is fundamental to cell growth optimization. Nutritional signals including nitrogen availability are integrated by the TORC1 complex which notably regulates arrestin-mediated endocytosis of amino-acid transporters. Ammonium is a ubiquitous compound playing key physiological roles in many, if not all, organisms. In yeast, it is a preferred nitrogen source transported by three Mep proteins which are orthologues of the mammalian Rhesus factors. By combining genetic, kinetic, biochemical and cell microscopy analyses, the current study reveals a novel mechanism enabling TORC1 to regulate the inherent activity of ammonium transport proteins, independently of arrestin-mediated endocytosis, identifying the still functional orphan Amu1/Par32 as a selective regulator intermediate. We show that, under poor nitrogen supply, the TORC1 effector kinase' Npr1' promotes phosphorylation of Amu1/Par32 which appears mainly cytosolic while ammonium transport proteins are active. Upon preferred nitrogen supplementation, like glutamine or ammonium addition, TORC1 upregulation enables Npr1 inhibition and Amu1/Par32 dephosphorylation. In these conditions, as in Npr1-lacking cells, hypophosphorylated Amu1/Par32 accumulates at the cell surface and mediates the inhibition of specific ammonium transport proteins. We show that the integrity of a conserved repeated motif of Amu1/Par32 is required for the interaction with these transport proteins. This study underscores the diversity of strategies enabling TORC1-Npr1 to selectively monitor cell permeability to nutrients by discriminating between transporters to be degraded or transiently inactivated and kept stable at the plasma membrane. This study further identifies the function of Amu1/Par32 in acute control of ammonium transport in response to variations in nitrogen availability. PMID:26172854

  5. S-nitrosation of β-catenin and p120 catenin: a novel regulatory mechanism in endothelial hyperpermeability

    PubMed Central

    Marín, N.; Zamorano, P.; Carrasco, R.; Mujica, P.; González, FG.; Quezada, C.; Meininger, CJ.; Boric, MP.; Durán, WN.; Sánchez, FA.

    2014-01-01

    Rationale Endothelial adherens junction proteins constitute an important element in the control of microvascular permeability. Platelet-activating factor (PAF) increases permeability to macromolecules via translocation of eNOS to cytosol and stimulation of eNOS-derived NO signaling cascade. The mechanisms by which NO signaling regulates permeability at adherens junctions are still incompletely understood. Objective We explored the hypothesis that PAF stimulates hyperpermeability via S-nitrosation (SNO) of adherens junction proteins. Methods and Results We measured PAF-stimulated S-nitrosation of β-catenin and p120-catenin (p120) in three cell lines: ECV-eNOSGFP, EAhy926 (derived from human umbilical vein) and CVEC (derived from bovine heart endothelium) and in the mouse cremaster muscle in vivo. SNO correlated with diminished abundance of β-catenin and p120 at the adherens junction and with hyperpermeability. TNF-α increased NO production and caused similar increase in S-nitrosation as PAF. To ascertain the importance of eNOS subcellular location in this process, we used ECV-304 cells transfected with cytosolic eNOS (GFPeNOSG2A) and plasma membrane eNOS (GFPeNOSCAAX). PAF induced S-nitrosation of β-catenin and p120 and significantly diminished association between these proteins in cells with cytosolic eNOS but not in cells wherein eNOS is anchored to the cell membrane. Inhibitors of NO production and of S-nitrosation blocked PAF-induced S-nitrosation and hyperpermeability whereas inhibition of the cGMP pathway had no effect. Mass spectrometry analysis of purified p120 identified cysteine 579 as the main S-nitrosated residue in the region that putatively interacts with VE-cadherin. Conclusions Our results demonstrate that agonist-induced SNO contributes to junctional membrane protein changes that enhance endothelial permeability. PMID:22777005

  6. Lycopene treatment against loss of bone mass, microarchitecture and strength in relation to regulatory mechanisms in a postmenopausal osteoporosis model.

    PubMed

    Ardawi, Mohammed-Salleh M; Badawoud, Mohammed H; Hassan, Sherif M; Rouzi, Abdulrahim A; Ardawi, Jumanah M S; AlNosani, Nouf M; Qari, Mohammed H; Mousa, Shaker A

    2016-02-01

    Lycopene supplementation decreases oxidative stress and exhibits beneficial effects on bone health, but the mechanisms through which it alters bone metabolism in vivo remain unclear. The present study aims to evaluate the effects of lycopene treatment on postmenopausal osteoporosis. Six-month-old female Wistar rats (n=264) were sham-operated (SHAM) or ovariectomized (OVX). The SHAM group received oral vehicle only and the OVX rats were randomized into five groups receiving oral daily lycopene treatment (mg/kg body weight per day): 0 OVX (control), 15 OVX, 30 OVX, and 45 OVX, and one group receiving alendronate (ALN) (2μg/kg body weight per day), for 12weeks. Bone densitometry measurements, bone turnover markers, biomechanical testing, and histomorphometric analysis were conducted. Micro computed tomography was also used to evaluate changes in microarchitecture. Lycopene treatment suppressed the OVX-induced increase in bone turnover, as indicated by changes in biomarkers of bone metabolism: serum osteocalcin (s-OC), serum N-terminal propeptide of type 1 collagen (s-PINP), serum crosslinked carboxyterminal telopeptides (s-CTX-1), and urinary deoxypyridinoline (u-DPD). Significant improvement in OVX-induced loss of bone mass, bone strength, and microarchitectural deterioration was observed in lycopene-treated OVX animals. These effects were observed mainly at sites rich in trabecular bone, with less effect in cortical bone. Lycopene treatment down-regulated osteoclast differentiation concurrent with up-regulating osteoblast together with glutathione peroxidase (GPx) catalase (CAT) and superoxide dismutase (SOD) activities. These findings demonstrate that lycopene treatment in OVX rats primarily suppressed bone turnover to restore bone strength and microarchitecture. PMID:26549245

  7. Study on the molecular regulatory mechanism of MicroRNA-195 in the invasion and metastasis of colorectal carcinoma

    PubMed Central

    Yang, Bin; Tan, Zhigang; Song, Yan

    2015-01-01

    Objective: This study aims to identify the target gene of hsa-miR-195 and to research the molecular mechanism of hsa-miR-195 which is through its target genes in the colorectal cancer invasion and metastasis. Methods: We used biological informatics (RNAhybrid and Target Scan analysis database) to predict the target genes of hsa-miR-195. Collected colon cancer tissues from clinical colorectal cancer patients by surgical removal of the carcinoma and control tissues, and researched the expression of Bcl-2 in tissues by immunohistochemical. Next, Real-time PCR was used to research the expression of hsa-miR-195 in Caco-2 and NCM460 cell line. hsa -miR-195 Mimics was transient transfered to Caco-2 cells, western blot was used to analysis the expression changes of Bcl-2. To analysis the possibility that hsa-miR-195 can affect the invasive ability of tumor cells by Bcl-2, we transferred hsa-miR-195 Mimics and Bcl-2 expression plasmid, and used the cell invasion experiment to discusses hsa-miR-195 effect on the ability of tumor cell invasion. Results: the immunohistochemical results showed that, the semi-quantitative parameters for the Bcl-2: control by 0.89 ± 0.51, 6 colon cancer by 31 ± 0.79. The expression of has-miR-195 in Caco-2 is 0.39 ± 1.5 while the value in control is2.01 ± 0.2, **P < 0.01. Conclusion: In colorectal cancer, has-miR-195 can promote cell apoptosis and inhibit the invasion and metastasis by inhibiting the expression of Bcl-2. PMID:26064276

  8. Identification of a Novel Regulatory Mechanism of Nutrient Transport Controlled by TORC1-Npr1-Amu1/Par32

    PubMed Central

    Boeckstaens, Mélanie; Merhi, Ahmad; Llinares, Elisa; Van Vooren, Pascale; Springael, Jean-Yves; Wintjens, René; Marini, Anna Maria

    2015-01-01

    Fine-tuning the plasma-membrane permeability to essential nutrients is fundamental to cell growth optimization. Nutritional signals including nitrogen availability are integrated by the TORC1 complex which notably regulates arrestin-mediated endocytosis of amino-acid transporters. Ammonium is a ubiquitous compound playing key physiological roles in many, if not all, organisms. In yeast, it is a preferred nitrogen source transported by three Mep proteins which are orthologues of the mammalian Rhesus factors. By combining genetic, kinetic, biochemical and cell microscopy analyses, the current study reveals a novel mechanism enabling TORC1 to regulate the inherent activity of ammonium transport proteins, independently of arrestin-mediated endocytosis, identifying the still functional orphan Amu1/Par32 as a selective regulator intermediate. We show that, under poor nitrogen supply, the TORC1 effector kinase' Npr1' promotes phosphorylation of Amu1/Par32 which appears mainly cytosolic while ammonium transport proteins are active. Upon preferred nitrogen supplementation, like glutamine or ammonium addition, TORC1 upregulation enables Npr1 inhibition and Amu1/Par32 dephosphorylation. In these conditions, as in Npr1-lacking cells, hypophosphorylated Amu1/Par32 accumulates at the cell surface and mediates the inhibition of specific ammonium transport proteins. We show that the integrity of a conserved repeated motif of Amu1/Par32 is required for the interaction with these transport proteins. This study underscores the diversity of strategies enabling TORC1-Npr1 to selectively monitor cell permeability to nutrients by discriminating between transporters to be degraded or transiently inactivated and kept stable at the plasma membrane. This study further identifies the function of Amu1/Par32 in acute control of ammonium transport in response to variations in nitrogen availability. PMID:26172854

  9. Network-based integration of molecular and physiological data elucidates regulatory mechanisms underlying adaptation to high-fat diet.

    PubMed

    Derous, Davina; Kelder, Thomas; van Schothorst, Evert M; van Erk, Marjan; Voigt, Anja; Klaus, Susanne; Keijer, Jaap; Radonjic, Marijana

    2015-07-01

    Health is influenced by interplay of molecular, physiological and environmental factors. To effectively maintain health and prevent disease, health-relevant relations need to be understood at multiple levels of biological complexity. Network-based methods provide a powerful platform for integration and mining of data and knowledge characterizing different aspects of health. Previously, we have reported physiological and gene expression changes associated with adaptation of murine epididymal white adipose tissue (eWAT) to 5 days and 12 weeks of high-fat diet (HFD) and low-fat diet feeding (Voigt et al. in Mol Nutr Food Res 57:1423-1434, 2013. doi: 10.1002/mnfr.201200671 ). In the current study, we apply network analysis on this dataset to comprehensively characterize mechanisms driving the short- and long-term adaptation of eWAT to HFD across multiple levels of complexity. We built a three-layered interaction network comprising enriched biological processes, their transcriptional regulators and associated changes in physiological parameters. The multi-layered network model reveals that early eWAT adaptation to HFD feeding involves major changes at a molecular level, including activation of TGF-β signalling pathway, immune and stress response and downregulation of mitochondrial functioning. Upon prolonged HFD intake, initial transcriptional response tails off, mitochondrial functioning is even further diminished, and in turn the relation between eWAT gene expression and physiological changes becomes more prominent. In particular, eWAT weight and total energy intake negatively correlate with cellular respiration process, revealing mitochondrial dysfunction as a hallmark of late eWAT adaptation to HFD. Apart from global understanding of the time-resolved adaptation to HFD, the multi-layered network model allows several novel mechanistic hypotheses to emerge: (1) early activation of TGF-β signalling as a trigger for structural and morphological changes in

  10. Integrative Modeling of eQTLs and Cis-Regulatory Elements Suggests Mechanisms Underlying Cell Type Specificity of eQTLs

    PubMed Central

    Brown, Christopher D.; Mangravite, Lara M.; Engelhardt, Barbara E.

    2013-01-01

    Genetic variants in cis-regulatory elements or trans-acting regulators frequently influence the quantity and spatiotemporal distribution of gene transcription. Recent interest in expression quantitative trait locus (eQTL) mapping has paralleled the adoption of genome-wide association studies (GWAS) for the analysis of complex traits and disease in humans. Under the hypothesis that many GWAS associations tag non-coding SNPs with small effects, and that these SNPs exert phenotypic control by modifying gene expression, it has become common to interpret GWAS associations using eQTL data. To fully exploit the mechanistic interpretability of eQTL-GWAS comparisons, an improved understanding of the genetic architecture and causal mechanisms of cell type specificity of eQTLs is required. We address this need by performing an eQTL analysis in three parts: first we identified eQTLs from eleven studies on seven cell types; then we integrated eQTL data with cis-regulatory element (CRE) data from the ENCODE project; finally we built a set of classifiers to predict the cell type specificity of eQTLs. The cell type specificity of eQTLs is associated with eQTL SNP overlap with hundreds of cell type specific CRE classes, including enhancer, promoter, and repressive chromatin marks, regions of open chromatin, and many classes of DNA binding proteins. These associations provide insight into the molecular mechanisms generating the cell type specificity of eQTLs and the mode of regulation of corresponding eQTLs. Using a random forest classifier with cell specific CRE-SNP overlap as features, we demonstrate the feasibility of predicting the cell type specificity of eQTLs. We then demonstrate that CREs from a trait-associated cell type can be used to annotate GWAS associations in the absence of eQTL data for that cell type. We anticipate that such integrative, predictive modeling of cell specificity will improve our ability to understand the mechanistic basis of human complex phenotypic

  11. Effect of temperature on the acid-base properties of the alumina surface: microcalorimetry and acid-base titration experiments.

    PubMed

    Morel, Jean-Pierre; Marmier, Nicolas; Hurel, Charlotte; Morel-Desrosiers, Nicole

    2006-06-15

    Sorption reactions on natural or synthetic materials that can attenuate the migration of pollutants in the geosphere could be affected by temperature variations. Nevertheless, most of the theoretical models describing sorption reactions are at 25 degrees C. To check these models at different temperatures, experimental data such as the enthalpies of sorption are thus required. Highly sensitive microcalorimeters can now be used to determine the heat effects accompanying the sorption of radionuclides on oxide-water interfaces, but enthalpies of sorption cannot be extracted from microcalorimetric data without a clear knowledge of the thermodynamics of protonation and deprotonation of the oxide surface. However, the values reported in the literature show large discrepancies and one must conclude that, amazingly, this fundamental problem of proton binding is not yet resolved. We have thus undertaken to measure by titration microcalorimetry the heat effects accompanying proton exchange at the alumina-water interface at 25 degrees C. Based on (i) the surface sites speciation provided by a surface complexation model (built from acid-base titrations at 25 degrees C) and (ii) results of the microcalorimetric experiments, calculations have been made to extract the enthalpic variations associated respectively to first and second deprotonation of the alumina surface. Values obtained are deltaH1 = 80+/-10 kJ mol(-1) and deltaH2 = 5+/-3 kJ mol(-1). In a second step, these enthalpy values were used to calculate the alumina surface acidity constants at 50 degrees C via the van't Hoff equation. Then a theoretical titration curve at 50 degrees C was calculated and compared to the experimental alumina surface titration curve. Good agreement between the predicted acid-base titration curve and the experimental one was observed. PMID:16504204

  12. Microhomology-mediated mechanisms underlie non-recurrent disease-causing microdeletions of the FOXL2 gene or its regulatory domain.

    PubMed

    Verdin, Hannah; D'haene, Barbara; Beysen, Diane; Novikova, Yana; Menten, Björn; Sante, Tom; Lapunzina, Pablo; Nevado, Julian; Carvalho, Claudia M B; Lupski, James R; De Baere, Elfride

    2013-01-01

    Genomic disorders are often caused by recurrent copy number variations (CNVs), with nonallelic homologous recombination (NAHR) as the underlying mechanism. Recently, several microhomology-mediated repair mechanisms--such as microhomology-mediated end-joining (MMEJ), fork stalling and template switching (FoSTeS), microhomology-mediated break-induced replication (MMBIR), serial replication slippage (SRS), and break-induced SRS (BISRS)--were described in the etiology of non-recurrent CNVs in human disease. In addition, their formation may be stimulated by genomic architectural features. It is, however, largely unexplored to what extent these mechanisms contribute to rare, locus-specific pathogenic CNVs. Here, fine-mapping of 42 microdeletions of the FOXL2 locus, encompassing FOXL2 (32) or its regulatory domain (10), serves as a model for rare, locus-specific CNVs implicated in genetic disease. These deletions lead to blepharophimosis syndrome (BPES), a developmental condition affecting the eyelids and the ovary. For breakpoint mapping we used targeted array-based comparative genomic hybridization (aCGH), quantitative PCR (qPCR), long-range PCR, and Sanger sequencing of the junction products. Microhomology, ranging from 1 bp to 66 bp, was found in 91.7% of 24 characterized breakpoint junctions, being significantly enriched in comparison with a random control sample. Our results show that microhomology-mediated repair mechanisms underlie at least 50% of these microdeletions. Moreover, genomic architectural features, like sequence motifs, non-B DNA conformations, and repetitive elements, were found in all breakpoint regions. In conclusion, the majority of these microdeletions result from microhomology-mediated mechanisms like MMEJ, FoSTeS, MMBIR, SRS, or BISRS. Moreover, we hypothesize that the genomic architecture might drive their formation by increasing the susceptibility for DNA breakage or promote replication fork stalling. Finally, our locus-centered study

  13. The role of acid-base effects on particle charging in apolar media.

    PubMed

    Gacek, Matthew Michael; Berg, John C

    2015-06-01

    The creation and stabilization of electric charge in apolar environments (dielectric constant≈2) have been an area of interest dating back to when an explanation was sought for the occurrence of what are now known as electrokinetic explosions during the pumping of fuels. More recently attention has focused on the charging of suspended particles in such media, underlying such applications as electrophoretic displays (e.g., the Amazon Kindle® reader) and new printing devices (e.g., the HP Indigo® Digital Press). The endeavor has been challenging owing to the complexity of the systems involved and the large number of factors that appear to be important. A number of different, and sometimes conflicting, theories for particle surface charging have been advanced, but most observations obtained in the authors' laboratory, as well as others, appear to be explainable in terms of an acid-base mechanism. Adducts formed between chemical functional groups on the particle surface and monomers of reverse micelle-forming surfactants dissociate, leaving charged groups on the surface, while the counter-charges formed are sequestered in the reverse micelles. For a series of mineral oxides in a given medium with a given surfactant, surface charging (as quantified by the maximum electrophoretic mobility or zeta potential obtained as surfactant concentration is varied) was found to scale linearly with the aqueous PZC (or IEP) values of the oxides. Different surfactants, with the same oxide series, yielded similar behavior, but with different PZC crossover points between negative and positive particle charging, and different slopes of charge vs. PZC. Thus the oxide series could be used as a yardstick to characterize the acid-base properties of the surfactants. This has led directly to the study of other materials, including surface-modified oxides, carbon blacks, pigments (charge transfer complexes), and polymer latices. This review focuses on the acid-base mechanism of particle

  14. Acid-Base Interactions at the Molecular Level: Adhesion and Friction Studies with Interfacial Force Microscopy

    SciTech Connect

    Burns, A.R.; Carpick, R.W.; Houston, J.E.; Michalske, T.A.

    1998-12-09

    To examine the forces of acid-base adhesive interactions at the molecular level, we utilize the scanning probe Interracial Force Microscope (IFM). Unlike cantilever-based atomic force microscopes, the EM is a non-compliant, mechanically stable probe that provides a complete adhesive profile without jump-to-contact. In this way, we are able to quantitatively measure the work of adhesion and bond energies at well-defined, nanometer-scale single asperity contacts. In particular, we will discuss the displacement-controlled adhesive forces between self-assembled monolayer of functionalized alkanethiols strongly bound to a gold substrate and a similarly functionalized tip. We also discuss a method utilizing decoupled lateral and normal force sensors to simultaneously observe the onset of both friction and chemical bond formation. Measurements show that friction can be directly attributed to bond formation and rupture well before repulsive contact.

  15. Enabling the Tablet Product Development of 5-Fluorocytosine by Conjugate Acid Base Cocrystals.

    PubMed

    Perumalla, Sathyanarayana R; Paul, Shubhajit; Sun, Changquan C

    2016-06-01

    5-Fluorocytosine (FC) is a high-dose antifungal drug that challenges the development of a tablet product due to poor solid-state stability and tabletability. Using 2 pharmaceutically acceptable conjugate acid base (CAB) cocrystals of FC with HCl and acesulfame, we have developed commercially viable high loading FC tablets. The tablets were prepared by direct compression using nano-coated microcrystalline cellulose Avicel PH105 as a tablet binder, which provided both excellent tabletability and good flowability. Commercial manufacturability of formulations based on both CAB cocrystals was verified on a compaction simulator. The results from an expedited friability study were used to set the compaction force, which yielded tablets with sufficient mechanical strength and rapid tablet disintegration. This work demonstrates the potential value of CAB cocrystals in drug product development. PMID:27238493

  16. Microbial infection-induced expansion of effector T cells overcomes the suppressive effects of regulatory T cells via an IL-2 deprivation mechanism.

    PubMed

    Benson, Alicia; Murray, Sean; Divakar, Prashanthi; Burnaevskiy, Nikolay; Pifer, Reed; Forman, James; Yarovinsky, Felix

    2012-01-15

    Foxp3(+) regulatory T (Treg) cells are a critical cell population that suppresses T cell activation in response to microbial and viral pathogens. We identify a cell-intrinsic mechanism by which effector CD4(+) T cells overcome the suppressive effects of Treg cells in the context of three distinct infections: Toxoplasma gondii, Listeria monocytogenes, and vaccinia virus. The acute responses to the parasitic, bacterial, and viral pathogens resulted in a transient reduction in frequency and absolute number of Treg cells. The infection-induced partial loss of Treg cells was essential for the initiation of potent Th1 responses and host protection against the pathogens. The observed disappearance of Treg cells was a result of insufficiency in IL-2 caused by the expansion of pathogen-specific CD4(+) T cells with a limited capacity of IL-2 production. Exogenous IL-2 treatment during the parasitic, bacterial, and viral infections completely prevented the loss of Treg cells, but restoration of Treg cells resulted in a greatly enhanced susceptibility to the pathogens. These results demonstrate that the transient reduction in Treg cells induced by pathogens via IL-2 deprivation is essential for optimal T cell responses and host resistance to microbial and viral pathogens. PMID:22147768

  17. A multilayered regulatory mechanism for the autoinhibition and activation of a plant CC-NB-LRR resistance protein with an extra N-terminal domain.

    PubMed

    Chen, Xiaojiao; Zhu, Min; Jiang, Lei; Zhao, Wenyang; Li, Jia; Wu, Jianyan; Li, Chun; Bai, Baohui; Lu, Gang; Chen, Hongyu; Moffett, Peter; Tao, Xiaorong

    2016-10-01

    The tomato resistance protein Sw-5b differs from the classical coiled-coil nucleotide-binding leucine-rich repeat (CC-NB-LRR) resistance proteins by having an extra N-terminal domain (NTD). To understand how NTD, CC and NB-LRR regulate autoinhibition and activation of Sw-5b, we dissected the function(s) of each domain. When viral elicitor was absent, Sw-5b LRR suppressed the central NB-ARC to maintain autoinhibition of the NB-LRR segment. The CC and NTD domains independently and additively enhanced the autoinhibition of NB-LRR. When viral elicitor was present, the NB-LRR segment of Sw-5b was specifically activated to trigger a hypersensitive response. Surprisingly, Sw-5b CC suppressed the activation of NB-LRR, whereas the extra NTD of Sw-5b became a positive regulator and fully activated the resistance protein, probably by relieving the inhibitory effects of the CC. In infection assays of transgenic plants, the NB-LRR segment alone was insufficient to confer resistance against Tomato spotted wilt tospovirus; the layers of NTD and CC regulation on NB-LRR were required for Sw-5b to confer resistance. Based on these findings, we propose that, to counter the negative regulation of the CC on NB-LRR, Sw-5b evolved an extra NTD to coordinate with the CC, thus developing a multilayered regulatory mechanism to control autoinhibition and activation. PMID:27558751

  18. Crosstalk between bone marrow-derived mesenchymal stem cells and regulatory T cells through a glucocorticoid-induced leucine zipper/developmental endothelial locus-1-dependent mechanism.

    PubMed

    Yang, Nianlan; Baban, Babak; Isales, Carlos M; Shi, Xing-Ming

    2015-09-01

    Bone marrow is a reservoir for regulatory T (T(reg)) cells, but how T(reg) cells are regulated in that environment remains poorly understood. We show that expression of glucocorticoid (GC)-induced leucine zipper (GILZ) in bone marrow mesenchymal lineage cells or bone marrow-derived mesenchymal stem cells (BMSCs) increases the production of T(reg) cells via a mechanism involving the up-regulation of developmental endothelial locus-1 (Del-1), an endogenous leukocyte-endothelial adhesion inhibitor. We found that the expression of Del-1 is increased ∼4-fold in the bone tissues of GILZ transgenic (Tg) mice, and this increase is coupled with a significant increase in the production of IL-10 (2.80 vs. 0.83) and decrease in the production of IL-6 (0.80 vs. 2.33) and IL-12 (0.25 vs. 1.67). We also show that GILZ-expressing BMSCs present antigen in a way that favors T(reg) cells. These results indicate that GILZ plays a critical role mediating the crosstalk between BMSCs and T(reg) in the bone marrow microenvironment. These data, together with our previous findings that overexpression of GILZ in BMSCs antagonizes TNF-α-elicited inflammatory responses, suggest that GILZ plays important roles in bone-immune cell communication and BMSC immune suppressive functions. PMID:26038125

  19. The mechanism of potent GTP cyclohydrolase I inhibition by 2,4-diamino-6-hydroxypyrimidine: requirement of the GTP cyclohydrolase I feedback regulatory protein.

    PubMed

    Kolinsky, Monica A; Gross, Steven S

    2004-09-24

    Inhibition of GTP cyclohydrolase I (GTPCH) has been used as a selective tool to assess the role of de novo synthesis of (6R)-5,6,7,8-tetrahydro-L-biopterin (BH4) in a biological system. Toward this end, 2,4-diamino-6-hydroxypyrimidine (DAHP) has been used as the prototypical GTPCH inhibitor. Using a novel real-time kinetic microplate assay for GTPCH activity and purified prokaryote-expressed recombinant proteins, we show that potent inhibition by DAHP is not the result of a direct interaction with GTPCH. Rather, inhibition by DAHP in phosphate buffer occurs via an indirect mechanism that requires the presence of GTPCH feedback regulatory protein (GFRP). Notably, GFRP was previously discovered as the essential factor that reconstitutes inhibition of pure recombinant GTPCH by the pathway end product BH4. Thus, DAHP inhibits GTPCH by engaging the endogenous feedback inhibitory system. We further demonstrate that L-Phe fully reverses the inhibition of GTPCH by DAHP/GFRP, which is also a feature in common with inhibition by BH4/GFRP. These findings suggest that DAHP is not an indiscriminate inhibitor of GTPCH in biological systems; instead, it is predicted to preferentially attenuate GTPCH activity in cells that most abundantly express GFRP and/or contain the lowest levels of L-Phe. PMID:15292175

  20. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism.

    PubMed

    Shahriari, Ali; Dawson, Neal J; Bell, Ryan A V; Storey, Kenneth B

    2013-01-01

    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD(+), which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. 1.1.1.28) from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in V max (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves. PMID:24233354

  1. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism

    PubMed Central

    Shahriari, Ali; Dawson, Neal J.; Bell, Ryan A. V.; Storey, Kenneth B.

    2013-01-01

    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD+, which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. 1.1.1.28) from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in Vmax (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves. PMID:24233354

  2. BosR (BB0647) Controls the RpoN-RpoS Regulatory Pathway and Virulence Expression in Borrelia burgdorferi by a Novel DNA-Binding Mechanism

    PubMed Central

    Ouyang, Zhiming; Deka, Ranjit K.; Norgard, Michael V.

