Sample records for acid-base regulatory mechanisms

  1. Recent advances in understanding trans-epithelial acid-base regulation and excretion mechanisms in cephalopods

    PubMed Central

    Hu, Marian Y; Hwang, Pung-Pung; Tseng, Yung-Che

    2015-01-01

    Cephalopods have evolved complex sensory systems and an active lifestyle to compete with fish for similar resources in the marine environment. Their highly active lifestyle and their extensive protein metabolism has led to substantial acid-base regulatory abilities enabling these organisms to cope with CO2 induced acid-base disturbances. In convergence to teleost, cephalopods possess an ontogeny-dependent shift in ion-regulatory epithelia with epidermal ionocytes being the major site of embryonic acid-base regulation and ammonia excretion, while gill epithelia take these functions in adults. Although the basic morphology and excretory function of gill epithelia in cephalopods were outlined almost half a century ago, modern immunohistological and molecular techniques are bringing new insights to the mechanistic basis of acid-base regulation and excretion of nitrogenous waste products (e.g. NH3/NH4+) across ion regulatory epithelia of cephalopods. Using cephalopods as an invertebrate model, recent findings reveal partly conserved mechanisms but also novel aspects of acid-base regulation and nitrogen excretion in these exclusively marine animals. Comparative studies using a range of marine invertebrates will create a novel and exciting research direction addressing the evolution of pH regulatory and excretory systems. PMID:26716070

  2. What is the Ultimate Goal in Acid-Base Regulation?

    ERIC Educational Resources Information Center

    Balakrishnan, Selvakumar; Gopalakrishnan, Maya; Alagesan, Murali; Prakash, E. Sankaranarayanan

    2007-01-01

    It is common to see chapters on acid-base physiology state that the goal of acid-base regulatory mechanisms is to maintain the pH of arterial plasma and not arterial PCO [subscript 2] (Pa[subscript CO[subscript 2

  3. Mechanistic Basis for Plant Responses to Drought Stress : Regulatory Mechanism of Abscisic Acid Signaling

    NASA Astrophysics Data System (ADS)

    Miyakawa, Takuya; Tanokura, Masaru

    The phytohormone abscisic acid (ABA) plays a key role in the rapid adaptation of plants to environmental stresses such as drought and high salinity. Accumulated ABA in plant cells promotes stomatal closure in guard cells and transcription of stress-tolerant genes. Our understanding of ABA responses dramatically improved by the discovery of both PYR/PYL/RCAR as a soluble ABA receptor and inhibitory complex of a protein phospatase PP2C and a protein kinase SnRK2. Moreover, several structural analyses of PYR/PYL/RCAR revealed the mechanistic basis for the regulatory mechanism of ABA signaling, which provides a rational framework for the design of alternative agonists in future.

  4. Acid-base homeostasis in the human system

    NASA Technical Reports Server (NTRS)

    White, R. J.

    1974-01-01

    Acid-base regulation is a cooperative phenomena in vivo with body fluids, extracellular and intracellular buffers, lungs, and kidneys all playing important roles. The present account is much too brief to be considered a review of present knowledge of these regulatory systems, and should be viewed, instead, as a guide to the elements necessary to construct a simple model of the mutual interactions of the acid-base regulatory systems of the body.

  5. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    NASA Astrophysics Data System (ADS)

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine

    2015-07-01

    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution.

  6. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  7. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

  8. Molecular mechanisms of acid-base sensing by the kidney.

    PubMed

    Brown, Dennis; Wagner, Carsten A

    2012-05-01

    A major function of the kidney is to collaborate with the respiratory system to maintain systemic acid-base status within limits compatible with normal cell and organ function. It achieves this by regulating the excretion and recovery of bicarbonate (mainly in the proximal tubule) and the secretion of buffered protons (mainly in the distal tubule and collecting duct). How proximal tubular cells and distal professional proton transporting (intercalated) cells sense and respond to changes in pH, bicarbonate, and CO(2) status is a question that has intrigued many generations of renal physiologists. Over the past few years, however, some candidate molecular pH sensors have been identified, including acid/alkali-sensing receptors (GPR4, InsR-RR), kinases (Pyk2, ErbB1/2), pH-sensitive ion channels (ASICs, TASK, ROMK), and the bicarbonate-stimulated adenylyl cyclase (sAC). Some acid-sensing mechanisms in other tissues, such as CAII-PDK2L1 in taste buds, might also have similar roles to play in the kidney. Finally, the function of a variety of additional membrane channels and transporters is altered by pH variations both within and outside the cell, and the expression of several metabolic enzymes are altered by acid-base status in parts of the nephron. Thus, it is possible that a master pH sensor will never be identified. Rather, the kidney seems equipped with a battery of molecules that scan the epithelial cell environment to mount a coordinated physiologic response that maintains acid-base homeostasis. This review collates current knowledge on renal acid-base sensing in the context of a whole organ sensing and response process.

  9. Regulatory mechanisms link phenotypic plasticity to evolvability

    PubMed Central

    van Gestel, Jordi; Weissing, Franz J.

    2016-01-01

    Organisms have a remarkable capacity to respond to environmental change. They can either respond directly, by means of phenotypic plasticity, or they can slowly adapt through evolution. Yet, how phenotypic plasticity links to evolutionary adaptability is largely unknown. Current studies of plasticity tend to adopt a phenomenological reaction norm (RN) approach, which neglects the mechanisms underlying plasticity. Focusing on a concrete question – the optimal timing of bacterial sporulation – we here also consider a mechanistic approach, the evolution of a gene regulatory network (GRN) underlying plasticity. Using individual-based simulations, we compare the RN and GRN approach and find a number of striking differences. Most importantly, the GRN model results in a much higher diversity of responsive strategies than the RN model. We show that each of the evolved strategies is pre-adapted to a unique set of unseen environmental conditions. The regulatory mechanisms that control plasticity therefore critically link phenotypic plasticity to the adaptive potential of biological populations. PMID:27087393

  10. Transport mechanism and regulatory properties of the human amino acid transporter ASCT2 (SLC1A5).

    PubMed

    Scalise, Mariafrancesca; Pochini, Lorena; Panni, Simona; Pingitore, Piero; Hedfalk, Kristina; Indiveri, Cesare

    2014-11-01

    The kinetic mechanism of the transport catalyzed by the human glutamine/neutral amino acid transporter hASCT2 over-expressed in P. pastoris was determined in proteoliposomes by pseudo-bi-substrate kinetic analysis of the Na(+)-glutamineex/glutaminein transport reaction. A random simultaneous mechanism resulted from the experimental analysis. Purified functional hASCT2 was chemically cross-linked to a stable dimeric form. The oligomeric structure correlated well with the kinetic mechanism of transport. Half-saturation constants (Km) of the transporter for the other substrates Ala, Ser, Asn and Thr were measured both on the external and internal side. External Km were much lower than the internal ones confirming the asymmetry of the transporter. The electric nature of the transport reaction was determined imposing a negative inside membrane potential generated by K(+) gradients in the presence of valinomycin. The transport reaction resulted to be electrogenic and the electrogenicity originated from external Na(+). Internal Na(+) exerted a stimulatory effect on the transport activity which could be explained by a regulatory, not a counter-transport, effect. Native and deglycosylated hASCT2 extracted from HeLa showed the same transport features demonstrating that the glycosyl moiety has no role in transport function. Both in vitro and in vivo interactions of hASCT2 with the scaffold protein PDZK1 were revealed.

  11. Metabolomics and transcriptomics profiles reveal the dysregulation of the tricarboxylic acid cycle and related mechanisms in prostate cancer.

    PubMed

    Shao, Yaping; Ye, Guozhu; Ren, Shancheng; Piao, Hai-Long; Zhao, Xinjie; Lu, Xin; Wang, Fubo; Ma, Wang; Li, Jia; Yin, Peiyuan; Xia, Tian; Xu, Chuanliang; Yu, Jane J; Sun, Yinghao; Xu, Guowang

    2018-07-15

    Genetic alterations drive metabolic reprograming to meet increased biosynthetic precursor and energy demands for cancer cell proliferation and survival in unfavorable environments. A systematic study of gene-metabolite regulatory networks and metabolic dysregulation should reveal the molecular mechanisms underlying prostate cancer (PCa) pathogenesis. Herein, we performed gas chromatography-mass spectrometry (GC-MS)-based metabolomics and RNA-seq analyses in prostate tumors and matched adjacent normal tissues (ANTs) to elucidate the molecular alterations and potential underlying regulatory mechanisms in PCa. Significant accumulation of metabolic intermediates and enrichment of genes in the tricarboxylic acid (TCA) cycle were observed in tumor tissues, indicating TCA cycle hyperactivation in PCa tissues. In addition, the levels of fumarate and malate were highly correlated with the Gleason score, tumor stage and expression of genes encoding related enzymes and were significantly related to the expression of genes involved in branched chain amino acid degradation. Using an integrated omics approach, we further revealed the potential anaplerotic routes from pyruvate, glutamine catabolism and branched chain amino acid (BCAA) degradation contributing to replenishing metabolites for TCA cycle. Integrated omics techniques enable the performance of network-based analyses to gain a comprehensive and in-depth understanding of PCa pathophysiology and may facilitate the development of new and effective therapeutic strategies. © 2018 UICC.

  12. Surface acid-base properties and hydration/dehydration mechanisms of aluminum (hydr)oxides.

    PubMed

    Yang, Xiaofang; Sun, Zhongxi; Wang, Dongsheng; Forsling, Willis

    2007-04-15

    In this paper, surface physiochemical properties of three typical aluminas, gamma-Al(OH)3, gamma-Al2O3, and alpha-Al2O3, were investigated by means of XRD, SEM, TEM, BET surface area, TG/DTA, and potentiometric titration techniques. Based on the titration data, surface protonation and deprotonation constants were determined using the constant capacitance model (CCM). The emphasis of this research was laid on the comparison of the crystal structure, surface hydration/dehydration and acid-base properties of these three typical alumina minerals. The calculation results revealed that the surface acidity of the aluminas is in the order of alpha-Al2O3>gamma-Al(OH)3>gamma-Al2O3 after being hydrated for 1 h. The correlation between the hydration/dehydration mechanisms of alumina and its acid/base properties is discussed.

  13. The history and regulatory mechanism of the Hippo pathway

    PubMed Central

    Kim, Wantae; Jho, Eek-hoon

    2018-01-01

    How the organ size is adjusted to the proper size during development and how organs know that they reach the original size during regeneration remain long-standing questions. Based on studies using multiple model organisms and approaches for over 20 years, a consensus has been established that the Hippo pathway plays crucial roles in controlling organ size and maintaining tissue homeostasis. Given the significance of these processes, the dysregulation of the Hippo pathway has also implicated various diseases, such as tissue degeneration and cancer. By regulating the downstream transcriptional coactivators YAP and TAZ, the Hippo pathway coordinates cell proliferation and apoptosis in response to a variety of signals including cell contact inhibition, polarity, mechanical sensation and soluble factors. Since the core components and their functions of the Hippo pathway are evolutionarily conserved, this pathway serves as a global regulator of organ size control. Therefore, further investigation of the regulatory mechanisms will provide physiological insights to better understand tissue homeostasis. In this review, the historical developments and current understandings of the regulatory mechanism of Hippo signaling pathway are discussed. PMID:29397869

  14. Metabolic and transcriptional regulatory mechanisms underlying the anoxic adaptation of rice coleoptile

    PubMed Central

    Lakshmanan, Meiyappan; Mohanty, Bijayalaxmi; Lim, Sun-Hyung; Ha, Sun-Hwa; Lee, Dong-Yup

    2014-01-01

    The ability of rice to germinate under anoxia by extending the coleoptile is a highly unusual characteristic and a key feature underpinning the ability of rice seeds to establish in such a stressful environment. The process has been a focal point for research for many years. However, the molecular mechanisms underlying the anoxic growth of the coleoptile still remain largely unknown. To unravel the key regulatory mechanisms of rice germination under anoxic stress, we combined in silico modelling with gene expression data analysis. Our initial modelling analysis via random flux sampling revealed numerous changes in rice primary metabolism in the absence of oxygen. In particular, several reactions associated with sucrose metabolism and fermentation showed a significant increase in flux levels, whereas reaction fluxes across oxidative phosphorylation, the tricarboxylic acid cycle and the pentose phosphate pathway were down-regulated. The subsequent comparative analysis of the differences in calculated fluxes with previously published gene expression data under air and anoxia identified at least 37 reactions from rice central metabolism that are transcriptionally regulated. Additionally, cis-regulatory content analyses of these transcriptionally controlled enzymes indicate a regulatory role for transcription factors such as MYB, bZIP, ERF and ZnF in transcriptional control of genes that are up-regulated during rice germination and coleoptile elongation under anoxia. PMID:24894389

  15. Design and mechanism of tetrahydrothiophene-based γ-aminobutyric acid aminotransferase inactivators.

    PubMed

    Le, Hoang V; Hawker, Dustin D; Wu, Rui; Doud, Emma; Widom, Julia; Sanishvili, Ruslan; Liu, Dali; Kelleher, Neil L; Silverman, Richard B

    2015-04-08

    Low levels of γ-aminobutyric acid (GABA), one of two major neurotransmitters that regulate brain neuronal activity, are associated with many neurological disorders, such as epilepsy, Parkinson's disease, Alzheimer's disease, Huntington's disease, and cocaine addiction. One of the main methods to raise the GABA level in human brain is to use small molecules that cross the blood-brain barrier and inhibit the activity of γ-aminobutyric acid aminotransferase (GABA-AT), the enzyme that degrades GABA. We have designed a series of conformationally restricted tetrahydrothiophene-based GABA analogues with a properly positioned leaving group that could facilitate a ring-opening mechanism, leading to inactivation of GABA-AT. One compound in the series is 8 times more efficient an inactivator of GABA-AT than vigabatrin, the only FDA-approved inactivator of GABA-AT. Our mechanistic studies show that the compound inactivates GABA-AT by a new mechanism. The metabolite resulting from inactivation does not covalently bind to amino acid residues of GABA-AT but stays in the active site via H-bonding interactions with Arg-192, a π-π interaction with Phe-189, and a weak nonbonded S···O═C interaction with Glu-270, thereby inactivating the enzyme.

  16. The SnRK2-APC/CTE regulatory module mediates the antagonistic action of gibberellic acid and abscisic acid pathways

    PubMed Central

    Lin, Qibing; Wu, Fuqing; Sheng, Peike; Zhang, Zhe; Zhang, Xin; Guo, Xiuping; Wang, Jiulin; Cheng, Zhijun; Wang, Jie; Wang, Haiyang; Wan, Jianmin

    2015-01-01

    Abscisic acid (ABA) and gibberellic acid (GA) antagonistically regulate many developmental processes and responses to biotic or abiotic stresses in higher plants. However, the molecular mechanism underlying this antagonism is still poorly understood. Here, we show that loss-of-function mutation in rice Tiller Enhancer (TE), an activator of the APC/CTE complex, causes hypersensitivity and hyposensitivity to ABA and GA, respectively. We find that TE physically interacts with ABA receptor OsPYL/RCARs and promotes their degradation by the proteasome. Genetic analysis also shows OsPYL/RCARs act downstream of TE in mediating ABA responses. Conversely, ABA inhibits APC/CTE activity by phosphorylating TE through activating the SNF1-related protein kinases (SnRK2s), which may interrupt the interaction between TE and OsPYL/RCARs and subsequently stabilize OsPYL/RCARs. In contrast, GA can reduce the level of SnRK2s and may promote APC/CTE-mediated degradation of OsPYL/RCARs. Thus, we propose that the SnRK2-APC/CTE regulatory module represents a regulatory hub underlying the antagonistic action of GA and ABA in plants. PMID:26272249

  17. The structure of the regulatory domain of the adenylyl cyclase Rv1264 from Mycobacterium tuberculosis with bound oleic acid.

    PubMed

    Findeisen, Felix; Linder, Jürgen U; Schultz, Anita; Schultz, Joachim E; Brügger, Britta; Wieland, Felix; Sinning, Irmgard; Tews, Ivo

    2007-06-22

    The universal secondary messenger cAMP is produced by adenylyl cyclases (ACs). Most bacterial and all eukaryotic ACs belong to class III of six divergent classes. A class III characteristic is formation of the catalytic pocket at a dimer interface and the presence of additional regulatory domains. Mycobacterium tuberculosis possesses 15 class III ACs, including Rv1264, which is activated at acidic pH due to pH-dependent structural transitions of the Rv1264 dimer. It has been shown by X-ray crystallography that the N-terminal regulatory and C-terminal catalytic domains of Rv1264 interact in completely different ways in the active and inhibited states. Here, we report an in-depth structural and functional analysis of the regulatory domain of Rv1264. The 1.6 A resolution crystal structure shows the protein in a tight, disk-shaped dimer, formed around a helical bundle, and involving a protein chain crossover. To understand pH regulation, we determined structures at acidic and basic pH values and employed structure-based mutagenesis in the holoenzyme to elucidate regulation using an AC activity assay. It has been shown that regulatory and catalytic domains must be linked in a single protein chain. The new studies demonstrate that the length of the linker segment is decisive for regulation. Several amino acids on the surface of the regulatory domain, when exchanged, altered the pH-dependence of AC activity. However, these residues are not conserved amongst a number of related ACs. The closely related mycobacterial Rv2212, but not Rv1264, is strongly activated by the addition of fatty acids. The structure resolved the presence of a deeply embedded fatty acid, characterised as oleic acid by mass spectrometry, which may serve as a hinge. From these data, we conclude that the regulatory domain is a structural scaffold used for distinct regulatory purposes.

  18. Regulatory components of carbon concentrating mechanisms in aquatic unicellular photosynthetic organisms.

    PubMed

    Tomar, Vandana; Sidhu, Gurpreet Kaur; Nogia, Panchsheela; Mehrotra, Rajesh; Mehrotra, Sandhya

    2017-11-01

    This review provides an insight into the regulation of the carbon concentrating mechanisms (CCMs) in lower organisms like cyanobacteria, proteobacteria, and algae. CCMs evolved as a mechanism to concentrate CO 2 at the site of primary carboxylating enzyme Ribulose-1, 5-bisphosphate carboxylase oxygenase (Rubisco), so that the enzyme could overcome its affinity towards O 2 which leads to wasteful processes like photorespiration. A diverse set of CCMs exist in nature, i.e., carboxysomes in cyanobacteria and proteobacteria; pyrenoids in algae and diatoms, the C 4 system, and Crassulacean acid metabolism in higher plants. Prime regulators of CCM in most of the photosynthetic autotrophs belong to the LysR family of transcriptional regulators, which regulate the activity of the components of CCM depending upon the ambient CO 2 concentrations. Major targets of these regulators are carbonic anhydrase and inorganic carbon uptake systems (CO 2 and HCO 3 - transporters) whose activities are modulated either at transcriptional level or by changes in the levels of their co-regulatory metabolites. The article provides information on the localization of the CCM components as well as their function and participation in the development of an efficient CCM. Signal transduction cascades leading to activation/inactivation of inducible CCM components on perception of low/high CO 2 stimuli have also been brought into picture. A detailed study of the regulatory components can aid in identifying the unraveled aspects of these mechanisms and hence provide information on key molecules that need to be explored to further provide a clear understanding of the mechanism under study.

  19. Major regulatory mechanisms involved in sperm motility

    PubMed Central

    Pereira, Rute; Sá, Rosália; Barros, Alberto; Sousa, Mário

    2017-01-01

    The genetic bases and molecular mechanisms involved in the assembly and function of the flagellum components as well as in the regulation of the flagellar movement are not fully understood, especially in humans. There are several causes for sperm immotility, of which some can be avoided and corrected, whereas other are related to genetic defects and deserve full investigation to give a diagnosis to patients. This review was performed after an extensive literature search on the online databases PubMed, ScienceDirect, and Web of Science. Here, we review the involvement of regulatory pathways responsible for sperm motility, indicating possible causes for sperm immotility. These included the calcium pathway, the cAMP-dependent protein kinase pathway, the importance of kinases and phosphatases, the function of reactive oxygen species, and how the regulation of cell volume and osmolarity are also fundamental components. We then discuss main gene defects associated with specific morphological abnormalities. Finally, we slightly discuss some preventive and treatments approaches to avoid development of conditions that are associated with unspecified sperm immotility. We believe that in the near future, with the development of more powerful techniques, the genetic causes of sperm immotility and the regulatory mechanisms of sperm motility will be better understand, thus enabling to perform a full diagnosis and uncover new therapies. PMID:26680031

  20. Design and Mechanism of Tetrahydrothiophene-Based γ-Aminobutyric Acid Aminotransferase Inactivators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Le, Hoang V.; Hawker, Dustin D.; Wu, Rui

    Low levels of gamma-aminobutyric acid (GABA), one of two major neurotransmitters that regulate brain neuronal activity, are associated with many neurological disorders, such as epilepsy, Parkinsons disease, Alzheimers disease, Huntingtons disease, and cocaine addiction. One of the main methods to raise the GABA level in human brain is to use small molecules that cross the bloodbrain barrier and inhibit the activity of gamma-aminobutyric acid aminotransferase (GABA-AT), the enzyme that degrades GABA. We have designed a series of conformationally restricted tetrahydrothiophene-based GABA analogues with a properly positioned leaving group that could facilitate a ring-opening mechanism, leading to inactivation of GABA-AT. Onemore » compound in the series is 8 times more efficient an inactivator of GABA-AT than vigabatrin, the only FDA-approved inactivator of GABA-AT. Our mechanistic studies show that the compound inactivates GABA-AT by a new mechanism. The metabolite resulting from inactivation does not covalently bind to amino acid residues of GABA-AT but stays in the active site via H-bonding interactions with Arg-192, a pi-pi interaction with Phe-189, and a weak nonbonded (SO)-O-...=C interaction with Glu-270, thereby inactivating the enzyme.« less

  1. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

    PubMed

    Guo, Liyuan; Wang, Jing

    2018-01-04

    Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Regulatory mechanisms of thiol-based redox sensors: lessons learned from structural studies on prokaryotic redox sensors.

    PubMed

    Lee, Sang Jae; Kim, Dong-Gyun; Lee, Kyu-Yeon; Koo, Ji Sung; Lee, Bong-Jin

    2018-05-17

    Oxidative stresses, such as reactive oxygen species, reactive electrophilic species, reactive nitrogen species, and reactive chlorine species, can damage cellular components, leading to cellular malfunction and death. In response to oxidative stress, bacteria have evolved redox-responsive sensors that enable them to simultaneously monitor and eradicate potential oxidative stress. Specifically, redox-sensing transcription regulators react to oxidative stress by means of modifying the thiol groups of cysteine residues, functioning as part of an efficient survival mechanism for many bacteria. In general, oxidative molecules can induce changes in the three-dimensional structures of redox sensors, which, in turn, affects the transcription of specific genes in detoxification pathways and defense mechanisms. Moreover, pathogenic bacteria utilize these redox sensors for adaptation and to evade subsequent oxidative attacks from host immune defense. For this reason, the redox sensors of pathogenic bacteria are potential antibiotic targets. Understanding the regulatory mechanisms of thiol-based redox sensors in bacteria will provide insight and knowledge into the discovery of new antibiotics.

  3. Sequence-based model of gap gene regulatory network.

    PubMed

    Kozlov, Konstantin; Gursky, Vitaly; Kulakovskiy, Ivan; Samsonova, Maria

    2014-01-01

    The detailed analysis of transcriptional regulation is crucially important for understanding biological processes. The gap gene network in Drosophila attracts large interest among researches studying mechanisms of transcriptional regulation. It implements the most upstream regulatory layer of the segmentation gene network. The knowledge of molecular mechanisms involved in gap gene regulation is far less complete than that of genetics of the system. Mathematical modeling goes beyond insights gained by genetics and molecular approaches. It allows us to reconstruct wild-type gene expression patterns in silico, infer underlying regulatory mechanism and prove its sufficiency. We developed a new model that provides a dynamical description of gap gene regulatory systems, using detailed DNA-based information, as well as spatial transcription factor concentration data at varying time points. We showed that this model correctly reproduces gap gene expression patterns in wild type embryos and is able to predict gap expression patterns in Kr mutants and four reporter constructs. We used four-fold cross validation test and fitting to random dataset to validate the model and proof its sufficiency in data description. The identifiability analysis showed that most model parameters are well identifiable. We reconstructed the gap gene network topology and studied the impact of individual transcription factor binding sites on the model output. We measured this impact by calculating the site regulatory weight as a normalized difference between the residual sum of squares error for the set of all annotated sites and for the set with the site of interest excluded. The reconstructed topology of the gap gene network is in agreement with previous modeling results and data from literature. We showed that 1) the regulatory weights of transcription factor binding sites show very weak correlation with their PWM score; 2) sites with low regulatory weight are important for the model output; 3

  4. Mechanisms of triglyceride metabolism in patients with bile acid diarrhea

    PubMed Central

    Sagar, Nidhi Midhu; McFarlane, Michael; Nwokolo, Chuka; Bardhan, Karna Dev; Arasaradnam, Ramesh Pulendran

    2016-01-01

    Bile acids (BAs) are essential for the absorption of lipids. BA synthesis is inhibited through intestinal farnesoid X receptor (FXR) activity. BA sequestration is known to influence BA metabolism and control serum lipid concentrations. Animal data has demonstrated a regulatory role for the FXR in triglyceride metabolism. FXR inhibits hepatic lipogenesis by inhibiting the expression of sterol regulatory element binding protein 1c via small heterodimer primer activity. Conversely, FXR promotes free fatty acids oxidation by inducing the expression of peroxisome proliferator-activated receptor α. FXR can reduce the expression of microsomal triglyceride transfer protein, which regulates the assembly of very low-density lipoproteins (VLDL). FXR activation in turn promotes the clearance of circulating triglycerides by inducing apolipoprotein C-II, very low-density lipoproteins receptor (VLDL-R) and the expression of Syndecan-1 together with the repression of apolipoprotein C-III, which increases lipoprotein lipase activity. There is currently minimal clinical data on triglyceride metabolism in patients with bile acid diarrhoea (BAD). Emerging data suggests that a third of patients with BAD have hypertriglyceridemia. Further research is required to establish the risk of hypertriglyceridaemia in patients with BAD and elicit the mechanisms behind this, allowing for targeted treatment. PMID:27570415

  5. Evolutionarily conserved regulatory mechanisms of abscisic acid signaling in land plants: characterization of ABSCISIC ACID INSENSITIVE1-like type 2C protein phosphatase in the liverwort Marchantia polymorpha.

    PubMed

    Tougane, Ken; Komatsu, Kenji; Bhyan, Salma Begum; Sakata, Yoichi; Ishizaki, Kimitsune; Yamato, Katsuyuki T; Kohchi, Takayuki; Takezawa, Daisuke

    2010-03-01

    Abscisic acid (ABA) is postulated to be a ubiquitous hormone that plays a central role in seed development and responses to environmental stresses of vascular plants. However, in liverworts (Marchantiophyta), which represent the oldest extant lineage of land plants, the role of ABA has been least emphasized; thus, very little information is available on the molecular mechanisms underlying ABA responses. In this study, we isolated and characterized MpABI1, an ortholog of ABSCISIC ACID INSENSITIVE1 (ABI1), from the liverwort Marchantia polymorpha. The MpABI1 cDNA encoded a 568-amino acid protein consisting of the carboxy-terminal protein phosphatase 2C (PP2C) domain and a novel amino-terminal regulatory domain. The MpABI1 transcript was detected in the gametophyte, and its expression level was increased by exogenous ABA treatment in the gemma, whose growth was strongly inhibited by ABA. Experiments using green fluorescent protein fusion constructs indicated that MpABI1 was mainly localized in the nucleus and that its nuclear localization was directed by the amino-terminal domain. Transient overexpression of MpABI1 in M. polymorpha and Physcomitrella patens cells resulted in suppression of ABA-induced expression of the wheat Em promoter fused to the beta -glucuronidase gene. Transgenic P. patens expressing MpABI1 and its mutant construct, MpABI1-d2, lacking the amino-terminal domain, had reduced freezing and osmotic stress tolerance, and associated with reduced accumulation of ABA-induced late embryogenesis abundant-like boiling-soluble proteins. Furthermore, ABA-induced morphological changes leading to brood cells were not prominent in these transgenic plants. These results suggest that MpABI1 is a negative regulator of ABA signaling, providing unequivocal molecular evidence of PP2C-mediated ABA response mechanisms functioning in liverworts.

  6. Regulatory T cells: mechanisms of differentiation and function.

    PubMed

    Josefowicz, Steven Z; Lu, Li-Fan; Rudensky, Alexander Y

    2012-01-01

    The immune system has evolved to mount an effective defense against pathogens and to minimize deleterious immune-mediated inflammation caused by commensal microorganisms, immune responses against self and environmental antigens, and metabolic inflammatory disorders. Regulatory T (Treg) cell-mediated suppression serves as a vital mechanism of negative regulation of immune-mediated inflammation and features prominently in autoimmune and autoinflammatory disorders, allergy, acute and chronic infections, cancer, and metabolic inflammation. The discovery that Foxp3 is the transcription factor that specifies the Treg cell lineage facilitated recent progress in understanding the biology of regulatory T cells. In this review, we discuss cellular and molecular mechanisms in the differentiation and function of these cells.

  7. Preclinical Development of Cell-Based Products: a European Regulatory Science Perspective.

    PubMed

    McBlane, James W; Phul, Parvinder; Sharpe, Michaela

    2018-06-25

    This article describes preclinical development of cell-based medicinal products for European markets and discusses European regulatory mechanisms open to developers to aid successful product development. Cell-based medicinal products are diverse, including cells that are autologous or allogeneic, have been genetically modified, or not, or expanded ex vivo, and applied systemically or to an anatomical site different to that of their origin; comments applicable to one product may not be applicable to others, so bespoke development is needed, for all elements - quality, preclinical and clinical. After establishing how the product is produced, proof of potential for therapeutic efficacy, and then safety, of the product need to be determined. This includes understanding biodistribution, persistence and toxicity, including potential for malignant transformation. These elements need to be considered in the context of the intended clinical development. This article describes regulatory mechanisms available to developers to support product development that aim to resolve scientific issues prior to marketing authorization application, to enable patients to have faster access to the product than would otherwise be the case. Developers are encouraged to be aware of both the scientific issues and regulatory mechanisms to ensure patients can be supplied with these products.

  8. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    PubMed Central

    2011-01-01

    Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG) that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses. PMID:21349196

  9. Thermal and Mechanical Characteristics of Polymer Composites Based on Epoxy Resin, Aluminium Nanopowders and Boric Acid

    NASA Astrophysics Data System (ADS)

    Nazarenko, O. B.; Melnikova, T. V.; Visakh, P. M.

    2016-01-01

    The epoxy polymers are characterized by low thermal stability and high flammability. Nanoparticles are considered to be effective fillers of polymer composites for improving their thermal and functional properties. In this work, the epoxy composites were prepared using epoxy resin ED-20, polyethylene polyamine as a hardener, aluminum nanopowder and boric acid fine powder as flame-retardant filler. The thermal characteristics of the obtained samples were studied using thermogravimetric analysis and differential scanning calorimetry. The mechanical characteristics of epoxy composites were also studied. It was found that an addition of all fillers enhances the thermal stability and mechanical characteristics of the epoxy composites. The best thermal stability showed the epoxy composite filled with boric acid. The highest flexural properties showed the epoxy composite based on the combination of boric acid and aluminum nanopowder.

  10. A qrr noncoding RNA deploys four different regulatory mechanisms to optimize quorum-sensing dynamics.

    PubMed

    Feng, Lihui; Rutherford, Steven T; Papenfort, Kai; Bagert, John D; van Kessel, Julia C; Tirrell, David A; Wingreen, Ned S; Bassler, Bonnie L

    2015-01-15

    Quorum sensing is a cell-cell communication process that bacteria use to transition between individual and social lifestyles. In vibrios, homologous small RNAs called the Qrr sRNAs function at the center of quorum-sensing pathways. The Qrr sRNAs regulate multiple mRNA targets including those encoding the quorum-sensing regulatory components luxR, luxO, luxM, and aphA. We show that a representative Qrr, Qrr3, uses four distinct mechanisms to control its particular targets: the Qrr3 sRNA represses luxR through catalytic degradation, represses luxM through coupled degradation, represses luxO through sequestration, and activates aphA by revealing the ribosome binding site while the sRNA itself is degraded. Qrr3 forms different base-pairing interactions with each mRNA target, and the particular pairing strategy determines which regulatory mechanism occurs. Combined mathematical modeling and experiments show that the specific Qrr regulatory mechanism employed governs the potency, dynamics, and competition of target mRNA regulation, which in turn, defines the overall quorum-sensing response. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Evolutionarily Conserved Regulatory Mechanisms of Abscisic Acid Signaling in Land Plants: Characterization of ABSCISIC ACID INSENSITIVE1-Like Type 2C Protein Phosphatase in the Liverwort Marchantia polymorpha1[C][OA

    PubMed Central

    Tougane, Ken; Komatsu, Kenji; Bhyan, Salma Begum; Sakata, Yoichi; Ishizaki, Kimitsune; Yamato, Katsuyuki T.; Kohchi, Takayuki; Takezawa, Daisuke

    2010-01-01

    Abscisic acid (ABA) is postulated to be a ubiquitous hormone that plays a central role in seed development and responses to environmental stresses of vascular plants. However, in liverworts (Marchantiophyta), which represent the oldest extant lineage of land plants, the role of ABA has been least emphasized; thus, very little information is available on the molecular mechanisms underlying ABA responses. In this study, we isolated and characterized MpABI1, an ortholog of ABSCISIC ACID INSENSITIVE1 (ABI1), from the liverwort Marchantia polymorpha. The MpABI1 cDNA encoded a 568-amino acid protein consisting of the carboxy-terminal protein phosphatase 2C (PP2C) domain and a novel amino-terminal regulatory domain. The MpABI1 transcript was detected in the gametophyte, and its expression level was increased by exogenous ABA treatment in the gemma, whose growth was strongly inhibited by ABA. Experiments using green fluorescent protein fusion constructs indicated that MpABI1 was mainly localized in the nucleus and that its nuclear localization was directed by the amino-terminal domain. Transient overexpression of MpABI1 in M. polymorpha and Physcomitrella patens cells resulted in suppression of ABA-induced expression of the wheat Em promoter fused to the β -glucuronidase gene. Transgenic P. patens expressing MpABI1 and its mutant construct, MpABI1-d2, lacking the amino-terminal domain, had reduced freezing and osmotic stress tolerance, and associated with reduced accumulation of ABA-induced late embryogenesis abundant-like boiling-soluble proteins. Furthermore, ABA-induced morphological changes leading to brood cells were not prominent in these transgenic plants. These results suggest that MpABI1 is a negative regulator of ABA signaling, providing unequivocal molecular evidence of PP2C-mediated ABA response mechanisms functioning in liverworts. PMID:20097789

  12. Defining Transcriptional Regulatory Mechanisms for Primary let-7 miRNAs

    PubMed Central

    Gaeta, Xavier; Le, Luat; Lin, Ying; Xie, Yuan; Lowry, William E.

    2017-01-01

    The let-7 family of miRNAs have been shown to control developmental timing in organisms from C. elegans to humans; their function in several essential cell processes throughout development is also well conserved. Numerous studies have defined several steps of post-transcriptional regulation of let-7 production; from pri-miRNA through pre-miRNA, to the mature miRNA that targets endogenous mRNAs for degradation or translational inhibition. Less-well defined are modes of transcriptional regulation of the pri-miRNAs for let-7. let-7 pri-miRNAs are expressed in polycistronic fashion, in long transcripts newly annotated based on chromatin-associated RNA-sequencing. Upon differentiation, we found that some let-7 pri-miRNAs are regulated at the transcriptional level, while others appear to be constitutively transcribed. Using the Epigenetic Roadmap database, we further annotated regulatory elements of each polycistron identified putative promoters and enhancers. Probing these regulatory elements for transcription factor binding sites identified factors that regulate transcription of let-7 in both promoter and enhancer regions, and identified novel regulatory mechanisms for this important class of miRNAs. PMID:28052101

  13. Diverse Cis-Regulatory Mechanisms Contribute to Expression Evolution of Tandem Gene Duplicates

    PubMed Central

    Baudouin-Gonzalez, Luís; Santos, Marília A; Tempesta, Camille; Sucena, Élio; Roch, Fernando; Tanaka, Kohtaro

    2017-01-01

    Abstract Pairs of duplicated genes generally display a combination of conserved expression patterns inherited from their unduplicated ancestor and newly acquired domains. However, how the cis-regulatory architecture of duplicated loci evolves to produce these expression patterns is poorly understood. We have directly examined the gene-regulatory evolution of two tandem duplicates, the Drosophila Ly6 genes CG9336 and CG9338, which arose at the base of the drosophilids between 40 and 60 Ma. Comparing the expression patterns of the two paralogs in four Drosophila species with that of the unduplicated ortholog in the tephritid Ceratitis capitata, we show that they diverged from each other as well as from the unduplicated ortholog. Moreover, the expression divergence appears to have occurred close to the duplication event and also more recently in a lineage-specific manner. The comparison of the tissue-specific cis-regulatory modules (CRMs) controlling the paralog expression in the four Drosophila species indicates that diverse cis-regulatory mechanisms, including the novel tissue-specific enhancers, differential inactivation, and enhancer sharing, contributed to the expression evolution. Our analysis also reveals a surprisingly variable cis-regulatory architecture, in which the CRMs driving conserved expression domains change in number, location, and specificity. Altogether, this study provides a detailed historical account that uncovers a highly dynamic picture of how the paralog expression patterns and their underlying cis-regulatory landscape evolve. We argue that our findings will encourage studying cis-regulatory evolution at the whole-locus level to understand how interactions between enhancers and other regulatory levels shape the evolution of gene expression. PMID:28961967

  14. Regulatory element-based prediction identifies new susceptibility regulatory variants for osteoporosis.

    PubMed

    Yao, Shi; Guo, Yan; Dong, Shan-Shan; Hao, Ruo-Han; Chen, Xiao-Feng; Chen, Yi-Xiao; Chen, Jia-Bin; Tian, Qing; Deng, Hong-Wen; Yang, Tie-Lin

    2017-08-01

    Despite genome-wide association studies (GWASs) have identified many susceptibility genes for osteoporosis, it still leaves a large part of missing heritability to be discovered. Integrating regulatory information and GWASs could offer new insights into the biological link between the susceptibility SNPs and osteoporosis. We generated five machine learning classifiers with osteoporosis-associated variants and regulatory features data. We gained the optimal classifier and predicted genome-wide SNPs to discover susceptibility regulatory variants. We further utilized Genetic Factors for Osteoporosis Consortium (GEFOS) and three in-house GWASs samples to validate the associations for predicted positive SNPs. The random forest classifier performed best among all machine learning methods with the F1 score of 0.8871. Using the optimized model, we predicted 37,584 candidate SNPs for osteoporosis. According to the meta-analysis results, a list of regulatory variants was significantly associated with osteoporosis after multiple testing corrections and contributed to the expression of known osteoporosis-associated protein-coding genes. In summary, combining GWASs and regulatory elements through machine learning could provide additional information for understanding the mechanism of osteoporosis. The regulatory variants we predicted will provide novel targets for etiology research and treatment of osteoporosis.

  15. Strong Ion Regulatory Abilities Enable the Crab Xenograpsus testudinatus to Inhabit Highly Acidified Marine Vent Systems

    PubMed Central

    Hu, Marian Y.; Guh, Ying-Jey; Shao, Yi-Ta; Kuan, Pou-Long; Chen, Guan-Lin; Lee, Jay-Ron; Jeng, Ming-Shiou; Tseng, Yung-Che

    2016-01-01

    Hydrothermal vent organisms have evolved physiological adaptations to cope with extreme abiotic conditions including temperature and pH. To date, acid-base regulatory abilities of vent organisms are poorly investigated, although this physiological feature is essential for survival in low pH environments. We report the acid-base regulatory mechanisms of a hydrothermal vent crab, Xenograpsus testudinatus, endemic to highly acidic shallow-water vent habitats with average environment pH-values ranging between 5.4 and 6.6. Within a few hours, X. testudinatus restores extracellular pH (pHe) in response to environmental acidification of pH 6.5 (1.78 kPa pCO2) accompanied by an increase in blood HCO3- levels from 8.8 ± 0.3 to 31 ± 6 mM. Branchial Na+/K+-ATPase (NKA) and V-type H+-ATPase (VHA), the major ion pumps involved in branchial acid-base regulation, showed dynamic increases in response to acidified conditions on the mRNA, protein and activity level. Immunohistochemical analyses demonstrate the presence of NKA in basolateral membranes, whereas the VHA is predominantly localized in cytoplasmic vesicles of branchial epithelial- and pillar-cells. X. testudinatus is closely related to other strong osmo-regulating brachyurans, which is also reflected in the phylogeny of the NKA. Accordingly, our results suggest that the evolution of strong ion regulatory abilities in brachyuran crabs that allowed the occupation of ecological niches in euryhaline, freshwater, and terrestrial habitats are probably also linked to substantial acid-base regulatory abilities. This physiological trait allowed X. testudinatus to successfully inhabit one of the world's most acidic marine environments. PMID:26869933

  16. Sociocognitive self-regulatory mechanisms governing transgressive behavior.

    PubMed

    Bandura, A; Caprara, G V; Barbaranelli, C; Pastorelli, C; Regalia, C

    2001-01-01

    This longitudinal research examined a structural model of the self-regulatory mechanisms governing transgressive conduct. Perceived academic and self-regulatory efficacy concurrently and longitudinally deterred transgressiveness both directly and by fostering prosocialness and adherence to moral self-sanctions for harmful conduct. The impact of perceived social self-efficacy was mediated through prosocialness. Moral disengagement and prosocialness affected transgressiveness through the mediating influence of irascible affectivity and hostile rumination. Ruminative affectivity, in turn, both concurrently and longitudinally affected transgressiveness. Moral disengagement also contributed independently to variance in transgressiveness over time. This pattern of relations was obtained after controlling for prior transgressiveness. The structural model was replicated across gender and provided a better fit to the data than did several alternative models.

  17. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    PubMed

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  18. A New Algorithm for Identifying Cis-Regulatory Modules Based on Hidden Markov Model

    PubMed Central

    2017-01-01

    The discovery of cis-regulatory modules (CRMs) is the key to understanding mechanisms of transcription regulation. Since CRMs have specific regulatory structures that are the basis for the regulation of gene expression, how to model the regulatory structure of CRMs has a considerable impact on the performance of CRM identification. The paper proposes a CRM discovery algorithm called ComSPS. ComSPS builds a regulatory structure model of CRMs based on HMM by exploring the rules of CRM transcriptional grammar that governs the internal motif site arrangement of CRMs. We test ComSPS on three benchmark datasets and compare it with five existing methods. Experimental results show that ComSPS performs better than them. PMID:28497059

  19. [Computer simulation of thyroid regulatory mechanisms in health and malignancy].

    PubMed

    Abduvaliev, A A; Gil'dieva, M S; Khidirov, B N; Saĭdalieva, M; Saatov, T S

    2010-07-01

    The paper describes a computer model for regulation of the number of thyroid follicular cells in health and malignancy. The authors'computer program for mathematical simulation of the regulatory mechanisms of a thyroid follicular cellular community cannot be now referred to as good commercial products. For commercialization of this product, it is necessary to draw up a direct relation of the introduced corrected values from the actually existing normal values, such as the peripheral blood concentrations of thyroid hormones or the mean values of endocrine tissue mitotic activity. However, the described computer program has been also used in researches by our scientific group in the study of thyroid cancer. The available biological experimental data and theoretical provisions on thyroid structural and functional organization at the cellular level allow one to construct mathematical models for quantitative analysis of the regulation of the size of a cellular community of a thyroid follicle in health and abnormalities, by using the method for simulation of the regulatory mechanisms of living systems and the equations of cellular community regulatory communities.

  20. Decomposition mechanism of chromite in sulfuric acid-dichromic acid solution

    NASA Astrophysics Data System (ADS)

    Zhao, Qing; Liu, Cheng-jun; Li, Bao-kuan; Jiang, Mao-fa

    2017-12-01

    The sulfuric acid leaching process is regarded as a promising, cleaner method to prepare trivalent chromium products from chromite; however, the decomposition mechanism of the ore is poorly understood. In this work, binary spinels of Mg-Al, Mg-Fe, and Mg-Cr in the powdered and lump states were synthesized and used as raw materials to investigate the decomposition mechanism of chromite in sulfuric acid-dichromic acid solution. The leaching yields of metallic elements and the changes in morphology of the spinel were studied. The experimental results showed that the three spinels were stable in sulfuric acid solution and that dichromic acid had little influence on the decomposition behavior of the Mg-Al spinel and Mg-Fe spinel because Mg2+, Al3+, and Fe3+ in spinels cannot be oxidized by Cr6+. However, in the case of the Mg-Cr spinel, dichromic acid substantially promoted the decomposition efficiency and functioned as a catalyst. The decomposition mechanism of chromite in sulfuric acid-dichromic acid solution was illustrated on the basis of the findings of this study.

  1. Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

    PubMed

    Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

    2015-05-30

    Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

  2. Behavioural ratings of self-regulatory mechanisms and driving behaviour after an acquired brain injury.

    PubMed

    Rike, Per-Ola; Ulleberg, Pål; Schultheis, Maria T; Lundqvist, Anna; Schanke, Anne-Kristine

    2014-01-01

    To explore whether measurements of self-regulatory mechanisms and cognition predict driving behaviour after an acquired brain injury (ABI). Consecutive follow-up study. At baseline participants included 77 persons with stroke and 32 persons with a traumatic brain injury (TBI), all of whom completed a multidisciplinary driving assessment (MDA). A follow-up cohort of 34 persons that succeeded the MDA was included. Baseline measurements: Neuropsychological tests and measurements of self-regulatory mechanisms (BRIEF-A and UPPS Impulsive Behaviour Scale), driving behaviour (DBQ) and pre-injury driving characteristics (mileage, compensatory driving strategies and accident rates). Follow-up measurements: Post-injury driving characteristics were collected by mailed questionnaires from the participants who succeeded the MDA. A MDA, which included a medical examination, neuropsychological testing and an on-road driving test, was considered in the decision for or against granting a driver's license. Self-regulatory mechanisms and driving behaviour were examined for research purposes only. At baseline, self-regulatory mechanisms were significantly associated to aberrant driving behaviour, but not with neuropsychological data or with the outcome of the on-road driving test. Aspects of self-regulation were associated to driving behaviour at follow-up. It is recommended that self-regulatory measurements should regularly be considered in the driving assessments after ABI.

  3. N-3 polyunsaturated fatty acid regulation of hepatic gene transcription

    PubMed Central

    Jump, Donald B.

    2009-01-01

    Purpose of review The liver plays a central role in whole body lipid metabolism and adapts rapidly to changes in dietary fat composition. This adaption involves changes in the expression of genes involved in glycolysis, de-novo lipogenesis, fatty acid elongation, desaturation and oxidation. This review brings together metabolic and molecular studies that help explain n-3 (omega-3) polyunsaturated fatty acid regulation of hepatic gene transcription. Recent findings Dietary n-3 polyunsaturated fatty acid regulates hepatic gene expression by targeting three major transcriptional regulatory networks: peroxisome proliferator-activated receptor α, sterol regulatory element binding protein-1 and the carbohydrate regulatory element binding protein/Max-like factor X heterodimer. 22 : 6,n-3, the most prominent n-3 polyunsaturated fatty acid in tissues, is a weak activator of peroxisome proliferator-activated receptor α. Hepatic metabolism of 22 : 6,n-3, however, generates 20 : 5,n-3, a strong peroxisome proliferator-activated receptor α activator. In contrast to peroxisome proliferator-activated receptor α, 22 : 6,n-3 is the most potent fatty acid regulator of hepatic sterol regulatory element binding protein-1. 22 : 6,n-3 suppresses sterol regulatory element binding protein-1 gene expression while enhancing degradation of nuclear sterol regulatory element binding protein-1 through 26S proteasome and Erk1/2-dependent mechanisms. Both n-3 and n-6 polyunsaturated fatty acid suppress carbohydrate regulatory element binding protein and Max-like factor X nuclear abundance and interfere with glucose-regulated hepatic metabolism. Summary These studies have revealed unique mechanisms by which specific polyunsaturated fatty acids control peroxisome proliferator activated receptor α, sterol regulatory element binding protein-1 and carbohydrate regulatory element binding protein/Max-like factor X function. As such, specific metabolic and signal transduction pathways contribute

  4. Data of thermal degradation and dynamic mechanical properties of starch–glycerol based films with citric acid as crosslinking agent

    PubMed Central

    González Seligra, Paula; Medina Jaramillo, Carolina; Famá, Lucía; Goyanes, Silvia

    2016-01-01

    Interest in biodegradable edible films as packaging or coating has increased because their beneficial effects on foods. In particular, food products are highly dependents on thermal stability, integrity and transition process temperatures of the packaging. The present work describes a complete data of the thermal degradation and dynamic mechanical properties of starch–glycerol based films with citric acid (CA) as crosslinking agent described in the article titled: “Biodegradable and non-retrogradable eco-films based on starch–glycerol with citric acid as crosslinking agent” González Seligra et al. (2016) [1]. Data describes thermogravimetric and dynamical mechanical experiences and provides the figures of weight loss and loss tangent of the films as a function of the temperature. PMID:27158645

  5. Overview on mechanisms of acetic acid resistance in acetic acid bacteria.

    PubMed

    Wang, Bin; Shao, Yanchun; Chen, Fusheng

    2015-02-01

    Acetic acid bacteria (AAB) are a group of gram-negative or gram-variable bacteria which possess an obligate aerobic property with oxygen as the terminal electron acceptor, meanwhile transform ethanol and sugar to corresponding aldehydes, ketones and organic acids. Since the first genus Acetobacter of AAB was established in 1898, 16 AAB genera have been recorded so far. As the main producer of a world-wide condiment, vinegar, AAB have evolved an elegant adaptive system that enables them to survive and produce a high concentration of acetic acid. Some researches and reviews focused on mechanisms of acid resistance in enteric bacteria and made the mechanisms thoroughly understood, while a few investigations did in AAB. As the related technologies with proteome, transcriptome and genome were rapidly developed and applied to AAB research, some plausible mechanisms conferring acetic acid resistance in some AAB strains have been published. In this review, the related mechanisms of AAB against acetic acid with acetic acid assimilation, transportation systems, cell morphology and membrane compositions, adaptation response, and fermentation conditions will be described. Finally, a framework for future research for anti-acid AAB will be provided.

  6. IA channels: diverse regulatory mechanisms.

    PubMed

    Carrasquillo, Yarimar; Nerbonne, Jeanne M

    2014-04-01

    In many peripheral and central neurons, A-type K(+) currents, IA, have been identified and shown to be key determinants in shaping action potential waveforms and repetitive firing properties, as well as in the regulation of synaptic transmission and synaptic plasticity. The functional properties and physiological roles of native neuronal IA, however, have been shown to be quite diverse in different types of neurons. Accumulating evidence suggests that this functional diversity is generated by multiple mechanisms, including the expression and subcellular distributions of IA channels encoded by different voltage-gated K(+) (Kv) channel pore-forming (α) subunits, interactions of Kv α subunits with cytosolic and/or transmembrane accessory subunits and regulatory proteins and post-translational modifications of channel subunits. Several recent reports further suggest that local protein translation in the dendrites of neurons and interactions between IA channels with other types of voltage-gated ion channels further expands the functional diversity of native neuronal IA channels. Here, we review the diverse molecular mechanisms that have been shown or proposed to underlie the functional diversity of native neuronal IA channels.

  7. Inferring nonlinear gene regulatory networks from gene expression data based on distance correlation.

    PubMed

    Guo, Xiaobo; Zhang, Ye; Hu, Wenhao; Tan, Haizhu; Wang, Xueqin

    2014-01-01

    Nonlinear dependence is general in regulation mechanism of gene regulatory networks (GRNs). It is vital to properly measure or test nonlinear dependence from real data for reconstructing GRNs and understanding the complex regulatory mechanisms within the cellular system. A recently developed measurement called the distance correlation (DC) has been shown powerful and computationally effective in nonlinear dependence for many situations. In this work, we incorporate the DC into inferring GRNs from the gene expression data without any underling distribution assumptions. We propose three DC-based GRNs inference algorithms: CLR-DC, MRNET-DC and REL-DC, and then compare them with the mutual information (MI)-based algorithms by analyzing two simulated data: benchmark GRNs from the DREAM challenge and GRNs generated by SynTReN network generator, and an experimentally determined SOS DNA repair network in Escherichia coli. According to both the receiver operator characteristic (ROC) curve and the precision-recall (PR) curve, our proposed algorithms significantly outperform the MI-based algorithms in GRNs inference.

  8. Inferring Nonlinear Gene Regulatory Networks from Gene Expression Data Based on Distance Correlation

    PubMed Central

    Guo, Xiaobo; Zhang, Ye; Hu, Wenhao; Tan, Haizhu; Wang, Xueqin

    2014-01-01

    Nonlinear dependence is general in regulation mechanism of gene regulatory networks (GRNs). It is vital to properly measure or test nonlinear dependence from real data for reconstructing GRNs and understanding the complex regulatory mechanisms within the cellular system. A recently developed measurement called the distance correlation (DC) has been shown powerful and computationally effective in nonlinear dependence for many situations. In this work, we incorporate the DC into inferring GRNs from the gene expression data without any underling distribution assumptions. We propose three DC-based GRNs inference algorithms: CLR-DC, MRNET-DC and REL-DC, and then compare them with the mutual information (MI)-based algorithms by analyzing two simulated data: benchmark GRNs from the DREAM challenge and GRNs generated by SynTReN network generator, and an experimentally determined SOS DNA repair network in Escherichia coli. According to both the receiver operator characteristic (ROC) curve and the precision-recall (PR) curve, our proposed algorithms significantly outperform the MI-based algorithms in GRNs inference. PMID:24551058

  9. General base-general acid catalysis by terpenoid cyclases.

    PubMed

    Pemberton, Travis A; Christianson, David W

    2016-07-01

    Terpenoid cyclases catalyze the most complex reactions in biology, in that more than half of the substrate carbon atoms often undergo changes in bonding during the course of a multistep cyclization cascade that proceeds through multiple carbocation intermediates. Many cyclization mechanisms require stereospecific deprotonation and reprotonation steps, and most cyclization cascades are terminated by deprotonation to yield an olefin product. The first bacterial terpenoid cyclase to yield a crystal structure was pentalenene synthase from Streptomyces exfoliatus UC5319. This cyclase generates the hydrocarbon precursor of the pentalenolactone family of antibiotics. The structures of pentalenene synthase and other terpenoid cyclases reveal predominantly nonpolar active sites typically lacking amino acid side chains capable of serving general base-general acid functions. What chemical species, then, enables the Brønsted acid-base chemistry required in the catalytic mechanisms of these enzymes? The most likely candidate for such general base-general acid chemistry is the co-product inorganic pyrophosphate. Here, we briefly review biological and nonbiological systems in which phosphate and its derivatives serve general base and general acid functions in catalysis. These examples highlight the fact that the Brønsted acid-base activities of phosphate derivatives are comparable to the Brønsted acid-base activities of amino acid side chains.

  10. Dissolution mechanism of aluminum hydroxides in acid media

    NASA Astrophysics Data System (ADS)

    Lainer, Yu. A.; Gorichev, I. G.; Tuzhilin, A. S.; Gololobova, E. G.

    2008-08-01

    The effects of the concentration, temperature, and potential at the hydroxide/electrolyte interface on the aluminum hydroxide dissolution in sulfuric, hydrochloric, and perchloric acids are studied. The limiting stage of the aluminum hydroxide dissolution in the acids is found to be the transition of the complexes that form on the aluminum hydroxide surface from the solid phase into the solution. The results of the calculation of the acid-base equilibrium constants at the oxide (hydroxide)/solution interface using the experimental data on the potentiometric titration of Al2O3 and AlOOH suspensions are analyzed. A mechanism is proposed for the dissolution of aluminum hydroxides in acid media.

  11. Allowance trading activity and state regulatory rulings: Evidence from the US Acid Rain Program

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bailey, E.M.

    1997-12-31

    The US Acid Rain Program is one of the first, and by far the most extensive, applications of a market based approach to pollution control. From the beginning, there has been concern whether utilities would participate in allowance trading, and whether regulatory activity at the state level would further complicate utilities` decision to trade allowances. This paper finds that public utility commission regulation has encouraged allowance trading activity in states with regulatory rulings, but that allowance trading activity has not been limited to states issuing regulations. Until there is evidence suggesting that significant additional cost savings could have been obtainedmore » if additional allowance trading activity had occurred in states without regulations or that utilities in states with regulations are still not taking advantage of all cost saving trading opportunities, this analysis suggests that there is little reason to believe that allowance trading activity is impeded by public utility commission regulations.« less

  12. Tunable mechanical properties of green solid films based on deoxyribonucleic acids

    NASA Astrophysics Data System (ADS)

    Matsuno, Hisao; Morimitsu, Yuma; Ohta, Noboru; Sekiguchi, Hiroshi; Takahara, Atsushi; Tanaka, Keiji

    Promoting green innovation to establish a worldwide low-carbon society is an urgent priority. We here show that solid films made from deoxyribonucleic acid (DNA) can be used as a structural material. The great advantage of DNA films over the ones made from synthetic polymers is that the mechanical properties are controllable, from glassy to rubbery, via semicrystalline by simply regulating the water content in the film. Why such unique mechanical properties can be manifested by the DNA films is determined from structural analyses using Fourier-transform infrared spectroscopy and wide-angle X-ray diffraction measurements. With increasing water content, the conformation of DNA was changed from A-form in an amorphous state to B-form in a partially packed one. DNA in the B-form became densely packed as the film was stretched. Also, DNAs were intermolecularly cross-linked using 2,5-hexanedione based on reductive amination induced by 2-picoline borane in aqueous phase. Cross-linking points were directly observed by atomic force microscopy. The tensile properties of cross-linked films were much better than those of non-cross-linked DNA films.

  13. Assessing College Students' Understanding of Acid Base Chemistry Concepts

    ERIC Educational Resources Information Center

    Wan, Yanjun Jean

    2014-01-01

    Typically most college curricula include three acid base models: Arrhenius', Bronsted-Lowry's, and Lewis'. Although Lewis' acid base model is generally thought to be the most sophisticated among these three models, and can be further applied in reaction mechanisms, most general chemistry curricula either do not include Lewis' acid base model, or…

  14. A novel processing system of sterol regulatory element-binding protein-1c regulated by polyunsaturated fatty acid.

    PubMed

    Nakakuki, Masanori; Kawano, Hiroyuki; Notsu, Tatsuto; Imada, Kazunori; Mizuguchi, Kiyoshi; Shimano, Hitoshi

    2014-05-01

    The proteolytic cascade is the key step in transactivation of sterol regulatory element-binding proteins (SREBPs), a transcriptional factor of lipid synthesis. Proteolysis of SREBP-2 is strictly regulated by sterols, but that of SREBP-1c was not strongly sterol-regulated, but inhibited by polyunsaturated fatty acids (PUFAs). In this study, the proteolytic processing of SREBP-1 and -2 was examined by transfection studies of cDNA-encoding mutants in which all the known cleavage sites were disrupted. In cultured cells, sterol-regulated SREBP-2 processing was completely eliminated by mutation of cleavage sites. In contrast, the corresponding SREBP-1c mutants as well as wild type exhibited large amounts of cleaved products in the nuclear extracts from culture cells and murine liver in vivo. The nuclear form of the mutant SREBP-1c was induced by delipidated condition and suppressed by eicosapentaenoic acid, an n-3 PUFA, but not by sterols. This novel processing mechanism was affected by neither SREBP cleavage-activating protein (SCAP) nor insulin-induced gene (Insig)-1, unlike SREBP-2, but abolished by a serine protease inhibitor. Through analysis of deletion mutant, a site-2 protease recognition sequence (DRSR) was identified to be involved in this novel processing. These findings suggest that SREBP-1c cleavage could be subjected to a novel PUFA-regulated cleavage system in addition to the sterol-regulatory SCAP/Insig system.

  15. Transcriptome profiling reveals regulatory mechanisms underlying Corolla Senescence in Petunia

    USDA-ARS?s Scientific Manuscript database

    Genetic regulatory mechanisms that govern petal natural senescence in petunia is complicated and unclear. To identify key genes and pathways that regulate the process, we initiated a transcriptome analysis in petunia petals at four developmental time points, including petal opening without anthesis ...

  16. Controlling mechanisms of metals release form cement-based waste form in acetic acid solution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cheng, Kuang Ye.

    1991-01-01

    The purpose of this dissertation is to identify the individual leaching mechanisms of metals by knowing the pH profile within the leached specimen and the physical and chemical properties of the leached material. Leaching of cement-based waste form in acetic acid solutions with different acidic strengths has been investigated in this work. The pH profile along the acid penetration route in the cement-based waste form was identified by various pH color indicators. The pH in the surface altered layer varies from 5.0 to 6.0, which is very close to the pH in the bulk leachate. A reacting zone, where themore » pH abruptly changes from 6 to 12, sharply divides the altered surface layer from the remaining unleached waste form or kernel. Leaching of metals is controlled by the acidity available in the leachant. Dissolution of alkaline materials leaves a silica-rich layer on the surface of the cement-based waste form. This surface layer exhibits different properties than those of the unleached material. The surface layer has a higher water content, is lighter weight, and is soft and friable. Furthermore, the abundant silicate content on the solid surface detains portion of the leached metals, while they are moving through the leached layer into bulk solution. The leaching of metals is a consequence of acid penetration. The distance from the solid/solution interface to the front of the leaching boundary can be regarded as the depth of leaching zone, where the metals dissolve and diffuse out of the waste form. The metal ions diffuse through the leached layer may be retarded on the solid surface by the pH-dependent adsorption reactions. It is found that the leaching process through the leached layer is diffusion-controlled for calcium and cadmium, whereas diffusion and adsorption occur simultaneously in the leached layer for lead and arsenic.« less

  17. Comparative genetic screens in human cells reveal new regulatory mechanisms in WNT signaling

    PubMed Central

    Lebensohn, Andres M; Dubey, Ramin; Neitzel, Leif R; Tacchelly-Benites, Ofelia; Yang, Eungi; Marceau, Caleb D; Davis, Eric M; Patel, Bhaven B; Bahrami-Nejad, Zahra; Travaglini, Kyle J; Ahmed, Yashi; Lee, Ethan; Carette, Jan E; Rohatgi, Rajat

    2016-01-01

    The comprehensive understanding of cellular signaling pathways remains a challenge due to multiple layers of regulation that may become evident only when the pathway is probed at different levels or critical nodes are eliminated. To discover regulatory mechanisms in canonical WNT signaling, we conducted a systematic forward genetic analysis through reporter-based screens in haploid human cells. Comparison of screens for negative, attenuating and positive regulators of WNT signaling, mediators of R-spondin-dependent signaling and suppressors of constitutive signaling induced by loss of the tumor suppressor adenomatous polyposis coli or casein kinase 1α uncovered new regulatory features at most levels of the pathway. These include a requirement for the transcription factor AP-4, a role for the DAX domain of AXIN2 in controlling β-catenin transcriptional activity, a contribution of glycophosphatidylinositol anchor biosynthesis and glypicans to R-spondin-potentiated WNT signaling, and two different mechanisms that regulate signaling when distinct components of the β-catenin destruction complex are lost. The conceptual and methodological framework we describe should enable the comprehensive understanding of other signaling systems. DOI: http://dx.doi.org/10.7554/eLife.21459.001 PMID:27996937

  18. General Base-General Acid Catalysis by Terpenoid Cyclases§

    PubMed Central

    Pemberton, Travis A.; Christianson, David W.

    2016-01-01

    Terpenoid cyclases catalyze the most complex reactions in biology, in that more than half of the substrate carbon atoms often undergo changes in bonding during the course of a multistep cyclization cascade that proceeds through multiple carbocation intermediates. Many cyclization mechanisms require stereospecific deprotonation and reprotonation steps, and most cyclization cascades are terminated by deprotonation to yield an olefin product. The first bacterial terpenoid cyclase to yield a crystal structure was pentalenene synthase from Streptomyces exfoliatus UC5319. This cyclase generates the hydrocarbon precursor of the pentalenolactone family of antibiotics. The structures of pentalenene synthase and other terpenoid cyclases reveal predominantly nonpolar active sites typically lacking amino acid side chains capable of serving general base-general acid functions. What chemical species, then, enables the Brønsted acid-base chemistry required in the catalytic mechanisms of these enzymes? The most likely candidate for such general base-general acid chemistry is the co-product inorganic pyrophosphate. Here, we briefly review biological and nonbiological systems in which phosphate and its derivatives serve general base and general acid functions in catalysis. These examples highlight the fact that the Brønsted acid-base activities of phosphate derivatives are comparable to the Brønsted acid-base activities of amino acid side chains. PMID:27072285

  19. A computational study of ultrafast acid dissociation and acid-base neutralization reactions. I. The model.

    PubMed

    Maurer, Patrick; Thomas, Vibin; Rivard, Ugo; Iftimie, Radu

    2010-07-28

    Ultrafast, time-resolved investigations of acid-base neutralization reactions have recently been performed using systems containing the photoacid 8-hydroxypyrene-1,3,6-trisulfonic acid trisodium salt (HPTS) and various Bronsted bases. Two conflicting neutralization mechanisms have been formulated by Mohammed et al. [Science 310, 83 (2005)] and Siwick et al. [J. Am. Chem. Soc. 129, 13412 (2007)] for the same acid-base system. Herein an ab initio molecular dynamics based computational model is formulated, which is able to investigate the validity of the proposed mechanisms in the general context of ground-state acid-base neutralization reactions. Our approach consists of using 2,4,6-tricyanophenol (exp. pKa congruent with 1) as a model for excited-state HPTS( *) (pKa congruent with 1.4) and carboxylate ions for the accepting base. We employ our recently proposed dipole-field/quantum mechanics (QM) treatment [P. Maurer and R. Iftimie, J. Chem. Phys. 132, 074112 (2010)] of the proton donor and acceptor molecules. This approach allows one to tune the free energy of neutralization to any desired value as well as model initial nonequilibrium hydration effects caused by a sudden increase in acidity, making it possible to achieve a more realistic comparison with experimental data than could be obtained via a full-QM treatment of the entire system. It is demonstrated that the dipole-field/QM model reproduces correctly key properties of the 2,4,6-tricyanophenol acid molecule including gas-phase proton dissociation energies and dipole moments, and condensed-phase hydration structure and pKa values.

  20. RNA-Seq-based transcriptome profiling of early nitrogen deficiency response in cucumber seedlings provides new insight into the putative nitrogen regulatory network.

    PubMed

    Zhao, Wenchao; Yang, Xueyong; Yu, Hongjun; Jiang, Weijie; Sun, Na; Liu, Xiaoran; Liu, Xiaolin; Zhang, Xiaomeng; Wang, Yan; Gu, Xingfang

    2015-03-01

    Nitrogen (N) is both an important macronutrient and a signal for plant growth and development. However, the early regulatory mechanism of plants in response to N starvation is not well understood, especially in cucumber, an economically important crop that normally consumes excessive N during production. In this study, the early time-course transcriptome response of cucumber leaves under N deficiency was monitored using RNA sequencing (RNA-Seq). More than 23,000 transcripts were examined in cucumber leaves, of which 364 genes were differentially expressed in response to N deficiency. Based on the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway database, gene ontology (GO) and protein-protein interaction analysis, 64 signaling-related N-deficiency-responsive genes were identified. Furthermore, the potential regulatory mechanisms of anthocyanin accumulation, Chl decline and cell wall remodeling were assessed at the transcription level. Increased ascorbic acid synthesis was identified in cucumber seedlings and fruit under N-deficient conditions, and a new corresponding regulatory hypothesis has been proposed. A data cross-comparison between model plants and cucumber was made, and some common and specific N-deficient response mechanisms were found in the present study. Our study provides novel insights into the responses of cucumber to nitrogen starvation at the global transcriptome level, which are expected to be highly useful for dissecting the N response pathways in this major vegetable and for improving N fertilization practices. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  1. α-Ketoglutarate regulates acid-base balance through an intrarenal paracrine mechanism

    PubMed Central

    Tokonami, Natsuko; Morla, Luciana; Centeno, Gabriel; Mordasini, David; Ramakrishnan, Suresh Krishna; Nikolaeva, Svetlana; Wagner, Carsten A.; Bonny, Olivier; Houillier, Pascal; Doucet, Alain; Firsov, Dmitri

    2013-01-01

    Paracrine communication between different parts of the renal tubule is increasingly recognized as an important determinant of renal function. Previous studies have shown that changes in dietary acid-base load can reverse the direction of apical α-ketoglutarate (αKG) transport in the proximal tubule and Henle’s loop from reabsorption (acid load) to secretion (base load). Here we show that the resulting changes in the luminal concentrations of αKG are sensed by the αKG receptor OXGR1 expressed in the type B and non-A–non-B intercalated cells of the connecting tubule (CNT) and the cortical collecting duct (CCD). The addition of 1 mM αKG to the tubular lumen strongly stimulated Cl–-dependent HCO3– secretion and electroneutral transepithelial NaCl reabsorption in microperfused CCDs of wild-type mice but not Oxgr1–/– mice. Analysis of alkali-loaded mice revealed a significantly reduced ability of Oxgr1–/– mice to maintain acid-base balance. Collectively, these results demonstrate that OXGR1 is involved in the adaptive regulation of HCO3– secretion and NaCl reabsorption in the CNT/CCD under acid-base stress and establish αKG as a paracrine mediator involved in the functional coordination of the proximal and the distal parts of the renal tubule. PMID:23934124

  2. The Acid-Base Properties, Hydrolytic Mechanism, and Susceptibility to O2 Oxidation of Fe4S4(SR)4-2 Clusters

    PubMed Central

    Bruice, Thomas C.; Maskiewicz, Richard; Job, Robert

    1975-01-01

    The iron-sulfur cluster compounds Fe4S4(SR)4-2 [where —SR = —SCH3, —S—C(CH3)3, and —S— CH2—CH(CH3)2] have been found to represent the base species of weak acids of pKa comparable to that of carboxylic acids. The acid species Fe4S4(SR)4H- is most subject to reaction with O2 and to acid-catalyzed solvolysis, while the base species Fe4S4(SR)4-2 most readily undergoes ligand exchange. The kinetics for hydrolysis of the isobutyl mercaptide cluster salt has been investigated in detail and a mechanism involving the stepwise process [Formula: see text] has been proposed. The importance of the acid-base equilibria in determining the reactivity of the iron-sulfur clusters and its possible importance as a factor in the determination of the potentials of ferredoxins and high potential iron protein are discussed. PMID:16592211

  3. Adaptive Response and Tolerance to Weak Acids in Saccharomyces cerevisiae: A Genome-Wide View

    PubMed Central

    Mira, Nuno P.; Teixeira, Miguel Cacho

    2010-01-01

    Abstract Weak acids are widely used as food preservatives (e.g., acetic, propionic, benzoic, and sorbic acids), herbicides (e.g., 2,4-dichlorophenoxyacetic acid), and as antimalarial (e.g., artesunic and artemisinic acids), anticancer (e.g., artesunic acid), and immunosuppressive (e.g., mycophenolic acid) drugs, among other possible applications. The understanding of the mechanisms underlying the adaptive response and resistance to these weak acids is a prerequisite to develop more effective strategies to control spoilage yeasts, and the emergence of resistant weeds, drug resistant parasites or cancer cells. Furthermore, the identification of toxicity mechanisms and resistance determinants to weak acid-based pharmaceuticals increases current knowledge on their cytotoxic effects and may lead to the identification of new drug targets. This review integrates current knowledge on the mechanisms of toxicity and tolerance to weak acid stress obtained in the model eukaryote Saccharomyces cerevisiae using genome-wide approaches and more detailed gene-by-gene analysis. The major features of the yeast response to weak acids in general, and the more specific responses and resistance mechanisms towards a specific weak acid or a group of weak acids, depending on the chemical nature of the side chain R group (R-COOH), are highlighted. The involvement of several transcriptional regulatory networks in the genomic response to different weak acids is discussed, focusing on the regulatory pathways controlled by the transcription factors Msn2p/Msn4p, War1p, Haa1p, Rim101p, and Pdr1p/Pdr3p, which are known to orchestrate weak acid stress response in yeast. The extrapolation of the knowledge gathered in yeast to other eukaryotes is also attempted. PMID:20955006

  4. Thick filament mechano-sensing is a calcium-independent regulatory mechanism in skeletal muscle.

    PubMed

    Fusi, L; Brunello, E; Yan, Z; Irving, M

    2016-10-31

    Recent X-ray diffraction studies on actively contracting fibres from skeletal muscle showed that the number of myosin motors available to interact with actin-containing thin filaments is controlled by the stress in the myosin-containing thick filaments. Those results suggested that thick filament mechano-sensing might constitute a novel regulatory mechanism in striated muscles that acts independently of the well-known thin filament-mediated calcium signalling pathway. Here we test that hypothesis using probes attached to the myosin regulatory light chain in demembranated muscle fibres. We show that both the extent and kinetics of thick filament activation depend on thick filament stress but are independent of intracellular calcium concentration in the physiological range. These results establish direct control of myosin motors by thick filament mechano-sensing as a general regulatory mechanism in skeletal muscle that is independent of the canonical calcium signalling pathway.

  5. Thick filament mechano-sensing is a calcium-independent regulatory mechanism in skeletal muscle

    PubMed Central

    Fusi, L.; Brunello, E.; Yan, Z.; Irving, M.

    2016-01-01

    Recent X-ray diffraction studies on actively contracting fibres from skeletal muscle showed that the number of myosin motors available to interact with actin-containing thin filaments is controlled by the stress in the myosin-containing thick filaments. Those results suggested that thick filament mechano-sensing might constitute a novel regulatory mechanism in striated muscles that acts independently of the well-known thin filament-mediated calcium signalling pathway. Here we test that hypothesis using probes attached to the myosin regulatory light chain in demembranated muscle fibres. We show that both the extent and kinetics of thick filament activation depend on thick filament stress but are independent of intracellular calcium concentration in the physiological range. These results establish direct control of myosin motors by thick filament mechano-sensing as a general regulatory mechanism in skeletal muscle that is independent of the canonical calcium signalling pathway. PMID:27796302

  6. Control and regulatory mechanisms associated with thermogenesis in flying insects and birds.

    PubMed

    Loli, Denise; Bicudo, José Eduardo P W

    2005-01-01

    Most insects and birds are able to fly. The chitin made exoskeleton of insects poses them several constraints, and this is one the reasons they are in general small sized animals. On the other hand, because birds possess an endoskeleton made of bones they may grow much larger when compared to insects. The two taxa are quite different with regards to their general "design" platform, in particular with respect to their respiratory and circulatory systems. However, because they fly, they may share in common several traits, namely those associated with the control and regulatory mechanisms governing thermogenesis. High core temperatures are essential for animal flight irrespective of the taxa they belong to. Birds and insects have thus evolved mechanisms which allowed them to control and regulate high rates of heat fluxes. This article discusses possible convergent thermogenic control and regulatory mechanisms associated with flight in insects and birds.

  7. The European Regulatory Environment of RNA-Based Vaccines.

    PubMed

    Hinz, Thomas; Kallen, Kajo; Britten, Cedrik M; Flamion, Bruno; Granzer, Ulrich; Hoos, Axel; Huber, Christoph; Khleif, Samir; Kreiter, Sebastian; Rammensee, Hans-Georg; Sahin, Ugur; Singh-Jasuja, Harpreet; Türeci, Özlem; Kalinke, Ulrich

    2017-01-01

    A variety of different mRNA-based drugs are currently in development. This became possible, since major breakthroughs in RNA research during the last decades allowed impressive improvements of translation, stability and delivery of mRNA. This article focuses on antigen-encoding RNA-based vaccines that are either directed against tumors or pathogens. mRNA-encoded vaccines are developed both for preventive or therapeutic purposes. Most mRNA-based vaccines are directly administered to patients. Alternatively, primary autologous cells from cancer patients are modified ex vivo by the use of mRNA and then are adoptively transferred to patients. In the EU no regulatory guidelines presently exist that specifically address mRNA-based vaccines. The existing regulatory framework, however, clearly defines that mRNA-based vaccines in most cases have to be centrally approved. Interestingly, depending on whether RNA-based vaccines are directed against tumors or infectious disease, they are formally considered gene therapy products or not, respectively. Besides an overview on the current clinical use of mRNA vaccines in various therapeutic areas a detailed discussion of the current regulatory situation is provided and regulatory perspectives are discussed.

  8. Revealing cell cycle control by combining model-based detection of periodic expression with novel cis-regulatory descriptors

    PubMed Central

    Andersson, Claes R; Hvidsten, Torgeir R; Isaksson, Anders; Gustafsson, Mats G; Komorowski, Jan

    2007-01-01

    Background We address the issue of explaining the presence or absence of phase-specific transcription in budding yeast cultures under different conditions. To this end we use a model-based detector of gene expression periodicity to divide genes into classes depending on their behavior in experiments using different synchronization methods. While computational inference of gene regulatory circuits typically relies on expression similarity (clustering) in order to find classes of potentially co-regulated genes, this method instead takes advantage of known time profile signatures related to the studied process. Results We explain the regulatory mechanisms of the inferred periodic classes with cis-regulatory descriptors that combine upstream sequence motifs with experimentally determined binding of transcription factors. By systematic statistical analysis we show that periodic classes are best explained by combinations of descriptors rather than single descriptors, and that different combinations correspond to periodic expression in different classes. We also find evidence for additive regulation in that the combinations of cis-regulatory descriptors associated with genes periodically expressed in fewer conditions are frequently subsets of combinations associated with genes periodically expression in more conditions. Finally, we demonstrate that our approach retrieves combinations that are more specific towards known cell-cycle related regulators than the frequently used clustering approach. Conclusion The results illustrate how a model-based approach to expression analysis may be particularly well suited to detect biologically relevant mechanisms. Our new approach makes it possible to provide more refined hypotheses about regulatory mechanisms of the cell cycle and it can easily be adjusted to reveal regulation of other, non-periodic, cellular processes. PMID:17939860

  9. Visual- and Vestibular-Autonomic Influence on Short-Term Cardiovascular Regulatory Mechanisms

    NASA Technical Reports Server (NTRS)

    Mullen, Thomas J.; Ramsdell, Craig D.

    1999-01-01

    This synergy project was a one-year effort conducted cooperatively by members of the NSBRI Cardiovascular Alterations and Neurovestibular Adaptation Teams in collaboration with NASA Johnson Space Center (JSC) colleagues. The objective of this study was to evaluate visual autonomic interactions on short-term cardiovascular regulatory mechanisms. Based on established visual-vestibular and vestibular-autonomic shared neural pathways, we hypothesized that visually induced changes in orientation will trigger autonomic cardiovascular reflexes. A second objective was to compare baroreflex changes during postural changes as measured with the new Cardiovascular System Identification (CSI) technique with those measured using a neck barocuff. While the neck barocuff stimulates only the carotid baroreceptors, CSI provides a measure of overall baroreflex responsiveness. This study involved a repeated measures design with 16 healthy human subjects (8 M, 8 F) to examine cardiovascular regulatory responses during actual and virtual head-upright tilts. Baroreflex sensitivity was first evaluated with subjects in supine and upright positions during actual tilt-table testing using both neck barocuff and CSI methods. The responses to actual tilts during this first session were then compared to responses during visually induced tilt and/or rotation obtained during a second session.

  10. Antioxidative mechanisms in chlorogenic acid.

    PubMed

    Tošović, Jelena; Marković, Svetlana; Dimitrić Marković, Jasmina M; Mojović, Miloš; Milenković, Dejan

    2017-12-15

    Although chlorogenic acid (5CQA) is an important ingredient of various foods and beverages, mechanisms of its antioxidative action have not been fully clarified. Besides electron spin resonance experiment, this study includes thermodynamic and mechanistic investigations of the hydrogen atom transfer (HAT), radical adduct formation (RAF), sequential proton loss electron transfer (SPLET), and single electron transfer - proton transfer (SET-PT) mechanisms of 5CQA in benzene, ethanol, and water solutions. The calculations were performed using the M06-2X/6-311++G(d,p) level of theory and CPCM solvation model. It was found that SET-PT is not a plausible antioxidative mechanism of 5CQA. RAF pathways are faster, but HAT yields thermodynamically more stable radical products, indicating that in acidic and neutral media 5CQA can take either HAT or RAF pathways. In basic environment (e.g. at physiological pH) SPLET is the likely antioxidative mechanism of 5CQA with extremely high rate. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. A New Pain Regulatory System via the Brain Long Chain Fatty Acid Receptor GPR40/FFA1 Signal.

    PubMed

    Nakamoto, Kazuo

    2017-01-01

    An increasingly large number of pharmacological and physiological works on fatty acids have shown that the functional properties of fatty acids are regulated by the amount of individual fatty acid intake and the distribution of fatty acids among organs. Recently, it has been determined that G-protein-coupled receptor 40/free fatty acid receptor 1 (GPR40/FFA1) is activated by long-chain fatty acids, such as docosahexaenoic acid (DHA). GPR40/FFA1 is mainly expressed in the β cell of the pancreas, spinal cord and brain. It is reported that this receptor has a functional role in controlling blood glucose levels via the modulation of insulin secretion. However, its physiological function in the brain remains unknown. Our previous studies have shown that GPR40/FFA1 is expressed in pro-opiomelanocortin (POMC)-positive neurons of the arcuate nucleus, serotonergic neurons in the nucleus raphe magnus, and in noradrenergic neurons in the locus coeruleus. Furthermore, the intracerebroventricular injection of DHA or GW9508, which is a selective GPR40/FFA1 agonist, attenuates formalin-induced inflammatory pain behavior through increasing β-endorphin release in the hypothalamus. It also suppresses complete Freund's adjuvant-induced mechanical allodynia and thermal hyperalgesia. Our findings suggest that brain free long-chain fatty acids-GPR40/FFA1 signaling might have an important role in the modulation of endogenous pain control systems. In this review, I discuss the current status and our recent study regarding a new pain regulatory system via the brain long chain fatty acid receptor GPR40/FFA1 signal.

  12. [Regulatory Mechanisms of PD-L1 Expression and Its Role in Immune Evasion].

    PubMed

    Kataoka, Keisuke

    2017-11-01

    Immune checkpoint blockade therapy using anti-PD-1 or anti-PD-L1 antibodies can unleash anti-tumor immunity and induce durable remission in a variety ofhuman cancers. However, the regulatory mechanisms of PD-L1 expression mediating immune evasion ofcancer cells have not been fully elucidated, including the genetic alterations causing PD-L1 overexpression. Recently, we have reported a novel genetic mechanism ofimmune evasion associated with structural variations(SVs)disrupting the 3'-untranslated region(UTR)ofthe PD-L1 gene in various malignancies, such as aggressive lymphomas and gastrointestinal cancers. Despite a heterogenous nature ofthese SVs, they are closely associated with a marked upregulation of PD-L1 expression, which augments tumor growth and escape from anti-tumor immunity. Here we present an overview of the regulatory mechanisms of PD-L1 expression in cancer cells, highlighting the genetic mechanisms of PD-L1 constitutive activation, with specific focus on PD-L1 3'-UTR disruption.

  13. 78 FR 36698 - Microbiology Devices; Reclassification of Nucleic Acid-Based Systems for Mycobacterium tuberculosis

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-19

    ... specimens from class III (premarket approval) into class II (special controls). FDA is also issuing the draft special controls guideline entitled ``Class II Special Controls Guideline: Nucleic Acid-Based In... regulatory controls needed to provide reasonable assurance of their safety and effectiveness. The three...

  14. The emergence and evolution of life in a "fatty acid world" based on quantum mechanics.

    PubMed

    Tamulis, Arvydas; Grigalavicius, Mantas

    2011-02-01

    Quantum mechanical based electron correlation interactions among molecules are the source of the weak hydrogen and Van der Waals bonds that are critical to the self-assembly of artificial fatty acid micelles. Life on Earth or elsewhere could have emerged in the form of self-reproducing photoactive fatty acid micelles, which gradually evolved into nucleotide-containing micelles due to the enhanced ability of nucleotide-coupled sensitizer molecules to absorb visible light. Comparison of the calculated absorption spectra of micelles with and without nucleotides confirmed this idea and supports the idea of the emergence and evolution of nucleotides in minimal cells of a so-called Fatty Acid World. Furthermore, the nucleotide-caused wavelength shift and broadening of the absorption pattern potentially gives these molecules an additional valuable role, other than a purely genetic one in the early stages of the development of life. From the information theory point of view, the nucleotide sequences in such micelles carry positional information providing better electron transport along the nucleotide-sensitizer chain and, in addition, providing complimentary copies of that information for the next generation. Nucleotide sequences, which in the first period of evolution of fatty acid molecules were useful just for better absorbance of the light in the longer wavelength region, later in the PNA or RNA World, took on the role of genetic information storage.

  15. Physical and mechanical properties of extruded poly(lactic acid)-based Paulownia elongata biocomposites

    USDA-ARS?s Scientific Manuscript database

    Paulownia wood flour (PWF), a byproduct of milling lumber, was tested as bio-filler with polylactic acid (PLA). Paulownia wood (PW) shavings were milled and separated into particle fractions and then blended with PLA with a single screw extruder. Mechanical and thermal properties were tested. Dif...

  16. The mechanism of proton conduction in phosphoric acid

    NASA Astrophysics Data System (ADS)

    Vilčiauskas, Linas; Tuckerman, Mark E.; Bester, Gabriel; Paddison, Stephen J.; Kreuer, Klaus-Dieter

    2012-06-01

    Neat liquid phosphoric acid (H3PO4) has the highest intrinsic proton conductivity of any known substance and is a useful model for understanding proton transport in other phosphate-based systems in biology and clean energy technologies. Here, we present an ab initio molecular dynamics study that reveals, for the first time, the microscopic mechanism of this high proton conductivity. Anomalously fast proton transport in hydrogen-bonded systems involves a structural diffusion mechanism in which intramolecular proton transfer is driven by specific hydrogen bond rearrangements in the surrounding environment. Aqueous media transport excess charge defects through local hydrogen bond rearrangements that drive individual proton transfer reactions. In contrast, strong, polarizable hydrogen bonds in phosphoric acid produce coupled proton motion and a pronounced protic dielectric response of the medium, leading to the formation of extended, polarized hydrogen-bonded chains. The interplay between these chains and a frustrated hydrogen-bond network gives rise to the high proton conductivity.

  17. Renal acidification responses to respiratory acid-base disorders.

    PubMed

    Madias, Nicolaos E

    2010-01-01

    Respiratory acid-base disorders are those abnormalities in acid-base equilibrium that are expressed as primary changes in the arterial carbon dioxide tension (PaCO2). An increase in PaCO2 (hypercapnia) acidifies body fluids and initiates the acid-base disturbance known as respiratory acidosis. By contrast, a decrease in PaCO2 (hypocapnia) alkalinizes body fluids and initiates the acid-base disturbance known as respiratory alkalosis. The impact on systemic acidity of these primary changes in PaCO2 is ameliorated by secondary, directional changes in plasma [HCO3¯] that occur in 2 stages. Acutely, hypercapnia or hypocapnia yields relatively small changes in plasma [HCO3¯] that originate virtually exclusively from titration of the body's nonbicarbonate buffers. During sustained hypercapnia or hypocapnia, much larger changes in plasma [HCO3¯] occur that reflect adjustments in renal acidification mechanisms. Consequently, the deviation of systemic acidity from normal is smaller in the chronic forms of these disorders. Here we provide an overview of the renal acidification responses to respiratory acid-base disorders. We also identify gaps in knowledge that require further research.

  18. Posttranslational control of the scaffold for Fe-S cluster biogenesis as a compensatory regulatory mechanism.

    PubMed

    Ciesielski, Szymon J; Craig, Elizabeth A

    2017-02-01

    Though toxic in excess, iron is vital for life. Thus, its use in all cells is tightly regulated. Analysis of Saccharomyces cerevisiae, which has been used extensively as a model system, has revealed layers of regulation of cellular iron trafficking and utilization. This regulation is based on the availability of both elemental iron and functionality of the Fe-S cluster biogenesis system. Here, we discuss a possible "first responder" regulatory mechanism centered on the stability of the scaffold protein on which Fe-S clusters are built.

  19. Exploring associations between self-regulatory mechanisms and neuropsychological functioning and driver behaviour after brain injury.

    PubMed

    Rike, Per-Ola; Johansen, Hans J; Ulleberg, Pål; Lundqvist, Anna; Schanke, Anne-Kristine

    2018-04-01

    The objective of this prospective one-year follow-up study was to explore the associations between self-regulatory mechanisms and neuropsychological tests as well as baseline and follow-up ratings of driver behaviour. The participants were a cohort of subjects with stroke and traumatic brain injury (TBI) who were found fit to drive after a multi-disciplinary driver assessment (baseline). Baseline measures included neuropsychological tests and ratings of self-regulatory mechanisms, i.e., executive functions (Behavior Rating Inventory of Executive Function-Adult Version; BRIEF-A) and impulsive personality traits (UPPS Impulsive Behavior Scale). The participants rated pre-injury driving behaviour on the Driver Behaviour Qestionnaire (DBQ) retrospectively at baseline and after one year of post-injury driving (follow-up). Better performance on neuropsychological tests was significantly associated with more post-injury DBQ Violations. The BRIEF-A main indexes were significantly associated with baseline and follow-up ratings of DBQ Mistakes and follow-up DBQ Inattention. UPPS (lack of) Perseverance was significantly associated with baseline DBQ Inattention, whereas UPPS Urgency was significantly associated with baseline DBQ Inexperience and post-injury DBQ Mistakes. There were no significant changes in DBQ ratings from baseline (pre-injury) to follow-up (post-injury). It was concluded that neuropsychological functioning and self-regulatory mechanisms are related to driver behaviour. Some aspects of driver behaviour do not necessarily change after brain injury, reflecting the influence of premorbid driving behaviour or impaired awareness of deficits on post-injury driving behaviour. Further evidence is required to predict the role of self-regulatory mechanisms on driver behaviour and crashes or near misses.

  20. [Influence of geomagnetic storms on the balance of autonomic regulatory mechanisms].

    PubMed

    Chichinadze, G; Tvildiani, L; Kvachadze, I; Tarkhan-Mouravi, I

    2005-09-01

    The investigation aimed to evaluate autonomic regulatory mechanisms in practically healthy persons during the geomagnetically quiet periods and during geomagnetic storms. The examinations were conducted among the volunteer young men (n=64) 18-22 years of age. The autonomic function was studied on the basis of the heart rate variability. The geomagnetically quiet periods were considered when the value of the K-index was no more then 2 and a geomagnetic storm was considered when the value of the index was 5 and more. It is ascertained that in the both cases the basic statistical indices of the heart rate were identical. The analysis of R-R intervals spectral power gave the possibility to sort the persons examined into the three different groups. The data obtained allowed to suggest that geomagnetic storms influence human organisms through the vagus centers by means of their excitation. This phenomenon may be considered as a self-regulatory physiologic mechanism of the adaptive character. The analysis of the spectral power of R-R intervals may be considered as a sensitive method for the detection of the magnitolabile persons.

  1. Mechanisms of intragastric pH sensing.

    PubMed

    Goo, Tyralee; Akiba, Yasutada; Kaunitz, Jonathan D

    2010-12-01

    Luminal amino acids and lack of luminal acidity as a result of acid neutralization by intragastric foodstuffs are powerful signals for acid secretion. Although the hormonal and neural pathways underlying this regulatory mechanism are well understood, the nature of the gastric luminal pH sensor has been enigmatic. In clinical studies, high pH, tryptic peptides, and luminal divalent metals (Ca(2+) and Mg(2+)) increase gastrin release and acid production. The calcium-sensing receptor (CaSR), first described in the parathyroid gland but expressed on gastric G cells, is a logical candidate for the gastric acid sensor. Because CaSR ligands include amino acids and divalent metals, and because extracellular pH affects ligand binding in the pH range of the gastric content, its pH, metal, and nutrient-sensing functions are consistent with physiologic observations. The CaSR is thus an attractive candidate for the gastric luminal sensor that is part of the neuroendocrine negative regulatory loop for acid secretion.

  2. Integrative FourD omics approach profiles the target network of the carbon storage regulatory system.

    PubMed

    Sowa, Steven W; Gelderman, Grant; Leistra, Abigail N; Buvanendiran, Aishwarya; Lipp, Sarah; Pitaktong, Areen; Vakulskas, Christopher A; Romeo, Tony; Baldea, Michael; Contreras, Lydia M

    2017-02-28

    Multi-target regulators represent a largely untapped area for metabolic engineering and anti-bacterial development. These regulators are complex to characterize because they often act at multiple levels, affecting proteins, transcripts and metabolites. Therefore, single omics experiments cannot profile their underlying targets and mechanisms. In this work, we used an Integrative FourD omics approach (INFO) that consists of collecting and analyzing systems data throughout multiple time points, using multiple genetic backgrounds, and multiple omics approaches (transcriptomics, proteomics and high throughput sequencing crosslinking immunoprecipitation) to evaluate simultaneous changes in gene expression after imposing an environmental stress that accentuates the regulatory features of a network. Using this approach, we profiled the targets and potential regulatory mechanisms of a global regulatory system, the well-studied carbon storage regulatory (Csr) system of Escherichia coli, which is widespread among bacteria. Using 126 sets of proteomics and transcriptomics data, we identified 136 potential direct CsrA targets, including 50 novel ones, categorized their behaviors into distinct regulatory patterns, and performed in vivo fluorescence-based follow up experiments. The results of this work validate 17 novel mRNAs as authentic direct CsrA targets and demonstrate a generalizable strategy to integrate multiple lines of omics data to identify a core pool of regulator targets. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. An allostatic mechanism for M2 pyruvate kinase as an amino-acid sensor.

    PubMed

    Yuan, Meng; McNae, Iain W; Chen, Yiyuan; Blackburn, Elizabeth A; Wear, Martin A; Michels, Paul A M; Fothergill-Gilmore, Linda A; Hupp, Ted; Walkinshaw, Malcolm D

    2018-05-10

    We have tested the effect of all 20 proteinogenic amino acids on the activity of the M2 isoenzyme of pyruvate kinase (M2PYK) and show that within physiologically relevant concentrations, phenylalanine, alanine, tryptophan, methionine, valine, and proline act as inhibitors while histidine and serine act as activators. Size exclusion chromatography has been used to show that all amino acids, whether activators or inhibitors, stabilise the tetrameric form of M2PYK. In the absence of amino-acid ligands an apparent tetramer-monomer dissociation K d is estimated to be ~0.9 µM with a slow dissociation rate (t 1/2 ~ 15 min). X-ray structures of M2PYK complexes with alanine, phenylalanine, and tryptophan show the M2PYK locked in an inactive T-state conformation, while activators lock the M2PYK tetramer in the active R-state conformation. Amino-acid binding in the allosteric pocket triggers rigid body rotations (11°) stabilising either T or R-states. The opposing inhibitory and activating effects of the non-essential amino acids serine and alanine suggest that M2PYK could act as a rapid-response nutrient sensor to rebalance cellular metabolism. This competition at a single allosteric site between activators and inhibitors provides a novel regulatory mechanism by which M2PYK activity is finely tuned by the relative (but not absolute) concentrations of activator and inhibitor amino acids. Such 'allostatic' regulation may be important in metabolic reprogramming and influencing cell fate. ©2018 The Author(s).

  4. An allostatic mechanism for M2 pyruvate kinase as an amino-acid sensor

    PubMed Central

    McNae, Iain W.; Chen, Yiyuan; Blackburn, Elizabeth A.; Wear, Martin A.; Hupp, Ted

    2018-01-01

    We have tested the effect of all 20 proteinogenic amino acids on the activity of the M2 isoenzyme of pyruvate kinase (M2PYK) and show that, within physiologically relevant concentrations, phenylalanine, alanine, tryptophan, methionine, valine, and proline act as inhibitors, while histidine and serine act as activators. Size exclusion chromatography has been used to show that all amino acids, whether activators or inhibitors, stabilise the tetrameric form of M2PYK. In the absence of amino-acid ligands an apparent tetramer–monomer dissociation Kd is estimated to be ∼0.9 µM with a slow dissociation rate (t1/2 ∼ 15 min). X-ray structures of M2PYK complexes with alanine, phenylalanine, and tryptophan show the M2PYK locked in an inactive T-state conformation, while activators lock the M2PYK tetramer in the active R-state conformation. Amino-acid binding in the allosteric pocket triggers rigid body rotations (11°) stabilising either T or R states. The opposing inhibitory and activating effects of the non-essential amino acids serine and alanine suggest that M2PYK could act as a rapid-response nutrient sensor to rebalance cellular metabolism. This competition at a single allosteric site between activators and inhibitors provides a novel regulatory mechanism by which M2PYK activity is finely tuned by the relative (but not absolute) concentrations of activator and inhibitor amino acids. Such ‘allostatic’ regulation may be important in metabolic reprogramming and influencing cell fate. PMID:29748232

  5. Inference of hierarchical regulatory network of estrogen-dependent breast cancer through ChIP-based data

    PubMed Central

    2010-01-01

    Background Global profiling of in vivo protein-DNA interactions using ChIP-based technologies has evolved rapidly in recent years. Although many genome-wide studies have identified thousands of ERα binding sites and have revealed the associated transcription factor (TF) partners, such as AP1, FOXA1 and CEBP, little is known about ERα associated hierarchical transcriptional regulatory networks. Results In this study, we applied computational approaches to analyze three public available ChIP-based datasets: ChIP-seq, ChIP-PET and ChIP-chip, and to investigate the hierarchical regulatory network for ERα and ERα partner TFs regulation in estrogen-dependent breast cancer MCF7 cells. 16 common TFs and two common new TF partners (RORA and PITX2) were found among ChIP-seq, ChIP-chip and ChIP-PET datasets. The regulatory networks were constructed by scanning the ChIP-peak region with TF specific position weight matrix (PWM). A permutation test was performed to test the reliability of each connection of the network. We then used DREM software to perform gene ontology function analysis on the common genes. We found that FOS, PITX2, RORA and FOXA1 were involved in the up-regulated genes. We also conducted the ERα and Pol-II ChIP-seq experiments in tamoxifen resistance MCF7 cells (denoted as MCF7-T in this study) and compared the difference between MCF7 and MCF7-T cells. The result showed very little overlap between these two cells in terms of targeted genes (21.2% of common genes) and targeted TFs (25% of common TFs). The significant dissimilarity may indicate totally different transcriptional regulatory mechanisms between these two cancer cells. Conclusions Our study uncovers new estrogen-mediated regulatory networks by mining three ChIP-based data in MCF7 cells and ChIP-seq data in MCF7-T cells. We compared the different ChIP-based technologies as well as different breast cancer cells. Our computational analytical approach may guide biologists to further study the

  6. Antifungal mechanisms supporting boric acid therapy of Candida vaginitis.

    PubMed

    De Seta, Francesco; Schmidt, Martin; Vu, Bao; Essmann, Michael; Larsen, Bryan

    2009-02-01

    Boric acid is a commonly cited treatment for recurrent and resistant yeast vaginitis, but data about the extent and mechanism of its antifungal activity are lacking. The aim of this study was to use in vitro methods to understand the spectrum and mechanism of boric acid as a potential treatment for vaginal infection. Yeast and bacterial isolates were tested by agar dilution to determine the intrinsic antimicrobial activity of boric acid. Established microbial physiology methods illuminated the mechanism of the action of boric acid against Candida albicans. C. albicans strains (including fluconazole-resistant strains) were inhibited at concentrations attainable intravaginally; as were bacteria. Broth dilution MICs were between 1563 and 6250 mg/L and boric acid proved fungistatic (also reflected by a decrease in CO(2) generation); prolonged culture at 50,000 mg/L was fungicidal. Several organic acids in yeast nitrogen broth yielded a lower pH than equimolar boric acid and sodium borate but were less inhibitory. Cold or anaerobic incubation protected yeast at high boric acid concentrations. Cells maintained integrity for 6 h in boric acid at 37 degrees C, but after 24 h modest intrusion of propidium iodide occurred; loss of plate count viability preceded uptake of vital stain. Growth at sub-MIC concentrations of boric acid decreased cellular ergosterol. The drug efflux pump CDR1 did not protect Candida as CDR1 expression was abrogated by boric acid. Boric acid interfered with the development of biofilm and hyphal transformation. Boric acid is fungistatic to fungicidal depending on concentration and temperature. Inhibition of oxidative metabolism appears to be a key antifungal mechanism, but inhibition of virulence probably contributes to therapeutic efficacy in vivo.

  7. S. pombe Uba1-Ubc15 Structure Reveals a Novel Regulatory Mechanism of Ubiquitin E2 Activity.

    PubMed

    Lv, Zongyang; Rickman, Kimberly A; Yuan, Lingmin; Williams, Katelyn; Selvam, Shanmugam Panneer; Woosley, Alec N; Howe, Philip H; Ogretmen, Besim; Smogorzewska, Agata; Olsen, Shaun K

    2017-02-16

    Ubiquitin (Ub) E1 initiates the Ub conjugation cascade by activating and transferring Ub to tens of different E2s. How Ub E1 cooperates with E2s that differ substantially in their predicted E1-interacting residues is unknown. Here, we report the structure of S. pombe Uba1 in complex with Ubc15, a Ub E2 with intrinsically low E1-E2 Ub thioester transfer activity. The structure reveals a distinct Ubc15 binding mode that substantially alters the network of interactions at the E1-E2 interface compared to the only other available Ub E1-E2 structure. Structure-function analysis reveals that the intrinsically low activity of Ubc15 largely results from the presence of an acidic residue at its N-terminal region. Notably, Ub E2 N termini are serine/threonine rich in many other Ub E2s, leading us to hypothesize that phosphorylation of these sites may serve as a novel negative regulatory mechanism of Ub E2 activity, which we demonstrate biochemically and in cell-based assays. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Eicosapentaenoic acid induces DNA demethylation in carcinoma cells through a TET1-dependent mechanism.

    PubMed

    Ceccarelli, Veronica; Valentini, Virginia; Ronchetti, Simona; Cannarile, Lorenza; Billi, Monia; Riccardi, Carlo; Ottini, Laura; Talesa, Vincenzo Nicola; Grignani, Francesco; Vecchini, Alba

    2018-05-14

    In cancer cells, global genomic hypomethylation is found together with localized hypermethylation of CpG islands within the promoters and regulatory regions of silenced tumor suppressor genes. Demethylating agents may reverse hypermethylation, thus promoting gene re-expression. Unfortunately, demethylating strategies are not efficient in solid tumor cells. DNA demethylation is mediated by ten-eleven translocation enzymes (TETs). They sequentially convert 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC), which is associated with active transcription; 5-formylcytosine; and finally, 5-carboxylcytosine. Although α-linolenic acid, eicosapentaenoic acid (EPA), and docosahexaenoic acid, the major n-3 polyunsaturated fatty acids, have anti-cancer effects, their action, as DNA-demethylating agents, has never been investigated in solid tumor cells. Here, we report that EPA demethylates DNA in hepatocarcinoma cells. EPA rapidly increases 5hmC on DNA, inducing p21 Waf1/Cip1 gene expression, which slows cancer cell-cycle progression. We show that the underlying molecular mechanism involves TET1. EPA simultaneously binds peroxisome proliferator-activated receptor γ (PPARγ) and retinoid X receptor α (RXRα), thus promoting their heterodimer and inducing a PPARγ-TET1 interaction. They generate a TET1-PPARγ-RXRα protein complex, which binds to a hypermethylated CpG island on the p21 gene, where TET1 converts 5mC to 5hmC. In an apparent shuttling motion, PPARγ and RXRα leave the DNA, whereas TET1 associates stably. Overall, EPA directly regulates DNA methylation levels, permitting TET1 to exert its anti-tumoral function.-Ceccarelli, V., Valentini, V., Ronchetti, S., Cannarile, L., Billi, M., Riccardi, C., Ottini, L., Talesa, V. N., Grignani, F., Vecchini, A., Eicosapentaenoic acid induces DNA demethylation in carcinoma cells through a TET1-dependent mechanism.

  9. High-risk medical devices, children and the FDA: regulatory challenges facing pediatric mechanical circulatory support devices.

    PubMed

    Almond, Christopher S D; Chen, Eric A; Berman, Michael R; Less, Joanne R; Baldwin, J Timothy; Linde-Feucht, Sarah R; Hoke, Tracey R; Pearson, Gail D; Jenkins, Kathy; Duncan, Brian W; Zuckerman, Bram D

    2007-01-01

    Pediatric mechanical circulatory support is a critical unmet need in the United States. Infant- and child-sized ventricular assist devices are currently being developed largely through federal contracts and grants through the National Heart, Lung, and Blood Institute (NHLBI). Human testing and marketing of high-risk devices for children raises epidemiologic and regulatory issues that will need to be addressed. Leaders from the US Food and Drug Administration (FDA), NHLBI, academic pediatric community, and industry convened in January 2006 for the first FDA Workshop on the Regulatory Process for Pediatric Mechanical Circulatory Support Devices. The purpose was to provide the pediatric community with an overview of the federal regulatory process for high-risk medical devices and to review the challenges specific to the development and regulation of pediatric mechanical circulatory support devices. Pediatric mechanical circulatory support present significant epidemiologic, logistic, and financial challenges to industry, federal regulators, and the pediatric community. Early interactions with the FDA, shared appreciation of challenges, and careful planning will be critical to avoid unnecessary delays in making potentially life-saving devices available for children. Collaborative efforts to address these challenges are warranted.

  10. Multilayer regulatory mechanisms control cleavage factor I proteins in filamentous fungi

    PubMed Central

    Rodríguez-Romero, J.; Franceschetti, M.; Bueno, E.; Sesma, A.

    2015-01-01

    Cleavage factor I (CFI) proteins are core components of the polyadenylation machinery that can regulate several steps of mRNA life cycle, including alternative polyadenylation, splicing, export and decay. Here, we describe the regulatory mechanisms that control two fungal CFI protein classes in Magnaporthe oryzae: Rbp35/CfI25 complex and Hrp1. Using mutational, genetic and biochemical studies we demonstrate that cellular concentration of CFI mRNAs is a limited indicator of their protein abundance. Our results suggest that several post-transcriptional mechanisms regulate Rbp35/CfI25 complex and Hrp1 in the rice blast fungus, some of which are also conserved in other ascomycetes. With respect to Rbp35, these include C-terminal processing, RGG-dependent localization and cleavage, C-terminal autoregulatory domain and regulation by an upstream open reading frame of Rbp35-dependent TOR signalling pathway. Our proteomic analyses suggest that Rbp35 regulates the levels of proteins involved in melanin and phenylpropanoids synthesis, among others. The drastic reduction of fungal CFI proteins in carbon-starved cells suggests that the pre-mRNA processing pathway is altered. Our findings uncover broad and multilayer regulatory mechanisms controlling fungal polyadenylation factors, which have profound implications in pre-mRNA maturation. This area of research offers new avenues for fungicide design by targeting fungal-specific proteins that globally affect thousands of mRNAs. PMID:25514925

  11. An investigation into the mechanisms of drug release from taste-masking fatty acid microspheres.

    PubMed

    Qi, Sheng; Deutsch, David; Craig, Duncan Q M

    2008-09-01

    Fatty acid microspheres based on stearic and palmitic acids are known to form effective taste masking systems, although the mechanisms by which the drug is preferentially released in the lower gastrointestinal tract are not known. The objective of the present study was to identify the mechanisms involved, with a particular view to clarify the role of acid soap formation in the dissolution process. Microspheres were prepared by a spray chilling process. Using benzoic acid as a model drug and an alkaline dissolution medium, a faster drug release was observed in the mixed fatty acid formulation (50:50 stearic:palmitic acid (w/w)) compared to the single fatty acid component systems. Thermal and powder X-ray diffraction studies indicated a greater degree of acid soap formation for the mixed formulation in alkaline media compared to the single fatty acid systems. Particle size and porosity studies indicated a modest reduction in size for the mixed systems and an increase in porosity on immersion in the dissolution medium. It is proposed that the mixed fatty acid system form a mixed crystal system which in turn facilitates interaction with the dissolution medium, thereby leading to a greater propensity for acid soap formation which in turn forms a permeable liquid crystalline phase through which the drug may diffuse. The role of dissolution of palmitic acid into the dissolution medium is also discussed as a secondary mechanism.

  12. Putting Theory to the Test: Which Regulatory Mechanisms Can Drive Realistic Growth of a Root?

    PubMed Central

    De Vos, Dirk; Vissenberg, Kris; Broeckhove, Jan; Beemster, Gerrit T. S.

    2014-01-01

    In recent years there has been a strong development of computational approaches to mechanistically understand organ growth regulation in plants. In this study, simulation methods were used to explore which regulatory mechanisms can lead to realistic output at the cell and whole organ scale and which other possibilities must be discarded as they result in cellular patterns and kinematic characteristics that are not consistent with experimental observations for the Arabidopsis thaliana primary root. To aid in this analysis, a ‘Uniform Longitudinal Strain Rule’ (ULSR) was formulated as a necessary condition for stable, unidirectional, symplastic growth. Our simulations indicate that symplastic structures are robust to differences in longitudinal strain rates along the growth axis only if these differences are small and short-lived. Whereas simple cell-autonomous regulatory rules based on counters and timers can produce stable growth, it was found that steady developmental zones and smooth transitions in cell lengths are not feasible. By introducing spatial cues into growth regulation, those inadequacies could be avoided and experimental data could be faithfully reproduced. Nevertheless, a root growth model based on previous polar auxin-transport mechanisms violates the proposed ULSR due to the presence of lateral gradients. Models with layer-specific regulation or layer-driven growth offer potential solutions. Alternatively, a model representing the known cross-talk between auxin, as the cell proliferation promoting factor, and cytokinin, as the cell differentiation promoting factor, predicts the effect of hormone-perturbations on meristem size. By down-regulating PIN-mediated transport through the transcription factor SHY2, cytokinin effectively flattens the lateral auxin gradient, at the basal boundary of the division zone, (thereby imposing the ULSR) to signal the exit of proliferation and start of elongation. This model exploration underlines the value of

  13. Putting theory to the test: which regulatory mechanisms can drive realistic growth of a root?

    PubMed

    De Vos, Dirk; Vissenberg, Kris; Broeckhove, Jan; Beemster, Gerrit T S

    2014-10-01

    In recent years there has been a strong development of computational approaches to mechanistically understand organ growth regulation in plants. In this study, simulation methods were used to explore which regulatory mechanisms can lead to realistic output at the cell and whole organ scale and which other possibilities must be discarded as they result in cellular patterns and kinematic characteristics that are not consistent with experimental observations for the Arabidopsis thaliana primary root. To aid in this analysis, a 'Uniform Longitudinal Strain Rule' (ULSR) was formulated as a necessary condition for stable, unidirectional, symplastic growth. Our simulations indicate that symplastic structures are robust to differences in longitudinal strain rates along the growth axis only if these differences are small and short-lived. Whereas simple cell-autonomous regulatory rules based on counters and timers can produce stable growth, it was found that steady developmental zones and smooth transitions in cell lengths are not feasible. By introducing spatial cues into growth regulation, those inadequacies could be avoided and experimental data could be faithfully reproduced. Nevertheless, a root growth model based on previous polar auxin-transport mechanisms violates the proposed ULSR due to the presence of lateral gradients. Models with layer-specific regulation or layer-driven growth offer potential solutions. Alternatively, a model representing the known cross-talk between auxin, as the cell proliferation promoting factor, and cytokinin, as the cell differentiation promoting factor, predicts the effect of hormone-perturbations on meristem size. By down-regulating PIN-mediated transport through the transcription factor SHY2, cytokinin effectively flattens the lateral auxin gradient, at the basal boundary of the division zone, (thereby imposing the ULSR) to signal the exit of proliferation and start of elongation. This model exploration underlines the value of

  14. Cinnamic Acid and Its Derivatives: Mechanisms for Prevention and Management of Diabetes and Its Complications.

    PubMed

    Adisakwattana, Sirichai

    2017-02-21

    With recent insight into the development of dietary supplements and functional foods, search of effective phytochemical compounds and their mechanisms involved in prevention and management of diabetes and its complications are now being assessed. Cinnamic acid and its derivatives occur naturally in high levels of plant-based foods. Among various biological activities, cinnamic acid and its derivatives are associated with a beneficial influence on diabetes and its complications. The aim of the review is to summarize the potential mechanisms of these compounds for prevention and management of diabetes and its complications. Based on several in vitro studies and animal models, cinnamic acid and its derivatives act on different mechanism of actions, including stimulation of insulin secretion, improvement of pancreatic β-cell functionality, inhibition of hepatic gluconeogenesis, enhanced glucose uptake, increased insulin signaling pathway, delay of carbohydrate digestion and glucose absorption, and inhibition of protein glycation and insulin fibrillation. However, due to the limited intestinal absorption being a result of low bioavailability of cinnamic acid and its derivatives, current improvement efforts with entrapping into solid and liquid particles are highlighted. Further human clinical studies are needed to clarify the effects of cinnamic acid and its derivatives in diabetic patients.

  15. [Neuronal and hormonal regulatory mechanisms of tears production and secretion].

    PubMed

    Mrugacz, Małgorzata; Zywalewska, Nella; Bakunowicz-Lazarczyk, Alina

    2005-01-01

    The ocular surface, tear film, lacrimal glands act as a functional unit to preserve the quality of the refractive surface of the eye, and to resist injury and protect the eye against bodily and environmental conditions. Homeostasis of this functional unit involves neuronal and hormonal regulatory mechanisms. The eye appears to be a target organ for sex hormones particulary the androgen, as they modulate the immune system and trophic functions of the lacrimal and Meibomian glands.

  16. Interplay of cis- and trans-regulatory mechanisms in the spliceosomal RNA helicase Brr2.

    PubMed

    Absmeier, Eva; Becke, Christian; Wollenhaupt, Jan; Santos, Karine F; Wahl, Markus C

    2017-01-02

    RNA helicase Brr2 is implicated in multiple phases of pre-mRNA splicing and thus requires tight regulation. Brr2 can be auto-inhibited via a large N-terminal region folding back onto its helicase core and auto-activated by a catalytically inactive C-terminal helicase cassette. Furthermore, it can be regulated in trans by the Jab1 domain of the Prp8 protein, which can inhibit Brr2 by intermittently inserting a C-terminal tail in the enzyme's RNA-binding tunnel or activate the helicase after removal of this tail. Presently it is unclear, whether these regulatory mechanisms functionally interact and to which extent they are evolutionarily conserved. Here, we report crystal structures of Saccharomyces cerevisiae and Chaetomium thermophilum Brr2-Jab1 complexes, demonstrating that Jab1-based inhibition of Brr2 presumably takes effect in all eukaryotes but is implemented via organism-specific molecular contacts. Moreover, the structures show that Brr2 auto-inhibition can act in concert with Jab1-mediated inhibition, and suggest that the N-terminal region influences how the Jab1 C-terminal tail interacts at the RNA-binding tunnel. Systematic RNA binding and unwinding studies revealed that the N-terminal region and the Jab1 C-terminal tail specifically interfere with accommodation of double-stranded and single-stranded regions of an RNA substrate, respectively, mutually reinforcing each other. Additionally, such analyses show that regulation based on the N-terminal region requires the presence of the inactive C-terminal helicase cassette. Together, our results outline an intricate system of regulatory mechanisms, which control Brr2 activities during snRNP assembly and splicing.

  17. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks

    PubMed Central

    2018-01-01

    Abstract Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element–target gene pairs (E–G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. PMID:29140525

  18. Redox sensing molecular mechanism of an iron metabolism regulatory protein FBXL5.

    PubMed

    Wei, Yaozhu; Yuan, Hong; Xu, Pengbiao; Tan, Xiangshi

    2017-02-15

    FBXL5 is a subunit of the SCF FBXL5 ubiquitin ligase complex that targets the proteasomal degradation of iron regulatory protein IRP2, which is an important regulator in iron metabolism. The degradation of FBXL5 itself is regulated in an iron- and oxygen-responsive manner through its diiron center containing Hr-like domain. Although the crystal structure of the Hr-like domain of FBXL5 and its degradation based on iron/oxygen sensing has been reported, the redox sensing molecular mechanism is still not clear. Herein the redox properties of FBXL5 were investigated via EPR, direct electrochemistry, SRCD, fluorescence emission spectroscopy, and redox kinetics. The results indicated that the conformation and function of FBXL5 are tuned by the redox states of the diiron center. The redox reactions of the diiron center are accompanied with conformational changes and iron release, which are associated with FBXL5 stability and degradation. These results provide insights into the redox sensing mechanism by which FBXL5 can serve as an iron metabolism regulator within mammalian cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Respiratory Acid-Base Disorders in the Critical Care Unit.

    PubMed

    Hopper, Kate

    2017-03-01

    The incidence of respiratory acid-base abnormalities in the critical care unit (CCU) is unknown, although respiratory alkalosis is suspected to be common in this population. Abnormal carbon dioxide tension can have many physiologic effects, and changes in Pco 2 may have a significant impact on outcome. Monitoring Pco 2 in CCU patients is an important aspect of critical patient assessment, and identification of respiratory acid-base abnormalities can be valuable as a diagnostic tool. Treatment of respiratory acid-base disorders is largely focused on resolution of the primary disease, although mechanical ventilation may be indicated in cases with severe respiratory acidosis. Published by Elsevier Inc.

  20. Regulatory Snapshots: integrative mining of regulatory modules from expression time series and regulatory networks.

    PubMed

    Gonçalves, Joana P; Aires, Ricardo S; Francisco, Alexandre P; Madeira, Sara C

    2012-01-01

    Explaining regulatory mechanisms is crucial to understand complex cellular responses leading to system perturbations. Some strategies reverse engineer regulatory interactions from experimental data, while others identify functional regulatory units (modules) under the assumption that biological systems yield a modular organization. Most modular studies focus on network structure and static properties, ignoring that gene regulation is largely driven by stimulus-response behavior. Expression time series are key to gain insight into dynamics, but have been insufficiently explored by current methods, which often (1) apply generic algorithms unsuited for expression analysis over time, due to inability to maintain the chronology of events or incorporate time dependency; (2) ignore local patterns, abundant in most interesting cases of transcriptional activity; (3) neglect physical binding or lack automatic association of regulators, focusing mainly on expression patterns; or (4) limit the discovery to a predefined number of modules. We propose Regulatory Snapshots, an integrative mining approach to identify regulatory modules over time by combining transcriptional control with response, while overcoming the above challenges. Temporal biclustering is first used to reveal transcriptional modules composed of genes showing coherent expression profiles over time. Personalized ranking is then applied to prioritize prominent regulators targeting the modules at each time point using a network of documented regulatory associations and the expression data. Custom graphics are finally depicted to expose the regulatory activity in a module at consecutive time points (snapshots). Regulatory Snapshots successfully unraveled modules underlying yeast response to heat shock and human epithelial-to-mesenchymal transition, based on regulations documented in the YEASTRACT and JASPAR databases, respectively, and available expression data. Regulatory players involved in functionally enriched

  1. Regulatory Snapshots: Integrative Mining of Regulatory Modules from Expression Time Series and Regulatory Networks

    PubMed Central

    Gonçalves, Joana P.; Aires, Ricardo S.; Francisco, Alexandre P.; Madeira, Sara C.

    2012-01-01

    Explaining regulatory mechanisms is crucial to understand complex cellular responses leading to system perturbations. Some strategies reverse engineer regulatory interactions from experimental data, while others identify functional regulatory units (modules) under the assumption that biological systems yield a modular organization. Most modular studies focus on network structure and static properties, ignoring that gene regulation is largely driven by stimulus-response behavior. Expression time series are key to gain insight into dynamics, but have been insufficiently explored by current methods, which often (1) apply generic algorithms unsuited for expression analysis over time, due to inability to maintain the chronology of events or incorporate time dependency; (2) ignore local patterns, abundant in most interesting cases of transcriptional activity; (3) neglect physical binding or lack automatic association of regulators, focusing mainly on expression patterns; or (4) limit the discovery to a predefined number of modules. We propose Regulatory Snapshots, an integrative mining approach to identify regulatory modules over time by combining transcriptional control with response, while overcoming the above challenges. Temporal biclustering is first used to reveal transcriptional modules composed of genes showing coherent expression profiles over time. Personalized ranking is then applied to prioritize prominent regulators targeting the modules at each time point using a network of documented regulatory associations and the expression data. Custom graphics are finally depicted to expose the regulatory activity in a module at consecutive time points (snapshots). Regulatory Snapshots successfully unraveled modules underlying yeast response to heat shock and human epithelial-to-mesenchymal transition, based on regulations documented in the YEASTRACT and JASPAR databases, respectively, and available expression data. Regulatory players involved in functionally enriched

  2. Acid-Base Homeostasis

    PubMed Central

    Nakhoul, Nazih; Hering-Smith, Kathleen S.

    2015-01-01

    Acid-base homeostasis and pH regulation are critical for both normal physiology and cell metabolism and function. The importance of this regulation is evidenced by a variety of physiologic derangements that occur when plasma pH is either high or low. The kidneys have the predominant role in regulating the systemic bicarbonate concentration and hence, the metabolic component of acid-base balance. This function of the kidneys has two components: reabsorption of virtually all of the filtered HCO3− and production of new bicarbonate to replace that consumed by normal or pathologic acids. This production or generation of new HCO3− is done by net acid excretion. Under normal conditions, approximately one-third to one-half of net acid excretion by the kidneys is in the form of titratable acid. The other one-half to two-thirds is the excretion of ammonium. The capacity to excrete ammonium under conditions of acid loads is quantitatively much greater than the capacity to increase titratable acid. Multiple, often redundant pathways and processes exist to regulate these renal functions. Derangements in acid-base homeostasis, however, are common in clinical medicine and can often be related to the systems involved in acid-base transport in the kidneys. PMID:26597304

  3. Structural and catalytic effects of an invariant purine substitution in the hammerhead ribozyme: implications for the mechanism of acid-base catalysis.

    PubMed

    Schultz, Eric P; Vasquez, Ernesto E; Scott, William G

    2014-09-01

    The hammerhead ribozyme catalyzes RNA cleavage via acid-base catalysis. Whether it does so by general acid-base catalysis, in which the RNA itself donates and abstracts protons in the transition state, as is typically assumed, or by specific acid-base catalysis, in which the RNA plays a structural role and proton transfer is mediated by active-site water molecules, is unknown. Previous biochemical and crystallographic experiments implicate an invariant purine in the active site, G12, as the general base. However, G12 may play a structural role consistent with specific base catalysis. To better understand the role of G12 in the mechanism of hammerhead catalysis, a 2.2 Å resolution crystal structure of a hammerhead ribozyme from Schistosoma mansoni with a purine substituted for G12 in the active site of the ribozyme was obtained. Comparison of this structure (PDB entry 3zd4), in which A12 is substituted for G, with three previously determined structures that now serve as important experimental controls, allows the identification of structural perturbations that are owing to the purine substitution itself. Kinetic measurements for G12 purine-substituted schistosomal hammerheads confirm a previously observed dependence of rate on the pK(a) of the substituted purine; in both cases inosine, which is similar to G in pK(a) and hydrogen-bonding properties, is unexpectedly inactive. Structural comparisons indicate that this may primarily be owing to the lack of the exocyclic 2-amino group in the G12A and G12I substitutions and its structural effect upon both the nucleotide base and phosphate of A9. The latter involves the perturbation of a previously identified and well characterized metal ion-binding site known to be catalytically important in both minimal and full-length hammerhead ribozyme sequences. The results permit it to be suggested that G12 plays an important role in stabilizing the active-site structure. This result, although not inconsistent with the potential

  4. Theoretical Study on Free Fatty Acid Elimination Mechanism for Waste Cooking Oils to Biodiesel over Acid Catalyst.

    PubMed

    Wang, Kai; Zhang, Xiaochao; Zhang, Jilong; Zhang, Zhiqiang; Fan, Caimei; Han, Peide

    2016-05-01

    A theoretical investigation on the esterification mechanism of free fatty acid (FFA) in waste cooking oils (WCOs) has been carried out using DMol(3) module based on the density functional theory (DFT). Three potential pathways of FFA esterification reaction are designed to achieve the formation of fatty acid methyl ester (FAME), and calculated results show that the energy barrier can be efficiently reduced from 88.597kcal/mol to 15.318kcal/mol by acid catalyst. The molar enthalpy changes (ΔrHm°) of designed pathways are negative, indicating that FFA esterification reaction is an exothermic process. The obtained favorable energy pathway is: H(+) firstly activates FFA, then the intermediate combines with methanol to form a tetrahedral structure, and finally, producing FAME after removing a water molecule. The rate-determining step is the combination of the activated FFA with methanol, and the activation energy is about 11.513kcal/mol at 298.15K. Our results should provide basic and reliable theoretical data for further understanding the elimination mechanism of FFA over acid catalyst in the conversion of WCOs to biodiesel products. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Regulatory mechanism of protein metabolic pathway during the differentiation process of chicken male germ cell.

    PubMed

    Li, Dong; Zuo, Qisheng; Lian, Chao; Zhang, Lei; Shi, Qingqing; Zhang, Zhentao; Wang, Yingjie; Ahmed, Mahmoud F; Tang, Beibei; Xiao, Tianrong; Zhang, Yani; Li, Bichun

    2015-08-01

    We explored the regulatory mechanism of protein metabolism during the differentiation process of chicken male germ cells and provide a basis for improving the induction system of embryonic stem cell differentiation to male germ cells in vitro. We sequenced the transcriptome of embryonic stem cells, primordial germ cells, and spermatogonial stem cells with RNA sequencing (RNA-Seq), bioinformatics analysis methods, and detection of the key genes by quantitative reverse transcription PCR (qRT-PCR). Finally, we found 16 amino acid metabolic pathways enriched in the biological metabolism during the differentiation process of embryonic stem cells to primordial germ cells and 15 amino acid metabolic pathways enriched in the differentiation stage of primordial germ cells to spermatogonial stem cells. We found three pathways, arginine-proline metabolic pathway, tyrosine metabolic pathway, and tryptophan metabolic pathway, significantly enriched in the whole differentiation process of embryonic stem cells to spermatogonial stem cells. Moreover, for these three pathways, we screened key genes such as NOS2, ADC, FAH, and IDO. qRT-PCR results showed that the expression trend of these genes were the same to RNA-Seq. Our findings showed that the three pathways and these key genes play an important role in the differentiation process of embryonic stem cells to male germ cells. These results provide basic information for improving the induction system of embryonic stem cell differentiation to male germ cells in vitro.

  6. microRNA regulatory mechanism by which PLLA aligned nanofibers influence PC12 cell differentiation

    NASA Astrophysics Data System (ADS)

    Yu, Yadong; Lü, Xiaoying; Ding, Fei

    2015-08-01

    Objective. Aligned nanofibers (AFs) are regarded as promising biomaterials in nerve tissue engineering. However, a full understanding of the biocompatibility of AFs at the molecular level is still challenging. Therefore, the present study focused on identifying the microRNA (miRNA)-mediated regulatory mechanism by which poly-L-lactic acid (PLLA) AFs influence PC12 cell differentiation. Approach. Firstly, the effects of PLLA random nanofibers (RFs)/AFs and PLLA films (control) on the biological responses of PC12 cells that are associated with neuronal differentiation were examined. Then, SOLiD sequencing and cDNA microarray were employed to profile the expressions of miRNAs and mRNAs. The target genes of the misregulated miRNAs were predicted and compared with the mRNA profile data. Functions of the matched target genes (the intersection between the predicted target genes and the experimentally-determined, misregulated genes) were analyzed. Main results. The results revealed that neurites spread in various directions in control and RF groups. In the AF group, most neurites extended in parallel with each other. The glucose consumption and lactic acid production in the RF and AF groups were higher than those in the control group. Compared with the control group, 42 and 94 miRNAs were significantly dysregulated in the RF and AF groups, respectively. By comparing the predicted target genes with the mRNA profile data, five and 87 matched target genes were found in the RF and AF groups, respectively. Three of the matched target genes in the AF group were found to be associated with neuronal differentiation, whereas none had this association in the RF group. The PLLA AFs induced the dysregulation of miRNAs that regulate many biological functions, including axonal guidance, lipid metabolism and long-term potentiation. In particular, two miRNA-matched target gene-biological function modules associated with neuronal differentiation were identified as follows: (1) miR-23b, mi

  7. Cinnamic Acid and Its Derivatives: Mechanisms for Prevention and Management of Diabetes and Its Complications

    PubMed Central

    Adisakwattana, Sirichai

    2017-01-01

    With recent insight into the development of dietary supplements and functional foods, search of effective phytochemical compounds and their mechanisms involved in prevention and management of diabetes and its complications are now being assessed. Cinnamic acid and its derivatives occur naturally in high levels of plant-based foods. Among various biological activities, cinnamic acid and its derivatives are associated with a beneficial influence on diabetes and its complications. The aim of the review is to summarize the potential mechanisms of these compounds for prevention and management of diabetes and its complications. Based on several in vitro studies and animal models, cinnamic acid and its derivatives act on different mechanism of actions, including stimulation of insulin secretion, improvement of pancreatic β-cell functionality, inhibition of hepatic gluconeogenesis, enhanced glucose uptake, increased insulin signaling pathway, delay of carbohydrate digestion and glucose absorption, and inhibition of protein glycation and insulin fibrillation. However, due to the limited intestinal absorption being a result of low bioavailability of cinnamic acid and its derivatives, current improvement efforts with entrapping into solid and liquid particles are highlighted. Further human clinical studies are needed to clarify the effects of cinnamic acid and its derivatives in diabetic patients. PMID:28230764

  8. A prior-based integrative framework for functional transcriptional regulatory network inference

    PubMed Central

    Siahpirani, Alireza F.