    2011-01-01

    In Borrelia burgdorferi (Bb), the Lyme disease spirochete, the alternative σ factor σ54 (RpoN) directly activates transcription of another alternative σ factor, σS (RpoS) which, in turn, controls the expression of virulence-associated membrane lipoproteins. As is customary in σ54-dependent gene control, a putative NtrC-like enhancer-binding protein, Rrp2, is required to activate the RpoN-RpoS pathway. However, recently it was found that rpoS transcription in Bb also requires another regulator, BosR, which was previously designated as a Fur or PerR homolog. Given this unexpected requirement for a second activator to promote σ54-dependent gene transcription, and the fact that regulatory mechanisms among similar species of pathogenic bacteria can be strain-specific, we sought to confirm the regulatory role of BosR in a second virulent strain (strain 297) of Bb. Indeed, BosR displayed the same influence over lipoprotein expression and mammalian infectivity for strain Bb 297 that were previously noted for Bb strain B31. We subsequently found that recombinant BosR (rBosR) bound to the rpoS gene at three distinct sites, and that binding occurred despite the absence of consensus Fur or Per boxes. This led to the identification of a novel direct repeat sequence (TAAATTAAAT) critical for rBosR binding in vitro. Mutations in the repeat sequence markedly inhibited or abolished rBosR binding. Taken together, our studies provide new mechanistic insights into how BosR likely acts directly on rpoS as a positive transcriptional activator. Additional novelty is engendered by the facts that, although BosR is a Fur or PerR homolog and it contains zinc (like Fur and PerR), it has other unique features that clearly set it apart from these other regulators. Our findings also have broader implications regarding a previously unappreciated layer of control that can be involved in σ54–dependent gene regulation in bacteria. PMID:21347346

  3. Acid/base account and minesoils: A review

    SciTech Connect

    Hossner, L.R.; Brandt, J.E.

    1997-12-31

    Generation of acidity from the oxidation of iron sulfides (FeS{sub 2}) is a common feature of geological materials exposed to the atmosphere by mining activities. Acid/base accounting (ABA) has been the primary method to evaluate the acid- or alkaline-potential of geological materials and to predict if weathering of these materials will have an adverse effect on terrestrial and aquatic environments. The ABA procedure has also been used to evaluate minesoils at different stages of weathering and, in some cases, to estimate lime requirements. Conflicting assessments of the methodology have been reported in the literature. The ABA is the fastest and easiest way to evaluate the acid-forming characteristics of overburden materials; however, accurate evaluations sometimes require that ABA data be examined in conjunction with additional sample information and results from other analytical procedures. The end use of ABA data, whether it be for minesoil evaluation or water quality prediction, will dictate the method`s interpretive criteria. Reaction kinetics and stoichiometry may vary and are not clearly defined for all situations. There is an increasing awareness of the potential for interfering compounds, particularly siderite (FeCO{sub 3}), to be present in geological materials associated with coal mines. Hardrock mines, with possible mixed sulfide mineralogy, offer a challenge to the ABA, since acid generation may be caused by minerals other than pyrite. A combination of methods, static and kinetic, is appropriate to properly evaluate the presence of acid-forming materials.

  4. Citric acid-based hydroxyapatite composite scaffolds enhance calvarial regeneration.

    PubMed

    Sun, Dawei; Chen, Yuhui; Tran, Richard T; Xu, Song; Xie, Denghui; Jia, Chunhong; Wang, Yuchen; Guo, Ying; Zhang, Zhongmin; Guo, Jinshan; Yang, Jian; Jin, Dadi; Bai, Xiaochun

    2014-01-01

    Citric acid-based polymer/hydroxyapatite composites (CABP-HAs) are a novel class of biomimetic composites that have recently attracted significant attention in tissue engineering. The objective of this study was to compare the efficacy of using two different CABP-HAs, poly (1,8-octanediol citrate)-click-HA (POC-Click-HA) and crosslinked urethane-doped polyester-HA (CUPE-HA) as an alternative to autologous tissue grafts in the repair of skeletal defects. CABP-HA disc-shaped scaffolds (65 wt.-% HA with 70% porosity) were used as bare implants without the addition of growth factors or cells to renovate 4 mm diameter rat calvarial defects (n = 72, n = 18 per group). Defects were either left empty (negative control group), or treated with CUPE-HA scaffolds, POC-Click-HA scaffolds, or autologous bone grafts (AB group). Radiological and histological data showed a significant enhancement of osteogenesis in defects treated with CUPE-HA scaffolds when compared to POC-Click-HA scaffolds. Both, POC-Click-HA and CUPE-HA scaffolds, resulted in enhanced bone mineral density, trabecular thickness, and angiogenesis when compared to the control groups at 1, 3, and 6 months post-trauma. These results show the potential of CABP-HA bare implants as biocompatible, osteogenic, and off-shelf-available options in the repair of orthopedic defects. PMID:25372769

  5. Solution influence on biomolecular equilibria - Nucleic acid base associations

    NASA Technical Reports Server (NTRS)

    Pohorille, A.; Pratt, L. R.; Burt, S. K.; Macelroy, R. D.

    1984-01-01

    Various attempts to construct an understanding of the influence of solution environment on biomolecular equilibria at the molecular level using computer simulation are discussed. First, the application of the formal statistical thermodynamic program for investigating biomolecular equilibria in solution is presented, addressing modeling and conceptual simplications such as perturbative methods, long-range interaction approximations, surface thermodynamics, and hydration shell. Then, Monte Carlo calculations on the associations of nucleic acid bases in both polar and nonpolar solvents such as water and carbon tetrachloride are carried out. The solvent contribution to the enthalpy of base association is positive (destabilizing) in both polar and nonpolar solvents while negative enthalpies for stacked complexes are obtained only when the solute-solute in vacuo energy is added to the total energy. The release upon association of solvent molecules from the first hydration layer around a solute to the bulk is accompanied by an increase in solute-solvent energy and decrease in solvent-solvent energy. The techniques presented are expectd to displace less molecular and more heuristic modeling of biomolecular equilibria in solution.

  6. Nucleic acid-based nanoengineering: novel structures for biomedical applications

    PubMed Central

    Li, Hanying; LaBean, Thomas H.; Leong, Kam W.

    2011-01-01

    Nanoengineering exploits the interactions of materials at the nanometre scale to create functional nanostructures. It relies on the precise organization of nanomaterials to achieve unique functionality. There are no interactions more elegant than those governing nucleic acids via Watson–Crick base-pairing rules. The infinite combinations of DNA/RNA base pairs and their remarkable molecular recognition capability can give rise to interesting nanostructures that are only limited by our imagination. Over the past years, creative assembly of nucleic acids has fashioned a plethora of two-dimensional and three-dimensional nanostructures with precisely controlled size, shape and spatial functionalization. These nanostructures have been precisely patterned with molecules, proteins and gold nanoparticles for the observation of chemical reactions at the single molecule level, activation of enzymatic cascade and novel modality of photonic detection, respectively. Recently, they have also been engineered to encapsulate and release bioactive agents in a stimulus-responsive manner for therapeutic applications. The future of nucleic acid-based nanoengineering is bright and exciting. In this review, we will discuss the strategies to control the assembly of nucleic acids and highlight the recent efforts to build functional nucleic acid nanodevices for nanomedicine. PMID:23050076

  7. Hypoxia and Its Acid-Base Consequences: From Mountains to Malignancy.

    PubMed

    Swenson, Erik R

    2016-01-01

    Hypoxia, depending upon its magnitude and circumstances, evokes a spectrum of mild to severe acid-base changes ranging from alkalosis to acidosis, which can alter many responses to hypoxia at both non-genomic and genomic levels, in part via altered hypoxia-inducible factor (HIF) metabolism. Healthy people at high altitude and persons hyperventilating to non-hypoxic stimuli can become alkalotic and alkalemic with arterial pH acutely rising as high as 7.7. Hypoxia-mediated respiratory alkalosis reduces sympathetic tone, blunts hypoxic pulmonary vasoconstriction and hypoxic cerebral vasodilation, and increases hemoglobin oxygen affinity. These effects and others can be salutary or counterproductive to tissue oxygen delivery and utilization, based upon magnitude of each effect and summation. With severe hypoxia either in the setting of profound arterial hemoglobin desaturation and reduced O2 content or poor perfusion (ischemia) at the global or local level, metabolic and hypercapnic acidosis develop along with considerable lactate formation and pH falling to below 6.8. Although conventionally considered to be injurious and deleterious to cell function and survival, both acidoses may be cytoprotective by various anti-inflammatory, antioxidant, and anti-apoptotic mechanisms which limit total hypoxic or ischemic-reperfusion injury. Attempts to correct acidosis by giving bicarbonate or other alkaline agents under these circumstances ahead of or concurrent with reoxygenation efforts may be ill advised. Better understanding of this so-called "pH paradox" or permissive acidosis may offer therapeutic possibilities. Rapidly growing cancers often outstrip their vascular supply compromising both oxygen and nutrient delivery and metabolic waste disposal, thus limiting their growth and metastatic potential. However, their excessive glycolysis and lactate formation may not necessarily represent oxygen insufficiency, but rather the Warburg effect-an attempt to provide a large amount

  8. Spontaneous formation of biocompatible vesicles in aqueous mixtures of amino acid-based cationic surfactants and SDS/SDBS.

    PubMed

    Shome, Anshupriya; Kar, Tanmoy; Das, Prasanta K

    2011-02-01

    The spontaneous formation of vesicles by six amino acid-based cationic surfactants and two anionic surfactants (sodium dodecylbenzene sulfonate (SDBS) and sodium dodecyl sulfate (SDS)) is reported. The head-group structure of the cationic surfactants is minutely altered to understand their effect on vesicle formation. To establish the regulatory role of the aromatic group in self-aggregation, both aliphatic and aromatic side-chain-substituted amino acid-based cationic surfactants are used. The presence of aromaticity in any one of the constituents favors the formation of vesicles by cationic/anionic surfactant mixtures. The formation of vesicles is primarily dependent on the balance between the hydrophobicity and hydrophilicity of both cationic and anionic surfactants. Vesicle formation is characterized by surface tension, fluorescence anisotropy, transmission electron microscopy, dynamic light scattering, and phase diagrams. These vesicles are thermally stable up to 65 °C, determined by temperature-dependent fluorescence anisotropy. According to the MTT assay, these catanionic vesicles are nontoxic to NIH3T3 cells, thus indicating their wider applicability as delivery vehicles to cells. Among the six cationic surfactants examined, tryptophan- and tyrosine-based surfactants have the ability to reduce HAuCl(4) to gold nanoparticles (GNPs), which is utilized to obtain in-situ-synthesized GNPs entrapped in vesicles without the need for any external reducing agent. PMID:21275029

  9. Adansonian Analysis and Deoxyribonucleic Acid Base Composition of Serratia marcescens

    PubMed Central

    Colwell, R. R.; Mandel, M.

    1965-01-01

    Colwell, R. R. (Georgetown University, Washington, D.C.), and M. Mandel. Adansonian analysis and deoxyribonucleic acid base composition of Serratia marcescens. J. Bacteriol. 89:454–461. 1965.—A total of 33 strains of Serratia marcescens were subjected to Adansonian analysis for which more than 200 coded features for each of the organisms were included. In addition, the base composition [expressed as moles per cent guanine + cytosine (G + C)] of the deoxyribonucleic acid (DNA) prepared from each of the strains was determined. Except for four strains which were intermediate between Serratia and the Hafnia and Aerobacter group C of Edwards and Ewing, the S. marcescens species group proved to be extremely homogeneous, and the different strains showed high affinities for each other (mean similarity, ¯S = 77%). The G + C ratio of the DNA from the Serratia strains ranged from 56.2 to 58.4% G + C. Many species names have been listed for the genus, but only a single clustering of the strains was obtained at the species level, for which the species name S. marcescens was retained. S. kiliensis, S. indica, S. plymuthica, and S. marinorubra could not be distinguished from S. marcescens; it was concluded, therefore, that there is only a single species in the genus. The variety designation kiliensis does not appear to be valid, since no subspecies clustering of strains with negative Voges-Proskauer reactions could be detected. The characteristics of the species are listed, and a description of S. marcescens is presented. PMID:14255714

  10. Acid-base properties of aqueous illite surfaces

    SciTech Connect

    Du, Q.; Sun, Z.; Forsling, W.; Tang, H.

    1997-03-01

    In this paper, the acid-base properties of illite/water suspensions are examined using the constant capacitance surface complexation model. On the basis of results of potentiometric titrations and solubility experiments, the authors conclude that the proton reactions in the supernatants of illite suspensions can be successfully represented by proton reactions of Al(H{sub 2}O){sub 6}{sup 3+} and Si(OH){sub 4} in water solutions. For illustrating the acidic characteristics of aqueous illite surfaces, two surface protonation models are proposed: (1) one site-one pK{sub a} model, {triple_bond}SOH {r_reversible} {triple_bond}SO{sup {minus}} + H{sup +}, pK{sub a}{sup int} = 4.12-4.23; (2) two sites-two pK{sub a}s model, {triple_bond}S{sub 1}OH {r_reversible} {triple_bond}S{sup 1}O{sup {minus}} + H{sup +}, pK{sub a{sub I}} = 4.17-4.44, and {triple_bond}S{sub II}OH {r_reversible} {triple_bond}S{sub II}O{sup {minus}} + H{sup +}, pK{sub a{sub II}}{sup int} = 6.35-7.74. Evaluation of these two models indicates that both of them can give good descriptions of the experimental data of systems with different illite concentrations and ionic strengths and that the one site-one pK{sub a} model can be considered as a simplification of the two sites-two pK{sub a}s model. Since both models assume only deprotonation reactions at the illite surfaces, they suggest that the surface behavior of the illite is similar to that of amorphous SiO{sub 2}. Model assumptions, experimental procedures, and evaluative criteria are detailed in the paper.

  11. Na(+), K(+), Cl(-), acid-base or H2O homeostasis in children with urinary tract infections: a narrative review.

    PubMed

    Bertini, Anna; Milani, Gregorio P; Simonetti, Giacomo D; Fossali, Emilio F; Faré, Pietro B; Bianchetti, Mario G; Lava, Sebastiano A G

    2016-09-01

    Guidelines on the diagnosis and management of urinary tract infections in childhood do not address the issue of abnormalities in Na(+), K(+), Cl(-) and acid-base balance. We have conducted a narrative review of the literature with the aim to describe the underlying mechanisms of these abnormalities and to suggest therapeutic maneuvers. Abnormalities in Na(+), K(+), Cl(-) and acid-base balance are common in newborns and infants and uncommon in children of more than 3 years of age. Such abnormalities may result from factitious laboratory results, from signs and symptoms (such as excessive sweating, poor fluid intake, vomiting and passage of loose stools) of the infection itself, from a renal dysfunction, from improper parenteral fluid management or from the prescribed antimicrobials. In addition, two transient renal tubular dysfunctions may occur in infants with infectious renal parenchymal involvement: a reduced capacity to concentrate urine and pseudohypoaldosteronism secondary to renal tubular unresponsiveness to aldosterone that presents with hyponatremia, hyperkalemia and acidosis. In addition to antimicrobials, volume resuscitation with an isotonic solution is required in these children. In secondary pseudohypoaldosteronism, isotonic solutions (such as 0.9 % saline or lactated Ringer) correct not only the volume depletion but also the hyperkalemia and acidosis. In conclusion, our review suggests that in infants with infectious renal parenchymal involvement, non-renal and renal causes concur to cause fluid volume depletion and abnormalities in electrolyte and acid-base balance, most frequently hyponatremia. PMID:26701834

  12. Characterization of low-molecular-weight hyaluronic acid-based hydrogel and differential stem cell responses in the hydrogel microenvironments.

    PubMed

    Kim, Jungju; Park, Yongdoo; Tae, Giyoong; Lee, Kyu Back; Hwang, Chang Mo; Hwang, Soon Jung; Kim, In Sook; Noh, Insup; Sun, Kyung

    2009-03-15

    Hyaluronic acid is a natural glycosaminoglycan involved in biological processes. Low-molecular-weight hyaluronic acid (10 and 50 kDa)-based hydrogel was synthesized using derivatized hyaluronic acid. Hyaluronic acid was acrylated by two steps: (1) introduction of an amine group using adipic acid dihydrazide, and (2) acrylation by N-acryloxysuccinimide. Injectable hyaluronic acid-based hydrogel was prepared by using acrylated hyaluronic acid and poly(ethylene glycol) tetra-thiols via Michael-type addition reaction. Mechanical properties of the hydrogel were evaluated by varying the molecular weight of acrylated hyaluronic acid (10 and 50 kDa) and the weight percent of hydrogel. Hydrogel based on 50-kDa hyaluronic acid showed the shortest gelation time and the highest complex modulus. Next, human mesenchymal stem cells were cultured in cell-adhesive RGD peptide-immobilized hydrogels together with bone morphogenic protein-2 (BMP-2). Cells cultured in the RGD/BMP-2-incorporated hydrogels showed proliferation rates higher than that of control or RGD-immobilized hydrogels. Real-time RT-PCR showed that the expression of osteoblast marker genes such as CBFalpha1 and alkaline phosphatase was increased in hyaluronic acid-based hydrogel, and the expression level was dependent on the molecular weight of hyaluronic acid, RGD peptide, and BMP-2. This study indicates that low-molecular-weight hyaluronic acid-based hydrogel can be applied to tissue regeneration as differentiation guidance materials of stem cells. PMID:18384163

  13. The Functional and Regulatory Mechanisms of the Thellungiella salsuginea Ascorbate Peroxidase 6 (TsAPX6) in Response to Salinity and Water Deficit Stresses

    PubMed Central

    Li, Zeqin; Zhang, Jilong; Li, Jingxiao; Li, Hongjie; Zhang, Genfa

    2016-01-01

    Soil salinization is a resource and ecological problem in the world. Thellungiella salsuginea is becoming a new model plant because it resembles its relative species, Arabidopsis thaliana, in small genome and short life cycle. It is highly tolerant to salinity and drought stresses. Ascorbate peroxidase (APX) is an enzyme that clears H2O2 in plants. The function and molecular and regulation mechanisms of APX in T. salsuginea have rarely been reported. In this study, an APX gene, TsApx6, was cloned from T. salsuginea and its responses to abiotic stresses in transgenic Arabidopsis were studied. Under high salinity treatment, the expression of TsApx6 was significantly induced. Under drought treatment, overexpression of TsApx6 increased the survival rate and reduced leaf water loss rate in Arabidopsis. Compared to the wild type plants, high salinity treatment reduced the concentrations of MDA, H2O2 and proline but elevated the activities of APX, GPX, CAT and SOD in the TsApx6-overexpressing plants. Meanwhile, germination rate, cotyledon greening, and root length were improved in the transgenic plants compared to the wild type plants under salt and water deficit conditions. Based on these findings, TsApx6 has an important function in the resistance of plants to certain abiotic stresses. The TsApx6 promoter sequence was obtained using Genome Walking technology. Bioinformatics analysis indicated that it contains some cis-acting elements related to stress response. The treatments of salt, dehydration, and ABA induced the expression of Gus gene under the regulation of the TsApx6 promoter. Mutation analysis showed that the MBS motif present in the TsApx6 promoter might be a key negative regulatory element which has an important effect on the growth and developmental process of plants. PMID:27097028

  14. Cloning, biochemical characterisation, tissue localisation and possible post-translational regulatory mechanism of the cytosolic phosphoglucose isomerase from developing sunflower seeds.

    PubMed

    Troncoso-Ponce, M A; Rivoal, J; Cejudo, F J; Dorion, S; Garcés, R; Martínez-Force, E

    2010-09-01

    Lipid biosynthesis in developing sunflower (Helianthus annuus L.) seeds requires reducing power. One of the main sources of cellular NADPH is the oxidative pentose phosphate pathway (OPPP), generated from the oxidation of glucose-6-phosphate. This glycolytic intermediate, which can be imported to the plastid and enter in the OPPP, is the substrate and product of cytosolic phosphoglucose isomerase (cPGI, EC 5.3.1.9). In this report, we describe the cloning of a full-length cDNA encoding cPGI from developing sunflower seeds. The sequence was predicted to code for a protein of 566 residues characterised by the presence of two sugar isomerase domains. This cDNA was heterologously expressed in Escherichia coli as a His-tagged protein. The recombinant protein was purified using immobilised metal ion affinity chromatography and biochemically characterised. The enzyme had a specific activity of 1,436 micromol min(-1) mg(-1) and 1,011 micromol min(-1) mg(-1) protein when the reaction was initiated with glucose-6-phosphate and fructose-6-phosphate, respectively. Activity was not affected by erythrose-4-phosphate, but was inhibited by 6-P gluconate and glyceraldehyde-3-phosphate. A polyclonal immune serum was raised against the purified enzyme, allowing the study of protein levels during the period of active lipid synthesis in seeds. These results were compared with PGI activity profiles and mRNA expression levels obtained from Q-PCR studies. Our results point to the existence of a possible post-translational regulatory mechanism during seed development. Immunolocalisation of the protein in seed tissues further indicated that cPGI is highly expressed in the procambial ring. PMID:20628759

  15. Mathematical model of a telomerase transcriptional regulatory network developed by cell-based screening: analysis of inhibitor effects and telomerase expression mechanisms.

    PubMed

    Bilsland, Alan E; Stevenson, Katrina; Liu, Yu; Hoare, Stacey; Cairney, Claire J; Roffey, Jon; Keith, W Nicol

    2014-02-01

    Cancer cells depend on transcription of telomerase reverse transcriptase (TERT). Many transcription factors affect TERT, though regulation occurs in context of a broader network. Network effects on telomerase regulation have not been investigated, though deeper understanding of TERT transcription requires a systems view. However, control over individual interactions in complex networks is not easily achievable. Mathematical modelling provides an attractive approach for analysis of complex systems and some models may prove useful in systems pharmacology approaches to drug discovery. In this report, we used transfection screening to test interactions among 14 TERT regulatory transcription factors and their respective promoters in ovarian cancer cells. The results were used to generate a network model of TERT transcription and to implement a dynamic Boolean model whose steady states were analysed. Modelled effects of signal transduction inhibitors successfully predicted TERT repression by Src-family inhibitor SU6656 and lack of repression by ERK inhibitor FR180204, results confirmed by RT-QPCR analysis of endogenous TERT expression in treated cells. Modelled effects of GSK3 inhibitor 6-bromoindirubin-3'-oxime (BIO) predicted unstable TERT repression dependent on noise and expression of JUN, corresponding with observations from a previous study. MYC expression is critical in TERT activation in the model, consistent with its well known function in endogenous TERT regulation. Loss of MYC caused complete TERT suppression in our model, substantially rescued only by co-suppression of AR. Interestingly expression was easily rescued under modelled Ets-factor gain of function, as occurs in TERT promoter mutation. RNAi targeting AR, JUN, MXD1, SP3, or TP53, showed that AR suppression does rescue endogenous TERT expression following MYC knockdown in these cells and SP3 or TP53 siRNA also cause partial recovery. The model therefore successfully predicted several aspects of TERT

  16. The Functional and Regulatory Mechanisms of the Thellungiella salsuginea Ascorbate Peroxidase 6 (TsAPX6) in Response to Salinity and Water Deficit Stresses.

    PubMed

    Li, Zeqin; Zhang, Jilong; Li, Jingxiao; Li, Hongjie; Zhang, Genfa

    2016-01-01

    Soil salinization is a resource and ecological problem in the world. Thellungiella salsuginea is becoming a new model plant because it resembles its relative species, Arabidopsis thaliana, in small genome and short life cycle. It is highly tolerant to salinity and drought stresses. Ascorbate peroxidase (APX) is an enzyme that clears H2O2 in plants. The function and molecular and regulation mechanisms of APX in T. salsuginea have rarely been reported. In this study, an APX gene, TsApx6, was cloned from T. salsuginea and its responses to abiotic stresses in transgenic Arabidopsis were studied. Under high salinity treatment, the expression of TsApx6 was significantly induced. Under drought treatment, overexpression of TsApx6 increased the survival rate and reduced leaf water loss rate in Arabidopsis. Compared to the wild type plants, high salinity treatment reduced the concentrations of MDA, H2O2 and proline but elevated the activities of APX, GPX, CAT and SOD in the TsApx6-overexpressing plants. Meanwhile, germination rate, cotyledon greening, and root length were improved in the transgenic plants compared to the wild type plants under salt and water deficit conditions. Based on these findings, TsApx6 has an important function in the resistance of plants to certain abiotic stresses. The TsApx6 promoter sequence was obtained using Genome Walking technology. Bioinformatics analysis indicated that it contains some cis-acting elements related to stress response. The treatments of salt, dehydration, and ABA induced the expression of Gus gene under the regulation of the TsApx6 promoter. Mutation analysis showed that the MBS motif present in the TsApx6 promoter might be a key negative regulatory element which has an important effect on the growth and developmental process of plants. PMID:27097028

  17. Unfolding-resistant translocase targeting: a novel mechanism for outer mitochondrial membrane localization exemplified by the Bbeta2 regulatory subunit of protein phosphatase 2A.

    PubMed

    Dagda, Ruben K; Barwacz, Chris A; Cribbs, J Thomas; Strack, Stefan

    2005-07-22

    Heterotrimeric serine/threonine protein phosphatase 2A (PP2A) consists of scaffolding (A), catalytic (C), and variable (B, B', and B'') subunits. Variable subunits dictate subcellular localization and substrate specificity of the PP2A holoenzyme. The Bbeta regulatory subunit gene is mutated in spinocerebellar ataxia type 12, and one of its splice variants, Bbeta2, targets PP2A to mitochondria to promote apoptosis in PC12 cells (Dagda, R. K., Zaucha, J. A., Wadzinski, B. E., and Strack, S. (2003) J. Biol. Chem. 278, 24976-24985). Here, we report that Bbeta2 is localized to the outer mitochondrial membrane by a novel mechanism, combining a cryptic mitochondrial import signal with a structural arrest domain. Scanning mutagenesis demonstrates that basic and hydrophobic residues mediate mitochondrial association and the proapoptotic activity of Bbeta2. When fused to green fluorescent protein, the N terminus of Bbeta2 acts as a cleavable mitochondrial import signal. Surprisingly, full-length Bbeta2 is not detectably cleaved and is retained at the outer mitochondrial membrane, even though it interacts with the TOM22 import receptor, as shown by luciferase complementation in intact cells. Mutations that open the C-terminal beta-propeller of Bbeta2 facilitate mitochondrial import, indicating that this rigid fold acts as a stop-transfer domain by resisting the partial unfolding step prerequisite for matrix translocation. Because hybrids of prototypical import and beta-propeller domains recapitulate this behavior, we predict the existence of other similarly localized proteins and a selection against highly stable protein folds in the mitochondrial matrix. This unfolding-resistant targeting to the mitochondrial translocase is necessary but not sufficient for the proapoptotic activity of Bbeta2, which also requires association with the rest of the PP2A holoenzyme. PMID:15923182

  18. Rab27a negatively regulates CFTR chloride channel function in colonic epithelia: Involvement of the effector proteins in the regulatory mechanism

    SciTech Connect

    Saxena, Sunil K. . E-mail: ssaxena@stevens.edu; Kaur, Simarna

    2006-07-21

    Cystic fibrosis, an autosomal recessive disorder, is caused by the disruption of biosynthesis or function of CFTR. CFTR regulatory mechanisms include channel transport to plasma membrane and protein-protein interactions. Rab proteins are small GTPases involved in vesicle transport, docking, and fusion. The colorectal epithelial HT-29 cells natively express CFTR and respond to cAMP with an increase in CFTR-mediated currents. DPC-inhibited currents could be completely eliminated with CFTR-specific SiRNA. Over-expression of Rab27a inhibited, while isoform specific SiRNA and Rab27a antibody stimulated CFTR-mediated currents in HT-29 cells. CFTR activity is inhibited both by Rab27a (Q78L) (constitutive active GTP-bound form of Rab27a) and Rab27a (T23N) (constitutive negative form that mimics the GDP-bound form). Rab27a mediated effects could be reversed by Rab27a-binding proteins, the synaptotagmin-like protein (SLP-5) and Munc13-4 accessory protein (a putative priming factor for exocytosis). The SLP reversal of Rab27a effect was restricted to C2A/C2B domains while the SHD motif imparted little more inhibition. The CFTR-mediated currents remain unaffected by Rab3 though SLP-5 appears to weakly bind it. The immunoprecipitation experiments suggest protein-protein interactions between Rab27a and CFTR. Rab27a appears to impair CFTR appearance at the cell surface by trapping CFTR in the intracellular compartments. Munc13-4 and SLP-5, on the other hand, limit Rab27a availability to CFTR, thus minimizing its effect on channel function. These observations decisively prove that Rab27a is involved in CFTR channel regulation through protein-protein interactions involving Munc13-4 and SLP-5 effector proteins, and thus could be a potential target for cystic fibrosis therapy.