    2017-01-01

    Abstract Transcriptional regulatory networks specify regulatory proteins controlling the context-specific expression levels of genes. Inference of genome-wide regulatory networks is central to understanding gene regulation, but remains an open challenge. Expression-based network inference is among the most popular methods to infer regulatory networks, however, networks inferred from such methods have low overlap with experimentally derived (e.g. ChIP-chip and transcription factor (TF) knockouts) networks. Currently we have a limited understanding of this discrepancy. To address this gap, we first develop a regulatory network inference algorithm, based on probabilistic graphical models, to integrate expression with auxiliary datasets supporting a regulatory edge. Second, we comprehensively analyze our and other state-of-the-art methods on different expression perturbation datasets. Networks inferred by integrating sequence-specific motifs with expression have substantially greater agreement with experimentally derived networks, while remaining more predictive of expression than motif-based networks. Our analysis suggests natural genetic variation as the most informative perturbation for network inference, and, identifies core TFs whose targets are predictable from expression. Multiple reasons make the identification of targets of other TFs difficult, including network architecture and insufficient variation of TF mRNA level. Finally, we demonstrate the utility of our inference algorithm to infer stress-specific regulatory networks and for regulator prioritization. PMID:27794550

  9. Superabsorbent biphasic system based on poly(lactic acid) and poly(acrylic acid)

    NASA Astrophysics Data System (ADS)

    Sartore, Luciana; Pandini, Stefano; Baldi, Francesco; Bignotti, Fabio

    2016-05-01

    In this research work, biocomposites based on crosslinked particles of poly(acrylic acid), commonly used as superabsorbent polymer (SAP), and poly-L-lactic acid (PLLA) were developed to elucidate the role of the filler (i.e., polymeric crosslinked particles) on the overall physico-mechanical behavior and to obtain superabsorbent thermoplastic products. Samples prepared by melt-blending of components in different ratios showed a biphasic system with a regular distribution of particles, with diameter ranging from 5 to 10 μm, within the PLLA polymeric matrix. The polymeric biphasic system, coded PLASA i.e. superabsorbent poly(lactic acid), showed excellent swelling properties, demonstrating that cross-linked particles retain their superabsorbent ability, as in their free counterparts, even if distributed in a thermoplastic polymeric matrix. The thermal characteristics of the biocomposites evidence enhanced thermal stability in comparison with neat PLLA and also mechanical properties are markedly modified by addition of crosslinked particles which induce regular stiffening effect. Furthermore, in aqueous environments the particles swell and are leached from PLLA matrix generating very high porosity. These new open-pore PLLA foams, produced in absence of organic solvents and chemical foaming agents, with good physico-mechanical properties appear very promising for several applications, for instance in tissue engineering for scaffold production.

  10. The glmS Ribozyme Cofactor is a General Acid-Base Catalyst

    PubMed Central

    Viladoms, Julia; Fedor, Martha J.

    2012-01-01

    The glmS ribozyme is the first natural self-cleaving ribozyme known to require a cofactor. The D-glucosamine-6-phosphate (GlcN6P) cofactor has been proposed to serve as a general acid, but its role in the catalytic mechanism has not been established conclusively. We surveyed GlcN6P-like molecules for their ability to support self-cleavage of the glmS ribozyme and found a strong correlation between the pH dependence of the cleavage reaction and the intrinsic acidity of the cofactors. For cofactors with low binding affinities the contribution to rate enhancement was proportional to their intrinsic acidity. This linear free-energy relationship between cofactor efficiency and acid dissociation constants is consistent with a mechanism in which the cofactors participate directly in the reaction as general acid-base catalysts. A high value for the Brønsted coefficient (β ~ 0.7) indicates that a significant amount of proton transfer has already occurred in the transition state. The glmS ribozyme is the first self-cleaving RNA to use an exogenous acid-base catalyst. PMID:23113700

  11. The glmS ribozyme cofactor is a general acid-base catalyst.

    PubMed

    Viladoms, Júlia; Fedor, Martha J

    2012-11-21

    The glmS ribozyme is the first natural self-cleaving ribozyme known to require a cofactor. The d-glucosamine-6-phosphate (GlcN6P) cofactor has been proposed to serve as a general acid, but its role in the catalytic mechanism has not been established conclusively. We surveyed GlcN6P-like molecules for their ability to support self-cleavage of the glmS ribozyme and found a strong correlation between the pH dependence of the cleavage reaction and the intrinsic acidity of the cofactors. For cofactors with low binding affinities, the contribution to rate enhancement was proportional to their intrinsic acidity. This linear free-energy relationship between cofactor efficiency and acid dissociation constants is consistent with a mechanism in which the cofactors participate directly in the reaction as general acid-base catalysts. A high value for the Brønsted coefficient (β ~ 0.7) indicates that a significant amount of proton transfer has already occurred in the transition state. The glmS ribozyme is the first self-cleaving RNA to use an exogenous acid-base catalyst.

  12. The Acid-Base Titration of a Very Weak Acid: Boric Acid

    ERIC Educational Resources Information Center

    Celeste, M.; Azevedo, C.; Cavaleiro, Ana M. V.

    2012-01-01

    A laboratory experiment based on the titration of boric acid with strong base in the presence of d-mannitol is described. Boric acid is a very weak acid and direct titration with NaOH is not possible. An auxiliary reagent that contributes to the release of protons in a known stoichiometry facilitates the acid-base titration. Students obtain the…

  13. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-01-01

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  14. The RNA-mediated, asymmetric ring regulatory mechanism of the transcription termination Rho helicase decrypted by time-resolved nucleotide analog interference probing (trNAIP).

    PubMed

    Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc

    2014-08-01

    Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Timing Embryo Segmentation: Dynamics and Regulatory Mechanisms of the Vertebrate Segmentation Clock

    PubMed Central

    Resende, Tatiana P.; Andrade, Raquel P.; Palmeirim, Isabel

    2014-01-01

    All vertebrate species present a segmented body, easily observed in the vertebrate column and its associated components, which provides a high degree of motility to the adult body and efficient protection of the internal organs. The sequential formation of the segmented precursors of the vertebral column during embryonic development, the somites, is governed by an oscillating genetic network, the somitogenesis molecular clock. Herein, we provide an overview of the molecular clock operating during somite formation and its underlying molecular regulatory mechanisms. Human congenital vertebral malformations have been associated with perturbations in these oscillatory mechanisms. Thus, a better comprehension of the molecular mechanisms regulating somite formation is required in order to fully understand the origin of human skeletal malformations. PMID:24895605

  16. Long Noncoding RNAs: a New Regulatory Code in Metabolic Control

    PubMed Central

    Zhao, Xu-Yun; Lin, Jiandie D.

    2015-01-01

    Long noncoding RNAs (lncRNAs) are emerging as an integral part of the regulatory information encoded in the genome. LncRNAs possess the unique capability to interact with nucleic acids and proteins and exert discrete effects on numerous biological processes. Recent studies have delineated multiple lncRNA pathways that control metabolic tissue development and function. The expansion of the regulatory code that links nutrient and hormonal signals to tissue metabolism gives new insights into the genetic and pathogenic mechanisms underlying metabolic disease. This review discusses lncRNA biology with a focus on its role in the development, signaling, and function of key metabolic tissues. PMID:26410599

  17. Effect of Gallic acid on mechanical and water barrier properties of zein-oleic acid composite films.

    PubMed

    Masamba, Kingsley; Li, Yue; Hategekimana, Joseph; Liu, Fei; Ma, Jianguo; Zhong, Fang

    2016-05-01

    In this study, the effect of gallic acid on mechanical and water barrier properties of zein-oleic acid 0-4 % composite films was investigated. Molecular weight distribution analysis was carried out to confirm gallic acid induced cross linking through change in molecular weight in fraction containing zein proteins. Results revealed that gallic acid treatment increased tensile strength from 17.9 MPa to 26.0 MPa, decreased water vapour permeability from 0.60 (g mm m(-2) h(-1) kPa(-1)) to 0.41 (g mm m(-2) h(-1) kPa(-1)), increased solubility from 6.3 % to 10.2 % and marginally increased elongation at break from 3.7 % to 4.2 % in zein films only. However, gallic acid treatment in zein-oleic composite films did not significantly influence mechanical and water barrier properties and in most instances irrespective of oleic acid concentration, the properties were negatively affected. Results from scanning electron microscopy showed that both gallic acid treated and untreated zein films and composite films containing 3 % oleic acid had a compact and homogeneous structure while those containing 4 % oleic acid had inhomogeneous structure. The findings have demonstrated that gallic acid treatment can significantly improve mechanical and water barrier properties especially in zein films only as opposed to when used in composite films using zein and oleic acid.

  18. The Amino Acid Specificity for Activation of Phenylalanine Hydroxylase Matches the Specificity for Stabilization of Regulatory Domain Dimers

    PubMed Central

    2016-01-01

    Liver phenylalanine hydroxylase is allosterically activated by phenylalanine. The structural changes that accompany activation have not been identified, but recent studies of the effects of phenylalanine on the isolated regulatory domain of the enzyme support a model in which phenylalanine binding promotes regulatory domain dimerization. Such a model predicts that compounds that stabilize the regulatory domain dimer will also activate the enzyme. Nuclear magnetic resonance spectroscopy and analytical ultracentrifugation were used to determine the ability of different amino acids and phenylalanine analogues to stabilize the regulatory domain dimer. The abilities of these compounds to activate the enzyme were analyzed by measuring their effects on the fluorescence change that accompanies activation and on the activity directly. At concentrations of 10–50 mM, d-phenylalanine, l-methionine, l-norleucine, and (S)-2-amino-3-phenyl-1-propanol were able to activate the enzyme to the same extent as 1 mM l-phenylalanine. Lower levels of activation were seen with l-4-aminophenylalanine, l-leucine, l-isoleucine, and 3-phenylpropionate. The ability of these compounds to stabilize the regulatory domain dimer agreed with their ability to activate the enzyme. These results support a model in which allosteric activation of phenylalanine hydroxylase is linked to dimerization of regulatory domains. PMID:26252467

  19. The Legionella pneumophila genome evolved to accommodate multiple regulatory mechanisms controlled by the CsrA-system

    PubMed Central

    Sahr, Tobias; Rusniok, Christophe; Impens, Francis; Oliva, Giulia; Sismeiro, Odile; Coppée, Jean-Yves

    2017-01-01

    The carbon storage regulator protein CsrA regulates cellular processes post-transcriptionally by binding to target-RNAs altering translation efficiency and/or their stability. Here we identified and analyzed the direct targets of CsrA in the human pathogen Legionella pneumophila. Genome wide transcriptome, proteome and RNA co-immunoprecipitation followed by deep sequencing of a wild type and a csrA mutant strain identified 479 RNAs with potential CsrA interaction sites located in the untranslated and/or coding regions of mRNAs or of known non-coding sRNAs. Further analyses revealed that CsrA exhibits a dual regulatory role in virulence as it affects the expression of the regulators FleQ, LqsR, LetE and RpoS but it also directly regulates the timely expression of over 40 Dot/Icm substrates. CsrA controls its own expression and the stringent response through a regulatory feedback loop as evidenced by its binding to RelA-mRNA and links it to quorum sensing and motility. CsrA is a central player in the carbon, amino acid, fatty acid metabolism and energy transfer and directly affects the biosynthesis of cofactors, vitamins and secondary metabolites. We describe the first L. pneumophila riboswitch, a thiamine pyrophosphate riboswitch whose regulatory impact is fine-tuned by CsrA, and identified a unique regulatory mode of CsrA, the active stabilization of RNA anti-terminator conformations inside a coding sequence preventing Rho-dependent termination of the gap operon through transcriptional polarity effects. This allows L. pneumophila to regulate the pentose phosphate pathway and the glycolysis combined or individually although they share genes in a single operon. Thus the L. pneumophila genome has evolved to acclimate at least five different modes of regulation by CsrA giving it a truly unique position in its life cycle. PMID:28212376

  20. Magneto-mechanical detection of nucleic acids and telomerase activity in cancer cells.

    PubMed

    Weizmann, Yossi; Patolsky, Fernando; Lioubashevski, Oleg; Willner, Itamar

    2004-02-04

    The ultra-sensitive magneto-mechanical detection of DNA, single-base-mismatches in nucleic acids, and the assay of telomerase activity are accomplished by monitoring the magnetically induced deflection of a cantilever functionalized with magnetic beads associated with the biosensing interface. The analyzed M13phi DNA hybridized with the nucleic acid-functionalized magnetic beads is replicated in the presence of dNTPs that include biotin-labeled dUTP. The resulting beads are attached to an avidin-coated cantilever, and the modified cantilever is deflected by an external magnetic field. Similarly, telomerization of nucleic acid-modified magnetic beads in the presence of dNTPs, biotin-labeled dUTP, and telomerase from cancer cell extracts and the subsequent association of the magnetic beads to the cantilever surface results in the lever deflection by an external magnetic field. M13phi DNA is sensed with a sensitivity limit of 7.1 x 10(-20) M by the magneto-mechanical detection method.

  1. Mechanisms of volatile production from non-sulfur amino acids by irradiation

    NASA Astrophysics Data System (ADS)

    Ahn, Dong Uk; Lee, Eun Joo; Feng, Xi; Zhang, Wangang; Lee, Ji Hwan; Jo, Cheorun; Nam, Kichang

    2016-02-01

    Non-sulfur amino acid monomers were used to study the mechanisms of volatile production in meat by irradiation. Irradiation not only produced many volatiles but also increased the amounts of volatiles from non-sulfur amino acid monomers. The major reaction mechanisms involved in volatile production from each group of the amino acids by irradiation differ significantly. However, we speculate that the radiolysis of amino acid side chains were the major mechanism. In addition, Strecker degradation, especially the production of aldehydes from aliphatic group amino acids, and deamination, isomerization, decarboxylation, cyclic reaction and dehydrogenation of the initial radiolytic products were also contributed to the production of volatile compounds. Each amino acid monomers produced different odor characteristics, but the intensities of odor from all non-sulfur amino acid groups were very weak. This indicated that the contribution of volatiles produced from non-sulfur amino acids was minor. If the volatile compounds from non-sulfur amino acids, especially aldehydes, interact with other volatiles compounds such as sulfur compounds, however, they can contribute to the off-odor of irradiated meat significantly.

  2. The human disease network in terms of dysfunctional regulatory mechanisms.

    PubMed

    Yang, Jing; Wu, Su-Juan; Dai, Wen-Tao; Li, Yi-Xue; Li, Yuan-Yuan

    2015-10-08

    Elucidation of human disease similarities has emerged as an active research area, which is highly relevant to etiology, disease classification, and drug repositioning. In pioneer studies, disease similarity was commonly estimated according to clinical manifestation. Subsequently, scientists started to investigate disease similarity based on gene-phenotype knowledge, which were inevitably biased to well-studied diseases. In recent years, estimating disease similarity according to transcriptomic behavior significantly enhances the probability of finding novel disease relationships, while the currently available studies usually mine expression data through differential expression analysis that has been considered to have little chance of unraveling dysfunctional regulatory relationships, the causal pathogenesis of diseases. We developed a computational approach to measure human disease similarity based on expression data. Differential coexpression analysis, instead of differential expression analysis, was employed to calculate differential coexpression level of every gene for each disease, which was then summarized to the pathway level. Disease similarity was eventually calculated as the partial correlation coefficients of pathways' differential coexpression values between any two diseases. The significance of disease relationships were evaluated by permutation test. Based on mRNA expression data and a differential coexpression analysis based method, we built a human disease network involving 1326 significant Disease-Disease links among 108 diseases. Compared with disease relationships captured by differential expression analysis based method, our disease links shared known disease genes and drugs more significantly. Some novel disease relationships were discovered, for example, Obesity and cancer, Obesity and Psoriasis, lung adenocarcinoma and S. pneumonia, which had been commonly regarded as unrelated to each other, but recently found to share similar molecular

  3. Folic acid modulates eNOS activity via effects on posttranslational modifications and protein–protein interactions☆

    PubMed Central

    Taylor, Sarah Y.; Dixon, Hannah M.; Yoganayagam, Shobana; Price, Natalie; Lang, Derek

    2013-01-01

    Folic acid enhances endothelial function and improves outcome in primary prevention of cardiovascular disease. The exact intracellular signalling mechanisms involved remain elusive and were therefore the subject of this study. Particular focus was placed on folic acid-induced changes in posttranslational modifications of endothelial nitric oxide synthase (eNOS). Cultured endothelial cells were exposed to folic acid in the absence or presence of phosphatidylinositol-3' kinase/Akt (PI3K/Akt) inhibitors. The phosphorylation status of eNOS was determined via western blotting. The activities of eNOS and PI3K/Akt were evaluated. The interaction of eNOS with caveolin-1, Heat-Shock Protein 90 and calmodulin was studied using co-immunoprecipitation. Intracellular localisation of eNOS was investigated using sucrose gradient centrifugation and confocal microscopy. Folic acid promoted eNOS dephosphorylation at negative regulatory sites, and increased phosphorylation at positive regulatory sites. Modulation of phosphorylation status was concomitant with increased cGMP concentrations, and PI3K/Akt activity. Inhibition of PI3K/Akt revealed specific roles for this kinase pathway in folic acid-mediated eNOS phosphorylation. Regulatory protein and eNOS protein associations were altered in favour of a positive regulatory effect in the absence of bulk changes in intracellular eNOS localisation. Folic acid-mediated eNOS activation involves the modulation of eNOS phosphorylation status at multiple residues and positive changes in important protein–protein interactions. Such intracellular mechanisms may in part explain improvements in clinical vascular outcome following folic acid treatment. PMID:23796957

  4. Regulatory mechanisms for absenteeism in the health sector: a systematic review of strategies and their implementation

    PubMed Central

    Kisakye, Angela N; Tweheyo, Raymond; Ssengooba, Freddie; Pariyo, George W; Rutebemberwa, Elizeus; Kiwanuka, Suzanne N

    2016-01-01

    Background A systematic review was undertaken to identify regulatory mechanisms aimed at mitigating health care worker absenteeism, to describe where and how they have been implemented as well as their possible effects. The goal was to propose potential policy options for managing the problem of absenteeism among human resources for health in low- and middle-income countries. Mechanisms described in this review are at the local workplace and broader national policy level. Methods A comprehensive online search was conducted on EMBASE, CINAHL, PubMed, Google Scholar, Google, and Social Science Citation Index using MEDLINE search terms. Retrieved studies were uploaded onto reference manager and screened by two independent reviewers. Only publications in English were included. Data were extracted and synthesized according to the objectives of the review. Results Twenty six of the 4,975 published articles retrieved were included. All were from high-income countries and covered all cadres of health workers. The regulatory mechanisms and possible effects include 1) organizational-level mechanisms being reported as effective in curbing absenteeism in low- and middle-income countries (LMICs); 2) prohibition of private sector activities in LMICs offering benefits but presenting a challenge for the government to monitor the health workforce; 3) contractual changes from temporary to fixed posts having been associated with no reduction in absenteeism and not being appropriate for LMICs; 4) multifaceted work interventions being implemented in most settings; 5) the possibility of using financial and incentive regulatory mechanisms in LMICs; 6) health intervention mechanisms reducing absenteeism when integrated with exercise programs; and 7) attendance by legislation during emergencies being criticized for violating human rights in the United States and not being effective in curbing absenteeism. Conclusion Most countries have applied multiple strategies to mitigate health care

  5. Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers

    PubMed Central

    Kwan, Hiu Yee; Niu, Xuyan; Dai, Wenlin; Tong, Tiejun; Chao, Xiaojuan; Su, Tao; Chan, Chi Leung; Lee, Kim Chung; Fu, Xiuqiong; Yi, Hua; Yu, Hua; Li, Ting; Tse, Anfernee Kai Wing; Fong, Wang Fun; Pan, Si-Yuan; Lu, Aiping; Yu, Zhi-Ling

    2015-01-01

    Schisandrin B (SchB) is one of the most abundant bioactive dibenzocyclooctadiene derivatives found in the fruit of Schisandra chinensis. Here, we investigated the potential therapeutic effects of SchB on non-alcoholic fatty-liver disease (NAFLD). In lipidomic study, ingenuity pathway analysis highlighted palmitate biosynthesis metabolic pathway in the liver samples of SchB-treated high-fat-diet-fed mice. Further experiments showed that the SchB treatment reduced expression and activity of fatty acid synthase, expressions of hepatic mature sterol regulatory element binding protein-1 and tumor necrosis factor-α, and hepatic level of palmitic acid which is known to promote progression of steatosis to steatohepatitis. Furthermore, the treatment also reduced hepatic fibrosis, activated nuclear factor-erythroid-2-related factor-2 which is known to attenuate the progression of NASH-related fibrosis. Interestingly, in fasting mice, a single high-dose SchB induced transient lipolysis and increased the expressions of adipose triglyceride lipase and phospho-hormone sensitive lipase. The treatment also increased plasma cholesterol levels and 3-hydroxy-3-methylglutaryl-CoA reductase activity, reduced the hepatic low-density-lipoprotein receptor expression in these mice. Our data not only suggest SchB is a potential therapeutic agent for NAFLD, but also provided important information for a safe consumption of SchB because SchB overdosed under fasting condition will have adverse effects on lipid metabolism. PMID:25766252

  6. Electrolyte and Acid-Base Disturbances in End-Stage Liver Disease: A Physiopathological Approach.

    PubMed

    Jiménez, José Víctor; Carrillo-Pérez, Diego Luis; Rosado-Canto, Rodrigo; García-Juárez, Ignacio; Torre, Aldo; Kershenobich, David; Carrillo-Maravilla, Eduardo

    2017-08-01

    Electrolyte and acid-base disturbances are frequent in patients with end-stage liver disease; the underlying physiopathological mechanisms are often complex and represent a diagnostic and therapeutic challenge to the physician. Usually, these disorders do not develop in compensated cirrhotic patients, but with the onset of the classic complications of cirrhosis such as ascites, renal failure, spontaneous bacterial peritonitis and variceal bleeding, multiple electrolyte, and acid-base disturbances emerge. Hyponatremia parallels ascites formation and is a well-known trigger of hepatic encephalopathy; its management in this particular population poses a risky challenge due to the high susceptibility of cirrhotic patients to osmotic demyelination. Hypokalemia is common in the setting of cirrhosis: multiple potassium wasting mechanisms both inherent to the disease and resulting from its management make these patients particularly susceptible to potassium depletion even in the setting of normokalemia. Acid-base disturbances range from classical respiratory alkalosis to high anion gap metabolic acidosis, almost comprising the full acid-base spectrum. Because most electrolyte and acid-base disturbances are managed in terms of their underlying trigger factors, a systematic physiopathological approach to their diagnosis and treatment is required.

  7. Photochemistry of nucleic acid bases and their thio- and aza-analogues in solution.

    PubMed

    Pollum, Marvin; Martínez-Fernández, Lara; Crespo-Hernández, Carlos E

    2015-01-01

    The steady-state and time-resolved photochemistry of the natural nucleic acid bases and their sulfur- and nitrogen-substituted analogues in solution is reviewed. Emphasis is given to the experimental studies performed over the last 3-5 years that showcase topical areas of scientific inquiry and those that require further scrutiny. Significant progress has been made toward mapping the radiative and nonradiative decay pathways of nucleic acid bases. There is a consensus that ultrafast internal conversion to the ground state is the primary relaxation pathway in the nucleic acid bases, whereas the mechanism of this relaxation and the level of participation of the (1)πσ*, (1) nπ*, and (3)ππ* states are still matters of debate. Although impressive research has been performed in recent years, the microscopic mechanism(s) by which the nucleic acid bases dissipate excess vibrational energy to their environment, and the role of the N-glycosidic group in this and in other nonradiative decay pathways, are still poorly understood. The simple replacement of a single atom in a nucleobase with a sulfur or nitrogen atom severely restricts access to the conical intersections responsible for the intrinsic internal conversion pathways to the ground state in the nucleic acid bases. It also enhances access to ultrafast and efficient inter-system crossing pathways that populate the triplet manifold in yields close to unity. Determining the coupled nuclear and electronic pathways responsible for the significantly different photochemistry in these nucleic acid base analogues serves as a convenient platform to examine the current state of knowledge regarding the photodynamic properties of the DNA and RNA bases from both experimental and computational perspectives. Further investigations should also aid in forecasting the prospective use of sulfur- and nitrogen-substituted base analogues in photochemotherapeutic applications.

  8. Acid-base treated vermiculite as high performance adsorbent: Insights into the mechanism of cationic dyes adsorption, regeneration, recyclability and stability studies.

    PubMed

    Stawiński, Wojciech; Węgrzyn, Agnieszka; Dańko, Tomasz; Freitas, Olga; Figueiredo, Sónia; Chmielarz, Lucjan

    2017-04-01

    Additional treatment with NaOH of acid activated vermiculite results in even higher increase in the adsorption capacity in comparison to samples modified only in acidic solution (first step of activation) with respect to raw material. Optimization of treatment conditions and adsorption capacity for two cationic dyes (methylene blue (MB) and astrazon red (AR)), also as binary mixture, was evaluated. The capacity, based on column studies, increased from 48 ± 2 to 203 ± 4 mg g -1 in the case of methylene blue and from 51 ± 1 to 127 ± 2 mg g -1 in the case of astrazon red on starting and acid-base treated material, respectively. It was shown that adsorption mechanism changes for both cationic dyes after NaOH treatment and it results in decrease of adsorption rate. In binary mixtures methylene blue is bound stronger by adsorbent and astrazon red may be removed in initial stage of adsorption. Extensive studies on desorption/regeneration process proved high efficiency in recyclable use of all materials. Although cation exchange capacity decreases due to acid treatment, after base treatment exchange properties are used more efficiently. On the other hand, increased specific surface area has less significant contribution into the adsorption potential of studied materials. Obtained adsorbents worked efficiently in 7 adsorption-regeneration cycles and loss of adsorption capacity was observed only in two first cycles. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Combined metabolomic and correlation networks analyses reveal fumarase insufficiency altered amino acid metabolism.

    PubMed

    Hou, Entai; Li, Xian; Liu, Zerong; Zhang, Fuchang; Tian, Zhongmin

    2018-04-01

    Fumarase catalyzes the interconversion of fumarate and l-malate in the tricarboxylic acid cycle. Fumarase insufficiencies were associated with increased levels of fumarate, decreased levels of malate and exacerbated salt-induced hypertension. To gain insights into the metabolism profiles induced by fumarase insufficiency and identify key regulatory metabolites, we applied a GC-MS based metabolomics platform coupled with a network approach to analyze fumarase insufficient human umbilical vein endothelial cells (HUVEC) and negative controls. A total of 24 altered metabolites involved in seven metabolic pathways were identified as significantly altered, and enriched for the biological module of amino acids metabolism. In addition, Pearson correlation network analysis revealed that fumaric acid, l-malic acid, l-aspartic acid, glycine and l-glutamic acid were hub metabolites according to Pagerank based on their three centrality indices. Alanine aminotransferase and glutamate dehydrogenase activities increased significantly in fumarase deficiency HUVEC. These results confirmed that fumarase insufficiency altered amino acid metabolism. The combination of metabolomics and network methods would provide another perspective on expounding the molecular mechanism at metabolomics level. Copyright © 2017 John Wiley & Sons, Ltd.

  10. Mechanism of ascorbic acid interference in biochemical tests that use peroxide and peroxidase to generate chromophore.

    PubMed

    Martinello, Flávia; Luiz da Silva, Edson

    2006-11-01

    Ascorbic acid interferes negatively in peroxidase-based tests (Trinder method). However, the precise mechanism remains unclear for tests that use peroxide, a phenolic compound and 4-aminophenazone (4-AP). We determined the chemical mechanism of this interference, by examining the effects of ascorbic acid in the reaction kinetics of the production and reduction of the oxidized chromophore in urate, cholesterol, triglyceride and glucose tests. Reaction of ascorbic acid with the Trinder method constituents was also verified. Ascorbic acid interfered stoichiometrically with all tests studied. However, it had two distinct effects on the reaction rate. In the urate test, ascorbic acid decreased the chromophore formation with no change in its production kinetics. In contrast, in cholesterol, triglyceride and glucose tests, an increase in the lag phase of color development occurred. Of all the Trinder constituents, only peroxide reverted the interference. In addition, ascorbic acid did not interfere with oxidase activity nor reduce significantly the chromophore formed. Peroxide depletion was the predominant chemical mechanism of ascorbic acid interference in the Trinder method with phenolics and 4-AP. Distinctive effects of ascorbic acid on the reaction kinetics of urate, cholesterol, glucose and triglyceride might be due to the rate of peroxide production by oxidases.

  11. Omega-3 fatty acids and non-alcoholic fatty liver disease: Evidence of efficacy and mechanism of action.

    PubMed

    Scorletti, Eleonora; Byrne, Christopher D

    2018-03-22

    For many years it has been known that high doses of long chain omega-3 fatty acids are beneficial in the treatment of hypertriglyceridaemia. Over the last three decades, there has also been a wealth of in vitro and in vivo data that has accumulated to suggest that long chain omega-3 fatty acid treatment might be beneficial to decrease liver triacylglycerol. Several biological mechanisms have been identified that support this hypothesis; notably, it has been shown that long chain omega-3 fatty acids have a beneficial effect: a) on bioactive metabolites involved in inflammatory pathways, and b) on alteration of nuclear transcription factor activities such as peroxisome proliferator-activated receptors (PPARs), sterol regulatory element-binding protein 1c (SREBP-1c) and carbohydrate-responsive element-binding protein (ChREBP), involved in inflammatory pathways and liver lipid metabolism. Since the pathogenesis of non alcoholic fatty liver disease (NAFLD) begins with the accumulation of liver lipid and progresses with inflammation and then several years later with development of fibrosis; it has been thought in patients with NAFLD omega-3 fatty acid treatment would be beneficial in treating liver lipid and possibly also in ameliorating inflammation. Meta-analyses (of predominantly dietary studies and small trials) have tended to support the assertion that omega-3 fatty acids are beneficial in decreasing liver lipid, but recent randomised controlled trials have produced conflicting data. These trials have suggested that omega-3 fatty acid might be beneficial in decreasing liver triglyceride (docosahexanoic acid also possibly being more effective than eicosapentanoic acid) but not in decreasing other features of steatohepatitis (or liver fibrosis). The purpose of this review is to discuss recent evidence regarding biological mechanisms by which long chain omega-3 fatty acids might act to ameliorate liver disease in NAFLD; to consider the recent evidence from randomised

  12. A conserved regulatory mechanism in bifunctional biotin protein ligases.

    PubMed

    Wang, Jingheng; Beckett, Dorothy

    2017-08-01

    Class II bifunctional biotin protein ligases (BirA), which catalyze post-translational biotinylation and repress transcription initiation, are broadly distributed in eubacteria and archaea. However, it is unclear if these proteins all share the same molecular mechanism of transcription regulation. In Escherichia coli the corepressor biotinoyl-5'-AMP (bio-5'-AMP), which is also the intermediate in biotin transfer, promotes operator binding and resulting transcription repression by enhancing BirA dimerization. Like E. coli BirA (EcBirA), Staphylococcus aureus, and Bacillus subtilis BirA (Sa and BsBirA) repress transcription in vivo in a biotin-dependent manner. In this work, sedimentation equilibrium measurements were performed to investigate the molecular basis of this biotin-responsive transcription regulation. The results reveal that, as observed for EcBirA, Sa, and BsBirA dimerization reactions are significantly enhanced by bio-5'-AMP binding. Thus, the molecular mechanism of the Biotin Regulatory System is conserved in the biotin repressors from these three organisms. © 2017 The Protein Society.

  13. MicroRNA-31 negatively regulates peripherally derived regulatory T-cell generation by repressing retinoic acid-inducible protein 3

    PubMed Central

    Zhang, Lingyun; Ke, Fang; Liu, Zhaoyuan; Bai, Jing; Liu, Jinlin; Yan, Sha; Xu, Zhenyao; Lou, Fangzhou; Wang, Hong; Zhu, Huiyuan; Sun, Yang; Cai, Wei; Gao, Yuanyuan; Li, Qun; Yu, Xue-Zhong; Qian, Youcun; Hua, Zichun; Deng, Jiong; Li, Qi-Jing; Wang, Honglin

    2015-01-01

    Peripherally derived regulatory T (pTreg) cell generation requires T-cell receptor (TCR) signalling and the cytokines TGF-β1 and IL-2. Here we show that TCR signalling induces the microRNA miR-31, which negatively regulates pTreg-cell generation. miR-31 conditional deletion results in enhanced induction of pTreg cells, and decreased severity of experimental autoimmune encephalomyelitis (EAE). Unexpectedly, we identify Gprc5a as a direct target of miR-31. Gprc5a is known as retinoic acid-inducible protein 3, and its deficiency leads to impaired pTreg-cell induction and increased EAE severity. By generating miR-31 and Gprc5a double knockout mice, we show that miR-31 promotes the development of EAE through inhibiting Gprc5a. Thus, our data identify miR-31 and its target Gprc5a as critical regulators for pTreg-cell generation, suggesting a previously unrecognized epigenetic mechanism for dysfunctional Treg cells in autoimmune diseases. PMID:26165721

  14. Osmotic Engine: Translating Osmotic Pressure into Macroscopic Mechanical Force via Poly(Acrylic Acid) Based Hydrogels

    PubMed Central

    Arens, Lukas; Weißenfeld, Felix; Klein, Christopher O.; Schlag, Karin

    2017-01-01

    Poly(acrylic acid)‐based hydrogels can swell up to 100–1000 times their own weight in desalinated water due to osmotic forces. As the swelling is about a factor of 2–12 lower in seawater‐like saline solutions (4.3 wt% NaCl) than in deionized water, cyclic swelling, and shrinking can potentially be used to move a piston in an osmotic motor. Consequently, chemical energy is translated into mechanical energy. This conversion is driven by differences in chemical potential and by changes in entropy. This is special, as most thermodynamic engines rely instead on the conversion of heat into mechanical energy. To optimize the efficiency of this process, the degree of neutralization, the degree of crosslinking, and the particle size of the hydrogels are varied. Additionally, different osmotic engine prototypes are constructed. The maximum mean power of 0.23 W kg−1 dry hydrogel is found by using an external load of 6 kPa, a polymer with 1.7 mol% crosslinking, a degree of neutralization of 10 mol%, and a particle size of 370–670 µm. As this is achieved only in the first round of optimization, higher values of the maximum power average over one cycle seem realistic. PMID:28932675

  15. A Sensitive Gel-based Method Combining Distinct Cyclophellitol-based Probes for the Identification of Acid/Base Residues in Human Retaining β-Glucosidases*

    PubMed Central

    Kallemeijn, Wouter W.; Witte, Martin D.; Voorn-Brouwer, Tineke M.; Walvoort, Marthe T. C.; Li, Kah-Yee; Codée, Jeroen D. C.; van der Marel, Gijsbert A.; Boot, Rolf G.; Overkleeft, Herman S.; Aerts, Johannes M. F. G.

    2014-01-01

    Retaining β-exoglucosidases operate by a mechanism in which the key amino acids driving the glycosidic bond hydrolysis act as catalytic acid/base and nucleophile. Recently we designed two distinct classes of fluorescent cyclophellitol-type activity-based probes (ABPs) that exploit this mechanism to covalently modify the nucleophile of retaining β-glucosidases. Whereas β-epoxide ABPs require a protonated acid/base for irreversible inhibition of retaining β-glucosidases, β-aziridine ABPs do not. Here we describe a novel sensitive method to identify both catalytic residues of retaining β-glucosidases by the combined use of cyclophellitol β-epoxide- and β-aziridine ABPs. In this approach putative catalytic residues are first substituted to noncarboxylic amino acids such as glycine or glutamine through site-directed mutagenesis. Next, the acid/base and nucleophile can be identified via classical sodium azide-mediated rescue of mutants thereof. Selective labeling with fluorescent β-aziridine but not β-epoxide ABPs identifies the acid/base residue in mutagenized enzyme, as only the β-aziridine ABP can bind in its absence. The Absence of the nucleophile abolishes any ABP labeling. We validated the method by using the retaining β-glucosidase GBA (CAZy glycosylhydrolase family GH30) and then applied it to non-homologous (putative) retaining β-glucosidases categorized in GH1 and GH116: GBA2, GBA3, and LPH. The described method is highly sensitive, requiring only femtomoles (nanograms) of ABP-labeled enzymes. PMID:25344605

  16. Tissue expression analysis, cloning and characterization of the 5'-regulatory region of the bovine FABP3 gene.

    PubMed

    Li, Anning; Wu, Lijuan; Wang, Xiaoyu; Xin, Yaping; Zan, Linsen

    2016-09-01

    Fatty acid binding protein 3 (FABP3) is a member of the FABP family which bind fatty acids and have an important role in fatty acid metabolism. A large number of studies have shown that the genetic polymorphisms of FABP3 are positively correlated with intramuscular fat (IMF) content in domestic animals, however, the function and transcriptional characteristics of FABP3 in cattle remain unclear. Real-time PCR analysis revealed that bovine FABP3 was highly expressed in cardiac tissue. The 5'-regulatory region of bovine FABP3 was cloned and its transcription initiation sites were identified. Sequence analysis showed that many transcriptional factor binding sites including TATA-box and CCAAT-box were present on the 5'-flanking region of bovine FABP3, and four CpG islands were found on nucleotides from -891 to +118. Seven serial deletion constructs of the 5'-regulatory region evaluated in dual-luciferase reporter assay indicated that its core promoter was 384 base pairs upstream from the transcription initiation site. The transcriptional factor binding sites RXRα, KLF15, CREB and Sp1 were conserved in the core promoter of cattle, sheep, pigs and dogs. These results provide further understanding of the function and regulation mechanism of bovine FABP3.

  17. The regulatory sciences for stem cell-based medicinal products.

    PubMed

    Yuan, Bao-Zhu; Wang, Junzhi

    2014-06-01

    Over the past few years, several new achievements have been made from stem cell studies, many of which have moved up from preclinical stages to early, or from early to middle or late, stages thanks to relatively safe profile and preliminary evidence of effectiveness. Moreover, some stem cell-based products have been approved for marketing by different national regulatory authorities. However, many critical issues associated mainly with incomplete understanding of stem cell biology and the relevant risk factors, and lack of effective regulations still exist and need to be urgently addressed, especially in countries where establishment of appropriate regulatory system just commenced. More relevantly, the stem cell regulatory sciences need to be established or improved to more effectively evaluate quality, safety and efficacy of stem cell products, and for building up the appropriate regulatory framework. In this review, we summarize some new achievements in stem cell studies, especially the preclinical and clinical studies, the existing regulations, and the associated challenges, and we then propose some considerations for improving stem cell regulatory sciences with a goal of promoting the steadfast growth of the well-regulated stem cell therapies abreast of evolvement of stem cell sciences and technologies.

  18. Adsorption mechanisms for fatty acids on DLC and steel studied by AFM and tribological experiments

    NASA Astrophysics Data System (ADS)

    Simič, R.; Kalin, M.

    2013-10-01

    Fatty acids are known to affect the friction and wear of steel contacts via adsorption onto the surface, which is one of the fundamental boundary-lubrication mechanisms. The understanding of the lubrication mechanisms of polar molecules on diamond-like carbon (DLC) is, however, still insufficient. In this work we aimed to find out whether such molecules have a similar effect on DLC coatings as they do on steel. The adsorption of hexadecanoic acid in various concentrations (2-20 mmol/l) on DLC was studied under static conditions using an atomic force microscope (AFM). The amount of surface coverage of the adsorbed fatty-acid molecules was analysed. In addition, tribological tests were performed to correlate the wear and friction behaviours in tribological contacts with the adsorption of molecules on the surface under static conditions. A good correlation between the AFM results and the tribological behaviour was observed. We confirmed that fatty acids can adsorb onto the DLC surfaces and are, therefore, potential boundary-lubrication agents for DLC coatings. The adsorption of the fatty acid onto the DLC surfaces reduces the wear of the coatings, but it is less effective in reducing the friction. Tentative adsorption mechanisms that include an environmental species effect, a temperature effect and a tribochemical effect are proposed for DLC and steel surfaces based on our results and few potential mechanisms found in literature.

  19. Feast/famine regulatory proteins (FFRPs): Escherichia coli Lrp, AsnC and related archaeal transcription factors.

    PubMed

    Yokoyama, Katsushi; Ishijima, Sanae A; Clowney, Lester; Koike, Hideaki; Aramaki, Hironori; Tanaka, Chikako; Makino, Kozo; Suzuki, Masashi

    2006-01-01

    Feast/famine regulatory proteins comprise a diverse family of transcription factors, which have been referred to in various individual identifications, including Escherichia coli leucine-responsive regulatory protein and asparagine synthase C gene product. A full length feast/famine regulatory protein consists of the N-terminal DNA-binding domain and the C-domain, which is involved in dimerization and further assembly, thereby producing, for example, a disc or a chromatin-like cylinder. Various ligands of the size of amino acids bind at the interface between feast/famine regulatory protein dimers, thereby altering their assembly forms. Also, the combination of feast/famine regulatory protein subunits forming the same assembly is altered. In this way, a small number of feast/famine regulatory proteins are able to regulate a large number of genes in response to various environmental changes. Because feast/famine regulatory proteins are shared by archaea and eubacteria, the genome-wide regulation by feast/famine regulatory proteins is traceable back to their common ancestor, being the prototype of highly differentiated transcription regulatory mechanisms found in organisms nowadays.

  20. The in Silico Insight into Carbon Nanotube and Nucleic Acid Bases Interaction.

    PubMed

    Karimi, Ali Asghar; Ghalandari, Behafarid; Tabatabaie, Seyed Saleh; Farhadi, Mohammad

    2016-05-01

    To explore practical applications of carbon nanotubes (CNTs) in biomedical fields the properties of their interaction with biomolecules must be revealed. Recent years, the interaction of CNTs with biomolecules is a subject of research interest for practical applications so that previous research explored that CNTs have complementary structure properties with single strand DNA (ssDNA). Hence, the quantum mechanics (QM) method based on ab initio was used for this purpose. Therefore values of binding energy, charge distribution, electronic energy and other physical properties of interaction were studied for interaction of nucleic acid bases and SCNT. In this study, the interaction between nucleic acid bases and a (4, 4) single-walled carbon nanotube (SCNT) were investigated through calculations within quantum mechanics (QM) method at theoretical level of Hartree-Fock (HF) method using 6-31G basis set. Hence, the physical properties such as electronic energy, total dipole moment, charge distributions and binding energy of nucleic acid bases interaction with SCNT were investigated based on HF method. It has been found that the guanine base adsorption is bound stronger to the outer surface of nanotube in comparison to the other bases, consistent with the recent theoretical studies. In the other words, the results explored that guanine interaction with SCNT has optimum level of electronic energy so that their interaction is stable. Also, the calculations illustrated that SCNT interact to nucleic acid bases by noncovalent interaction because of charge distribution an electrostatic area is created in place of interaction. Consequently, small diameter SCNT interaction with nucleic acid bases is noncovalent. Also, the results revealed that small diameter SCNT interaction especially SCNT (4, 4) with nucleic acid bases can be useful in practical application area of biomedical fields such detection and drug delivery.

  1. New insights into the molecular mechanism of intestinal fatty acid absorption

    PubMed Central

    Wang, Tony Y.; Liu, Min; Portincasa, Piero; Wang, David Q.-H.

    2013-01-01

    Background Dietary fat is the most important energy source of all the nutrients. Fatty acids, stored as triacylglycerols in the body, are an important reservoir of stored energy and derive primarily from animal fats and vegetable oils. Design Although the molecular mechanisms for the transport of water-insoluble amphipathic fatty acids across cell membranes have been debated for many years, it is now believed that the dominant means for intestinal fatty acid uptake is via membrane-associated fatty acid-binding proteins, i.e., fatty acid transporters on the apical membrane of enterocytes. Results These findings indicate that intestinal fatty acid absorption is a multistep process that is regulated by multiple genes at the enterocyte level, and intestinal fatty acid absorption efficiency could be determined by factors influencing intraluminal fatty acid molecules across the brush border membrane of enterocytes. To facilitate research on intestinal, hepatic and plasma triacylglycerol metabolism, it is imperative to establish standard protocols for precisely and accurately measuring the efficiency of intestinal fatty acid absorption in humans and animal models. In this review, we will discuss the chemical structure and nomenclature of fatty acids and summarize recent progress in investigating the molecular mechanisms underlying the intestinal absorption of fatty acids, with a particular emphasis on the physical-chemistry of intestinal lipids and the molecular physiology of intestinal fatty acid transporters. Conclusions A better understanding of the molecular mechanism of intestinal fatty acid absorption should lead to novel approaches to the treatment and the prevention of fatty acid-related metabolic diseases that are prevalent worldwide. PMID:24102389

  2. Sulfenic acid chemistry, detection and cellular lifetime☆

    PubMed Central

    Gupta, Vinayak; Carroll, Kate S.

    2014-01-01

    Background Reactive oxygen species-mediated cysteine sulfenic acid modification has emerged as an important regulatory mechanism in cell signaling. The stability of sulfenic acid in proteins is dictated by the local microenvironment and ability of antioxidants to reduce this modification. Several techniques for detecting this cysteine modification have been developed, including direct and in situ methods. Scope of review This review presents a historical discussion of sulfenic acid chemistry and highlights key examples of this modification in proteins. A comprehensive survey of available detection techniques with advantages and limitations is discussed. Finally, issues pertaining to rates of sulfenic acid formation, reduction, and chemical trapping methods are also covered. Major conclusions Early chemical models of sulfenic acid yielded important insights into the unique reactivity of this species. Subsequent pioneering studies led to the characterization of sulfenic acid formation in proteins. In parallel, the discovery of oxidant-mediated cell signaling pathways and pathological oxidative stress has led to significant interest in methods to detect these modifications. Advanced methods allow for direct chemical trapping of protein sulfenic acids directly in cells and tissues. At the same time, many sulfenic acids are short-lived and the reactivity of current probes must be improved to sample these species, while at the same time, preserving their chemical selectivity. Inhibitors with binding scaffolds can be rationally designed to target sulfenic acid modifications in specific proteins. General significance Ever increasing roles for protein sulfenic acids have been uncovered in physiology and pathology. A more complete understanding of sulfenic acid-mediated regulatory mechanisms will continue to require rigorous and new chemical insights. This article is part of a Special Issue entitled Current methods to study reactive oxygen species - pros and cons and

  3. Biodegradable Photo-Crosslinked Thin Polymer Networks Based on Vegetable Oil Hydroxyfatty Acids

    USDA-ARS?s Scientific Manuscript database

    Novel crosslinked thin polymer networks based on vegetable oil hydroxyfatty acids (HFAs) were prepared by UV photopolymerization and their mechanical properties were evaluated. Two raw materials, castor oil and 7,10-dihydroxy-8(E)-octadecenoic acid (DOD) were used as sources of mono- and di-HFAs, r...

  4. Soluble adenylyl cyclase is an acid-base sensor in epithelial base-secreting cells.

    PubMed

    Roa, Jinae N; Tresguerres, Martin

    2016-08-01

    Blood acid-base regulation by specialized epithelia, such as gills and kidney, requires the ability to sense blood acid-base status. Here, we developed primary cultures of ray (Urolophus halleri) gill cells to study mechanisms for acid-base sensing without the interference of whole animal hormonal regulation. Ray gills have abundant base-secreting cells, identified by their noticeable expression of vacuolar-type H(+)-ATPase (VHA), and also express the evolutionarily conserved acid-base sensor soluble adenylyl cyclase (sAC). Exposure of cultured cells to extracellular alkalosis (pH 8.0, 40 mM HCO3 (-)) triggered VHA translocation to the cell membrane, similar to previous reports in live animals experiencing blood alkalosis. VHA translocation was dependent on sAC, as it was blocked by the sAC-specific inhibitor KH7. Ray gill base-secreting cells also express transmembrane adenylyl cyclases (tmACs); however, tmAC inhibition by 2',5'-dideoxyadenosine did not prevent alkalosis-dependent VHA translocation, and tmAC activation by forskolin reduced the abundance of VHA at the cell membrane. This study demonstrates that sAC is a necessary and sufficient sensor of extracellular alkalosis in ray gill base-secreting cells. In addition, this study indicates that different sources of cAMP differentially modulate cell biology. Copyright © 2016 the American Physiological Society.

  5. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk

    PubMed Central

    Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems. PMID:25694852

  6. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk.

    PubMed

    McCraty, Rollin; Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems.

  7. Retinoic Acid Signaling Affects Cortical Synchrony During Sleep

    NASA Astrophysics Data System (ADS)

    Maret, Stéphanie; Franken, Paul; Dauvilliers, Yves; Ghyselinck, Norbert B.; Chambon, Pierre; Tafti, Mehdi

    2005-10-01

    Delta oscillations, characteristic of the electroencephalogram (EEG) of slow wave sleep, estimate sleep depth and need and are thought to be closely linked to the recovery function of sleep. The cellular mechanisms underlying the generation of delta waves at the cortical and thalamic levels are well documented, but the molecular regulatory mechanisms remain elusive. Here we demonstrate in the mouse that the gene encoding the retinoic acid receptor beta determines the contribution of delta oscillations to the sleep EEG. Thus, retinoic acid signaling, which is involved in the patterning of the brain and dopaminergic pathways, regulates cortical synchrony in the adult.

  8. On the acid-base properties of humic acid in soil.

    PubMed

    Cooke, James D; Hamilton-Taylor, John; Tipping, Edward

    2007-01-15

    Humic acid was isolated from three contrasting organic-rich soils and acid-base titrations performed over a range of ionic strengths. Results obtained were unlike most humic acid data sets; they showed a greater ionic strength dependency at low pH than at high pH. Forward- and back-titrations with the base and acid revealed hysteresis, particularly at low pH. Previous authors attributed this type of hysteresis to humic acid aggregates-created during the isolation procedure-being redissolved during titration as the pH increased and regarded the results as artificial. However, forward- and back-titrations with organic-rich soils also demonstrated a similar hysteretic behavior. These observations indicate (i) that titrations of humic acid in aggregated form (as opposed to the more usual dissolved form) are more representative of the acid-base properties of humic acid in soil and (ii) that the ionic strength dependency of proton binding in humic acid is related to its degree of aggregation. Thus, the current use of models based on data from dissolved humic substances to predictthe acid-base properties of humic acid in soil under environmental conditions may be flawed and could substantially overestimate their acid buffering capacity.

  9. Acetic Acid Can Catalyze Succinimide Formation from Aspartic Acid Residues by a Concerted Bond Reorganization Mechanism: A Computational Study

    PubMed Central

    Takahashi, Ohgi; Kirikoshi, Ryota; Manabe, Noriyoshi

    2015-01-01

    Succinimide formation from aspartic acid (Asp) residues is a concern in the formulation of protein drugs. Based on density functional theory calculations using Ace-Asp-Nme (Ace = acetyl, Nme = NHMe) as a model compound, we propose the possibility that acetic acid (AA), which is often used in protein drug formulation for mildly acidic buffer solutions, catalyzes the succinimide formation from Asp residues by acting as a proton-transfer mediator. The proposed mechanism comprises two steps: cyclization (intramolecular addition) to form a gem-diol tetrahedral intermediate and dehydration of the intermediate. Both steps are catalyzed by an AA molecule, and the first step was predicted to be rate-determining. The cyclization results from a bond formation between the amide nitrogen on the C-terminal side and the side-chain carboxyl carbon, which is part of an extensive bond reorganization (formation and breaking of single bonds and the interchange of single and double bonds) occurring concertedly in a cyclic structure formed by the amide NH bond, the AA molecule and the side-chain C=O group and involving a double proton transfer. The second step also involves an AA-mediated bond reorganization. Carboxylic acids other than AA are also expected to catalyze the succinimide formation by a similar mechanism. PMID:25588215

  10. Acetic acid can catalyze succinimide formation from aspartic acid residues by a concerted bond reorganization mechanism: a computational study.

    PubMed

    Takahashi, Ohgi; Kirikoshi, Ryota; Manabe, Noriyoshi

    2015-01-12

    Succinimide formation from aspartic acid (Asp) residues is a concern in the formulation of protein drugs. Based on density functional theory calculations using Ace-Asp-Nme (Ace = acetyl, Nme = NHMe) as a model compound, we propose the possibility that acetic acid (AA), which is often used in protein drug formulation for mildly acidic buffer solutions, catalyzes the succinimide formation from Asp residues by acting as a proton-transfer mediator. The proposed mechanism comprises two steps: cyclization (intramolecular addition) to form a gem-diol tetrahedral intermediate and dehydration of the intermediate. Both steps are catalyzed by an AA molecule, and the first step was predicted to be rate-determining. The cyclization results from a bond formation between the amide nitrogen on the C-terminal side and the side-chain carboxyl carbon, which is part of an extensive bond reorganization (formation and breaking of single bonds and the interchange of single and double bonds) occurring concertedly in a cyclic structure formed by the amide NH bond, the AA molecule and the side-chain C=O group and involving a double proton transfer. The second step also involves an AA-mediated bond reorganization. Carboxylic acids other than AA are also expected to catalyze the succinimide formation by a similar mechanism.

  11. Mechanism of Inactivation of γ-Aminobutyric Acid Aminotransferase by (1S,3S)-3-Amino-4-difluoromethylene-1-cyclopentanoic Acid (CPP-115)

    PubMed Central

    2016-01-01

    γ-Aminobutyric acid aminotransferase (GABA-AT) is a pyridoxal 5′-phosphate (PLP)-dependent enzyme that degrades GABA, the principal inhibitory neurotransmitter in mammalian cells. When the concentration of GABA falls below a threshold level, convulsions can occur. Inhibition of GABA-AT raises GABA levels in the brain, which can terminate seizures as well as have potential therapeutic applications in treating other neurological disorders, including drug addiction. Among the analogues that we previously developed, (1S,3S)-3-amino-4-difluoromethylene-1-cyclopentanoic acid (CPP-115) showed 187 times greater potency than that of vigabatrin, a known inactivator of GABA-AT and approved drug (Sabril) for the treatment of infantile spasms and refractory adult epilepsy. Recently, CPP-115 was shown to have no adverse effects in a Phase I clinical trial. Here we report a novel inactivation mechanism for CPP-115, a mechanism-based inactivator that undergoes GABA-AT-catalyzed hydrolysis of the difluoromethylene group to a carboxylic acid with concomitant loss of two fluoride ions and coenzyme conversion to pyridoxamine 5′-phosphate (PMP). The partition ratio for CPP-115 with GABA-AT is about 2000, releasing cyclopentanone-2,4-dicarboxylate (22) and two other precursors of this compound (20 and 21). Time-dependent inactivation occurs by a conformational change induced by the formation of the aldimine of 4-aminocyclopentane-1,3-dicarboxylic acid and PMP (20), which disrupts an electrostatic interaction between Glu270 and Arg445 to form an electrostatic interaction between Arg445 and the newly formed carboxylate produced by hydrolysis of the difluoromethylene group in CPP-115, resulting in a noncovalent, tightly bound complex. This represents a novel mechanism for inactivation of GABA-AT and a new approach for the design of mechanism-based inactivators in general. PMID:25616005

  12. Mechanism of Inactivation of γ-Aminobutyric Acid Aminotransferase by (1 S ,3 S )-3-Amino-4-difluoromethylene-1-cyclopentanoic Acid (CPP-115)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Hyunbeom; Doud, Emma H.; Wu, Rui

    gamma-Aminobutyric acid aminotransferase (GABA-AT) is a pyridoxal 5'-phosphate (PLP)-dependent enzyme that degrades GABA, the principal inhibitory neurotransmitter in mammalian cells. When the concentration of GABA falls below a threshold level, convulsions can occur. Inhibition of GABA-AT raises GABA levels in the brain, which can terminate seizures as well as have potential therapeutic applications in treating other neurological disorders, including drug addiction. Among the analogues that we previously developed, (1S,3S)-3-amino-4-difluoromethylene-1-cyclopentanoic acid (CPP-115) showed 187 times greater potency than that of vigabatrin, a known inactivator of GABA-AT and approved drug (Sabril) for the treatment of infantile spasms and refractory adult epilepsy. Recently,more » CPP-115 was shown to have no adverse effects in a Phase I clinical trial. Here we report a novel inactivation mechanism for CPP-115, a mechanism-based inactivator that undergoes GABA-AT-catalyzed hydrolysis of the difluoromethylene group to a carboxylic acid with concomitant loss of two fluoride ions and coenzyme conversion to pyridoxamine 5'-phosphate (PMP). The partition ratio for CPP-115 with GABA-AT is about 2000, releasing cyclopentanone-2,4-dicarboxylate (22) and two other precursors of this compound (20 and 21). Time-dependent inactivation occurs by a conformational change induced by the formation of the aldimine of 4-aminocyclopentane-1,3-dicarboxylic acid and PMP (20), which disrupts an electrostatic interaction between Glu270 and Arg445 to form an electrostatic interaction between Arg445 and the newly formed carboxylate produced by hydrolysis of the difluoromethylene group in CPP-115, resulting in a noncovalent, tightly bound complex. This represents a novel mechanism for inactivation of GABA-AT and a new approach for the design of mechanism-based inactivators in general.« less

  13. Mechanism of inactivation of γ-aminobutyric acid aminotransferase by (1S,3S)-3-amino-4-difluoromethylene-1-cyclopentanoic acid (CPP-115).

    PubMed

    Lee, Hyunbeom; Doud, Emma H; Wu, Rui; Sanishvili, Ruslan; Juncosa, Jose I; Liu, Dali; Kelleher, Neil L; Silverman, Richard B

    2015-02-25

    γ-Aminobutyric acid aminotransferase (GABA-AT) is a pyridoxal 5'-phosphate (PLP)-dependent enzyme that degrades GABA, the principal inhibitory neurotransmitter in mammalian cells. When the concentration of GABA falls below a threshold level, convulsions can occur. Inhibition of GABA-AT raises GABA levels in the brain, which can terminate seizures as well as have potential therapeutic applications in treating other neurological disorders, including drug addiction. Among the analogues that we previously developed, (1S,3S)-3-amino-4-difluoromethylene-1-cyclopentanoic acid (CPP-115) showed 187 times greater potency than that of vigabatrin, a known inactivator of GABA-AT and approved drug (Sabril) for the treatment of infantile spasms and refractory adult epilepsy. Recently, CPP-115 was shown to have no adverse effects in a Phase I clinical trial. Here we report a novel inactivation mechanism for CPP-115, a mechanism-based inactivator that undergoes GABA-AT-catalyzed hydrolysis of the difluoromethylene group to a carboxylic acid with concomitant loss of two fluoride ions and coenzyme conversion to pyridoxamine 5'-phosphate (PMP). The partition ratio for CPP-115 with GABA-AT is about 2000, releasing cyclopentanone-2,4-dicarboxylate (22) and two other precursors of this compound (20 and 21). Time-dependent inactivation occurs by a conformational change induced by the formation of the aldimine of 4-aminocyclopentane-1,3-dicarboxylic acid and PMP (20), which disrupts an electrostatic interaction between Glu270 and Arg445 to form an electrostatic interaction between Arg445 and the newly formed carboxylate produced by hydrolysis of the difluoromethylene group in CPP-115, resulting in a noncovalent, tightly bound complex. This represents a novel mechanism for inactivation of GABA-AT and a new approach for the design of mechanism-based inactivators in general.

  14. Mechanism of Inactivation of γ-Aminobutyric Acid Aminotransferase by (1 S ,3 S)-3-Amino-4-difluoromethylene-1-cyclopentanoic Acid (CPP-115)

    DOE PAGES

    Lee, Hyunbeom; Doud, Emma H.; Wu, Rui; ...

    2015-01-23

    γ-Aminobutyric acid aminotransferase (GABA-AT) is a pyridoxal 5'-phosphate (PLP)-dependent enzyme that degrades GABA, the principal inhibitory neurotransmitter in mammalian cells. When the concentration of GABA falls below a threshold level, convulsions can occur. Inhibition of GABA-AT raises GABA levels in the brain, which can terminate seizures as well as have potential therapeutic applications in treating other neurological disorders, including drug addiction. Among the analogues that we previously developed, (1S,3S)-3-amino-4-difluoromethylene-1-cyclopentanoic acid (CPP-115) showed 187 times greater potency than that of vigabatrin, a known inactivator of GABA-AT and approved drug (Sabril) for the treatment of infantile spasms and refractory adult epilepsy. Recently,more » CPP-115 was shown to have no adverse effects in a Phase I clinical trial. Here we report a novel inactivation mechanism for CPP-115, a mechanism-based inactivator that undergoes GABA-AT-catalyzed hydrolysis of the difluoromethylene group to a carboxylic acid with concomitant loss of two fluoride ions and coenzyme conversion to pyridoxamine 5'-phosphate (PMP). The partition ratio for CPP-115 with GABA-AT is about 2000, releasing cyclopentanone-2,4-dicarboxylate (22) and two other precursors of this compound (20 and 21). Time-dependent inactivation occurs by a conformational change induced by the formation of the aldimine of 4-aminocyclopentane-1,3-dicarboxylic acid and PMP (20), which disrupts an electrostatic interaction between Glu270 and Arg445 to form an electrostatic interaction between Arg445 and the newly formed carboxylate produced by hydrolysis of the difluoromethylene group in CPP-115, resulting in a noncovalent, tightly bound complex. Ultimately, this represents a novel mechanism for inactivation of GABA-AT and a new approach for the design of mechanism-based inactivators in general.« less

  15. Modeling the Regulatory Mechanisms by Which NLRX1 Modulates Innate Immune Responses to Helicobacter pylori Infection

    PubMed Central

    Philipson, Casandra W.; Bassaganya-Riera, Josep; Viladomiu, Monica; Kronsteiner, Barbara; Abedi, Vida; Hoops, Stefan; Michalak, Pawel; Kang, Lin; Girardin, Stephen E.; Hontecillas, Raquel

    2015-01-01

    Helicobacter pylori colonizes half of the world’s population as the dominant member of the gastric microbiota resulting in a lifelong chronic infection. Host responses toward the bacterium can result in asymptomatic, pathogenic or even favorable health outcomes; however, mechanisms underlying the dual role of H. pylori as a commensal versus pathogenic organism are not well characterized. Recent evidence suggests mononuclear phagocytes are largely involved in shaping dominant immunity during infection mediating the balance between host tolerance and succumbing to overt disease. We combined computational modeling, bioinformatics and experimental validation in order to investigate interactions between macrophages and intracellular H. pylori. Global transcriptomic analysis on bone marrow-derived macrophages (BMDM) in a gentamycin protection assay at six time points unveiled the presence of three sequential host response waves: an early transient regulatory gene module followed by sustained and late effector responses. Kinetic behaviors of pattern recognition receptors (PRRs) are linked to differential expression of spatiotemporal response waves and function to induce effector immunity through extracellular and intracellular detection of H. pylori. We report that bacterial interaction with the host intracellular environment caused significant suppression of regulatory NLRC3 and NLRX1 in a pattern inverse to early regulatory responses. To further delineate complex immune responses and pathway crosstalk between effector and regulatory PRRs, we built a computational model calibrated using time-series RNAseq data. Our validated computational hypotheses are that: 1) NLRX1 expression regulates bacterial burden in macrophages; and 2) early host response cytokines down-regulate NLRX1 expression through a negative feedback circuit. This paper applies modeling approaches to characterize the regulatory role of NLRX1 in mechanisms of host tolerance employed by macrophages to

  16. The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.

    PubMed

    Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S

    2015-08-21

    The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties.

  17. New insights into the molecular mechanism of intestinal fatty acid absorption.

    PubMed

    Wang, Tony Y; Liu, Min; Portincasa, Piero; Wang, David Q-H

    2013-11-01

    Dietary fat is one of the most important energy sources of all the nutrients. Fatty acids, stored as triacylglycerols (also called triglycerides) in the body, are an important reservoir of stored energy and derived primarily from animal fats and vegetable oils. Although the molecular mechanisms for the transport of water-insoluble amphipathic fatty acids across cell membranes have been debated for many years, it is now believed that the dominant means for intestinal fatty acid uptake is via membrane-associated fatty acid-binding proteins, that is, fatty acid transporters on the apical membrane of enterocytes. These findings indicate that intestinal fatty acid absorption is a multistep process that is regulated by multiple genes at the enterocyte level, and intestinal fatty acid absorption efficiency could be determined by factors influencing intraluminal fatty acid molecules across the brush border membrane of enterocytes. To facilitate research on intestinal, hepatic and plasma triacylglycerol metabolism, it is imperative to establish standard protocols for precisely and accurately measuring the efficiency of intestinal fatty acid absorption in humans and animal models. In this review, we will discuss the chemical structure and nomenclature of fatty acids and summarize recent progress in investigating the molecular mechanisms underlying the intestinal absorption of fatty acids, with a particular emphasis on the physical chemistry of intestinal lipids and the molecular physiology of intestinal fatty acid transporters. A better understanding of the molecular mechanism of intestinal fatty acid absorption should lead to novel approaches to the treatment and the prevention of fatty acid-related metabolic diseases that are prevalent worldwide. © 2013 Stichting European Society for Clinical Investigation Journal Foundation. Published by John Wiley & Sons Ltd.

  18. Entropy-based divergent and convergent modular pattern reveals additive and synergistic anticerebral ischemia mechanisms.

    PubMed

    Yu, Yanan; Zhang, Xiaoxu; Li, Bing; Zhang, Yingying; Liu, Jun; Li, Haixia; Chen, Yinying; Wang, Pengqian; Kang, Ruixia; Wu, Hongli; Wang, Zhong

    2016-12-01

    Module-based network analysis of diverse pharmacological mechanisms is critical to systematically understand combination therapies and disease outcomes. We first constructed drug-target ischemic networks in baicalin, jasminoidin, ursodeoxycholic acid, and their combinations baicalin and jasminoidin as well as jasminoidin and ursodeoxycholic acid groups and identified modules using the entropy-based clustering algorithm. The modules 11, 7, 4, 8 and 3 were identified as baicalin, jasminoidin, ursodeoxycholic acid, baicalin and jasminoidin and jasminoidin and ursodeoxycholic acid-emerged responsive modules, while 12, 8, 15, 17 and 9 were identified as disappeared responsive modules based on variation of topological similarity, respectively. No overlapping differential biological processes were enriched between baicalin and jasminoidin and jasminoidin and ursodeoxycholic acid pure emerged responsive modules, but two were enriched by their co-disappeared responsive modules including nucleotide-excision repair and epithelial structure maintenance. We found an additive effect of baicalin and jasminoidin in a divergent pattern and a synergistic effect of jasminoidin and ursodeoxycholic acid in a convergent pattern on "central hit strategy" of regulating inflammation against cerebral ischemia. The proposed module-based approach may provide us a holistic view to understand multiple pharmacological mechanisms associated with differential phenotypes from the standpoint of modular pharmacology.