  19. Regulatory mechanism of the light-activable allosteric switch LOV-TAP for the control of DNA binding: a computer simulation study.

    PubMed

    Peter, Emanuel; Dick, Bernhard; Baeurle, Stephan A

    2013-03-01

    The spatio-temporal control of gene expression is fundamental to elucidate cell proliferation and deregulation phenomena in living systems. Novel approaches based on light-sensitive multiprotein complexes have recently been devised, showing promising perspectives for the noninvasive and reversible modulation of the DNA-transcriptional activity in vivo. This has lately been demonstrated in a striking way through the generation of the artificial protein construct light-oxygen-voltage (LOV)-tryptophan-activated protein (TAP), in which the LOV-2-Jα photoswitch of phototropin1 from Avena sativa (AsLOV2-Jα) has been ligated to the tryptophan-repressor (TrpR) protein from Escherichia coli. Although tremendous progress has been achieved on the generation of such protein constructs, a detailed understanding of their functioning as opto-genetical tools is still in its infancy. Here, we elucidate the early stages of the light-induced regulatory mechanism of LOV-TAP at the molecular level, using the noninvasive molecular dynamics simulation technique. More specifically, we find that Cys450-FMN-adduct formation in the AsLOV2-Jα-binding pocket after photoexcitation induces the cleavage of the peripheral Jα-helix from the LOV core, causing a change of its polarity and electrostatic attraction of the photoswitch onto the DNA surface. This goes along with the flexibilization through unfolding of a hairpin-like helix-loop-helix region interlinking the AsLOV2-Jα- and TrpR-domains, ultimately enabling the condensation of LOV-TAP onto the DNA surface. By contrast, in the dark state the AsLOV2-Jα photoswitch remains inactive and exerts a repulsive electrostatic force on the DNA surface. This leads to a distortion of the hairpin region, which finally relieves its tension by causing the disruption of LOV-TAP from the DNA. PMID:23042418

  20. pKa Modulation of the Acid/Base Catalyst within GH32 and GH68: A Role in Substrate/Inhibitor Specificity?

    PubMed Central

    Yuan, Shuguang; Le Roy, Katrien; Venken, Tom; Lammens, Willem; Van den Ende, Wim; De Maeyer, Marc

    2012-01-01

    Glycoside hydrolases of families 32 (GH32) and 68 (GH68) belong to clan GH-J, containing hydrolytic enzymes (sucrose/fructans as donor substrates) and fructosyltransferases (sucrose/fructans as donor and acceptor substrates). In GH32 members, some of the sugar substrates can also function as inhibitors, this regulatory aspect further adding to the complexity in enzyme functionalities within this family. Although 3D structural information becomes increasingly available within this clan and huge progress has been made on structure-function relationships, it is not clear why some sugars bind as inhibitors without being catalyzed. Conserved aspartate and glutamate residues are well known to act as nucleophile and acid/bases within this clan. Based on the available 3D structures of enzymes and enzyme-ligand complexes as well as docking simulations, we calculated the pKa of the acid-base before and after substrate binding. The obtained results strongly suggest that most GH-J members show an acid-base catalyst that is not sufficiently protonated before ligand entrance, while the acid-base can be fully protonated when a substrate, but not an inhibitor, enters the catalytic pocket. This provides a new mechanistic insight aiming at understanding the complex substrate and inhibitor specificities observed within the GH-J clan. Moreover, besides the effect of substrate entrance on its own, we strongly suggest that a highly conserved arginine residue (in the RDP motif) rather than the previously proposed Tyr motif (not conserved) provides the proton to increase the pKa of the acid-base catalyst. PMID:22662155

  1. [On improvement of the mechanism for establishing and changing indicators of quality and food safety in the regulatory and legal acts of the Eurasian Economical Union].

    PubMed

    Arnautov, O V

    2016-01-01

    In accordance with the Treaty on the Eurasian Economic Union (EAEU) to ensure the sanitary and epidemiological welfare of the population within the Union, a coordinated policy in agreed policy in the sphere of application of sanitary measures is carried out. Sanitary measures are the obligatory requirements and procedures, including requirements for the final product, processing methods, production, transportation, storage and disposal, sampling procedures, methods of research (tests), risk assessment, the state registration, requirements for packaging directly aimed at ensuring the safety of products (goods) in order to protect human welfare, and they should be applied on the basis having a scientific explanation, and only to the extent that is necessary to protect human welfare. Sanitary measures applied within the Union should be based on international and regional standards, guidelines and (or) the recommendations, except when they based on appropriate scientific studies and explanations. In this case sanitary measures which could provide a higher level of sanitary protection are introduced. At present, the mechanism of the development, justification and approval of common sanitary and epidemiological requirements (ESR) and procedures of the Eurasian Economic Commission (the Commission) is not installed. The absence of a clear mechanism for the development, approval and implementation of the ESR to the products (goods) on the basis having a scientific explanation on the one hand could lead to the creation of unjustified barriers to foreign and mutual trade, on the other--to weaken the level of safety for human life and health of products (goods) placed on markets of the Union. In order to bring the regulatory legal acts of the Customs Union in accordance with the Treaty on the Eurasian Economic Union the Commission in cooperation with the competent authorities of the Member States in the field of sanitary and epidemiological welfare developed the project of

  2. Canonical Pedagogical Content Knowledge by Cores for Teaching Acid-Base Chemistry at High School

    ERIC Educational Resources Information Center

    Alvarado, Clara; Cañada, Florentina; Garritz, Andoni; Mellado, Vicente

    2015-01-01

    The topic of acid-base chemistry is one of the oldest in general chemistry courses and it has been almost continuously in academic discussion. The central purpose of documenting the knowledge and beliefs of a group of ten Mexican teachers with experience in teaching acid-base chemistry in high school was to know how they design, prepare and…

  3. Acid-base properties of the surface of the α-Al2O3 suspension

    NASA Astrophysics Data System (ADS)

    Ryazanov, M. A.; Dudkin, B. N.

    2009-12-01

    The distribution of the acid-base centers on the surface of α-Al2O3 suspension particles was studied by potentiometric titration, and the corresponding p K spectra were constructed. It was inferred that the double electric layer created by the supporting electrolyte substantially affected the screening of the acid-base centers on the particle surface of the suspension.

  4. Collaborative Strategies for Teaching Common Acid-Base Disorders to Medical Students

    ERIC Educational Resources Information Center

    Petersen, Marie Warrer; Toksvang, Linea Natalie; Plovsing, Ronni R.; Berg, Ronan M. G.

    2014-01-01

    The ability to recognize and diagnose acid-base disorders is of the utmost importance in the clinical setting. However, it has been the experience of the authors that medical students often have difficulties learning the basic principles of acid-base physiology in the respiratory physiology curriculum, particularly when applying this knowledge to…

  5. A Comparative Study of French and Turkish Students' Ideas on Acid-Base Reactions

    ERIC Educational Resources Information Center

    Cokelez, Aytekin

    2010-01-01

    The goal of this comparative study was to determine the knowledge that French and Turkish upper secondary-school students (grades 11 and 12) acquire on the concept of acid-base reactions. Following an examination of the relevant curricula and textbooks in the two countries, 528 students answered six written questions about the acid-base concept.…

  6. Thai Grade 11 Students' Alternative Conceptions for Acid-Base Chemistry

    ERIC Educational Resources Information Center

    Artdej, Romklao; Ratanaroutai, Thasaneeya; Coll, Richard Kevin; Thongpanchang, Tienthong

    2010-01-01

    This study involved the development of a two-tier diagnostic instrument to assess Thai high school students' understanding of acid-base chemistry. The acid-base diagnostic test (ABDT) comprising 18 items was administered to 55 Grade 11 students in a science and mathematics programme during the second semester of the 2008 academic year. Analysis of…

  7. Using the Logarithmic Concentration Diagram, Log "C", to Teach Acid-Base Equilibrium

    ERIC Educational Resources Information Center

    Kovac, Jeffrey

    2012-01-01

    Acid-base equilibrium is one of the most important and most challenging topics in a typical general chemistry course. This article introduces an alternative to the algebraic approach generally used in textbooks, the graphical log "C" method. Log "C" diagrams provide conceptual insight into the behavior of aqueous acid-base systems and allow…

  8. High School Students' Understanding of Acid-Base Concepts: An Ongoing Challenge for Teachers

    ERIC Educational Resources Information Center

    Damanhuri, Muhd Ibrahim Muhamad; Treagust, David F.; Won, Mihye; Chandrasegaran, A. L.

    2016-01-01

    Using a quantitative case study design, the "Acids-Bases Chemistry Achievement Test" ("ABCAT") was developed to evaluate the extent to which students in Malaysian secondary schools achieved the intended curriculum on acid-base concepts. Responses were obtained from 260 Form 5 (Grade 11) students from five schools to initially…

  9. Study on the Regulatory Mechanism of the Lipid Metabolism Pathways during Chicken Male Germ Cell Differentiation Based on RNA-Seq

    PubMed Central

    Zuo, Qisheng; Li, Dong; Zhang, Lei; Elsayed, Ahmed Kamel; Lian, Chao; Shi, Qingqing; Zhang, Zhentao; Zhu, Rui; Wang, Yinjie; Jin, Kai; Zhang, Yani; Li, Bichun

    2015-01-01

    Here, we explore the regulatory mechanism of lipid metabolic signaling pathways and related genes during differentiation of male germ cells in chickens, with the hope that better understanding of these pathways may improve in vitro induction. Fluorescence-activated cell sorting was used to obtain highly purified cultures of embryonic stem cells (ESCs), primitive germ cells (PGCs), and spermatogonial stem cells (SSCs). The total RNA was then extracted from each type of cell. High-throughput analysis methods (RNA-seq) were used to sequence the transcriptome of these cells. Gene Ontology (GO) analysis and the KEGG database were used to identify lipid metabolism pathways and related genes. Retinoic acid (RA), the end-product of the retinol metabolism pathway, induced in vitro differentiation of ESC into male germ cells. Quantitative real-time PCR (qRT-PCR) was used to detect changes in the expression of the genes involved in the retinol metabolic pathways. From the results of RNA-seq and the database analyses, we concluded that there are 328 genes in 27 lipid metabolic pathways continuously involved in lipid metabolism during the differentiation of ESC into SSC in vivo, including retinol metabolism. Alcohol dehydrogenase 5 (ADH5) and aldehyde dehydrogenase 1 family member A1 (ALDH1A1) are involved in RA synthesis in the cell. ADH5 was specifically expressed in PGC in our experiments and aldehyde dehydrogenase 1 family member A1 (ALDH1A1) persistently increased throughout development. CYP26b1, a member of the cytochrome P450 superfamily, is involved in the degradation of RA. Expression of CYP26b1, in contrast, decreased throughout development. Exogenous RA in the culture medium induced differentiation of ESC to SSC-like cells. The expression patterns of ADH5, ALDH1A1, and CYP26b1 were consistent with RNA-seq results. We conclude that the retinol metabolism pathway plays an important role in the process of chicken male germ cell differentiation. PMID:25658587

  10. Structural analysis of cysteine S-nitrosylation: a modified acid-based motif and the emerging role of trans-nitrosylation

    PubMed Central

    Marino, Stefano M.; Gladyshev, Vadim N.

    2009-01-01

    S-nitrosylation, the selective and reversible addition of nitric oxide (NO) moiety to cysteine (Cys) sulfur in proteins, regulates numerous cellular processes. In recent years, proteomic approaches have been developed that are capable of identifying nitrosylated Cys residues. However, the features underlying specificity of Cys modification with NO remain poorly defined. Previous studies suggested that S-nitrosylated Cys may be flanked by an acid-base motif or hydrophobic areas, and show high reactivity, low pKa and high sulfur atom exposure. In the current study, we prepared an extensive, manually curated dataset of proteins with S-nitrosothiols, accounting for a variety of biochemical functions, organisms of origin and physiological responses to NO. Analysis of this generic NO-Cys dataset revealed that proximal acid-base motif, Cys pKa, sulfur atom exposure, Cys conservation or hydrophobicity in the vicinity of the modified Cys do not define the specificity of S-nitrosylation. Instead, this analysis revealed a revised acid-base motif, which is located more distantly to the Cys and has its charged groups exposed. We hypothesize that, rather than being strictly employed for direct activation of Cys, the modified acid-base motif is engaged in protein-protein interactions whereby contributing to trans-nitrosylation as an important and widespread mechanism for reversible modification of Cys with NO moiety. For proteins lacking the revised motif, we discuss alternative mechanisms including a potential role of nitrosoglutathione as a transacting agent. PMID:19854201

  11. Acid-base chemistry of frustrated water at protein interfaces.

    PubMed

    Fernández, Ariel

    2016-01-01

    Water molecules at a protein interface are often frustrated in hydrogen-bonding opportunities due to subnanoscale confinement. As shown, this condition makes them behave as a general base that may titrate side-chain ammonium and guanidinium cations. Frustration-based chemistry is captured by a quantum mechanical treatment of proton transference and shown to remove same-charge uncompensated anticontacts at the interface found in the crystallographic record and in other spectroscopic information on the aqueous interface. Such observations are untenable within classical arguments, as hydronium is a stronger acid than ammonium or guanidinium. Frustration enables a directed Grotthuss mechanism for proton transference stabilizing same-charge anticontacts. PMID:26762189

  12. Regulatory Mechanisms Underlying Oil Palm Fruit Mesocarp Maturation, Ripening, and Functional Specialization in Lipid and Carotenoid Metabolism1[W][OA

    PubMed Central

    Tranbarger, Timothy J.; Dussert, Stéphane; Joët, Thierry; Argout, Xavier; Summo, Marilyne; Champion, Antony; Cros, David; Omore, Alphonse; Nouy, Bruno; Morcillo, Fabienne

    2011-01-01

    Fruit provide essential nutrients and vitamins for the human diet. Not only is the lipid-rich fleshy mesocarp tissue of the oil palm (Elaeis guineensis) fruit the main source of edible oil for the world, but it is also the richest dietary source of provitamin A. This study examines the transcriptional basis of these two outstanding metabolic characters in the oil palm mesocarp. Morphological, cellular, biochemical, and hormonal features defined key phases of mesocarp development. A 454 pyrosequencing-derived transcriptome was then assembled for the developmental phases preceding and during maturation and ripening, when high rates of lipid and carotenoid biosynthesis occur. A total of 2,629 contigs with differential representation revealed coordination of metabolic and regulatory components. Further analysis focused on the fatty acid and triacylglycerol assembly pathways and during carotenogenesis. Notably, a contig similar to the Arabidopsis (Arabidopsis thaliana) seed oil transcription factor WRINKLED1 was identified with a transcript profile coordinated with those of several fatty acid biosynthetic genes and the high rates of lipid accumulation, suggesting some common regulatory features between seeds and fruits. We also focused on transcriptional regulatory networks of the fruit, in particular those related to ethylene transcriptional and GLOBOSA/PISTILLATA-like proteins in the mesocarp and a central role for ethylene-coordinated transcriptional regulation of type VII ethylene response factors during ripening. Our results suggest that divergence has occurred in the regulatory components in this monocot fruit compared with those identified in the dicot tomato (Solanum lycopersicum) fleshy fruit model. PMID:21487046

  13. Seawater salinity and blood acid-base balance in the lugworm, Arenicola marina (L.).

    PubMed

    Toulmond, A; Jouin, C

    1992-03-01

    The kinetics of variations in the blood acid base balance (ABB) were investigated in a moderately euryhaline osmoconformer, the lugworm Arenicola marina (L.), exposed to natural and experimental hypo- or hyperosmotic shocks. In natural as well as in experimental conditions, a hyposmotic shock induced a transient and essentially metabolic acidosis, probably linked to the ionic readjustments following the shock, which was rapidly overridden by a metabolic alkalosis. In field conditions, a new ABB equilibrium was then attained, the metabolic alkalosis being neutralized by the respiratory and metabolic acidosis occurring normally in the lugworm during low tide. Conversely, in the normoxic conditions of our laboratory experiments, a new ABB equilibrium was never reached. Under experimental conditions, a hyperosmotic shock always induced a respiratory and metabolic acidosis. In the field, this phenomenon must occur at the beginning of high tide and must help to restore normal blood ABB in lugworms submitted to a moderate hyposmotic shock during low tide. All the observed blood ABB variations reveal the complex intracellular processes through which the lugworm submitted to moderate osmotic shocks tentatively regulates, sometimes without any real success, its osmoticity and volume. Obviously, complementary physical, physiological and behavioral mechanisms allow the lugworm to live in sediments washed by almost fresh water during a 7-8 h 'low tide'. PMID:1604064

  14. Regulatory Physiology

    NASA Technical Reports Server (NTRS)

    Lane, Helen W.; Whitson, Peggy A.; Putcha, Lakshmi; Baker, Ellen; Smith, Scott M.; Stewart, Karen; Gretebeck, Randall; Nimmagudda, R. R.; Schoeller, Dale A.; Davis-Street, Janis

    1999-01-01

    As noted elsewhere in this report, a central goal of the Extended Duration Orbiter Medical Project (EDOMP) was to ensure that cardiovascular and muscle function were adequate to perform an emergency egress after 16 days of spaceflight. The goals of the Regulatory Physiology component of the EDOMP were to identify and subsequently ameliorate those biochemical and nutritional factors that deplete physiological reserves or increase risk for disease, and to facilitate the development of effective muscle, exercise, and cardiovascular countermeasures. The component investigations designed to meet these goals focused on biochemical and physiological aspects of nutrition and metabolism, the risk of renal (kidney) stone formation, gastrointestinal function, and sleep in space. Investigations involved both ground-based protocols to validate proposed methods and flight studies to test those methods. Two hardware tests were also completed.

  15. Regulatory Anatomy

    PubMed Central

    2015-01-01

    This article proposes the term “safety logics” to understand attempts within the European Union (EU) to harmonize member state legislation to ensure a safe and stable supply of human biological material for transplants and transfusions. With safety logics, I refer to assemblages of discourses, legal documents, technological devices, organizational structures, and work practices aimed at minimizing risk. I use this term to reorient the analytical attention with respect to safety regulation. Instead of evaluating whether safety is achieved, the point is to explore the types of “safety” produced through these logics as well as to consider the sometimes unintended consequences of such safety work. In fact, the EU rules have been giving rise to complaints from practitioners finding the directives problematic and inadequate. In this article, I explore the problems practitioners face and why they arise. In short, I expose the regulatory anatomy of the policy landscape. PMID:26139952

  16. Facing acid-base disorders in the third millennium - the Stewart approach revisited.

    PubMed

    Kishen, R; Honoré, Patrick M; Jacobs, R; Joannes-Boyau, O; De Waele, E; De Regt, J; Van Gorp, V; Boer, W; Spapen, Hd

    2014-01-01

    Acid-base disorders are common in the critically ill. Most of these disorders do not cause harm and are self-limiting after appropriate resuscitation and management. Unfortunately, clinicians tend to think about an acid-base disturbance as a "disease" and spend long hours effectively treating numbers rather than the patient. Moreover, a sizable number of intensive-care physicians experience difficulties in interpreting the significance of or understanding the etiology of certain forms of acid-base disequilibria. Traditional tools for interpreting acid-base disorders may not be adequate for analyzing the complex nature of these metabolic abnormalities. Inappropriate interpretation may also lead to wrong clinical conclusions and incorrectly influence clinical management (eg, bicarbonate therapy for metabolic acidosis in different clinical situations). The Stewart approach, based on physicochemical principles, is a robust physiological concept that can facilitate the interpretation and analysis of simple, mixed, and complex acid-base disorders, thereby allowing better diagnosis of the cause of the disturbance and more timely treatment. However, as the concept does not attach importance to plasma bicarbonate, clinicians may find it complicated to use in their daily clinical practice. This article reviews various approaches to interpreting acid-base disorders and suggests the integration of base-excess and Stewart approach for a better interpretation of these metabolic disorders. PMID:24959091

  17. Thai Grade 11 students' alternative conceptions for acid-base chemistry

    NASA Astrophysics Data System (ADS)

    Artdej, Romklao; Ratanaroutai, Thasaneeya; Coll, Richard Kevin; Thongpanchang, Tienthong

    2010-07-01

    This study involved the development of a two-tier diagnostic instrument to assess Thai high school students' understanding of acid-base chemistry. The acid-base diagnostic test (ABDT) comprising 18 items was administered to 55 Grade 11 students in a science and mathematics programme during the second semester of the 2008 academic year. Analysis of students' responses from this study followed the methodology outlined by Çalik and Ayas. The research findings suggest that the ABDT, the multiple choice diagnostic instrument, enables researchers and teachers to classify students' understanding at different levels. Most students exhibited alternative conceptions for several concepts: acid-base theory, dissociation of strong acids or bases, and dissociation of weak acids/bases. Interestingly, one of the concepts that students appeared to find most difficult, and for which they exhibited the most alternative conceptions, was acid-base theory. Some alternative conceptions revealed in this study differ from earlier reports, such as the concept of electrolyte and non-electrolyte solutions as well as the concentration changes of H3O+and OH- in water. These research findings present valuable information for facilitating better understanding of acid-base chemistry by providing insight into the preventable and correctable alternative conceptions exhibited by students.

  18. Exercise training of late-pregnant and nonpregnant dairy cows affects physical fitness and acid-base homeostasis.

    PubMed

    Davidson, J A; Beede, D K

    2009-02-01

    The objective was to determine if exercise training improves physical fitness of nonlactating, late-pregnant and nonpregnant multiparous Holstein cows and alters acid-base homeostasis during an exercise test on a treadmill. Twenty-six pairs (each pair having 1 late-pregnant and 1 nonpregnant) of cows were assigned to treatments of exercise training or no exercise. Exercise training was walking (1.25 to 1.5 h at 3.25 km/h) every other day in an outdoor mechanical walker for 70 d. Cows completed treadmill exercise tests on d 0, 30, and 60 of the experiment or about d 70, 40, and 10 before expected parturition of the pregnant cow of each pair. On d 0, physical fitness was similar among all cows based on durations of treadmill tests, heart rates, and acid-base measurements at given workloads (21.1 +/- 0.6 min; 144 +/- 2.2 beats per min; plasma lactate 3.1 +/- 1.9 mmol/L; and venous blood pH 7.44 +/- 0.0035, respectively). After 60 d of training, exercised cows walked longer during treadmill exercise tests compared with nonexercised cows (23.7 vs. 18.3 +/- 0.85 min, respectively), indicating greater physical fitness (pooled across pregnancy status). Heart rates and plasma lactate concentrations at given workloads were less (144 vs. 156 +/- 2.7 beats per min; and 1.4 vs. 3.2 +/- 0.24 mmol/L for exercised compared with nonexercised cows, respectively). Additionally, exercised cows more effectively maintained acid-base homeostasis during treadmill tests compared with nonexercised cows. Metabolic, endocrine, and nutritional demands associated with late pregnancy did not affect responses differently to exercise training for late-pregnant compared with nonpregnant cows. Overall, exercise training of late-pregnant and nonpregnant cows for 60 d improved physical fitness. PMID:19164665

  19. Schiff base structured acid-base cooperative dual sites in an ionic solid catalyst lead to efficient heterogeneous knoevenagel condensations.

    PubMed

    Zhang, Mingjue; Zhao, Pingping; Leng, Yan; Chen, Guojian; Wang, Jun; Huang, Jun

    2012-10-01

    An acid-base bifunctional ionic solid catalyst [PySaIm](3)PW was synthesized by the anion exchange of the ionic-liquid (IL) precursor 1-(2-salicylaldimine)pyridinium bromide ([PySaIm]Br) with the Keggin-structured sodium phosphotungstate (Na(3) PW). The catalyst was characterized by FTIR, UV/Vis, XRD, SEM, Brunauer-Emmett-Teller (BET) theory, thermogravimetric analysis, (1)H NMR spectroscopy, ESI-MS, elemental analysis, and melting points. Together with various counterparts, [PySaIm](3)PW was evaluated in Knoevenagel condensation under solvent and solvent-free conditions. The Schiff base structure attached to the IL cation of [PySaIm](3)PW involves acidic salicyl hydroxyl and basic imine, and provides a controlled nearby position for the acid-base dual sites. The high melting and insoluble properties of [PySaIm](3)PW are relative to the large volume and high valence of PW anions, as well as the intermolecular hydrogen-bonding networks among inorganic anions and IL cations. The ionic solid catalyst [PySaIm](3)PW leads to heterogeneous Knoevenagel condensations. In solvent-free condensation of benzaldehyde with ethyl cyanoacetate, it exhibits a conversion of 95.8 % and a selectivity of 100 %; the conversion is even much higher than that (78.2 %) with ethanol as a solvent. The solid catalyst has a convenient recoverability with only a slight decrease in conversion following subsequent recyclings. Furthermore, the new catalyst is highly applicable to many substrates of aromatic aldehydes with activated methylene compounds. On the basis of the characterization and reaction results, a unique acid-base cooperative mechanism within a Schiff base structure is proposed and discussed, which thoroughly explains not only the highly efficient catalytic performance of [PySaIm](3)PW, but also the lower activities of various control catalysts. PMID:22907828

  20. Polylactic Acid-Based Polymer Blends for Durable Applications

    NASA Astrophysics Data System (ADS)

    Finniss, Adam

    There has been considerable scientific interest in both research and commercial communities as of late in the area of biologically based or sourced plastics. As the consumption of petroleum rises and concerns about climate change increase, this field is likely to grow even larger. One bioplastic that has received a great deal of attention is polylactic acid (PLA). In the past, this material was used mainly in medical or specialty applications, but advancements in manufacturing have led to a desire to use PLA more widely, especially in durable applications. Unfortunately, PLA has several drawbacks that hinder more widespread usage of the material as a durable item: it has low ductility and impact strength in bulk applications, along with poor stability in the face of heat, humidity or liquid media. To combat these deficiencies, a number of techniques were investigated. Samples were annealed to create crystalline domains that would improve mechanical properties and reduce diffusion, blended with graphene to create barriers to diffusion throughout the material, or compounded with a polycarbonate (PC) polymer phase to protect the PLA phase and to enhance the mechanical properties of the blend. If a material containing biologically sourced components with good mechanical properties can be created, it would be desirable for durable uses such as electronics components or as an automotive grade resin. Crystallization experiments were carried out in a differential scanning calorimeter to determine the effects of heat treatment and additives on the rather slow crystallization kinetics of PLA polymer. It was determined that the blending in of the PC phase did not significantly alter the kinetics or mechanism of crystal growth. The addition of graphene to any PC/PLA formulation served as a nucleating agent which speeded up the crystallization kinetics markedly, in some cases by several orders of magnitude. Results obtained from these experiments were internally consistent

  1. Development of polylactic acid-based materials through reactive modification

    NASA Astrophysics Data System (ADS)