  19. Physicochemical characterization and mechanisms of release of theophylline from melt-extruded dosage forms based on a methacrylic acid copolymer.

    PubMed

    Young, Christopher R; Dietzsch, Caroline; Cerea, Matteo; Farrell, Thomas; Fegely, Kurt A; Rajabi-Siahboomi, Ali; McGinity, James W

    2005-09-14

    The purpose of the current study was to investigate the physicochemical properties of melt-extruded dosage forms based on Acryl-EZE and to determine the influence of gelling agents on the mechanisms and kinetics of drug release from thermally processed matrices. Acryl-EZE is a pre-mixed excipient blend based on a methacrylic acid copolymer that is optimized for film-coating applications. Powder blends containing theophylline, Acryl-EZE, triethyl citrate and an optional gelling agent, Methocel K4M Premium (hydroxypropyl methylcellulose, HPMC, hypromellose 2208) or Carbopol 974P (carbomer), were thermally processed using a Randcastle single-screw extruder. The physical and chemical stability of materials during processing was determined using thermal gravimetric analysis and HPLC. The mechanism of drug release was determined using the Korsmeyer-Peppas model and the hydration and erosion of tablets during the dissolution studies were investigated. The excipient blends were physically and chemically stable during processing, and the resulting dosage forms exhibited pH-dependent dissolution properties. Extrusion of blends containing HPMC or carbomer changed the mechanism and kinetics of drug release from the thermally processed dosage forms. At concentrations of 5% or below, carbomer was more effective than HPMC at extending the duration of theophylline release from matrix tablets. Furthermore, carbomer containing tablets were stable upon storage for 3 months at 40 degrees C/75% RH. Thus, hot-melt extrusion was an effective process for the preparation of controlled release matrix systems based on Acryl-EZE.

  20. Function of fusion regulatory proteins (FRPs) in immune cells and virus-infected cells.

    PubMed

    Tsurudome, M; Ito, Y

    2000-01-01

    Two molecules that regulate cell fusion have been identified and designated fusion regulatory protein-1 (FRP-1) and FRP-2. FRP-1 is a complex composed of a glycosylated heavy chain and a nonglycosylated light chain that are disulfide linked. FRP-1 heavy chain is identical to 4F2/CD98 heavy chain, whereas FRP-2 is identical to integrin alpha3 subunit. The FRP-1 heavy chain is a multifunctional molecule: that is, fusion regulator, amino acid transporter, integrin regulator, comitogenic factor, Na+-Ca2+ exchanger, oncogenic protein, and so on. Several aspects of the structure and function of the FRP-1 system are reviewed: fusion regulatory molecular mechanisms, cross-talk between the FRP-1 and integrin, the FRP-1 system as amino acid transporter, and FRP-1-mediated T-cell activation. The FRP-1 system is involved in virus-mediated cell fusion and multinucleated giant cell formation of blood monocytes. Monoclonal antibodies against human FRP-1 heavy chain induce polykaryocytes that have properties as osteoclasts. Multiple steps participate in molecular mechanisms regulating cell fusion. The FRP-1 heavy chain supports amino acid transport activity and the FRP-1 light chains have recently been cloned as amino acid transporters that require association with the heavy chain to exhibit their activity. Novel pathways for monocyte-dependent regulation of T-cell activation have recently been found that are mediated by the FRP-1 system. In conclusion, the FRP-1 molecules are essential factors for basic cellular functions.

  1. Acid-base equilibrium dynamics in methanol and dimethyl sulfoxide probed by two-dimensional infrared spectroscopy.

    PubMed

    Lee, Chiho; Son, Hyewon; Park, Sungnam

    2015-07-21

    Two-dimensional infrared (2DIR) spectroscopy, which has been proven to be an excellent experimental method for studying thermally-driven chemical processes, was successfully used to investigate the acid dissociation equilibrium of HN3 in methanol (CH3OH) and dimethyl sulfoxide (DMSO) for the first time. Our 2DIR experimental results indicate that the acid-base equilibrium occurs on picosecond timescales in CH3OH but that it occurs on much longer timescales in DMSO. Our results imply that the different timescales of the acid-base equilibrium originate from different proton transfer mechanisms between the acidic (HN3) and basic (N3(-)) species in CH3OH and DMSO. In CH3OH, the acid-base equilibrium is assisted by the surrounding CH3OH molecules which can directly donate H(+) to N3(-) and accept H(+) from HN3 and the proton migrates through the hydrogen-bonded chain of CH3OH. On the other hand, the acid-base equilibrium in DMSO occurs through the mutual diffusion of HN3 and N3(-) or direct proton transfer. Our 2DIR experimental results corroborate different proton transfer mechanisms in the acid-base equilibrium in protic (CH3OH) and aprotic (DMSO) solvents.

  2. Epigenetic regulatory mechanisms in vertebrate eye development and disease

    PubMed Central

    Cvekl, A; Mitton, KP

    2014-01-01

    Eukaryotic DNA is organized as a nucleoprotein polymer termed chromatin with nucleosomes serving as its repetitive architectural units. Cellular differentiation is a dynamic process driven by activation and repression of specific sets of genes, partitioning the genome into transcriptionally active and inactive chromatin domains. Chromatin architecture at individual genes/loci may remain stable through cell divisions, from a single mother cell to its progeny during mitosis, and represents an example of epigenetic phenomena. Epigenetics refers to heritable changes caused by mechanisms distinct from the primary DNA sequence. Recent studies have shown a number of links between chromatin structure, gene expression, extracellular signaling, and cellular differentiation during eye development. This review summarizes recent advances in this field, and the relationship between sequence-specific DNA-binding transcription factors and their roles in recruitment of chromatin remodeling enzymes. In addition, lens and retinal differentiation is accompanied by specific changes in the nucleolar organization, expression of non-coding RNAs, and DNA methylation. Epigenetic regulatory mechanisms in ocular tissues represent exciting areas of research that have opened new avenues for understanding normal eye development, inherited eye diseases and eye diseases related to aging and the environment. PMID:20179734

  3. The regulatory network analysis of long noncoding RNAs in human colorectal cancer.

    PubMed

    Zhang, Yuwei; Tao, Yang; Li, Yang; Zhao, Jinshun; Zhang, Lina; Zhang, Xiaohong; Dong, Changzheng; Xie, Yangyang; Dai, Xiaoyu; Zhang, Xinjun; Liao, Qi

    2018-05-01

    Colorectal cancer (CRC) is among one of the most prevalent and lethiferous diseases worldwide. Long noncoding RNAs (lncRNAs) are commonly accepted to function as a key regulatory factor in human cancer, but the potential regulatory mechanisms of CRC-associated lncRNA are largely obscure. Here, we integrated several expression profiles to obtain 55 differentially expressed (DE) lncRNAs. We first detected lncRNA interactions with transcription factors, microRNAs, mRNAs, and RNA-binding proteins to construct a regulatory network and then create functional enrichment analyses for them using bioinformatics approaches. We found the upregulated genes in the regulatory network are enriched in cell cycle and DNA damage response, while the downregulated genes are enriched in cell differentiation, cellular response, and cell signaling. We then employed module-based methods to mine several intriguing modules from the overall network, which helps to classify the functions of genes more specifically. Next, we confirmed the validity of our network by comparisons with a randomized network using computational method. Finally, we attempted to annotate lncRNA functions based on the regulatory network, which indicated its potential application. Our study of the lncRNA regulatory network provided significant clues to unveil lncRNAs potential regulatory mechanisms in CRC and laid a foundation for further experimental investigation.

  4. Extracellular Acidic pH Activates the Sterol Regulatory Element-Binding Protein 2 to Promote Tumor Progression.

    PubMed

    Kondo, Ayano; Yamamoto, Shogo; Nakaki, Ryo; Shimamura, Teppei; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Yoshida, Tetsuo; Aburatani, Hiroyuki; Osawa, Tsuyoshi

    2017-02-28

    Conditions of the tumor microenvironment, such as hypoxia and nutrient starvation, play critical roles in cancer progression. However, the role of acidic extracellular pH in cancer progression is not studied as extensively as that of hypoxia. Here, we show that extracellular acidic pH (pH 6.8) triggered activation of sterol regulatory element-binding protein 2 (SREBP2) by stimulating nuclear translocation and promoter binding to its targets, along with intracellular acidification. Interestingly, inhibition of SREBP2, but not SREBP1, suppressed the upregulation of low pH-induced cholesterol biosynthesis-related genes. Moreover, acyl-CoA synthetase short-chain family member 2 (ACSS2), a direct SREBP2 target, provided a growth advantage to cancer cells under acidic pH. Furthermore, acidic pH-responsive SREBP2 target genes were associated with reduced overall survival of cancer patients. Thus, our findings show that SREBP2 is a key transcriptional regulator of metabolic genes and progression of cancer cells, partly in response to extracellular acidification. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  5. Biodegradable Zein-Based Blend Films: Structural, Mechanical and Barrier Properties

    PubMed Central

    Filho, José Francisco Lopes

    2015-01-01

    Summary The effect of adding a hydrocolloid on the structural, mechanical and barrier properties of zein-based blend films is evaluated. Zein-oleic acid blend film with added xanthan gum (Z-OA-XG) showed higher water solubility (13.09%) and opacity (8.49 AU/mm) than zein-oleic acid (Z-OA) film (10.80% and 5.19 AU/mm, respectively). Furthermore, Z-OA film had greater flexibility with lower Young’s Modulus (YM=5.02 MPa) and higher elongation at break (η=10.62%); nonetheless, it was less resistant to tension (tensile strength σ=8.5 MPa) than Z-OA-XG film, which showed YM, η and σ of 6.38 MPa, 6.66% and 10.485 MPa, respectively. Both films had glossy and homogeneous structure with comparable water vapour and oxygen barrier properties around 4.39·10–11 and 1.82·10–13 g/(Pa·s·m), respectively. Based on that, xanthan gum structure influenced mainly mechanical and light barrier properties of zein-oleic acid blend films. PMID:27904368

  6. Nucleic acid-induced antiviral immunity in invertebrates: an evolutionary perspective.

    PubMed

    Wang, Pei-Hui; Weng, Shao-Ping; He, Jian-Guo

    2015-02-01

    Nucleic acids derived from viral pathogens are typical pathogen associated molecular patterns (PAMPs). In mammals, the recognition of viral nucleic acids by pattern recognition receptors (PRRs), which include Toll-like receptors (TLRs) and retinoic acid-inducible gene (RIG)-I-like receptors (RLRs), induces the release of inflammatory cytokines and type I interferons (IFNs) through the activation of nuclear factor κB (NF-κB) and interferon regulatory factor (IRF) 3/7 pathways, triggering the host antiviral state. However, whether nucleic acids can induce similar antiviral immunity in invertebrates remains ambiguous. Several studies have reported that nucleic acid mimics, especially dsRNA mimic poly(I:C), can strongly induce non-specific antiviral immune responses in insects, shrimp, and oyster. This behavior shows multiple similarities to the hallmarks of mammalian IFN responses. In this review, we highlight the current understanding of nucleic acid-induced antiviral immunity in invertebrates. We also discuss the potential recognition and regulatory mechanisms that confer non-specific antiviral immunity on invertebrate hosts. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Kinetic study on ferulic acid production from banana stem waste via mechanical extraction

    NASA Astrophysics Data System (ADS)

    Zainol, Norazwina; Masngut, Nasratun; Khairi Jusup, Muhamad

    2018-04-01

    Banana is the tropical plants associated with lots of medicinal properties. It has been reported to be a potential source of phenolic compounds such as ferulic acid (FA). FA has excellent antioxidant properties higher than vitamin C and E. FA also have a wide range of biological activities, such as antioxidant activities and anti-microbial activities. This paper presents an experimental and kinetic study on ferulic acid (FA) production from banana stem waste (BSW) via mechanical extraction. The objective of this research is to determine the kinetic parameters in the ferulic acid production. The banana stem waste was randomly collected from the local banana plantation in Felda Lepar Hilir, Pahang. The banana stem juice was mechanically extracted by using sugarcane press machine (KR3176) and further analyzed in high performance liquid chromatography. The differential and integral method was applied to determine the kinetic parameter of the extraction process and the data obtained were fitted into the 0th, 1st and 2nd order of extraction process. Based on the results, the kinetic parameter and R2 value from were 0.05 and 0.93, respectively. It was determined that the 0th kinetic order fitted the reaction processes to best represent the mechanical extraction.

  8. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet.

    PubMed

    Terova, Genciana; Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc

    2016-01-01

    Bacteria that inhabit the epithelium of the animals' digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  9. Glycyrrhetinic acid-modified chitosan nanoparticles enhanced the effect of 5-fluorouracil in murine liver cancer model via regulatory T-cells

    PubMed Central

    Cheng, Mingrong; Xu, Hongzhi; Wang, Yong; Chen, Houxiang; He, Bing; Gao, Xiaoyan; Li, Yingchun; Han, Jiang; Zhang, Zhiping

    2013-01-01

    Modified chitosan nanoparticles are a promising platform for drug, such as 5-fluorouracil (5-FU), gene, and vaccine delivery. Here, we used chitosan and hepatoma cell-specific binding molecule glycyrrhetinic acid (GA) to synthesize glycyrrhetinic acid-modified chitosan (GA-CTS). The synthetic product was confirmed by infrared spectroscopy and hydrogen nuclear magnetic resonance. By combining GA-CTS and 5-FU, we obtained a GA-CTS/5-FU nanoparticle, with a particle size of 193.7 nm, drug loading of 1.56%, and a polydispersity index of 0.003. The GA-CTS/5-FU nanoparticle provided a sustained-release system comprising three distinct phases of quick, steady, and slow release. In vitro data indicated that it had a dose- and time-dependent anticancer effect. The effective drug exposure time against hepatic cancer cells was increased in comparison with that observed with 5-FU. In vivo studies on an orthotropic liver cancer mouse model demonstrated that GA-CTS/5-FU significantly inhibited cancer cell proliferation, resulting in increased survival time. The antitumor mechanisms for GA-CTS/5-FU nanoparticle were possibly associated with an increased expression of regulatory T-cells, decreased expression of cytotoxic T-cell and natural killer cells, and reduced levels of interleukin-2 and interferon gamma. PMID:24187487

  10. [Research Progress on Metabolic Regulatory Mechanisms of Hematopoietic Stem Cells -Review].

    PubMed

    Zhang, Ya-Wen; Cheng, Hui; Cheng, Tao

    2018-06-01

    Hematopoietic stem cells (HSC) are a class of stem cells with self-renewal and multipotent differentiation into a variety of blood cells and are most thoroughly studied, maturely applied in the clinic adult stem cell. Function of HSC is closely associated with metabolic regulation. The metabolic state mainly maintains HSC living in hypoxic bone marrow microenvironment depending on glycolysis for energy metabolism, and keeping low reactive oxygen species (ROS) level. Proteins like Hif-1, FoxO3, ATM, PTPMT1 protect HSC from ROS injury, maintaining HSC in hypoxic state. In addition, glucose metabolism-related enzymes, glutamine, fatty acid oxidation, purine and amino acid metabolism also play important roles in metabolic regulation of HSC. In this review the research progress on metabolism regnlation mechanisms of HSC is summurized, focusing on the mechanisms releted with oxydation metabolism regulation, carbohydrate metabolism level, purine metabolism and aminoacide metabolism.

  11. Impairment of interferon regulatory factor-3 activation by hepatitis C virus core protein basic amino acid region 1.

    PubMed

    Inoue, Kazuaki; Tsukiyama-Kohara, Kyoko; Matsuda, Chiho; Yoneyama, Mitsutoshi; Fujita, Takashi; Kuge, Shusuke; Yoshiba, Makoto; Kohara, Michinori

    2012-11-30

    Interferon regulatory factor-3 (IRF-3), a key transcriptional factor in the type I interferon system, is frequently impaired by hepatitis C virus (HCV), in order to establish persistent infection. However, the exact mechanism by which the virus establishes persistent infection has not been fully understood yet. The present study aimed to investigate the effects of various HCV proteins on IRF-3 activation, and elucidate the underlying mechanisms. To achieve this, full-length HCV and HCV subgenomic constructs corresponding to structural and each of the nonstructural proteins were transiently transfected into HepG2 cells. IFN-β induction, plaque formation, and IRF-3 dimerization were elicited by Newcastle disease virus (NDV) infection. The expressions of IRF-3 homodimer and its monomer, Ser386-phosphorylated IRF-3, and HCV core protein were detected by immunofluorescence and western blotting. IFN-β mRNA expression was quantified by real-time PCR (RT-PCR), and IRF-3 activity was measured by the levels of IRF-3 dimerization and phosphorylation, induced by NDV infection or polyriboinosinic:polyribocytidylic acid [poly(I:C)]. Switching of the expression of the complete HCV genome as well as the core proteins, E1, E2, and NS2, suppressed IFN-β mRNA levels and IRF-3 dimerization, induced by NDV infection. Our study revealed a crucial region of the HCV core protein, basic amino acid region 1 (BR1), to inhibit IRF-3 dimerization as well as its phosphorylation induced by NDV infection and poly (I:C), thus interfering with IRF-3 activation. Therefore, our study suggests that rescue of the IRF-3 pathway impairment may be an effective treatment for HCV infection. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Entropy-based divergent and convergent modular pattern reveals additive and synergistic anticerebral ischemia mechanisms

    PubMed Central

    Yu, Yanan; Zhang, Xiaoxu; Li, Bing; Zhang, Yingying; Liu, Jun; Li, Haixia; Chen, Yinying; Wang, Pengqian; Kang, Ruixia; Wu, Hongli

    2016-01-01

    Module-based network analysis of diverse pharmacological mechanisms is critical to systematically understand combination therapies and disease outcomes. We first constructed drug-target ischemic networks in baicalin, jasminoidin, ursodeoxycholic acid, and their combinations baicalin and jasminoidin as well as jasminoidin and ursodeoxycholic acid groups and identified modules using the entropy-based clustering algorithm. The modules 11, 7, 4, 8 and 3 were identified as baicalin, jasminoidin, ursodeoxycholic acid, baicalin and jasminoidin and jasminoidin and ursodeoxycholic acid-emerged responsive modules, while 12, 8, 15, 17 and 9 were identified as disappeared responsive modules based on variation of topological similarity, respectively. No overlapping differential biological processes were enriched between baicalin and jasminoidin and jasminoidin and ursodeoxycholic acid pure emerged responsive modules, but two were enriched by their co-disappeared responsive modules including nucleotide-excision repair and epithelial structure maintenance. We found an additive effect of baicalin and jasminoidin in a divergent pattern and a synergistic effect of jasminoidin and ursodeoxycholic acid in a convergent pattern on “central hit strategy” of regulating inflammation against cerebral ischemia. The proposed module-based approach may provide us a holistic view to understand multiple pharmacological mechanisms associated with differential phenotypes from the standpoint of modular pharmacology. PMID:27480252

  13. Favorable genomic environments for cis-regulatory evolution: A novel theoretical framework.

    PubMed

    Maeso, Ignacio; Tena, Juan J

    2016-09-01

    Cis-regulatory changes are arguably the primary evolutionary source of animal morphological diversity. With the recent explosion of genome-wide comparisons of the cis-regulatory content in different animal species is now possible to infer general principles underlying enhancer evolution. However, these studies have also revealed numerous discrepancies and paradoxes, suggesting that the mechanistic causes and modes of cis-regulatory evolution are still not well understood and are probably much more complex than generally appreciated. Here, we argue that the mutational mechanisms and genomic regions generating new regulatory activities must comply with the constraints imposed by the molecular properties of cis-regulatory elements (CREs) and the organizational features of long-range chromatin interactions. Accordingly, we propose a new integrative evolutionary framework for cis-regulatory evolution based on two major premises for the origin of novel enhancer activity: (i) an accessible chromatin environment and (ii) compatibility with the 3D structure and interactions of pre-existing CREs. Mechanisms and DNA sequences not fulfilling these premises, will be less likely to have a measurable impact on gene expression and as such, will have a minor contribution to the evolution of gene regulation. Finally, we discuss current comparative cis-regulatory data under the light of this new evolutionary model, and propose that the two most prominent mechanisms for the evolution of cis-regulatory changes are the overprinting of ancestral CREs and the exaptation of transposable elements. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Complexity in Acid-Base Titrations: Multimer Formation Between Phosphoric Acids and Imines.

    PubMed

    Malm, Christian; Kim, Heejae; Wagner, Manfred; Hunger, Johannes

    2017-08-10

    Solutions of Brønsted acids with bases in aprotic solvents are not only common model systems to study the fundamentals of proton transfer pathways but are also highly relevant to Brønsted acid catalysis. Despite their importance the light nature of the proton makes characterization of acid-base aggregates challenging. Here, we track such acid-base interactions over a broad range of relative compositions between diphenyl phosphoric acid and the base quinaldine in dichloromethane, by using a combination of dielectric relaxation and NMR spectroscopy. In contrast to what one would expect for an acid-base titration, we find strong deviations from quantitative proton transfer from the acid to the base. Even for an excess of the base, multimers consisting of one base and at least two acid molecules are formed, in addition to the occurrence of proton transfer from the acid to the base and simultaneous formation of ion pairs. For equimolar mixtures such multimers constitute about one third of all intermolecular aggregates. Quantitative analysis of our results shows that the acid-base association constant is only around six times larger than that for the acid binding to an acid-base dimer, that is, to an already protonated base. Our findings have implications for the interpretation of previous studies of reactive intermediates in organocatalysis and provide a rationale for previously observed nonlinear effects in phosphoric acid catalysis. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  15. Going Beyond, Going Further: The Preparation of Acid-Base Titration Curves.

    ERIC Educational Resources Information Center

    McClendon, Michael

    1984-01-01

    Background information, list of materials needed, and procedures used are provided for a simple technique for generating mechanically plotted acid-base titration curves. The method is suitable for second-year high school chemistry students. (JN)

  16. Transancestral fine-mapping of four type 2 diabetes susceptibility loci highlights potential causal regulatory mechanisms

    PubMed Central

    Horikoshi, Momoko; Pasquali, Lorenzo; Wiltshire, Steven; Huyghe, Jeroen R.; Mahajan, Anubha; Asimit, Jennifer L.; Ferreira, Teresa; Locke, Adam E.; Robertson, Neil R.; Wang, Xu; Sim, Xueling; Fujita, Hayato; Hara, Kazuo; Young, Robin; Zhang, Weihua; Choi, Sungkyoung; Chen, Han; Kaur, Ismeet; Takeuchi, Fumihiko; Fontanillas, Pierre; Thuillier, Dorothée; Yengo, Loic; Below, Jennifer E.; Tam, Claudia H.T.; Wu, Ying; Abecasis, Gonçalo; Altshuler, David; Bell, Graeme I.; Blangero, John; Burtt, Noél P.; Duggirala, Ravindranath; Florez, Jose C.; Hanis, Craig L.; Seielstad, Mark; Atzmon, Gil; Chan, Juliana C.N.; Ma, Ronald C.W.; Froguel, Philippe; Wilson, James G.; Bharadwaj, Dwaipayan; Dupuis, Josee; Meigs, James B.; Cho, Yoon Shin; Park, Taesung; Kooner, Jaspal S.; Chambers, John C.; Saleheen, Danish; Kadowaki, Takashi; Tai, E. Shyong; Mohlke, Karen L.; Cox, Nancy J.; Ferrer, Jorge; Zeggini, Eleftheria; Kato, Norihiro; Teo, Yik Ying; Boehnke, Michael; McCarthy, Mark I.; Morris, Andrew P.

    2016-01-01

    To gain insight into potential regulatory mechanisms through which the effects of variants at four established type 2 diabetes (T2D) susceptibility loci (CDKAL1, CDKN2A-B, IGF2BP2 and KCNQ1) are mediated, we undertook transancestral fine-mapping in 22 086 cases and 42 539 controls of East Asian, European, South Asian, African American and Mexican American descent. Through high-density imputation and conditional analyses, we identified seven distinct association signals at these four loci, each with allelic effects on T2D susceptibility that were homogenous across ancestry groups. By leveraging differences in the structure of linkage disequilibrium between diverse populations, and increased sample size, we localised the variants most likely to drive each distinct association signal. We demonstrated that integration of these genetic fine-mapping data with genomic annotation can highlight potential causal regulatory elements in T2D-relevant tissues. These analyses provide insight into the mechanisms through which T2D association signals are mediated, and suggest future routes to understanding the biology of specific disease susceptibility loci. PMID:26911676

  17. Mechanisms of acid reflux and how refluxed Acid extends proximally in patients with non-erosive reflux disease.

    PubMed

    Sano, Hirohito; Iwakiri, Katsuhiko; Kawami, Noriyuki; Tanaka, Yuriko; Sakamoto, Choitsu

    2014-01-01

    The mechanisms that cause acid reflux in patients with non-erosive reflux disease (NERD), including those that determine how acid extends proximally, are not yet clear. Concurrent esophageal manometry and pH monitoring were performed for 3 h after a meal in 13 patients with NERD, 12 with mild reflux esophagitis (RE), and 13 healthy subjects (HS). Transient lower esophageal sphincter (LES) relaxation (TLESR) was the major mechanism of acid reflux in all three groups. LES pressure did not differ between the groups. At 2 cm above the LES, there were no differences between the three groups in the number of TLESR-related acid reflux episodes, rate of TLESRs and rate of acid reflux during TLESR. However, at 7 cm above the LES, the rate of acid reflux during TLESRs was significantly higher in patients with NERD (mean ± SEM 42.3 ± 4.8) than in those with mild RE (28.0 ± 3.8) and HS (10.8 ± 2.5). TLESRs are the sole motor events underlying acid reflux episodes in patients with NERD. Acid extends proximally more readily in patients with NERD than in HS and those with mild RE.

  18. Regulatory Mechanisms Underlying Oil Palm Fruit Mesocarp Maturation, Ripening, and Functional Specialization in Lipid and Carotenoid Metabolism1[W][OA

    PubMed Central

    Tranbarger, Timothy J.; Dussert, Stéphane; Joët, Thierry; Argout, Xavier; Summo, Marilyne; Champion, Antony; Cros, David; Omore, Alphonse; Nouy, Bruno; Morcillo, Fabienne

    2011-01-01

    Fruit provide essential nutrients and vitamins for the human diet. Not only is the lipid-rich fleshy mesocarp tissue of the oil palm (Elaeis guineensis) fruit the main source of edible oil for the world, but it is also the richest dietary source of provitamin A. This study examines the transcriptional basis of these two outstanding metabolic characters in the oil palm mesocarp. Morphological, cellular, biochemical, and hormonal features defined key phases of mesocarp development. A 454 pyrosequencing-derived transcriptome was then assembled for the developmental phases preceding and during maturation and ripening, when high rates of lipid and carotenoid biosynthesis occur. A total of 2,629 contigs with differential representation revealed coordination of metabolic and regulatory components. Further analysis focused on the fatty acid and triacylglycerol assembly pathways and during carotenogenesis. Notably, a contig similar to the Arabidopsis (Arabidopsis thaliana) seed oil transcription factor WRINKLED1 was identified with a transcript profile coordinated with those of several fatty acid biosynthetic genes and the high rates of lipid accumulation, suggesting some common regulatory features between seeds and fruits. We also focused on transcriptional regulatory networks of the fruit, in particular those related to ethylene transcriptional and GLOBOSA/PISTILLATA-like proteins in the mesocarp and a central role for ethylene-coordinated transcriptional regulation of type VII ethylene response factors during ripening. Our results suggest that divergence has occurred in the regulatory components in this monocot fruit compared with those identified in the dicot tomato (Solanum lycopersicum) fleshy fruit model. PMID:21487046

  19. [Metabolism of cholesterol and fatty acids in nephrotic syndrome and its regulation by sterol regulatory element binding proteins (SREBP's). Effect of soy protein consumption].

    PubMed

    Tovar, Armando; Manzano, Natalia; Torres, Nimbe

    2005-01-01

    Hyperlipidemia occurs during nephrotic syndrome (NS). It is known that cholesterol and fatty acid biosynthesis is controlled by the transcription factors sterol regulatory element binding proteins (SREBPs). Soy protein consumption reduces the concentration of these lipids, although its mechanism of action is not well known. The aim of the present study was to establish whether soy protein consumption reduces cholesterol and triglycerides levels by regulating of SREBPs. Male Wistar rats with experimental NS were studied for 64 days. The results showed that rats fed with soy protein had significantly lower plasma cholesterol and triglyceride concentrations as well as proteinuria than rats fed with casein diet. These decrements were associated with a decrease in the expression of SREBP-1 and fatty acid biosynthetic enzymes. In addition, Western blot analysis revealed that in nuclear extracts from hepatocytes of rats fed with soy protein, there was a lower concentration of SREBP-1 than in rats fed with casein. The results of this study indicate that consumption of a soy protein diet has beneficial effects on nephrotic syndrome.

  20. Synthesis of new kojic acid based unnatural α-amino acid derivatives.

    PubMed

    Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Uma Devi, P; Behera, Manoranjan

    2015-11-01

    An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Chemical mechanism of fire retardance of boric acid on wood

    Treesearch

    Qingwen Wang; Jian Li; Jerrold E. Winandy

    2004-01-01

    It is commonly accepted that the fire retardant mechanism of boric acid is a physical mechanism achieved by the formation of a coating or protective layer on the wood surface at high temperature. Although a char-forming catalytic mechanism has been proposed by some researchers, little direct experimental support has been provided for such a chemical mechanism. In this...

  2. Bicarbonate sensing in mouse cortical astrocytes during extracellular acid/base disturbances.

    PubMed

    Theparambil, Shefeeq M; Naoshin, Zinnia; Defren, Sabrina; Schmaelzle, Jana; Weber, Tobias; Schneider, Hans-Peter; Deitmer, Joachim W

    2017-04-15

    The present study suggests that the electrogenic sodium-bicarbonate cotransporter, NBCe1, supported by carbonic anhydrase II, CAII, provides an efficient mechanism of bicarbonate sensing in cortical astrocytes. This mechanism is proposed to play a major role in setting the pH i responses to extracellular acid/base challenges in astrocytes. A decrease in extracellular [HCO 3 - ] during isocapnic acidosis and isohydric hypocapnia, or an increase in intracellular [HCO 3 - ] during hypercapnic acidosis, was effectively sensed by NBCe1, which carried bicarbonate out of the cells under these conditions, and caused an acidification and sodium fall in WT astrocytes, but not in NBCe1-knockout astrocytes. Isocapnic acidosis, hypercapnic acidosis and isohydric hypocapnia evoked inward currents in NBCe1- and CAII-expressing Xenopus laevis oocytes, but not in native oocytes, suggesting that NBCe1 operates in the outwardly directed mode under these conditions consistent with our findings in astrocytes. We propose that bicarbonate sensing of astrocytes may have functional significance during extracellular acid/base disturbances in the brain, as it not only alters intracellular pH/[HCO 3 - ]-dependent functions of astrocytes, but also modulates the extracellular pH/[HCO 3 - ] in brain tissue. Extracellular acid/base status of the mammalian brain undergoes dynamic changes during many physiological and pathological events. Although intracellular pH (pH i ) of astrocytes responds to extracellular acid/base changes, the mechanisms mediating these changes have remained unresolved. We have previously shown that the electrogenic sodium-bicarbonate cotransporter, NBCe1, is a high-affinity bicarbonate carrier in cortical astrocytes. In the present study, we investigated whether NBCe1 plays a role in bicarbonate sensing in astrocytes, and in determining the pH i responses to extracellular acid/base challenges. We measured changes in intracellular H + and Na + in astrocytes from wild

  3. Bicarbonate sensing in mouse cortical astrocytes during extracellular acid/base disturbances

    PubMed Central

    Naoshin, Zinnia; Defren, Sabrina; Schmaelzle, Jana; Weber, Tobias; Schneider, Hans‐Peter

    2017-01-01

    Key points The present study suggests that the electrogenic sodium–bicarbonate cotransporter, NBCe1, supported by carbonic anhydrase II, CAII, provides an efficient mechanism of bicarbonate sensing in cortical astrocytes. This mechanism is proposed to play a major role in setting the pHi responses to extracellular acid/base challenges in astrocytes.A decrease in extracellular [HCO3 −] during isocapnic acidosis and isohydric hypocapnia, or an increase in intracellular [HCO3 −] during hypercapnic acidosis, was effectively sensed by NBCe1, which carried bicarbonate out of the cells under these conditions, and caused an acidification and sodium fall in WT astrocytes, but not in NBCe1‐knockout astrocytes.Isocapnic acidosis, hypercapnic acidosis and isohydric hypocapnia evoked inward currents in NBCe1‐ and CAII‐expressing Xenopus laevis oocytes, but not in native oocytes, suggesting that NBCe1 operates in the outwardly directed mode under these conditions consistent with our findings in astrocytes.We propose that bicarbonate sensing of astrocytes may have functional significance during extracellular acid/base disturbances in the brain, as it not only alters intracellular pH/[HCO3 −]‐dependent functions of astrocytes, but also modulates the extracellular pH/[HCO3 −] in brain tissue. Abstract Extracellular acid/base status of the mammalian brain undergoes dynamic changes during many physiological and pathological events. Although intracellular pH (pHi) of astrocytes responds to extracellular acid/base changes, the mechanisms mediating these changes have remained unresolved. We have previously shown that the electrogenic sodium–bicarbonate cotransporter, NBCe1, is a high‐affinity bicarbonate carrier in cortical astrocytes. In the present study, we investigated whether NBCe1 plays a role in bicarbonate sensing in astrocytes, and in determining the pHi responses to extracellular acid/base challenges. We measured changes in intracellular H+ and Na+ in

  4. Mechanism of Corrosion by Naphthenic Acids and Organosulfur Compounds at High Temperatures

    NASA Astrophysics Data System (ADS)

    Jin, Peng

    Due to the law of supply and demand, the last decade has witnessed a skyrocketing in the price of light sweet crude oil. Therefore, refineries are increasingly interested in "opportunity crudes", characterized by their discounted price and relative ease of procurement. However, the attractive economics of opportunity crudes come with the disadvantage of high acid/organosulfur compound content, which could lead to corrosion and even failure of facilities in refineries. However, it is generally accepted that organosulfur compounds may form protective iron sulfide layers on the metal surface and decrease the corrosion rate. Therefore, it is necessary to investigate the corrosive property of crudes at high temperatures, the mechanism of corrosion by acids (naphthenic acids) in the presence of organosulfur compounds, and methods to mitigate its corrosive effect. In 2004, an industrial project was initiated at the Institute for Corrosion and Multiphase Technology to investigate the corrosion by naphthenic acids and organosulfur compounds. In this project, for each experiment there were two experimentation phases: pretreatment and challenge. In the first pretreatment phase, a stirred autoclave was filled with a real crude oil fraction or model oil of different acidity and organosulfur compound concentration. Then, the stirred autoclave was heated to high temperatures to examine the corrosivity of the oil to different materials (specimens made from CS and 5% Cr containing steel were used). During the pretreatment, corrosion product layers were formed on the metal surface. In the second challenge phase, the steel specimens pretreated in the first phase were inserted into a rotating cylinder autoclave, called High Velocity Rig (HVR). The HVR was fed with a high-temperature oil solution of naphthenic acids to attack the iron sulfide layers. Based on the difference of specimen weight loss between the two steps, the net corrosion rate could be calculated and the protectiveness

  5. Anti-Sigma Factors in E. coli: Common Regulatory Mechanisms Controlling Sigma Factors Availability

    PubMed Central

    Treviño-Quintanilla, Luis Gerardo; Freyre-González, Julio Augusto; Martínez-Flores, Irma

    2013-01-01

    In bacteria, transcriptional regulation is a key step in cellular gene expression. All bacteria contain a core RNA polymerase that is catalytically competent but requires an additional σ factor for specific promoter recognition and correct transcriptional initiation. The RNAP core is not able to selectively bind to a given σ factor. In contrast, different σ factors have different affinities for the RNAP core. As a consequence, the concentration of alternate σ factors requires strict regulation in order to properly control the delicate interplay among them, which favors the competence for the RNAP core. This control is archived by different σ/anti-σ controlling mechanisms that shape complex regulatory networks and cascades, and enable the response to sudden environmental cues, whose global understanding is a current challenge for systems biology. Although there have been a number of excellent studies on each of these σ/anti-σ post-transcriptional regulatory systems, no comprehensive comparison of these mechanisms in a single model organism has been conducted. Here, we survey all these systems in E. coli dissecting and analyzing their inner workings and highlightin their differences. Then, following an integral approach, we identify their commonalities and outline some of the principles exploited by the cell to effectively and globally reprogram the transcriptional machinery. These principles provide guidelines for developing biological synthetic circuits enabling an efficient and robust response to sudden stimuli. PMID:24396271

  6. Multiple regulatory systems coordinate DNA replication with cell growth in Bacillus subtilis.

    PubMed

    Murray, Heath; Koh, Alan

    2014-10-01

    In many bacteria the rate of DNA replication is linked with cellular physiology to ensure that genome duplication is coordinated with growth. Nutrient-mediated growth rate control of DNA replication initiation has been appreciated for decades, however the mechanism(s) that connects these cell cycle activities has eluded understanding. In order to help address this fundamental question we have investigated regulation of DNA replication in the model organism Bacillus subtilis. Contrary to the prevailing view we find that changes in DnaA protein level are not sufficient to account for nutrient-mediated growth rate control of DNA replication initiation, although this regulation does require both DnaA and the endogenous replication origin. We go on to report connections between DNA replication and several essential cellular activities required for rapid bacterial growth, including respiration, central carbon metabolism, fatty acid synthesis, phospholipid synthesis, and protein synthesis. Unexpectedly, the results indicate that multiple regulatory systems are involved in coordinating DNA replication with cell physiology, with some of the regulatory systems targeting oriC while others act in a oriC-independent manner. We propose that distinct regulatory systems are utilized to control DNA replication in response to diverse physiological and chemical changes.

  7. Towards bridging the gap between acid-base transporters and neuronal excitability modulation

    PubMed Central

    Liu, Ying; Chen, Li-Ming

    2014-01-01

    pH homeostasis is a fundamental regulator of the function of the central nervous system. Dysfunction of acid-base transporters often results in disturbance of neuronal excitability. In a latest issue of Journal of Neuroscience, Jones et al. report that increasing intracellular bicarbonate concentration substantially stimulates the excitability of pyramidal neurons from mouse hippocampus by inhibiting KCNQ potassium channel. The finding shed important new light in understanding the molecular mechanism underlying the regulation of neuronal excitability by acid-base transporters. PMID:25755844

  8. Biological and regulatory roles of acid-induced small RNA RyeC in Salmonella Typhimurium.

    PubMed

    Ryan, Daniel; Mukherjee, Mohana; Nayak, Ritu; Dutta, Ria; Suar, Mrutyunjay

    2018-05-03

    Salmonella Typhimurium is an enteric pathogen that has evolved masterful strategies to enable survival under stress conditions both within and outside a host. The acid tolerance response (ATR) is one such mechanism that enhances the viability of acid adapted bacteria to lethal pH levels. While numerous studies exist on the protein coding components of this response, there is very little data on the roles of small RNAs (sRNAs). These non-coding RNA molecules have recently been shown to play roles as regulators of bacterial stress response and virulence pathways. They function through complementary base pairing interactions with target mRNAs and affect their translation and/or stability. There are also a few that directly bind to proteins by mimicking their respective targets. Here, we identify several sRNAs expressed during the ATR of S. Typhimurium and characterize one highly induced candidate, RyeC. Further, we identify ptsI as a trans-encoded target that is directly regulated by this sRNA. From a functional perspective, over-expression of RyeC in Salmonella produced a general attenuation of several in vitro phenotypes including acid survival, motility, adhesion and invasion of epithelial cell lines as well as replication within macrophages. Together, this study highlights the diverse roles played by sRNAs in acid tolerance and virulence of S. Typhimurium. Copyright © 2018. Published by Elsevier B.V.

  9. Retinoic acid treated human dendritic cells induce T regulatory cells via the expression of CD141 and GARP which is impaired with age.

    PubMed

    Agrawal, Sudhanshu; Ganguly, Sreerupa; Tran, Alexander; Sundaram, Padmaja; Agrawal, Anshu

    2016-06-01

    Aged subjects display increased susceptibility to mucosal diseases. Retinoic Acid (RA) plays a major role in inducing tolerance in the mucosa. RA acts on Dendritic cells (DCs) to induce mucosal tolerance. Here we compared the response of DCs from aged and young individuals to RA with a view to understand the role of DCs in age-associated increased susceptibility to mucosal diseases. Our investigations revealed that compared to young DCs, RA stimulated DCs from aged subjects are defective in inducing IL-10 and T regulatory cells. Examinations of the underlying mechanisms indicated that RA exposure led to the upregulation of CD141 and GARP on DCs which rendered the DCs tolerogenic. CD141(hi), GARP(+) DCs displayed enhanced capacity to induce T regulatory cells compared to CD141(lo) and GARP(-) DCs. Unlike RA stimulated DCs from young, DCs from aged subjects exhibited diminished upregulation of both CD141 and GARP. The percentage of DCs expressing CD141 and GARP on RA treatment was significantly reduced in DCs from aged individuals. Furthermore, the remaining CD141(hi), GARP(+) DCs from aged individuals were also deficient in inducing T regs. In summary, reduced response of aged DCs to RA enhances mucosal inflammation in the elderly, increasing their susceptibility to mucosal diseases.

  10. Retinoic acid treated human dendritic cells induce T regulatory cells via the expression of CD141 and GARP which is impaired with age

    PubMed Central

    Agrawal, Sudhanshu; Ganguly, Sreerupa; Tran, Alexander; Sundaram, Padmaja; Agrawal, Anshu

    2016-01-01

    Aged subjects display increased susceptibility to mucosal diseases. Retinoic Acid (RA) plays a major role in inducing tolerance in the mucosa. RA acts on Dendritic cells (DCs) to induce mucosal tolerance. Here we compared the response of DCs from aged and young individuals to RA with a view to understand the role of DCs in age-associated increased susceptibility to mucosal diseases. Our investigations revealed that compared to young DCs, RA stimulated DCs from aged subjects are defective in inducing IL-10 and T regulatory cells. Examinations of the underlying mechanisms indicated that RA exposure led to the upregulation of CD141 and GARP on DCs which rendered the DCs tolerogenic. CD141hi, GARP+ DCs displayed enhanced capacity to induce T regulatory cells compared to CD141lo and GARP− DCs. Unlike RA stimulated DCs from young, DCs from aged subjects exhibited diminished upregulation of both CD141 and GARP. The percentage of DCs expressing CD141 and GARP on RA treatment was significantly reduced in DCs from aged individuals. Furthermore, the remaining CD141hi, GARP+ DCs from aged individuals were also deficient in inducing T regs. In summary, reduced response of aged DCs to RA enhances mucosal inflammation in the elderly, increasing their susceptibility to mucosal diseases. PMID:27244900

  11. Properties of Base Stocks Obtained from Used Engine Oils by Acid/Clay Re-refining (Proprietes des Stocks de Base Obtenus par Regeneration des Huiles a Moteur Usees par le Procede de Traitement a l’Acide et a la Terre),

    DTIC Science & Technology

    1980-09-01

    Research Conseil national Council Canada de recherches Canada LEY EL < PROPERTIES OF BASE STOCKS OBTAINED FROM USED ENGINE OILS BY ACID /CLAY RE-REFINING DTIC...MECHANICAL ENGINEERING REPORT Canad NC MP75 NRC NO. 18719 PROPERTIES OF BASE STOCKS OBTAINED FROM USED ENGINE OILS BY ACID /CLAY RE-REFINING (PROPRIETES...refined Base Stock ..................................... 10 3 Physical Test Data of Acid /Clay Process - Re-refined Base Stock Oils ............ 11 4

  12. MYCN-driven regulatory mechanisms controlling LIN28B in neuroblastoma

    PubMed Central

    Beckers, Anneleen; Van Peer, Gert; Carter, Daniel R.; Gartlgruber, Moritz; Herrmann, Carl; Agarwal, Saurabh; Helsmoortel, Hetty H.; Althoff, Kristina; Molenaar, Jan J.; Cheung, Belamy B.; Schulte, Johannes H.; Benoit, Yves; Shohet, Jason M.; Westermann, Frank; Marshall, Glenn M.; Vandesompele, Jo; De Preter, Katleen; Speleman, Frank

    2016-01-01

    LIN28B has been identified as an oncogene in various tumor entities, including neuroblastoma, a childhood cancer that originates from neural crest-derived cells, and is characterized by amplification of the MYCN oncogene. Recently, elevated LIN28B expression levels were shown to contribute to neuroblastoma tumorigenesis via let-7 dependent de-repression of MYCN. However, additional insight in the regulation of LIN28B in neuroblastoma is lacking. Therefore, we have performed a comprehensive analysis of the regulation of LIN28B in neuroblastoma, with a specific focus on the contribution of miRNAs. We show that MYCN regulates LIN28B expression in neuroblastoma tumors via two distinct parallel mechanisms. First, through an unbiased LIN28B-3′UTR reporter screen, we found that miR-26a-5p and miR-26b-5p regulate LIN28B expression. Next, we demonstrated that MYCN indirectly affects the expression of miR-26a-5p, and hence regulates LIN28B, therefor establishing a MYCN-miR-26a-5p-LIN28B regulatory axis. Second, we provide evidence that MYCN regulates LIN28B expression via interaction with the LIN28B promotor, establishing a direct MYCN-LIN28B regulatory axis. We believe that these findings mark LIN28B as an important effector of the MYCN oncogenic phenotype and underlines the importance of MYCN-regulated miRNAs in establishing the MYCN-driven oncogenic process. PMID:26123663

  13. The regulatory network of ThbZIP1 in response to abscisic acid treatment

    PubMed Central

    Ji, Xiaoyu; Liu, Guifeng; Liu, Yujia; Nie, Xianguang; Zheng, Lei; Wang, Yucheng

    2015-01-01

    Previously, a bZIP transcription factor from Tamarix hispida, ThbZIP1, was characterized: plants overexpressing ThbZIP1 displayed improved salt stress tolerance but were sensitive to abscisic acid (ABA). In the current study, we further characterized the regulatory network of ThbZIP1 and the mechanism of ABA sensitivity mediated by ThbZIP1. An ABF transcription factor from T. hispida, ThABF1, directly regulates the expression of ThbZIP1. Microarray analysis identified 1662 and 1609 genes that were respectively significantly upregulated or downregulated by ThbZIP1 when exposed to ABA. Gene ontology (GO) analysis showed that the processes including “response to stimulus,” “catalytic activity,” “binding function,” and “metabolic process” were highly altered in ThbZIP1 expressing plants exposed to ABA. The gene expression in ThbZIP1 transformed plants were compared between exposed to ABA and salt on the genome scale. Genes differentially regulated by both salt and ABA treatment only accounted for 9.75% of total differentially regulated genes. GO analysis showed that structural molecule activity, organelle part, membrane-enclosed lumen, reproduction, and reproductive process are enhanced by ABA but inhibited by salt stress. Conversely, immune system and multi-organism process were improved by salt but inhibited by ABA. Transcription regulator activity, enzyme regulator activity, and developmental process were significantly altered by ABA but were not affected by salt stress. Our study provides insights into how ThbZIP1 mediates ABA and salt stress response at the molecular level. PMID:25713576

  14. Strong ion calculator--a practical bedside application of modern quantitative acid-base physiology.

    PubMed

    Lloyd, P

    2004-12-01

    To review acid-base balance by considering the physical effects of ions in solution and describe the use of a calculator to derive the strong ion difference and Atot and strong ion gap. A review of articles reporting on the use of strong ion difference and Atot in the interpretation of acid base balance. Tremendous progress has been made in the last decade in our understanding of acid-base physiology. We now have a quantitative understanding of the mechanisms underlying the acidity of an aqueous solution. We can now predict the acidity given information about the concentration of the various ion-forming species within it. We can predict changes in acid-base status caused by disturbance of these factors, and finally, we can detect unmeasured anions with greater sensitivity than was previously possible with the anion gap, using either arterial or venous blood sampling. Acid-base interpretation has ceased to be an intuitive and arcane art. Much of it is now an exact computation that can be automated and incorporated into an online hospital laboratory information system. All diseases and all therapies can affect a patient's acid-base status only through the final common pathway of one or more of the three independent factors. With Constable's equations we can now accurately predict the acidity of plasma. When there is a discrepancy between the observed and predicted acidity we can deduce the net concentration of unmeasured ions to account for the difference.

  15. Acid-base chemistry of frustrated water at protein interfaces.

    PubMed

    Fernández, Ariel

    2016-01-01

    Water molecules at a protein interface are often frustrated in hydrogen-bonding opportunities due to subnanoscale confinement. As shown, this condition makes them behave as a general base that may titrate side-chain ammonium and guanidinium cations. Frustration-based chemistry is captured by a quantum mechanical treatment of proton transference and shown to remove same-charge uncompensated anticontacts at the interface found in the crystallographic record and in other spectroscopic information on the aqueous interface. Such observations are untenable within classical arguments, as hydronium is a stronger acid than ammonium or guanidinium. Frustration enables a directed Grotthuss mechanism for proton transference stabilizing same-charge anticontacts. © 2015 Federation of European Biochemical Societies.

  16. Modulation of cAMP levels by high-fat diet and curcumin and regulatory effects on CD36/FAT scavenger receptor/fatty acids transporter gene expression.

    PubMed

    Zingg, Jean-Marc; Hasan, Syeda T; Nakagawa, Kiyotaka; Canepa, Elisa; Ricciarelli, Roberta; Villacorta, Luis; Azzi, Angelo; Meydani, Mohsen

    2017-01-02

    Curcumin, a polyphenol from turmeric (Curcuma longa), reduces inflammation, atherosclerosis, and obesity in several animal studies. In Ldlr -/- mice fed a high-fat diet (HFD), curcumin reduces plasma lipid levels, therefore contributing to a lower accumulation of lipids and to reduced expression of fatty acid transport proteins (CD36/FAT, FABP4/aP2) in peritoneal macrophages. In this study, we analyzed the molecular mechanisms by which curcumin (500, 1000, 1500 mg/kg diet, for 4 months) may influence plasma and tissue lipid levels in Ldlr -/- mice fed an HFD. In liver, HFD significantly suppressed cAMP levels, and curcumin restored almost normal levels. Similar trends were observed in adipose tissues, but not in brain, skeletal muscle, spleen, and kidney. Treatment with curcumin increased phosphorylation of CREB in liver, what may play a role in regulatory effects of curcumin in lipid homeostasis. In cell lines, curcumin increased the level of cAMP, activated the transcription factor CREB and the human CD36 promoter via a sequence containing a consensus CREB response element. Regulatory effects of HFD and Cur on gene expression were observed in liver, less in skeletal muscle and not in brain. Since the cAMP/protein kinase A (PKA)/CREB pathway plays an important role in lipid homeostasis, energy expenditure, and thermogenesis by increasing lipolysis and fatty acid β-oxidation, an increase in cAMP levels induced by curcumin may contribute to its hypolipidemic and anti-atherosclerotic effects. © 2016 BioFactors, 43(1):42-53, 2017. © 2016 International Union of Biochemistry and Molecular Biology.

  17. Transancestral fine-mapping of four type 2 diabetes susceptibility loci highlights potential causal regulatory mechanisms.

    PubMed

    Horikoshi, Momoko; Pasquali, Lorenzo; Wiltshire, Steven; Huyghe, Jeroen R; Mahajan, Anubha; Asimit, Jennifer L; Ferreira, Teresa; Locke, Adam E; Robertson, Neil R; Wang, Xu; Sim, Xueling; Fujita, Hayato; Hara, Kazuo; Young, Robin; Zhang, Weihua; Choi, Sungkyoung; Chen, Han; Kaur, Ismeet; Takeuchi, Fumihiko; Fontanillas, Pierre; Thuillier, Dorothée; Yengo, Loic; Below, Jennifer E; Tam, Claudia H T; Wu, Ying; Abecasis, Gonçalo; Altshuler, David; Bell, Graeme I; Blangero, John; Burtt, Noél P; Duggirala, Ravindranath; Florez, Jose C; Hanis, Craig L; Seielstad, Mark; Atzmon, Gil; Chan, Juliana C N; Ma, Ronald C W; Froguel, Philippe; Wilson, James G; Bharadwaj, Dwaipayan; Dupuis, Josee; Meigs, James B; Cho, Yoon Shin; Park, Taesung; Kooner, Jaspal S; Chambers, John C; Saleheen, Danish; Kadowaki, Takashi; Tai, E Shyong; Mohlke, Karen L; Cox, Nancy J; Ferrer, Jorge; Zeggini, Eleftheria; Kato, Norihiro; Teo, Yik Ying; Boehnke, Michael; McCarthy, Mark I; Morris, Andrew P

    2016-05-15

    To gain insight into potential regulatory mechanisms through which the effects of variants at four established type 2 diabetes (T2D) susceptibility loci (CDKAL1, CDKN2A-B, IGF2BP2 and KCNQ1) are mediated, we undertook transancestral fine-mapping in 22 086 cases and 42 539 controls of East Asian, European, South Asian, African American and Mexican American descent. Through high-density imputation and conditional analyses, we identified seven distinct association signals at these four loci, each with allelic effects on T2D susceptibility that were homogenous across ancestry groups. By leveraging differences in the structure of linkage disequilibrium between diverse populations, and increased sample size, we localised the variants most likely to drive each distinct association signal. We demonstrated that integration of these genetic fine-mapping data with genomic annotation can highlight potential causal regulatory elements in T2D-relevant tissues. These analyses provide insight into the mechanisms through which T2D association signals are mediated, and suggest future routes to understanding the biology of specific disease susceptibility loci. © The Author 2016. Published by Oxford University Press.

  18. Acid-base and ion balance in fishes with bimodal respiration.

    PubMed

    Shartau, R B; Brauner, C J

    2014-03-01

    The evolution of air breathing during the Devonian provided early fishes with bimodal respiration with a stable O2 supply from air. This was, however, probably associated with challenges and trade-offs in terms of acid-base balance and ionoregulation due to reduced gill:water interaction and changes in gill morphology associated with air breathing. While many aspects of acid-base and ionoregulation in air-breathing fishes are similar to water breathers, the specific cellular and molecular mechanisms involved remain largely unstudied. In general, reduced ionic permeability appears to be an important adaptation in the few bimodal fishes investigated but it is not known if this is a general characteristic. The kidney appears to play an important role in minimizing ion loss to the freshwater environment in the few species investigated, and while ion uptake across the gut is probably important, it has been largely unexplored. In general, air breathing in facultative air-breathing fishes is associated with an acid-base disturbance, resulting in an increased partial pressure of arterial CO2 and a reduction in extracellular pH (pHE ); however, several fishes appear to be capable of tightly regulating tissue intracellular pH (pHI ), despite a large sustained reduction in pHE , a trait termed preferential pHI regulation. Further studies are needed to determine whether preferential pHI regulation is a general trait among bimodal fishes and if this confers reduced sensitivity to acid-base disturbances, including those induced by hypercarbia, exhaustive exercise and hypoxia or anoxia. Additionally, elucidating the cellular and molecular mechanisms may yield insight into whether preferential pHI regulation is a trait ultimately associated with the early evolution of air breathing in vertebrates. © 2014 The Fisheries Society of the British Isles.

  19. Exploration of a mechanism for the production of highly unsaturated fatty acids in Scenedesmus sp. at low temperature grown on oil crop residue based medium.

    PubMed

    Lu, Qian; Li, Jun; Wang, Jinghan; Li, Kun; Li, Jingjing; Han, Pei; Chen, Paul; Zhou, Wenguang

    2017-11-01

    The ability of algae to produce lipids comprising of unsaturated fatty acids varies with strains and culture conditions. This study investigates the effect of temperature on the production of unsaturated fatty acids in Scenedesmus sp. grown on oil crop residue based medium. At low temperature (10°C), synthesis of lipids compromising of high contents of unsaturated fatty acids took place primarily in the early stage while protein accumulation mainly occurred in the late stage. This stepwise lipid-protein synthesis process was found to be associated with the contents of acetyl-CoA and α-KG in the algal cells. A mechanism was proposed and tested through simulation experiments which quantified the carbon flux allocation in algal cells at different cultivation stages. It is concluded that low culture temperature such as 10°C is suitable for the production of lipids comprising of unsaturated fatty acids. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Mechanical behavior of polymer-based vs. metallic-based bioresorbable stents

    PubMed Central

    Ang, Hui Ying; Huang, Ying Ying; Lim, Soo Teik; Wong, Philip; Joner, Michael

    2017-01-01

    Bioresorbable scaffolds (BRS) were developed to overcome the drawbacks of current metallic drug-eluting stents (DES), such as late in-stent restenosis and caging of the vessel permanently. The concept of the BRS is to provide transient support to the vessel during healing before being degraded and resorbed by the body, freeing the vessel and restoring vasomotion. The mechanical properties of the BRS are influenced by the choice of the material and processing methods. Due to insufficient radial strength of the bioresorbable material, BRS often required large strut profile as compared to conventional metallic DES. Having thick struts will in turn affect the deliverability of the device and may cause flow disturbance, thereby increasing the incidence of acute thrombotic events. Currently, the bioresorbable poly-l-lactic acid (PLLA) polymer and magnesium (Mg) alloys are being investigated as materials in BRS technologies. The bioresorption process, mechanical properties, in vitro observations and clinical outcomes of PLLA-based and Mg-based BRS will be examined in this review. PMID:28894598

  1. Regulatory mechanisms of metabolic flexibility in the dark-eyed junco (Junco hyemalis).

    PubMed

    Stager, Maria; Swanson, David L; Cheviron, Zachary A

    2015-03-01

    Small temperate birds reversibly modify their aerobic performance to maintain thermoregulatory homeostasis under seasonally changing environmental conditions and these physiological adjustments may be attributable to changes in the expression of genes in the underlying regulatory networks. Here, we report the results of an experimental procedure designed to gain insight into the fundamental mechanisms of metabolic flexibility in the dark-eyed junco (Junco hyemalis). We combined genomic transcriptional profiles with measures of metabolic enzyme activities and whole-animal thermogenic performance from juncos exposed to four 6-week acclimation treatments that varied in temperature (cold, 3°C; warm, 24°C) and photoperiod (short day, 8 h light:16 h dark; long day, 16 h light:8 h dark). Cold-acclimated birds increased thermogenic capacity compared with warm-acclimated birds, and this enhanced performance was associated with upregulation of genes involved in muscle hypertrophy, angiogenesis, and lipid transport and oxidation, as well as with catabolic enzyme activities. These physiological changes occurred over ecologically relevant timescales, suggesting that birds make regulatory adjustments to interacting, hierarchical pathways in order to seasonally enhance thermogenic capacity. © 2015. Published by The Company of Biologists Ltd.

  2. Correlated accumulation of anthocyanins and rosmarinic acid in mechanically stressed red cell suspensions of basil (Ocimum basilicum).

    PubMed

    Strazzer, Pamela; Guzzo, Flavia; Levi, Marisa

    2011-02-15

    A red basil cell line (T2b) rich in rosmarinic acid (RA) was selected for the stable production of anthocyanins (ACs) in the dark. Cell suspension cultures were subjected to mechanical stress through increased agitation (switch from 90 to 150 rpm) to determine the relationship between AC and RA accumulation. Cell extracts were analyzed by HPLC and LC-MS, and the resulting data were processed with multivariate statistical analysis. MS and MS/MS spectra facilitated the putative annotation of several complex cyanidin-based ACs, which were esterified with coumaric acid and, in some cases, also with malonic acid. It was also possible to identify various RA-related molecules, some caffeic and coumaric acid derivatives and some flavanones. Mechanical stress increased the total AC and RA contents, but reduced biomass accumulation. Many metabolites were induced by mechanical stress, including RA and some of its derivatives, most ACs, hydroxycinnamic acids and flavonoids, whereas the abundance of some RA dimers was reduced. Although AC and RA share a common early biosynthetic pathway (from phenylalanine to 4-coumaroyl-CoA) and could have similar or overlapping functions providing antioxidant activity against stress-generated reactive oxygen species, there appeared to be no competition between their individual pathways. Copyright © 2010 Elsevier GmbH. All rights reserved.

  3. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    NASA Astrophysics Data System (ADS)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  4. Uptake mechanism of valproic acid in human placental choriocarcinoma cell line (BeWo).

    PubMed

    Ushigome, F; Takanaga, H; Matsuo, H; Tsukimori, K; Nakano, H; Ohtani, H; Sawada, Y

    2001-04-13

    Valproic acid is an anticonvulsant widely used for the treatment of epilepsy. However, valproic acid is known to show fetal toxicity, including teratogenicity. In the present study, to elucidate the mechanisms of valproic acid transport across the blood-placental barrier, we carried out transcellular transport and uptake experiments with human placental choriocarcinoma epithelial cells (BeWo cells) in culture. The permeability coefficient of [3H]valproic acid in BeWo cells for the apical-to-basolateral flux was greater than that for the opposite flux, suggesting a higher unidirectional transport in the fetal direction. The uptake of [3H]valproic acid from the apical side was temperature-dependent and enhanced under acidic pH. In the presence of 50 microM carbonyl cyanide p-trifluoromethoxylhydrazone, the uptake of [3H]valproic acid was significantly reduced. A metabolic inhibitor, 10 mM sodium azide, also significantly reduced the uptake of [3H]valproic acid. Therefore, valproic acid is actively transported in a pH-dependent manner on the brush-border membrane of BeWo cells. Kinetic analysis of valproic acid uptake revealed the involvement of a non-saturable component and a saturable component. The Michaelis constant for the saturable transport (K(t)) was smaller under acidic pH, suggesting a proton-linked active transport mechanism for valproic acid in BeWo cells. In the inhibitory experiments, some short-chain fatty acids, such as acetic acid, lactic acid, propanoic acid and butyric acid, and medium-chain fatty acids, such as hexanoic acid and octanoic acid, inhibited the uptake of [3H]valproic acid. The uptake of [3H]valproic acid was also significantly decreased in the presence of 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid, salicylic acid and furosemide, which are well-known inhibitors of the anion exchange system. Moreover, p-aminohippuric acid significantly reduced the uptake of [3H]valproic acid. These results suggest that an active transport

  5. SuperSAGE analysis of the Nicotiana attenuata transcriptome after fatty acid-amino acid elicitation (FAC): identification of early mediators of insect responses

    PubMed Central

    2010-01-01

    Background Plants trigger and tailor defense responses after perception of the oral secretions (OS) of attacking specialist lepidopteran larvae. Fatty acid-amino acid conjugates (FACs) in the OS of the Manduca sexta larvae are necessary and sufficient to elicit the herbivory-specific responses in Nicotiana attenuata, an annual wild tobacco species. How FACs are perceived and activate signal transduction mechanisms is unknown. Results We used SuperSAGE combined with 454 sequencing to quantify the early transcriptional changes elicited by the FAC N-linolenoyl-glutamic acid (18:3-Glu) and virus induced gene silencing (VIGS) to examine the function of candidate genes in the M. sexta-N. attenuata interaction. The analysis targeted mRNAs encoding regulatory components: rare transcripts with very rapid FAC-elicited kinetics (increases within 60 and declines within 120 min). From 12,744 unique Tag sequences identified (UniTags), 430 and 117 were significantly up- and down-regulated ≥ 2.5-fold, respectively, after 18:3-Glu elicitation compared to wounding. Based on gene ontology classification, more than 25% of the annotated UniTags corresponded to putative regulatory components, including 30 transcriptional regulators and 22 protein kinases. Quantitative PCR analysis was used to analyze the FAC-dependent regulation of a subset of 27 of these UniTags and for most of them a rapid and transient induction was confirmed. Six FAC-regulated genes were functionally characterized by VIGS and two, a putative lipid phosphate phosphatase (LPP) and a protein of unknown function, were identified as important mediators of the M. sexta-N. attenuata interaction. Conclusions The analysis of the early changes in the transcriptome of N. attenuata after FAC elicitation using SuperSAGE/454 has identified regulatory genes involved in insect-specific mediated responses in plants. Moreover, it has provided a foundation for the identification of additional novel regulators associated with this

  6. SuperSAGE analysis of the Nicotiana attenuata transcriptome after fatty acid-amino acid elicitation (FAC): identification of early mediators of insect responses.

    PubMed

    Gilardoni, Paola A; Schuck, Stefan; Jüngling, Ruth; Rotter, Björn; Baldwin, Ian T; Bonaventure, Gustavo

    2010-04-14

    Plants trigger and tailor defense responses after perception of the oral secretions (OS) of attacking specialist lepidopteran larvae. Fatty acid-amino acid conjugates (FACs) in the OS of the Manduca sexta larvae are necessary and sufficient to elicit the herbivory-specific responses in Nicotiana attenuata, an annual wild tobacco species. How FACs are perceived and activate signal transduction mechanisms is unknown. We used SuperSAGE combined with 454 sequencing to quantify the early transcriptional changes elicited by the FAC N-linolenoyl-glutamic acid (18:3-Glu) and virus induced gene silencing (VIGS) to examine the function of candidate genes in the M. sexta-N. attenuata interaction. The analysis targeted mRNAs encoding regulatory components: rare transcripts with very rapid FAC-elicited kinetics (increases within 60 and declines within 120 min). From 12,744 unique Tag sequences identified (UniTags), 430 and 117 were significantly up- and down-regulated >or= 2.5-fold, respectively, after 18:3-Glu elicitation compared to wounding. Based on gene ontology classification, more than 25% of the annotated UniTags corresponded to putative regulatory components, including 30 transcriptional regulators and 22 protein kinases. Quantitative PCR analysis was used to analyze the FAC-dependent regulation of a subset of 27 of these UniTags and for most of them a rapid and transient induction was confirmed. Six FAC-regulated genes were functionally characterized by VIGS and two, a putative lipid phosphate phosphatase (LPP) and a protein of unknown function, were identified as important mediators of the M. sexta-N. attenuata interaction. The analysis of the early changes in the transcriptome of N. attenuata after FAC elicitation using SuperSAGE/454 has identified regulatory genes involved in insect-specific mediated responses in plants. Moreover, it has provided a foundation for the identification of additional novel regulators associated with this process.