    Fowlks, Alison Camille

    2009-12-01

    Polylactic acid (PLA)-based systems have shown to be of great potential for the development of materials requiring biobased content, biodegradation, and sufficient properties. The efforts in this study are directed toward addressing the current research need to overcome some of the inherent drawbacks of PLA. To meet this need, reactive extrusion was employed to develop new materials based on PLA by grafting, compounding, and polymer blending. In the first part of this work, maleic anhydride (MA) was grafted onto PLA by reactive extrusion. Two structurally different peroxides were used to initiate grafting and results were reported on the basis of grafting, molecular weight, and thermal behavior. An inverse relationship between degree of grafting and molecular weight was established. It was also found that, regardless of peroxide type, there is an optimum peroxid-to-MA ratio of 0.5:2 that promotes maximum grafting, beyond which degradation reactions become predominant. Overall, it was found that the maleated copolymer (MAPLA) could be used as an interfacial modifier in PLA-based composites. Therefore, MAPLA was incorporated into PLA-talc composites in varying concentrations. The influence of the MAPLA addition on the mechanical and thermal behavior was investigated. When added in an optimum concentration, MAPLA improved the tensile strength and crystallization of the composite. Furthermore, microscopic observation confirmed the compatibilization effect of MAPLA in PLA-talc composites. Vinyltrimethoxysilane was free-radically grafted onto the backbone of PLA and subsequently moisture crosslinked. The effects of monomer, initiator, and catalyst concentration on the degree of crosslinking and the mechanical and thermal properties were investigated. The presence of a small amount of catalyst showed to be a major contributor to the crosslinking formation in the time frame investigated, shown by an increase in gel content and decrease in crystallinity. Furthermore

  2. Polylactic Acid-Based Polymer Blends for Durable Applications

    NASA Astrophysics Data System (ADS)

    Finniss, Adam

    There has been considerable scientific interest in both research and commercial communities as of late in the area of biologically based or sourced plastics. As the consumption of petroleum rises and concerns about climate change increase, this field is likely to grow even larger. One bioplastic that has received a great deal of attention is polylactic acid (PLA). In the past, this material was used mainly in medical or specialty applications, but advancements in manufacturing have led to a desire to use PLA more widely, especially in durable applications. Unfortunately, PLA has several drawbacks that hinder more widespread usage of the material as a durable item: it has low ductility and impact strength in bulk applications, along with poor stability in the face of heat, humidity or liquid media. To combat these deficiencies, a number of techniques were investigated. Samples were annealed to create crystalline domains that would improve mechanical properties and reduce diffusion, blended with graphene to create barriers to diffusion throughout the material, or compounded with a polycarbonate (PC) polymer phase to protect the PLA phase and to enhance the mechanical properties of the blend. If a material containing biologically sourced components with good mechanical properties can be created, it would be desirable for durable uses such as electronics components or as an automotive grade resin. Crystallization experiments were carried out in a differential scanning calorimeter to determine the effects of heat treatment and additives on the rather slow crystallization kinetics of PLA polymer. It was determined that the blending in of the PC phase did not significantly alter the kinetics or mechanism of crystal growth. The addition of graphene to any PC/PLA formulation served as a nucleating agent which speeded up the crystallization kinetics markedly, in some cases by several orders of magnitude. Results obtained from these experiments were internally consistent

  3. An attempt to use the peritoneal cavity fluid in the diagnostics of acid-base balance disorders in dogs.

    PubMed

    Sławuta, P; Glińska-Suchocka, K

    2013-01-01

    The acid-base balance parameters (ABB) of blood are used in the diagnostics and therapy of acidosis or alkalosis type disorders. Nowadays, some reports on the attempts to use the body cavity fluid for the diagnostics of the ABB disorders have appeared in the human medicine. The study has aimed at comparing the acid-base balance parameters (ABB): pH, pCO2, and HCO3(-) determined in the arterial blood and the fluid from the peritoneal cavity in dogs. The study was carried out on 20 dogs suffering from ascites developed as a result of the chronic renal failure. 1 ml of full blood was drawn from each dog from its femoral artery to a heparinized syringe equipped with a needle with an internal diameter of 0.7 mm and the puncture of the abdominal cavity was carried out in the white line. In the sample of arterial blood and the sample of the abdominal cavity fluid drawn the ABB parameters were determined. In the group examined, the ABB parameters determined for the arterial blood and the fluid had comparable numeric values and the same nature of the ABB disorder diagnosed on the basis of them. The conclusions are as follows: the results of the effusion fluid gasometry depend on the mechanism of the fluid formation and, in the case when it comes from the developed capillary network, a pressure of gases and remaining ABB parameters are similar to those determined for the arterial blood. PMID:24195280

  4. Regulatory Snapshots: integrative mining of regulatory modules from expression time series and regulatory networks.

    PubMed

    Gonçalves, Joana P; Aires, Ricardo S; Francisco, Alexandre P; Madeira, Sara C

    2012-01-01

    Explaining regulatory mechanisms is crucial to understand complex cellular responses leading to system perturbations. Some strategies reverse engineer regulatory interactions from experimental data, while others identify functional regulatory units (modules) under the assumption that biological systems yield a modular organization. Most modular studies focus on network structure and static properties, ignoring that gene regulation is largely driven by stimulus-response behavior. Expression time series are key to gain insight into dynamics, but have been insufficiently explored by current methods, which often (1) apply generic algorithms unsuited for expression analysis over time, due to inability to maintain the chronology of events or incorporate time dependency; (2) ignore local patterns, abundant in most interesting cases of transcriptional activity; (3) neglect physical binding or lack automatic association of regulators, focusing mainly on expression patterns; or (4) limit the discovery to a predefined number of modules. We propose Regulatory Snapshots, an integrative mining approach to identify regulatory modules over time by combining transcriptional control with response, while overcoming the above challenges. Temporal biclustering is first used to reveal transcriptional modules composed of genes showing coherent expression profiles over time. Personalized ranking is then applied to prioritize prominent regulators targeting the modules at each time point using a network of documented regulatory associations and the expression data. Custom graphics are finally depicted to expose the regulatory activity in a module at consecutive time points (snapshots). Regulatory Snapshots successfully unraveled modules underlying yeast response to heat shock and human epithelial-to-mesenchymal transition, based on regulations documented in the YEASTRACT and JASPAR databases, respectively, and available expression data. Regulatory players involved in functionally enriched

  5. Noncoding Regulatory RNAs in Hematopoiesis.

    PubMed

    Jeong, M; Goodell, M A

    2016-01-01

    Hematopoiesis is a dynamic process in which blood cells are continuously generated from hematopoietic stem cells (HSCs). The regulatory mechanisms controlling HSC fate have been studied extensively over the past several decades. Although many protein-coding genes have been shown to regulate hematopoietic differentiation, additional levels of HSC regulation are not well studied. Advances in deep sequencing have revealed many new classes of regulatory noncoding RNAs (ncRNAs), such as enhancer RNAs and antisense ncRNAs. Functional analysis of some of these ncRNAs has provided insights into the molecular mechanisms that regulate hematopoietic development and disease. In this review, we summarize recent advances in our understanding of functional regulatory ncRNAs associated with hematopoietic self-renewal and differentiation, as well as those dysregulated ncRNAs involved in hematologic malignancies. PMID:27137659

  6. T Regulatory Type 1 Cells in Squamous Cell Carcinoma of the Head and Neck: Mechanisms of Suppression and Expansion in Advanced Disease

    PubMed Central

    Bergmann, Christoph; Strauss, Laura; Wang, Yun; Szczepanski, Miroslaw J.; Lang, Stephan; Johnson, Jonas T.; Whiteside, Theresa L.

    2013-01-01

    Purpose Regulatory T cells play a major role in tumor escape from immunosurveillance. T regulatory cells type 1 (Tr1), a subset of regulatory T cells present in the tumor and peripheral circulation of patients with head and neck squamous cell carcinoma (HNSCC), mediate immune suppression and might contribute to tumor progression. Experimental Design CD4+CD25− T cells were isolated from peripheral blood mononuclear cells (PBMC) or tumor-infiltrating lymphocytes (TIL) of 26 HNSCC patients and 10 normal controls. The Tr1 cell phenotype was determined before and after culture in the presence of interleukin (IL)-2, IL-10, and IL-15, each at 10 to 20 IU/mL. Suppression was measured in carboxyfluorescein diacetate succinimidyl ester – based proliferation assays with or without neutralizing anti-IL-10 or anti – transforming growth factor-β1 (TGF-β1) monoclonal antibodies in Transwell systems. ELISA was used to define the Tr1 cytokine profile. Results Tr1 cells originate from CD4+CD25− precursors present in TIL and PBMC of HNSCC patients. Cytokine-driven ex vivo expansion of Tr1 precursors yielded CD4+CD25−Foxp3lowCD132+IL-10+TGF-β1 + populations that mediated higher suppression than Tr1 cells of normal controls (P < 0.0001). Tr1 cells suppressed proliferation of autologous responders via IL-10 and TGF-β1 secretion. Expression of these cytokines was higher in TIL-derived than PBMC-derived Tr1 cells (P < 0.0001). The Tr1 cell frequency and suppressor function were significantly higher in patients presenting with advanced than early disease stages and in patients “cured” by oncologic therapies than in those with active disease. Conclusions In HNSCC, Tr1 cell generation is promoted at the tumor site. Tr1 cells use TGF-β and IL-10 to mediate suppression. They expand during disease progression and also following cancer therapy in patients with no evident disease. PMID:18559587

  7. Salicylic Acid-Based Polymers for Guided Bone Regeneration Using Bone Morphogenetic Protein-2

    PubMed Central

    Subramanian, Sangeeta; Mitchell, Ashley; Yu, Weiling; Snyder, Sabrina; Uhrich, Kathryn

    2015-01-01

    Bone morphogenetic protein-2 (BMP-2) is used clinically to promote spinal fusion, treat complex tibia fractures, and to promote bone formation in craniomaxillofacial surgery. Excessive bone formation at sites where BMP-2 has been applied is an established complication and one that could be corrected by guided tissue regeneration methods. In this study, anti-inflammatory polymers containing salicylic acid [salicylic acid-based poly(anhydride-ester), SAPAE] were electrospun with polycaprolactone (PCL) to create thin flexible matrices for use as guided bone regeneration membranes. SAPAE polymers hydrolyze to release salicylic acid, which is a nonsteroidal anti-inflammatory drug. PCL was used to enhance the mechanical integrity of the matrices. Two different SAPAE-containing membranes were produced and compared: fast-degrading (FD-SAPAE) and slow-degrading (SD-SAPAE) membranes that release salicylic acid at a faster and slower rate, respectively. Rat femur defects were treated with BMP-2 and wrapped with FD-SAPAE, SD-SAPAE, or PCL membrane or were left unwrapped. The effects of different membranes on bone formation within and outside of the femur defects were measured by histomorphometry and microcomputed tomography. Bone formation within the defect was not affected by membrane wrapping at BMP-2 doses of 12 μg or more. In contrast, the FD-SAPAE membrane significantly reduced bone formation outside the defect compared with all other treatments. The rapid release of salicylic acid from the FD-SAPAE membrane suggests that localized salicylic acid treatment during the first few days of BMP-2 treatment can limit ectopic bone formation. The data support development of SAPAE polymer membranes for guided bone regeneration applications as well as barriers to excessive bone formation. PMID:25813520

  8. Acid-base and electrolyte abnormalities during renal support for acute kidney injury: recognition and management.

    PubMed

    Claure-Del Granado, Rolando; Claure, Rolando; Bouchard, Josée

    2012-01-01

    Acute kidney injury (AKI) is associated with electrolyte and acid-base disturbances such as hyperkalemia, metabolic acidosis, hypocalcemia and hyperphosphatemia. The initiation of dialysis in AKI can efficiently treat these complications. The choice of dialysis modality can be made based on their operational characteristics to tailor the therapy according to the clinical scenario. Each dialysis modality can also trigger significant electrolyte and acid-base disorders, such as hypokalemia, hypophosphatemia and metabolic alkalosis, which may direct changes in fluid delivery and composition. Continuous techniques may be particularly useful in these situations as they allow more time for correction and to maintain balance. This review provides an overview of the electrolyte and acid-base disturbances occurring in AKI and after the initiation of dialysis and discusses therapeutic options in this setting. PMID:23095419

  9. Absorption, fluorescence, and acid-base equilibria of rhodamines in micellar media of sodium dodecyl sulfate.

    PubMed

    Obukhova, Elena N; Mchedlov-Petrossyan, Nikolay O; Vodolazkaya, Natalya A; Patsenker, Leonid D; Doroshenko, Andrey O; Marynin, Andriy I; Krasovitskii, Boris M

    2017-01-01

    Rhodamine dyes are widely used as molecular probes in different fields of science. The aim of this paper was to ascertain to what extent the structural peculiarities of the compounds influence their absorption, emission, and acid-base properties under unified conditions. The acid-base dissociation (HR(+)⇄R+H(+)) of a series of rhodamine dyes was studied in sodium n-dodecylsulfate micellar solutions. In this media, the form R exists as a zwitterion R(±). The indices of apparent ionization constants of fifteen rhodamine cations HR(+) with different substituents in the xanthene moiety vary within the range of pKa(app)=5.04 to 5.53. The distinct dependence of emission of rhodamines bound to micelles on pH of bulk water opens the possibility of using them as fluorescent interfacial acid-base indicators. PMID:27423469

  10. Essentials in the diagnosis of acid-base disorders and their high altitude application.

    PubMed

    Paulev, P E; Zubieta-Calleja, G R

    2005-09-01

    This report describes the historical development in the clinical application of chemical variables for the interpretation of acid-base disturbances. The pH concept was already introduced in 1909. Following World War II, disagreements concerning the definition of acids and bases occurred, and since then two strategies have been competing. Danish scientists in 1923 defined an acid as a substance able to give off a proton at a given pH, and a base as a substance that could bind a proton, whereas the North American Singer-Hasting school in 1948 defined acids as strong non-buffer anions and bases as non-buffer cations. As a consequence of this last definition, electrolyte disturbances were mixed up with real acid-base disorders and the variable, strong ion difference (SID), was introduced as a measure of non-respiratory acid-base disturbances. However, the SID concept is only an empirical approximation. In contrast, the Astrup/Siggaard-Andersen school of scientists, using computer strategies and the Acid-base Chart, has made diagnosis of acid-base disorders possible at a glance on the Chart, when the data are considered in context with the clinical development. Siggaard-Andersen introduced Base Excess (BE) or Standard Base Excess (SBE) in the extracellular fluid volume (ECF), extended to include the red cell volume (eECF), as a measure of metabolic acid-base disturbances and recently replaced it by the term Concentration of Titratable Hydrogen Ion (ctH). These two concepts (SBE and ctH) represent the same concentration difference, but with opposite signs. Three charts modified from the Siggaard-Andersen Acid-Base Chart are presented for use at low, medium and high altitudes of 2500 m, 3500 m, and 4000 m, respectively. In this context, the authors suggest the use of Titratable Hydrogen Ion concentration Difference (THID) in the extended extracellular fluid volume, finding it efficient and better than any other determination of the metabolic component in acid-base

  11. Closed cycle ion exchange method for regenerating acids, bases and salts

    DOEpatents

    Dreyfuss, Robert M.

    1976-01-01

    A method for conducting a chemical reaction in acidic, basic, or neutral solution as required and then regenerating the acid, base, or salt by means of ion exchange in a closed cycle reaction sequence which comprises contacting the spent acid, base, or salt with an ion exchanger, preferably a synthetic organic ion-exchange resin, so selected that the counter ions thereof are ions also produced as a by-product in the closed reaction cycle, and then regenerating the spent ion exchanger by contact with the by-product counter ions. The method is particularly applicable to closed cycle processes for the thermochemical production of hydrogen.

  12. Bifunctional Organic Polymeric Catalysts with a Tunable Acid-Base Distance and Framework Flexibility

    NASA Astrophysics Data System (ADS)

    Chen, Huanhui; Wang, Yanan; Wang, Qunlong; Li, Junhui; Yang, Shiqi; Zhu, Zhirong

    2014-09-01

    Acid-base bifunctional organic polymeric catalysts were synthesized with tunable structures. we demonstrated two synthesis approaches for structural fine-tune. In the first case, the framework flexibility was tuned by changing the ratio of rigid blocks to flexible blocks within the polymer framework. In the second case, we precisely adjusted the acid-base distance by distributing basic monomers to be adjacent to acidic monomers, and by changing the chain length of acidic monomers. In a standard test reaction for the aldol condensation of 4-nitrobenzaldehyde with acetone, the catalysts showed good reusability upon recycling and maintained relatively high conversion percentage.

  13. Silica nanoparticles as a delivery system for nucleic acid-based reagents

    PubMed Central

    Hom, Christopher; Lu, Jie

    2010-01-01

    The transport of nucleic acid-based reagents is predicated upon developing structurally stable delivery systems that can preferentially bind and protect DNA and RNA, and release their cargo upon reaching their designated sites. Recent advancements in tailoring the size, shape, and external surface functionalization of silica materials have led to increased biocompatibility and efficiency of delivery. In this Feature Article, we highlight recent research progress in the use of silica nanoparticles as a delivery vehicle for nucleic acid-based reagents. PMID:20740060

  14. Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems

    PubMed Central

    Lui, Clarissa; Cady, Nathaniel C.; Batt, Carl A.

    2009-01-01

    The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform. PMID:22412335

  15. Surface acid-base characteristics of fiber materials by contact angle measurements

    SciTech Connect

    Mao Youan . Dept. of Materials Science and Applied Chemistry)

    1993-11-05

    Contact angle measurements were used to study the surface acid-base characteristics of treated and untreated carbon fibers, and of treated and untreated silicon carbide fibers. It has been shown that, when untreated the surfaces of these two fibers exhibits amphoteric, but the base character is dominant. After oxidization in a liquid phase, the surface acid character of the carbon fibers changes little, whereas the base character becomes much stronger. The treatment, with boiling-concentrated HNO[sub 3] for three hours and the sintering treatment in air at 500 C. for eight hours, has little effect on the surface acid-base characteristics of the silicon carbide fibers.

  16. The Comparative Studies of Binding Activity of Curcumin and Didemethylated Curcumin with Selenite: Hydrogen Bonding vs Acid-Base Interactions.

    PubMed

    Liao, Jiahn-Haur; Wu, Tzu-Hua; Chen, Ming-Yi; Chen, Wei-Ting; Lu, Shou-Yun; Wang, Yi-Hsuan; Wang, Shao-Pin; Hsu, Yen-Min; Huang, Yi-Shiang; Huang, Zih-You; Lin, Yu-Ching; Chang, Ching-Ming; Huang, Fu-Yung; Wu, Shih-Hsiung

    2015-01-01

    In this report, the in vitro relative capabilities of curcumin (CCM) and didemethylated curcumin (DCCM) in preventing the selenite-induced crystallin aggregation were investigated by turbidity tests and isothermal titration calorimetry (ITC). DCCM showed better activity than CCM. The conformers of CCM/SeO3(2-) and DCCM/SeO3(2-) complexes were optimized by molecular orbital calculations. Results reveal that the selenite anion surrounded by CCM through the H-bonding between CCM and selenite, which is also observed via IR and NMR studied. For DCCM, the primary driving force is the formation of an acid-base adduct with selenite showing that the phenolic OH group of DCCM was responsible for forming major conformer of DCCM. The formation mechanisms of selenite complexes with CCM or DCCM explain why DCCM has greater activity than CCM in extenuating the toxicity of selenite as to prevent selenite-induced lens protein aggregation. PMID:26635113

  17. The effect of acid-base clustering and ions on the growth of atmospheric nano-particles

    NASA Astrophysics Data System (ADS)

    Lehtipalo, Katrianne; Rondo, Linda; Kontkanen, Jenni; Schobesberger, Siegfried; Jokinen, Tuija; Sarnela, Nina; Kürten, Andreas; Ehrhart, Sebastian; Franchin, Alessandro; Nieminen, Tuomo; Riccobono, Francesco; Sipilä, Mikko; Yli-Juuti, Taina; Duplissy, Jonathan; Adamov, Alexey; Ahlm, Lars; Almeida, João; Amorim, Antonio; Bianchi, Federico; Breitenlechner, Martin; Dommen, Josef; Downard, Andrew J.; Dunne, Eimear M.; Flagan, Richard C.; Guida, Roberto; Hakala, Jani; Hansel, Armin; Jud, Werner; Kangasluoma, Juha; Kerminen, Veli-Matti; Keskinen, Helmi; Kim, Jaeseok; Kirkby, Jasper; Kupc, Agnieszka; Kupiainen-Määttä, Oona; Laaksonen, Ari; Lawler, Michael J.; Leiminger, Markus; Mathot, Serge; Olenius, Tinja; Ortega, Ismael K.; Onnela, Antti; Petäjä, Tuukka; Praplan, Arnaud; Rissanen, Matti P.; Ruuskanen, Taina; Santos, Filipe D.; Schallhart, Simon; Schnitzhofer, Ralf; Simon, Mario; Smith, James N.; Tröstl, Jasmin; Tsagkogeorgas, Georgios; Tomé, António; Vaattovaara, Petri; Vehkamäki, Hanna; Vrtala, Aron E.; Wagner, Paul E.; Williamson, Christina; Wimmer, Daniela; Winkler, Paul M.; Virtanen, Annele; Donahue, Neil M.; Carslaw, Kenneth S.; Baltensperger, Urs; Riipinen, Ilona; Curtius, Joachim; Worsnop, Douglas R.; Kulmala, Markku

    2016-05-01

    The growth of freshly formed aerosol particles can be the bottleneck in their survival to cloud condensation nuclei. It is therefore crucial to understand how particles grow in the atmosphere. Insufficient experimental data has impeded a profound understanding of nano-particle growth under atmospheric conditions. Here we study nano-particle growth in the CLOUD (Cosmics Leaving OUtdoors Droplets) chamber, starting from the formation of molecular clusters. We present measured growth rates at sub-3 nm sizes with different atmospherically relevant concentrations of sulphuric acid, water, ammonia and dimethylamine. We find that atmospheric ions and small acid-base clusters, which are not generally accounted for in the measurement of sulphuric acid vapour, can participate in the growth process, leading to enhanced growth rates. The availability of compounds capable of stabilizing sulphuric acid clusters governs the magnitude of these effects and thus the exact growth mechanism. We bring these observations into a coherent framework and discuss their significance in the atmosphere.

  18. The Comparative Studies of Binding Activity of Curcumin and Didemethylated Curcumin with Selenite: Hydrogen Bonding vs Acid-Base Interactions

    NASA Astrophysics Data System (ADS)

    Liao, Jiahn-Haur; Wu, Tzu-Hua; Chen, Ming-Yi; Chen, Wei-Ting; Lu, Shou-Yun; Wang, Yi-Hsuan; Wang, Shao-Pin; Hsu, Yen-Min; Huang, Yi-Shiang; Huang, Zih-You; Lin, Yu-Ching; Chang, Ching-Ming; Huang, Fu-Yung; Wu, Shih-Hsiung

    2015-12-01

    In this report, the in vitro relative capabilities of curcumin (CCM) and didemethylated curcumin (DCCM) in preventing the selenite-induced crystallin aggregation were investigated by turbidity tests and isothermal titration calorimetry (ITC). DCCM showed better activity than CCM. The conformers of CCM/SeO32- and DCCM/SeO32- complexes were optimized by molecular orbital calculations. Results reveal that the selenite anion surrounded by CCM through the H-bonding between CCM and selenite, which is also observed via IR and NMR studied. For DCCM, the primary driving force is the formation of an acid-base adduct with selenite showing that the phenolic OH group of DCCM was responsible for forming major conformer of DCCM. The formation mechanisms of selenite complexes with CCM or DCCM explain why DCCM has greater activity than CCM in extenuating the toxicity of selenite as to prevent selenite-induced lens protein aggregation.

  19. The Comparative Studies of Binding Activity of Curcumin and Didemethylated Curcumin with Selenite: Hydrogen Bonding vs Acid-Base Interactions

    PubMed Central

    Liao, Jiahn-Haur; Wu, Tzu-Hua; Chen, Ming-Yi; Chen, Wei-Ting; Lu, Shou-Yun; Wang, Yi-Hsuan; Wang, Shao-Pin; Hsu, Yen-Min; Huang, Yi-Shiang; Huang, Zih-You; Lin, Yu-Ching; Chang, Ching-Ming; Huang, Fu-Yung; Wu, Shih-Hsiung

    2015-01-01

    In this report, the in vitro relative capabilities of curcumin (CCM) and didemethylated curcumin (DCCM) in preventing the selenite-induced crystallin aggregation were investigated by turbidity tests and isothermal titration calorimetry (ITC). DCCM showed better activity than CCM. The conformers of CCM/SeO32− and DCCM/SeO32− complexes were optimized by molecular orbital calculations. Results reveal that the selenite anion surrounded by CCM through the H-bonding between CCM and selenite, which is also observed via IR and NMR studied. For DCCM, the primary driving force is the formation of an acid-base adduct with selenite showing that the phenolic OH group of DCCM was responsible for forming major conformer of DCCM. The formation mechanisms of selenite complexes with CCM or DCCM explain why DCCM has greater activity than CCM in extenuating the toxicity of selenite as to prevent selenite-induced lens protein aggregation. PMID:26635113

  20. Fine-mapping analysis revealed complex pleiotropic effect and tissue-specific regulatory mechanism of TNFSF15 in primary biliary cholangitis, Crohn's disease and leprosy.

    PubMed

    Sun, Yonghu; Irwanto, Astrid; Toyo-Oka, Licht; Hong, Myunghee; Liu, Hong; Andiappan, Anand Kumar; Choi, Hyunchul; Hitomi, Yuki; Yu, Gongqi; Yu, Yongxiang; Bao, Fangfang; Wang, Chuan; Fu, Xian; Yue, Zhenhua; Wang, Honglei; Zhang, Huimin; Kawashima, Minae; Kojima, Kaname; Nagasaki, Masao; Nakamura, Minoru; Yang, Suk-Kyun; Ye, Byong Duk; Denise, Yosua; Rotzschke, Olaf; Song, Kyuyoung; Tokunaga, Katsushi; Zhang, Furen; Liu, Jianjun

    2016-01-01

    Genetic polymorphism within the 9q32 locus is linked with increased risk of several diseases, including Crohn's disease (CD), primary biliary cholangitis (PBC) and leprosy. The most likely disease-causing gene within 9q32 is TNFSF15, which encodes the pro-inflammatory cytokine TNF super-family member 15, but it was unknown whether these disparate diseases were associated with the same genetic variance in 9q32, and how variance within this locus might contribute to pathology. Using genetic data from published studies on CD, PBC and leprosy we revealed that bearing a T allele at rs6478108/rs6478109 (r(2) = 1) or rs4979462 was significantly associated with increased risk of CD and decreased risk of leprosy, while the T allele at rs4979462 was associated with significantly increased risk of PBC. In vitro analyses showed that the rs6478109 genotype significantly affected TNFSF15 expression in cells from whole blood of controls, while functional annotation using publicly-available data revealed the broad cell type/tissue-specific regulatory potential of variance at rs6478109 or rs4979462. In summary, we provide evidence that variance within TNFSF15 has the potential to affect cytokine expression across a range of tissues and thereby contribute to protection from infectious diseases such as leprosy, while increasing the risk of immune-mediated diseases including CD and PBC. PMID:27507062

  1. A systematic computational analysis of the rRNA-3' UTR sequence complementarity suggests a regulatory mechanism influencing post-termination events in metazoan translation.

    PubMed

    Pánek, Josef; Kolář, Michal; Herrmannová, Anna; Valášek, Leoš Shivaya

    2016-07-01

    Nucleic acid sequence complementarity underlies many fundamental biological processes. Although first noticed a long time ago, sequence complementarity between mRNAs and ribosomal RNAs still lacks a meaningful biological interpretation. Here we used statistical analysis of large-scale sequence data sets and high-throughput computing to explore complementarity between 18S and 28S rRNAs and mRNA 3' UTR sequences. By the analysis of 27,646 full-length 3' UTR sequences from 14 species covering both protozoans and metazoans, we show that the computed 18S rRNA complementarity creates an evolutionarily conserved localization pattern centered around the ribosomal mRNA entry channel, suggesting its biological relevance and functionality. Based on this specific pattern and earlier data showing that post-termination 80S ribosomes are not stably anchored at the stop codon and can migrate in both directions to codons that are cognate to the P-site deacylated tRNA, we propose that the 18S rRNA-mRNA complementarity selectively stabilizes post-termination ribosomal complexes to facilitate ribosome recycling. We thus demonstrate that the complementarity between 18S rRNA and 3' UTRs has a non-random nature and very likely carries information with a regulatory potential for translational control. PMID:27190231

  2. Fine-mapping analysis revealed complex pleiotropic effect and tissue-specific regulatory mechanism of TNFSF15 in primary biliary cholangitis, Crohn’s disease and leprosy

    PubMed Central

    Sun, Yonghu; Irwanto, Astrid; Toyo-oka, Licht; Hong, Myunghee; Liu, Hong; Andiappan, Anand Kumar; Choi, Hyunchul; Hitomi, Yuki; Yu, Gongqi; Yu, Yongxiang; Bao, Fangfang; Wang, Chuan; Fu, Xian; Yue, Zhenhua; Wang, Honglei; Zhang, Huimin; Kawashima, Minae; Kojima, Kaname; Nagasaki, Masao; Nakamura, Minoru; Yang, Suk-Kyun; Ye, Byong Duk; Denise, Yosua; Rotzschke, Olaf; Song, Kyuyoung; Tokunaga, Katsushi; Zhang, Furen; Liu, Jianjun

    2016-01-01

    Genetic polymorphism within the 9q32 locus is linked with increased risk of several diseases, including Crohn’s disease (CD), primary biliary cholangitis (PBC) and leprosy. The most likely disease-causing gene within 9q32 is TNFSF15, which encodes the pro-inflammatory cytokine TNF super-family member 15, but it was unknown whether these disparate diseases were associated with the same genetic variance in 9q32, and how variance within this locus might contribute to pathology. Using genetic data from published studies on CD, PBC and leprosy we revealed that bearing a T allele at rs6478108/rs6478109 (r2 = 1) or rs4979462 was significantly associated with increased risk of CD and decreased risk of leprosy, while the T allele at rs4979462 was associated with significantly increased risk of PBC. In vitro analyses showed that the rs6478109 genotype significantly affected TNFSF15 expression in cells from whole blood of controls, while functional annotation using publicly-available data revealed the broad cell type/tissue-specific regulatory potential of variance at rs6478109 or rs4979462. In summary, we provide evidence that variance within TNFSF15 has the potential to affect cytokine expression across a range of tissues and thereby contribute to protection from infectious diseases such as leprosy, while increasing the risk of immune-mediated diseases including CD and PBC. PMID:27507062

  3. Surveying Students' Conceptual and Procedural Knowledge of Acid-Base Behavior of Substances

    ERIC Educational Resources Information Center

    Furio-Mas, Carles; Calatayud, Maria-Luisa; Barcenas, Sergio L.

    2007-01-01

    By the end of their high school studies, students should be able to understand macroscopic and sub-microscopic conceptualization of acid-base behavior and the relationship between these conceptual models. The aim of this article is to ascertain whether grade-12 students have sufficient background knowledge to explain the properties of acids,…

  4. Kinetic Classroom: Acid-Base and Redox Demonstrations with Student Movement.

    ERIC Educational Resources Information Center

    Lomax, Joseph F.

    1994-01-01

    Describes classroom activities that involve student movement to demonstrate principles of kinetics. This classroom method can be used for any topic related to dynamic processes. The method used in this activity illustrates Brxnsted-Lowry acid-base theory and redox reactions. Takes advantage of analogies between proton and electron transfers. Use…

  5. Determining surface areas of marine alga cells by acid-base titration method.

    PubMed

    Wang, X; Ma, Y; Su, Y

    1997-09-01

    A new method for determining the surface area of living marine alga cells was described. The method uses acid-base titration to measure the surface acid/base amount on the surface of alga cells and uses the BET (Brunauer, Emmett, and Teller) equation to estimate the maximum surface acid/base amount, assuming that hydrous cell walls have carbohydrates or other structural compounds which can behave like surface Brönsted acid-base sites due to coordination of environmental H2O molecules. The method was applied to 18 diverse alga species (including 7 diatoms, 2 flagellates, 8 green algae and 1 red alga) maintained in seawater cultures. For the species examined, the surface areas of individual cells ranged from 2.8 x 10(-8) m2 for Nannochloropsis oculata to 690 x 10(-8) m2 for Dunaliella viridis, specific surface areas from 1,030 m2.g-1 for Dunaliella salina to 28,900 m2.g-1 for Pyramidomonas sp. Measurement accuracy was 15.2%. Preliminary studies show that the method may be more promising and accurate than light/electron microscopic measurements for coarse estimation of the surface area of living algae. PMID:9297794

  6. Semisynthetic DNA-protein conjugates for fabrication of nucleic acid based nanostructures

    NASA Astrophysics Data System (ADS)

    Rabe, Kersten S.; Feldkamp, Udo; Niemeyer, Christof M.

    2008-10-01

    We here report on the developments of semisynthetic DNA-protein conjugates and their assembly into multi-component nanostructures. We describe the improvement of the DNA sequences embedded in such nanostructures by computational and analytical methods. Moreover, we report on the exploration of novel DNA conjugates of streptavidin or redox proteins with improved properties for the assembly of nucleic acid based nanostructures.

  7. The Effect of Voluntary Ventilation on Acid-base Responses to a Moo Duk Tkow Form.

    ERIC Educational Resources Information Center

    Hetzler, Ronald K.; And Others

    1989-01-01

    Results are reported from a study that investigated the acid-base and lactate reponses to voluntary integration of breathing and exercise movements during beginning level form Ki Cho I, performed at competitive intensities. Findings suggest that respiratory compensation does not occur and that respiratory acidosis may contribute to metabolic…

  8. Isoelectric Point, Electric Charge, and Nomenclature of the Acid-Base Residues of Proteins

    ERIC Educational Resources Information Center

    Maldonado, Andres A.; Ribeiro, Joao M.; Sillero, Antonio

    2010-01-01

    The main object of this work is to present the pedagogical usefulness of the theoretical methods, developed in this laboratory, for the determination of the isoelectric point (pI) and the net electric charge of proteins together with some comments on the naming of the acid-base residues of proteins. (Contains 8 figures and 4 tables.)

  9. The Acid-Base Titration of a Very Weak Acid: Boric Acid

    ERIC Educational Resources Information Center

    Celeste, M.; Azevedo, C.; Cavaleiro, Ana M. V.

    2012-01-01

    A laboratory experiment based on the titration of boric acid with strong base in the presence of d-mannitol is described. Boric acid is a very weak acid and direct titration with NaOH is not possible. An auxiliary reagent that contributes to the release of protons in a known stoichiometry facilitates the acid-base titration. Students obtain the…

  10. Acid-Base Chemistry According to Robert Boyle: Chemical Reactions in Words as well as Symbols

    ERIC Educational Resources Information Center

    Goodney, David E.

    2006-01-01

    Examples of acid-base reactions from Robert Boyle's "The Sceptical Chemist" are used to illustrate the rich information content of chemical equations. Boyle required lengthy passages of florid language to describe the same reaction that can be done quite simply with a chemical equation. Reading or hearing the words, however, enriches the student's…

  11. Interactive Computer-Assisted Instruction in Acid-Base Physiology for Mobile Computer Platforms

    ERIC Educational Resources Information Center

    Longmuir, Kenneth J.

    2014-01-01

    In this project, the traditional lecture hall presentation of acid-base physiology in the first-year medical school curriculum was replaced by interactive, computer-assisted instruction designed primarily for the iPad and other mobile computer platforms. Three learning modules were developed, each with ~20 screens of information, on the subjects…

  12. Analysis and Identification of Acid-Base Indicator Dyes by Thin-Layer Chromatography

    ERIC Educational Resources Information Center

    Clark, Daniel D.

    2007-01-01

    Thin-layer chromatography (TLC) is a very simple and effective technique that is used by chemists by different purposes, including the monitoring of the progress of a reaction. TLC can also be easily used for the analysis and identification of various acid-base indicator dyes.

  13. Experienced Teachers' Pedagogical Content Knowledge of Teaching Acid-Base Chemistry

    ERIC Educational Resources Information Center

    Drechsler, Michal; Van Driel, Jan

    2008-01-01

    We investigated the pedagogical content knowledge (PCK) of nine experienced chemistry teachers. The teachers took part in a teacher training course on students' difficulties and the use of models in teaching acid-base chemistry, electrochemistry, and redox reactions. Two years after the course, the teachers were interviewed about their PCK of (1)…

  14. Red Shoe-Blue Shoe: An Acid-Base Demonstration with a Fashionable Twist.

    ERIC Educational Resources Information Center

    Breyer, Arthur C.; Uzelmeier, Calvin E.

    1998-01-01

    Illustrates that acid-base indicators come in many forms and the reversible effects that acids and bases have on the colors of such indicators. An object is dyed in an indicator, which causes the object to turn dark blue at pH less than 3.0 to 5.0. Suggests using dyeable fabric shoes and other cotton articles. (PVD)

  15. Students' Understanding of Acid, Base and Salt Reactions in Qualitative Analysis.

    ERIC Educational Resources Information Center

    Tan, Kim-Chwee Daniel; Goh, Ngoh-Khang; Chia, Lian-Sai; Treagust, David F.

    2003-01-01

    Uses a two-tier, multiple-choice diagnostic instrument to determine (n=915) grade 10 students' understanding of the acid, base, and salt reactions involved in basic qualitative analysis. Reports that many students did not understand the formation of precipitates and the complex salts, acid/salt-base reactions, and thermal decomposition involved in…

  16. Electrolyte Diets, Stress, and Acid-Base Balance in Broiler Chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The aim of this study was to compare acid-base balance in broiler chickens provided diets’ containing two different dietary electrolyte balances (DEB) and administered either adrenocorticotropic hormone (ACTH) or saline. Diets were moderate (M; 174 mEq/kg) or high (H; 241 mEq/kg) DEB by altering Na-...

  17. Combinatorial readout of unmodified H3R2 and acetylated H3K14 by the tandem PHD finger of MOZ reveals a regulatory mechanism for HOXA9 transcription.

    PubMed

    Qiu, Yu; Liu, Lei; Zhao, Chen; Han, Chuanchun; Li, Fudong; Zhang, Jiahai; Wang, Yan; Li, Guohong; Mei, Yide; Wu, Mian; Wu, Jihui; Shi, Yunyu

    2012-06-15

    Histone acetylation is a hallmark for gene transcription. As a histone acetyltransferase, MOZ (monocytic leukemia zinc finger protein) is important for HOX gene expression as well as embryo and postnatal development. In vivo, MOZ forms a tetrameric complex with other subunits, including several chromatin-binding modules with regulatory functions. Here we report the solution structure of the tandem PHD (plant homeodomain) finger (PHD12) of human MOZ in a free state and the 1.47 Å crystal structure in complex with H3K14ac peptide, which reveals the structural basis for the recognition of unmodified R2 and acetylated K14 on histone H3. Moreover, the results of chromatin immunoprecipitation (ChIP) and RT-PCR assays indicate that PHD12 facilitates the localization of MOZ onto the promoter locus of the HOXA9 gene, thereby promoting the H3 acetylation around the promoter region and further up-regulating the HOXA9 mRNA level. Taken together, our findings suggest that the combinatorial readout of the H3R2/K14ac by PHD12 might represent an important epigenetic regulatory mechanism that governs transcription and also provide a clue of cross-talk between the MOZ complex and histone H3 modifications. PMID:22713874

  18. Metabolism, gas exchange, and acid-base balance of giant salamanders.

    PubMed

    Ultsch, Gordon R

    2012-08-01

    The giant salamanders are aquatic and paedomorphic urodeles including the genera Andrias and Cryptobranchus (Cryptobranchidae), Amphiuma (Amphiumidae), Siren (Sirenidae), and Necturus (Proteidae, of which only N. maculosus is considered 'a giant'). Species in the genera Cryptobranchus and Necturus are considered aquatic salamanders well adapted for breathing water, poorly adapted for breathing air, and with limited abilities to compensate acid-base disturbances. As such, they are water-breathing animals with a somewhat fish-like respiratory and acid-base physiology, whose habitat selection is limited to waters that do not typically become hypoxic or hypercarbic (although this assertion has been questioned for N. maculosus). Siren and Amphiuma species, by contrast, are dependent upon air-breathing, have excellent lungs, inefficient (Siren) or no (Amphiuma) gills, and are obligate air-breathers with an acid-base status more similar to that of terrestrial tetrapods. As such, they can be considered to be air-breathing animals that live in water. Their response to the aquatic hypercarbia that they often encounter is to maintain intracellular pH (pH(i) ) and abandon extracellular pH regulation, a process that has been referred to as preferential pH(i) regulation. The acid-base status of some present-day tropical air-breathing fishes, and of Siren and Amphiuma, suggests that the acid-base transition from a low PCO(2) -low [] system typical of water-breathing fishes to the high PCO(2) -high [] systems of terrestrial tetrapods may have been completed before emergence onto land, and likely occurred in habitats that were typically both hypoxic and hypercarbic. PMID:22151821

  19. Acid-base analysis: a critique of the Stewart and bicarbonate-centered approaches.

    PubMed

    Kurtz, Ira; Kraut, Jeffrey; Ornekian, Vahram; Nguyen, Minhtri K

    2008-05-01

    When approaching the analysis of disorders of acid-base balance, physical chemists, physiologists, and clinicians, tend to focus on different aspects of the relevant phenomenology. The physical chemist focuses on a quantitative understanding of proton hydration and aqueous proton transfer reactions that alter the acidity of a given solution. The physiologist focuses on molecular, cellular, and whole organ transport processes that modulate the acidity of a given body fluid compartment. The clinician emphasizes the diagnosis, clinical causes, and most appropriate treatment of acid-base disturbances. Historically, two different conceptual frameworks have evolved among clinicians and physiologists for interpreting acid-base phenomena. The traditional or bicarbonate-centered framework relies quantitatively on the Henderson-Hasselbalch equation, whereas the Stewart or strong ion approach utilizes either the original Stewart equation or its simplified version derived by Constable. In this review, the concepts underlying the bicarbonate-centered and Stewart formulations are analyzed in detail, emphasizing the differences in how each approach characterizes acid-base phenomenology at the molecular level, tissue level, and in the clinical realm. A quantitative comparison of the equations that are currently used in the literature to calculate H(+) concentration ([H(+)]) is included to clear up some of the misconceptions that currently exist in this area. Our analysis demonstrates that while the principle of electroneutrality plays a central role in the strong ion formulation, electroneutrality mechanistically does not dictate a specific [H(+)], and the strong ion and bicarbonate-centered approaches are quantitatively identical even in the presence of nonbicarbonate buffers. Finally, our analysis indicates that the bicarbonate-centered approach utilizing the Henderson-Hasselbalch equation is a mechanistic formulation that reflects the underlying acid-base phenomenology. PMID

  20. Regulatory T Cell-Dependent and -Independent Mechanisms of Immune Suppression by CD28/B7 and CD40/CD40L Costimulation Blockade.

    PubMed

    Vogel, Isabel; Verbinnen, Bert; Van Gool, Stefaan; Ceuppens, Jan L

    2016-07-15

    Blocking of costimulatory CD28/B7 and CD40/CD40L interactions is an experimental approach to immune suppression and tolerance induction. We previously reported that administration of a combination of CTLA-4Ig and MR1 (anti-CD40L mAb) for blockade of these interactions induces tolerance in a fully mismatched allogeneic splenocyte transfer model in mice. We now used this model to study whether regulatory T cells (Tregs) contribute to immune suppression and why both pathways have to be blocked simultaneously. Mice were injected with allogeneic splenocytes, CD4(+) T cells, or CD8(+) T cells and treated with MR1 mAb and different doses of CTLA-4Ig. The graft-versus-host reaction of CD4(+) T cells, but not of CD8(+) T cells, was inhibited by MR1. CTLA-4Ig was needed to cover CD8(+) T cells but had only a weak effect on CD4(+) T cells. Consequently, only the combination provided full protection when splenocytes were transferred. Importantly, MR1 and low-dose CTLA-4Ig treatment resulted in a relative increase in Tregs, and immune suppressive efficacy was abolished in the absence of Tregs. High-dose CTLA-4Ig treatment, in contrast, prevented Treg expansion and activity, and in combination with MR1 completely inhibited CD4(+) and CD8(+) T cell activation in a Treg-independent manner. In conclusion, MR1 and CTLA-4Ig act synergistically as they target different T cell populations. The contribution of Tregs to immune suppression by costimulation blockade depends on the concentration of CTLA-4Ig and thus on the degree of available CD28 costimulation. PMID:27288533

  1. Identification of in vivo DNA-binding mechanisms of Pax6 and reconstruction of Pax6-dependent gene regulatory networks during forebrain and lens development

    PubMed Central

    Sun, Jian; Rockowitz, Shira; Xie, Qing; Ashery-Padan, Ruth; Zheng, Deyou; Cvekl, Ales

    2015-01-01

    The transcription factor Pax6 is comprised of the paired domain (PD) and homeodomain (HD). In the developing forebrain, Pax6 is expressed in ventricular zone precursor cells and in specific subpopulations of neurons; absence of Pax6 results in disrupted cell proliferation and cell fate specification. Pax6 also regulates the entire lens developmental program. To reconstruct Pax6-dependent gene regulatory networks (GRNs), ChIP-seq studies were performed using forebrain and lens chromatin from mice. A total of 3514 (forebrain) and 3723 (lens) Pax6-containing peaks were identified, with ∼70% of them found in both tissues and thereafter called ‘common’ peaks. Analysis of Pax6-bound peaks identified motifs that closely resemble Pax6-PD, Pax6-PD/HD and Pax6-HD established binding sequences. Mapping of H3K4me1, H3K4me3, H3K27ac, H3K27me3 and RNA polymerase II revealed distinct types of tissue-specific enhancers bound by Pax6. Pax6 directly regulates cortical neurogenesis through activation (e.g. Dmrta1 and Ngn2) and repression (e.g. Ascl1, Fezf2, and Gsx2) of transcription factors. In lens, Pax6 directly regulates cell cycle exit via components of FGF (Fgfr2, Prox1 and Ccnd1) and Wnt (Dkk3, Wnt7a, Lrp6, Bcl9l, and Ccnd1) signaling pathways. Collectively, these studies provide genome-wide analysis of Pax6-dependent GRNs in lens and forebrain and establish novel roles of Pax6 in organogenesis. PMID:26138486

  2. Regulatory physiology discipline science plan

    NASA Technical Reports Server (NTRS)

    1991-01-01

    The focus of the Regulatory Physiology discipline of the Space Physiology and Countermeasures Program is twofold. First, to determine and study how microgravity and associated factors of space flight affect the regulatory mechanisms by which humans adapt and achieve homeostasis and thereby regulate their ability to respond to internal and external signals; and, second, to study selected physiological systems that have been demonstrated to be influenced by gravity. The Regulatory Physiology discipline, as defined here, is composed of seven subdisciplines: (1) Circadian Rhythms, (2) Endocrinology, (3) Fluid and Electrolyte Regulation, (4) Hematology, (5) Immunology, (6) Metabolism and Nutrition, and (7) Temperature Regulation. The purpose of this Discipline Science Plan is to provide a conceptual strategy for NASA's Life Sciences Division research and development activities in the area of regulatory physiology. It covers the research areas critical to NASA's programmatic requirements for the Extended-Duration Orbiter, Space Station Freedom, and exploration mission science activities. These science activities include ground-based and flight; basic, applied, and operational; and animal and human research and development. This document summarizes the current status of the program, outlines available knowledge, establishes goals and objectives, identifies science priorities, and defines critical questions in regulatory physiology. It contains a general plan that will be used by both NASA Headquarters Program Offices and the field centers to review and plan basic, applied, and operational intramural and extramural research and development activities in this area.

  3. Effect of high sodium intake during 14 days of bed-rest on acid-base balance

    NASA Astrophysics Data System (ADS)

    Frings, P.; Baecker, N.; Heer, M.

    Lowering mechanical load like in microgravity is the dominant stimulus leading to bone loss However high dietary sodium intake is also considered as a risk factor for osteoporosis and thereby might exacerbate the microgravity induced bone loss In a metabolic balance non bed-rest study we have recently shown that a very high sodium intake leads to an increased bone resorption most likely because of a mild metabolic acidosis Frings et al FASEB J 19 5 A1345 2005 To test if mild metabolic acidosis also occurs during immobilization we examined the effect of increased dietary sodium on bone metabolism and acid-base balance in eight healthy male test subjects mean age 26 25 pm 3 49 years body weight 77 98 pm 4 34 kg in our metabolic ward during a 14-day head-down tilt HDT bed-rest study The study was designed as a randomized crossover study with two study periods Each period was divided into three parts 4 ambulatory days with 200 mmol sodium intake 14 days of bed-rest with either 550 mmol or 50 mmol sodium intake and 3 recovery days with 200 mmol sodium intake The sodium intake was altered by variations in dietary sodium chloride content Blood pH P CO2 and P O2 were analyzed in fasting morning fingertip blood samples several times during the entire study Bicarbonate HCO 3 - and base excess BE were calculated according to the Henderson-Hasselbach equation Preliminary results in the acid-base balance from the first study period 4 subjects with 550 mmol and 4 subjects with 50 mmol sodium intake strongly

  4. Dual mechanisms of action of the RNA-binding protein human antigen R explains its regulatory effect on melanoma cell migration.

    PubMed

    Moradi, Farnaz; Berglund, Pontus; Linnskog, Rickard; Leandersson, Karin; Andersson, Tommy; Prasad, Chandra Prakash

    2016-06-01

    Overexpression of wingless-type MMTV integration site family 5A (WNT5A) plays a significant role in melanoma cancer progression; however, the mechanism(s) involved remains unknown. In breast cancer, the human antigen R (HuR) has been implicated in the regulation of WNT5A expression. Here, we demonstrate that endogenous expression of WNT5A correlates with levels of active HuR in HTB63 and WM852 melanoma cells and that HuR binds to WNT5A messenger RNA in both cell lines. Although the HuR inhibitor MS-444 significantly impaired migration in both melanoma cell lines, it reduced WNT5A expression only in HTB63 cells, as did small interfering RNA knockdown of HuR. Consistent with this finding, MS-444-induced inhibition of HTB63 cell migration was restored by the addition of recombinant WNT5A, whereas MS-444-induced inhibition of WM852 cell migration was restored by the addition of recombinant matrix metalloproteinase-9, another HuR-regulated protein. Clearly, HuR positively regulates melanoma cell migration via at least 2 distinct mechanisms making HuR an attractive therapeutic target for halting melanoma dissemination. PMID:26970271

  5. Metabolic fate of poly-(lactic-co-glycolic acid)-based curcumin nanoparticles following oral administration

    PubMed Central

    Harigae, Takahiro; Nakagawa, Kiyotaka; Miyazawa, Taiki; Inoue, Nao; Kimura, Fumiko; Ikeda, Ikuo; Miyazawa, Teruo

    2016-01-01

    Purpose Curcumin (CUR), the main polyphenol in turmeric, is poorly absorbed and rapidly metabolized following oral administration, which severely curtails its bioavailability. Poly-(lactic-co-glycolic acid)-based CUR nanoparticles (CUR-NP) have recently been suggested to improve CUR bioavailability, but this has not been fully verified. Specifically, no data are available about curcumin glucuronide (CURG), the major metabolite of CUR found in the plasma following oral administration of CUR-NP. Herein, we investigated the absorption and metabolism of CUR-NP and evaluated whether CUR-NP improves CUR bioavailability. Methods Following oral administration of CUR-NP in rats, we analyzed the plasma and organ distribution of CUR and its metabolites using high-performance liquid chromatography-tandem mass spectrometry. To elucidate the mechanism of increased intestinal absorption of CUR-NP, we prepared mixed micelles comprised of phosphatidylcholine and bile salts and examined the micellar solubility of CUR-NP. Additionally, we investigated the cellular incorporation of the resultant micelles into differentiated Caco-2 human intestinal cells. Results Following in vivo administration of CUR-NP, CUR was effectively absorbed and present mainly as CURG in the plasma which contained significant amounts of the metabolite compared with other organs. Thus, CUR-NP increased intestinal absorption of CUR rather than decreasing metabolic degradation and conversion to other metabolites. In vitro, CUR encapsulated in CUR-NP was solubilized in mixed micelles; however, whether the micelles contained CUR or CUR-NP had little influence on cellular uptake efficiency. Therefore, we suggest that the high solubilization capacity of CUR-NP in mixed micelles, rather than cellular uptake efficiency, explains the high intestinal absorption of CUR-NP in vivo. Conclusion These findings provide a better understanding of the bioavailability of CUR and CUR-NP following oral administration. To improve

  6. Genome-Wide Mapping of Targets of Maize Histone Deacetylase HDA101 Reveals Its Function and Regulatory Mechanism during Seed Development[OPEN

    PubMed Central

    Yang, Hua; Liu, Xinye; Xin, Mingming; Du, Jinkun; Hu, Zhaorong; Peng, HuiRu; Sun, Qixin; Ni, Zhongfu; Yao, Yingyin

    2016-01-01

    Histone deacetylases (HDACs) regulate histone acetylation levels by removing the acetyl group from lysine residues. The maize (Zea mays) HDAC HDA101 influences several aspects of development, including kernel size; however, the molecular mechanism by which HDA101 affects kernel development remains unknown. In this study, we find that HDA101 regulates the expression of transfer cell-specific genes, suggesting that their misregulation may be associated with the defects in differentiation of endosperm transfer cells and smaller kernels observed in hda101 mutants. To investigate HDA101 function during the early stages of seed development, we performed genome-wide mapping of HDA101 binding sites. We observed that, like mammalian HDACs, HDA101 mainly targets highly and intermediately expressed genes. Although loss of HDA101 can induce histone hyperacetylation of its direct targets, this often does not involve variation in transcript levels. A small subset of inactive genes that must be negatively regulated during kernel development is also targeted by HDA101 and its loss leads to hyperacetylation and increased expression of these inactive genes. Finally, we report that HDA101 interacts with members of different chromatin remodeling complexes, such as NFC103/MSI1 and SNL1/SIN3-like protein corepressors. Taken together, our results reveal a complex genetic network regulated by HDA101 during seed development and provide insight into the different mechanisms of HDA101-mediated regulation of transcriptionally active and inactive genes. PMID:26908760

  7. Genome-Wide Mapping of Targets of Maize Histone Deacetylase HDA101 Reveals Its Function and Regulatory Mechanism during Seed Development.

    PubMed

    Yang, Hua; Liu, Xinye; Xin, Mingming; Du, Jinkun; Hu, Zhaorong; Peng, HuiRu; Rossi, Vincenzo; Sun, Qixin; Ni, Zhongfu; Yao, Yingyin

    2016-03-01

    Histone deacetylases (HDACs) regulate histone acetylation levels by removing the acetyl group from lysine residues. The maize (Zea mays)HDACHDA101 influences several aspects of development, including kernel size; however, the molecular mechanism by which HDA101 affects kernel development remains unknown. In this study, we find that HDA101 regulates the expression of transfer cell-specific genes, suggesting that their misregulation may be associated with the defects in differentiation of endosperm transfer cells and smaller kernels observed inhda101mutants. To investigate HDA101 function during the early stages of seed development, we performed genome-wide mapping of HDA101 binding sites. We observed that, like mammalianHDACs, HDA101 mainly targets highly and intermediately expressed genes. Although loss of HDA101 can induce histone hyperacetylation of its direct targets, this often does not involve variation in transcript levels. A small subset of inactive genes that must be negatively regulated during kernel development is also targeted by HDA101 and its loss leads to hyperacetylation and increased expression of these inactive genes. Finally, we report that HDA101 interacts with members of different chromatin remodeling complexes, such as NFC103/MSI1 and SNL1/SIN3-like protein corepressors. Taken together, our results reveal a complex genetic network regulated by HDA101 during seed development and provide insight into the different mechanisms of HDA101-mediated regulation of transcriptionally active and inactive genes. PMID:26908760

  8. A Negative Regulatory Mechanism Involving 14-3-3ζ Limits Signaling Downstream of ROCK to Regulate Tissue Stiffness in Epidermal Homeostasis.