  7. Origins and Mechanisms of miRNAs and siRNAs.

    PubMed

    Carthew, Richard W; Sontheimer, Erik J

    2009-02-20

    Over the last decade, approximately 20-30 nucleotide RNA molecules have emerged as critical regulators in the expression and function of eukaryotic genomes. Two primary categories of these small RNAs--short interfering RNAs (siRNAs) and microRNAs (miRNAs)--act in both somatic and germline lineages in a broad range of eukaryotic species to regulate endogenous genes and to defend the genome from invasive nucleic acids. Recent advances have revealed unexpected diversity in their biogenesis pathways and the regulatory mechanisms that they access. Our understanding of siRNA- and miRNA-based regulation has direct implications for fundamental biology as well as disease etiology and treatment.

  8. Abscisic Acid-Cytokinin Antagonism Modulates Resistance Against Pseudomonas syringae in Tobacco.

    PubMed

    Großkinsky, Dominik K; van der Graaff, Eric; Roitsch, Thomas

    2014-12-01

    Phytohormones are known as essential regulators of plant defenses, with ethylene, jasmonic acid, and salicylic acid as the central immunity backbone, while other phytohormones have been demonstrated to interact with this. Only recently, a function of the classic phytohormone cytokinin in plant immunity has been described in Arabidopsis, rice, and tobacco. Although interactions of cytokinins with salicylic acid and auxin have been indicated, the complete network of cytokinin interactions with other immunity-relevant phytohormones is not yet understood. Therefore, we studied the interaction of kinetin and abscisic acid as a negative regulator of plant immunity to modulate resistance in tobacco against Pseudomonas syringae. By analyzing infection symptoms, pathogen proliferation, and accumulation of the phytoalexin scopoletin as a key mediator of kinetin-induced resistance in tobacco, antagonistic interaction of these phytohormones in plant immunity was identified. Kinetin reduced abscisic acid levels in tobacco, while increased abscisic acid levels by exogenous application or inhibition of abscisic acid catabolism by diniconazole neutralized kinetin-induced resistance. Based on these results, we conclude that reduction of abscisic acid levels by enhanced abscisic acid catabolism strongly contributes to cytokinin-mediated resistance effects. Thus, the identified cytokinin-abscisic acid antagonism is a novel regulatory mechanism in plant immunity.

  9. Regulatory RNAs and control of epigenetic mechanisms: expectations for cognition and cognitive dysfunction.

    PubMed

    Butler, Anderson A; Webb, William M; Lubin, Farah D

    2016-01-01

    The diverse functions of noncoding RNAs (ncRNAs) can influence virtually every aspect of the transcriptional process including epigenetic regulation of genes. In the CNS, regulatory RNA networks and epigenetic mechanisms have broad relevance to gene transcription changes involved in long-term memory formation and cognition. Thus, it is becoming increasingly clear that multiple classes of ncRNAs impact neuronal development, neuroplasticity, and cognition. Currently, a large gap exists in our knowledge of how ncRNAs facilitate epigenetic processes, and how this phenomenon affects cognitive function. In this review, we discuss recent findings highlighting a provocative role for ncRNAs including lncRNAs and piRNAs in the control of epigenetic mechanisms involved in cognitive function. Furthermore, we discuss the putative roles for these ncRNAs in cognitive disorders such as schizophrenia and Alzheimer's disease.

  10. Sequential injection redox or acid-base titration for determination of ascorbic acid or acetic acid.

    PubMed

    Lenghor, Narong; Jakmunee, Jaroon; Vilen, Michael; Sara, Rolf; Christian, Gary D; Grudpan, Kate

    2002-12-06

    Two sequential injection titration systems with spectrophotometric detection have been developed. The first system for determination of ascorbic acid was based on redox reaction between ascorbic acid and permanganate in an acidic medium and lead to a decrease in color intensity of permanganate, monitored at 525 nm. A linear dependence of peak area obtained with ascorbic acid concentration up to 1200 mg l(-1) was achieved. The relative standard deviation for 11 replicate determinations of 400 mg l(-1) ascorbic acid was 2.9%. The second system, for acetic acid determination, was based on acid-base titration of acetic acid with sodium hydroxide using phenolphthalein as an indicator. The decrease in color intensity of the indicator was proportional to the acid content. A linear calibration graph in the range of 2-8% w v(-1) of acetic acid with a relative standard deviation of 4.8% (5.0% w v(-1) acetic acid, n=11) was obtained. Sample throughputs of 60 h(-1) were achieved for both systems. The systems were successfully applied for the assays of ascorbic acid in vitamin C tablets and acetic acid content in vinegars, respectively.

  11. Isotope Effects and Mechanism of the Asymmetric BOROX Brønsted Acid Catalyzed Aziridination Reaction

    PubMed Central

    Vetticatt, Mathew J.; Desai, Aman A.; Wulff, William D.

    2013-01-01

    The mechanism of the chiral VANOL-BOROX Brønsted acid catalyzed aziridination reaction of imines and ethyldiazoacetate has been studied using a combination of experimental kinetic isotope effects and theoretical calculations. A stepwise mechanism where reversible formation of a diazonium ion intermediate precedes rate-limiting ring-closure to form the cis-aziridine is implicated. A revised model for the origin of enantio- and diastereoselectivity is proposed based on relative energies of the ring closing transition structures. PMID:23687986

  12. Study on the regulatory mechanism of the lipid metabolism pathways during chicken male germ cell differentiation based on RNA-seq.

    PubMed

    Zuo, Qisheng; Li, Dong; Zhang, Lei; Elsayed, Ahmed Kamel; Lian, Chao; Shi, Qingqing; Zhang, Zhentao; Zhu, Rui; Wang, Yinjie; Jin, Kai; Zhang, Yani; Li, Bichun

    2015-01-01

    Here, we explore the regulatory mechanism of lipid metabolic signaling pathways and related genes during differentiation of male germ cells in chickens, with the hope that better understanding of these pathways may improve in vitro induction. Fluorescence-activated cell sorting was used to obtain highly purified cultures of embryonic stem cells (ESCs), primitive germ cells (PGCs), and spermatogonial stem cells (SSCs). The total RNA was then extracted from each type of cell. High-throughput analysis methods (RNA-seq) were used to sequence the transcriptome of these cells. Gene Ontology (GO) analysis and the KEGG database were used to identify lipid metabolism pathways and related genes. Retinoic acid (RA), the end-product of the retinol metabolism pathway, induced in vitro differentiation of ESC into male germ cells. Quantitative real-time PCR (qRT-PCR) was used to detect changes in the expression of the genes involved in the retinol metabolic pathways. From the results of RNA-seq and the database analyses, we concluded that there are 328 genes in 27 lipid metabolic pathways continuously involved in lipid metabolism during the differentiation of ESC into SSC in vivo, including retinol metabolism. Alcohol dehydrogenase 5 (ADH5) and aldehyde dehydrogenase 1 family member A1 (ALDH1A1) are involved in RA synthesis in the cell. ADH5 was specifically expressed in PGC in our experiments and aldehyde dehydrogenase 1 family member A1 (ALDH1A1) persistently increased throughout development. CYP26b1, a member of the cytochrome P450 superfamily, is involved in the degradation of RA. Expression of CYP26b1, in contrast, decreased throughout development. Exogenous RA in the culture medium induced differentiation of ESC to SSC-like cells. The expression patterns of ADH5, ALDH1A1, and CYP26b1 were consistent with RNA-seq results. We conclude that the retinol metabolism pathway plays an important role in the process of chicken male germ cell differentiation.

  13. Specific interactions between DNA and regulatory protein controlled by ligand-binding: Ab initio molecular simulation

    NASA Astrophysics Data System (ADS)

    Matsushita, Y.; Murakawa, T.; Shimamura, K.; Oishi, M.; Ohyama, T.; Kurita, N.

    2015-02-01

    The catabolite activator protein (CAP) is one of the regulatory proteins controlling the transcription mechanism of gene. Biochemical experiments elucidated that the complex of CAP with cyclic AMP (cAMP) is indispensable for controlling the mechanism, while previous molecular simulations for the monomer of CAP+cAMP complex revealed the specific interactions between CAP and cAMP. However, the effect of cAMP-binding to CAP on the specific interactions between CAP and DNA is not elucidated at atomic and electronic levels. We here considered the ternary complex of CAP, cAMP and DNA in solvating water molecules and investigated the specific interactions between them at atomic and electronic levels using ab initio molecular simulations based on classical molecular dynamics and ab initio fragment molecular orbital methods. The results highlight the important amino acid residues of CAP for the interactions between CAP and cAMP and between CAP and DNA.

  14. Modulation of heart rate and heart rate variability by n-3 long chain polyunsaturated fatty acids: Speculation on mechanism(s).

    PubMed

    Drewery, Merritt L; Spedale, Steven B; Lammi-Keefe, Carol J

    2017-09-01

    Heart rate (HR) and heart rate variability (HRV) are valuable markers of health. Although the underlying mechanism(s) are controversial, it is well documented that n-3 long chain polyunsaturated fatty acid (LCPUFA) intake improves HR and HRV in various populations. Autonomic modulation and/or alterations in cardiac electrophysiology are commonly cited as potential mechanisms responsible for these effects. This article reviews existing evidence for each and explores a separate mechanism which has not received much attention but has scientific merit. Based on presented evidence, it is proposed that n-3 LCPUFAs affect HR and HRV directly by autonomic modulation and indirectly by altering circulating factors, both dependently and independently of the autonomic nervous system. The evidence for changes in cardiac electrophysiology as the mechanism by which n-3 LCPUFAs affect HR and HRV needs strengthening. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Mechanisms of bile acid mediated inflammation in the liver.

    PubMed

    Li, Man; Cai, Shi-Ying; Boyer, James L

    2017-08-01

    Bile acids are synthesized in the liver and are the major component in bile. Impaired bile flow leads to cholestasis that is characterized by elevated levels of bile acid in the liver and serum, followed by hepatocyte and biliary injury. Although the causes of cholestasis have been extensively studied, the molecular mechanisms as to how bile acids initiate liver injury remain controversial. In this chapter, we summarize recent advances in the pathogenesis of bile acid induced liver injury. These include bile acid signaling pathways in hepatocytes as well as the response of cholangiocytes and innate immune cells in the liver in both patients with cholestasis and cholestatic animal models. We focus on how bile acids trigger the production of molecular mediators of neutrophil recruitment and the role of the inflammatory response in this pathological process. These advances point to a number of novel targets where drugs might be judged to be effective therapies for cholestatic liver injury. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Mechanisms of ketamine on mice hippocampi shown by gas chromatography-mass spectrometry-based metabolomic analysis.

    PubMed

    Lian, Bin; Xia, Jinjun; Yang, Xun; Zhou, Chanjuan; Gong, Xue; Gui, Siwen; Mao, Qiang; Wang, Ling; Li, Pengfei; Huang, Cheng; Qi, Xunzhong; Xie, Peng

    2018-06-13

    In the present study, we used a gas chromatography-mass spectrometry-based metabolomics method to evaluate the effects of ketamine on mice hippocampi. Multivariate statistical analysis and ingenuity pathway analysis were then used to identify and explore the potential mechanisms and biofunction of ketamine. Compared with the control (CON) group, 14 differential metabolites that involved amino acid metabolism, energy metabolism, and oxidative stress metabolism were identified. After combination with 2,3-dihydroxy-6-nitro-7-sulfamoyl-benzo[f]quinoxaline-2,3-dione (NBQX) administration, six of the 14 metabolites remained significantly differentially expressed between the ketamine (KET) and KET+NBQX groups, including glycine, alanine, glutamine, aspartic acid, myoinositol, and ascorbate, whereas no difference was found in the levels of the other eight metabolites between the KET and KET+NBQX groups, including phosphate, 4-aminobutyric acid, urea, creatine, L-malic acid, galactinol, inosine, and aminomalonic. Our findings indicate that ketamine exerts antidepressant effects through an α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid inhibition-dependent mechanism and a mechanism not affected by α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid inhibition. Which provides further insight into the therapeutic mechanisms of ketamine in the hippocampus.

  17. Pesticide regulations for agriculture: Chemically flawed regulatory practice.

    PubMed

    Gamble, Donald S; Bruccoleri, Aldo G

    2016-08-02

    Two categories of pesticide soil models now exist. Government regulatory agencies use pesticide fate and transport hydrology models, including versions of PRZM.gw. They have good descriptions of pesticide transport by water flow. Their descriptions of chemical mechanisms are unrealistic, having been postulated using the universally accepted but incorrect pesticide soil science. The objective of this work is to report experimental tests of a pesticide soil model in use by regulatory agencies and to suggest possible improvements. Tests with experimentally based data explain why PRZM.gw predictions can be wrong by orders of magnitude. Predictive spreadsheet models are the other category. They are experimentally based, with chemical stoichiometry applied to integral kinetic rate laws for sorption, desorption, intra-particle diffusion, and chemical reactions. They do not account for pesticide transport through soils. Each category of models therefore lacks what the other could provide. They need to be either harmonized or replaced. Some preliminary tests indicate that an experimental mismatch between the categories of models will have to be resolved. Reports of pesticides in the environment and the medical problems that overlap geographically indicate that government regulatory practice needs to account for chemical kinetics and mechanisms. Questions about possible cause and effect links could then be investigated.

  18. Inflammatory, metabolic, and genetic mechanisms of vascular calcification

    PubMed Central

    Demer, Linda L.; Tintut, Yin

    2014-01-01

    This review centers on updating the active research area of vascular calcification. This pathology underlies substantial cardiovascular morbidity and mortality, through adverse mechanical effects on vascular compliance, vasomotion, and, most likely, plaque stability. Biomineralization is a complex, regulated process occurring widely throughout nature. Decades ago, its presence in the vasculature was considered a mere curiosity and an unregulated, “dystrophic” process that does not involve biological mechanisms. While it remains controversial whether the process has any adaptive value or past evolutionary advantage, substantial advances have been made in understanding the biological mechanisms driving the process. Different types of calcific vasculopathy, such as inflammatory vs. metabolic, have parallel mechanisms in skeletal bone calcification, such as intramembranous and endochondral ossification. Recent work has identified important regulatory roles for inflammation, oxidized lipids, elastin, alkaline phosphatase, osteoprogenitor cells, matrix gamma-carboxyglutamic acid protein (MGP), transglutaminase, osteoclastic regulatory factors, phosphate regulatory hormones and receptors, apoptosis, prelamin A, autophagy, and microvesicles or microparticles similar to the matrix vesicles of skeletal bone. Recent work has uncovered fascinating interactions between MGP, vitamin K, warfarin and transport proteins. And, lastly, recent breakthroughs in inherited forms of calcific vasculopathy, have identified the genes responsible as well as an unexpected overlap of phenotypes. PMID:24665125

  19. A Regulatory Hierarchy of the Arabidopsis Branched-Chain Amino Acid Metabolic Network.

    PubMed

    Xing, Anqi; Last, Robert L

    2017-06-01

    The branched-chain amino acids (BCAAs) Ile, Val, and Leu are essential nutrients that humans and other animals obtain from plants. However, total and relative amounts of plant BCAAs rarely match animal nutritional needs, and improvement requires a better understanding of the mechanistic basis for BCAA homeostasis. We present an in vivo regulatory model of BCAA homeostasis derived from analysis of feedback-resistant Arabidopsis thaliana mutants for the three allosteric committed enzymes in the biosynthetic network: threonine deaminase (also named l- O -methylthreonine resistant 1 [OMR1]), acetohydroxyacid synthase small subunit 2 (AHASS2), and isopropylmalate synthase 1 (IPMS1). In this model, OMR1 exerts primary control on Ile accumulation and functions independently of AHAS and IPMS AHAS and IPMS regulate Val and Leu homeostasis, where AHAS affects total Val+Leu and IPMS controls partitioning between these amino acids. In addition, analysis of feedback-resistant and loss-of-function single and double mutants revealed that each AHAS and IPMS isoenzyme contributes to homeostasis rather than being functionally redundant. The characterized feedback resistance mutations caused increased free BCAA levels in both seedlings and seeds. These results add to our understanding of the basis of in vivo BCAA homeostasis and inform approaches to improve the amount and balance of these essential nutrients in crops. © 2017 American Society of Plant Biologists. All rights reserved.

  20. The central role of chloride in the metabolic acid-base changes in canine parvoviral enteritis.

    PubMed

    Burchell, Richard K; Schoeman, Johan P; Leisewitz, Andrew L

    2014-04-01

    The acid-base disturbances in canine parvoviral (CPV) enteritis are not well described. In addition, the mechanisms causing these perturbations have not been fully elucidated. The purpose of the present study was to assess acid-base changes in puppies suffering from CPV enteritis, using a modified strong ion model (SIM). The hypothesis of the study was that severe acid-base disturbances would be present and that the SIM would provide insights into pathological mechanisms, which have not been fully appreciated by the Henderson-Hasselbalch model. The study analysed retrospective data, obtained from 42 puppies with confirmed CPV enteritis and 10 healthy control dogs. The CPV-enteritis group had been allocated a clinical score, to allow classification of the data according to clinical severity. The effects of changes in free water, chloride, l-lactate, albumin and phosphate were calculated, using a modification of the base excess algorithm. When the data were summated for each patient, and correlated to each individual component, the most important contributor to the metabolic acid-base changes, according to the SIM, was chloride (P<0.001). Severely-affected animals tended to demonstrate hypochloraemic alkalosis, whereas mildly-affected puppies had a hyperchloraemic acidosis (P=0.007). In conclusion, the acid-base disturbances in CPV enteritis are multifactorial and complex, with the SIM providing information in terms of the origin of these changes. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Multiple Regulatory Systems Coordinate DNA Replication with Cell Growth in Bacillus subtilis

    PubMed Central

    Murray, Heath; Koh, Alan

    2014-01-01

    In many bacteria the rate of DNA replication is linked with cellular physiology to ensure that genome duplication is coordinated with growth. Nutrient-mediated growth rate control of DNA replication initiation has been appreciated for decades, however the mechanism(s) that connects these cell cycle activities has eluded understanding. In order to help address this fundamental question we have investigated regulation of DNA replication in the model organism Bacillus subtilis. Contrary to the prevailing view we find that changes in DnaA protein level are not sufficient to account for nutrient-mediated growth rate control of DNA replication initiation, although this regulation does require both DnaA and the endogenous replication origin. We go on to report connections between DNA replication and several essential cellular activities required for rapid bacterial growth, including respiration, central carbon metabolism, fatty acid synthesis, phospholipid synthesis, and protein synthesis. Unexpectedly, the results indicate that multiple regulatory systems are involved in coordinating DNA replication with cell physiology, with some of the regulatory systems targeting oriC while others act in a oriC-independent manner. We propose that distinct regulatory systems are utilized to control DNA replication in response to diverse physiological and chemical changes. PMID:25340815

  2. Acetolactate synthase regulatory subunits play divergent and overlapping roles in branched-chain amino acid synthesis and Arabidopsis development.

    PubMed

    Dezfulian, Mohammad H; Foreman, Curtis; Jalili, Espanta; Pal, Mrinal; Dhaliwal, Rajdeep K; Roberto, Don Karl A; Imre, Kathleen M; Kohalmi, Susanne E; Crosby, William L

    2017-04-07

    Branched-chain amino acids (BCAAs) are synthesized by plants, fungi, bacteria, and archaea with plants being the major source of these amino acids in animal diets. Acetolactate synthase (ALS) is the first enzyme in the BCAA synthesis pathway. Although the functional contribution of ALS to BCAA biosynthesis has been extensively characterized, a comprehensive understanding of the regulation of this pathway at the molecular level is still lacking. To characterize the regulatory processes governing ALS activity we utilized several complementary approaches. Using the ALS catalytic protein subunit as bait we performed a yeast two-hybrid (Y2H) screen which resulted in the identification of a set of interacting proteins, two of which (denoted as ALS-INTERACTING PROTEIN1 and 3 [AIP1 and AIP3, respectively]) were found to be evolutionarily conserved orthologues of bacterial feedback-regulatory proteins and therefore implicated in the regulation of ALS activity. To investigate the molecular role AIPs might play in BCAA synthesis in Arabidopsis thaliana, we examined the functional contribution of aip1 and aip3 knockout alleles to plant patterning and development and BCAA synthesis under various growth conditions. Loss-of-function genetic backgrounds involving these two genes exhibited differential aberrant growth responses in valine-, isoleucine-, and sodium chloride-supplemented media. While BCAA synthesis is believed to be localized to the chloroplast, both AIP1 and AIP3 were found to localize to the peroxisome in addition to the chloroplast. Analysis of free amino acid pools in the mutant backgrounds revealed that they differ in the absolute amount of individual BCAAs accumulated and exhibit elevated levels of BCAAs in leaf tissues. Despite the phenotypic differences observed in aip1 and aip3 backgrounds, functional redundancy between these loci was suggested by the finding that aip1/aip3 double knockout mutants are severely developmentally compromised. Taken together the

  3. Characteristics and mechanisms of hypothalamic neuronal fatty acid sensing.

    PubMed

    Le Foll, Christelle; Irani, Boman G; Magnan, Christophe; Dunn-Meynell, Ambrose A; Levin, Barry E

    2009-09-01

    We assessed the mechanisms by which specialized hypothalamic ventromedial nucleus (VMN) neurons utilize both glucose and long-chain fatty acids as signaling molecules to alter their activity as a potential means of regulating energy homeostasis. Fura-2 calcium (Ca(2+)) and membrane potential dye imaging, together with pharmacological agents, were used to assess the mechanisms by which oleic acid (OA) alters the activity of dissociated VMN neurons from 3- to 4-wk-old rats. OA excited up to 43% and inhibited up to 29% of all VMN neurons independently of glucose concentrations. In those neurons excited by both 2.5 mM glucose and OA, OA had a concentration-dependent effective excitatory concentration (EC(50)) of 13.1 nM. Neurons inhibited by both 2.5 mM glucose and OA had an effective inhibitory concentration (IC(50)) of 93 nM. At 0.5 mM glucose, OA had markedly different effects on these same neurons. Inhibition of carnitine palmitoyltransferase, reactive oxygen species formation, long-chain acetyl-CoA synthetase and ATP-sensitive K(+) channel activity or activation of uncoupling protein 2 (UCP2) accounted for only approximately 20% of OA's excitatory effects and approximately 40% of its inhibitory effects. Inhibition of CD36, a fatty acid transporter that can alter cell function independently of intracellular fatty acid metabolism, reduced the effects of OA by up to 45%. Thus OA affects VMN neuronal activity through multiple pathways. In glucosensing neurons, its effects are glucose dependent. This glucose-OA interaction provides a potential mechanism whereby such "metabolic sensing" neurons can respond to differences in the metabolic states associated with fasting and feeding.

  4. Building hospital capacity planning mechanisms in Poland: The impact of 2016/2017 regulatory changes.

    PubMed

    Dubas-Jakóbczyk, Katarzyna; Sowada, Christoph; Domagała, Alicja; Więckowska, Barbara

    2018-02-07

    Capacity planning is a crucial component of modern health care governance. The aim of this paper is to analyze the requirements that need to be met to build effective hospital capacity planning mechanisms in Poland. In this context, the recent regulatory changes strongly influencing hospital sector functioning, including introduction of health care needs maps, capital investment assessment, and hospital network regulations, are analyzed. Some possible ways forward, based on review of international experiences in hospital capacity planning, are discussed. Applied methods include literature review and analysis of statistical data as well as desk analysis of key national regulations related to hospital sector. Results indicate that at the system level, the process of capacity planning involves 4 elements: capital investment in facilities, equipment, and technology; service delivery; allocation of staff; and financial resources. For hospital capacity planning to be effective, the strategic decision at the macrolevel must be complemented by appropriate management of individual hospitals. The major challenge of building hospital capacity planning mechanism in Poland is imbedding it into the overall health system strategy. Because of the lack of such a strategy, the practical implementation of the ad hoc changes, which have been introduced, shows some inconsistencies. The regulations implemented between 2016 and 2017 provided a basis for hospital capacity planning, yet still need evaluation and adjustments. Also, including a mechanism for human resources planning is of crucial importance. The regulations should provide incentives for reducing oversized hospital infrastructure with simultaneous development of the long-term and coordinated care models. Copyright © 2018 John Wiley & Sons, Ltd.

  5. Insights into the Mechanisms Underlying Boron Homeostasis in Plants

    PubMed Central

    Yoshinari, Akira; Takano, Junpei

    2017-01-01

    Boron is an essential element for plants but is toxic in excess. Therefore, plants must adapt to both limiting and excess boron conditions for normal growth. Boron transport in plants is primarily based on three transport mechanisms across the plasma membrane: passive diffusion of boric acid, facilitated diffusion of boric acid via channels, and export of borate anion via transporters. Under boron -limiting conditions, boric acid channels and borate exporters function in the uptake and translocation of boron to support growth of various plant species. In Arabidopsis thaliana, NIP5;1 and BOR1 are located in the plasma membrane and polarized toward soil and stele, respectively, in various root cells, for efficient transport of boron from the soil to the stele. Importantly, sufficient levels of boron induce downregulation of NIP5;1 and BOR1 through mRNA degradation and proteolysis through endocytosis, respectively. In addition, borate exporters, such as Arabidopsis BOR4 and barley Bot1, function in boron exclusion from tissues and cells under conditions of excess boron. Thus, plants actively regulate intracellular localization and abundance of transport proteins to maintain boron homeostasis. In this review, the physiological roles and regulatory mechanisms of intracellular localization and abundance of boron transport proteins are discussed. PMID:29204148

  6. Inhibitory effect of 10-hydroxydecanoic acid on lipopolysaccharide-induced nitric oxide production via translational downregulation of interferon regulatory factor-1 in RAW264 murine macrophages.

    PubMed

    Takahashi, Keita; Sugiyama, Tsuyoshi; Tokoro, Shunji; Neri, Paol; Mori, Hiroshi

    2013-08-01

    Toll-like receptors (TLRs) play a critical role in innate immunity by recognizing pathogen-associated molecular patterns. Various environmental materials including lipids may affect TLR signaling and modulate innate immune responses. We previously reported that 10-hydroxy-trans-2-decenoic acid (10H2DA) inhibits lipopolysaccharide (LPS)-induced interleukin (IL)-6 and nitric oxide (NO) production via inhibiting NF-κB activation. In this study, we investigated the effect of 10-hydroxydecanoic acid (10HDA), a saturated fatty acid of 10H2DA, on LPS-induced cytokines/chemokines and NO production. 10HDA inhibited LPS-induced NO production, but not tumor necrosis factor-α or IL-6 production. LPS-induced activation of interferon (IFN)-stimulated response element, but not NF-κB, was inhibited by 10HDA. Phosphorylation of STAT1 and STAT2 was not affected, but IFN-regulatory factor (IRF)-1 production was significantly reduced by 10HDA. The LPS-induced increase of IRF-1 mRNA, however, was not affected by 10HDA. We found that IRF-1 mRNA level in the polysomal fraction was significantly decreased by 10HDA. Further, LPS-induced phosphorylation of Akt and 4E-BP1, which control mRNA translation, was markedly decreased. These results suggest that 10HDA inhibited LPS-induced NO production through inhibiting IRF-1 translation. These findings elucidate a novel mechanism for anti-inflammatory activity of medium-chain fatty acid 10HDA.

  7. Boric acid inhibits embryonic histone deacetylases: A suggested mechanism to explain boric acid-related teratogenicity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Di Renzo, Francesca; Cappelletti, Graziella; Broccia, Maria L.

    2007-04-15

    Histone deacetylases (HDAC) control gene expression by changing histonic as well as non histonic protein conformation. HDAC inhibitors (HDACi) are considered to be among the most promising drugs for epigenetic treatment for cancer. Recently a strict relationship between histone hyperacetylation in specific tissues of mouse embryos exposed to two HDACi (valproic acid and trichostatin A) and specific axial skeleton malformations has been demonstrated. The aim of this study is to verify if boric acid (BA), that induces in rodents malformations similar to those valproic acid and trichostatin A-related, acts through similar mechanisms: HDAC inhibition and histone hyperacetylation. Pregnant mice weremore » treated intraperitoneally with a teratogenic dose of BA (1000 mg/kg, day 8 of gestation). Western blot analysis and immunostaining were performed with anti hyperacetylated histone 4 (H4) antibody on embryos explanted 1, 3 or 4 h after treatment and revealed H4 hyperacetylation at the level of somites. HDAC enzyme assay was performed on embryonic nuclear extracts. A significant HDAC inhibition activity (compatible with a mixed type partial inhibition mechanism) was evident with BA. Kinetic analyses indicate that BA modifies substrate affinity by a factor {alpha} = 0.51 and maximum velocity by a factor {beta} = 0.70. This work provides the first evidence for HDAC inhibition by BA and suggests such a molecular mechanism for the induction of BA-related malformations.« less

  8. Structures of human cytosolic NADP-dependent isocitrate dehydrogenase reveal a novel self-regulatory mechanism of activity.

    PubMed

    Xu, Xiang; Zhao, Jingyue; Xu, Zhen; Peng, Baozhen; Huang, Qiuhua; Arnold, Eddy; Ding, Jianping

    2004-08-06

    Isocitrate dehydrogenases (IDHs) catalyze the oxidative decarboxylation of isocitrate to alpha-ketoglutarate, and regulation of the enzymatic activity of IDHs is crucial for their biological functions. Bacterial IDHs are reversibly regulated by phosphorylation of a strictly conserved serine residue at the active site. Eukaryotic NADP-dependent IDHs (NADP-IDHs) have been shown to have diverse important biological functions; however, their regulatory mechanism remains unclear. Structural studies of human cytosolic NADP-IDH (HcIDH) in complex with NADP and in complex with NADP, isocitrate, and Ca2+ reveal three biologically relevant conformational states of the enzyme that differ substantially in the structure of the active site and in the overall structure. A structural segment at the active site that forms a conserved alpha-helix in all known NADP-IDH structures assumes a loop conformation in the open, inactive form of HcIDH; a partially unraveled alpha-helix in the semi-open, intermediate form; and an alpha-helix in the closed, active form. The side chain of Asp279 of this segment occupies the isocitrate-binding site and forms hydrogen bonds with Ser94 (the equivalent of the phosphorylation site in bacterial IDHs) in the inactive form and chelates the metal ion in the active form. The structural data led us to propose a novel self-regulatory mechanism for HcIDH that mimics the phosphorylation mechanism used by the bacterial homologs, consistent with biochemical and biological data. This mechanism might be applicable to other eukaryotic NADP-IDHs. The results also provide insights into the recognition and specificity of substrate and cofactor by eukaryotic NADP-IDHs.

  9. Clustering mechanism of oxocarboxylic acids involving hydration reaction: Implications for the atmospheric models

    NASA Astrophysics Data System (ADS)

    Liu, Ling; Kupiainen-Määttä, Oona; Zhang, Haijie; Li, Hao; Zhong, Jie; Kurtén, Theo; Vehkamäki, Hanna; Zhang, Shaowen; Zhang, Yunhong; Ge, Maofa; Zhang, Xiuhui; Li, Zesheng

    2018-06-01

    The formation of atmospheric aerosol particles from condensable gases is a dominant source of particulate matter in the boundary layer, but the mechanism is still ambiguous. During the clustering process, precursors with different reactivities can induce various chemical reactions in addition to the formation of hydrogen bonds. However, the clustering mechanism involving chemical reactions is rarely considered in most of the nucleation process models. Oxocarboxylic acids are common compositions of secondary organic aerosol, but the role of oxocarboxylic acids in secondary organic aerosol formation is still not fully understood. In this paper, glyoxylic acid, the simplest and the most abundant atmospheric oxocarboxylic acid, has been selected as a representative example of oxocarboxylic acids in order to study the clustering mechanism involving hydration reactions using density functional theory combined with the Atmospheric Clusters Dynamic Code. The hydration reaction of glyoxylic acid can occur either in the gas phase or during the clustering process. Under atmospheric conditions, the total conversion ratio of glyoxylic acid to its hydration reaction product (2,2-dihydroxyacetic acid) in both gas phase and clusters can be up to 85%, and the product can further participate in the clustering process. The differences in cluster structures and properties induced by the hydration reaction lead to significant differences in cluster formation rates and pathways at relatively low temperatures.

  10. Structural aspects of catalytic mechanisms of endonucleases and their binding to nucleic acids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhukhlistova, N. E.; Balaev, V. V.; Lyashenko, A. V.

    2012-05-15

    Endonucleases (EC 3.1) are enzymes of the hydrolase class that catalyze the hydrolytic cleavage of deoxyribonucleic and ribonucleic acids at any region of the polynucleotide chain. Endonucleases are widely used both in biotechnological processes and in veterinary medicine as antiviral agents. Medical applications of endonucleases in human cancer therapy hold promise. The results of X-ray diffraction studies of the spatial organization of endonucleases and their complexes and the mechanism of their action are analyzed and generalized. An analysis of the structural studies of this class of enzymes showed that the specific binding of enzymes to nucleic acids is characterized bymore » interactions with nitrogen bases and the nucleotide backbone, whereas the nonspecific binding of enzymes is generally characterized by interactions only with the nucleic-acid backbone. It should be taken into account that the specificity can be modulated by metal ions and certain low-molecular-weight organic compounds. To test the hypotheses about specific and nonspecific nucleic-acid-binding proteins, it is necessary to perform additional studies of atomic-resolution three-dimensional structures of enzyme-nucleic-acid complexes by methods of structural biology.« less

  11. Structural aspects of catalytic mechanisms of endonucleases and their binding to nucleic acids

    NASA Astrophysics Data System (ADS)

    Zhukhlistova, N. E.; Balaev, V. V.; Lyashenko, A. V.; Lashkov, A. A.

    2012-05-01

    Endonucleases (EC 3.1) are enzymes of the hydrolase class that catalyze the hydrolytic cleavage of deoxyribonucleic and ribonucleic acids at any region of the polynucleotide chain. Endonucleases are widely used both in biotechnological processes and in veterinary medicine as antiviral agents. Medical applications of endonucleases in human cancer therapy hold promise. The results of X-ray diffraction studies of the spatial organization of endonucleases and their complexes and the mechanism of their action are analyzed and generalized. An analysis of the structural studies of this class of enzymes showed that the specific binding of enzymes to nucleic acids is characterized by interactions with nitrogen bases and the nucleotide backbone, whereas the nonspecific binding of enzymes is generally characterized by interactions only with the nucleic-acid backbone. It should be taken into account that the specificity can be modulated by metal ions and certain low-molecular-weight organic compounds. To test the hypotheses about specific and nonspecific nucleic-acid-binding proteins, it is necessary to perform additional studies of atomic-resolution three-dimensional structures of enzyme-nucleic-acid complexes by methods of structural biology.

  12. The Dual Regulatory Role of Amino Acids Leu480 and Gln481 of Prothrombin*

    PubMed Central

    Wiencek, Joesph R.; Hirbawi, Jamila; Yee, Vivien C.; Kalafatis, Michael

    2016-01-01

    Prothrombin (FII) is activated to α-thrombin (IIa) by prothrombinase. Prothrombinase is composed of a catalytic subunit, factor Xa (fXa), and a regulatory subunit, factor Va (fVa), assembled on a membrane surface in the presence of divalent metal ions. We constructed, expressed, and purified several mutated recombinant FII (rFII) molecules within the previously determined fVa-dependent binding site for fXa (amino acid region 473–487 of FII). rFII molecules bearing overlapping deletions within this significant region first established the minimal stretch of amino acids required for the fVa-dependent recognition exosite for fXa in prothrombinase within the amino acid sequence Ser478–Val479–Leu480–Gln481–Val482. Single, double, and triple point mutations within this stretch of rFII allowed for the identification of Leu480 and Gln481 as the two essential amino acids responsible for the enhanced activation of FII by prothrombinase. Unanticipated results demonstrated that although recombinant wild type α-thrombin and rIIaS478A were able to induce clotting and activate factor V and factor VIII with rates similar to the plasma-derived molecule, rIIaSLQ→AAA with mutations S478A/L480A/Q481A was deficient in clotting activity and unable to efficiently activate the pro-cofactors. This molecule was also impaired in protein C activation. Similar results were obtained with rIIaΔSLQ (where rIIaΔSLQ is recombinant human α-thrombin with amino acids Ser478/Leu480/Gln481 deleted). These data provide new evidence demonstrating that amino acid sequence Leu480–Gln481: 1) is crucial for proper recognition of the fVa-dependent site(s) for fXa within prothrombinase on FII, required for efficient initial cleavage of FII at Arg320; and 2) is compulsory for appropriate tethering of fV, fVIII, and protein C required for their timely activation by IIa. PMID:26601957

  13. Purification of organic acids by chromatography with strong anionic resins: Investigation of uptake mechanisms.

    PubMed

    Lemaire, Julien; Blanc, Claire-Line; Lutin, Florence; Théoleyre, Marc-André; Stambouli, Moncef; Pareau, Dominique

    2016-08-05

    Bio-based organic acids are promising renewable carbon sources for the chemical industry. However energy-consuming purification processes are used, like distillation or crystallization, to reach high purities required in some applications. That is why preparative chromatography was studied as an alternative separation technique. In a previous work dealing with the purification of lactic, succinic and citric acids, the Langmuir model was insufficient to explain the elution profiles obtained with a strong anionic resin. Consequently the Langmuir model was coupled with a usual ion-exchange model to take into account the retention of their conjugate bases (<2%), which are commonly neglected at low pH (<1.5). Elution simulations with both uptake mechanisms fitted very well with experimental pulse tests. Only two parameters were optimized (equilibrium constant of acid uptake and ion-exchange selectivity coefficient of conjugate base) and their value were coherent with experimental and resin suppliers' data. These results confirmed that the singular tailing and apparent delay observed with succinic and citric acids can be explained by the high affinity of succinate and citrate for resin cationic sites. The model was implemented in a preparative chromatography simulation program in order to optimize operating parameters of our pilot-scale ISMB unit (Improved Simulated Moving Bed). The comparison with experimental ISMB profiles was conclusive. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Fracture mechanics based design for radioactive material transport packagings -- Historical review

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smith, J.A.; Salzbrenner, D.; Sorenson, K.

    1998-04-01

    The use of a fracture mechanics based design for the radioactive material transport (RAM) packagings has been the subject of extensive research for more than a decade. Sandia National Laboratories (SNL) has played an important role in the research and development of the application of this technology. Ductile iron has been internationally accepted as an exemplary material for the demonstration of a fracture mechanics based method of RAM packaging design and therefore is the subject of a large portion of the research discussed in this report. SNL`s extensive research and development program, funded primarily by the U. S. Department ofmore » Energy`s Office of Transportation, Energy Management and Analytical Services (EM-76) and in an auxiliary capacity, the office of Civilian Radioactive Waste Management, is summarized in this document along with a summary of the research conducted at other institutions throughout the world. In addition to the research and development work, code and standards development and regulatory positions are also discussed.« less

  15. SATRAT: Staphylococcus aureus transcript regulatory network analysis tool.

    PubMed

    Gopal, Tamilselvi; Nagarajan, Vijayaraj; Elasri, Mohamed O

    2015-01-01

    Staphylococcus aureus is a commensal organism that primarily colonizes the nose of healthy individuals. S. aureus causes a spectrum of infections that range from skin and soft-tissue infections to fatal invasive diseases. S. aureus uses a large number of virulence factors that are regulated in a coordinated fashion. The complex regulatory mechanisms have been investigated in numerous high-throughput experiments. Access to this data is critical to studying this pathogen. Previously, we developed a compilation of microarray experimental data to enable researchers to search, browse, compare, and contrast transcript profiles. We have substantially updated this database and have built a novel exploratory tool-SATRAT-the S. aureus transcript regulatory network analysis tool, based on the updated database. This tool is capable of performing deep searches using a query and generating an interactive regulatory network based on associations among the regulators of any query gene. We believe this integrated regulatory network analysis tool would help researchers explore the missing links and identify novel pathways that regulate virulence in S. aureus. Also, the data model and the network generation code used to build this resource is open sourced, enabling researchers to build similar resources for other bacterial systems.

  16. The Conjugate Acid-Base Chart.

    ERIC Educational Resources Information Center

    Treptow, Richard S.

    1986-01-01

    Discusses the difficulties that beginning chemistry students have in understanding acid-base chemistry. Describes the use of conjugate acid-base charts in helping students visualize the conjugate relationship. Addresses chart construction, metal ions, buffers and pH titrations, and the organic functional groups and nonaqueous solvents. (TW)

  17. 3D composites based on the blends of chitosan and collagen with the addition of hyaluronic acid.

    PubMed

    Sionkowska, Alina; Kaczmarek, Beata; Lewandowska, Katarzyna; Grabska, Sylwia; Pokrywczyńska, Marta; Kloskowski, Tomasz; Drewa, Tomasz

    2016-08-01

    3D porous composites based on blends of chitosan, collagen and hyaluronic acid were obtained through the lyophilization process. Mechanical properties, swelling behavior and thermal stability of the blends were studied. Moreover, SEM images were taken and the structure of the blends was studied. Biological properties of the materials obtained were investigated by analyzing of proliferation rate of fibroblast cells incubated with biomaterial extract using MTT assay (3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide). The results showed that the properties of 3D composites based on the blends of chitosan and collagen were altered after the addition 1%, 2% and 5% of hyaluronic acid. Mechanical properties and thermal stability of chitosan/collagen blends were improved in the presence of hyaluronic acid in the composite. New 3D materials based on the blends of chitosan, collagen and hyaluronic acid were non-toxic and did not significantly affect cell morphology. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Mechanism of antiinflammatory actions of curcumine and boswellic acids.

    PubMed

    Ammon, H P; Safayhi, H; Mack, T; Sabieraj, J

    1993-03-01

    Curcumine from Curcuma longa and the gum resin of Boswellia serrata, which were demonstrated to act as anti-inflammatories in in vivo animal models, were studied in a set of in vitro experiments in order to elucidate the mechanism of their beneficial effects. Curcumine inhibited the 5-lipoxygenase activity in rat peritoneal neutrophils as well as the 12-lipoxygenase and the cyclooxygenase activities in human platelets. In a cell free peroxidation system curcumine exerted strong antioxidative activity. Thus, its effects on the dioxygenases are probably due to its reducing capacity. Boswellic acids were isolated from the gum resin of Boswellia serrata and identified as the active principles. Boswellic acids inhibited the leukotriene synthesis via 5-lipoxygenase, but did not affect the 12-lipoxygenase and the cyclooxygenase activities. Additionally, boswellic acids did not impair the peroxidation of arachidonic acid by iron and ascorbate. The data suggest that boswellic acids are specific, non-redox inhibitors of leukotriene synthesis either interacting directly with 5-lipoxygenase or blocking its translocation.

  19. Re-evaluation of Non-regulatory Asbestos Group Minerals for Regulatory Agencies

    NASA Astrophysics Data System (ADS)

    Dogan, M.; Dogan, A.

    2013-05-01

    There are established rules and regulations for some asbestos group minerals - amphibole group minerals of actinolite, amosite, anthophyllite, crocidolite, tremolite; and serpentine group minerals of chrysotile- called "regulatory". There are also "non-regulatory" naturally occurring asbestos (NOA) group minerals as constituent of rocks and soil, including richterite, winchite, fluoro-edenite, balangeroite, carlosturanite, gageite, arfvedsonite, and magnesio-arfvedsonite. Strong evidences for carcinogenicity of these NOA minerals in later cohorts of cancer patients demonstrated the risks associated with these minerals. In addition, although the chrysotile asbestos regulated by some organizations such as WHO, World Trade Organization, United Nations, US EPA, International Labour Organization, and EU Countries; however, controversies still continue surrounding the use of chrysotile. Determinations of polymineralic fibrous veins, mixed particles, amphibole cleavage fragments, and genetic predisposition are also important issues (i.e. Dogan et al., 2006).Therefore, accurate characterizations of chemical composition, morphology, structure, and defects are necessary in order to find out mechanism(s) of carcinogenicity of all asbestos group minerals. Calculation methods of chemical composition are still under debate because of assumption of no vacancies at any sites and intergrowth of minerals. Substitution(s) may cause deviations from the ideal chemical formula and wide variations in chemical compositions. Detail morphological and chemical quantification of individual asbestos group minerals in micro- and nano-scale may help to evaluate its true carcinogenetic mechanism(s), and consequently prevention and possibly treatment of related diseases. we propose that nonregulatory asbestos minerals and the chrysotile should be re-evaluated. The amount of fibers inhaled, in terms of weight percent and number, need also be re-evaluated by mineralogists. Finally, Regulatory

  20. Biocomputional construction of a gene network under acid stress in Synechocystis sp. PCC 6803.

    PubMed

    Li, Yi; Rao, Nini; Yang, Feng; Zhang, Ying; Yang, Yang; Liu, Han-ming; Guo, Fengbiao; Huang, Jian

    2014-01-01

    Acid stress is one of the most serious threats that cyanobacteria have to face, and it has an impact at all levels from genome to phenotype. However, very little is known about the detailed response mechanism to acid stress in this species. We present here a general analysis of the gene regulatory network of Synechocystis sp. PCC 6803 in response to acid stress using comparative genome analysis and biocomputational prediction. In this study, we collected 85 genes and used them as an initial template to predict new genes through co-regulation, protein-protein interactions and the phylogenetic profile, and 179 new genes were obtained to form a complete template. In addition, we found that 11 enriched pathways such as glycolysis are closely related to the acid stress response. Finally, we constructed a regulatory network for the intricate relationship of these genes and summarize the key steps in response to acid stress. This is the first time a bioinformatic approach has been taken systematically to gene interactions in cyanobacteria and the elaboration of their cell metabolism and regulatory pathways under acid stress, which is more efficient than a traditional experimental study. The results also provide theoretical support for similar research into environmental stresses in cyanobacteria and possible industrial applications. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  1. A primer on thermodynamic-based models for deciphering transcriptional regulatory logic.

    PubMed

    Dresch, Jacqueline M; Richards, Megan; Ay, Ahmet

    2013-09-01

    A rigorous analysis of transcriptional regulation at the DNA level is crucial to the understanding of many biological systems. Mathematical modeling has offered researchers a new approach to understanding this central process. In particular, thermodynamic-based modeling represents the most biophysically informed approach aimed at connecting DNA level regulatory sequences to the expression of specific genes. The goal of this review is to give biologists a thorough description of the steps involved in building, analyzing, and implementing a thermodynamic-based model of transcriptional regulation. The data requirements for this modeling approach are described, the derivation for a specific regulatory region is shown, and the challenges and future directions for the quantitative modeling of gene regulation are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. CoryneRegNet: an ontology-based data warehouse of corynebacterial transcription factors and regulatory networks.

    PubMed

    Baumbach, Jan; Brinkrolf, Karina; Czaja, Lisa F; Rahmann, Sven; Tauch, Andreas

    2006-02-14

    The application of DNA microarray technology in post-genomic analysis of bacterial genome sequences has allowed the generation of huge amounts of data related to regulatory networks. This data along with literature-derived knowledge on regulation of gene expression has opened the way for genome-wide reconstruction of transcriptional regulatory networks. These large-scale reconstructions can be converted into in silico models of bacterial cells that allow a systematic analysis of network behavior in response to changing environmental conditions. CoryneRegNet was designed to facilitate the genome-wide reconstruction of transcriptional regulatory networks of corynebacteria relevant in biotechnology and human medicine. During the import and integration process of data derived from experimental studies or literature knowledge CoryneRegNet generates links to genome annotations, to identified transcription factors and to the corresponding cis-regulatory elements. CoryneRegNet is based on a multi-layered, hierarchical and modular concept of transcriptional regulation and was implemented by using the relational database management system MySQL and an ontology-based data structure. Reconstructed regulatory networks can be visualized by using the yFiles JAVA graph library. As an application example of CoryneRegNet, we have reconstructed the global transcriptional regulation of a cellular module involved in SOS and stress response of corynebacteria. CoryneRegNet is an ontology-based data warehouse that allows a pertinent data management of regulatory interactions along with the genome-scale reconstruction of transcriptional regulatory networks. These models can further be combined with metabolic networks to build integrated models of cellular function including both metabolism and its transcriptional regulation.

  3. STATE ACID RAIN RESEARCH AND SCREENING SYSTEM - VERSION 1.0 USER'S MANUAL

    EPA Science Inventory

    The report is a user's manual that describes Version 1.0 of EPA's STate Acid Rain Research and Screening System (STARRSS), developed to assist utility regulatory commissions in reviewing utility acid rain compliance plans. It is a screening tool that is based on scenario analysis...

  4. Disorders of Acid-Base Balance: New Perspectives

    PubMed Central

    Seifter, Julian L.; Chang, Hsin-Yun

    2017-01-01

    Background Disorders of acid-base involve the complex interplay of many organ systems including brain, lungs, kidney, and liver. Compensations for acid-base disturbances within the brain are more complete, while limitations of compensations are more apparent for most systemic disorders. However, some of the limitations on compensations are necessary to survival, in that preservation of oxygenation, energy balance, cognition, electrolyte, and fluid balance are connected mechanistically. Summary This review aims to give new and comprehensive perspective on understanding acid-base balance and identifying associated disorders. All metabolic acid-base disorders can be approached in the context of the relative losses or gains of electrolytes or a change in the anion gap in body fluids. Acid-base and electrolyte balance are connected not only at the cellular level but also in daily clinical practice. Urine chemistry is essential to understanding electrolyte excretion and renal compensations. Key Messages Many constructs are helpful to understand acid-base, but these models are not mutually exclusive. Electroneutrality and the close interconnection between electrolyte and acid-base balance are important concepts to apply in acid-base diagnoses. All models have complexity and shortcuts that can help in practice. There is no reason to dismiss any of the present constructs, and there is benefit in a combined approach. PMID:28232934

  5. USP1 deubiquitinase: cellular functions, regulatory mechanisms and emerging potential as target in cancer therapy

    PubMed Central

    2013-01-01

    Reversible protein ubiquitination is emerging as a key process for maintaining cell homeostasis, and the enzymes that participate in this process, in particular E3 ubiquitin ligases and deubiquitinases (DUBs), are increasingly being regarded as candidates for drug discovery. Human DUBs are a group of approximately 100 proteins, whose cellular functions and regulatory mechanisms remain, with some exceptions, poorly characterized. One of the best-characterized human DUBs is ubiquitin-specific protease 1 (USP1), which plays an important role in the cellular response to DNA damage. USP1 levels, localization and activity are modulated through several mechanisms, including protein-protein interactions, autocleavage/degradation and phosphorylation, ensuring that USP1 function is carried out in a properly regulated spatio-temporal manner. Importantly, USP1 expression is deregulated in certain types of human cancer, suggesting that USP1 could represent a valid target in cancer therapy. This view has gained recent support with the finding that USP1 inhibition may contribute to revert cisplatin resistance in an in vitro model of non-small cell lung cancer (NSCLC). Here, we describe the current knowledge on the cellular functions and regulatory mechanisms of USP1. We also summarize USP1 alterations found in cancer, combining data from the literature and public databases with our own data. Finally, we discuss the emerging potential of USP1 as a target, integrating published data with our novel findings on the effects of the USP1 inhibitor pimozide in combination with cisplatin in NSCLC cells. PMID:23937906

  6. 77 FR 52977 - Regulatory Capital Rules: Advanced Approaches Risk-Based Capital Rule; Market Risk Capital Rule

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-30

    ... Corporation 12 CFR Parts 324, 325 Regulatory Capital Rules: Advanced Approaches Risk-Based Capital Rule... 325 RIN 3064-AD97 Regulatory Capital Rules: Advanced Approaches Risk-Based Capital Rule; Market Risk... the agencies' current capital rules. In this NPR (Advanced Approaches and Market Risk NPR) the...

  7. Small RNA-mediated regulation in bacteria: A growing palette of diverse mechanisms.

    PubMed

    Dutta, Tanmay; Srivastava, Shubhangi

    2018-05-20

    Small RNAs (sRNAs) in bacteria have evolved with diverse mechanisms to balance their target gene expression in response to changes in the environment. Accumulating studies on bacterial regulatory processes firmly established that sRNAs modulate their target gene expression generally at the posttranscriptional level. Identification of large number of sRNAs by advanced technologies, like deep sequencing, tilling microarray, indicates the existence of a plethora of distinctive sRNA-mediated regulatory mechanisms in bacteria. Types of the novel mechanisms are increasing with the discovery of new sRNAs. Complementary base pairing between sRNAs and target RNAs assisted by RNA chaperones like Hfq and ProQ, in many occasions, to regulate the cognate gene expression is prevalent in sRNA mechanisms. sRNAs, in most studied cases, can directly base pair with target mRNA to remodel its expression. Base pairing can happen either in the untranslated regions or in the coding regions of mRNA to activate/repress its translation. sRNAs also act as target mimic to titrate away different regulatory RNAs from its target. Other mechanism includes the sequestration of regulatory proteins, especially transcription factors, by sRNAs. Numerous sRNAs, following analogous mechanism, are widespread in bacteria, and thus, has drawn immense attention for the development of RNA-based technologies. Nevertheless, typical sRNA mechanisms are also discovered to be confined in some bacteria. Analysis of the sRNA mechanisms unravels their existence in both the single step processes and the complex regulatory networks with a global effect on cell physiology. This review deals with the diverse array of mechanisms, which sRNAs follow to maintain bacterial lifestyle. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Acid Stress Response Mechanisms of Group B Streptococci

    PubMed Central

    Shabayek, Sarah; Spellerberg, Barbara

    2017-01-01

    Group B streptococcus (GBS) is a leading cause of neonatal mortality and morbidity in the United States and Europe. It is part of the vaginal microbiota in up to 30% of pregnant women and can be passed on to the newborn through perinatal transmission. GBS has the ability to survive in multiple different host niches. The pathophysiology of this bacterium reveals an outstanding ability to withstand varying pH fluctuations of the surrounding environments inside the human host. GBS host pathogen interations include colonization of the acidic vaginal mucosa, invasion of the neutral human blood or amniotic fluid, breaching of the blood brain barrier as well as survival within the acidic phagolysosomal compartment of macrophages. However, investigations on GBS responses to acid stress are limited. Technologies, such as whole genome sequencing, genome-wide transcription and proteome mapping facilitate large scale identification of genes and proteins. Mechanisms enabling GBS to cope with acid stress have mainly been studied through these techniques and are summarized in the current review PMID:28936424

  9. The effects and potential mechanisms of folic acid on cognitive function: a comprehensive review.

    PubMed

    Enderami, Athena; Zarghami, Mehran; Darvishi-Khezri, Hadi

    2018-06-23

    Cognitive impairment and dementia are major neurocognitive disorders that cause a noticeable decline in cognitive abilities, including memory and thinking skills. The effectiveness of using folic acid as an adjuvant for management of neurocognitive disorders is not well-known. This paper explains the role of folic acid, including its usefulness, effectiveness, adverse side effects, and active mechanisms on cognitive functions of the elderly. In the current study, we reviewed clinical and experimental studies investigating the use of folic acid prior to November 2017, using PubMed, ISI Web of Knowledge, Science Direct, Scopus, Ovid, and Cochrane Library databases. A total of 142 articles were retrieved by electronic search. Based on the preset inclusion and exclusion criteria, a total of 36 articles were retrieved for full text analysis. According to data obtained from the review, it seems that folic acid supplementation may improve cognitive function by decreasing homocysteine (Hcy), vascular care, attenuating inflammatory status, modification of cerebral folic acid deficiency, and antioxidant responses. Specifically, people with high levels of Hcy have a better response to folic acid supplementation, which may arise from low serum folate concentration.

  10. An ant colony optimization based algorithm for identifying gene regulatory elements.

    PubMed

    Liu, Wei; Chen, Hanwu; Chen, Ling

    2013-08-01

    It is one of the most important tasks in bioinformatics to identify the regulatory elements in gene sequences. Most of the existing algorithms for identifying regulatory elements are inclined to converge into a local optimum, and have high time complexity. Ant Colony Optimization (ACO) is a meta-heuristic method based on swarm intelligence and is derived from a model inspired by the collective foraging behavior of real ants. Taking advantage of the ACO in traits such as self-organization and robustness, this paper designs and implements an ACO based algorithm named ACRI (ant-colony-regulatory-identification) for identifying all possible binding sites of transcription factor from the upstream of co-expressed genes. To accelerate the ants' searching process, a strategy of local optimization is presented to adjust the ants' start positions on the searched sequences. By exploiting the powerful optimization ability of ACO, the algorithm ACRI can not only improve precision of the results, but also achieve a very high speed. Experimental results on real world datasets show that ACRI can outperform other traditional algorithms in the respects of speed and quality of solutions. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Improvement of thermal and mechanical properties of composite based on polylactic acid and microfibrillated cellulose through chemical modification

    NASA Astrophysics Data System (ADS)

    Suryanegara, L.; Nugraha, R. A.; Achmadi, S. S.

    2017-07-01

    Polylactic acid (PLA) is the most representative sustainable and bio-based polymer environmentally friendly that has a great potential to replace petroleum-based plastics. However, brittleness, low heat resistance, and slow crystallization limit the wide application of PLA. One of strategies to improve PLA properties is by reinforcing with microfibrillated cellulose (MFC). Unfortunately, the hydrophilic properties of MFC make it difficult to attain good dispersion in a hydrophobic PLA matrix. Therefore, modification of MFC was needed to increase its compatibility with PLA in the composite formation. In this experiment, MFC was modified with partial acetylation (degree of substitution: 1) and further grafted with lactide monomers through ring-opening polymerization using Sn(Oct)2 catalyst. The result of acetylation and grafting were verified by infrared spectra. Composites were prepared by mixing PLA (molecular weight of 200,000) and the modified MFC at 9:1 ratio through organic solvent method. Followed by 8 min-kneading and hot pressing at 180°C, the resulted composites were evaluated for their mechanical and thermal properties. Thermal characterization carried out using differential scanning calorimetry measurements showed that the presence of modified MFC increased the temperature of glass transition and accelerated the crystallization of PLA. Mechanical properties measurement showed that the presence of modified MFC enhanced the elongation at break (1.1 to 1.8%), tensile strength (14.9 to 25.7 MPa), and modulus of elasticity (1.7 to 2.1 GPa). These results demonstrated that the modified MFC could extend the application of PLA in industry.

  12. Physicochemical and Mechanical Properties of Bambara Groundnut Starch Films Modified with Stearic Acid.

    PubMed

    Oyeyinka, Samson A; Singh, Suren; Amonsou, Eric O

    2017-01-01

    The physicochemical and mechanical properties of biofilm prepared from bambara starch modified with varying concentrations of stearic acid (0%, 2.5%, 3.5%, 5%, 7%, and 10%) were studied. By scanning electron microscopy, bambara starch films modified with stearic acid (≥3.5%) showed a progressively rough surface compared to those with 2.5% stearic acid and the control. Fourier transform infrared spectroscopy spectra revealed a peak shift of approximately 31 cm -1 , suggesting the promotion of hydrogen bond formation between hydroxyl groups of starch and stearic acid. The addition of 2.5% stearic acid to bambara starch film reduced water vapor permeability by approximately 17%. Bambara starch films modified with higher concentration of stearic acid were more opaque and showed significantly high melting temperatures. However, mechanical properties of starch films were generally negatively affected by stearic acid. Bambara starch film may be modified with 2.5% stearic acid for improved water vapor permeability and thermal stability with minimal effect on tensile strength. © 2016 Institute of Food Technologists®.

  13. JCell--a Java-based framework for inferring regulatory networks from time series data.

    PubMed

    Spieth, C; Supper, J; Streichert, F; Speer, N; Zell, A

    2006-08-15

    JCell is a Java-based application for reconstructing gene regulatory networks from experimental data. The framework provides several algorithms to identify genetic and metabolic dependencies based on experimental data conjoint with mathematical models to describe and simulate regulatory systems. Owing to the modular structure, researchers can easily implement new methods. JCell is a pure Java application with additional scripting capabilities and thus widely usable, e.g. on parallel or cluster computers. The software is freely available for download at http://www-ra.informatik.uni-tuebingen.de/software/JCell.

  14. Retinol Promotes In Vitro Growth of Proximal Colon Organoids through a Retinoic Acid-Independent Mechanism

    PubMed Central

    Nibe, Yoichi; Akiyama, Shintaro; Matsumoto, Yuka; Nozaki, Kengo; Fukuda, Masayoshi; Hayashi, Ayumi; Mizutani, Tomohiro; Oshima, Shigeru; Watanabe, Mamoru; Nakamura, Tetsuya

    2016-01-01

    Retinol (ROL), the alcohol form of vitamin A, is known to control cell fate decision of various types of stem cells in the form of its active metabolite, retinoic acid (RA). However, little is known about whether ROL has regulatory effects on colonic stem cells. We examined in this study the effect of ROL on the growth of murine normal colonic cells cultured as organoids. As genes involved in RA synthesis from ROL were differentially expressed along the length of the colon, we tested the effect of ROL on proximal and distal colon organoids separately. We found that organoid forming efficiency and the expression level of Lgr5, a marker gene for colonic stem cells were significantly enhanced by ROL in the proximal colon organoids, but not in the distal ones. Interestingly, neither retinaldehyde (RAL), an intermediate product of the ROL-RA pathway, nor RA exhibited growth promoting effects on the proximal colon organoids, suggesting that ROL-dependent growth enhancement in organoids involves an RA-independent mechanism. This was confirmed by the observation that an inhibitor for RA-mediated gene transcription did not abrogate the effect of ROL on organoids. This novel role of ROL in stem cell maintenance in the proximal colon provides insights into the mechanism of region-specific regulation for colonic stem cell maintenance. PMID:27564706

  15. Dual RNA regulatory control of a Staphylococcus aureus virulence factor.

    PubMed

    Chabelskaya, Svetlana; Bordeau, Valérie; Felden, Brice

    2014-04-01

    In pathogens, the accurate programming of virulence gene expression is essential for infection. It is achieved by sophisticated arrays of regulatory proteins and ribonucleic acids (sRNAs), but in many cases their contributions and connections are not yet known. Based on genetic, biochemical and structural evidence, we report that the expression pattern of a Staphylococcus aureus host immune evasion protein is enabled by the collaborative actions of RNAIII and small pathogenicity island RNA D (SprD). Their combined expression profiles during bacterial growth permit early and transient synthesis of Sbi to avoid host immune responses. Together, these two sRNAs use antisense mechanisms to monitor Sbi expression at the translational level. Deletion analysis combined with structural analysis of RNAIII in complex with its novel messenger RNA (mRNA) target indicate that three distant RNAIII domains interact with distinct sites of the sbi mRNA and that two locations are deep in the sbi coding region. Through distinct domains, RNAIII lowers production of two proteins required for avoiding innate host immunity, staphylococcal protein A and Sbi. Toeprints and in vivo mutational analysis reveal a novel regulatory module within RNAIII essential for attenuation of Sbi translation. The sophisticated translational control of mRNA by two differentially expressed sRNAs ensures supervision of host immune escape by a major pathogen.

  16. Structure-based mechanism of lipoteichoic acid synthesis by Staphylococcus aureus LtaS

    PubMed Central

    Lu, Duo; Wörmann, Mirka E.; Zhang, Xiaodong; Schneewind, Olaf; Gründling, Angelika; Freemont, Paul S.

    2009-01-01

    Staphylococcus aureus synthesizes polyglycerol-phosphate lipoteichoic acid (LTA) from phosphatidylglycerol. LtaS, a predicted membrane protein with 5 N-terminal transmembrane helices followed by a large extracellular part (eLtaS), is required for staphylococcal growth and LTA synthesis. Here, we report the first crystal structure of the eLtaS domain at 1.2-Å resolution and show that it assumes a sulfatase-like fold with an α/β core and a C-terminal part composed of 4 anti-parallel β-strands and a long α-helix. Overlaying eLtaS with sulfatase structures identified active site residues, which were confirmed by alanine substitution mutagenesis and in vivo enzyme function assays. The cocrystal structure with glycerol-phosphate and the coordination of a Mn2+ cation allowed us to propose a reaction mechanism, whereby the active site threonine of LtaS functions as nucleophile for phosphatidylglycerol hydrolysis and formation of a covalent threonine–glycerolphosphate intermediate. These results will aid in the development of LtaS-specific inhibitors for S. aureus and many other Gram-positive pathogens. PMID:19168632

  17. Regulatory physiology discipline science plan

    NASA Technical Reports Server (NTRS)

    1991-01-01

    The focus of the Regulatory Physiology discipline of the Space Physiology and Countermeasures Program is twofold. First, to determine and study how microgravity and associated factors of space flight affect the regulatory mechanisms by which humans adapt and achieve homeostasis and thereby regulate their ability to respond to internal and external signals; and, second, to study selected physiological systems that have been demonstrated to be influenced by gravity. The Regulatory Physiology discipline, as defined here, is composed of seven subdisciplines: (1) Circadian Rhythms, (2) Endocrinology, (3) Fluid and Electrolyte Regulation, (4) Hematology, (5) Immunology, (6) Metabolism and Nutrition, and (7) Temperature Regulation. The purpose of this Discipline Science Plan is to provide a conceptual strategy for NASA's Life Sciences Division research and development activities in the area of regulatory physiology. It covers the research areas critical to NASA's programmatic requirements for the Extended-Duration Orbiter, Space Station Freedom, and exploration mission science activities. These science activities include ground-based and flight; basic, applied, and operational; and animal and human research and development. This document summarizes the current status of the program, outlines available knowledge, establishes goals and objectives, identifies science priorities, and defines critical questions in regulatory physiology. It contains a general plan that will be used by both NASA Headquarters Program Offices and the field centers to review and plan basic, applied, and operational intramural and extramural research and development activities in this area.