    PubMed

    Kular, Jasreen; Scheer, Kaitlin G; Pyne, Natasha T; Allam, Amr H; Pollard, Anthony N; Magenau, Astrid; Wright, Rebecca L; Kolesnikoff, Natasha; Moretti, Paul A; Wullkopf, Lena; Stomski, Frank C; Cowin, Allison J; Woodcock, Joanna M; Grimbaldeston, Michele A; Pitson, Stuart M; Timpson, Paul; Ramshaw, Hayley S; Lopez, Angel F; Samuel, Michael S

    2015-12-21

    ROCK signaling causes epidermal hyper-proliferation by increasing ECM production, elevating dermal stiffness, and enhancing Fak-mediated mechano-transduction signaling. Elevated dermal stiffness in turn causes ROCK activation, establishing mechano-reciprocity, a positive feedback loop that can promote tumors. We have identified a negative feedback mechanism that limits excessive ROCK signaling during wound healing and is lost in squamous cell carcinomas (SCCs). Signal flux through ROCK was selectively tuned down by increased levels of 14-3-3ζ, which interacted with Mypt1, a ROCK signaling antagonist. In 14-3-3ζ(-/-) mice, unrestrained ROCK signaling at wound margins elevated ECM production and reduced ECM remodeling, increasing dermal stiffness and causing rapid wound healing. Conversely, 14-3-3ζ deficiency enhanced cutaneous SCC size. Significantly, inhibiting 14-3-3ζ with a novel pharmacological agent accelerated wound healing 2-fold. Patient samples of chronic non-healing wounds overexpressed 14-3-3ζ, while cutaneous SCCs had reduced 14-3-3ζ. These results reveal a novel 14-3-3ζ-dependent mechanism that negatively regulates mechano-reciprocity, suggesting new therapeutic opportunities. PMID:26702834

  9. Deep Sequencing-Based Transcriptome Analysis Reveals the Regulatory Mechanism of Bemisia tabaci (Hemiptera: Aleyrodidae) Nymph Parasitized by Encarsia sophia (Hymenoptera: Aphelinidae)

    PubMed Central

    Wang, Ran; Li, Fei; Zhang, Fan; Wang, Su

    2016-01-01

    The whitefly Bemisia tabaci is a genetically diverse complex with multiple cryptic species, and some are the most destructive invasive pests of many ornamentals and crops worldwide. Encarsia sophia is an autoparasitoid wasp that demonstrated high efficiency as bio-control agent of whiteflies. However, the immune mechanism of B. tabaci parasitization by E. sophia is unknown. In order to investigate immune response of B. tabaci to E. Sophia parasitization, the transcriptome of E. sophia parasitized B. tabaci nymph was sequenced by Illumina sequencing. De novo assembly generated 393,063 unigenes with average length of 616 bp, in which 46,406 unigenes (15.8% of all unigenes) were successfully mapped. Parasitization by E. sophia had significant effects on the transcriptome profile of B. tabaci nymph. A total of 1482 genes were significantly differentially expressed, of which 852 genes were up-regulated and 630 genes were down-regulated. These genes were mainly involved in immune response, development, metabolism and host signaling pathways. At least 52 genes were found to be involved in the host immune response, 33 genes were involved in the development process, and 29 genes were involved in host metabolism. Taken together, the assembled and annotated transcriptome sequences provided a valuable genomic resource for further understanding the molecular mechanism of immune response of B. tabaci parasitization by E. sophia. PMID:27332546

  10. 3 CFR - Regulatory Review

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 3 The President 1 2010-01-01 2010-01-01 false Regulatory Review Presidential Documents Other Presidential Documents Memorandum of January 30, 2009 Regulatory Review Memorandum for the Heads of Executive Departments and Agencies For well over two decades, the Office of Information and Regulatory Affairs (OIRA) at the Office of Management...

  11. A novel regulatory mechanism for trimeric GTP-binding proteins in the membrane and secretory granule fractions of human and rodent beta cells.

    PubMed Central

    Kowluru, A; Seavey, S E; Rhodes, C J; Metz, S A

    1996-01-01

    Recently we described roles for heterotrimeric and low-molecular-mass GTP-binding proteins in insulin release from normal rat islets. During these studies, we observed that a protein with an apparent molecular mass (37 kDa) similar to that of the beta subunit of trimeric GTP-binding proteins underwent phosphorylation in each of five classes of insulin-secreting cells. Incubation of the beta cell total membrane fraction or the isolated secretory granule fraction (but not the cytosolic fraction) with [gamma-32P]ATP or [gamma-32P]GTP resulted in the phosphorylation of this protein, which was selectively immunoprecipitated by an anti-serum directed against the common beta subunit of trimeric G-proteins. Disruption of the alpha beta gamma trimer (by pretreatment with either fluoroaluminate or guanosine 5'(-)[gamma-thio]triphosphate) prevented beta subunit phosphorylation. Based on differential sensitivities to pH, heat and the histidine-selective reagent diethyl pyrocarbonate (and reversal of the latter by hydroxylamine), the phosphorylated amino acid was presumptively identified as histidine. Incubation of pure beta subunit alone or in combination with the exogenous purified alpha subunit of transducin did not result in the phosphorylation of the beta subunit, but addition of the islet cell membrane fraction did support this event, suggesting that membrane localization (or a membrane-associated factor) is required for beta subunit phosphorylation. Incubation of phosphorylated beta subunit with G alpha.GDP accelerated the dephosphorylation of the beta subunit, accompanied by the formation of G alpha-GTP. Immunoblotting detected multiple alpha subunits (of Gi, G(o) and Gq) and at least one beta subunit in the secretory granule fraction of normal rat islets and insulinoma cells. These data describe a potential alternative mechanism for the activation of GTP-binding proteins in beta cells which contrasts with the classical receptor-agonist mechanism: G beta undergoes

  12. Regulatory affairs administration as regulatory policy determinant

    SciTech Connect

    Forcier, J.R.

    1984-05-10

    It is the thesis of this article that the processing of a utility company's regulation-related work, the supporting tasks and the manner in which they are completed, can and does have a significant impact on the final results or work product of the regulatory affairs function, including even, potentially, the action of the regulatory agency. The article is therefore full of practical pointers on how the interface with the regulatory authority can best be organized, managed, and carried through to the attainment of optimum results for the utility. 2 references.

  13. Acid-Base Behavior in Hydrothermal Processing of Wastes - Final Report

    SciTech Connect

    Johnston, K.; Rossky, P.

    2000-12-01

    A major obstacle to development of hydrothermal oxidation technology has been a lack of scientific knowledge of chemistry in hydrothermal solution above 350 C, particularly acid-base behavior, and transport phenomena, which is needed to understand corrosion, metal-ion complexation, and salt precipitation and recovery. Our objective has been to provide this knowledge with in situ UV-visible spectroscopic measurements and fully molecular computer simulation. Our recent development of relatively stable organic UV-visible pH indicators for supercritical water oxidation offers the opportunity to characterize buffers and to monitor acid-base titrations. These results have important implications for understanding reaction pathways and yields for decomposition of wastes in supercritical water.

  14. Theory of ion transport with fast acid-base equilibrations in bioelectrochemical systems

    NASA Astrophysics Data System (ADS)

    Dykstra, J. E.; Biesheuvel, P. M.; Bruning, H.; Ter Heijne, A.

    2014-07-01

    Bioelectrochemical systems recover valuable components and energy in the form of hydrogen or electricity from aqueous organic streams. We derive a one-dimensional steady-state model for ion transport in a bioelectrochemical system, with the ions subject to diffusional and electrical forces. Since most of the ionic species can undergo acid-base reactions, ion transport is combined in our model with infinitely fast ion acid-base equilibrations. The model describes the current-induced ammonia evaporation and recovery at the cathode side of a bioelectrochemical system that runs on an organic stream containing ammonium ions. We identify that the rate of ammonia evaporation depends not only on the current but also on the flow rate of gas in the cathode chamber, the diffusion of ammonia from the cathode back into the anode chamber, through the ion exchange membrane placed in between, and the membrane charge density.

  15. Theory of ion transport with fast acid-base equilibrations in bioelectrochemical systems.

    PubMed

    Dykstra, J E; Biesheuvel, P M; Bruning, H; Ter Heijne, A

    2014-07-01

    Bioelectrochemical systems recover valuable components and energy in the form of hydrogen or electricity from aqueous organic streams. We derive a one-dimensional steady-state model for ion transport in a bioelectrochemical system, with the ions subject to diffusional and electrical forces. Since most of the ionic species can undergo acid-base reactions, ion transport is combined in our model with infinitely fast ion acid-base equilibrations. The model describes the current-induced ammonia evaporation and recovery at the cathode side of a bioelectrochemical system that runs on an organic stream containing ammonium ions. We identify that the rate of ammonia evaporation depends not only on the current but also on the flow rate of gas in the cathode chamber, the diffusion of ammonia from the cathode back into the anode chamber, through the ion exchange membrane placed in between, and the membrane charge density. PMID:25122405

  16. [Participation of the adrenals in the pathogenesis of metabolic acid-base disorders].

    PubMed

    Iluchev, D; Shtereva, S

    1976-01-01

    The authors examined in dynamics the changes in the functional state of the adrenals on 240 rabbits, which served as models for acute metabolic deviations in the acid-base balance. The obtained results showed that the acute metabolic acidosis increased moderately the values of ACTH and 17-hydroxycorticosteroids in blood without changing their concentration on the adrenal tissue. It lowered strongly the content of catecholamines (adrenaline and noradranaline) in the adrenal medular part. The metabolic alkalosis raised the concentration of ACTH in blood plasma and increased the amount of corticosteroids in blood and adrenals. There was no well formed parallelism in normalizing acid-base and hormonal indices. As a consequence of this a stage of postaciodotic catecholamine adrenal deficit was formed as well as metabasic hypercorticism in the experimental animals. PMID:14819

  17. Characterization of the functional role of allosteric site residue Asp102 in the regulatory mechanism of human mitochondrial NAD(P)+-dependent malate dehydrogenase (malic enzyme)

    PubMed Central

    2005-01-01

    Human mitochondrial NAD(P)+-dependent malate dehydrogenase (decarboxylating) (malic enzyme) can be specifically and allosterically activated by fumarate. X-ray crystal structures have revealed conformational changes in the enzyme in the absence and in the presence of fumarate. Previous studies have indicated that fumarate is bound to the allosteric pocket via Arg67 and Arg91. Mutation of these residues almost abolishes the activating effect of fumarate. However, these amino acid residues are conserved in some enzymes that are not activated by fumarate, suggesting that there may be additional factors controlling the activation mechanism. In the present study, we tried to delineate the detailed molecular mechanism of activation of the enzyme by fumarate. Site-directed mutagenesis was used to replace Asp102, which is one of the charged amino acids in the fumarate binding pocket and is not conserved in other decarboxylating malate dehydrogenases. In order to explore the charge effect of this residue, Asp102 was replaced by alanine, glutamate or lysine. Our experimental data clearly indicate the importance of Asp102 for activation by fumarate. Mutation of Asp102 to Ala or Lys significantly attenuated the activating effect of fumarate on the enzyme. Kinetic parameters indicate that the effect of fumarate was mainly to decrease the Km values for malate, Mg2+ and NAD+, but it did not notably elevate kcat. The apparent substrate Km values were reduced by increasing concentrations of fumarate. Furthermore, the greatest effect of fumarate activation was apparent at low malate, Mg2+ or NAD+ concentrations. The Kact values were reduced with increasing concentrations of malate, Mg2+ and NAD+. The Asp102 mutants, however, are much less sensitive to regulation by fumarate. Mutation of Asp102 leads to the desensitization of the co-operative effect between fumarate and substrates of the enzyme. PMID:15989682

  18. Underlying mechanism of regulatory actions of diclofenac, a nonsteroidal anti-inflammatory agent, on neuronal potassium channels and firing: an experimental and theoretical study.

    PubMed

    Huang, C W; Hung, T Y; Liao, Y K; Hsu, M C; Wu, S N

    2013-06-01

    Diclofenac (DIC), a nonsteroidal anti-inflammatory drug, is known to exert anti-nociceptive and anti-convulsant actions; however, its effects on ion currents, in neurons remain debatable. We aimed to investigate (1) potential effects of diclofenac on membrane potential and potassium currents in differentiated NSC-34 neuronal cells and dorsal root ganglion (DRG) neurons with whole-cell patch-clamp technology, and (2) firing of action potentials (APs), using a simulation model from hippocampal CA1 pyramidal neurons based on diclofenac's effects on potassium currents. In the NSC-34 cells, diclofenac exerted an inhibitory effect on delayed-rectifier K⁺ current (I(KDR)) with an IC₅₀ value of 73 μM. Diclofenac not merely inhibited the I(KDR) amplitude in response to membrane depolarization, but also accelerated the process of current inactivation. The inhibition by diclofenac of IK(DR) was not reversed by subsequent application of either naloxone. Importantly, diclofenac (300 μM) increased the amplitude of M-type K⁺ current (I)(KM)), while flupirtine (10 μM) or meclofenamic acid (10 μM) enhanced it effectively. Consistently, diclofenac (100 μM) increased the amplitude of I(KM) and diminished the I(KDR) amplitude, with a shortening of inactivation time constant in DRG neurons. Furthermore, by using the simulation modeling, we demonstrated the potential electrophysiological mechanisms underlying changes in AP firing caused by diclofenac. During the exposure to diclofenac, the actions on both I(KM) and I(KDR) could be potential mechanism through which it influences the excitability of fast-spiking neurons. Caution needs to be made in attributing the effects of diclofenac primarily to those produced by the activation of I(KM). PMID:23959723

  19. Hyperventilation and blood acid-base balance in hypercapnia exposed red drum (Sciaenops ocellatus).

    PubMed

    Ern, Rasmus; Esbaugh, Andrew J

    2016-05-01

    Hyperventilation is a common response in fish exposed to elevated water CO2. It is believed to lessen the respiratory acidosis associated with hypercapnia by lowering arterial PCO2, but the contribution of hyperventilation to blood acid-base compensation has yet to be quantified. Hyperventilation may also increase the flux of irons across the gill epithelium and the cost of osmoregulation, owing to the osmo-respiratory compromise. Therefore, hypercapnia exposed fish may increase standard metabolic rate (SMR) leaving less energy for physiological functions such as foraging, migration, growth and reproduction. Here we show that gill ventilation, blood PCO2 and total blood [CO2] increased in red drum (Sciaenops ocellatus) exposed to 1000 and 5000 µatm water CO2, and that blood PCO2 and total blood [CO2] decrease in fish during hypoxia induced hyperventilation. Based on these results we estimate the ventilatory contributions to total acid-base compensation in 1000 and 5000 µatm water CO2. We find that S. ocellatus only utilize a portion of its ventilatory capacity to reduce the acid-base disturbance in 1000 µatm water CO2. SMR was unaffected by both salinity and hypercapnia exposure indicating that the cost of osmoregulation is small relative to SMR, and that the lack of increased ventilation in 1000 µatm water CO2 despite the capacity to do so is not due to an energetic tradeoff between acid-base balance and osmoregulation. Therefore, while ocean acidification may impact ventilatory parameters, there will be little impact on the overall energy budget of S. ocellatus. PMID:26922790

  20. Acid-base properties of 2-phenethyldithiocarbamoylacetic acid, an antitumor agent

    NASA Astrophysics Data System (ADS)

    Novozhilova, N. E.; Kutina, N. N.; Petukhova, O. A.; Kharitonov, Yu. Ya.

    2013-07-01

    The acid-base properties of the 2-phenethyldithiocarbamoylacetic acid (PET) substance belonging to the class of isothiocyanates and capable of inhibiting the development of tumors on many experimental models were studied. The acidity and hydrolysis constants of the PET substance in ethanol, acetone, aqueous ethanol, and aqueous acetone solutions were determined from the data of potentiometric (pH-metric) titration of ethanol and acetone solutions of PET with aqueous solidum hydroxide at room temperature.

  1. Roles of urea production, ammonium excretion, and amino acid oxidation in acid-base balance.

    PubMed

    Mackenzie, W

    1986-02-01

    Atkinson and colleagues recently proposed several concepts that contrast with traditional views: first, that acid-base balance is regulated chiefly by the reactions leading to urea production in the liver; second, that ammonium excretion by the kidney plays no role in acid-base homeostasis; and third, that ammonium does not stimulate ureagenesis (except indirectly). To examine these concepts, plasma ions other than bicarbonate are categorized as 1) fixed cations (Na+, K+, Ca2+, and Mg2+, symbolized M+) and anions (Cl-), 2) buffer anions (A-), 3) other anions (X-), and 4) ammonium plus charged amino groups (N+). Since electroneutrality dictates that M+ + N+ = Cl- + HCO3- + A- + X-, it follows that delta HCO3- = delta(M+ - Cl-) - delta A- - delta X- + delta N+. Therefore acid-base disturbances (changes in HCO3-) can be categorized as to how they affect bodily content and hence plasma concentration of each of these four types of ions. The stoichiometry of ureagenesis, glutamine hydrolysis, ammonium and titratable acid excretion, oxidation of neutral, acidic, and basic amino acids, and oxidation of methionine, phosphoserine, and protein are examined to see how they alter these quantities. It is concluded that 1) although ureagenesis is pH dependent and also counteracts a tendency of amino acid oxidation to cause alkalosis, this tendency is inherently limited by the hyperammonemia (delta N+) that necessarily accompanies it, 2) ammonium excretion is equivalent to hydrogen excretion in its effects on acid-base balance if, and only if, it occurs in exchange for sodium or is accompanied by chloride excretion and only when the glutamate generated by glutamine hydrolysis is oxidized.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:3511732

  2. Acid-Base Pairs in Lewis Acidic Zeolites Promote Direct Aldol Reactions by Soft Enolization.

    PubMed

    Lewis, Jennifer D; Van de Vyver, Stijn; Román-Leshkov, Yuriy

    2015-08-17

    Hf-, Sn-, and Zr-Beta zeolites catalyze the cross-aldol condensation of aromatic aldehydes with acetone under mild reaction conditions with near quantitative yields. NMR studies with isotopically labeled molecules confirm that acid-base pairs in the Si-O-M framework ensemble promote soft enolization through α-proton abstraction. The Lewis acidic zeolites maintain activity in the presence of water and, unlike traditional base catalysts, in acidic solutions. PMID:26138135

  3. Acid-Base Chemistry of White Wine: Analytical Characterisation and Chemical Modelling

    PubMed Central

    Prenesti, Enrico; Berto, Silvia; Toso, Simona; Daniele, Pier Giuseppe

    2012-01-01

    A chemical model of the acid-base properties is optimized for each white wine under study, together with the calculation of their ionic strength, taking into account the contributions of all significant ionic species (strong electrolytes and weak one sensitive to the chemical equilibria). Coupling the HPLC-IEC and HPLC-RP methods, we are able to quantify up to 12 carboxylic acids, the most relevant substances responsible of the acid-base equilibria of wine. The analytical concentration of carboxylic acids and of other acid-base active substances was used as input, with the total acidity, for the chemical modelling step of the study based on the contemporary treatment of overlapped protonation equilibria. New protonation constants were refined (L-lactic and succinic acids) with respect to our previous investigation on red wines. Attention was paid for mixed solvent (ethanol-water mixture), ionic strength, and temperature to ensure a thermodynamic level to the study. Validation of the chemical model optimized is achieved by way of conductometric measurements and using a synthetic “wine” especially adapted for testing. PMID:22566762

  4. Experienced Teachers' Pedagogical Content Knowledge of Teaching Acid-base Chemistry

    NASA Astrophysics Data System (ADS)

    Drechsler, Michal; van Driel, Jan

    2008-11-01

    We investigated the pedagogical content knowledge (PCK) of nine experienced chemistry teachers. The teachers took part in a teacher training course on students’ difficulties and the use of models in teaching acid-base chemistry, electrochemistry, and redox reactions. Two years after the course, the teachers were interviewed about their PCK of (1) students’ difficulties in understanding acid-base chemistry and (2) models of acids and bases in their teaching practice. In the interviews, the teachers were asked to comment on authentic student responses collected in a previous study that included student interviews about their understanding of acids and bases. Further, the teachers drew story-lines representing their level of satisfaction with their acid-base teaching. The results show that, although all teachers recognised some of the students’ difficulties as confusion between models, only a few chose to emphasise the different models of acids and bases. Most of the teachers thought it was sufficient to distinguish clearly between the phenomenological level and the particle level. The ways the teachers reflected on their teaching, in order to improve it, also differed. Some teachers reflected more on students’ difficulties; others were more concerned about their own performance. Implications for chemistry (teacher) education are discussed.

  5. Aqueous extracts of Mozambican plants as alternative and environmentally safe acid-base indicators.

    PubMed

    Macuvele, Domingos Lusitaneo Pier; Sithole, Gerre Zebedias Samo; Cesca, Karina; Macuvele, Suzana Lília Pinare; Matsinhe, Jonas Valente

    2016-06-01

    Indicators are substances that change color as the pH of the medium. Many of these substances are dyes of synthetic origin. The mulala plant (Euclea natalensis), which roots are commonly used by rural communities for their oral hygiene, and roseira (Hibiscus rosa-sinensis), an ornamental plant, are abundant in Mozambique. Currently, synthetic acid-base indicators are most commonly used but have environmental implications and, on the other hand, are expensive products, so the demand for natural indicators started. This study investigated the applicability of aqueous extracts of H. rosa-sinensis and E. natalensis as acid-base indicators. Ground on this work, the extracts can be used as acid-base indicators. On the basis of the absorption spectroscopy in both the UV-Vis region and previous studies, it was possible to preliminarily pinpoint anthocyanins and naphthoquinones as responsible for the shifting of colors depending on the pH range of aqueous extracts of H. rosa-sinensis and E. natalensis. These natural indicators are easily accessible, inexpensive, easy to extract, environmentally safe, and locally available. PMID:26936478

  6. Physiological responses of dogs on exposure to hot, arid conditions. Acid-base status.

    PubMed

    Krausz, S; Marder, J

    1977-09-16

    Acid-base parameters were determined in chronically cannulated dogs exposed to ambient temperatures increasing from 25-47 degrees C (with relative humidity below 30%). pH increased from 7.409 +/- 0.004 (S.E.M.) to 7.538 +/- 0.017, PaCO2 decreased from 33.0 +/- 0.5 to 20.9 +/- 1.2 torr, and [HCO3-] decreased from 20.9 +/- 0.3 to 17.2 +/- 0.4 mEq/l. Minimal base excess change, together with a rapid return to normal parameters upon recooling to 25 degrees C, suggests that the stress is almost exclusively respiratory, with little metabolic involvement. Analysis of serial exposures shows no acclimatization effect in acid-base status. This suggests the possible existence of natural acclimation to heat in dogs maintained in a warm climate, permitting excellent tolerance of hot, arid conditions with limited acid-base disturbance. PMID:563058

  7. The evolution of mammalian hibernation: lessons from comparative acid-base physiology.

    PubMed

    Malan, André

    2014-09-01

    The conquest of land has endowed air-breathers with the capability to utilize ventilation not only to acquire oxygen but also to control blood and intracellular acid-base state. Hypercapnic acidosis (resulting from ventilatory control and/or behavioral choice), thus, has become a universal component of hypometabolic states in air-breathers, with inhibitory and/or protective roles. Here, special emphasis is placed on the understanding of alterations of acid-base state associated with changes in temperature. Hypercapnic acidosis in connection with hypometabolism has been found in a variety of air-breathing clades, from snails to mammals through lungfish, amphibians, and reptiles. The discovery of the plesiomorphic character of mammalian hibernation has made the transfer to hibernation biology of the experience gained in the application of hypercapnic acidosis (the so-called "pH-stat" procedure) relevant to acid-base control in clinical artificial hypothermia. This paves the way for mutual benefits from such reciprocal exchange of information between hibernation biology and clinical applications. PMID:24585189

  8. A comparative study of surface acid-base characteristics of natural illites from different origins

    SciTech Connect

    Liu, W.; Sun, Z.; Forsling, W.; Du, Q.; Tang, H.

    1999-11-01

    The acid-base characteristics of naturally occurring illites, collected from different locations, were investigated by potentiometeric titrations. The experimental data were interpreted using the constant capacitance surface complexation model. Considerable release of Al and Si from illite samples and subsequent complexation or precipitation of hydroxyl aluminosilicates generated during the acidimetric forward titration and the alkalimetric back titration, respectively, were observed. In order to describe the acid-base chemistry of aqueous illite surfaces, two surface proton-reaction models, introducing the corresponding reactions between the dissolved aluminum species and silicic acid, as well as a surface Al-Si complex on homogeneous illite surface sites, were proposed. Optimization results indicated that both models could provide a good description of the titration behavior for all aqueous illite systems in this study. The intrinsic acidity constants for the different illites were similar in Model 1, showing some generalities in their acid-base properties. Model 1 may be considered as a simplification of Model 2, evident in the similarities between the corresponding constants. In addition, the formation constant for surface Al-Si species (complexes or precipitates) is relatively stable in this study.

  9. Tick-borne encephalitis (TBE) and hepatitis B nonresponders feature different immunologic mechanisms in response to TBE and influenza vaccination with involvement of regulatory T and B cells and IL-10.

    PubMed

    Garner-Spitzer, Erika; Wagner, Angelika; Paulke-Korinek, Maria; Kollaritsch, Herwig; Heinz, Franz X; Redlberger-Fritz, Monika; Stiasny, Karin; Fischer, Gottfried F; Kundi, Michael; Wiedermann, Ursula

    2013-09-01

    Low responsiveness/nonresponsiveness is characterized by an insufficient immune response upon primary and/or booster vaccination and affects 1-10% of vaccinees. In the current study, we aimed to investigate whether nonresponsiveness is an Ag/vaccine-specific phenomenon and to clarify underlying immunological mechanisms. Nonresponders to tick-borne encephalitis (TBE) or hepatitis B Ag with a history of previous TBE vaccinations were booster vaccinated with TBE and influenza vaccine and compared with TBE high responders in terms of humoral and cellular immune response. Postboosters in TBE high responder existing TBE titers increased, and solid humoral responses to influenza vaccine were induced. In TBE nonresponders, low to undetectable prevaccination TBE titers remained low, whereas sufficient influenza Abs were induced. In both TBE groups, a positive correlation of humoral and cellular immune response was seen as high/low TBE titers were associated with sufficient/lack of Ag-specific T cell proliferation. Furthermore, responses to influenza were robust in terms of Abs and cytokine production. In contrast, in hepatitis B nonresponders, sufficient humoral responses to TBE and influenza Ags were induced despite lacking specific IL-2 and IFN-γ production. Importantly, these patients showed high IL-10 baseline levels in vitro. HLA-DR subtypes associated with hepatitis B nonresponsiveness were overrepresented in this group, and high IL-10 levels were linked to these subtypes. Whereas TBE and hepatitis B nonresponders had increased IL-10-producing FOXP3(+) T regulatory cells upon vaccination, only in hepatitis B nonresponders, showing elevated prevaccination IL-10 levels, a prominent population of B regulatory cells was detected. We conclude that immunological pathways of nonresponsiveness follow different patterns depending both on vaccine Ag and genetic predisposition of the vaccinee. PMID:23872054

  10. Self-assembly of hydrogen-bonded supramolecular complexes of nucleic-acid-base and fatty-acid at the liquid-solid interface.

    PubMed

    Zhao, Huiling; Song, Xin; Aslan, Hüsnü; Liu, Bo; Wang, Jianguo; Wang, Li; Besenbacher, Flemming; Dong, Mingdong

    2016-06-01

    Self-assembly provides an effective approach for the fabrication of supramolecular complexes or heterojunction materials, which have unique properties and potential applications in many fields. In this study, the self-assembled structures of stearic acid (SA) and nucleic acid base, guanine (G), are formed at the liquid-solid interface. Two main configurations, namely SA-G-SA and SA-G-G-SA, are observed and the intermolecular recognition mechanism between G and SA is proposed from the hydrogen-bonding point of view. PMID:27170421

  11. Regulatory mechanisms of ecdysone-inducible Blimp-1 encoding a transcriptional repressor that is important for the prepupal development in Drosophila.

    PubMed

    Akagi, Kazutaka; Ueda, Hitoshi

    2011-06-01

    Blimp-1 is an ecdysone-inducible transcription factor that is expressed in the early stage of the prepupal period. The timing of its disappearance determines expression timing of the FTZ-F1 gene, whose temporally restricted expression is essential for the prepupal development. To elucidate the termination mechanism of Blimp-1 gene expression, we examined the regulation of the Blimp-1 gene using an organ culture system. The results showed that the Blimp-1 gene is transcribed in cultured organs taken from a low ecdysteroid period even after extended exposure to 20-hydroxyecdysone, while well-known early genes such as E75A are repressed under the same conditions. Similar selective transcription was observed in the cultured organs obtained from a high ecdysteroid period. We further showed that Blimp-1 transcripts quickly disappeared in the presence of actinomycin D. From these results, we concluded that the Blimp-1 gene is transcribed when the ecdysteroid titer is high, but the expressed mRNA degrades rapidly; these unique regulations limit its expression to the high ecdysteroid stage. PMID:21671917

  12. Electronic absorption study on acid-base equilibria for some pyrimidine derivatives containing semi- and thiosemicarbazone moiety

    NASA Astrophysics Data System (ADS)

    Kılıç, H.

    2010-02-01

    The UV-vis spectra of recently synthesized 5-benzoyl-1-(methylphenylmethyleneamino)-4-phenyl-1H-pyrimidine-2-one, ( I), and 5-benzoyl-1-(methylphenylmethyleneamino)-4-phenyl-1H-pyrimidine-2-thione, ( II) were studied in aqueous methanol (5%, v/v methanol). The nature of the electronic transitions and the roles of carbonyl oxygen of I and thiocarbonyl sulfur of II on the behavior of UV-vis spectra were discussed. Acid-base equilibria of the compounds against varying pH and p Ka values related equilibria were determined at an ionic strength of 0.10 M by using the Henderson-Haselbalch equation. The mean acidity constants for the protonated forms of the compounds were determined as p Ka1 = 5.121, p Ka2 = 7.929 and p Ka3 = 11.130 for I and p Ka1 = 4.684, p Ka2 = 7.245 and p Ka3 = 10.630 for II. The preferred dissociation mechanisms were discussed based on UV-vis data and a mechanism was proposed for each compound.

  13. Propaedeutic study for the delivery of nucleic acid-based molecules from PLGA microparticles and stearic acid nanoparticles

    PubMed Central

    Grassi, G; Coceani, N; Farra, R; Dapas, B; Racchi, G; Fiotti, N; Pascotto, A; Rehimers, B; Guarnieri, G; Grassi, M

    2006-01-01

    We studied the mechanism governing the delivery of nucleic acid-based drugs (NABD) from microparticles and nanoparticles in zero shear conditions, a situation occurring in applications such as in situ delivery to organ parenchyma. The delivery of a NABD molecule from poly(DL-lactide-co-glycolide) (PLGA) microparticles and stearic acid (SA) nanoparticles was studied using an experimental apparatus comprising a donor chamber separated from the receiver chamber by a synthetic membrane. A possible toxic effect on cell biology, as evaluated by studying cell proliferation, was also conducted for just PLGA microparticles. A mathematical model based on the hypothesis that NABD release from particles is due to particle erosion was used to interpret experimental release data. Despite zero shear conditions imposed in the donor chamber, particle erosion was the leading mechanism for NABD release from both PLGA microparticles and SA nanoparticles. PLGA microparticle erosion speed is one order of magnitude higher than that of competing to SA nanoparticles. Finally, no deleterious effects of PLGA microparticles on cell proliferation were detected. Thus, the data here reported can help optimize the delivery systems aimed at release of NABD from micro- and nanoparticles. PMID:17722283

  14. ADVANCEMENT OF NUCLEIC ACID-BASED TOOLS FOR MONITORING IN SITU REDUCTIVE DECHLORINATION

    SciTech Connect

    Vangelas, K; ELIZABETH EDWARDS, E; FRANK LOFFLER, F; Brian02 Looney, B

    2006-11-17

    Regulatory protocols generally recognize that destructive processes are the most effective mechanisms that support natural attenuation of chlorinated solvents. In many cases, these destructive processes will be biological processes and, for chlorinated compounds, will often be reductive processes that occur under anaerobic conditions. The existing EPA guidance (EPA, 1998) provides a list of parameters that provide indirect evidence of reductive dechlorination processes. In an effort to gather direct evidence of these processes, scientists have identified key microorganisms and are currently developing tools to measure the abundance and activity of these organisms in subsurface systems. Drs. Edwards and Luffler are two recognized leaders in this field. The research described herein continues their development efforts to provide a suite of tools to enable direct measures of biological processes related to the reductive dechlorination of TCE and PCE. This study investigated the strengths and weaknesses of the 16S rRNA gene-based approach to characterizing the natural attenuation capabilities in samples. The results suggested that an approach based solely on 16S rRNA may not provide sufficient information to document the natural attenuation capabilities in a system because it does not distinguish between strains of organisms that have different biodegradation capabilities. The results of the investigations provided evidence that tools focusing on relevant enzymes for functionally desired characteristics may be useful adjuncts to the 16SrRNA methods.

  15. Born energy, acid-base equilibrium, structure and interactions of end-grafted weak polyelectrolyte layers.

    PubMed

    Nap, R J; Tagliazucchi, M; Szleifer, I

    2014-01-14

    This work addresses the effect of the Born self-energy contribution in the modeling of the structural and thermodynamical properties of weak polyelectrolytes confined to planar and curved surfaces. The theoretical framework is based on a theory that explicitly includes the conformations, size, shape, and charge distribution of all molecular species and considers the acid-base equilibrium of the weak polyelectrolyte. Namely, the degree of charge in the polymers is not imposed but it is a local varying property that results from the minimization of the total free energy. Inclusion of the dielectric properties of the polyelectrolyte is important as the environment of a polymer layer is very different from that in the adjacent aqueous solution. The main effect of the Born energy contribution on the molecular organization of an end-grafted weak polyacid layer is uncharging the weak acid (or basic) groups and consequently decreasing the concentration of mobile ions within the layer. The magnitude of the effect increases with polymer density and, in the case of the average degree of charge, it is qualitatively equivalent to a small shift in the equilibrium constant for the acid-base equilibrium of the weak polyelectrolyte monomers. The degree of charge is established by the competition between electrostatic interactions, the polymer conformational entropy, the excluded volume interactions, the translational entropy of the counterions and the acid-base chemical equilibrium. Consideration of the Born energy introduces an additional energetic penalty to the presence of charged groups in the polyelectrolyte layer, whose effect is mitigated by down-regulating the amount of charge, i.e., by shifting the local-acid base equilibrium towards its uncharged state. Shifting of the local acid-base equilibrium and its effect on the properties of the polyelectrolyte layer, without considering the Born energy, have been theoretically predicted previously. Account of the Born energy leads

  16. Born energy, acid-base equilibrium, structure and interactions of end-grafted weak polyelectrolyte layers

    SciTech Connect

    Nap, R. J.; Tagliazucchi, M.; Szleifer, I.

    2014-01-14

    This work addresses the effect of the Born self-energy contribution in the modeling of the structural and thermodynamical properties of weak polyelectrolytes confined to planar and curved surfaces. The theoretical framework is based on a theory that explicitly includes the conformations, size, shape, and charge distribution of all molecular species and considers the acid-base equilibrium of the weak polyelectrolyte. Namely, the degree of charge in the polymers is not imposed but it is a local varying property that results from the minimization of the total free energy. Inclusion of the dielectric properties of the polyelectrolyte is important as the environment of a polymer layer is very different from that in the adjacent aqueous solution. The main effect of the Born energy contribution on the molecular organization of an end-grafted weak polyacid layer is uncharging the weak acid (or basic) groups and consequently decreasing the concentration of mobile ions within the layer. The magnitude of the effect increases with polymer density and, in the case of the average degree of charge, it is qualitatively equivalent to a small shift in the equilibrium constant for the acid-base equilibrium of the weak polyelectrolyte monomers. The degree of charge is established by the competition between electrostatic interactions, the polymer conformational entropy, the excluded volume interactions, the translational entropy of the counterions and the acid-base chemical equilibrium. Consideration of the Born energy introduces an additional energetic penalty to the presence of charged groups in the polyelectrolyte layer, whose effect is mitigated by down-regulating the amount of charge, i.e., by shifting the local-acid base equilibrium towards its uncharged state. Shifting of the local acid-base equilibrium and its effect on the properties of the polyelectrolyte layer, without considering the Born energy, have been theoretically predicted previously. Account of the Born energy leads

  17. Born energy, acid-base equilibrium, structure and interactions of end-grafted weak polyelectrolyte layers

    NASA Astrophysics Data System (ADS)

    Nap, R. J.; Tagliazucchi, M.; Szleifer, I.

    2014-01-01

    This work addresses the effect of the Born self-energy contribution in the modeling of the structural and thermodynamical properties of weak polyelectrolytes confined to planar and curved surfaces. The theoretical framework is based on a theory that explicitly includes the conformations, size, shape, and charge distribution of all molecular species and considers the acid-base equilibrium of the weak polyelectrolyte. Namely, the degree of charge in the polymers is not imposed but it is a local varying property that results from the minimization of the total free energy. Inclusion of the dielectric properties of the polyelectrolyte is important as the environment of a polymer layer is very different from that in the adjacent aqueous solution. The main effect of the Born energy contribution on the molecular organization of an end-grafted weak polyacid layer is uncharging the weak acid (or basic) groups and consequently decreasing the concentration of mobile ions within the layer. The magnitude of the effect increases with polymer density and, in the case of the average degree of charge, it is qualitatively equivalent to a small shift in the equilibrium constant for the acid-base equilibrium of the weak polyelectrolyte monomers. The degree of charge is established by the competition between electrostatic interactions, the polymer conformational entropy, the excluded volume interactions, the translational entropy of the counterions and the acid-base chemical equilibrium. Consideration of the Born energy introduces an additional energetic penalty to the presence of charged groups in the polyelectrolyte layer, whose effect is mitigated by down-regulating the amount of charge, i.e., by shifting the local-acid base equilibrium towards its uncharged state. Shifting of the local acid-base equilibrium and its effect on the properties of the polyelectrolyte layer, without considering the Born energy, have been theoretically predicted previously. Account of the Born energy leads

  18. [Electrolyte and acid-base balance disorders in advanced chronic kidney disease].

    PubMed

    Alcázar Arroyo, R

    2008-01-01

    1. The kidneys are the key organs to maintain the balance of the different electrolytes in the body and the acid-base balance. Progressive loss of kidney function results in a number of adaptive and compensatory renal and extrarenal changes that allow homeostasis to be maintained with glomerular filtration rates in the range of 10-25 ml/min. With glomerular filtration rates below 10 ml/min, there are almost always abnormalites in the body's internal environment with clinical repercussions. 2. Water Balance Disorders: In advanced chronic kidney disease (CKD), the range of urine osmolality progressively approaches plasma osmolality and becomes isostenuric. This manifests clinically as symptoms of nocturia and polyuria, especially in tubulointerstitial kidney diseases. Water overload will result in hyponatremia and a decrease in water intake will lead to hypernatremia. Routine analyses of serum Na levels should be performed in all patients with advanced CKD (Strength of Recommendation C). Except in edematous states, a daily fluid intake of 1.5-2 liters should be recommended (Strength of Recommendation C). Hyponatremia does not usually occur with glomerular filtration rates above 10 ml/min (Strength of Recommendation B). If it occurs, an excessive intake of free water should be considered or nonosmotic release of vasopressin by stimuli such as pain, anesthetics, hypoxemia or hypovolemia, or the use of diuretics. Hypernatremia is less frequent than hyponatremia in CKD. It can occur because of the provision of hypertonic parenteral solutions, or more frequently as a consequence of osmotic diuresis due to inadequate water intake during intercurrent disease, or in some circumstance that limits access to water (obtundation, immobility). 3. Sodium Balance Disorders: In CKD, fractional excretion of sodium increases so that absolute sodium excretion is not modified until glomerular filtration rates below 15 ml/min (Strength of Recommendation B). Total body content of sodium is

  19. A New Regulatory Mechanism for Kv7.2 Protein During Neuropathy: Enhanced Transport from the Soma to Axonal Terminals of Injured Sensory Neurons.

    PubMed

    Cisneros, Elsa; Roza, Carolina; Jackson, Nieka; López-García, José Antonio

    2015-01-01

    Kv7.2 channel expression has been reported to decrease in dorsal root ganglia (DRG) following the induction of a peripheral neuropathy while other experiments show that Kv7.2 accumulates in peripheral neuromas. The mechanisms underlying these novel expression patterns are poorly understood. Here we use immunofluorescence methods to analyze Kv7.2 protein expression changes in sensory neurons following peripheral axotomy and the potential role of axonal transport. Results indicate that DRG neurons express Kv7.2 in ~16% of neurons and that this number decreases by about 65% after axotomy. Damaged neurons were identified in DRG by application of the tracer Fluoro-ruby at the site of injury during surgery. Reduction of Kv7.2 expression was particularly strong in damaged neurons although some loss was also found in putative uninjured neurons. In parallel to the decrease in the soma of axotomized sensory neurons, Kv7.2 accumulated at neuromatose fiber endings. Blockade of axonal transport with either vinblastine (VLB) or colchicine (COL) abolished Kv7.2 redistribution in neuropathic animals. Channel distribution rearrangements did not occur following induction of inflammation in the hind paw. Behavioral tests indicate that protein rearrangements within sensory afferents are essential to the development of allodynia under neuropathic conditions. These results suggest that axotomy enhances axonal transport in injured sensory neurons, leading to a decrease of somatic expression of Kv7.2 protein and a concomitant accumulation in damaged fiber endings. Localized changes in channel expression patterns under pathological conditions may create novel opportunities for Kv7.2 channel openers to act as analgesics. PMID:26696829

  20. Whirlin interacts with espin and modulates its actin-regulatory function: an insight into the mechanism of Usher syndrome type II.

    PubMed

    Wang, Le; Zou, Junhuang; Shen, Zuolian; Song, E; Yang, Jun

    2012-02-01

    Whirlin mutations cause retinal degeneration and hearing loss in Usher syndrome type II (USH2) and non-syndromic deafness, DFNB31. Its protein recruits other USH2 causative proteins to form a complex at the periciliary membrane complex in photoreceptors and the ankle link of the stereocilia in hair cells. However, the biological function of this USH2 protein complex is largely unknown. Using a yeast two-hybrid screen, we identified espin, an actin-binding/bundling protein involved in human deafness when defective, as a whirlin-interacting protein. The interaction between these two proteins was confirmed by their coimmunoprecipitation and colocalization in cultured cells. This interaction involves multiple domains of both proteins and only occurs when espin does not bind to actin. Espin was partially colocalized with whirlin in the retina and the inner ear. In whirlin knockout mice, espin expression changed significantly in these two tissues. Further studies found that whirlin increased the mobility of espin and actin at the actin bundles cross-linked by espin and, eventually, affected the dimension of these actin bundles. In whirlin knockout mice, the stereocilia were thickened in inner hair cells. We conclude that the interaction between whirlin and espin and the balance between their expressions are required to maintain the actin bundle network in photoreceptors and hair cells. Disruption of this actin bundle network contributes to the pathogenic mechanism of hearing loss and retinal degeneration caused by whirlin and espin mutations. Espin is a component of the USH2 protein complex and could be a candidate gene for Usher syndrome. PMID:22048959

  1. A New Regulatory Mechanism for Kv7.2 Protein During Neuropathy: Enhanced Transport from the Soma to Axonal Terminals of Injured Sensory Neurons

    PubMed Central

    Cisneros, Elsa; Roza, Carolina; Jackson, Nieka; López-García, José Antonio

    2015-01-01

    Kv7.2 channel expression has been reported to decrease in dorsal root ganglia (DRG) following the induction of a peripheral neuropathy while other experiments show that Kv7.2 accumulates in peripheral neuromas. The mechanisms underlying these novel expression patterns are poorly understood. Here we use immunofluorescence methods to analyze Kv7.2 protein expression changes in sensory neurons following peripheral axotomy and the potential role of axonal transport. Results indicate that DRG neurons express Kv7.2 in ~16% of neurons and that this number decreases by about 65% after axotomy. Damaged neurons were identified in DRG by application of the tracer Fluoro-ruby at the site of injury during surgery. Reduction of Kv7.2 expression was particularly strong in damaged neurons although some loss was also found in putative uninjured neurons. In parallel to the decrease in the soma of axotomized sensory neurons, Kv7.2 accumulated at neuromatose fiber endings. Blockade of axonal transport with either vinblastine (VLB) or colchicine (COL) abolished Kv7.2 redistribution in neuropathic animals. Channel distribution rearrangements did not occur following induction of inflammation in the hind paw. Behavioral tests indicate that protein rearrangements within sensory afferents are essential to the development of allodynia under neuropathic conditions. These results suggest that axotomy enhances axonal transport in injured sensory neurons, leading to a decrease of somatic expression of Kv7.2 protein and a concomitant accumulation in damaged fiber endings. Localized changes in channel expression patterns under pathological conditions may create novel opportunities for Kv7.2 channel openers to act as analgesics. PMID:26696829

  2. The analysis of estrogen receptor-α positive breast cancer stem-like cells unveils a high expression of the serpin proteinase inhibitor PI-9: Possible regulatory mechanisms.

    PubMed

    Lauricella, Marianna; Carlisi, Daniela; Giuliano, Michela; Calvaruso, Giuseppe; Cernigliaro, Cesare; Vento, Renza; D'Anneo, Antonella

    2016-07-01

    Breast cancer stem cells seem to play important roles in breast tumor recurrence and endocrine therapy resistance, although the underlying mechanisms have not been well established. Moreover, in some tumor systems the immunosurveillance failure against cancer cells has been related to the presence of the granzyme B inhibitor PI-9. This study explored the status of PI-9 in tumorspheres isolated from estrogen receptor-α positive (ERα+) breast cancer MCF7 cells. Studies were performed in tertiary tumorspheres which possess high levels of stemness markers (Nanog, Oct3/4 and Sox2) and self-renewal ability. The exposure to estrogens (17-β estradiol and genistein) increased the number and sizes of tumorspheres, promoting cell proliferation as demonstrated by the increase in the proliferating cell nuclear antigen (PCNA). The study of the three isoforms (66, 46 and 36 kDa) of ERα disclosed that tertiary tumorspheres exhibit a marked increase in ERα36, while the level of ERα66, which is highly expressed in MCF7 cells, declines. Although it is known that PI-9 is a transcriptional target of ERα66, surprisingly in tertiary tumorspheres, despite the reduced level of ERα66, the protein and mRNA content of PI-9 is higher than in MCF7 cells. Treatment with estrogens further increased PI-9 level while decreased that of ERα66 isoform thus excluding the involvement of this receptor isoform in the event. Moreover, our studies also provided evidence that tertiary tumorspheres express elevated levels of CXCR4 and phospho-p38, suggesting that the high PI-9 content might be ascribed to the activation of the proliferative CXCR4/phospho-p38 axis. Taken together, these events could supply a selective advantage to breast cancer stem cells by interfering with immunosurveillance systems and open up the avenue to new possible targets for breast cancer treatment. PMID:27121069

  3. Multiple functions of the crustacean gill: osmotic/ionic regulation, acid-base balance, ammonia excretion, and bioaccumulation of toxic metals

    PubMed Central

    Henry, Raymond P.; Lucu, Čedomil; Onken, Horst; Weihrauch, Dirk

    2012-01-01

    The crustacean gill is a multi-functional organ, and it is the site of a number of physiological processes, including ion transport, which is the basis for hemolymph osmoregulation; acid-base balance; and ammonia excretion. The gill is also the site by which many toxic metals are taken up by aquatic crustaceans, and thus it plays an important role in the toxicology of these species. This review provides a comprehensive overview of the ecology, physiology, biochemistry, and molecular biology of the mechanisms of osmotic and ionic regulation performed by the gill. The current concepts of the mechanisms of ion transport, the structural, biochemical, and molecular bases of systemic physiology, and the history of their development are discussed. The relationship between branchial ion transport and hemolymph acid-base regulation is also treated. In addition, the mechanisms of ammonia transport and excretion across the gill are discussed. And finally, the toxicology of heavy metal accumulation via the gill is reviewed in detail. PMID:23162474

  4. Genomics in the land of regulatory science.

    PubMed

    Tong, Weida; Ostroff, Stephen; Blais, Burton; Silva, Primal; Dubuc, Martine; Healy, Marion; Slikker, William

    2015-06-01

    Genomics science has played a major role in the generation of new knowledge in the basic research arena, and currently question arises as to its potential to support regulatory processes. However, the integration of genomics in the regulatory decision-making process requires rigorous assessment and would benefit from consensus amongst international partners and research communities. To that end, the Global Coalition for Regulatory Science Research (GCRSR) hosted the fourth Global Summit on Regulatory Science (GSRS2014) to discuss the role of genomics in regulatory decision making, with a specific emphasis on applications in food safety and medical product development. Challenges and issues were discussed in the context of developing an international consensus for objective criteria in the analysis, interpretation and reporting of genomics data with an emphasis on transparency, traceability and "fitness for purpose" for the intended application. It was recognized that there is a need for a global path in the establishment of a regulatory bioinformatics framework for the development of transparent, reliable, reproducible and auditable processes in the management of food and medical product safety risks. It was also recognized that training is an important mechanism in achieving internationally consistent outcomes. GSRS2014 provided an effective venue for regulators andresearchers to meet, discuss common issues, and develop collaborations to address the challenges posed by the application of genomics to regulatory science, with the ultimate goal of wisely integrating novel technical innovations into regulatory decision-making. PMID:25796433

  5. Renal regulation of acid-base equilibrium during chronic administration of mineral acid.

    PubMed

    De Sousa, R C; Harrington, J T; Ricanati, E S; Shelkrot, J W; Schwartz, W B

    1974-02-01

    load is the inability of the distal exchange mechanism to conserve the Na+ increment fully by means of H+ exchange. Escape of Na+ and K+ into the urine and the resulting stimulus to Na(+)-H+ exchange remove this constraint and are responsible for establishment of a new steady-state of acid-base equilibrium at plasma [HCO3-] levels significantly higher than those seen with HCl. The feeding of HCl in the presence of a normal salt intake led to a degree of metabolic acidosis not significantly different from that seen in dogs ingesting a low-salt diet. We suggest that the presence of dietary sodium at distal exchange sites did not enhance acid excretion because it is only after a loss of body sodium stores that sodium avidity is increased sufficiently to allow full removal of the acid load. The present findings indicate that the fundamental factors controlling acid excretion and bicarbonate reabsorption in metabolic acidosis are closely similar to those operative in metabolic alkalosis. PMID:11344560

  6. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet

    PubMed Central

    Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc

    2016-01-01

    Bacteria that inhabit the epithelium of the animals’ digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  7. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet.

    PubMed

    Terova, Genciana; Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc

    2016-01-01

    Bacteria that inhabit the epithelium of the animals' digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  8. The generalized lewis acid-base titration of palladium and niobium

    NASA Astrophysics Data System (ADS)

    Cima, M.; Brewer, L.

    1988-12-01

    The high thermodynamic stability of alloys composed of platinum group metals and group IVB and VB metals has been explained by an electronic interaction analogous to the Lewis acid-base concept for nontransition elements. The analogy is further demonstrated by the titration of palladium by addition of niobium. The activity of niobium in solid palladium was measured as a function of concentration by solid-state galvanic cells and study of the ternary oxide phase diagram. The galvanic cells were of the type Pt/NbO2,Nb2O4.8/YDTJNbOy,Nbpd/Pt where the solid electrolyte is yttria-doped thoria (YDT). Ternary phase diagrams for the Pd-Nb-0 and Rh-Nb-0 systems were obtained by characterizing samples equilibrated at 1000 °C. The phase relationships found in the ternary diagrams were also used to derive thermochemical data for the alloys. Thermochemical quantities for other acid-base stabilized alloys such as Nb-Rh, Ti-Pd, and Ti-Rh were also measured. The excess partial molar ΔGxs/R of niobium at infinite dilution was determined to be -31 kilo-Kelvin at 1000 °C, and the AG°JR of formation of a mole of NbPd3.55 is —21 kilo-Kelvin. These results and those for the other systems are used to assess the importance of valence electron configuration, nuclear charge, and crystal field effects in the context of generalized Lewis acid-base theory. It is concluded that both the nuclear charge of the atom and crystal field splitting of the valence orbitals significantly affect the basicity of the platinum group metals.

  9. Synthesis of acid-base bifunctional mesoporous materials by oxidation and thermolysis

    SciTech Connect

    Yu, Xiaofang; Zou, Yongcun; Wu, Shujie; Liu, Heng; Guan, Jingqi; Kan, Qiubin

    2011-06-15

    Graphical abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst. The obtained sample of SO{sub 3}H-MCM-41-NH{sub 2} containing amine and sulfonic acids exhibits excellent catalytic activity in aldol condensation reaction. Research highlights: {yields} Synthesize acid-base bifunctional mesoporous materials SO{sub 3}H-MCM-41-NH{sub 2}. {yields} Oxidation and then thermolysis to generate acidic site and basic site. {yields} Exhibit good catalytic performance in aldol condensation reaction between acetone and various aldehydes. -- Abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst SO{sub 3}H-MCM-41-NH{sub 2}. This method was achieved by co-condensation of tetraethylorthosilicate (TEOS), 3-mercaptopropyltrimethoxysilane (MPTMS) and (3-triethoxysilylpropyl) carbamicacid-1-methylcyclohexylester (3TAME) in the presence of cetyltrimethylammonium bromide (CTAB), followed by oxidation and then thermolysis to generate acidic site and basic site. X-ray diffraction (XRD) and transmission electron micrographs (TEM) show that the resultant materials keep mesoporous structure. Thermogravimetric analysis (TGA), X-ray photoelectron spectra (XPS), back titration, solid-state {sup 13}C CP/MAS NMR and solid-state {sup 29}Si MAS NMR confirm that the organosiloxanes were condensed as a part of the silica framework. The bifunctional sample (SO{sub 3}H-MCM-41-NH{sub 2}) containing amine and sulfonic acids exhibits excellent acid-basic properties, which make it possess high activity in aldol condensation reaction between acetone and various aldehydes.

  10. Synthesis, characterization and catalytic activity of acid-base bifunctional materials through protection of amino groups

    SciTech Connect

    Shao, Yanqiu; Liu, Heng; Yu, Xiaofang; Guan, Jingqi; Kan, Qiubin

    2012-03-15

    Graphical abstract: Acid-base bifunctional mesoporous material SO{sub 3}H-SBA-15-NH{sub 2} was successfully synthesized under low acidic medium through protection of amino groups. Highlights: Black-Right-Pointing-Pointer The acid-base bifunctional material SO{sub 3}H-SBA-15-NH{sub 2} was successfully synthesized through protection of amino groups. Black-Right-Pointing-Pointer The obtained bifunctional material was tested for aldol condensation. Black-Right-Pointing-Pointer The SO{sub 3}H-SBA-15-NH{sub 2} catalyst containing amine and sulfonic acid groups exhibited excellent acid-basic properties. -- Abstract: Acid-base bifunctional mesoporous material SO{sub 3}H-SBA-15-NH{sub 2} was successfully synthesized under low acidic medium through protection of amino groups. X-ray diffraction (XRD), N{sub 2} adsorption-desorption, transmission electron micrographs (TEM), back titration, {sup 13}C magic-angle spinning (MAS) NMR and {sup 29}Si magic-angle spinning (MAS) NMR were employed to characterize the synthesized materials. The obtained bifunctional material was tested for aldol condensation reaction between acetone and 4-nitrobenzaldehyde. Compared with monofunctional catalysts of SO{sub 3}H-SBA-15 and SBA-15-NH{sub 2}, the bifunctional sample of SO{sub 3}H-SBA-15-NH{sub 2} containing amine and sulfonic acid groups exhibited excellent acid-basic properties, which make it possess high activity for the aldol condensation.

  11. KINEMATIC VARIABLES AND BLOOD ACID-BASE STATUS IN THE ANALYSIS OF COLLEGIATE SWIMMERS’ ANAEROBIC CAPACITY

    PubMed Central

    Bielec, G.; Makar, P.; Laskowski, R.