  18. Identification of critical regulatory genes in cancer signaling network using controllability analysis

    NASA Astrophysics Data System (ADS)

    Ravindran, Vandana; Sunitha, V.; Bagler, Ganesh

    2017-05-01

    Cancer is characterized by a complex web of regulatory mechanisms which makes it difficult to identify features that are central to its control. Molecular integrative models of cancer, generated with the help of data from experimental assays, facilitate use of control theory to probe for ways of controlling the state of such a complex dynamic network. We modeled the human cancer signaling network as a directed graph and analyzed it for its controllability, identification of driver nodes and their characterization. We identified the driver nodes using the maximum matching algorithm and classified them as backbone, peripheral and ordinary based on their role in regulatory interactions and control of the network. We found that the backbone driver nodes were key to driving the regulatory network into cancer phenotype (via mutations) as well as for steering into healthy phenotype (as drug targets). This implies that while backbone genes could lead to cancer by virtue of mutations, they are also therapeutic targets of cancer. Further, based on their impact on the size of the set of driver nodes, genes were characterized as indispensable, dispensable and neutral. Indispensable nodes within backbone of the network emerged as central to regulatory mechanisms of control of cancer. In addition to probing the cancer signaling network from the perspective of control, our findings suggest that indispensable backbone driver nodes could be potentially leveraged as therapeutic targets. This study also illustrates the application of structural controllability for studying the mechanisms underlying the regulation of complex diseases.

  19. A Computer-Based Simulation of an Acid-Base Titration

    ERIC Educational Resources Information Center

    Boblick, John M.

    1971-01-01

    Reviews the advantages of computer simulated environments for experiments, referring in particular to acid-base titrations. Includes pre-lab instructions and a sample computer printout of a student's use of an acid-base simulation. Ten references. (PR)

  20. Dissolution mechanism of calcium apatites in acids: A review of literature

    PubMed Central

    Dorozhkin, Sergey V

    2012-01-01

    Eight dissolution models of calcium apatites (both fluorapatite and hydroxyapatite) in acids were drawn from the published literature, analyzed and discussed. Major limitations and drawbacks of the models were conversed in details. The models were shown to deal with different aspects of apatite dissolution phenomenon and none of them was able to describe the dissolution process in general. Therefore, an attempt to combine the findings obtained by different researchers was performed which resulted in creation of the general description of apatite dissolution in acids. For this purpose, eight dissolution models were assumed to complement each other and provide the correct description of the specific aspects of apatite dissolution. The general description considers all possible dissolution stages involved and points out to some missing and unclear phenomena to be experimentally studied and verified in future. This creates a new methodological approach to investigate reaction mechanisms based on sets of affine data, obtained by various research groups under dissimilar experimental conditions. PMID:25237611

  1. A systems biology approach to defining regulatory mechanisms for cartilage and tendon cell phenotypes.

    PubMed

    Mueller, A J; Tew, S R; Vasieva, O; Clegg, P D; Canty-Laird, E G

    2016-09-27

    Phenotypic plasticity of adult somatic cells has provided emerging avenues for the development of regenerative therapeutics. In musculoskeletal biology the mechanistic regulatory networks of genes governing the phenotypic plasticity of cartilage and tendon cells has not been considered systematically. Additionally, a lack of strategies to effectively reproduce in vitro functional models of cartilage and tendon is retarding progress in this field. De- and redifferentiation represent phenotypic transitions that may contribute to loss of function in ageing musculoskeletal tissues. Applying a systems biology network analysis approach to global gene expression profiles derived from common in vitro culture systems (monolayer and three-dimensional cultures) this study demonstrates common regulatory mechanisms governing de- and redifferentiation transitions in cartilage and tendon cells. Furthermore, evidence of convergence of gene expression profiles during monolayer expansion of cartilage and tendon cells, and the expression of key developmental markers, challenges the physiological relevance of this culture system. The study also suggests that oxidative stress and PI3K signalling pathways are key modulators of in vitro phenotypes for cells of musculoskeletal origin.

  2. Nucleic acid-based electrochemical nanobiosensors.

    PubMed

    Abi, Alireza; Mohammadpour, Zahra; Zuo, Xiaolei; Safavi, Afsaneh

    2018-04-15

    The detection of biomarkers using sensitive and selective analytical devices is critically important for the early stage diagnosis and treatment of diseases. The synergy between the high specificity of nucleic acid recognition units and the great sensitivity of electrochemical signal transductions has already shown promise for the development of efficient biosensing platforms. Yet nucleic-acid based electrochemical biosensors often rely on target amplification strategies (e.g., polymerase chain reactions) to detect analytes at clinically relevant concentration ranges. The complexity and time-consuming nature of these amplification methods impede moving nucleic acid-based electrochemical biosensors from laboratory-based to point-of-care test settings. Fortunately, advancements in nanotechnology have provided growing evidence that the recruitment of nanoscaled materials and structures can enhance the biosensing performance (particularly in terms of sensitivity and response time) to the level suitable for use in point-of-care diagnostic tools. This Review highlights the significant progress in the field of nucleic acid-based electrochemical nanobiosensing with the focus on the works published during the last five years. Copyright © 2017. Published by Elsevier B.V.

  3. Investigating Students' Reasoning about Acid-Base Reactions

    ERIC Educational Resources Information Center

    Cooper, Melanie M.; Kouyoumdjian, Hovig; Underwood, Sonia M.

    2016-01-01

    Acid-base chemistry is central to a wide range of reactions. If students are able to understand how and why acid-base reactions occur, it should provide a basis for reasoning about a host of other reactions. Here, we report the development of a method to characterize student reasoning about acid-base reactions based on their description of…

  4. CoryneRegNet: An ontology-based data warehouse of corynebacterial transcription factors and regulatory networks

    PubMed Central

    Baumbach, Jan; Brinkrolf, Karina; Czaja, Lisa F; Rahmann, Sven; Tauch, Andreas

    2006-01-01

    Background The application of DNA microarray technology in post-genomic analysis of bacterial genome sequences has allowed the generation of huge amounts of data related to regulatory networks. This data along with literature-derived knowledge on regulation of gene expression has opened the way for genome-wide reconstruction of transcriptional regulatory networks. These large-scale reconstructions can be converted into in silico models of bacterial cells that allow a systematic analysis of network behavior in response to changing environmental conditions. Description CoryneRegNet was designed to facilitate the genome-wide reconstruction of transcriptional regulatory networks of corynebacteria relevant in biotechnology and human medicine. During the import and integration process of data derived from experimental studies or literature knowledge CoryneRegNet generates links to genome annotations, to identified transcription factors and to the corresponding cis-regulatory elements. CoryneRegNet is based on a multi-layered, hierarchical and modular concept of transcriptional regulation and was implemented by using the relational database management system MySQL and an ontology-based data structure. Reconstructed regulatory networks can be visualized by using the yFiles JAVA graph library. As an application example of CoryneRegNet, we have reconstructed the global transcriptional regulation of a cellular module involved in SOS and stress response of corynebacteria. Conclusion CoryneRegNet is an ontology-based data warehouse that allows a pertinent data management of regulatory interactions along with the genome-scale reconstruction of transcriptional regulatory networks. These models can further be combined with metabolic networks to build integrated models of cellular function including both metabolism and its transcriptional regulation. PMID:16478536

  5. Acid-base equilibrium in aqueous solutions of 1,3-dimethylbarbituric acid as studied by 13C NMR spectroscopy

    NASA Astrophysics Data System (ADS)

    Gryff-Keller, A.; Kraska-Dziadecka, A.

    2011-12-01

    13C NMR spectra of 1,3-dimethylbarbituric acid in aqueous solutions of various acidities and for various solute concentrations have been recorded and interpreted. The spectra recorded at pH = 2 and below contain the signals of the neutral solute molecule exclusively, while the ones recorded at pH = 7 and above only the signals of the appropriate anion, which has been confirmed by theoretical GIAO-DFT calculations. The signals in the spectra recorded for solutions of pH < 7 show dynamic broadenings. The lineshape analysis of these signals has provided information on the kinetics of the processes running in the dynamic acid-base equilibrium. The kinetic data determined this way have been used to clarify the mechanisms of these processes. The numerical analysis has shown that under the investigated conditions deprotonation of the neutral solute molecules undergoes not only via a simple transfer of the C-H proton to water molecules but also through a process with participation of the barbiturate anions. Moreover, the importance of tautomerism, or association, or both these phenomena for the kinetics of the acid-base transformations in the investigated system has been shown. Qualitatively similar changes of 13C NMR spectra with the solution pH variation have been observed for the parent barbituric acid.

  6. An Alternative Mechanism for the Dimerization of Formic Acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brinkman, Nicole R.; Tschumper, Gregory; Yan, Ge

    Gas-phase formic acid exists primarily as a cyclic dimer. The mechanism of dimerization has been traditionally considered to be a synchronous process; however, recent experimental findings suggest a possible alternative mechanism by which two formic acid monomers proceed through an acyclic dimer to the cyclic dimer in a stepwise process. To investigate this newly proposed process of dimerization in formic acid, density functional theory and second-order Moeller-Plesset perturbation theory (MP2) have been used to optimize cis and trans monomers of formic acid, the acyclic and cyclic dimers, and the acyclic and cyclic transition states between minima. Single-point energies of themore » trans monomer, dimer minima, and transition states at the MP2/TZ2P+diff optimized geometries were computed at the coupled-cluster level of theory including singles and doubles with perturbatively applied triple excitations [CCSD(T)] with an aug-cc-pVTZ basis set to obtain an accurate determination of energy barriers and dissociation energies. A counterpoise correction was performed to determine an estimate of the basis set superposition error in computing relative energies. The explicitly correlated MP2 method of Kutzelnigg and Klopper (MP2-R12) was used to provide an independent means for obtaining the MP2 one-particle limit. The cyclic minimum is predicted to be 6.3 kcal/mol more stable than the acyclic minimum, and the barrier to double proton transfer is 7.1 kcal/mol.« less

  7. Insights into the mechanism and inhibition of fatty acid amide hydrolase from quantum mechanics/molecular mechanics (QM/MM) modelling.

    PubMed

    Lodola, Alessio; Mor, Marco; Sirirak, Jitnapa; Mulholland, Adrian J

    2009-04-01

    FAAH (fatty acid amide hydrolase) is a promising target for the treatment of several central nervous system and peripheral disorders. Combined QM/MM (quantum mechanics/molecular mechanics) calculations have elucidated the role of its unusual catalytic triad in the hydrolysis of oleamide and oleoylmethyl ester substrates, and have identified the productive inhibitor-binding orientation for the carbamoylating compound URB524. These are potentially crucial insights for designing new covalent inhibitors of this drug target.

  8. A new mechanism for bile acid diarrhea: defective feedback inhibition of bile acid biosynthesis.

    PubMed

    Walters, Julian R F; Tasleem, Ali M; Omer, Omer S; Brydon, W Gordon; Dew, Tracy; le Roux, Carel W

    2009-11-01

    Primary (idiopathic) bile acid malabsorption (BAM) is a common, yet underrecognized, chronic diarrheal syndrome. Diagnosis is difficult without selenium homocholic acid taurine (SeHCAT) testing. The diarrhea results from excess colonic bile acids, but the pathogenesis is unclear. Fibroblast growth factor 19 (FGF19), produced in the ileum in response to bile acid absorption, regulates hepatic bile acid synthesis. We proposed that FGF19 is involved in bile acid diarrhea and measured its levels in patients with BAM. Blood was collected from fasting patients with chronic diarrhea; BAM was diagnosed by SeHCAT. Serum FGF19 was measured by enzyme-linked immunosorbent assay. Serum 7alpha-hydroxy-4-cholesten-3-one (C4) was determined using high-performance liquid chromatography, to quantify bile acid synthesis. Data were compared between patients and subjects without diarrhea (controls). Samples were taken repeatedly after meals from several subjects. The median C4 level was significantly higher in patients with primary BAM than in controls (51 vs 18 ng/mL; P < .0001). The median FGF19 level was significantly lower in patients with BAM (120 vs 231 pg/mL; P < .0005). There was a significant inverse relationship between FGF19 and C4 levels (P < .0004). Low levels of FGF19 were also found in patients with postcholecystectomy and secondary bile acid diarrhea. Abnormal patterns of FGF19 levels were observed throughout the day in some patients with primary BAM. Patients with BAM have reduced serum FGF19 which may be useful in diagnosis. We propose a mechanism whereby impaired FGF19 feedback inhibition causes excessive bile acid synthesis that exceeds the normal capacity for ileal reabsorption, producing bile acid diarrhea.

  9. Fluorescent sensors based on boronic acids

    NASA Astrophysics Data System (ADS)

    Cooper, Christopher R.; James, Tony D.

    1999-05-01

    Sensor systems have long been needed for detecting the presence in solution of certain chemically or biologically important species. Sensors are used in a wide range of applications from simple litmus paper that shows a single color change in acidic or basic environments to complex biological assays that use enzymes, antibodies and antigens to display binding events. With this work the use of boronic acids in the design and synthesis of sensors for saccharides (diols) will be presented. The fluorescent sensory systems rely on photoinduced electron transfer (PET) to modulate the observed fluorescence. When saccharides form cyclic boronate esters with boronic acids, the Lewis acidity of the boronic acid is enhanced and therefore the Lewis acid-base interaction between the boronic acid and a neighboring amine is strengthened. The strength of this acid-base interaction modulates the PET from the amine (acting as a quencher) to anthracene (acting as a fluorophore). These compounds show increased fluorescence at neutral pH through suppression of the PET from nitrogen to anthracene on saccharide binding. The general strategy for the development of saccharide selective systems will be discussed. The potential of the boronic acid based systems will be illustrated using the development of glucose and glucosamine selective fluorescent sensors as examples.

  10. Regulatory divergence of homeologous Atlantic salmon elovl5 genes following the salmonid-specific whole-genome duplication.

    PubMed

    Carmona-Antoñanzas, Greta; Zheng, Xiaozhong; Tocher, Douglas R; Leaver, Michael J

    2016-10-10

    Fatty acyl elongase 5 (elovl5) is a critical enzyme in the vertebrate biosynthetic pathway which produces the physiologically essential long-chain polyunsaturated fatty acids (LC-PUFA), docosahexenoic acid (DHA), and eicosapentenoic acid (EPA) from 18 carbon fatty acids precursors. In contrast to most other vertebrates, Atlantic salmon possess two copies of elovl5 (elovl5a and elovl5b) as a result of a whole-genome duplication (WGD) which occurred at the base of the salmonid lineage. WGDs have had a major influence on vertebrate evolution, providing extra genetic material, enabling neofunctionalization to accelerate adaptation and speciation. However, little is known about the mechanisms by which such duplicated homeologous genes diverge. Here we show that homeologous Atlantic salmon elovl5a and elovl5b genes have been asymmetrically colonised by transposon-like elements. Identical locations and identities of insertions are also present in the rainbow trout duplicate elovl5 genes, but not in the nearest extant representative preduplicated teleost, the northern pike. Both elovl5 salmon duplicates possessed conserved regulatory elements that promoted Srebp1- and Srebp2-dependent transcription, and differences in the magnitude of Srebp response between promoters could be attributed to a tandem duplication of SRE and NF-Y cofactor binding sites in elovl5b. Furthermore, an insertion in the promoter region of elovl5a confers responsiveness to Lxr/Rxr transcriptional activation. Our results indicate that most, but not all, transposon mobilisation into elovl5 genes occurred after the split from the common ancestor of pike and salmon, but before more recent salmonid speciations, and that divergence of elovl5 regulatory regions have enabled neofuntionalization by promoting differential expression of these homeologous genes. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. A TRPA1-dependent mechanism for the pungent sensation of weak acids

    PubMed Central

    Wang, Yuanyuan Y.; Chang, Rui B.; Allgood, Sallie D.; Silver, Wayne L.

    2011-01-01

    Acetic acid produces an irritating sensation that can be attributed to activation of nociceptors within the trigeminal ganglion that innervate the nasal or oral cavities. These sensory neurons sense a diverse array of noxious agents in the environment, allowing animals to actively avoid tissue damage. Although receptor mechanisms have been identified for many noxious chemicals, the mechanisms by which animals detect weak acids, such as acetic acid, are less well understood. Weak acids are only partially dissociated at neutral pH and, as such, some can cross the cell membrane, acidifying the cell cytosol. The nociceptor ion channel TRPA1 is activated by CO2, through gating of the channel by intracellular protons, making it a candidate to more generally mediate sensory responses to weak acids. To test this possibility, we measured responses to weak acids from heterologously expressed TRPA1 channels and trigeminal neurons with patch clamp recording and Ca2+ microfluorometry. Our results show that heterologously expressed TRPA1 currents can be induced by a series of weak organic acids, including acetic, propionic, formic, and lactic acid, but not by strong acids. Notably, the degree of channel activation was predicted by the degree of intracellular acidification produced by each acid, suggesting that intracellular protons are the proximate stimulus that gates the channel. Responses to weak acids produced a Ca2+-independent inactivation that precluded further activation by weak acids or reactive chemicals, whereas preactivation by reactive electrophiles sensitized TRPA1 channels to weak acids. Importantly, responses of trigeminal neurons to weak acids were highly overrepresented in the subpopulation of TRPA1-expressing neurons and were severely reduced in neurons from TRPA1 knockout mice. We conclude that TRPA1 is a general sensor for weak acids that produce intracellular acidification and suggest that it functions within the pain pathway to mediate sensitivity to

  12. Plasticity and innovation of regulatory mechanisms underlying seed oil content mediated by duplicated genes in the palaeopolyploid soybean.

    PubMed

    Zhang, Dajian; Zhao, Meixia; Li, Shuai; Sun, Lianjun; Wang, Weidong; Cai, Chunmei; Dierking, Emily C; Ma, Jianxin

    2017-06-01

    Many plants have undergone whole genome duplication (WGD). However, how regulatory networks underlying a particular trait are reshaped in polyploids has not been experimentally investigated. Here we show that the regulatory pathways modulating seed oil content, which involve WRINKLED1 (WRI1), LEAFY COTYLEDON1 (LEC1), and LEC2 in Arabidopsis, have been modified in the palaeopolyploid soybean. Such modifications include functional reduction of GmWRI1b of the GmWRI1a/GmWRI1b homoeologous pair relevant to WRI1, complementary non-allelic dosage effects of the GmLEC1a/GmLEC1b homoeologous pair relevant to LEC1, pseudogenization of the singleton GmLEC2 relevant to LEC2, and the rise of the LEC2-like function of GmABI3b, contrasting to its homoeolog GmABI3a, which maintains the ABSCISIC ACID INSENSITIVE 3 (ABI3)-like function in modulating seed maturation and dormancy. The function of GmABI3b in modulating seed oil biosynthesis was fulfilled by direct binding to a RY (CATGCA) cis-regulatory element in the GmWRI1a promoter, which was absent in the GmWRI1b promoter, resulting in reduction of the GmWRI1b expression. Nevertheless, the three regulators each exhibited similar intensities of purifying selection to their respective duplicates since these pairs were formed by a WGD event that is proposed to have occurred approximately 13 million years ago (mya), suggesting that the differentiation in spatiotemporal expression between the duplicated genes is more likely to be the outcome of neutral variation in regulatory sequences. This study thus exemplifies the plasticity, dynamics, and novelty of regulatory networks mediated by WGD. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  13. Ultrastructural observation of the acid-base resistant zone of all-in-one adhesives using three different acid-base challenges.

    PubMed

    Tsujimoto, Miho; Nikaido, Toru; Inoue, Go; Sadr, Alireza; Tagami, Junji

    2010-11-01

    The aim of this study was to analyze the ultrastructure of the dentin-adhesive interface using two all-in-one adhesive systems (Clearfil Tri-S Bond, TB; Tokuyama Bond Force, BF) after different acid-base challenges. Three solutions were used as acidic solutions for the acid-base challenges: a demineralizing solution (DS), a phosphoric acid solution (PA), and a hydrochloric acid solution (HCl). After the acid-base challenges, the bonded interfaces were examined by scanning electron microscopy. Thickness of the acid-base resistant zone (ABRZ) created in PA and HCl was thinner than in DS for both adhesive systems. For BF adhesive, an eroded area was observed beneath the ABRZ after immersion in PA and HCl, but not in DS. Conversely for TB adhesive, the eroded area was observed only after immersion in PA. In conclusion, although the ABRZ was observed for both all-in-one adhesive systems, its morphological features were influenced by the ingredients of both the adhesive material and acidic solution.

  14. [What is the contribution of Stewart's concept in acid-base disorders analysis?].

    PubMed

    Quintard, H; Hubert, S; Ichai, C

    2007-05-01

    . This concept allows to establish the relationship between hyperchloremic acidosis and infusion of solutes which contain large concentration of chloride such as NaCl 0.9%. Finally, the Stewart concept permits to understand that sodium bicarbonate as well as sodium lactate induces plasma alkalinization. In fact, sodium remains in plasma, whereas anion (lactate or bicarbonate) are metabolized leading to an increase in plasma SID. Due to its simplicity, the traditional Henderson-Hasselbalch approach of acid-base disorders, remains commonly used. However, it gives an inadequate pathophysiological analysis which may conduct to a false diagnosis, especially with complex acid-base imbalances. Despite its apparent complexity, the Stewart concept permits to understand precisely the mechanisms of acid-base disorders. It has to become the most appropriate approach to analyse complex acid-base abnormalities.

  15. Finding gene regulatory network candidates using the gene expression knowledge base.

    PubMed

    Venkatesan, Aravind; Tripathi, Sushil; Sanz de Galdeano, Alejandro; Blondé, Ward; Lægreid, Astrid; Mironov, Vladimir; Kuiper, Martin

    2014-12-10

    Network-based approaches for the analysis of large-scale genomics data have become well established. Biological networks provide a knowledge scaffold against which the patterns and dynamics of 'omics' data can be interpreted. The background information required for the construction of such networks is often dispersed across a multitude of knowledge bases in a variety of formats. The seamless integration of this information is one of the main challenges in bioinformatics. The Semantic Web offers powerful technologies for the assembly of integrated knowledge bases that are computationally comprehensible, thereby providing a potentially powerful resource for constructing biological networks and network-based analysis. We have developed the Gene eXpression Knowledge Base (GeXKB), a semantic web technology based resource that contains integrated knowledge about gene expression regulation. To affirm the utility of GeXKB we demonstrate how this resource can be exploited for the identification of candidate regulatory network proteins. We present four use cases that were designed from a biological perspective in order to find candidate members relevant for the gastrin hormone signaling network model. We show how a combination of specific query definitions and additional selection criteria derived from gene expression data and prior knowledge concerning candidate proteins can be used to retrieve a set of proteins that constitute valid candidates for regulatory network extensions. Semantic web technologies provide the means for processing and integrating various heterogeneous information sources. The GeXKB offers biologists such an integrated knowledge resource, allowing them to address complex biological questions pertaining to gene expression. This work illustrates how GeXKB can be used in combination with gene expression results and literature information to identify new potential candidates that may be considered for extending a gene regulatory network.

  16. Decoding the role of regulatory element polymorphisms in complex disease.

    PubMed

    Vockley, Christopher M; Barrera, Alejandro; Reddy, Timothy E

    2017-04-01

    Genetic variation in gene regulatory elements contributes to diverse human diseases, ranging from rare and severe developmental defects to common and complex diseases such as obesity and diabetes. Early examples of regulatory mechanisms of human diseases involve large chromosomal rearrangements that change the regulatory connections within the genome. Single nucleotide variants in regulatory elements can also contribute to disease, potentially via demonstrated associations with changes in transcription factor binding, enhancer activity, post-translational histone modifications, long-range enhancer-promoter interactions, or RNA polymerase recruitment. Establishing causality between non-coding genetic variants, gene regulation, and disease has recently become more feasible with advances in genome-editing and epigenome-editing technologies. As establishing causal regulatory mechanisms of diseases becomes routine, functional annotation of target genes is likely to emerge as a major bottleneck for translation into patient benefits. In this review, we discuss the history and recent advances in understanding the regulatory mechanisms of human disease, and new challenges likely to be encountered once establishing those mechanisms becomes rote. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Primer on clinical acid-base problem solving.

    PubMed

    Whittier, William L; Rutecki, Gregory W

    2004-03-01

    Acid-base problem solving has been an integral part of medical practice in recent generations. Diseases discovered in the last 30-plus years, for example, Bartter syndrome and Gitelman syndrome, D-lactic acidosis, and bulimia nervosa, can be diagnosed according to characteristic acid-base findings. Accuracy in acid-base problem solving is a direct result of a reproducible, systematic approach to arterial pH, partial pressure of carbon dioxide, bicarbonate concentration, and electrolytes. The 'Rules of Five' is one tool that enables clinicians to determine the cause of simple and complex disorders, even triple acid-base disturbances, with consistency. In addition, other electrolyte abnormalities that accompany acid-base disorders, such as hypokalemia, can be incorporated into algorithms that complement the Rules and contribute to efficient problem solving in a wide variety of diseases. Recently urine electrolytes have also assisted clinicians in further characterizing select disturbances. Acid-base patterns, in many ways, can serve as a 'common diagnostic pathway' shared by all subspecialties in medicine. From infectious disease (eg, lactic acidemia with highly active antiviral therapy therapy) through endocrinology (eg, Conn's syndrome, high urine chloride alkalemia) to the interface between primary care and psychiatry (eg, bulimia nervosa with multiple potential acid-base disturbances), acid-base problem solving is the key to unlocking otherwise unrelated diagnoses. Inasmuch as the Rules are clinical tools, they are applied throughout this monograph to diverse pathologic conditions typical in contemporary practice.

  18. Design and Mechanism of Tetrahydrothiophene-based GABA Aminotransferase Inactivators

    PubMed Central

    Le, Hoang V.; Hawker, Dustin D.; Wu, Rui; Doud, Emma; Widom, Julia; Sanishvili, Ruslan; Liu, Dali; Kelleher, Neil L.; Silverman, Richard B.

    2015-01-01

    Low levels of γ-aminobutyric acid (GABA), one of two major neurotransmitters that regulate brain neuronal activity, are associated with many neurological disorders, such as epilepsy, Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, and cocaine addiction. One of the main methods to raise the GABA level in human brain is to use small molecules that cross the blood-brain barrier and inhibit the activity of γ-aminobutyric acid aminotransferase (GABA-AT), the enzyme that degrades GABA. We have designed a series of conformationally-restricted, tetrahydrothiophene-based GABA analogs with a properly-positioned leaving group that could facilitate a ring-opening mechanism, leading to inactivation of GABA-AT. One compound in the series is eight times more efficient an inactivator of GABA-AT than vigabatrin, the only FDA-approved inactivator of GABA-AT. Our mechanistic studies show that the compound inactivates GABA-AT by a new mechanism. The metabolite resulting from inactivation does not covalently bind to amino acid residues of GABA-AT but stays in the active site via H-bond interactions with Arg-192, a π-π interaction with Phe-189, and a weak nonbonded S···O=C interaction with Glu-270, thereby inactivating the enzyme. PMID:25781189

  19. Potential mechanisms for low uric acid in Parkinson disease

    PubMed Central

    Young, Sarah; Rosen, Ami; Bernhard, Douglas; Millington, David; Factor, Stewart

    2018-01-01

    Several epidemiologic studies have described an association between low serum uric acid (UA) and Parkinson disease (PD). Uric acid is a known antioxidant, and one proposed mechanism of neurodegeneration in PD is oxidative damage of dopamine neurons. However, other complex metabolic pathways may contribute. The purpose of this study is to elucidate potential mechanisms of low serum UA in PD. Subjects who met diagnostic criteria for definite or probable PD (n = 20) and controls (n = 20) aged 55–80 years were recruited. Twenty-four hour urine samples were collected from all participants, and both uric acid and allantoin were measured and corrected for body mass index (BMI). Urinary metabolites were compared using a twoway ANOVA with diagnosis and sex as the explanatory variables. There were no significant differences between PD and controls for total UA (p = 0.60), UA corrected for BMI (p = 0.37), or in the interaction of diagnosis and sex on UA (p = 0.24). Similarly, there were no significant differences between PD and controls for allantoin (p = 0.47), allantoin corrected for BMI (p = 0.57), or in the interaction of diagnosis and sex on allantoin (p = 0.78). Allantoin/UA ratios also did not significantly differ by diagnosis (p = 0.99). Our results imply that low serum UA in PD may be due to an intrinsic mechanism that alters the homeostatic set point for serum UA in PD, and may contribute to relatively lower protection against oxidative damage. These findings provide indirect support for neuroprotection trials aimed at raising serum UA. PMID:26747026

  20. Azelaic Acid: Evidence-based Update on Mechanism of Action and Clinical Application.

    PubMed

    Schulte, Brian C; Wu, Wesley; Rosen, Ted

    2015-09-01

    Azelaic acid is a complex molecule with many diverse activities. The latter include anti-infective and anti-inflammatory action. The agent also inhibits follicular keratinization and epidermal melanogenesis. Due to the wide variety of biological activities, azelaic acid has been utilized as a management tool in a broad spectrum of disease states and cutaneous disorders. This paper reviews the clinical utility of azelaic acid, noting the quality of the evidence supporting each potential use.

  1. Interpretation of pH-activity profiles for acid-base catalysis from molecular simulations.

    PubMed

    Dissanayake, Thakshila; Swails, Jason M; Harris, Michael E; Roitberg, Adrian E; York, Darrin M

    2015-02-17

    The measurement of reaction rate as a function of pH provides essential information about mechanism. These rates are sensitive to the pK(a) values of amino acids directly involved in catalysis that are often shifted by the enzyme active site environment. Experimentally observed pH-rate profiles are usually interpreted using simple kinetic models that allow estimation of "apparent pK(a)" values of presumed general acid and base catalysts. One of the underlying assumptions in these models is that the protonation states are uncorrelated. In this work, we introduce the use of constant pH molecular dynamics simulations in explicit solvent (CpHMD) with replica exchange in the pH-dimension (pH-REMD) as a tool to aid in the interpretation of pH-activity data of enzymes and to test the validity of different kinetic models. We apply the methods to RNase A, a prototype acid-base catalyst, to predict the macroscopic and microscopic pK(a) values, as well as the shape of the pH-rate profile. Results for apo and cCMP-bound RNase A agree well with available experimental data and suggest that deprotonation of the general acid and protonation of the general base are not strongly coupled in transphosphorylation and hydrolysis steps. Stronger coupling, however, is predicted for the Lys41 and His119 protonation states in apo RNase A, leading to the requirement for a microscopic kinetic model. This type of analysis may be important for other catalytic systems where the active forms of the implicated general acid and base are oppositely charged and more highly correlated. These results suggest a new way for CpHMD/pH-REMD simulations to bridge the gap with experiments to provide a molecular-level interpretation of pH-activity data in studies of enzyme mechanisms.

  2. Interpretation of pH-activity Profiles for Acid-Base Catalysis from Molecular Simulations

    PubMed Central

    Dissanayake, Thakshila; Swails, Jason; Harris, Michael E.; Roitberg, Adrian E.; York, Darrin M.

    2015-01-01

    The measurement of reaction rate as a function of pH provides essential information about mechanism. These rates are sensitive to the pKa values of amino acids directly involved in catalysis that are often shifted by the enzyme active site environment. Experimentally observed pH-rate profiles are usually interpreted using simple kinetic models that allow estimation of “apparent pKa” values of presumed general acid and base catalysts. One of the underlying assumptions in these models is that the protonation states are uncorrelated. In the present work, we introduce the use of constant pH molecular dynamics simulations in explicit solvent (CpHMD) with replica exchange in the pH-dimension (pH-REMD) as a tool to aid in the interpretation of pH-activity data of enzymes, and test the validity of different kinetic models. We apply the methods to RNase A, a prototype acid/base catalyst, to predict the macroscopic and microscopic pKa values, as well as the shape of the pH-rate profile. Results for apo and cCMP-bound RNase A agree well with available experimental data, and suggest that deprotonation of the general acid and protonation of the general base are not strongly coupled in transphosphorylation and hydrolysis steps. Stronger coupling, however, is predicted for the Lys41 and His119 protonation states in apo RNase A, leading to the requirement for a microscopic kinetic model. This type of analysis may be important for other catalytic systems where the active forms of implicated general acid and base are oppositely charged and more highly correlated. These results suggest a new way for CpHMD/pH-REMD simulations to bridge the gap with experiments to provide a molecular-level interpretation of pH-activity data in studies of enzyme mechanisms. PMID:25615525

  3. Teaching Acid/Base Physiology in the Laboratory

    ERIC Educational Resources Information Center

    Friis, Ulla G.; Plovsing, Ronni; Hansen, Klaus; Laursen, Bent G.; Wallstedt, Birgitta

    2010-01-01

    Acid/base homeostasis is one of the most difficult subdisciplines of physiology for medical students to master. A different approach, where theory and practice are linked, might help students develop a deeper understanding of acid/base homeostasis. We therefore set out to develop a laboratory exercise in acid/base physiology that would provide…

  4. Molecular Mechanisms for Sweet-suppressing Effect of Gymnemic Acids*

    PubMed Central

    Sanematsu, Keisuke; Kusakabe, Yuko; Shigemura, Noriatsu; Hirokawa, Takatsugu; Nakamura, Seiji; Imoto, Toshiaki; Ninomiya, Yuzo

    2014-01-01

    Gymnemic acids are triterpene glycosides that selectively suppress taste responses to various sweet substances in humans but not in mice. This sweet-suppressing effect of gymnemic acids is diminished by rinsing the tongue with γ-cyclodextrin (γ-CD). However, little is known about the molecular mechanisms underlying the sweet-suppressing effect of gymnemic acids and the interaction between gymnemic acids versus sweet taste receptor and/or γ-CD. To investigate whether gymnemic acids directly interact with human (h) sweet receptor hT1R2 + hT1R3, we used the sweet receptor T1R2 + T1R3 assay in transiently transfected HEK293 cells. Similar to previous studies in humans and mice, gymnemic acids (100 μg/ml) inhibited the [Ca2+]i responses to sweet compounds in HEK293 cells heterologously expressing hT1R2 + hT1R3 but not in those expressing the mouse (m) sweet receptor mT1R2 + mT1R3. The effect of gymnemic acids rapidly disappeared after rinsing the HEK293 cells with γ-CD. Using mixed species pairings of human and mouse sweet receptor subunits and chimeras, we determined that the transmembrane domain of hT1R3 was mainly required for the sweet-suppressing effect of gymnemic acids. Directed mutagenesis in the transmembrane domain of hT1R3 revealed that the interaction site for gymnemic acids shared the amino acid residues that determined the sensitivity to another sweet antagonist, lactisole. Glucuronic acid, which is the common structure of gymnemic acids, also reduced sensitivity to sweet compounds. In our models, gymnemic acids were predicted to dock to a binding pocket within the transmembrane domain of hT1R3. PMID:25056955

  5. Lewis pair polymerization by classical and frustrated Lewis pairs: acid, base and monomer scope and polymerization mechanism.

    PubMed

    Zhang, Yuetao; Miyake, Garret M; John, Mallory G; Falivene, Laura; Caporaso, Lucia; Cavallo, Luigi; Chen, Eugene Y-X

    2012-08-14

    Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C(6)F(5))(3) with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl-α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C(6)F(5))(3)-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C(6)F(5))(3), can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P(t)Bu(3)), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P(4)-(t)Bu). The P(4)-(t)Bu/Al(C(6)F(5))(3) pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10(4) h(-1) (0.125 mol% catalyst, 100% MMA conversion in 30 s, M(n) = 2.12 × 10(5) g mol(-1), PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P(γ)MMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C(6)F(5))(3) adduct with P(t)Bu(3) and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the (t)Bu(3)P/Al(C(6)F(5))(3) pair is zero-order in monomer concentration after an initial

  6. Therapeutic nucleic acids: current clinical status

    PubMed Central

    Sridharan, Kannan

    2016-01-01

    Abstract Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are simple linear polymers that have been the subject of considerable research in the last two decades and have now moved into the realm of being stand‐alone therapeutic agents. Much of this has stemmed from the appreciation that they carry out myriad functions that go beyond mere storage of genetic information and protein synthesis. Therapy with nucleic acids either uses unmodified DNA or RNA or closely related compounds. From both a development and regulatory perspective, they fall somewhere between small molecules and biologics. Several of these compounds are in clinical development and many have received regulatory approval for human use. This review addresses therapeutic uses of DNA based on antisense oligonucleotides, DNA aptamers and gene therapy; and therapeutic uses of RNA including micro RNAs, short interfering RNAs, ribozymes, RNA decoys and circular RNAs. With their specificity, functional diversity and limited toxicity, therapeutic nucleic acids hold enormous promise. However, challenges that need to be addressed include targeted delivery, mass production at low cost, sustaining efficacy and minimizing off‐target toxicity. Technological developments will hold the key to this and help accelerate drug approvals in the years to come. PMID:27111518

  7. Sterol regulatory element-binding protein-1 participates in the regulation of fatty acid synthase expression in colorectal neoplasia.

    PubMed

    Li, J N; Mahmoud, M A; Han, W F; Ripple, M; Pizer, E S

    2000-11-25

    Endogenous fatty acid synthesis has been observed in certain rapidly proliferating normal and neoplastic tissues. Sterol regulatory element-binding proteins (SREBPs) are transcription factors that regulate the expression of lipogenic genes including fatty acid synthase (FAS), the major biosynthetic enzyme for fatty acid synthesis. We have previously shown that SREBP-1, FAS, and Ki-67, a proliferation marker, colocalized in the crypts of the fetal gastrointestinal tract epithelium. This study sought to determine whether SREBP-1 participates in the regulation of proliferation-associated fatty acid synthesis in colorectal neoplasia. An immunohistochemical analysis of SREBP-1, FAS, and Ki-67 expression in 25 primary human colorectal carcinoma specimens showed colocalization in 22 of these. To elucidate a functional linkage between SREBP-1 activation and proliferation-associated FA synthesis, SREBP-1 and FAS content were assayed during the adaptive response of cultured HCT116 colon carcinoma cells to pharmacological inhibition of FA synthesis. Cerulenin and TOFA each inhibited the endogenous synthesis of fatty acids in a dose-dependent manner and each induced increases in both precursor and mature forms of SREBP-1. Subsequently, both the transcriptional activity of the FAS promoter in a luciferase reporter gene construct and the FAS expression increased. These results demonstrate that tumor cells recognize and respond to a deficiency in endogenous fatty acid synthesis by upregulating both SREBP-1 and FAS expression and support the model that SREBP-1 participates in the transcriptional regulation of lipogenic genes in colorectal neoplasia. Copyright 2000 Academic Press.

  8. [Kidney, Fluid, and Acid-Base Balance].

    PubMed

    Shioji, Naohiro; Hayashi, Masao; Morimatsu, Hiroshi

    2016-05-01

    Kidneys play an important role to maintain human homeostasis. They contribute to maintain body fluid, electrolytes, and acid-base balance. Especially in fluid control, we, physicians can intervene body fluid balance using fluid resuscitation and diuretics. In recent years, one type of fluid resuscitation, hydroxyl ethyl starch has been extensively studied in the field of intensive care. Although their effects on fluid resuscitation are reasonable, serious complications such as kidney injury requiring renal replacement therapy occur frequently. Now we have to pay more attention to this important complication. Another topic of fluid management is tolvaptan, a selective vasopressin-2 receptor antagonist Recent randomized trial suggested that tolvaptan has a similar supportive effect for fluid control and more cost effective compared to carperitide. In recent years, Stewart approach is recognized as one important tool to assess acid-base balance in critically ill patients. This approach has great value, especially to understand metabolic components in acid-base balance. Even for assessing the effects of kidneys on acid-base balance, this approach gives us interesting insight. We should appropriately use this new approach to treat acid-base abnormality in critically ill patients.

  9. Impact of Regulatory Interventions to Reduce Intake of Artificial Trans–Fatty Acids: A Systematic Review

    PubMed Central

    Almíron-Roig, Eva; Monsivais, Pablo; Jebb, Susan A.; Benjamin Neelon, Sara E.; Griffin, Simon J.; Ogilvie, David B.

    2015-01-01

    We examined the impact of regulatory action to reduce levels of artificial trans–fatty acids (TFAs) in food. We searched Medline, Embase, ISI Web of Knowledge, and EconLit (January 1980 to December 2012) for studies related to government regulation of food- or diet-related health behaviors from which we extracted the subsample of legislative initiatives to reduce artificial TFAs in food. We screened 38 162 articles and identified 14 studies that examined artificial TFA controls limiting permitted levels or mandating labeling. These measures achieved good compliance, with evidence of appropriate reformulation. Regulations grounded on maximum limits and mandated labeling can lead to reductions in actual and reported TFAs in food and appear to encourage food producers to reformulate their products. PMID:25602897

  10. The pH ruler: a Java applet for developing interactive exercises on acids and bases.

    PubMed

    Barrette-Ng, Isabelle H

    2011-07-01

    In introductory biochemistry courses, it is often a struggle to teach the basic concepts of acid-base chemistry in a manner that is relevant to biological systems. To help students gain a more intuitive and visual understanding of abstract acid-base concepts, a simple graphical construct called the pH ruler Java applet was developed. The applet allows students to visualize the abundance of different protonation states of diprotic and triprotic amino acids at different pH values. Using the applet, the student can drag a widget on a slider bar to change the pH and observe in real time changes in the abundance of different ionization states of this amino acid. This tool provides a means for developing more complex inquiry-based, active-learning exercises to teach more advanced topics of biochemistry, such as protein purification, protein structure and enzyme mechanism.

  11. Density-dependence as a size-independent regulatory mechanism.

    PubMed

    de Vladar, Harold P

    2006-01-21

    The growth function of populations is central in biomathematics. The main dogma is the existence of density-dependence mechanisms, which can be modelled with distinct functional forms that depend on the size of the population. One important class of regulatory functions is the theta-logistic, which generalizes the logistic equation. Using this model as a motivation, this paper introduces a simple dynamical reformulation that generalizes many growth functions. The reformulation consists of two equations, one for population size, and one for the growth rate. Furthermore, the model shows that although population is density-dependent, the dynamics of the growth rate does not depend either on population size, nor on the carrying capacity. Actually, the growth equation is uncoupled from the population size equation, and the model has only two parameters, a Malthusian parameter rho and a competition coefficient theta. Distinct sign combinations of these parameters reproduce not only the family of theta-logistics, but also the van Bertalanffy, Gompertz and Potential Growth equations, among other possibilities. It is also shown that, except for two critical points, there is a general size-scaling relation that includes those appearing in the most important allometric theories, including the recently proposed Metabolic Theory of Ecology. With this model, several issues of general interest are discussed such as the growth of animal population, extinctions, cell growth and allometry, and the effect of environment over a population.

  12. Automatic inference of multicellular regulatory networks using informative priors.

    PubMed

    Sun, Xiaoyun; Hong, Pengyu

    2009-01-01

    To fully understand the mechanisms governing animal development, computational models and algorithms are needed to enable quantitative studies of the underlying regulatory networks. We developed a mathematical model based on dynamic Bayesian networks to model multicellular regulatory networks that govern cell differentiation processes. A machine-learning method was developed to automatically infer such a model from heterogeneous data. We show that the model inference procedure can be greatly improved by incorporating interaction data across species. The proposed approach was applied to C. elegans vulval induction to reconstruct a model capable of simulating C. elegans vulval induction under 73 different genetic conditions.

  13. Deciphering RNA Regulatory Elements Involved in the Developmental and Environmental Gene Regulation of Trypanosoma brucei.

    PubMed

    Gazestani, Vahid H; Salavati, Reza

    2015-01-01

    Trypanosoma brucei is a vector-borne parasite with intricate life cycle that can cause serious diseases in humans and animals. This pathogen relies on fine regulation of gene expression to respond and adapt to variable environments, with implications in transmission and infectivity. However, the involved regulatory elements and their mechanisms of actions are largely unknown. Here, benefiting from a new graph-based approach for finding functional regulatory elements in RNA (GRAFFER), we have predicted 88 new RNA regulatory elements that are potentially involved in the gene regulatory network of T. brucei. We show that many of these newly predicted elements are responsive to both transcriptomic and proteomic changes during the life cycle of the parasite. Moreover, we found that 11 of predicted elements strikingly resemble previously identified regulatory elements for the parasite. Additionally, comparison with previously predicted motifs on T. brucei suggested the superior performance of our approach based on the current limited knowledge of regulatory elements in T. brucei.

  14. Beta-ketoacyl-acyl carrier protein synthase IV: a key enzyme for regulation of medium-chain fatty acid synthesis in Cuphea lanceolata seeds.

    PubMed

    Schütt, Burkhardt Siegfried; Abbadi, Amine; Loddenkötter, Brigitte; Brummel, Monika; Spener, Friedrich

    2002-09-01

    With the aim of elucidating the mechanisms involved in the biosynthesis of medium-chain fatty acids in Cuphea lanceolata Ait., a crop accumulating up to 90% decanoic acid in seed triacylglycerols, cDNA clones of a beta-ketoacyl-acyl carrier protein (ACP) synthase IV (clKAS IV, EC 2.3.1.41) were isolated from C. lanceolata seed embryos. The amino acid sequence deduced from clKAS IV cDNA showed 80% identity to other plant KAS II-type enzymes, 55% identity towards plant KAS I and over 90% towards other Cuphea KAS IV-type sequences. Recombinant clKAS IV was functionally overexpressed in Escherichia coli, and substrate specificity of purified enzyme showed strong preference for elongation of short-chain and medium-chain acyl-ACPs (C4- to C10-ACP) with nearly equal activity. Further elongation steps were catalysed with distinctly less activity. Moreover, short- and medium-chain acyl-ACPs exerted a chain-length-specific and concentration-dependent substrate inhibition of clKAS IV. Based on these findings a regulatory mechanism for medium-chain fatty acid synthesis in C. lanceolata is presented.

  15. Mechanism of Calcium Lactate Facilitating Phytic Acid Degradation in Soybean during Germination.

    PubMed

    Hui, Qianru; Yang, Runqiang; Shen, Chang; Zhou, Yulin; Gu, Zhenxin

    2016-07-13

    Calcium lactate facilitates the growth and phytic acid degradation of soybean sprouts, but the mechanism is unclear. In this study, calcium lactate (Ca) and calcium lactate with lanthanum chloride (Ca+La) were used to treat soybean sprouts to reveal the relevant mechanism. Results showed that the phytic acid content decreased and the availability of phosphorus increased under Ca treatment. This must be due to the enhancement of enzyme activity related to phytic acid degradation. In addition, the energy metabolism was accelerated by Ca treatment. The energy status and energy metabolism-associated enzyme activity also increased. However, the transmembrane transport of calcium was inhibited by La(3+) and concentrated in intercellular space or between the cell wall and cell membrane; thus, Ca+La treatment showed reverse results compared with those of Ca treatment. Interestingly, gene expression did not vary in accordance with their enzyme activity. These results demonstrated that calcium lactate increased the rate of phytic acid degradation by enhancing growth, phosphorus metabolism, and energy metabolism.

  16. Down-regulated energy metabolism genes associated with mitochondria oxidative phosphorylation and fatty acid metabolism in viral cardiomyopathy mouse heart.

    PubMed

    Xu, Jing; Nie, Hong-gang; Zhang, Xiao-dong; Tian, Ye; Yu, Bo

    2011-08-01

    The majority of experimental and clinical studies indicates that the hypertrophied and failing myocardium are characterized by changes in energy and substrate metabolism that attributed to failing heart changes at the genomic level, in fact, heart failure is caused by various diseases, their energy metabolism and substrate are in different genetic variations, then the potential significance of the molecular mechanisms for the aetiology of heart failure is necessary to be evaluated. Persistent viral infection (especially coxsackievirus group B3) of the myocardium in viral myocarditis and viral dilated cardiomyopathy has never been neglected by experts. This study aimed to explore the role and regulatory mechanism of the altered gene expression for energy metabolism involved in mitochondrial oxidative phosphorylation, fatty acid metabolism in viral dilated cardiomyopathy. cDNA Microarray technology was used to evaluate the expression of >35,852 genes in a mice model of viral dilated cardiomyopathy. In total 1385 highly different genes expression, we analyzed 33 altered genes expression for energy metabolism involved in mitochondrial oxidative phosphorylation, fatty acid metabolism and further selected real-time-PCR for quantity one of regulatory mechanisms for energy including fatty acid metabolism-the UCP2 and assayed cytochrome C oxidase activity by Spectrophotometer to explore mitochondrial oxidative phosphorylation function. We found obviously different expression of 33 energy metabolism genes associated with mitochondria oxidative phosphorylation, fatty acid metabolism in cardiomyopathy mouse heart, the regulatory gene for energy metabolism: UCP2 was down-regulated and cytochrome C oxidase activity was decreased. Genes involved in both fatty acid metabolism and mitochondrial oxidative phosphorylation were down-regulated, mitochondrial uncoupling proteins (UCP2) expression did not increase but decrease which might be a kind of adaptive protection response to

  17. Cytosolic nucleic acid sensors and innate immune regulation.

    PubMed

    Ori, Daisuke; Murase, Motoya; Kawai, Taro

    2017-03-04

    During viral and bacterial infections, pathogen-derived cytosolic nucleic acids are recognized by the intracellular RNA sensors retinoic acid-inducible gene I and melanoma-differentiated gene 5 and intracellular DNA sensors, including cyclic-di-GMP-AMP synthase, absent in melanoma 2, interferon (IFN)-gamma inducible protein 16, polymerase III, and so on. Binding of intracellular nucleic acids to these sensors activates downstream signaling cascades, resulting in the production of type I IFNs and pro-inflammatory cytokines to induce appropriate systematic immune responses. While these sensors also recognize endogenous nucleic acids and activate immune responses, they can discriminate between self- and non-self-nucleic acids. However, dysfunction of these sensors or failure of regulatory mechanisms causes aberrant activation of immune response and autoimmune disorders. In this review, we focus on how intracellular immune sensors recognize exogenous nucleic acids and activate the innate immune system, and furthermore, how autoimmune diseases result from dysfunction of these sensors.

  18. Uncovering transcription factor and microRNA risk regulatory pathways associated with osteoarthritis by network analysis.

    PubMed

    Song, Zhenhua; Zhang, Chi; He, Lingxiao; Sui, Yanfang; Lin, Xiafei; Pan, Jingjing

    2018-06-12

    Osteoarthritis (OA) is the most common form of joint disease. The development of inflammation have been considered to play a key role during the progression of OA. Regulatory pathways are known to play crucial roles in many pathogenic processes. Thus, deciphering these risk regulatory pathways is critical for elucidating the mechanisms underlying OA. We constructed an OA-specific regulatory network by integrating comprehensive curated transcription and post-transcriptional resource involving transcription factor (TF) and microRNA (miRNA). To deepen our understanding of underlying molecular mechanisms of OA, we developed an integrated systems approach to identify OA-specific risk regulatory pathways. In this study, we identified 89 significantly differentially expressed genes between normal and inflamed areas of OA patients. We found the OA-specific regulatory network was a standard scale-free network with small-world properties. It significant enriched many immune response-related functions including leukocyte differentiation, myeloid differentiation and T cell activation. Finally, 141 risk regulatory pathways were identified based on OA-specific regulatory network, which contains some known regulator of OA. The risk regulatory pathways may provide clues for the etiology of OA and be a potential resource for the discovery of novel OA-associated disease genes. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. Guanine base stacking in G-quadruplex nucleic acids

    PubMed Central

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2013-01-01

    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  20. Slc3a2 Mediates Branched-Chain Amino-Acid-Dependent Maintenance of Regulatory T Cells.

    PubMed

    Ikeda, Kayo; Kinoshita, Makoto; Kayama, Hisako; Nagamori, Shushi; Kongpracha, Pornparn; Umemoto, Eiji; Okumura, Ryu; Kurakawa, Takashi; Murakami, Mari; Mikami, Norihisa; Shintani, Yasunori; Ueno, Satoko; Andou, Ayatoshi; Ito, Morihiro; Tsumura, Hideki; Yasutomo, Koji; Ozono, Keiichi; Takashima, Seiji; Sakaguchi, Shimon; Kanai, Yoshikatsu; Takeda, Kiyoshi

    2017-11-14

    Foxp3 + regulatory T (Treg) cells, which suppress immune responses, are highly proliferative in vivo. However, it remains unclear how the active replication of Treg cells is maintained in vivo. Here, we show that branched-chain amino acids (BCAAs), including isoleucine, are required for maintenance of the proliferative state of Treg cells via the amino acid transporter Slc3a2-dependent metabolic reprogramming. Mice fed BCAA-reduced diets showed decreased numbers of Foxp3 + Treg cells with defective in vivo proliferative capacity. Mice lacking Slc3a2 specifically in Foxp3 + Treg cells showed impaired in vivo replication and decreased numbers of Treg cells. Slc3a2-deficient Treg cells showed impaired isoleucine-induced activation of the mTORC1 pathway and an altered metabolic state. Slc3a2 mutant mice did not show an isoleucine-induced increase of Treg cells in vivo and exhibited multi-organ inflammation. Taken together, these findings demonstrate that BCAA controls Treg cell maintenance via Slc3a2-dependent metabolic regulation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  1. Molecular mechanisms behind the antimicrobial activity of hop iso-α-acids in Lactobacillus brevis.

    PubMed

    Schurr, Benjamin C; Hahne, Hannes; Kuster, Bernhard; Behr, Jürgen; Vogel, Rudi F

    2015-04-01

    The main bittering component in beer, hop iso-α-acids, have been characterised as weak acids, which act as ionophores impairing microbial cells' function under acidic conditions as present in beer. Besides medium pH, divalent cations play a central role regarding the efficacy of the antimicrobial effect. The iso-α-acids' non-bitter derivatives humulinic acids can be found in isomerised hop extracts and can be generated during hop storage. Therefore, they have been under investigation concerning their influence on beer sensory properties. This study sketches the molecular mechanism behind iso-α-acids' antimicrobial activity in Lactobacillus (L.) brevis regarding their ionophore activity versus the dependence of the inhibitory potential on manganese binding, and suggests humulinic acids as novel tasteless food preservatives. We designed and synthesised chemically modified iso-α-acids to enhance the basic understanding of the molecular mechanism of antimicrobial iso-α-acids. It could be observed that a manganese-binding dependent transmembrane redox reaction (oxidative stress) plays a crucial role in inhibition. Privation of an acidic hydroxyl group neither erased ionophore activity, nor did it entirely abolish antimicrobial activity. Humulinic acids proved to be highly inhibitory, even outperforming iso-α-acids. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Critical protein GAPDH and its regulatory mechanisms in cancer cells

    PubMed Central

    Zhang, Jin-Ying; Zhang, Fan; Hong, Chao-Qun; Giuliano, Armando E.; Cui, Xiao-Jiang; Zhou, Guang-Ji; Zhang, Guo-Jun; Cui, Yu-Kun

    2015-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), initially identified as a glycolytic enzyme and considered as a housekeeping gene, is widely used as an internal control in experiments on proteins, mRNA, and DNA. However, emerging evidence indicates that GAPDH is implicated in diverse functions independent of its role in energy metabolism; the expression status of GAPDH is also deregulated in various cancer cells. One of the most common effects of GAPDH is its inconsistent role in the determination of cancer cell fate. Furthermore, studies have described GAPDH as a regulator of cell death; other studies have suggested that GAPDH participates in tumor progression and serves as a new therapeutic target. However, related regulatory mechanisms of its numerous cellular functions and deregulated expression levels remain unclear. GAPDH is tightly regulated at transcriptional and posttranscriptional levels, which are involved in the regulation of diverse GAPDH functions. Several cancer-related factors, such as insulin, hypoxia inducible factor-1 (HIF-1), p53, nitric oxide (NO), and acetylated histone, not only modulate GAPDH gene expression but also affect protein functions via common pathways. Moreover, posttranslational modifications (PTMs) occurring in GAPDH in cancer cells result in new activities unrelated to the original glycolytic function of GAPDH. In this review, recent findings related to GAPDH transcriptional regulation and PTMs are summarized. Mechanisms and pathways involved in GAPDH regulation and its different roles in cancer cells are also described. PMID:25859407

  3. Injectable and body temperature sensitive hydrogels based on chitosan and hyaluronic acid for pH sensitive drug release.

    PubMed

    Zhang, Wei; Jin, Xin; Li, Heng; Zhang, Run-Run; Wu, Cheng-Wei

    2018-04-15

    Hydrogels based on chitosan/hyaluronic acid/β-sodium glycerophosphate demonstrate injectability, body temperature sensitivity, pH sensitive drug release and adhesion to cancer cell. The drug (doxorubicin) loaded hydrogel precursor solutions are injectable and turn to hydrogels when the temperature is increased to body temperature. The acidic condition (pH 4.00) can trigger the release of drug and the cancer cell (Hela) can adhere to the surface of the hydrogels, which will be beneficial for tumor site-specific administration of drug. The mechanical strength, the gelation temperature, and the drug release behavior can be tuned by varying hyaluronic acid content. The mechanisms were characterized using dynamic mechanical analysis, Fourier transform infrared spectroscopy, scanning electron microscopy and fluorescence microscopy. The carboxyl group in hyaluronic acid can form the hydrogen bondings with the protonated amine in chitosan, which promotes the increase of mechanical strength of the hydrogels and depresses the initial burst release of drug from the hydrogel. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Anti-cancer Mechanism of Docosahexaenoic Acid in Pancreatic Carcinogenesis: A Mini-review

    PubMed Central

    Park, Mirae; Kim, Hyeyoung

    2017-01-01

    Pancreatic cancer is a highly aggressive malignant tumor of the digestive system and radical resection, which is available to very few patients, might be the only possibility for cure. Since therapeutic choices are limited at the advanced stage, prevention is more important for reducing incidence in high-risk individuals with family history of pancreatic cancer. Epidemiological studies have shown that a high consumption of fish oil or ω3-polyunsaturated fatty acids reduces the risk of pancreatic cancers. Dietary fish oil supplementation has shown to suppress pancreatic cancer development in animal models. Previous experimental studies revealed that several hallmarks of cancer involved in the pathogenesis of pancreatic cancer, such as the resistance to apoptosis, hyper-proliferation with abnormal Wnt/β-catenin signaling, expression of pro-angiogenic growth factors, and invasion. Docosahexaenoic acid (DHA) is a ω3-polyunsaturated fatty acid and rich in cold oceanic fish oil. DHA shows anti-cancer activity by inducing oxidative stress and apoptosis, inhibiting Wnt/β-catenin signaling, and decreasing extracellular matrix degradation and expression of pro-angiogenic factors in pancreatic cancer cells. This review will summarize anti-cancer mechanism of DHA in pancreatic carcinogenesis based on the recent studies. PMID:28382280

  5. Whole body acid-base modeling revisited.

    PubMed

    Ring, Troels; Nielsen, Søren

    2017-04-01

    The textbook account of whole body acid-base balance in terms of endogenous acid production, renal net acid excretion, and gastrointestinal alkali absorption, which is the only comprehensive model around, has never been applied in clinical practice or been formally validated. To improve understanding of acid-base modeling, we managed to write up this conventional model as an expression solely on urine chemistry. Renal net acid excretion and endogenous acid production were already formulated in terms of urine chemistry, and we could from the literature also see gastrointestinal alkali absorption in terms of urine excretions. With a few assumptions it was possible to see that this expression of net acid balance was arithmetically identical to minus urine charge, whereby under the development of acidosis, urine was predicted to acquire a net negative charge. The literature already mentions unexplained negative urine charges so we scrutinized a series of seminal papers and confirmed empirically the theoretical prediction that observed urine charge did acquire negative charge as acidosis developed. Hence, we can conclude that the conventional model is problematic since it predicts what is physiologically impossible. Therefore, we need a new model for whole body acid-base balance, which does not have impossible implications. Furthermore, new experimental studies are needed to account for charge imbalance in urine under development of acidosis. Copyright © 2017 the American Physiological Society.

  6. A conserved RNA structural element within the hepatitis B virus post-transcriptional regulatory element enhance nuclear export of intronless transcripts and repress the splicing mechanism.

    PubMed

    Visootsat, Akasit; Payungporn, Sunchai; T-Thienprasert, Nattanan P

    2015-12-01

    Hepatitis B virus (HBV) infection is a primary cause of hepatocellular carcinoma and liver cirrhosis worldwide. To develop novel antiviral drugs, a better understanding of HBV gene expression regulation is vital. One important aspect is to understand how HBV hijacks the cellular machinery to export unspliced RNA from the nucleus. The HBV post-transcriptional regulatory element (HBV PRE) has been proposed to be the HBV RNA nuclear export element. However, the function remains controversial, and the core element is unclear. This study, therefore, aimed to identify functional regulatory elements within the HBV PRE and investigate their functions. Using bioinformatics programs based on sequence conservation and conserved RNA secondary structures, three regulatory elements were predicted, namely PRE 1151-1410, PRE 1520-1620 and PRE 1650-1684. PRE 1151-1410 significantly increased intronless and unspliced luciferase activity in both HepG2 and COS-7 cells. Likewise, PRE 1151-1410 significantly elevated intronless and unspliced HBV surface transcripts in liver cancer cells. Moreover, motif analysis predicted that PRE 1151-1410 contains several regulatory motifs. This study reported the roles of PRE 1151-1410 in intronless transcript nuclear export and the splicing mechanism. Additionally, these results provide knowledge in the field of HBV RNA regulation. Moreover, PRE 1151-1410 may be used to enhance the expression of other mRNAs in intronless reporter plasmids.

  7. Modification of Cys-418 of pyruvate formate-lyase by methacrylic acid, based on its radical mechanism.

    PubMed

    Plaga, W; Vielhaber, G; Wallach, J; Knappe, J

    2000-01-21

    The recently determined crystal structure of pyruvate formate-lyase (PFL) suggested a new view of the mechanism of this glycyl radical enzyme, namely that intermediary thiyl radicals of Cys-418 and Cys-419 participate in different ways [Becker, A. et al. (1999) Nat. Struct. Biol. 6, 969-975]. We report here a suicide reaction of PFL that occurs with the substrate-analog methacrylate with retention of the protein radical (K(I)=0.42 mM, k(i)=0.14 min(-1)). Using [1-(14)C]methacrylate (synthesized via acetone cyanhydrin), the reaction end-product was identified by peptide mapping and cocrystallization experiments as S-(2-carboxy-(2S)-propyl) substituted Cys-418. The stereoselectivity of the observed Michael addition reaction is compatible with a radical mechanism that involves Cys-418 thiyl as nucleophile and Cys-419 as H-atom donor, thus supporting the functional assignments of these catalytic amino acid residues derived from the protein structure.

  8. Effect of l-lysine-assisted surface grafting for nano-hydroxyapatite on mechanical properties and in vitro bioactivity of poly(lactic acid-co-glycolic acid).

    PubMed

    Liuyun, Jiang; Lixin, Jiang; Chengdong, Xiong; Lijuan, Xu; Ye, Li

    2016-01-01

    It is promising and challenging to study surface modification for nano-hydroxyapatite to improve the dispersion and enhance the mechanical properties and bioactivity of poly(lactic acid-co-glycolic acid). In this paper, we designed an effective new surface grafting with the assist of l-lysine for nano-hydroxyapatite, and the nano-hydroxyapatite surface grafted with the assist of l-lysine (g-nano-hydroxyapatite) was incorporated into poly(lactic acid-co-glycolic acid) to develop a series of g-nano-hydroxyapatite/poly(lactic acid-co-glycolic acid) nano-composites. The surface modification reaction for nano-hydroxyapatite, the mechanical properties, and in vitro human osteoblast-like cell (MG-63) response were characterized and investigated by Fourier transformation infrared, thermal gravimetric analysis, dispersion test, electromechanical universal tester, differential scanning calorimeter measurements, and in vitro cells culture experiment. The results showed that the grafting amount on the surface of nano-hydroxyapatite was enhanced with the increase of l-lysine, and the dispersion of nano-hydroxyapatite was improved more, so that it brought about better promotion crystallization and more excellent mechanical enhancement effect for poly(lactic acid-co-glycolic acid), comparing with the unmodified nano-hydroxyapatite. Moreover, the cells' attachment and proliferation results confirmed that the incorporation of the g-nano-hydroxyapatite into poly(lactic acid-co-glycolic acid) exhibited better biocompatibility than poly(lactic acid-co-glycolic acid). The above results indicated that the new surface grafting with the assist of l-lysine for nano-hydroxyapatite was an ideal novel surface modification method, which brought about better mechanical enhancement effect and in vitro bioactivity for poly(lactic acid-co-glycolic acid) with adding higher g-nano-hydroxyapatite content, suggesting it had a great potential to be used as bone fracture internal fixation materials

  9. Mechanism of body weight reducing effect of oral boric Acid intake.

    PubMed

    Aysan, Erhan; Sahin, Fikrettin; Telci, Dilek; Erdem, Merve; Muslumanoglu, Mahmut; Yardımcı, Erkan; Bektasoglu, Huseyin

    2013-01-01

    Objective. The effect of oral boric acid intake on reducing body weight has been previously demonstrated although the mechanism has been unclear. This research study reveals the mechanism. Subjects. Twelve mice were used, in groups of six each in the control and study groups. For five days, control group mice drank standard tap water while during the same time period the study group mice drank tap water which contains 0.28 mg/250 mL boric acid. After a 5-day period, gene expression levels for uncoupling proteins (UCPs) in the white adipose tissue (WAT), brown adipose tissue (BAT), and skeletal muscle tissue (SMT) and total body weight changes were analyzed. Results. Real time PCR analysis revealed no significant change in UCP3 expressions, but UCP2 in WAT (P: 0.0317), BAT (P: 0.014), and SMT (P: 0.0159) and UCP1 in BAT (P: 0.026) were overexpressed in the boric acid group. In addition, mice in the boric acid group lost body weight (mean 28.1%) while mice in the control group experienced no weight loss but a slight weight gain (mean 0.09%, P < 0.001). Conclusion. Oral boric acid intake causes overexpression of thermogenic proteins in the adipose and skeletal muscle tissues. Increasing thermogenesis through UCP protein pathway results in the accelerated lipolysis and body weight loss.