    2013-01-01

    Short duration repeated maximal efforts are often used in swimming training to improve lactate tolerance, which gives swimmers the ability to maintain a high work rate for a longer period of time. The aim of the study was to examine the kinematics of swimming and its relation to the changes in blood acid-base status and potassium level. Seven collegiate swimmers, with at least 6 years of training experience, volunteered to participate in the study. The test consisted of 8 x 25 m front crawl performed with maximum effort. The rest period between repetitions was set to five seconds. Blood samples were taken from the fingertip at rest, after warm-up and in the 3rd minute after completion of the test. The swimming was recorded with a video recorder, for later analysis of time, velocity and technique (stroke index). Based on the swimming velocity results, the obtained curve can be divided into rapid decrease of velocity and relatively stable velocities. The breaking point of repetition in swimming velocity was assumed as the swimming velocity threshold and it was highly correlated with the decrease of the blood acid-base status (pH r=0.82, BE r=0.87, HCO3 - r=0.76; p<0.05 in all cases). There was no correlation between stroke index or fatigue index and blood acid-base status. Analysis of the swimming speed in the 8 x 25 m test seems to be helpful in evaluation of lactate tolerance (anaerobic capacity) in collegiate swimmers. PMID:24744491

  12. Spectroscopic Investigation of Surface Dependent Acid-base Property of Ceria Nanoshapes

    DOE PAGESBeta

    Wu, Zili; Mann, Amanda K; Li, Meijun; Overbury, Steven

    2015-01-01

    In addition to their well-known redox character, the acid-base property is another interesting aspect of ceria-based catalysts. Herein, the effect of surface structure on the acid-base property of ceria was studied in detail by utilizing ceria nanocrystals with different morphologies (cubes, octahedra and rods) that exhibit crystallographically well-defined surface facets. The nature, type, strength and amount of acid and base sites on these ceria nanoshapes were investigated via in situ IR spectroscopy combined with various probe molecules. Pyridine adsorption shows the presence of Lewis acid sites (Ce cations) on the ceria nanoshapes. These Lewis acid sites are relatively weak andmore » similar in strength among the three nanoshapes according to the probing by both pyridine and acetonitrile. Both Br nsted (hydroxyl group) and Lewis (surface lattice oxygen) base sites are present on the ceria nanoshapes as probed by CO2 adsorption. CO2 and chloroform adsorption indicate that the strength and amount of the Lewis base sites are shape dependent: rods > cubes > octahedra. The weak and strong surface dependence of the acid and base sites, respectively, are a result of interplay between the surface structure dependent coordination unsaturation status of the Ce cations and O anions and the amount of defect sites on the three ceria nanoshapes. Furthermore, it was found that the nature of the acid-base sites of ceria can be impacted by impurities, such as Na and P residues that result from their use as structure-directing reagent in the hydrothermal synthesis of the ceria nanocrystals. This observation calls for precaution in interpreting the catalytic behavior of nanoshaped ceria where trace impurities may be present.« less

  13. Beta-adrenergic stimulation of cFOS via protein kinase A is mediated by cAMP regulatory element binding protein (CREB)-dependent and tissue-specific CREB-independent mechanisms in corticotrope cells.

    PubMed

    Boutillier, A L; Barthel, F; Roberts, J L; Loeffler, J P

    1992-11-25

    Catecholamines stimulate proopiomelanocortin (POMC) gene expression in corticotrope cells, but the molecular mechanisms of these effects are not known. While beta-adrenergic receptors stimulate the protein kinase A (PKA) system, the POMC promoter does not have classical cAMP-response elements (CREs). Therefore, we investigated the induction of the c-fos protooncogen, previously shown to increase POMC transcription in AtT20 cells. In this corticotrope-derived cell line, we show that activation of beta-receptors with isoprenaline (Iso) induces a transient rise in c-fos mRNA levels. Gel mobility shift assays with a labeled AP1 consensus sequence (TGACTCA) showed induction of specific binding activity after Iso treatment. Cotransfection experiments with dominant inhibitory PKA mutants and reporter genes containing c-fos promoter sequences showed that c-fos induction by Iso is entirely dependent on a functional PKA activity. Furthermore, we show that beta-receptor induction of c-fos in corticotrophs is mediated by at least two distinct cAMP-responsive sequences. cAMP regulatory element binding (CREB)-dependent induction is observed on the CRE located at -60 bp on the c-fos promoter. A region located in the vicinity of the dyad symetry element (-290) is also found to mediate tissue-specific cAMP induction. Transcriptional activation by this site, although sensitive to PKA antagonism, is not blocked by CREB mutants. PMID:1331087

  14. Has Stewart approach improved our ability to diagnose acid-base disorders in critically ill patients?

    PubMed

    Masevicius, Fabio D; Dubin, Arnaldo

    2015-02-01

    The Stewart approach-the application of basic physical-chemical principles of aqueous solutions to blood-is an appealing method for analyzing acid-base disorders. These principles mainly dictate that pH is determined by three independent variables, which change primarily and independently of one other. In blood plasma in vivo these variables are: (1) the PCO2; (2) the strong ion difference (SID)-the difference between the sums of all the strong (i.e., fully dissociated, chemically nonreacting) cations and all the strong anions; and (3) the nonvolatile weak acids (Atot). Accordingly, the pH and the bicarbonate levels (dependent variables) are only altered when one or more of the independent variables change. Moreover, the source of H(+) is the dissociation of water to maintain electroneutrality when the independent variables are modified. The basic principles of the Stewart approach in blood, however, have been challenged in different ways. First, the presumed independent variables are actually interdependent as occurs in situations such as: (1) the Hamburger effect (a chloride shift when CO2 is added to venous blood from the tissues); (2) the loss of Donnan equilibrium (a chloride shift from the interstitium to the intravascular compartment to balance the decrease of Atot secondary to capillary leak; and (3) the compensatory response to a primary disturbance in either independent variable. Second, the concept of water dissociation in response to changes in SID is controversial and lacks experimental evidence. In addition, the Stewart approach is not better than the conventional method for understanding acid-base disorders such as hyperchloremic metabolic acidosis secondary to a chloride-rich-fluid load. Finally, several attempts were performed to demonstrate the clinical superiority of the Stewart approach. These studies, however, have severe methodological drawbacks. In contrast, the largest study on this issue indicated the interchangeability of the Stewart and

  15. Relationship of students' conceptual representations and problem-solving abilities in acid-base chemistry

    NASA Astrophysics Data System (ADS)

    Powers, Angela R.

    2000-10-01

    This study explored the relationship between secondary chemistry students' conceptual representations of acid-base chemistry, as shown in student-constructed concept maps, and their ability to solve acid-base problems, represented by their score on an 18-item paper and pencil test, the Acid-Base Concept Assessment (ABCA). The ABCA, consisting of both multiple-choice and short-answer items, was originally designed using a question-type by subtopic matrix, validated by a panel of experts, and refined through pilot studies and factor analysis to create the final instrument. The concept map task included a short introduction to concept mapping, a prototype concept map, a practice concept-mapping activity, and the instructions for the acid-base concept map task. The instruments were administered to chemistry students at two high schools; 108 subjects completed both instruments for this study. Factor analysis of ABCA results indicated that the test was unifactorial for these students, despite the intention to create an instrument with multiple "question-type" scales. Concept maps were scored both holistically and by counting valid concepts. The two approaches were highly correlated (r = 0.75). The correlation between ABCA score and concept-map score was 0.29 for holistically-scored concept maps and 0.33 for counted-concept maps. Although both correlations were significant, they accounted for only 8.8 and 10.2% of variance in ABCA scores, respectively. However, when the reliability of the instruments used is considered, more than 20% of the variance in ABCA scores may be explained by concept map scores. MANOVAs for ABCA and concept map scores by instructor, student gender, and year in school showed significant differences for both holistic and counted concept-map scores. Discriminant analysis revealed that the source of these differences was the instruction variable. Significant differences between classes receiving different instruction were found in the frequency of

  16. Determination of the acidic sites of purified single-walled carbon nanotubes by acid base titration

    NASA Astrophysics Data System (ADS)

    Hu, H.; Bhowmik, P.; Zhao, B.; Hamon, M. A.; Itkis, M. E.; Haddon, R. C.

    2001-09-01

    We report the measurement of the acidic sites in three different samples of commercially available full-length purified single-walled carbon nanotubes (SWNTs) - as obtained from CarboLex (CLI), Carbon Solutions (CSI) and Tubes@Rice (TAR) - by simple acid-base titration methods. Titration of the purified SWNTs with NaOH and NaHCO 3 solutions was used to determine the total percentage of acidic sites and carboxylic acid groups, respectively. The total percentage of acidic sites in full length purified SWNTs from TAR, CLI and CSI are about 1-3%.

  17. The importance of acid-base management for cardiac and cerebral preservation during open heart operations.

    PubMed

    Swan, H

    1984-04-01

    The basic physiologic characteristics of acid-base equilibria during hypothermia were briefly reviewed. By graphic analysis, four possible clinical strategies for managing the acid-base status of the patient undergoing H-CPB were documented. The effect of hemodilution on buffer capacity was charted in a manner applicable to common current operative procedures. During hypothermia for cardiac operations as presently conducted, the perfusionist is in control of the temperature of the body and the perfusion preservation of the body and brain; the surgeon must assume responsibility for preservation of the heart. The literature pertinent to the relationship of the acid-base state to the functions and structural preservation of the heart and brain during the conditions of cooling to and rewarming from deep hypothermia associated with cardiopulmonary bypass, aortic cross clamping, cardioplegia and total circulatory arrest have been reviewed. The evidence is overwhelming that myocardial anoxia caused by aortic occlusion or total circulatory arrest at any temperature to 15 degrees C. result in progressive acidosis which, of itself, is myotoxic. In contrast, alkalinity is ionotropic. Myocardial ischemia, in both adults and infants, should be prevented and treated by alkaline perfusion cooling and by frequent coronary perfusion of a cardiopreservative solution which is extremely cold (4 to 8 degrees C.), oxygenated, has a pH of 7.8, slightly hyperosmolar and which has a hematocrit of 20 per cent (imidazole, erythrocytes and plasma protein colloid), a cardioplegic ionic pattern and energy substrates. Reperfusion of the heart should begin at a 37 pH of 7.8. Evidence is strong that the use of CO2 added to any gas mixture is harmful. It increases myocardial acidosis; it does not increase cerebral blood flow during hypothermia. Protection of the unperfused brain of an infant should emphasize prevention of circulatory arrest prolonged to more than 40 minutes. Temporary reperfusion

  18. Spectral and Acid-Base Properties of Hydroxyflavones in Micellar Solutions of Cationic Surfactants

    NASA Astrophysics Data System (ADS)

    Lipkovska, N. A.; Barvinchenko, V. N.; Fedyanina, T. V.; Rugal', A. A.

    2014-09-01

    It has been shown that the spectral characteristics (intensity, position of the absorption band) and the acid-base properties in a series of structurally similar hydroxyflavones depend on the concentration of the cationic surfactants miramistin and decamethoxin in aqueous solutions, and the extent of their changes is more pronounced for hydrophobic quercetin than for hydrophilic rutin. For the first time, we have determined the apparent dissociation constants of quercetin and rutin in solutions of these cationic surfactants (pKa1) over a broad concentration range and we have established that they decrease in the series water-decamethoxin-miramistin.

  19. The species- and site-specific acid-base properties of penicillamine and its homodisulfide

    NASA Astrophysics Data System (ADS)

    Mirzahosseini, Arash; Szilvay, András; Noszál, Béla

    2014-08-01

    Penicillamine, penicillamine disulfide and 4 related compounds were studied by 1H NMR-pH titrations and case-tailored evaluation methods. The resulting acid-base properties are quantified in terms of 14 macroscopic and 28 microscopic protonation constants and the concomitant 7 interactivity parameters. The species- and site-specific basicities are interpreted by means of inductive and shielding effects through various intra- and intermolecular comparisons. The thiolate basicities determined this way are key parameters and exclusive means for the prediction of thiolate oxidizabilities and chelate forming properties in order to understand and influence chelation therapy and oxidative stress at the molecular level.

  20. Management of Acute Kidney Injury and Acid-Base Balance in the Septic Patient.

    PubMed

    Weyker, Paul D; Pérez, Xosé L; Liu, Kathleen D

    2016-06-01

    Acute kidney injury (AKI) is an abrupt decrease in kidney function that takes place over hours to days. Sepsis is the leading cause of AKI and portends a particularly high morbidity and mortality, although the severity may vary from a transient rise in serum creatinine to end-stage renal disease. With regard to acid-base management in septic AKI, caution should be used with hyperchloremic crystalloid solutions, and dialysis is often used in the setting of severe acidosis. In the future, biomarkers may help clinicians identify AKI earlier and allow for potential interventions before the development of severe AKI. PMID:27229644

  1. Acid-base balance and plasma composition in the aestivating lungfish (Protopterus).

    PubMed

    DeLaney, R G; Lahiri, S; Hamilton, R; Fishman, P

    1977-01-01

    Upon entering into aestivation, Protopterus aethiopicus develops a respiratory acidosis. A slow compensatory increase in plasma bicarbonate suffices only to partially restore arterial pH toward normal. The cessation of water intake from the start of aestivation results in hemoconcentration and marked oliguria. The concentrations of most plasma constituents continue to increase progressively, and the electrolyte ratios change. The increase in urea concentration is disproportionately high for the degree of dehydration and constitutes an increasing fraction of total plasma osmolality. Acid-base and electrolyte balance do not reach a new equilibrium within 1 yr in the cocoon. PMID:13665

  2. The role of acid-base imbalance in statin-induced myotoxicity.

    PubMed

    Taha, Dhiaa A; De Moor, Cornelia H; Barrett, David A; Lee, Jong Bong; Gandhi, Raj D; Hoo, Chee Wei; Gershkovich, Pavel

    2016-08-01

    Disturbances in acid-base balance, such as acidosis and alkalosis, have potential to alter the pharmacologic and toxicologic outcomes of statin therapy. Statins are commonly prescribed for elderly patients who have multiple comorbidities such as diabetes mellitus, cardiovascular, and renal diseases. These patients are at risk of developing acid-base imbalance. In the present study, the effect of disturbances in acid-base balance on the interconversion of simvastatin and pravastatin between lactone and hydroxy acid forms have been investigated in physiological buffers, human plasma, and cell culture medium over pH ranging from 6.8-7.8. The effects of such interconversion on cellular uptake and myotoxicity of statins were assessed in vitro using C2C12 skeletal muscle cells under conditions relevant to acidosis, alkalosis, and physiological pH. Results indicate that the conversion of the lactone forms of simvastatin and pravastatin to the corresponding hydroxy acid is strongly pH dependent. At physiological and alkaline pH, substantial proportions of simvastatin lactone (SVL; ∼87% and 99%, respectively) and pravastatin lactone (PVL; ∼98% and 99%, respectively) were converted to the active hydroxy acid forms after 24 hours of incubation at 37°C. At acidic pH, conversion occurs to a lower extent, resulting in greater proportion of statin remaining in the more lipophilic lactone form. However, pH alteration did not influence the conversion of the hydroxy acid forms of simvastatin and pravastatin to the corresponding lactones. Furthermore, acidosis has been shown to hinder the metabolism of the lactone form of statins by inhibiting hepatic microsomal enzyme activities. Lipophilic SVL was found to be more cytotoxic to undifferentiated and differentiated skeletal muscle cells compared with more hydrophilic simvastatin hydroxy acid, PVL, and pravastatin hydroxy acid. Enhanced cytotoxicity of statins was observed under acidic conditions and is attributed to increased

  3. The effect of acid-base clustering and ions on the growth of atmospheric nano-particles.

    PubMed

    Lehtipalo, Katrianne; Rondo, Linda; Kontkanen, Jenni; Schobesberger, Siegfried; Jokinen, Tuija; Sarnela, Nina; Kürten, Andreas; Ehrhart, Sebastian; Franchin, Alessandro; Nieminen, Tuomo; Riccobono, Francesco; Sipilä, Mikko; Yli-Juuti, Taina; Duplissy, Jonathan; Adamov, Alexey; Ahlm, Lars; Almeida, João; Amorim, Antonio; Bianchi, Federico; Breitenlechner, Martin; Dommen, Josef; Downard, Andrew J; Dunne, Eimear M; Flagan, Richard C; Guida, Roberto; Hakala, Jani; Hansel, Armin; Jud, Werner; Kangasluoma, Juha; Kerminen, Veli-Matti; Keskinen, Helmi; Kim, Jaeseok; Kirkby, Jasper; Kupc, Agnieszka; Kupiainen-Määttä, Oona; Laaksonen, Ari; Lawler, Michael J; Leiminger, Markus; Mathot, Serge; Olenius, Tinja; Ortega, Ismael K; Onnela, Antti; Petäjä, Tuukka; Praplan, Arnaud; Rissanen, Matti P; Ruuskanen, Taina; Santos, Filipe D; Schallhart, Simon; Schnitzhofer, Ralf; Simon, Mario; Smith, James N; Tröstl, Jasmin; Tsagkogeorgas, Georgios; Tomé, António; Vaattovaara, Petri; Vehkamäki, Hanna; Vrtala, Aron E; Wagner, Paul E; Williamson, Christina; Wimmer, Daniela; Winkler, Paul M; Virtanen, Annele; Donahue, Neil M; Carslaw, Kenneth S; Baltensperger, Urs; Riipinen, Ilona; Curtius, Joachim; Worsnop, Douglas R; Kulmala, Markku

    2016-01-01

    The growth of freshly formed aerosol particles can be the bottleneck in their survival to cloud condensation nuclei. It is therefore crucial to understand how particles grow in the atmosphere. Insufficient experimental data has impeded a profound understanding of nano-particle growth under atmospheric conditions. Here we study nano-particle growth in the CLOUD (Cosmics Leaving OUtdoors Droplets) chamber, starting from the formation of molecular clusters. We present measured growth rates at sub-3 nm sizes with different atmospherically relevant concentrations of sulphuric acid, water, ammonia and dimethylamine. We find that atmospheric ions and small acid-base clusters, which are not generally accounted for in the measurement of sulphuric acid vapour, can participate in the growth process, leading to enhanced growth rates. The availability of compounds capable of stabilizing sulphuric acid clusters governs the magnitude of these effects and thus the exact growth mechanism. We bring these observations into a coherent framework and discuss their significance in the atmosphere. PMID:27197574

  4. The Importance of the Ionic Product for Water to Understand the Physiology of the Acid-Base Balance in Humans

    PubMed Central

    Adeva-Andany, María M.; Carneiro-Freire, Natalia; Donapetry-García, Cristóbal; Rañal-Muíño, Eva; López-Pereiro, Yosua

    2014-01-01

    Human plasma is an aqueous solution that has to abide by chemical rules such as the principle of electrical neutrality and the constancy of the ionic product for water. These rules define the acid-base balance in the human body. According to the electroneutrality principle, plasma has to be electrically neutral and the sum of its cations equals the sum of its anions. In addition, the ionic product for water has to be constant. Therefore, the plasma concentration of hydrogen ions depends on the plasma ionic composition. Variations in the concentration of plasma ions that alter the relative proportion of anions and cations predictably lead to a change in the plasma concentration of hydrogen ions by driving adaptive adjustments in water ionization that allow plasma electroneutrality while maintaining constant the ionic product for water. The accumulation of plasma anions out of proportion of cations induces an electrical imbalance compensated by a fall of hydroxide ions that brings about a rise in hydrogen ions (acidosis). By contrast, the deficiency of chloride relative to sodium generates plasma alkalosis by increasing hydroxide ions. The adjustment of plasma bicarbonate concentration to these changes is an important compensatory mechanism that protects plasma pH from severe deviations. PMID:24877130

  5. Acid-base strength and acidochromism of some dimethylamino-azinium iodides. An integrated experimental and theoretical study.

    PubMed

    Benassi, Enrico; Carlotti, Benedetta; Fortuna, Cosimo G; Barone, Vincenzo; Elisei, Fausto; Spalletti, Anna

    2015-01-15

    The effects of pH on the spectral properties of stilbazolium salts bearing dimethylamino substituents, namely, trans isomers of the iodides of the dipolar E-[2-(4-dimethylamino)styryl]-1-methylpyridinium, its branched quadrupolar analogue E,E-[2,6-di-(p-dimethylamino)styryl]-1-methylpyridinium, and three analogues, chosen to investigate the effects of the stronger quinolinium acceptor, the longer butadiene π bridge, or both, were investigated through a joint experimental and computational approach. A noticeable acidochromism of the absorption spectra (interesting for applications) was observed, with the basic and protonated species giving intensely colored and transparent solutions, respectively. The acid–base equilibrium constants for the protonation of the dimethylamino group in the ground state (pKa) were experimentally derived. Theoretical calculations according to the thermodynamic Born-Haber cycle provided pKa values in good agreement with the experimental values. The very low fluorescence yield did not allow a direct investigation of the changes in the acid-base properties in the excited state (pKa*) by fluorimetric titrations. Their values were derived by quantum-mechanical calculations and estimated experimentally on the basis of the Förster cycle. PMID:25521813

  6. Early apoptotic features of K562 cell death induced by 5-aminolaevulinic acid-based photodynamic therapy.

    PubMed

    Kuzelová, K; Grebenová, D; Pluskalová, M; Marinov, I; Hrkal, Z

    2004-01-23

    5-Aminolaevulinic acid-based photodynamic therapy (ALA-PDT) is used to eliminate cancerous cells through photoactivation of endogenously formed protoporphyrin IX (PPIX) following the administration of PPIX precursor, 5-aminolaevulinic acid (ALA). We report on the kinetics of PPIX accumulation and the mechanism of cytotoxic effects of ALA-PDT studied in the chronic myelogenous leukaemia derived cell line K562. The PPIX distribution and, consequently, cytotoxic effects were found to be heterogenous. A subpopulation of K562 cells accumulating PPIX to a lesser extent exhibits only transient cell cycle arrest. A fraction of cells, probably those with higher PPIX accumulation, are irreversibly damaged by ALA-PDT. We detected several signs of an early apoptosis: lowering of Bcl-xL expression, decrease of the mitochondrial and plasma membrane potential, the cytochrome c release into the cytoplasm, and the unmasking of the mitochondrial antigen 7A6. However, late apoptotic events were lacking: neither caspase-3 activation nor DNA fragmentation occurred. Instead, rapidly progressing cell necrosis resulting from plasma membrane damage was observed. We suggest that the high level of the antiapoptotic heat-shock proteins HSP70 and HSP27 found by us in the K562 cells is responsible for the inhibition of the apoptotic process upstream of caspases activation. PMID:14732253

  7. How are the Concepts and Theories of Acid Base Reactions Presented? Chemistry in Textbooks and as Presented by Teachers

    NASA Astrophysics Data System (ADS)

    Furió-Más, Carlos; Calatayud, María Luisa; Guisasola, Jenaro; Furió-Gómez, Cristina

    2005-09-01

    This paper investigates the views of science and scientific activity that can be found in chemistry textbooks and heard from teachers when acid base reactions are introduced to grade 12 and university chemistry students. First, the main macroscopic and microscopic conceptual models are developed. Second, we attempt to show how the existence of views of science in textbooks and of chemistry teachers contributes to an impoverished image of chemistry. A varied design has been elaborated to analyse some epistemological deficiencies in teaching acid base reactions. Textbooks have been analysed and teachers have been interviewed. The results obtained show that the teaching process does not emphasize the macroscopic presentation of acids and bases. Macroscopic and microscopic conceptual models involved in the explanation of acid base processes are mixed in textbooks and by teachers. Furthermore, the non-problematic introduction of concepts, such as the hydrolysis concept, and the linear, cumulative view of acid base theories (Arrhenius and Brönsted) were detected.

  8. Gene Regulatory Networks Elucidating Huanglongbing Disease Mechanisms

    PubMed Central

    Martinelli, Federico; Reagan, Russell L.; Uratsu, Sandra L.; Phu, My L.; Albrecht, Ute; Zhao, Weixiang; Davis, Cristina E.; Bowman, Kim D.; Dandekar, Abhaya M.

    2013-01-01

    Next-generation sequencing was exploited to gain deeper insight into the response to infection by Candidatus liberibacter asiaticus (CaLas), especially the immune disregulation and metabolic dysfunction caused by source-sink disruption. Previous fruit transcriptome data were compared with additional RNA-Seq data in three tissues: immature fruit, and young and mature leaves. Four categories of orchard trees were studied: symptomatic, asymptomatic, apparently healthy, and healthy. Principal component analysis found distinct expression patterns between immature and mature fruits and leaf samples for all four categories of trees. A predicted protein – protein interaction network identified HLB-regulated genes for sugar transporters playing key roles in the overall plant responses. Gene set and pathway enrichment analyses highlight the role of sucrose and starch metabolism in disease symptom development in all tissues. HLB-regulated genes (glucose-phosphate-transporter, invertase, starch-related genes) would likely determine the source-sink relationship disruption. In infected leaves, transcriptomic changes were observed for light reactions genes (downregulation), sucrose metabolism (upregulation), and starch biosynthesis (upregulation). In parallel, symptomatic fruits over-expressed genes involved in photosynthesis, sucrose and raffinose metabolism, and downregulated starch biosynthesis. We visualized gene networks between tissues inducing a source-sink shift. CaLas alters the hormone crosstalk, resulting in weak and ineffective tissue-specific plant immune responses necessary for bacterial clearance. Accordingly, expression of WRKYs (including WRKY70) was higher in fruits than in leaves. Systemic acquired responses were inadequately activated in young leaves, generally considered the sites where most new infections occur. PMID:24086326

  9. Gene regulatory networks elucidating Huanglongbing disease mechanisms

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Next-generation sequencing was exploited to gain deeper insight into the response to infection by Candidatus liberibacter asiaticus (CaLas), especially the immune disregulation and metabolic dysfunction caused by source-sink disruption. Previous fruit transcriptome data were compared with additional...

  10. Self-Regulatory Mechanisms Governing Gender Development.

    ERIC Educational Resources Information Center

    Bussey, Kay; Bandura, Albert

    1992-01-01

    Groups of younger and older children in a sample of two to five year olds were assessed for gender knowledge, gender standards, and gender-linked behavior. All children exhibited more same- than cross-sex typed behavior. Older children expressed self-approval for same-sex behavior and self-criticism for cross-sex behavior. (BC)

  11. Nuclear Regulatory Commission Semiannual Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-20

    ...) 2010, less the amounts appropriated from the Nuclear Waste Fund, amounts appropriated for Waste... agenda on April 26, 2010 (75 FR 21960). For this edition of the NRC's regulatory agenda, the most... publication of the last NRC semiannual agenda on April 26, 2010 (75 FR 21960). Within each group, the...

  12. NRC regulatory agenda

    SciTech Connect

    Not Available

    1991-04-01

    The NRC Regulatory Agenda is a compilation of all rules on which the NRC has recently completed action or has proposed, or is considering action and all petitions for rulemaking which have been received by the Commission and are pending disposition by the Commission. The Regulatory Agenda is updated and issued each quarter.

  13. NRC regulatory agenda

    SciTech Connect

    Not Available

    1992-05-01

    The NRC Regulatory Agenda is a compilation of all rules on which the NRC has recently completed action, or has proposed action, or is considering action, and all petitions for rulemaking which have been received by the Commission and are pending disposition by the Commission. The Regulatory Agenda is updated and issued each quarter.

  14. NRC Regulatory Agenda

    SciTech Connect

    Not Available

    1991-10-01

    The NRC Regulatory Agenda is a compilation of all rules on which the NRC has recently completed action, or has proposed action, or is considering action, and all petitions for rulemaking which have been received by the Commission and are pending disposition by the Commission. The Regulatory Agenda is updated and issued each quarter.

  15. NRC Regulatory Agenda

    SciTech Connect

    Not Available

    1991-08-01

    The NRC Regulatory Agenda is a compilation of all rules on which the NRC has recently completed action or has proposed, or is considering action and all petitions for rulemaking which have been received by the commission and are pending disposition by the Commission. The Regulatory Agenda is updated and issued each quarter.