  10. KIRMES: kernel-based identification of regulatory modules in euchromatic sequences.

    PubMed

    Schultheiss, Sebastian J; Busch, Wolfgang; Lohmann, Jan U; Kohlbacher, Oliver; Rätsch, Gunnar

    2009-08-15

    Understanding transcriptional regulation is one of the main challenges in computational biology. An important problem is the identification of transcription factor (TF) binding sites in promoter regions of potential TF target genes. It is typically approached by position weight matrix-based motif identification algorithms using Gibbs sampling, or heuristics to extend seed oligos. Such algorithms succeed in identifying single, relatively well-conserved binding sites, but tend to fail when it comes to the identification of combinations of several degenerate binding sites, as those often found in cis-regulatory modules. We propose a new algorithm that combines the benefits of existing motif finding with the ones of support vector machines (SVMs) to find degenerate motifs in order to improve the modeling of regulatory modules. In experiments on microarray data from Arabidopsis thaliana, we were able to show that the newly developed strategy significantly improves the recognition of TF targets. The python source code (open source-licensed under GPL), the data for the experiments and a Galaxy-based web service are available at http://www.fml.mpg.de/raetsch/suppl/kirmes/.

  11. Do rice suspension-cultured cells treated with abscisic acid mimic developing seeds?

    PubMed

    Matsuno, Koya; Fujimura, Tatsuhito

    2015-08-01

    Starch synthesis is activated in the endosperm during seed development and also in rice suspension cells cultured with abscisic acid. In the anticipation that the mechanisms of starch synthesis are similar between the endosperm and the suspension cells cultured with abscisic acid, expression of genes involved in starch synthesis was evaluated in the suspension cells after abscisic acid treatment. However, it was found that the regulatory mechanism of starch synthesis in the suspension cells cultured with abscisic acid was different from that in developing seeds. Expression analyses of genes involved in oil bodies, which accumulate in the embryo and aleurone layer, and seed storage proteins, which accumulate mainly in the endosperm, showed that the former were activated in the suspension cells cultured with abscisic acid, but the latter were not. Master regulators for embryogenesis, OsVP1 (homologue of AtABI3) and OsLFL1 (homologue of AtFUS3 or AtLFL2), were expressed in the suspension cells at levels comparable to those in the embryo. From these results, it is suggested that interactions between regulators and abscisic acid control the synthesis of phytic acid and oil bodies in the cultured cells and embryo. We suggest that the system of suspension cells cultured with abscisic acid helps to reveal the mechanisms of phytic acid and oil body synthesis in embryo.

  12. Hormone-induced modifications of the chromatin structure surrounding upstream regulatory regions conserved between the mouse and rabbit whey acidic protein genes.

    PubMed Central

    Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve

    2003-01-01

    The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766

  13. Quantification of Lewis acid induced Brønsted acidity of protogenic Lewis bases.

    PubMed

    Lathem, A Paige; Heiden, Zachariah M

    2017-05-09

    Proton transfer promoted by the coordination of protogenic Lewis bases to a Lewis acid is a critical step in catalytic transformations. Although the acidification of water upon coordination to a Lewis acid has been known for decades, no attempts have been made to correlate the Brønsted acidity of the coordinated water molecule with Lewis acid strength. To probe this effect, the pK a 's (estimated error of 1.3 pK a units) in acetonitrile of ten protogenic Lewis bases coordinated to seven Lewis acids containing Lewis acidities varying 70 kcal mol -1 , were computed. To quantify Lewis acid strength, the ability to transfer a hydride (hydride donor ability) from the respective main group hydride was used. Coordination of a Lewis acid to water increased the acidity of the bound water molecule between 20 and 50 pK a units. A linear correlation exhibiting a 2.6 pK a unit change of the Lewis acid-water adduct per ten kcal mol -1 change in hydride donor ability of the respective main group hydride was obtained. For the ten protogenic Lewis bases studied, the coordinated protogenic Lewis bases were acidified between 10 and 50 pK a units. On average, a ten kcal mol -1 change in hydride donor ability of the respective main group hydride resulted in about a 2.8 pK a unit change in the Brønsted acidity of the Lewis acid-Lewis base adducts. Since attempts to computationally investigate the pK a of main group dihydrogen complexes were unsuccessful, experimental determination of the first reported pK a of a main group dihydrogen complex is described. The pK a of H 2 -B(C 6 F 5 ) 3 was determined to be 5.8 ± 0.2 in acetonitrile.

  14. pKa Modulation of the Acid/Base Catalyst within GH32 and GH68: A Role in Substrate/Inhibitor Specificity?

    PubMed Central

    Yuan, Shuguang; Le Roy, Katrien; Venken, Tom; Lammens, Willem; Van den Ende, Wim; De Maeyer, Marc

    2012-01-01

    Glycoside hydrolases of families 32 (GH32) and 68 (GH68) belong to clan GH-J, containing hydrolytic enzymes (sucrose/fructans as donor substrates) and fructosyltransferases (sucrose/fructans as donor and acceptor substrates). In GH32 members, some of the sugar substrates can also function as inhibitors, this regulatory aspect further adding to the complexity in enzyme functionalities within this family. Although 3D structural information becomes increasingly available within this clan and huge progress has been made on structure-function relationships, it is not clear why some sugars bind as inhibitors without being catalyzed. Conserved aspartate and glutamate residues are well known to act as nucleophile and acid/bases within this clan. Based on the available 3D structures of enzymes and enzyme-ligand complexes as well as docking simulations, we calculated the pKa of the acid-base before and after substrate binding. The obtained results strongly suggest that most GH-J members show an acid-base catalyst that is not sufficiently protonated before ligand entrance, while the acid-base can be fully protonated when a substrate, but not an inhibitor, enters the catalytic pocket. This provides a new mechanistic insight aiming at understanding the complex substrate and inhibitor specificities observed within the GH-J clan. Moreover, besides the effect of substrate entrance on its own, we strongly suggest that a highly conserved arginine residue (in the RDP motif) rather than the previously proposed Tyr motif (not conserved) provides the proton to increase the pKa of the acid-base catalyst. PMID:22662155

  15. The development of regulatory expectations for computer-based safety systems for the UK nuclear programme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hughes, P. J.; Westwood, R.N; Mark, R. T.

    2006-07-01

    The Nuclear Installations Inspectorate (NII) of the UK's Health and Safety Executive (HSE) has completed a review of their Safety Assessment Principles (SAPs) for Nuclear Installations recently. During the period of the SAPs review in 2004-2005 the designers of future UK naval reactor plant were optioneering the control and protection systems that might be implemented. Because there was insufficient regulatory guidance available in the naval sector to support this activity the Defence Nuclear Safety Regulator (DNSR) invited the NII to collaborate with the production of a guidance document that provides clarity of regulatory expectations for the production of safety casesmore » for computer based safety systems. A key part of producing regulatory expectations was identifying the relevant extant standards and sector guidance that reflect good practice. The three principal sources of such good practice were: IAEA Safety Guide NS-G-1.1 (Software for Computer Based Systems Important to Safety in Nuclear Power Plants), European Commission consensus document (Common Position of European Nuclear Regulators for the Licensing of Safety Critical Software for Nuclear Reactors) and IEC nuclear sector standards such as IEC60880. A common understanding has been achieved between the NII and DNSR and regulatory guidance developed which will be used by both NII and DNSR in the assessment of computer-based safety systems and in the further development of more detailed joint technical assessment guidance for both regulatory organisations. (authors)« less

  16. Interaction of sulfuric acid corrosion and mechanical wear of iron

    NASA Technical Reports Server (NTRS)

    Rengstorff, G. W. P.; Miyoshi, K.; Buckley, D. H.

    1986-01-01

    Friction and wear experiment were conducted with elemental iron sliding on aluminum oxide in aerated sulfuric acid at concentrations ranging from very dilute (0.00007 N; i.e., 4 ppm) to very concentrated (96 percent acid). Load and reciprocating sliding speed were kept constant. With the most dilute acid concentration of 0.00007 to 0.0002 N, a complex corrosion product formed that was friable and often increased friction and wear. At slightly higher concentrations of 0.001 N, metal losses were essentially by wear alone. Because no buildup of corrosion products occurred, this acid concentration became the standard from which to separate metal loss from direct corrosion and mechanical wear losses. When the acid concentration was increased to 5 percent (1 N), the well-established high corrosion rate of iron in sulfuric acid strongly dominated the total wear loss. This strong corrosion increased to 30 percent acid and decreased somewhat to 50 percent acid in accordance with expectations. However, the low corrosion of iron expected at acid concentrations of 65 to 96 percent was not observed in the wear area. It was apparent that the normal passivating film was being worn away and a galvanic cell established that rapidly attacked the wear area. Under the conditions where direct corrosion losses were highest, the coefficient of friction was the lowest.

  17. Interaction of sulfuric acid corrosion and mechanical wear of iron

    NASA Technical Reports Server (NTRS)

    Rengstorff, G. W. P.; Miyoshi, K.; Buckley, D. H.

    1984-01-01

    Friction and wear experiments were conducted with elemental iron sliding on aluminum oxide in aerated sulfuric acid at concentrations ranging from very dilute (0.00007 N; i.e., 4 ppm) to very concentrated (96 percent acid). Load and reciprocating sliding speed were kept constant. With the most dilute acid concentration of 0.00007 to 0.0002 N, a complex corrosion product formed that was friable and often increased friction and wear. At slightly higher concentrations of 0.001 N, metal losses were essentially by wear alone. Because no buildup of corrosion products occurred, this acid concentration became the standard from which to separate metal loss from direct corrosion and mechanical wear losses. When the acid concentration was increased to 5 percent (1 N), the well-established high corrosion rate of iron in sulfuric acid strongly dominated the total wear loss. This strong corrosion increased to 30 percent acid and decreased somewhat to 50 percent acid in accordance with expectations. However, the low corrosion of iron expected at acid concentrations of 65 to 96 percent was not observed in the wear area. It was apparent that the normal passivating film was being worn away and a galvanic cell established that rapidly attacked the wear area. Under the conditions where direct corrosion losses were highest, the coefficient of friction was the lowest.

  18. Mechanisms Underlying the Anti-Aging and Anti-Tumor Effects of Lithocholic Bile Acid

    PubMed Central

    Arlia-Ciommo, Anthony; Piano, Amanda; Svistkova, Veronika; Mohtashami, Sadaf; Titorenko, Vladimir I.

    2014-01-01

    Bile acids are cholesterol-derived bioactive lipids that play essential roles in the maintenance of a heathy lifespan. These amphipathic molecules with detergent-like properties display numerous beneficial effects on various longevity- and healthspan-promoting processes in evolutionarily distant organisms. Recent studies revealed that lithocholic bile acid not only causes a considerable lifespan extension in yeast, but also exhibits a substantial cytotoxic effect in cultured cancer cells derived from different tissues and organisms. The molecular and cellular mechanisms underlying the robust anti-aging and anti-tumor effects of lithocholic acid have emerged. This review summarizes the current knowledge of these mechanisms, outlines the most important unanswered questions and suggests directions for future research. PMID:25238416

  19. De novo reconstruction of gene regulatory networks from time series data, an approach based on formal methods.

    PubMed

    Ceccarelli, Michele; Cerulo, Luigi; Santone, Antonella

    2014-10-01

    Reverse engineering of gene regulatory relationships from genomics data is a crucial task to dissect the complex underlying regulatory mechanism occurring in a cell. From a computational point of view the reconstruction of gene regulatory networks is an undetermined problem as the large number of possible solutions is typically high in contrast to the number of available independent data points. Many possible solutions can fit the available data, explaining the data equally well, but only one of them can be the biologically true solution. Several strategies have been proposed in literature to reduce the search space and/or extend the amount of independent information. In this paper we propose a novel algorithm based on formal methods, mathematically rigorous techniques widely adopted in engineering to specify and verify complex software and hardware systems. Starting with a formal specification of gene regulatory hypotheses we are able to mathematically prove whether a time course experiment belongs or not to the formal specification, determining in fact whether a gene regulation exists or not. The method is able to detect both direction and sign (inhibition/activation) of regulations whereas most of literature methods are limited to undirected and/or unsigned relationships. We empirically evaluated the approach on experimental and synthetic datasets in terms of precision and recall. In most cases we observed high levels of accuracy outperforming the current state of art, despite the computational cost increases exponentially with the size of the network. We made available the tool implementing the algorithm at the following url: http://www.bioinformatics.unisannio.it. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Self-discrepancy and regulatory fit in avatar-based exergames.

    PubMed

    Jin, Seung-A Annie

    2012-12-01

    Drawing from Higgins's self-discrepancy theory and regulatory focus theory, this study examined the use of activated selves and regulatory foci in health games. Utilizing the Wii's avatar-creating and exergaming features, a 2 (activated self: actual self versus ideal self) x 2 (regulatory focus: promotion versus prevention) x 2 (efficacy appeals: self-efficacy versus response-efficacy) between-subjects experiment tested the interactions of activated selves, regulatory foci, and efficacy appeals on low-calorie dieting intentions after health game playing. Results from an experiment with 156 participants demonstrated that a fit between regulatory focus and efficacy appeals induced greater dieting intentions when the actual self was activated while the opposite effect occurred when the ideal self was activated. Theoretical contributions to basic and applied social psychology as well as managerial implications for consumer behavior research are considered.

  1. Improved ethanol yield and reduced Minimum Ethanol Selling Price (MESP) by modifying low severity dilute acid pretreatment with deacetylation and mechanical refining: 1) Experimental

    PubMed Central

    2012-01-01

    Background Historically, acid pretreatment technology for the production of bio-ethanol from corn stover has required severe conditions to overcome biomass recalcitrance. However, the high usage of acid and steam at severe pretreatment conditions hinders the economic feasibility of the ethanol production from biomass. In addition, the amount of acetate and furfural produced during harsh pretreatment is in the range that strongly inhibits cell growth and impedes ethanol fermentation. The current work addresses these issues through pretreatment with lower acid concentrations and temperatures incorporated with deacetylation and mechanical refining. Results The results showed that deacetylation with 0.1 M NaOH before acid pretreatment improved the monomeric xylose yield in pretreatment by up to 20% while keeping the furfural yield under 2%. Deacetylation also improved the glucose yield by 10% and the xylose yield by 20% during low solids enzymatic hydrolysis. Mechanical refining using a PFI mill further improved sugar yields during both low- and high-solids enzymatic hydrolysis. Mechanical refining also allowed enzyme loadings to be reduced while maintaining high yields. Deacetylation and mechanical refining are shown to assist in achieving 90% cellulose yield in high-solids (20%) enzymatic hydrolysis. When fermentations were performed under pH control to evaluate the effect of deacetylation and mechanical refining on the ethanol yields, glucose and xylose utilizations over 90% and ethanol yields over 90% were achieved. Overall ethanol yields were calculated based on experimental results for the base case and modified cases. One modified case that integrated deacetylation, mechanical refining, and washing was estimated to produce 88 gallons of ethanol per ton of biomass. Conclusion The current work developed a novel bio-ethanol process that features pretreatment with lower acid concentrations and temperatures incorporated with deacetylation and mechanical refining. The

  2. Phosphatidic acid induces EHD3-containing membrane tubulation and is required for receptor recycling.

    PubMed

    Henmi, Yuji; Oe, Natsuko; Kono, Nozomu; Taguchi, Tomohiko; Takei, Kohji; Tanabe, Kenji

    2016-03-01

    EHD3 is localized on the tubular structures of early endosomes, and it regulates their trafficking pathway. However, the regulatory mechanism of EHD3-containing tubular structures remains poorly understood. An in vitro liposome co-sedimentation assay revealed that EHD3 interacted with phosphatidic acid through its helical domain and this interaction induced liposomal tubulations. Additionally, inhibiting phosphatidic acid synthesis with diacylglycerol kinase inhibitor or lysophosphatidic acid acyltransferase inhibitor significantly reduced the number of EHD3-containing tubules and impaired their trafficking from early endosomes. These results suggest that EHD3 and phosphatidic acid cooperatively regulate membrane deformation and trafficking from early endosomes. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Thioarsenides: A case for long-range Lewis acid-base-directed van der Waals interactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gibbs, Gerald V.; Wallace, Adam F.; Downs, R. T.

    2011-04-01

    Electron density distributions, bond paths, Laplacian and local energy density properties have been calculated for a number of As4Sn (n = 3,4,5) thioarsenide molecular crystals. On the basis of the distributions, the intramolecular As-S and As-As interactions classify as shared bonded interactions and the intermolecular As-S, As-As and S-S interactions classify as closed-shell van der Waals bonded interactions. The bulk of the intermolecular As-S bond paths link regions of locally concentrated electron density (Lewis base regions) with aligned regions of locally depleted electron density (Lewis acid regions) on adjacent molecules. The paths are comparable with intermolecular paths reported for severalmore » other molecular crystals that link aligned Lewis base and acid regions in a key-lock fashion, interactions that classified as long range Lewis acid-base directed van der Waals interactions. As the bulk of the intermolecular As-S bond paths (~70%) link Lewis acid-base regions on adjacent molecules, it appears that molecules adopt an arrangement that maximizes the number of As-S Lewis acid-base intermolecular bonded interactions. The maximization of the number of Lewis acid-base interactions appears to be connected with the close-packed array adopted by molecules: distorted cubic close-packed arrays are adopted for alacránite, pararealgar, uzonite, realgar and β-AsS and the distorted hexagonal close-packed arrays adopted by α- and β-dimorphite. A growth mechanism is proposed for thioarsenide molecular crystals from aqueous species that maximizes the number of long range Lewis acid-base vdW As-S bonded interactions with the resulting directed bond paths structuralizing the molecules as a molecular crystal.« less

  4. Construction of diagnosis system and gene regulatory networks based on microarray analysis.

    PubMed

    Hong, Chun-Fu; Chen, Ying-Chen; Chen, Wei-Chun; Tu, Keng-Chang; Tsai, Meng-Hsiun; Chan, Yung-Kuan; Yu, Shyr Shen

    2018-05-01

    A microarray analysis generally contains expression data of thousands of genes, but most of them are irrelevant to the disease of interest, making analyzing the genes concerning specific diseases complicated. Therefore, filtering out a few essential genes as well as their regulatory networks is critical, and a disease can be easily diagnosed just depending on the expression profiles of a few critical genes. In this study, a target gene screening (TGS) system, which is a microarray-based information system that integrates F-statistics, pattern recognition matching, a two-layer K-means classifier, a Parameter Detection Genetic Algorithm (PDGA), a genetic-based gene selector (GBG selector) and the association rule, was developed to screen out a small subset of genes that can discriminate malignant stages of cancers. During the first stage, F-statistic, pattern recognition matching, and a two-layer K-means classifier were applied in the system to filter out the 20 critical genes most relevant to ovarian cancer from 9600 genes, and the PDGA was used to decide the fittest values of the parameters for these critical genes. Among the 20 critical genes, 15 are associated with cancer progression. In the second stage, we further employed a GBG selector and the association rule to screen out seven target gene sets, each with only four to six genes, and each of which can precisely identify the malignancy stage of ovarian cancer based on their expression profiles. We further deduced the gene regulatory networks of the 20 critical genes by applying the Pearson correlation coefficient to evaluate the correlationship between the expression of each gene at the same stages and at different stages. Correlationships between gene pairs were calculated, and then, three regulatory networks were deduced. Their correlationships were further confirmed by the Ingenuity pathway analysis. The prognostic significances of the genes identified via regulatory networks were examined using online

  5. ReNE: A Cytoscape Plugin for Regulatory Network Enhancement

    PubMed Central

    Politano, Gianfranco; Benso, Alfredo; Savino, Alessandro; Di Carlo, Stefano

    2014-01-01

    One of the biggest challenges in the study of biological regulatory mechanisms is the integration, americanmodeling, and analysis of the complex interactions which take place in biological networks. Despite post transcriptional regulatory elements (i.e., miRNAs) are widely investigated in current research, their usage and visualization in biological networks is very limited. Regulatory networks are commonly limited to gene entities. To integrate networks with post transcriptional regulatory data, researchers are therefore forced to manually resort to specific third party databases. In this context, we introduce ReNE, a Cytoscape 3.x plugin designed to automatically enrich a standard gene-based regulatory network with more detailed transcriptional, post transcriptional, and translational data, resulting in an enhanced network that more precisely models the actual biological regulatory mechanisms. ReNE can automatically import a network layout from the Reactome or KEGG repositories, or work with custom pathways described using a standard OWL/XML data format that the Cytoscape import procedure accepts. Moreover, ReNE allows researchers to merge multiple pathways coming from different sources. The merged network structure is normalized to guarantee a consistent and uniform description of the network nodes and edges and to enrich all integrated data with additional annotations retrieved from genome-wide databases like NCBI, thus producing a pathway fully manageable through the Cytoscape environment. The normalized network is then analyzed to include missing transcription factors, miRNAs, and proteins. The resulting enhanced network is still a fully functional Cytoscape network where each regulatory element (transcription factor, miRNA, gene, protein) and regulatory mechanism (up-regulation/down-regulation) is clearly visually identifiable, thus enabling a better visual understanding of its role and the effect in the network behavior. The enhanced network produced by Re

  6. Genotoxicity Expert Panel review: weight of evidence evaluation of the genotoxicity of glyphosate, glyphosate-based formulations, and aminomethylphosphonic acid.

    PubMed

    Brusick, David; Aardema, Marilyn; Kier, Larry; Kirkland, David; Williams, Gary

    2016-09-01

    In 2015, the International Agency for Research on Cancer (IARC) published a monograph concluding there was strong evidence for genotoxicity of glyphosate and glyphosate formulations and moderate evidence for genotoxicity of the metabolite aminomethylphosphonic acid (AMPA). These conclusions contradicted earlier extensive reviews supporting the lack of genotoxicity of glyphosate and glyphosate formulations. The IARC Monograph concluded there was strong evidence of induction of oxidative stress by glyphosate, glyphosate formulations, and AMPA. The Expert Panel reviewed the genotoxicity and oxidative stress data considered in the IARC Monograph, together with other available data not considered by IARC. The Expert Panel defined and used a weight of evidence (WoE) approach that included ranking of studies and endpoints by the strength of their linkage to events associated with carcinogenic mechanisms. Importantly, the Expert Panel concluded that there was sufficient information available from a very large number of regulatory genotoxicity studies that should have been considered by IARC. The WoE approach, the inclusion of all relevant regulatory studies, and some differences in interpretation of individual studies led to significantly different conclusions by the Expert Panel compared with the IARC Monograph. The Expert Panel concluded that glyphosate, glyphosate formulations, and AMPA do not pose a genotoxic hazard and the data do not support the IARC Monograph genotoxicity evaluation. With respect to carcinogenicity classification and mechanism, the Expert Panel concluded that evidence relating to an oxidative stress mechanism of carcinogenicity was largely unconvincing and that the data profiles were not consistent with the characteristics of genotoxic carcinogens.

  7. Acid generation mechanism in anion-bound chemically amplified resists used for extreme ultraviolet lithography

    NASA Astrophysics Data System (ADS)

    Komuro, Yoshitaka; Yamamoto, Hiroki; Kobayashi, Kazuo; Ohomori, Katsumi; Kozawa, Takahiro

    2015-03-01

    Extreme ultraviolet (EUV) lithography is the most promising candidate for the high-volume production of semiconductor devices with half-pitches of sub 10nm. An anion-bound polymer(ABP), in which at the anion part of onium salts is polymerized, has attracted much attention from the viewpoint of the control of acid diffusion. In this study, the acid generation mechanism in ABP films was investigated using γ and EUV radiolysis. On the basis of experimental results, the acid generation mechanism in anion-bound chemically amplified resists was proposed. The protons of acids are considered to be mainly generated through the reaction of phenyl radicals with diphenylsulfide radical cations that are produced through the hole transfer to the decomposition products of onium salts.

  8. Toxin-antitoxin systems and regulatory mechanisms in Mycobacterium tuberculosis.

    PubMed

    Slayden, Richard A; Dawson, Clinton C; Cummings, Jason E

    2018-06-01

    There has been a significant reduction in annual tuberculosis incidence since the World Health Organization declared tuberculosis a global health threat. However, treatment of M. tuberculosis infections requires lengthy multidrug therapeutic regimens to achieve a durable cure. The development of new drugs that are active against resistant strains and phenotypically diverse organisms continues to present the greatest challenge in the future. Numerous phylogenomic analyses have revealed that the Mtb genome encodes a significantly expanded repertoire of toxin-antitoxin (TA) loci that makes up the Mtb TA system. A TA loci is a two-gene operon encoding a 'toxin' protein that inhibits bacterial growth and an interacting 'antitoxin' partner that neutralizes the inhibitory activity of the toxin. The presence of multiple chromosomally encoded TA loci in Mtb raises important questions in regard to expansion, regulation and function. Thus, the functional roles of TA loci in Mtb pathogenesis have received considerable attention over the last decade. The cumulative results indicate that they are involved in regulating adaptive responses to stresses associated with the host environment and drug treatment. Here we review the TA families encoded in Mtb, discuss the duplication of TA loci in Mtb, regulatory mechanism of TA loci, and phenotypic heterogeneity and pathogenesis.

  9. Omics-based approaches reveal phospholipids remodeling of Rhizopus oryzae responding to furfural stress for fumaric acid-production from xylose.

    PubMed

    Pan, Xinrong; Liu, Huanhuan; Liu, Jiao; Wang, Cheng; Wen, Jianping

    2016-12-01

    In order to relieve the toxicity of furfural on Rhizopus oryzae fermentation, the molecular mechanism of R. oryzae responding to furfural stress for fumaric acid-production was investigated by omics-based approaches. In metabolomics analysis, 29 metabolites including amino acid, sugars, polyols and fatty acids showed significant changes for maintaining the basic cell metabolism at the cost of lowering fumaric acid production. To further uncover the survival mechanism, lipidomics was carried out, revealing that phosphatidylcholine, phosphatidylglycerol, phosphatidylinositol and polyunsaturated acyl chains might be closely correlated with R. oryzae's adapting to furfural stress. Based on the above omics analysis, lecithin, inositol and soybean oil were exogenously supplemented separately with an optimized concentration in the presence of furfural, which increased fumaric acid titer from 5.78g/L to 10.03g/L, 10.05g/L and 12.13g/L (increased by 73.5%, 73.8% and 110%, respectively). These findings provide a methodological guidance for hemicellulose-fumaric acid development. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. A mechanism underlying the effects of polyunsaturated fatty acids on breast cancer

    PubMed Central

    ZHANG, HAO; ZHOU, LEI; SHI, WEI; SONG, NING; YU, KARU; GU, YUCHUN

    2012-01-01

    Breast cancer is the most frequent cancer in women. Evidence suggests that the polyunsaturated fatty acids (PUFAs), eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA) affect breast cancer proliferation, differentiation and prognosis. However, the mechanism still remains unclear. In this study, the expression of transient receptor potential canonical (TRPC)3 was detected throughout the cell cytoplasm and at the cell surface of MCF-7 cells. Ca2+ entry was induced in these cells via activated TRPC3 by either the diacylglycerol analogue (OAG) or by intracellular Ca2+ store depletion. TRPC-mediated Ca2+ entry was inhibited by PUFAs including arachidonic acid (AA) and linolenic acid (LA) but not saturated fatty acids. Overexpression of the PUFA degradation enzyme, cyclooxygenase 2 (COX2), enhanced capacitative Ca2+ entry. In addition, inhibition of COX2 reduced [Ca2+]i. Nevertheless, inhibition of TRPC reduced the cell cycle S phase and cell migration, implicating a functional role for TRP-mediated Ca2+ entry in cell proliferation and invasion. Exogenous PUFA as well as a TRPC3 antagonist consistently attenuated breast cancer cell proliferation and migration, suggesting a mechanism in which PUFA restrains the breast cancer partly via its inhibition of TRPC channels. Additionally, our results also suggest that TRPC3 appears as a new mediator of breast cancer cell migration/invasion and represents a potential target for a new class of anticancer agent. PMID:22692672

  11. Basic aspects of tumor cell fatty acid-regulated signaling and transcription factors.

    PubMed

    Comba, Andrea; Lin, Yi-Hui; Eynard, Aldo Renato; Valentich, Mirta Ana; Fernandez-Zapico, Martín Ernesto; Pasqualini, Marìa Eugenia

    2011-12-01

    This article reviews the current knowledge and experimental research about the mechanisms by which fatty acids and their derivatives control specific gene expression involved during carcinogenesis. Changes in dietary fatty acids, specifically the polyunsaturated fatty acids of the ω-3 and ω-6 families and some derived eicosanoids from lipoxygenases, cyclooxygenases, and cytochrome P-450, seem to control the activity of transcription factor families involved in cancer cell proliferation or cell death. Their regulation may be carried out either through direct binding to DNA as peroxisome proliferator-activated receptors or via modulation in an indirect manner of signaling pathway molecules (e.g., protein kinase C) and other transcription factors (nuclear factor kappa B and sterol regulatory element binding protein). Knowledge of the mechanisms by which fatty acids control specific gene expression may identify important risk factors for cancer and provide insight into the development of new therapeutic strategies for a better management of whole body lipid metabolism.

  12. Lipoic acid protects gastric mucosa from ethanol-induced injury in rat through a mechanism involving aldehyde dehydrogenase 2 activation.

    PubMed

    Li, Jia-Hui; Ju, Gui-Xia; Jiang, Jun-Lin; Li, Nian-Sheng; Peng, Jun; Luo, Xiu-Ju

    2016-11-01

    Numerous studies demonstrate that reactive aldehydes are highly toxic and aldehyde dehydrogenase 2 (ALDH2)-mediated detoxification of reactive aldehydes is thought as an endogenous protective mechanism against reactive aldehydes-induced cell injury. This study aims to explore whether lipoic acid, a potential ALDH2 activator, is able to protect gastric mucosa from ethanol-induced injury through a mechanism involving clearance of reactive aldehydes. The rats received 60% of acidified ethanol through intragastric administration and held for 1 h to establish a mucosal injury model. Lipoic acid (10 or 30 mg/kg) or Alda-1 (a positive control, 10 mg/kg) was given 45 min before the ethanol treatment. The gastric tissues were collected for analysis of gastric ulcer index, cellular apoptosis, 4-hydroxy-2-nonenal (4-HNE) and malondialdehyde (MDA) contents, and ALDH2 activity. The results showed that acute administration of ethanol led to an increase in gastric ulcer index, cellular apoptosis, 4-HNE and MDA contents concomitant with a decrease in ALDH2 activity; these phenomena were reversed by lipoic acid or Alda-1. The gastric protection of lipoic acid was attenuated in the presence of ALDH2 inhibitor. Based on these observations, we conclude that lipoic acid exerts the beneficial effects on ethanol-induced injury through a mechanism involving, at least in part, ALDH2 activation. As a dietary supplement or a medicine already in some countries, lipoic acid can be used to treat the ethanol - induced gastric mucosal injury. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Arginine 26 and aspartic acid 69 of the regulatory subunit are key residues of subunits interaction of acetohydroxyacid synthase isozyme III from E. coli.

    PubMed

    Zhao, Yuefang; Wen, Xin; Niu, Congwei; Xi, Zhen

    2012-11-05

    Acetohydroxyacid synthase (AHAS), which catalyzes the first step in the biosynthesis of branched-chain amino acids, is composed of catalytic and regulatory subunits. The enzyme exhibits full activity only when the regulatory subunit (RSU) binds to the catalytic subunit (CSU). However, the crystal structure of the holoenzyme has not been reported yet, and the molecular interaction between the CSU and RSU is also unknown. Herein, we introduced a global-surface, site-directed labeling scanning method to determine the potential interaction region of the RSU. This approach relies on the insertion of a bulky fluorescent probe at the designated site on the surface of the RSU to cause a dramatic change in holoenzyme activity by perturbing subunit interaction. Then, the key amino acid residues in the potential interaction regions were identified by site-directed mutagenesis. Compared to the wild-type, the single-point mutants R26A and D69A showed 54 and 64 % activity, respectively, whereas the double mutant (R26A+D69A) gave 14 %, thus suggesting that residues Arg26 and Asp69 are the key residues of subunit interaction with cooperative action. Additionally, the results of GST pull-down assays and pH-dependence experiments suggested that polar interaction is the main force for subunits interaction. A plausible protein-protein interaction model of the holoenzyme of Escherichia coli AHAS III is proposed, based on the mutagenesis and protein docking studies. The protocol established here should be useful for the identification of the molecular interactions between proteins. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Visualizing the chain-flipping mechanism in fatty-acid biosynthesis

    DOE PAGES

    Beld, Joris; Cang, Hu; Burkart, Michael D.

    2014-10-29

    The acyl carrier protein (ACP) from fatty acid synthases sequesters elongating products within its hydrophobic core, but this dynamic mechanism remains poorly understood. In this paper, we exploited solvatochromic pantetheine probes attached to ACP that fluoresce when sequestered. The addition of a catalytic partner lures the cargo out of the ACP and into the active site of the enzyme, thus enhancing fluorescence to reveal the elusive chain-flipping mechanism. This activity was confirmed by the use of a dual solvatochromic cross-linking probe and solution-phase NMR spectroscopy. Finally, the chain-flipping mechanism was visualized by single-molecule fluorescence techniques, thus demonstrating specificity between themore » Escherichia coli ACP and its ketoacyl synthase catalytic partner KASII.« less

  15. Gluconic acid produced by Gluconacetobacter diazotrophicus Pal5 possesses antimicrobial properties.

    PubMed

    Nieto-Peñalver, Carlos G; Savino, María J; Bertini, Elisa V; Sánchez, Leandro A; de Figueroa, Lucía I C

    2014-09-01

    Gluconic acid is produced in large quantities by the endophytic and diazotrophic bacterium Gluconacetobacter diazotrophicus Pal5. This organic acid derives from direct oxidation of glucose by a pyrroloquinoline-quinone-linked glucose dehydrogenase in this plant growth-promoting bacterium. In the present article, evidence is presented showing that gluconic acid is also responsible for the antimicrobial activity of G. diazotrophicus Pal5. The broad antagonistic spectrum includes Gram-positive and -negative bacteria. Eukaryotic microorganisms are more resistant to growth inhibition by this acid. Inhibition by gluconic acid can be modified through the presence of other organic acids. In contrast to other microorganisms, the Quorum Sensing system of G. diazotrophicus Pal5, a regulatory mechanism that plays a key role in several microbe-microbe interactions, is not related to gluconic acid production and the concomitant antagonistic activity. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  16. [Mechanical properties of polylactic acid/beta-tricalcium phosphate composite scaffold with double channels based on three-dimensional printing technique].

    PubMed

    Lian, Qin; Zhuang, Pei; Li, Changhai; Jin, Zhongmin; Li, Dichen

    2014-03-01

    To improve the poor mechanical strength of porous ceramic scaffold, an integrated method based on three-dimensional (3-D) printing technique is developed to incorporate the controlled double-channel porous structure into the polylactic acid/beta-tricalcium phosphate (PLA/beta-TCP) reinforced composite scaffolds (double-channel composite scaffold) to improve their tissue regeneration capability and the mechanical properties. The designed double-channel structure inside the ceramic scaffold consisted of both primary and secondary micropipes, which parallel but un-connected. The set of primary channels was used for cell ingrowth, while the set of secondary channels was used for the PLA perfusion. Integration technology of 3-D printing technique and gel-casting was firstly used to fabricate the double-channel ceramic scaffolds. PLA/beta-TCP composite scaffolds were obtained by the polymer gravity perfusion process to pour PLA solution into the double-channel ceramic scaffolds through the secondary channel set. Microscope, porosity, and mechanical experiments for the standard samples were used to evaluate the composite properties. The ceramic scaffold with only the primary channel (single-channel scaffold) was also prepared as a control. Morphology observation results showed that there was no PLA inside the primary channels of the double-channel composite scaffolds but a dense interface layer between PLA and beta-TCP obviously formed on the inner wall of the secondary channels by the PLA penetration during the perfusion process. Finite element simulation found that the compressive strength of the double-channel composite scaffold was less than that of the single-channel scaffold; however, mechanical tests found that the maximum compressive strength of the double-channel composite scaffold [(21.25 +/- 1.15) MPa] was higher than that of the single-channel scaffold[ (9.76 +/- 0.64) MPa]. The double-channel composite scaffolds fabricated by 3-D printing technique have

  17. Effects of diet on titratable acid-base excretion in grasshoppers.

    PubMed

    Frazier, M R; Harrison, J F; Behmer, S T

    2000-01-01

    Despite the potential for diet to affect organismal acid-base status, especially in herbivores, little is known about the effects of diet on acid-base loading and excretion. We tested the effects of diet on acid-base loading and excretion in grasshoppers by (a) comparing the fecal acid-base content of 15 grasshopper species collected from the field and (b) comparing fecal acid-base excretion rates of Schistocerca americana grasshoppers fed vegetable diets that differed in their ashed and raw acid-base contents. The field experiments indicated that grass-feeding species excrete fairly neutral fecal pellets, while forb/mixed-feeding species vary widely in their fecal acid-base contents. In the laboratory experiment, acid-base excretion rates were positively correlated with dietary ashed base intake rates but were not correlated with the acid-base content of raw, unashed diet or feeding rate. These experiments suggest that some diets could strongly challenge the acid-base homeostasis of herbivores; in some grasshoppers, dietary acid-base loads could produce certainly lethal 1-unit changes in average body pH within 6 h if they were not excreted.

  18. T regulatory cells in contact hypersensitivity.

    PubMed

    Cavani, Andrea

    2008-08-01

    The review summarizes the recent investigations focused on T regulatory cells in hapten diseases. Multiple mechanisms ensure tolerance to small chemicals penetrating the skin. Among these, specific T regulatory cells play a major role in controlling harmful immune responses to environmental antigens. Most of the T regulatory cells involved in this process belongs to the CD4 subset and suppress hapten-specific immune response through the release of IL-10 and through direct interaction with effector T cells, blocking their function. Methods for in-vitro and in-vivo expansion of specific T regulatory cells may represent an innovative approach for the cure of contact hypersensitivity.

  19. Heteromeric amino acid transporters. In search of the molecular bases of transport cycle mechanisms.

    PubMed

    Palacín, Manuel; Errasti-Murugarren, Ekaitz; Rosell, Albert

    2016-06-15

    Heteromeric amino acid transporters (HATs) are relevant targets for structural studies. On the one hand, HATs are involved in inherited and acquired human pathologies. On the other hand, these molecules are the only known examples of solute transporters composed of two subunits (heavy and light) linked by a disulfide bridge. Unfortunately, structural knowledge of HATs is scarce and limited to the atomic structure of the ectodomain of a heavy subunit (human 4F2hc-ED) and distant prokaryotic homologues of the light subunits that share a LeuT-fold. Recent data on human 4F2hc/LAT2 at nanometer resolution revealed 4F2hc-ED positioned on top of the external loops of the light subunit LAT2. Improved resolution of the structure of HATs, combined with conformational studies, is essential to establish the structural bases for light subunit recognition and to evaluate the functional relevance of heavy and light subunit interactions for the amino acid transport cycle. © 2016 Authors; published by Portland Press Limited.

  20. The Kidney and Acid-Base Regulation

    ERIC Educational Resources Information Center

    Koeppen, Bruce M.

    2009-01-01

    Since the topic of the role of the kidneys in the regulation of acid base balance was last reviewed from a teaching perspective (Koeppen BM. Renal regulation of acid-base balance. Adv Physiol Educ 20: 132-141, 1998), our understanding of the specific membrane transporters involved in H+, HCO , and NH transport, and especially how these…

  1. Aciduricity and acid tolerance mechanisms of Streptococcus anginosus.

    PubMed

    Sasaki, Minoru; Kodama, Yoshitoyo; Shimoyama, Yu; Ishikawa, Taichi; Kimura, Shigenobu

    2018-04-17

    Although Streptococcus anginosus constitutes a proportion of the normal flora of the gastrointestinal and genital tracts, and the oral cavity, it has been reported that S. anginosus infection could be closely associated with abscesses at various body sites, infective endocarditis, and upper gastrointestinal cancers. The colonization in an acidic environment due to the aciduricity of S. anginosus could be the etiology of the systemic infection of the bacteria. To elucidate the aciduricity and acid tolerance mechanisms of the microbe, we examined the viability and growth of S. anginosus under acidic conditions. The viabilities of S. anginosus NCTC 10713 and Streptococcus mutans ATCC 25175 at pH 4.0 showed as being markedly higher than those of Streptococcus sanguinis ATCC 10556, Streptococcus gordonii ATCC 10558, and Streptococcus mitis ATCC 49456; however, the viability was partially inhibited by dicyclohexylcarbodiimide, an H + -ATPase inhibitor, suggesting that H + -ATPase could play a role in the viability of S. anginosus under acidic conditions. In addition, S. anginosus NCTC 10713 could grow at pH 5.0 and showed a marked arginine deiminase (ADI) activity, unlike its ΔarcA mutant, deficient in the gene encoding ADI, and other streptococcal species, which indicated that ADI could also be associated with aciduricity. These results suggest that S. anginosus has significant aciduric properties, which can be attributed to these enzyme activities.

  2. [Acid-base homeostasis and the thyro-parathyroid glands].

    PubMed

    Cuisinier-Gleizes, P; George, A; Thomasset, M; Mathieu, H

    1975-05-12

    Chronic metabolic acidosis entails hyperparathyroidism and osteopathy. In order to elucidate the role of the thyroparathyroids in this bone lesion production the effects of acidic diet for 7 weeks were studied in parathyroidectomized (PTX), thyroparathyroidectomized (TPTX) and shamoperated (Sh-O) growing rats. In all animals urinary excretion of calcium, phosphate, ammonium and titrable acidity was similarly increased. The rise in hydroxyproline excretion and urinary 85-sr (that was injected previous to acidic feeding) was more marked in PTX and TPTX rats. Moreover, in these animals the serum calcium level was increased, the blood pH was decreased. According to these data, an acidic diet intake that is not sufficient to elicit a fall in blood pH of normal young rats can induce severe acidosis in chronically parathyroidectomized or thyroparathyroidectomized animals; moreover the bone resorption appears more marked. It is concluded that parathyroids are involved in the extra-cellular fluid defense mechanism against acidosis by a no bone resorptive mechanism. We hypothesize that the parathyroids permit the necessary and adequate supply of bicarbonates by the bone to maintain blood pH homeostasis.

  3. Acid-base properties of 2-phenethyldithiocarbamoylacetic acid, an antitumor agent

    NASA Astrophysics Data System (ADS)

    Novozhilova, N. E.; Kutina, N. N.; Petukhova, O. A.; Kharitonov, Yu. Ya.

    2013-07-01

    The acid-base properties of the 2-phenethyldithiocarbamoylacetic acid (PET) substance belonging to the class of isothiocyanates and capable of inhibiting the development of tumors on many experimental models were studied. The acidity and hydrolysis constants of the PET substance in ethanol, acetone, aqueous ethanol, and aqueous acetone solutions were determined from the data of potentiometric (pH-metric) titration of ethanol and acetone solutions of PET with aqueous solidum hydroxide at room temperature.

  4. Effects and mechanism of acid rain on plant chloroplast ATP synthase.

    PubMed

    Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua

    2016-09-01

    Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.

  5. Oxalate Acid-Base Cements as a Means of Carbon Storage

    NASA Astrophysics Data System (ADS)

    Erdogan, S. T.

    2017-12-01

    Emission of CO2 from industrial processes poses a myriad of environmental problems. One such polluter is the portland cement (PC) industry. PC is the main ingredient in concrete which is the ubiquitous binding material for construction works. Its production is responsible for 5-10 % of all anthropogenic CO2 emissions. Half of this emission arises from the calcination of calcareous raw materials and half from kiln fuel burning and cement clinker grinding. There have long been efforts to reduce the carbon footprint of concrete. Among the many ways, one is to bind CO2 to the phases in the cement-water paste, oxides, hydroxides, and silicates of calcium, during early hydration or while in service. The problem is that obtaining calcium oxide cheaply requires the decarbonation of limestone and the uptake of CO2 is slow and limited mainly to the surface of the concrete due to its low gas permeability. Hence, a faster method to bind more CO2 is needed. Acid-base (AB) cements are fast-setting, high-strength systems that have high durability in many environments in which PC concrete is vulnerable. They are made with a powder base such as MgO and an acid or acid salt, like phosphates. Despite certain advantages over PC cement systems, AB cements are not feasible, due to their high acid content. Also, the phosphoric acid used comes from non-renewable sources of phosphate. A potential way to reduce the drawbacks of using phosphates could be to use organic acids. Oxalic acid or its salts could react with the proper powder base to give concrete that could be used for infrastructure hence that would have very high demand. In addition, methods to produce oxalates from CO2, even atmospheric, are becoming widespread and more economical. The base can also be an industrial byproduct to further lower the environmental impact. This study describes the use of oxalic acid and industrial byproducts to obtain mortars with mechanical properties comparable to those of PC mortars. It is

  6. Acid-base properties of humic and fulvic acids formed during composting.

    PubMed

    Plaza, César; Senesi, Nicola; Polo, Alfredo; Brunetti, Gennaro

    2005-09-15

    The soil acid-base buffering capacity and the biological availability, mobilization, and transport of macro- and micronutrients, toxic metal ions, and xenobiotic organic cations in soil are strongly influenced by the acid-base properties of humic substances, of which humic and fulvic acids are the major fractions. For these reasons, the proton binding behavior of the humic acid-like (HA) and fulvic acid-like (FA) fractions contained in a compost are believed to be instrumental in its successful performance in soil. In this work, the acid-base properties of the HAs and FAs isolated from a mixture of the sludge residue obtained from olive oil mill wastewater (OMW) evaporated in an open-air pond and tree cuttings (TC) at different stages of composting were investigated by a current potentiometric titration method and the nonideal competitive adsorption (NICA)-Donnan model. The NICA-Donnan model provided an excellent description of the acid-base titration data, and pointed out substantial differences in site density and proton-binding affinity between the HAs and FAs examined. With respect to FAs, HAs were characterized by a smaller content of carboxylic- and phenolic-type groups and their larger affinities for proton binding. Further, HAs featured a greater heterogeneity in carboxylic-type groups than FAs. The composting process increased the content and decreased the proton affinity of carboxylic- and phenolic-type groups of HAs and FAs, and increased the heterogeneity of phenolic-type groups of HAs. As a whole, these effects indicated that the composting process could produce HA and FA fractions with greater cation binding capacities. These results suggest that composting of organic materials improves their agronomic and environmental value by increasing their potential to retain and exchange macro- and micronutrients, and to reduce the bioavailability of organic and inorganic pollutants.

  7. Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics

    NASA Astrophysics Data System (ADS)

    Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

    2015-12-01

    Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains.

  8. Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics.

    PubMed

    Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

    2015-12-22

    Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains.

  9. Poly (lactic acid)-based biomaterials for orthopaedic regenerative engineering.

    PubMed

    Narayanan, Ganesh; Vernekar, Varadraj N; Kuyinu, Emmanuel L; Laurencin, Cato T

    2016-12-15

    Regenerative engineering converges tissue engineering, advanced materials science, stem cell science, and developmental biology to regenerate complex tissues such as whole limbs. Regenerative engineering scaffolds provide mechanical support and nanoscale control over architecture, topography, and biochemical cues to influence cellular outcome. In this regard, poly (lactic acid) (PLA)-based biomaterials may be considered as a gold standard for many orthopaedic regenerative engineering applications because of their versatility in fabrication, biodegradability, and compatibility with biomolecules and cells. Here we discuss recent developments in PLA-based biomaterials with respect to processability and current applications in the clinical and research settings for bone, ligament, meniscus, and cartilage regeneration. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Acid-base physiology, neurobiology and behaviour in relation to CO2-induced ocean acidification.

    PubMed

    Tresguerres, Martin; Hamilton, Trevor J

    2017-06-15

    Experimental exposure to ocean and freshwater acidification affects the behaviour of multiple aquatic organisms in laboratory tests. One proposed cause involves an imbalance in plasma chloride and bicarbonate ion concentrations as a result of acid-base regulation, causing the reversal of ionic fluxes through GABA A receptors, which leads to altered neuronal function. This model is exclusively based on differential effects of the GABA A receptor antagonist gabazine on control animals and those exposed to elevated CO 2 However, direct measurements of actual chloride and bicarbonate concentrations in neurons and their extracellular fluids and of GABA A receptor properties in aquatic organisms are largely lacking. Similarly, very little is known about potential compensatory mechanisms, and about alternative mechanisms that might lead to ocean acidification-induced behavioural changes. This article reviews the current knowledge on acid-base physiology, neurobiology, pharmacology and behaviour in relation to marine CO 2 -induced acidification, and identifies important topics for future research that will help us to understand the potential effects of predicted levels of aquatic acidification on organisms. © 2017. Published by The Company of Biologists Ltd.

  11. Analysis of the mechanism of activation of cAMP-dependent protein kinase through the study of mutants of the yeast regulatory subunit.

    PubMed

    Zaremberg, V; Moreno, S

    1996-04-01

    Spontaneous mutations in the gene which encodes the regulatory subunit of cAMP-dependent protein kinase (PKA) of Saccharomyces cerevisiae (BCY1) have been isolated previously [Cannon, J. F., Gibbs, J. B. & Tatchell, K. (1986) Genetics 113, 247-264] by selection of ras2::LEU2 revertants that grew on non-fermentable carbon sources. The revertants were placed into groups of increasing severity based on the number of PKA-dependent traits affected [Cannon, J. F., Gitan, R. & Tatchell, K. (1990) J. Biol. Chem. 265, 11897-11904]. In this work the ras2 mutation has been crossed out in each bcy1 allele and the phenotypes of these mutants have been assessed. The order of severity of the mutants in both genetic backgrounds is maintained but the severity of each mutant in the normal background is higher than in the ras2::LEU2 background. Total catalytic-subunit and regulatory-subunit activities were measured in crude extracts of the bcy1 ras2::LEU2 mutants. With one exception (bcy1-6) the calculated regulatory subunit/catalytic subunit ratios of the bcy1 mutants relative to that of wild-type cells were greater than one. The dependence of PKA activity on cAMP was measured in permeabilized cells. The strains show an activity ratio in the absence and presence of cAMP in the range 0.5-1 for Kemptide phosphorylation. Overexpression of the high-affinity cAMP phosphodiesterase gene (PDE2) in the bcy1 ras2::LEU2 strains did not alter their PKA-dependent phenotypes. However, transformants were not observed from the parental ras2::LEU2 strain and the bcy1-6 ras2::LEU2 strain. The results are discussed with respect to a hypothesis for the molecular mechanism of the differential reversal of ras2 phenotypes by the bcy1 alleles. Mutations in the regulatory subunit are predicted to affect the structure of the holoenzyme such that the catalytic subunit is capable of maintaining an active catalytic state, without the need to dissociate from the regulatory subunit.

  12. Sensory-motor responses to mechanical stimulation of the esophagus after sensitization with acid.

    PubMed

    Drewes, Asbjørn-Mohr; Reddy, Hariprasad; Staahl, Camilla; Pedersen, Jan; Funch-Jensen, Peter; Arendt-Nielsen, Lars; Gregersen, Hans

    2005-07-28

    Sensitization most likely plays an important role in chronic pain disorders, and such sensitization can be mimicked by experimental acid perfusion of the esophagus. The current study systematically investigated the sensory and motor responses of the esophagus to controlled mechanical stimuli before and after sensitization. Thirty healthy subjects were included. Distension of the distal esophagus with a balloon was performed before and after perfusion with 0.1 mol/L hydrochloric acid for 30 min. An impedance planimetry system was used to measure cross-sectional area, volume, pressure, and tension during the distensions. A new model allowed evaluation of the phasic contractions by the tension during contractions as a function of the initial muscle length before the contraction (comparable to the Frank-Starling law for the heart). Length-tension diagrams were used to evaluate the muscle tone before and after relaxation of the smooth muscle with butylscopolamine. The sensitization resulted in allodynia and hyperalgesia to the distension volumes, and the degree of sensitization was related to the infused volume of acid. Furthermore, a nearly 50% increase in the evoked referred pain was seen after sensitization. The mechanical analysis demonstrated hyper-reactivity of the esophagus following acid perfusion, with an increased number and force of the phasic contractions, but the muscle tone did not change. Acid perfusion of the esophagus sensitizes the sensory pathways and facilitates secondary contractions. The new model can be used to study abnormal sensory-motor mechanisms in visceral organs.

  13. Sensory-motor responses to mechanical stimulation of the esophagus after sensitization with acid

    PubMed Central

    Drewes, Asbjorn Mohr; Reddy, Hariprasad; Staahl, Camilla; Pedersen, Jan; Funch-Jensen, Peter; Arendt-Nielsen, Lars; Gregersen, Hans

    2005-01-01

    AIM: Sensitization most likely plays an important role in chronic pain disorders, and such sensitization can be mimicked by experimental acid perfusion of the esophagus. The current study systematically investigated the sensory and motor responses of the esophagus to controlled mechanical stimuli before and after sensitization. METHODS: Thirty healthy subjects were included. Distension of the distal esophagus with a balloon was performed before and after perfusion with 0.1 mol/L hydrochloric acid for 30 min. An impedance planimetry system was used to measure cross-sectional area, volume, pressure, and tension during the distensions. A new model allowed evaluation of the phasic contractions by the tension during contractions as a function of the initial muscle length before the contraction (comparable to the Frank-Starling law for the heart). Length-tension diagrams were used to evaluate the muscle tone before and after relaxation of the smooth muscle with butylscopolamine. RESULTS: The sensitization resulted in allodynia and hyperalgesia to the distension volumes, and the degree of sensitization was related to the infused volume of acid. Furthermore, a nearly 50% increase in the evoked referred pain was seen after sensitization. The mechanical analysis demonstrated hyper-reactivity of the esophagus following acid perfusion, with an increased number and force of the phasic contractions, but the muscle tone did not change. CONCLUSION: Acid perfusion of the esophagus sensitizes the sensory pathways and facilitates secondary contractions. The new model can be used to study abnormal sensory-motor mechanisms in visceral organs. PMID:16038036

  14. Simvastatin may induce insulin resistance through a novel fatty acid mediated cholesterol independent mechanism

    PubMed Central

    Kain, Vasundhara; Kapadia, Bandish; Misra, Parimal; Saxena, Uday

    2015-01-01

    Statins are a class of oral drugs that are widely used for treatment of hypercholesterolemia. Recent clinical data suggest that chronic use of these drugs increases the frequency of new onset diabetes. Studies to define the risks of statin-induced diabetes and its underlying mechanisms are clearly necessary. We explored the possible mechanism of statin induced insulin resistance using a well-established cell based model and simvastatin as a prototype statin. Our data show that simvastatin induces insulin resistance in a cholesterol biosynthesis inhibition independent fashion but does so by a fatty acid mediated effect on insulin signaling pathway. These data may help design strategies for prevention of statin induced insulin resistance and diabetes in patients with hypercholesterolemia. PMID:26345110

  15. Identification of Regulatory DNA Elements Using Genome-wide Mapping of DNase I Hypersensitive Sites during Tomato Fruit Development.

    PubMed

    Qiu, Zhengkun; Li, Ren; Zhang, Shuaibin; Wang, Ketao; Xu, Meng; Li, Jiayang; Du, Yongchen; Yu, Hong; Cui, Xia

    2016-08-01

    Development and ripening of tomato fruit are precisely controlled by transcriptional regulation, which depends on the orchestrated accessibility of regulatory proteins to promoters and other cis-regulatory DNA elements. This accessibility and its effect on gene expression play a major role in defining the developmental process. To understand the regulatory mechanism and functional elements modulating morphological and anatomical changes during fruit development, we generated genome-wide high-resolution maps of DNase I hypersensitive sites (DHSs) from the fruit tissues of the tomato cultivar "Moneymaker" at 20 days post anthesis as well as break stage. By exploring variation of DHSs across fruit development stages, we pinpointed the most likely hypersensitive sites related to development-specific genes. By detecting binding motifs on DHSs of these development-specific genes or genes in the ascorbic acid biosynthetic pathway, we revealed the common regulatory elements contributing to coordinating gene transcription of plant ripening and specialized metabolic pathways. Our results contribute to a better understanding of the regulatory dynamics of genes involved in tomato fruit development and ripening. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

  16. AtmiRNET: a web-based resource for reconstructing regulatory networks of Arabidopsis microRNAs.

    PubMed

    Chien, Chia-Hung; Chiang-Hsieh, Yi-Fan; Chen, Yi-An; Chow, Chi-Nga; Wu, Nai-Yun; Hou, Ping-Fu; Chang, Wen-Chi

    2015-01-01

    Compared with animal microRNAs (miRNAs), our limited knowledge of how miRNAs involve in significant biological processes in plants is still unclear. AtmiRNET is a novel resource geared toward plant scientists for reconstructing regulatory networks of Arabidopsis miRNAs. By means of highlighted miRNA studies in target recognition, functional enrichment of target genes, promoter identification and detection of cis- and trans-elements, AtmiRNET allows users to explore mechanisms of transcriptional regulation and miRNA functions in Arabidopsis thaliana, which are rarely investigated so far. High-throughput next-generation sequencing datasets from transcriptional start sites (TSSs)-relevant experiments as well as five core promoter elements were collected to establish the support vector machine-based prediction model for Arabidopsis miRNA TSSs. Then, high-confidence transcription factors participate in transcriptional regulation of Arabidopsis miRNAs are provided based on statistical approach. Furthermore, both experimentally verified and putative miRNA-target interactions, whose validity was supported by the correlations between the expression levels of miRNAs and their targets, are elucidated for functional enrichment analysis. The inferred regulatory networks give users an intuitive insight into the pivotal roles of Arabidopsis miRNAs through the crosstalk between miRNA transcriptional regulation (upstream) and miRNA-mediate (downstream) gene circuits. The valuable information that is visually oriented in AtmiRNET recruits the scant understanding of plant miRNAs and will be useful (e.g. ABA-miR167c-auxin signaling pathway) for further research. Database URL: http://AtmiRNET.itps.ncku.edu.tw/ © The Author(s) 2015. Published by Oxford University Press.

  17. Enhancement of the Mechanical Properties of a Polylactic Acid/Flax Fiber Biocomposite by WPU, WPU/Starch, and TPS Polyurethanes Using Coupling Additives

    NASA Astrophysics Data System (ADS)

    Miskolczi, N.; Sedlarik, V.; Kucharczyk, P.; Riegel, E.

    2018-01-01

    This work is addressed to the synthesis of bio-based polymers and investigation of their application in a flax-fiber-reinforced polylactic acid. Polyurethane polymers were synthesized from polyphenyl-methane-diisocyanate, poly (ethylene oxide) glycol, and ricinoleic acid, and their structure was examined by the Fourier transform infrared spectroscopy, thermogravimetric analysis, and differential scanning calorimetry. It was established that the introduction of flax fibers and different compatibilizers into the polymers improved their mechanical properties. A vinyl-trimetoxy-silane and polyalkenyl-polymaleic-anhydride derivative with a high acid number produced the best effect on the properties, but samples without additives had the highest water absorption capacity. SEM micrographs showed a good correlation between the morphology of fracture structure of the composites and the mechanical properties of flax fibers.

  18. Omega-3 fatty acids eicosapentaenoic acid and docosahexaenoic acid and their mechanisms of action on apolipoprotein B-containing lipoproteins in humans: a review.

    PubMed

    Oscarsson, Jan; Hurt-Camejo, Eva

    2017-08-10

    Epidemiological and genetic studies suggest that elevated triglyceride (TG)-rich lipoprotein levels in the circulation increase the risk of cardiovascular disease. Prescription formulations of omega-3 fatty acids (OM3FAs), mainly eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), reduce plasma TG levels and are approved for the treatment of patients with severe hypertriglyceridemia. Many preclinical studies have investigated the TG-lowering mechanisms of action of OM3FAs, but less is known from clinical studies. We conducted a review, using systematic methodology, of studies in humans assessing the mechanisms of action of EPA and DHA on apolipoprotein B-containing lipoproteins, including TG-rich lipoproteins and low-density lipoproteins (LDLs). A systematic search of PubMed retrieved 55 articles, of which 30 were used in the review; 35 additional arrticles were also included. In humans, dietary DHA is retroconverted to EPA, while production of DHA from EPA is not observed. Dietary DHA is preferentially esterified into TGs, while EPA is more evenly esterified into TGs, cholesterol esters and phospholipids. The preferential esterification of DHA into TGs likely explains the higher turnover of DHA than EPA in plasma. The main effects of both EPA and DHA are decreased fasting and postprandial serum TG levels, through reduction of hepatic very-low-density lipoprotein (VLDL)-TG production. The exact mechanism for reduced VLDL production is not clear but does not include retention of lipids in the liver; rather, increased hepatic fatty acid oxidation is likely. The postprandial reduction in TG levels is caused by increased lipoprotein lipase activity and reduced serum VLDL-TG concentrations, resulting in enhanced chylomicron clearance. Overall, no clear differences between the effects of EPA and DHA on TG levels, or on turnover of TG-rich lipoproteins, have been observed. Effects on LDL are complex and may be influenced by genetics, such as APOE genotype. EPA and

  19. Use of Gallic Acid to Enhance the Antioxidant and Mechanical Properties of Active Fish Gelatin Film.

    PubMed

    Limpisophon, Kanokrat; Schleining, Gerhard

    2017-01-01

    This study explores the potential roles of gallic acid in fish gelatin film for improving mechanical properties, UV barrier, and providing antioxidant activities. Glycerol, a common used plasticizer, also impacts on mechanical properties of the film. A factorial design was used to investigate the effects of gallic acid and glycerol concentrations on antioxidant activities and mechanical properties of fish gelatin film. Increasing the amount of gallic acid increased the antioxidant capacities of the film measured by radical scavenging assay and the ferric reducing ability of plasma assay. The released antioxidant power of gallic acid from the film was not reduced by glycerol. The presence of gallic acid not only increased the antioxidant capacity of the film, but also increased the tensile strength, elongation at break, and reduced UV absorption due to interaction between gallic acid and protein by hydrogen bonding. Glycerol did not affect the antioxidant capacities of the film, but increased the elasticity of the films. Overall, this study revealed that gallic acid entrapped in the fish gelatin film provided antioxidant activities and improved film characteristics, namely UV barrier, strength, and elasticity of the film. © 2016 Institute of Food Technologists®.

  20. Biosafety, biosecurity and internationally mandated regulatory regimes: compliance mechanisms for education and global health security

    PubMed Central

    Sture, Judi; Whitby, Simon; Perkins, Dana

    2015-01-01

    This paper highlights the biosafety and biosecurity training obligations that three international regulatory regimes place upon states parties. The duty to report upon the existence of such provisions as evidence of compliance is discussed in relation to each regime. We argue that such mechanisms can be regarded as building blocks for the development and delivery of complementary biosafety and biosecurity teaching and training materials. We show that such building blocks represent foundations upon which life and associated scientists – through greater awareness of biosecurity concerns – can better fulfil their responsibilities to guard their work from misuse in the future. PMID:24494580

  1. Imaging of pH in vivo using hyperpolarized 13C-labelled zymonic acid

    PubMed Central

    Düwel, Stephan; Hundshammer, Christian; Gersch, Malte; Feuerecker, Benedikt; Steiger, Katja; Buck, Achim; Walch, Axel; Haase, Axel; Glaser, Steffen J.; Schwaiger, Markus; Schilling, Franz

    2017-01-01

    Natural pH regulatory mechanisms can be overruled during several pathologies such as cancer, inflammation and ischaemia, leading to local pH changes in the human body. Here we demonstrate that 13C-labelled zymonic acid (ZA) can be used as hyperpolarized magnetic resonance pH imaging sensor. ZA is synthesized from [1-13C]pyruvic acid and its 13C resonance frequencies shift up to 3.0 p.p.m. per pH unit in the physiological pH range. The long lifetime of the hyperpolarized signal enhancement enables monitoring of pH, independent of concentration, temperature, ionic strength and protein concentration. We show in vivo pH maps within rat kidneys and subcutaneously inoculated tumours derived from a mammary adenocarcinoma cell line and characterize ZA as non-toxic compound predominantly present in the extracellular space. We suggest that ZA represents a reliable and non-invasive extracellular imaging sensor to localize and quantify pH, with the potential to improve understanding, diagnosis and therapy of diseases characterized by aberrant acid-base balance. PMID:28492229

  2. A New Regulatory Policy for FTTx-Based Next-Generation Access Networks

    NASA Astrophysics Data System (ADS)

    Makarovič, Boštjan

    2013-07-01

    This article critically assesses the latest European Commission policies in relation to next-generation access investment that put focus on regulated prices and relaxing of wholesale access obligations. Pointing at the vital socio-legal and economic arguments, it further challenges the assumptions of the current EU regulatory framework and calls for a more contractual utility-based model of regulation instead of the current system that overly relies on market-driven infrastructure-based competition.

  3. Nutrigenomic regulation of adipose tissue development --- role of retinoic acid: A review

    PubMed Central

    Wang, Bo; Yang, Qiyuan; Harris, Corrine L.; Nelson, Mark L.; Busboom, Jan R.; Zhu, Mei-Jun; Du, Min

    2016-01-01

    To improve the efficiency of animal production, livestock have been extensively selected or managed to reduce fat accumulation and increase lean growth, which reduces intramuscular or marbling fat content. To enhance marbling, a better understanding of the mechanisms regulating adipogenesis is needed. Vitamin A has recently been shown to have a profound impact on all stages of adipogenesis. Retinoic acid, an active metabolite of vitamin A, activates both retinoic acid receptors (RAR) and retinoid X receptors (RXR), inducing epigenetic changes in key regulatory genes governing adipogenesis. Additionally, Vitamin D and folates interact with the retinoic acid receptors to regulate adipogenesis. In this review, we discuss nutritional regulation of adipogenesis, focusing on retinoic acid and its impact on epigenetic modifications of key adipogenic genes. PMID:27086067

  4. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  5. Regulatory Mechanisms Controlling Maturation of Serotonin Neuron Identity and Function

    PubMed Central

    Spencer, William C.; Deneris, Evan S.

    2017-01-01

    The brain serotonin (5-hydroxytryptamine; 5-HT) system has been extensively studied for its role in normal physiology and behavior, as well as, neuropsychiatric disorders. The broad influence of 5-HT on brain function, is in part due to the vast connectivity pattern of 5-HT-producing neurons throughout the CNS. 5-HT neurons are born and terminally specified midway through embryogenesis, then enter a protracted period of maturation, where they functionally integrate into CNS circuitry and then are maintained throughout life. The transcriptional regulatory networks controlling progenitor cell generation and terminal specification of 5-HT neurons are relatively well-understood, yet the factors controlling 5-HT neuron maturation are only recently coming to light. In this review, we first provide an update on the regulatory network controlling 5-HT neuron development, then delve deeper into the properties and regulatory strategies governing 5-HT neuron maturation. In particular, we discuss the role of the 5-HT neuron terminal selector transcription factor (TF) Pet-1 as a key regulator of 5-HT neuron maturation. Pet-1 was originally shown to positively regulate genes needed for 5-HT synthesis, reuptake and vesicular transport, hence 5-HT neuron-type transmitter identity. It has now been shown to regulate, both positively and negatively, many other categories of genes in 5-HT neurons including ion channels, GPCRs, transporters, neuropeptides, and other transcription factors. Its function as a terminal selector results in the maturation of 5-HT neuron excitability, firing characteristics, and synaptic modulation by several neurotransmitters. Furthermore, there is a temporal requirement for Pet-1 in the control of postmitotic gene expression trajectories thus indicating a direct role in 5-HT neuron maturation. Proper regulation of the maturation of cellular identity is critical for normal neuronal functioning and perturbations in the gene regulatory networks controlling

  6. Regulatory Mechanisms Controlling Maturation of Serotonin Neuron Identity and Function.

    PubMed

    Spencer, William C; Deneris, Evan S

    2017-01-01

    The brain serotonin (5-hydroxytryptamine; 5-HT) system has been extensively studied for its role in normal physiology and behavior, as well as, neuropsychiatric disorders. The broad influence of 5-HT on brain function, is in part due to the vast connectivity pattern of 5-HT-producing neurons throughout the CNS. 5-HT neurons are born and terminally specified midway through embryogenesis, then enter a protracted period of maturation, where they functionally integrate into CNS circuitry and then are maintained throughout life. The transcriptional regulatory networks controlling progenitor cell generation and terminal specification of 5-HT neurons are relatively well-understood, yet the factors controlling 5-HT neuron maturation are only recently coming to light. In this review, we first provide an update on the regulatory network controlling 5-HT neuron development, then delve deeper into the properties and regulatory strategies governing 5-HT neuron maturation. In particular, we discuss the role of the 5-HT neuron terminal selector transcription factor (TF) Pet-1 as a key regulator of 5-HT neuron maturation. Pet-1 was originally shown to positively regulate genes needed for 5-HT synthesis, reuptake and vesicular transport, hence 5-HT neuron-type transmitter identity. It has now been shown to regulate, both positively and negatively, many other categories of genes in 5-HT neurons including ion channels, GPCRs, transporters, neuropeptides, and other transcription factors. Its function as a terminal selector results in the maturation of 5-HT neuron excitability, firing characteristics, and synaptic modulation by several neurotransmitters. Furthermore, there is a temporal requirement for Pet-1 in the control of postmitotic gene expression trajectories thus indicating a direct role in 5-HT neuron maturation. Proper regulation of the maturation of cellular identity is critical for normal neuronal functioning and perturbations in the gene regulatory networks controlling

  7. Activation mechanism of melB tyrosinase from Aspergillus oryzae by acidic treatment.

    PubMed

    Fujieda, Nobutaka; Murata, Michiaki; Yabuta, Shintaro; Ikeda, Takuya; Shimokawa, Chizu; Nakamura, Yukihiro; Hata, Yoji; Itoh, Shinobu

    2013-01-01

    The pro form of recombinant tyrosinase from Aspergillus oryzae (melB) shows no catalytic activity, but acid treatment (around pH 3.5) of protyrosinase activates it to induce tyrosinase activity. Circular dichroism spectra, gel filtration analysis, and colorimetric assay have indicated that acid treatment around pH 3.5 induced the disruption of the conformation of the C-terminal domain covering the enzyme active site. These structural changes induced by the acid treatment may open the entrance to the enzyme active site for substrate incorporation. To compare the mechanism of hydroxylation by the acid-treated tyrosinase with that by trypsin-treated tyrosinase, a detailed steady-state kinetic analysis of the phenolase activity was performed by monitoring the O(2)-consumption rate using a Clark-type oxygen electrode. The results clearly show that the phenolase activity (phenol hydroxylation) of the activated tyrosinase involves an electrophilic aromatic substitution mechanism as in the case of mushroom tyrosinase (Yamazaki and Itoh in J. Am. Chem. Soc. 125:13034-13035, 2003) and activated hemocyanin with urea (Morioka et al. in J. Am. Chem. Soc. 128:6788-6789, 2006).

  8. Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis

    PubMed Central

    Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet

    2011-01-01

    Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689

  9. Dissecting Molecular Mechanisms in Bile Acid Diarrhea.

    PubMed

    Camilleri, Michael

    2016-03-01

    It was previously demonstrated that patients with bile acid (BA) diarrhea have low fasting serum levels of the ileal hormone--fibroblast growth factor-19 (FGF-19). In this paper, the authors demonstrate a positive correlation between ileal transcripts of FGF-19 and (75)SeHCAT retention, providing further evidence of FGF-19 deficiency as an explanation for BA diarrhea. Variants in KLB and FGFR4 genes (that determine the functional re-uptake of BA in the portal circulation by hepatocytes) are also demonstrated to be associated with (75)SeHCAT retention, confirming a second potential mechanism for the development of BA diarrhea.

  10. Nucleic Acid-Based Nanodevices in Biological Imaging.

    PubMed

    Chakraborty, Kasturi; Veetil, Aneesh T; Jaffrey, Samie R; Krishnan, Yamuna

    2016-06-02

    The nanoscale engineering of nucleic acids has led to exciting molecular technologies for high-end biological imaging. The predictable base pairing, high programmability, and superior new chemical and biological methods used to access nucleic acids with diverse lengths and in high purity, coupled with computational tools for their design, have allowed the creation of a stunning diversity of nucleic acid-based nanodevices. Given their biological origin, such synthetic devices have a tremendous capacity to interface with the biological world, and this capacity lies at the heart of several nucleic acid-based technologies that are finding applications in biological systems. We discuss these diverse applications and emphasize the advantage, in terms of physicochemical properties, that the nucleic acid scaffold brings to these contexts. As our ability to engineer this versatile scaffold increases, its applications in structural, cellular, and organismal biology are clearly poised to massively expand.

  11. PlantTFDB 4.0: toward a central hub for transcription factors and regulatory interactions in plants.

    PubMed

    Jin, Jinpu; Tian, Feng; Yang, De-Chang; Meng, Yu-Qi; Kong, Lei; Luo, Jingchu; Gao, Ge

    2017-01-04

    With the goal of providing a comprehensive, high-quality resource for both plant transcription factors (TFs) and their regulatory interactions with target genes, we upgraded plant TF database PlantTFDB to version 4.0 (http://planttfdb.cbi.pku.edu.cn/). In the new version, we identified 320 370 TFs from 165 species, presenting a more comprehensive genomic TF repertoires of green plants. Besides updating the pre-existing abundant functional and evolutionary annotation for identified TFs, we generated three new types of annotation which provide more directly clues to investigate functional mechanisms underlying: (i) a set of high-quality, non-redundant TF binding motifs derived from experiments; (ii) multiple types of regulatory elements identified from high-throughput sequencing data; (iii) regulatory interactions curated from literature and inferred by combining TF binding motifs and regulatory elements. In addition, we upgraded previous TF prediction server, and set up four novel tools for regulation prediction and functional enrichment analyses. Finally, we set up a novel companion portal PlantRegMap (http://plantregmap.cbi.pku.edu.cn) for users to access the regulation resource and analysis tools conveniently. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. An Appetite for Modernizing the Regulatory Framework for Protein Content Claims in Canada

    PubMed Central

    Marinangeli, Christopher P. F.; Foisy, Samara; Shoveller, Anna K.; Porter, Cara; Musa-Veloso, Kathy; Sievenpiper, John L.; Jenkins, David J. A.

    2017-01-01

    The need for protein-rich plant-based foods continues as dietary guidelines emphasize their contribution to healthy dietary patterns that prevent chronic disease and promote environmental sustainability. However, the Canadian Food and Drug Regulations provide a regulatory framework that can prevent Canadian consumers from identifying protein-rich plant-based foods. In Canada, protein nutrient content claims are based on the protein efficiency ratio (PER) and protein rating method, which is based on a rat growth bioassay. PERs are not additive, and the protein rating of a food is underpinned by its Reasonable Daily Intake. The restrictive nature of Canada’s requirements for supporting protein claims therefore presents challenges for Canadian consumers to adapt to a rapidly changing food environment. This commentary will present two options for modernizing the regulatory framework for protein content claims in Canada. The first and preferred option advocates that protein quality not be considered in the determination of the eligibility of a food for protein content claims. The second and less preferred option, an interim solution, is a framework for adopting the protein digestibility corrected amino acid score as the official method for supporting protein content and quality claims and harmonizes Canada’s regulatory framework with that of the USA. PMID:28832556

  13. An Appetite for Modernizing the Regulatory Framework for Protein Content Claims in Canada.

    PubMed

    Marinangeli, Christopher P F; Foisy, Samara; Shoveller, Anna K; Porter, Cara; Musa-Veloso, Kathy; Sievenpiper, John L; Jenkins, David J A

    2017-08-23

    The need for protein-rich plant-based foods continues as dietary guidelines emphasize their contribution to healthy dietary patterns that prevent chronic disease and promote environmental sustainability. However, the Canadian Food and Drug Regulations provide a regulatory framework that can prevent Canadian consumers from identifying protein-rich plant-based foods. In Canada, protein nutrient content claims are based on the protein efficiency ratio (PER) and protein rating method, which is based on a rat growth bioassay. PERs are not additive, and the protein rating of a food is underpinned by its Reasonable Daily Intake. The restrictive nature of Canada's requirements for supporting protein claims therefore presents challenges for Canadian consumers to adapt to a rapidly changing food environment. This commentary will present two options for modernizing the regulatory framework for protein content claims in Canada. The first and preferred option advocates that protein quality not be considered in the determination of the eligibility of a food for protein content claims. The second and less preferred option, an interim solution, is a framework for adopting the protein digestibility corrected amino acid score as the official method for supporting protein content and quality claims and harmonizes Canada's regulatory framework with that of the USA.

  14. The EU, "Regulatory State Regionalism" and New Modes of Higher Education Governance

    ERIC Educational Resources Information Center

    Robertson, Susan L.

    2010-01-01

    Jayasuriya's conceptualisation of "regulatory regionalism" is particularly useful for examining the presence, significance and effect of new higher education governance mechanisms in constituting Europe as a competitive region and knowledge-based economy. In particular he argues that we need to take sufficient account of the role of…

  15. Genomic and transcriptomic analyses reveal adaptation mechanisms of an Acidithiobacillus ferrivorans strain YL15 to alpine acid mine drainage.

    PubMed

    Peng, Tangjian; Ma, Liyuan; Feng, Xue; Tao, Jiemeng; Nan, Meihua; Liu, Yuandong; Li, Jiaokun; Shen, Li; Wu, Xueling; Yu, Runlan; Liu, Xueduan; Qiu, Guanzhou; Zeng, Weimin

    2017-01-01

    Acidithiobacillus ferrivorans is an acidophile that often occurs in low temperature acid mine drainage, e.g., that located at high altitude. Being able to inhabit the extreme environment, the bacterium must possess strategies to copy with the survival stress. Nonetheless, information on the strategies is in demand. Here, genomic and transcriptomic assays were performed to illuminate the adaptation mechanisms of an A. ferrivorans strain YL15, to the alpine acid mine drainage environment in Yulong copper mine in southwest China. Genomic analysis revealed that strain has a gene repertoire for metal-resistance, e.g., genes coding for the mer operon and a variety of transporters/efflux proteins, and for low pH adaptation, such as genes for hopanoid-synthesis and the sodium:proton antiporter. Genes for various DNA repair enzymes and synthesis of UV-absorbing mycosporine-like amino acids precursor indicated hypothetical UV radiation-resistance mechanisms in strain YL15. In addition, it has two types of the acquired immune system-type III-B and type I-F CRISPR/Cas modules against invasion of foreign genetic elements. RNA-seq based analysis uncovered that strain YL15 uses a set of mechanisms to adapt to low temperature. Genes involved in protein synthesis, transmembrane transport, energy metabolism and chemotaxis showed increased levels of RNA transcripts. Furthermore, a bacterioferritin Dps gene had higher RNA transcript counts at 6°C, possibly implicated in protecting DNA against oxidative stress at low temperature. The study represents the first to comprehensively unveil the adaptation mechanisms of an acidophilic bacterium to the acid mine drainage in alpine regions.

  16. Genomic and transcriptomic analyses reveal adaptation mechanisms of an Acidithiobacillus ferrivorans strain YL15 to alpine acid mine drainage

    PubMed Central

    Ma, Liyuan; Feng, Xue; Tao, Jiemeng; Nan, Meihua; Liu, Yuandong; Li, Jiaokun; Shen, Li; Wu, Xueling; Yu, Runlan; Liu, Xueduan; Qiu, Guanzhou; Zeng, Weimin

    2017-01-01

    Acidithiobacillus ferrivorans is an acidophile that often occurs in low temperature acid mine drainage, e.g., that located at high altitude. Being able to inhabit the extreme environment, the bacterium must possess strategies to copy with the survival stress. Nonetheless, information on the strategies is in demand. Here, genomic and transcriptomic assays were performed to illuminate the adaptation mechanisms of an A. ferrivorans strain YL15, to the alpine acid mine drainage environment in Yulong copper mine in southwest China. Genomic analysis revealed that strain has a gene repertoire for metal-resistance, e.g., genes coding for the mer operon and a variety of transporters/efflux proteins, and for low pH adaptation, such as genes for hopanoid-synthesis and the sodium:proton antiporter. Genes for various DNA repair enzymes and synthesis of UV-absorbing mycosporine-like amino acids precursor indicated hypothetical UV radiation—resistance mechanisms in strain YL15. In addition, it has two types of the acquired immune system–type III-B and type I-F CRISPR/Cas modules against invasion of foreign genetic elements. RNA-seq based analysis uncovered that strain YL15 uses a set of mechanisms to adapt to low temperature. Genes involved in protein synthesis, transmembrane transport, energy metabolism and chemotaxis showed increased levels of RNA transcripts. Furthermore, a bacterioferritin Dps gene had higher RNA transcript counts at 6°C, possibly implicated in protecting DNA against oxidative stress at low temperature. The study represents the first to comprehensively unveil the adaptation mechanisms of an acidophilic bacterium to the acid mine drainage in alpine regions. PMID:28542527

  17. Thiol-based Redox Proteins in Brassica napus Guard Cell Abscisic Acid and Methyl Jasmonate Signaling

    PubMed Central

    Zhu, Mengmeng; Zhu, Ning; Song, Wen-yuan; Harmon, Alice C.; Assmann, Sarah M.; Chen, Sixue

    2014-01-01

    SUMMARY Reversibly oxidized cysteine sulfhydryl groups serve as redox sensors or targets of redox sensing that are important in different physiological processes. Little is known, however, about redox sensitive proteins in guard cells and how they function in stomatal signaling. In this study, Brassica napus guard cell proteins altered by redox in response to abscisic acid (ABA) or methyl jasmonate (MeJA) were identified by complementary proteomics approaches, saturation differential in-gel electrophoresis (DIGE) and isotope-coded affinity tag (ICAT). In total, 65 and 118 potential redox responsive proteins were identified in ABA and MeJA treated guard cells, respectively. All the proteins contain at least one cysteine, and over half of them are predicted to form intra-molecular disulfide bonds. Most of the proteins fall into the functional groups of energy, stress and defense, and metabolism. Based on the peptide sequences identified by mass spectrometry, 30 proteins were common to ABA and MeJA treated samples. A total of 44 cysteines was mapped in all the identified proteins, and their levels of redox sensitivity were quantified. Two of the proteins, a SNRK2 kinase and an isopropylmalate dehydrogenase were confirmed to be redox regulated and involved in stomatal movement. This study creates an inventory of potential redox switches, and highlights a protein redox regulatory mechanism in guard cell ABA and MeJA signal transduction. PMID:24580573

  18. Deciphering RNA regulatory elements in trypanosomatids: one piece at a time or genome-wide?

    PubMed

    Gazestani, Vahid H; Lu, Zhiquan; Salavati, Reza

    2014-05-01

    Morphological and metabolic changes in the life cycle of Trypanosoma brucei are accomplished by precise regulation of hundreds of genes. In the absence of transcriptional control, RNA-binding proteins (RBPs) shape the structure of gene regulatory maps in this organism, but our knowledge about their target RNAs, binding sites, and mechanisms of action is far from complete. Although recent technological advances have revolutionized the RBP-based approaches, the main framework for the RNA regulatory element (RRE)-based approaches has not changed over the last two decades in T. brucei. In this Opinion, after highlighting the current challenges in RRE inference, we explain some genome-wide solutions that can significantly boost our current understanding about gene regulatory networks in T. brucei. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Integrated magnetic tweezers and single-molecule FRET for investigating the mechanical properties of nucleic acid

    PubMed Central

    Long, Xi; Parks, Joseph W.; Stone, Michael D.

    2017-01-01

    Many enzymes promote structural changes in their nucleic acid substrates via application of piconewton forces over nanometer length scales. Magnetic tweezers (MT) is a single molecule force spectroscopy method widely used for studying the energetics of such mechanical processes. MT permits stable application of a wide range of forces and torques over long time scales with nanometer spatial resolution. However, in any force spectroscopy experiment, the ability to monitor structural changes in nucleic acids with nanometer sensitivity requires the system of interest to be held under high degrees of tension to improve signal to noise. This limitation prohibits measurement of structural changes within nucleic acids under physiologically relevant conditions of low stretching forces. To overcome this challenge, researchers have integrated a spatially sensitive fluorescence spectroscopy method, single molecule-FRET, with MT to allow simultaneous observation and manipulation of nanoscale structural transitions over a wide range of forces. Here, we describe a method for using this hybrid instrument to analyze the mechanical properties of nucleic acids. We expect that this method for analysis of nucleic acid structure will be easily adapted for experiments aiming to interrogate the mechanical responses of other biological macromolecules. PMID:27320203

  20. The Acid-Base Properties and Chemical Composition of the Surface of the InSb-ZnTe System

    NASA Astrophysics Data System (ADS)

    Kirovskaya, I. A.; Shubenkova, E. G.; Timoshenko, O. T.; Filatova, T. N.

    2008-04-01

    The acid-base properties and chemical composition of the surface of solid solutions and binary components of the InSb-ZnTe system were studied by the hydrolytic adsorption, nonaqueous conductometric titration, mechanochemistry, IR spectroscopy, and mass spectrometry methods. The strength, nature, and concentration of acid centers were determined. Changes in the concentration of acid centers caused by surface exposure to CO and changes in the composition of the system were also studied. The mechanism of acid-base interactions was established. The chemical composition of the surface of system components exposed to air included adsorbed H2O molecules, OH- groups, hydrocarbon and oxocarbon compounds, and the products of surface atom oxidation. After thermal treatment in a vacuum, the composition of the surface approached the stoichiometric composition.

  1. ApoHRP-based assay to measure intracellular regulatory heme.

    PubMed

    Atamna, Hani; Brahmbhatt, Marmik; Atamna, Wafa; Shanower, Gregory A; Dhahbi, Joseph M

    2015-02-01

    The majority of the heme-binding proteins possess a "heme-pocket" that stably binds to heme. Usually known as housekeeping heme-proteins, they participate in a variety of metabolic reactions (e.g., catalase). Heme also binds with lower affinity to the "Heme-Regulatory Motifs" (HRM) in specific regulatory proteins. This type of heme binding is known as exchangeable or regulatory heme (RH). Heme binding to HRM proteins regulates their function (e.g., Bach1). Although there are well-established methods for assaying total cellular heme (e.g., heme-proteins plus RH), currently there is no method available for measuring RH independent of the total heme (TH). The current study describes and validates a new method to measure intracellular RH. This method is based on the reconstitution of apo-horseradish peroxidase (apoHRP) with heme to form holoHRP. The resulting holoHRP activity is then measured with a colorimetric substrate. The results show that apoHRP specifically binds RH but not with heme from housekeeping heme-proteins. The RH assay detects intracellular RH. Furthermore, using conditions that create positive (hemin) or negative (N-methyl protoporphyrin IX) controls for heme in normal human fibroblasts (IMR90), the RH assay shows that RH is dynamic and independent of TH. We also demonstrated that short-term exposure to subcytotoxic concentrations of lead (Pb), mercury (Hg), or amyloid-β (Aβ) significantly alters intracellular RH with little effect on TH. In conclusion the RH assay is an effective assay to investigate intracellular RH concentration and demonstrates that RH represents ∼6% of total heme in IMR90 cells.

  2. Oxidation mechanism of formic acid on the bismuth adatom-modified Pt(111) surface.

    PubMed

    Perales-Rondón, Juan Victor; Ferre-Vilaplana, Adolfo; Feliu, Juan M; Herrero, Enrique

    2014-09-24

    In order to improve catalytic processes, elucidation of reaction mechanisms is essential. Here, supported by a combination of experimental and computational results, the oxidation mechanism of formic acid on Pt(111) electrodes modified by the incorporation of bismuth adatoms is revealed. In the proposed model, formic acid is first physisorbed on bismuth and then deprotonated and chemisorbed in formate form, also on bismuth, from which configuration the C-H bond is cleaved, on a neighbor Pt site, yielding CO2. It was found computationally that the activation energy for the C-H bond cleavage step is negligible, which was also verified experimentally.

  3. Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics

    PubMed Central

    Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

    2015-01-01

    Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains. PMID:26691589

  4. Methionine-Mediated Repression in Saccharomyces cerevisiae: a Pleiotropic Regulatory System Involving Methionyl Transfer Ribonucleic Acid and the Product of Gene eth2

    PubMed Central

    Cherest, H.; Surdin-Kerjan, Y.; De Robichon-Szulmajster, H.

    1971-01-01

    Detailed study of methionine-mediated repression of enzymes involved in methionine biosynthesis in Saccharomyces cerevisiae led to classification of these enzymes into two distinct regulatory groups. Group I comprises four enzymes specifically involved in different parts of methionine biosynthesis, namely, homoserine-O-transacetylase, homocysteine synthetase, adenosine triphosphate sulfurylase, and sulfite reductase. Repressibility of these enzymes is greatly decreased in strains carrying a genetically impaired methionyl-transfer ribonucleic acid (tRNA) synthetase (mutation ts− 296). Conditions leading to absence of repression in the mutant strain have been correlated with a sharp decrease in bulk tRNAmet charging, whereas conditions which restore repressibility of group I enzymes also restore tRNAmet charging. These findings implicate methionyl-tRNA in the regulatory process. However, the absence of a correlation in the wild type between methionyl-tRNA charging and the levels of methionine group I enzymes suggests that only a minor iso accepting species of tRNAmet may be devoted with a regulatory function. Repressibility of the same four enzymes (group I) was also decreased in strains carrying the regulatory mutation eth2r. Although structural genes coding for two of these enzymes, as well as mutations ts− 296 and eth2r segregate independently to each other, synthesis of group I enzymes is coordinated. The pleiotropic regulatory system involved seems then to comprise beside a “regulatory methionyl tRNAmet,” another element, product of gene eth2, which might correspond either to an aporepressor protein or to the “regulatory tRNAmet” itself. Regulation of group II enzymes is defined by response to exogenous methionine, absence of response to either mutations ts− 296 and eth2r, and absence of coordinacy with group I enzymes. However, the two enzymes which belong to this group and are both involved in threonine and methionine biosynthesis undergo

  5. Autotoxicity mechanism of Oryza sativa: transcriptome response in rice roots exposed to ferulic acid

    PubMed Central

    2013-01-01

    Background Autotoxicity plays an important role in regulating crop yield and quality. To help characterize the autotoxicity mechanism of rice, we performed a large-scale, transcriptomic analysis of the rice root response to ferulic acid, an autotoxin from rice straw. Results Root growth rate was decreased and reactive oxygen species, calcium content and lipoxygenase activity were increased with increasing ferulic acid concentration in roots. Transcriptome analysis revealed more transcripts responsive to short ferulic-acid exposure (1- and 3-h treatments, 1,204 genes) than long exposure (24 h, 176 genes). Induced genes were involved in cell wall formation, chemical detoxification, secondary metabolism, signal transduction, and abiotic stress response. Genes associated with signaling and biosynthesis for ethylene and jasmonic acid were upregulated with ferulic acid. Ferulic acid upregulated ATP-binding cassette and amino acid/auxin permease transporters as well as genes encoding signaling components such as leucine-rich repeat VIII and receptor-like cytoplasmic kinases VII protein kinases, APETALA2/ethylene response factor, WRKY, MYB and Zinc-finger protein expressed in inflorescence meristem transcription factors. Conclusions The results of a transcriptome analysis suggest the molecular mechanisms of plants in response to FA, including toxicity, detoxicification and signaling machinery. FA may have a significant effect on inhibiting rice root elongation through modulating ET and JA hormone homeostasis. FA-induced gene expression of AAAP transporters may contribute to detoxicification of the autotoxin. Moreover, the WRKY and Myb TFs and LRR-VIII and SD-2b kinases might regulate downstream genes under FA stress but not general allelochemical stress. This comprehensive description of gene expression information could greatly facilitate our understanding of the mechanisms of autotoxicity in plants. PMID:23705659

  6. The plastidial retrograde signal methyl erythritol cyclopyrophosphate is a regulator of salicylic acid and jasmonic acid crosstalk

    PubMed Central

    Lemos, Mark; Xiao, Yanmei; Bjornson, Marta; Wang, Jin-zheng; Hicks, Derrick; de Souza, Amancio; Wang, Chang-Quan; Yang, Panyu; Ma, Shisong; Dinesh-Kumar, Savithramma; Dehesh, Katayoon

    2016-01-01

    The exquisite harmony between hormones and their corresponding signaling pathways is central to prioritizing plant responses to simultaneous and/or successive environmental trepidations. The crosstalk between jasmonic acid (JA) and salicylic acid (SA) is an established effective mechanism that optimizes and tailors plant adaptive responses. However, the underlying regulatory modules of this crosstalk are largely unknown. Global transcriptomic analyses of mutant plants (ceh1) with elevated levels of the stress-induced plastidial retrograde signaling metabolite 2-C-methyl-D-erythritol cyclopyrophosphate (MEcPP) revealed robustly induced JA marker genes, expected to be suppressed by the presence of constitutively high SA levels in the mutant background. Analyses of a range of genotypes with varying SA and MEcPP levels established the selective role of MEcPP-mediated signal(s) in induction of JA-responsive genes in the presence of elevated SA. Metabolic profiling revealed the presence of high levels of the JA precursor 12-oxo-phytodienoic acid (OPDA), but near wild type levels of JA in the ceh1 mutant plants. Analyses of coronatine-insensitive 1 (coi1)/ceh1 double mutant plants confirmed that the MEcPP-mediated induction is JA receptor COI1 dependent, potentially through elevated OPDA. These findings identify MEcPP as a previously unrecognized central regulatory module that induces JA-responsive genes in the presence of high SA, thereby staging a multifaceted plant response within the environmental context. PMID:26733689

  7. Acid-triggered membrane insertion of Pseudomonas exotoxin A involves an original mechanism based on pH-regulated tryptophan exposure.

    PubMed

    Méré, Jocelyn; Morlon-Guyot, Juliette; Bonhoure, Anne; Chiche, Laurent; Beaumelle, Bruno

    2005-06-03

    Exposure to low endosomal pH during internalization of Pseudomonas exotoxin A (PE) triggers membrane insertion of its translocation domain. This process is a prerequisite for PE translocation to the cytosol where it inactivates protein synthesis. Although hydrophobic helices enable membrane insertion of related bacterial toxins such as diphtheria toxin, the PE translocation domain is devoid of hydrophobic stretches and the structural features triggering acid-induced membrane insertion of PE are not known. Here we have identified a molecular device that enables PE membrane insertion. This process is promoted by exposure of a key tryptophan residue. At neutral pH, this Trp is buried in a hydrophobic pocket closed by the smallest alpha-helix of the translocation domain. Upon acidification, protonation of the Asp that is the N-cap residue of the helix leads to its destabilization, enabling Trp side chain insertion into the endosome membrane. This tryptophan-based membrane insertion system is surprisingly similar to the membrane-anchoring mechanism of human annexin-V and could be used by other proteins as well.

  8. Hydrolysis of Ketene Catalyzed by Formic Acid: Modification of Reaction Mechanism, Energetics, and Kinetics with Organic Acid Catalysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Louie, Matthew K.; Francisco, Joseph S.; Verdicchio, Marco

    2015-05-14

    The hydrolysis of ketene (H2C=C=O) to form acetic acid involving two water molecules and also separately in the presence of one to two water molecules and formic acid (FA) was investigated. Our results show that, while the currently accepted indirect mechanism, involving addition of water across the carbonyl C=O bond of ketene to form an ene-diol followed by tautomerization of the ene-diol to form acetic acid, is the preferred pathway when water alone is present, with formic acid as catalyst, addition of water across the ketene C=C double bond to directly produce acetic acid becomes the kinetically favored pathway formore » temperatures below 400 K. We find not only that the overall barrier for ketene hydrolysis involving one water molecule and formic acid (H2C2O + H2O + FA) is significantly lower than that involving two water molecules (H2C2O + 2H(2)O) but also that FA is able to reduce the barrier height for the direct path, involving addition of water across the C=C double bond, so that it is essentially identical with (6.4 kcal/mol) that for the indirect ene-diol formation path involving addition of water across the C=O bond. For the case of ketene hydrolysis involving two water molecules and formic acid (H2C2O + 2H(2)O + FA), the barrier for the direct addition of water across the C=C double bond is reduced even further and is 2.5 kcal/mol lower relative to the ene-diol path involving addition of water across the C=O bond. In fact, the hydrolysis barrier for the H2C2O + 2H(2)O + FA reaction through the direct path is sufficiently low (2.5 kcal/mol) for it to be an energetically accessible pathway for acetic acid formation under atmospheric conditions. Given the structural similarity between acetic and formic acid, our results also have potential implications for aqueous-phase chemistry. Thus, in an aqueous environment, even in the absence of formic acid, though the initial mechanism for ketene hydrolysis is expected to involve addition of water across the

  9. Acid-base titrations using microfluidic paper-based analytical devices.

    PubMed

    Karita, Shingo; Kaneta, Takashi

    2014-12-16

    Rapid and simple acid-base titration was accomplished using a novel microfluidic paper-based analytical device (μPAD). The μPAD was fabricated by wax printing and consisted of ten reservoirs for reaction and detection. The reaction reservoirs contained various amounts of a primary standard substance, potassium hydrogen phthalate (KHPth), whereas a constant amount of phenolphthalein was added to all the detection reservoirs. A sample solution containing NaOH was dropped onto the center of the μPAD and was allowed to spread to the reaction reservoirs where the KHPth neutralized it. When the amount of NaOH exceeded that of the KHPth in the reaction reservoirs, unneutralized hydroxide ion penetrated the detection reservoirs, resulting in a color reaction from the phenolphthalein. Therefore, the number of the detection reservoirs with no color change determined the concentration of the NaOH in the sample solution. The titration was completed within 1 min by visually determining the end point, which required neither instrumentation nor software. The volumes of the KHPth and phenolphthalein solutions added to the corresponding reservoirs were optimized to obtain reproducible and accurate results for the concentration of NaOH. The μPADs determined the concentration of NaOH at orders of magnitude ranging from 0.01 to 1 M. An acid sample, HCl, was also determined using Na2CO3 as a primary standard substance instead of KHPth. Furthermore, the μPAD was applicable to the titrations of nitric acid, sulfuric acid, acetic acid, and ammonia solutions. The μPADs were stable for more than 1 month when stored in darkness at room temperature, although this was reduced to only 5 days under daylight conditions. The analysis of acidic hot spring water was also demonstrated in the field using the μPAD, and the results agreed well with those obtained by classic acid-base titration.

  10. Protective Effect of Unsaturated Fatty Acids on Palmitic Acid-Induced Toxicity in Skeletal Muscle Cells is not Mediated by PPARδ Activation.

    PubMed

    Tumova, Jana; Malisova, Lucia; Andel, Michal; Trnka, Jan

    2015-10-01

    Unsaturated free fatty acids (FFA) are able to prevent deleterious effects of saturated FFA in skeletal muscle cells although the mechanisms involved are still not completely understood. FFA act as endogenous ligands of peroxisome proliferator-activated receptors (PPAR), transcription factors regulating the expression of genes involved in lipid metabolism. The aim of this study was to determine whether activation of PPARδ, the most common PPAR subtype in skeletal muscle, plays a role in mediating the protective effect of unsaturated FFA on saturated FFA-induced damage in skeletal muscle cells and to examine an impact on mitochondrial respiration. Mouse C2C12 myotubes were treated for 24 h with different concentrations of saturated FFA (palmitic acid), unsaturated FFA (oleic, linoleic and α-linolenic acid), and their combinations. PPARδ agonist GW501516 and antagonist GSK0660 were also used. Both mono- and polyunsaturated FFA, but not GW501516, prevented palmitic acid-induced cell death. Mono- and polyunsaturated FFA proved to be effective activators of PPARδ compared to saturated palmitic acid; however, in combination with palmitic acid their effect on PPARδ activation was blocked and stayed at the levels observed for palmitic acid alone. Unsaturated FFA at moderate physiological concentrations as well as GW501516, but not palmitic acid, mildly uncoupled mitochondrial respiration. Our results indicate that although unsaturated FFA are effective activators of PPARδ, their protective effect on palmitic acid-induced toxicity is not mediated by PPARδ activation and subsequent induction of lipid regulatory genes in skeletal muscle cells. Other mechanisms, such as mitochondrial uncoupling, may underlie their effect.

  11. Suppressor mutations identify amino acids in PAA-1/PR65 that facilitate regulatory RSA-1/B″ subunit targeting of PP2A to centrosomes in C. elegans

    PubMed Central

    Lange, Karen I.; Heinrichs, Jeffrey; Cheung, Karen; Srayko, Martin

    2013-01-01

    Summary Protein phosphorylation and dephosphorylation is a key mechanism for the spatial and temporal regulation of many essential developmental processes and is especially prominent during mitosis. The multi-subunit protein phosphatase 2A (PP2A) enzyme plays an important, yet poorly characterized role in dephosphorylating proteins during mitosis. PP2As are heterotrimeric complexes comprising a catalytic, structural, and regulatory subunit. Regulatory subunits are mutually exclusive and determine subcellular localization and substrate specificity of PP2A. At least 3 different classes of regulatory subunits exist (termed B, B′, B″) but there is no obvious similarity in primary sequence between these classes. Therefore, it is not known how these diverse regulatory subunits interact with the same holoenzyme to facilitate specific PP2A functions in vivo. The B″ family of regulatory subunits is the least understood because these proteins lack conserved structural domains. RSA-1 (regulator of spindle assembly) is a regulatory B″ subunit required for mitotic spindle assembly in Caenorhabditis elegans. In order to address how B″ subunits interact with the PP2A core enzyme, we focused on a conditional allele, rsa-1(or598ts), and determined that this mutation specifically disrupts the protein interaction between RSA-1 and the PP2A structural subunit, PAA-1. Through genetic screening, we identified a putative interface on the PAA-1 structural subunit that interacts with a defined region of RSA-1/B″. In the context of previously published results, these data propose a mechanism of how different PP2A B-regulatory subunit families can bind the same holoenzyme in a mutually exclusive manner, to perform specific tasks in vivo. PMID:23336080

  12. Suppressor mutations identify amino acids in PAA-1/PR65 that facilitate regulatory RSA-1/B″ subunit targeting of PP2A to centrosomes in C. elegans.

    PubMed

    Lange, Karen I; Heinrichs, Jeffrey; Cheung, Karen; Srayko, Martin

    2013-01-15

    Protein phosphorylation and dephosphorylation is a key mechanism for the spatial and temporal regulation of many essential developmental processes and is especially prominent during mitosis. The multi-subunit protein phosphatase 2A (PP2A) enzyme plays an important, yet poorly characterized role in dephosphorylating proteins during mitosis. PP2As are heterotrimeric complexes comprising a catalytic, structural, and regulatory subunit. Regulatory subunits are mutually exclusive and determine subcellular localization and substrate specificity of PP2A. At least 3 different classes of regulatory subunits exist (termed B, B', B″) but there is no obvious similarity in primary sequence between these classes. Therefore, it is not known how these diverse regulatory subunits interact with the same holoenzyme to facilitate specific PP2A functions in vivo. The B″ family of regulatory subunits is the least understood because these proteins lack conserved structural domains. RSA-1 (regulator of spindle assembly) is a regulatory B″ subunit required for mitotic spindle assembly in Caenorhabditis elegans. In order to address how B″ subunits interact with the PP2A core enzyme, we focused on a conditional allele, rsa-1(or598ts), and determined that this mutation specifically disrupts the protein interaction between RSA-1 and the PP2A structural subunit, PAA-1. Through genetic screening, we identified a putative interface on the PAA-1 structural subunit that interacts with a defined region of RSA-1/B″. In the context of previously published results, these data propose a mechanism of how different PP2A B-regulatory subunit families can bind the same holoenzyme in a mutually exclusive manner, to perform specific tasks in vivo.

  13. The function of the RNA-binding protein TEL1 in moss reveals ancient regulatory mechanisms of shoot development.

    PubMed

    Vivancos, Julien; Spinner, Lara; Mazubert, Christelle; Charlot, Florence; Paquet, Nicolas; Thareau, Vincent; Dron, Michel; Nogué, Fabien; Charon, Céline

    2012-03-01

    The shoot represents the basic body plan in land plants. It consists of a repeated structure composed of stems and leaves. Whereas vascular plants generate a shoot in their diploid phase, non-vascular plants such as mosses form a shoot (called the gametophore) in their haploid generation. The evolution of regulatory mechanisms or genetic networks used in the development of these two kinds of shoots is unclear. TERMINAL EAR1-like genes have been involved in diploid shoot development in vascular plants. Here, we show that disruption of PpTEL1 from the moss Physcomitrella patens, causes reduced protonema growth and gametophore initiation, as well as defects in gametophore development. Leafy shoots formed on ΔTEL1 mutants exhibit shorter stems with more leaves per shoot, suggesting an accelerated leaf initiation (shortened plastochron), a phenotype shared with the Poaceae vascular plants TE1 and PLA2/LHD2 mutants. Moreover, the positive correlation between plastochron length and leaf size observed in ΔTEL1 mutants suggests a conserved compensatory mechanism correlating leaf growth and leaf initiation rate that would minimize overall changes in plant biomass. The RNA-binding protein encoded by PpTEL1 contains two N-terminus RNA-recognition motifs, and a third C-terminus non-canonical RRM, specific to TEL proteins. Removal of the PpTEL1 C-terminus (including this third RRM) or only 16-18 amino acids within it seriously impairs PpTEL1 function, suggesting a critical role for this third RRM. These results show a conserved function of the RNA-binding PpTEL1 protein in the regulation of shoot development, from early ancestors to vascular plants, that depends on the third TEL-specific RRM.

  14. Ectopic expression of phosphoenolpyruvate carboxylase in Vicia narbonensis seeds: effects of improved nutrient status on seed maturation and transcriptional regulatory networks.

    PubMed

    Radchuk, Ruslana; Radchuk, Volodymyr; Götz, Klaus-Peter; Weichert, Heiko; Richter, Andreas; Emery, R J Neil; Weschke, Winfriede; Weber, Hans

    2007-09-01

    Seed maturation responds to endogenous and exogenous signals like nutrient status, energy and hormones. We recently showed that phosphoenolpyruvate carboxylase (PEPC) overexpression in Vicia narbonensis seeds alters seed metabolism and channels carbon into organic acids, resulting in greater seed storage capacity and increased protein content. Thus, these lines represent models with altered sink strength and improved nutrient status. Here we analyse seed developmental and metabolic parameters, and C/N partitioning in these seeds. Transgenic embryos take up more carbon and nitrogen. Changes in dry to FW ratio, seed fill duration and major seed components indicate altered seed development. Array-based gene expression analysis of embryos reveals upregulation of seed metabolism, especially during the transition phase and at late maturation, in terms of protein storage and processing, amino acid metabolism, primary metabolism and transport, energy and mitochondrial activity, transcriptional and translational activity, stress tolerance, photosynthesis, cell proliferation and elongation, signalling and hormone action and regulated protein degradation. Stimulated cell elongation is in accordance with upregulated signalling pathways related to gibberellic acid/brassinosteroids. We discuss that activated organic and amino acid production leads to a wide-range activation of nitrogen metabolism, including the machinery of storage protein synthesis, amino acid synthesis, protein processing and deposition, translational activity and the methylation cycle. We suggest that alpha-ketoglutarate (alpha-KG) and/or oxalacetate provide signals for coordinate upregulation of amino acid biosynthesis. Activation of stress tolerance genes indicates partial overlap between nutrient, stress and abscisic acid (ABA) signals, indicating a common interacting or regulatory mechanism between nutrients, stress and ABA. In conclusion, analysis of PEPC overexpressing seeds identified pathways

  15. ACID RAIN AND SOIL MICROBIAL ACTIVITY: EFFECTS AND THEIR MECHANISMS

    EPA Science Inventory

    In the investigation, our aim was to determine if acid rain affects soil microbial activity and to identify possible mechanisms of observed effects. A Sierran forest soil (pH 6.4) planted with Ponderosa pine seedlings was exposed to simulated rain (pH 2.0, 3.0, 4.0 and 5.6) with ...

  16. Pathway-Based Analysis of Genome-Wide siRNA Screens Reveals the Regulatory Landscape of App Processing

    PubMed Central

    Camargo, Luiz Miguel; Zhang, Xiaohua Douglas; Loerch, Patrick; Caceres, Ramon Miguel; Marine, Shane D.; Uva, Paolo; Ferrer, Marc; de Rinaldis, Emanuele; Stone, David J.; Majercak, John; Ray, William J.; Yi-An, Chen; Shearman, Mark S.; Mizuguchi, Kenji

    2015-01-01

    The progressive aggregation of Amyloid-β (Aβ) in the brain is a major trait of Alzheimer's Disease (AD). Aβ is produced as a result of proteolytic processing of the β-amyloid precursor protein (APP). Processing of APP is mediated by multiple enzymes, resulting in the production of distinct peptide products: the non-amyloidogenic peptide sAPPα and the amyloidogenic peptides sAPPβ, Aβ40, and Aβ42. Using a pathway-based approach, we analyzed a large-scale siRNA screen that measured the production of different APP proteolytic products. Our analysis identified many of the biological processes/pathways that are known to regulate APP processing and have been implicated in AD pathogenesis, as well as revealing novel regulatory mechanisms. Furthermore, we also demonstrate that some of these processes differentially regulate APP processing, with some mechanisms favouring production of certain peptide species over others. For example, synaptic transmission having a bias towards regulating Aβ40 production over Aβ42 as well as processes involved in insulin and pancreatic biology having a bias for sAPPβ production over sAPPα. In addition, some of the pathways identified as regulators of APP processing contain genes (CLU, BIN1, CR1, PICALM, TREM2, SORL1, MEF2C, DSG2, EPH1A) recently implicated with AD through genome wide association studies (GWAS) and associated meta-analysis. In addition, we provide supporting evidence and a deeper mechanistic understanding of the role of diabetes in AD. The identification of these processes/pathways, their differential impact on APP processing, and their relationships to each other, provide a comprehensive systems biology view of the “regulatory landscape” of APP. PMID:25723573

  17. Gene Regulatory Network Inferences Using a Maximum-Relevance and Maximum-Significance Strategy

    PubMed Central

    Liu, Wei; Zhu, Wen; Liao, Bo; Chen, Xiangtao

    2016-01-01

    Recovering gene regulatory networks from expression data is a challenging problem in systems biology that provides valuable information on the regulatory mechanisms of cells. A number of algorithms based on computational models are currently used to recover network topology. However, most of these algorithms have limitations. For example, many models tend to be complicated because of the “large p, small n” problem. In this paper, we propose a novel regulatory network inference method called the maximum-relevance and maximum-significance network (MRMSn) method, which converts the problem of recovering networks into a problem of how to select the regulator genes for each gene. To solve the latter problem, we present an algorithm that is based on information theory and selects the regulator genes for a specific gene by maximizing the relevance and significance. A first-order incremental search algorithm is used to search for regulator genes. Eventually, a strict constraint is adopted to adjust all of the regulatory relationships according to the obtained regulator genes and thus obtain the complete network structure. We performed our method on five different datasets and compared our method to five state-of-the-art methods for network inference based on information theory. The results confirm the effectiveness of our method. PMID:27829000

  18. Contributions of acid rain research to the forest science-policy interface: learning from the national acid precipitation assessment program.

    Treesearch

    Charles E. Peterson; David S. Shriner

    2004-01-01

    During the 1970s, there was growing concern by scientists, policy officials and the general public in the USA over the possible effects of acid rain on human health and the environment (crops, forests, water, etc.). The lack of science-based information needed for policy and regulatory decisions led Congress to create an interagency task force in 1980 called the...

  19. Chem I Supplement: Emphasis on Acids and Bases

    ERIC Educational Resources Information Center

    Journal of Chemical Education Staff

    1977-01-01

    Provides supplementary notes on acids and bases suitable for secondary school chemistry instruction, including acidity in solid and natural waters, acidity balance in body chemistry, acid and basic foods, pH values of common fluids, examples of drugs, and commercial preparation of nitric acid. (SL)

  20. How a microbial drug transporter became essential for crop cultivation on acid soils: aluminium tolerance conferred by the multidrug and toxic compound extrusion (MATE) family

    PubMed Central

    Magalhaes, Jurandir V.

    2010-01-01

    Background Aluminium (Al) toxicity is a major agricultural constraint for crop cultivation on acid soils, which comprise a large portion of the world's arable land. One of the most widely accepted mechanisms of Al tolerance in plants is based on Al-activated organic acid release into the rhizosphere, with organic acids forming stable, non-toxic complexes with Al. This mechanism has recently been validated by the isolation of bona-fide Al-tolerance genes in crop species, which encode membrane transporters that mediate Al-activated organic acid release leading to Al exclusion from root apices. In crop species such as sorghum and barley, members in the multidrug and toxic compound extrusion (MATE) family underlie Al tolerance by a mechanism based on Al-activated citrate release. Scope and Conclusions The study of Al tolerance in plants as conferred by MATE family members is in its infancy. Therefore, much is yet to be discovered about the functional diversity and evolutionary dynamics that led MATE proteins to acquire transport properties conducive to Al tolerance in plants. In this paper we review the major characteristics of transporters in the MATE family and will relate this knowledge to Al tolerance in plants. The MATE family is clearly extremely flexible with respect to substrate specificity, which raises the possibility that Al tolerance as encoded by MATE proteins may not be restricted to Al-activated citrate release in plant species. There are also indications that regulatory loci may be of pivotal importance to fully explore the potential for Al-tolerance improvement based on MATE genes. PMID:20511585

  1. Regulation of the proteome by amino acids.

    PubMed

    Bourgoin-Voillard, Sandrine; Goron, Arthur; Seve, Michel; Moinard, Christophe

    2016-03-01

    Besides their main contribution as substrates for protein synthesis, amino acids as signaling molecules could exert some regulatory functions on protein synthesis and/or proteolysis that have been emphasized in a number of recent studies. Several publications have highlighted supplemental roles of those amino acids in protein metabolism as well as in immunity, heat shock response, or apoptosis processes. In this way, via their regulatory properties, selected amino acids (such as leucine, glutamine, arginine, citrulline, or methionine) directly influence the proteome. In this review, we are proposing an overview of the regulation of the proteome by amino acids in mammals. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Evaluation of a computer-based approach to teaching acid/base physiology.

    PubMed

    Rawson, Richard E; Quinlan, Kathleen M

    2002-12-01

    Because acid/base physiology is a difficult subject for most medical and veterinary students, the first author designed a software program, Acid/Base Primer, that would help students with this topic. The Acid/Base Primer was designed and evaluated within a conceptual framework of basic educational principles. Seventy-five first-year veterinary students (of 81; 93% response rate) participated in this study. Students took both a pre- and posttest of content understanding. After completing the Acid/Base Primer in pairs, each student filled out a survey evaluating the features of the program and describing his/her use and experience of it. Four pairs of students participated in interviews that elaborated on the surveys. Scores improved from 53 +/- 2% on the pretest to 74 +/- 1% on an immediate posttest. On surveys and in interviews, students reported that the program helped them construct their own understanding of acid/base physiology and prompted discussions in pairs of students when individual understandings differed. The case-based format provided anchors and a high degree of relevance. Repetition of concepts helped students develop a more complex network of understanding. Questions in the program served to scaffold the learning process by providing direction, accentuating the relevant features of the cases, and provoking discussion. Guidelines for software development were generated on the basis of the findings and relevant educational literature.

  3. Reverse engineering of gene regulatory networks.

    PubMed

    Cho, K H; Choo, S M; Jung, S H; Kim, J R; Choi, H S; Kim, J

    2007-05-01

    Systems biology is a multi-disciplinary approach to the study of the interactions of various cellular mechanisms and cellular components. Owing to the development of new technologies that simultaneously measure the expression of genetic information, systems biological studies involving gene interactions are increasingly prominent. In this regard, reconstructing gene regulatory networks (GRNs) forms the basis for the dynamical analysis of gene interactions and related effects on cellular control pathways. Various approaches of inferring GRNs from gene expression profiles and biological information, including machine learning approaches, have been reviewed, with a brief introduction of DNA microarray experiments as typical tools for measuring levels of messenger ribonucleic acid (mRNA) expression. In particular, the inference methods are classified according to the required input information, and the main idea of each method is elucidated by comparing its advantages and disadvantages with respect to the other methods. In addition, recent developments in this field are introduced and discussions on the challenges and opportunities for future research are provided.

  4. A novel mechanism of acid and bile acid-induced DNA damage involving Na+/H+ exchanger: implication for Barrett's oesophagus.

    PubMed

    Goldman, Aaron; Shahidullah, Mohammad; Goldman, David; Khailova, Ludmila; Watts, George; Delamere, Nicholas; Dvorak, Katerina

    2010-12-01

    Barrett's oesophagus is a premalignant disease associated with oesophageal adenocarcinoma. The major goal of this study was to determine the mechanism responsible for bile acid-induced alteration in intracellular pH (pH(i)) and its effect on DNA damage in cells derived from normal oesophagus (HET1A) or Barrett's oesophagus (CP-A). Cells were exposed to bile acid cocktail (BA) and/or acid in the presence/absence of inhibitors of nitric oxide synthase (NOS) or sodium-hydrogen exchanger (NHE). Nitric oxide (NO), pH(i) and DNA damage were measured by fluorescent imaging and comet assay. Expression of NHE1 and NOS in cultured cells and biopsies from Barrett's oesophagus or normal squamous epithelium was determined by RT-PCR, immunoblotting or immunohistochemistry. A dose dependent decrease in pH(i) was observed in CP-A cells exposed to BA. This effect of BA is the consequence of NOS activation and increased NO production, which leads to NHE inhibition. Exposure of oesophageal cells to acid in combination with BA synergistically decreased pH(i). The decrease was more pronounced in CP-A cells and resulted in >2-fold increase in DNA damage compared to acid treatment alone. Examination of biopsies and cell lines revealed robust expression of NHE1 in Barrett's oesophagus but an absence of NHE1 in normal epithelium. The results of this study identify a new mechanism of bile acid-induced DNA damage. We found that bile acids present in the refluxate activate immediately all three isoforms of NOS, which leads to an increased NO production and NHE inhibition. This consequently results in increased intracellular acidification and DNA damage, which may lead to mutations and cancer progression. Therefore, we propose that in addition to gastric reflux, bile reflux should be controlled in patients with Barrett's oesophagus.

  5. Ethylene-Inhibited Jasmonic Acid Biosynthesis Promotes Mesocotyl/Coleoptile Elongation of Etiolated Rice Seedlings[OPEN

    PubMed Central

    Xiong, Qing; Ma, Biao; Lu, Xiang; Huang, Yi-Hua; He, Si-Jie; Yang, Chao; Yin, Cui-Cui; Zhou, Yang; Wang, Wen-Sheng; Li, Zhi-Kang; Chen, Shou-Yi

    2017-01-01

    Elongation of the mesocotyl and coleoptile facilitates the emergence of rice (Oryza sativa) seedlings from soil and is affected by various genetic and environment factors. The regulatory mechanism underlying this process remains largely unclear. Here, we examined the regulation of mesocotyl and coleoptile growth by characterizing a gaoyao1 (gy1) mutant that exhibits a longer mesocotyl and longer coleoptile than its original variety of rice. GY1 was identified through map-based cloning and encodes a PLA1-type phospholipase that localizes in chloroplasts. GY1 functions at the initial step of jasmonic acid (JA) biosynthesis to repress mesocotyl and coleoptile elongation in etiolated rice seedlings. Ethylene inhibits the expression of GY1 and other genes in the JA biosynthesis pathway to reduce JA levels and enhance mesocotyl and coleoptile growth by promoting cell elongation. Genetically, GY1 acts downstream of the OsEIN2-mediated ethylene signaling pathway to regulate mesocotyl/coleoptile growth. Through analysis of the resequencing data from 3000 rice accessions, we identified a single natural variation of the GY1 gene, GY1376T, which contributes to mesocotyl elongation in rice varieties. Our study reveals novel insights into the regulatory mechanism of mesocotyl/coleoptile elongation and should have practical applications in rice breeding programs. PMID:28465411

  6. Interfacial mechanisms of heterogeneous Fenton reactions catalyzed by iron-based materials: A review.

    PubMed

    He, Jie; Yang, Xiaofang; Men, Bin; Wang, Dongsheng

    2016-01-01

    The heterogeneous Fenton reaction can generate highly reactive hydroxyl radicals (OH) from reactions between recyclable solid catalysts and H2O2 at acidic or even circumneutral pH. Hence, it can effectively oxidize refractory organics in water or soils and has become a promising environmentally friendly treatment technology. Due to the complex reaction system, the mechanism behind heterogeneous Fenton reactions remains unresolved but fascinating, and is crucial for understanding Fenton chemistry and the development and application of efficient heterogeneous Fenton technologies. Iron-based materials usually possess high catalytic activity, low cost, negligible toxicity and easy recovery, and are a superior type of heterogeneous Fenton catalysts. Therefore, this article reviews the fundamental but important interfacial mechanisms of heterogeneous Fenton reactions catalyzed by iron-based materials. OH, hydroperoxyl radicals/superoxide anions (HO2/O2(-)) and high-valent iron are the three main types of reactive oxygen species (ROS), with different oxidation reactivity and selectivity. Based on the mechanisms of ROS generation, the interfacial mechanisms of heterogeneous Fenton systems can be classified as the homogeneous Fenton mechanism induced by surface-leached iron, the heterogeneous catalysis mechanism, and the heterogeneous reaction-induced homogeneous mechanism. Different heterogeneous Fenton systems catalyzed by characteristic iron-based materials are comprehensively reviewed. Finally, related future research directions are also suggested. Copyright © 2015. Published by Elsevier B.V.

  7. Structure-based Mechanism of CMP-2-keto-3-deoxymanno-octulonic Acid Synthetase

    PubMed Central

    Heyes, Derren J.; Levy, Colin; Lafite, Pierre; Roberts, Ian S.; Goldrick, Marie; Stachulski, Andrew V.; Rossington, Steven B.; Stanford, Deborah; Rigby, Stephen E. J.; Scrutton, Nigel S.; Leys, David

    2009-01-01

    The enzyme CMP-Kdo synthetase (KdsB) catalyzes the addition of 2-keto-3-deoxymanno-octulonic acid (Kdo) to CTP to form CMP-Kdo, a key reaction in the biosynthesis of lipopolysaccharide. The reaction catalyzed by KdsB and the related CMP-acylneuraminate synthase is unique among the sugar-activating enzymes in that the respective sugars are directly coupled to a cytosine monophosphate. Using inhibition studies, in combination with isothermal calorimetry, we show the substrate analogue 2β-deoxy-Kdo to be a potent competitive inhibitor. The ligand-free Escherichia coli KdsB and ternary complex KdsB-CTP-2β-deoxy-Kdo crystal structures reveal that Kdo binding leads to active site closure and repositioning of the CTP phosphates and associated Mg2+ ion (Mg-B). Both ligands occupy conformations compatible with an Sn2-type attack on the α-phosphate by the Kdo 2-hydroxyl group. Based on strong similarity with DNA/RNA polymerases, both in terms of overall chemistry catalyzed as well as active site configuration, we postulate a second Mg2+ ion (Mg-A) is bound by the catalytically competent KdsB-CTP-Kdo ternary complex. Modeling of this complex reveals the Mg-A coordinated to the conserved Asp100 and Asp235 in addition to the CTP α-phosphate and both the Kdo carboxylic and 2-hydroxyl groups. EPR measurements on the Mn2+-substituted ternary complex support this model. We propose the KdsB/CNS sugar-activating enzymes catalyze the formation of activated sugars, such as the abundant CMP-5-N-acetylneuraminic acid, by recruitment of two Mg2+ to the active site. Although each metal ion assists in correct positioning of the substrates and activation of the α-phosphate, Mg-A is responsible for activation of the sugar-hydroxyl group. PMID:19815542

  8. Pathogenesis and pharmacologic treatment of obesity: the role of energy regulatory mechanism.

    PubMed

    Manulu, Mangatas S M; Sutanegara, I N Dwi

    2006-01-01

    Obesity has become a worldwide public health problem affecting millions of people. This is a chronic, stigmatized, and costly disease, rarely curable and is increasing in prevalence to a point today where we define obesity as an epidemic disease that not only in developed but also on developing countries. The pathogenesis of obesity is largely unknown, especially about energy regulatory mechanism that involved wide area of neuroendocrinology that is very interesting but very complex and makes internists "refuse" to learn. Obesity occurs through a longstanding imbalance between energy intake and energy expenditure, influenced by a complex biologic system that regulates appetite and adiposity. Obesity influences the pathogenesis of hypertension, type 2 diabetes, dyslipidemia, kidney, heart, and cerebrovascular disease. It is very wise for every internist to learn the pathogenesis and treatment of this worldwide diseases. Until now, the available treatments, including drugs, are palliative and are effective only while the treatment is being actively used; and besides so many side effects reported.

  9. Basic Aspects of Tumor Cell Fatty Acid-Regulated Signaling and Transcription Factors

    PubMed Central

    Comba, Andrea; Lin, Yi-Hui; Eynard, Aldo Renato; Valentich, Mirta Ana; Fernandez-Zapico, Martin Ernesto; Pasqualini, Marìa Eugenia

    2012-01-01

    This article reviews the current knowledge and experimental research about the mechanisms by which fatty acids and their derivatives control specific gene expression involved during carcinogenesis. Changes in dietary fatty acids, specifically the polyunsaturated fatty acids (PUFAs) of the ω-3 and ω-6 families and some derived eicosanoids from lipoxygenases (LOXs), cyclooxygenases (COXs), and cytochrome P-450 (CYP-450), seem to control the activity of transcription factor families involved in cancer cell proliferation or cell death. Their regulation may be carried out either through direct binding to DNA as peroxisome proliferator–activated receptors (PPARs) or via modulation in an indirect manner of signaling pathway molecules (e.g., protein kinase C [PKC]) and other transcription factors (nuclear factor kappa B [NFκB] and sterol regulatory element binding protein [SREBP]). Knowledge of the mechanisms by which fatty acids control specific gene expression may identify important risk factors for cancer, and provide insight into the development of new therapeutic strategies for a better management of whole-body lipid metabolism. PMID:22048864

  10. General acid-base catalysis mediated by nucleobases in the hairpin ribozyme

    PubMed Central

    Kath-Schorr, Stephanie; Wilson, Timothy J.; Li, Nan-Sheng; Lu, Jun; Piccirilli, Joseph A.; Lilley, David M. J.

    2012-01-01

    The catalytic mechanism by which the hairpin ribozyme accelerates cleavage or ligation of the phosphodiester backbone of RNA has been incompletely understood. There is experimental evidence for an important role for an adenine (A38) and a guanine (G8), and it has been proposed that these act in general acid-base catalysis. In this work we show that a large reduction in cleavage rate on substitution of A38 by purine (A38P) can be reversed by replacement of the 5′-oxygen atom at the scissile phosphate by sulfur (5′-PS), which is a much better leaving group. This is consistent with A38 acting as the general acid in the unmodified ribozyme. The rate of cleavage of the 5′-PS substrate by the A38P ribozyme increases with pH log-linearly, indicative of a requirement for a deprotonated base with a relatively high pKa. On substitution of G8 by diaminopurine, the 5′-PS substrate cleavage rate at first increases with pH and then remains at a plateau, exhibiting an apparent pKa consistent with this nucleotide acting in general base catalysis. Alternative explanations for the pH dependence of hairpin ribozyme reactivity are discussed, from which we conclude that general acid-base catalysis by A38 and G8 is the simplest and most probable explanation consistent with all the experimental data. PMID:22958171

  11. The acid-base resistant zone in three dentin bonding systems.

    PubMed

    Inoue, Go; Nikaido, Toru; Foxton, Richard M; Tagami, Junji

    2009-11-01

    An acid-base resistant zone has been found to exist after acid-base challenge adjacent to the hybrid layer using SEM. The aim of this study was to examine the acid-base resistant zone using three different bonding systems. Dentin disks were applied with three different bonding systems, and then a resin composite was light-cured to make dentin disk sandwiches. After acid-base challenge, the polished surfaces were observed using SEM. For both one- and two-step self-etching primer systems, an acid-base resistant zone was clearly observed adjacent to the hybrid layer - but with differing appearances. For the wet bonding system, the presence of an acid-base resistant zone was unclear. This was because the self-etching primer systems etched the dentin surface mildly, such that the remaining mineral phase of dentin and the bonding agent yielded clear acid-base resistant zones. In conclusion, the acid-base resistant zone was clearly observed when self-etching primer systems were used, but not so for the wet bonding system.

  12. Evaluation of modeled cloud chemistry mechanism against laboratory irradiation experiments: The HxOy/iron/carboxylic acid chemical system

    NASA Astrophysics Data System (ADS)

    Long, Yoann; Charbouillot, Tiffany; Brigante, Marcello; Mailhot, Gilles; Delort, Anne-Marie; Chaumerliac, Nadine; Deguillaume, Laurent

    2013-10-01

    Currently, cloud chemistry models are including more detailed and explicit multiphase mechanisms based on laboratory experiments that determine such values as kinetic constants, stability constants of complexes and hydration constants. However, these models are still subject to many uncertainties related to the aqueous chemical mechanism they used. Particularly, the role of oxidants such as iron and hydrogen peroxide in the oxidative capacity of the cloud aqueous phase has typically never been validated against laboratory experimental data. To fill this gap, we adapted the M2C2 model (Model of Multiphase Cloud Chemistry) to simulate irradiation experiments on synthetic aqueous solutions under controlled conditions (e.g., pH, temperature, light intensity) and for actual cloud water samples. Various chemical compounds that purportedly contribute to the oxidative budget in cloud water (i.e., iron, oxidants, such as hydrogen peroxide: H2O2) were considered. Organic compounds (oxalic, formic and acetic acids) were taken into account as target species because they have the potential to form iron complexes and are good indicators of the oxidative capacity of the cloud aqueous phase via their oxidation in this medium. The range of concentrations for all of the chemical compounds evaluated was representative of in situ measurements. Numerical outputs were compared with experimental data that consisted of a time evolution of the concentrations of the target species. The chemical mechanism in the model describing the “oxidative engine” of the HxOy/iron (HxOy = H2O2, HO2rad /O2rad - and HOrad ) chemical system was consistent with laboratory measurements. Thus, the degradation of the carboxylic acids evaluated was closely reproduced by the model. However, photolysis of the Fe(C2O4)+ complex needs to be considered in cloud chemistry models for polluted conditions (i.e., acidic pH) to correctly reproduce oxalic acid degradation. We also show that iron and formic acid lead to

  13. Integrated magnetic tweezers and single-molecule FRET for investigating the mechanical properties of nucleic acid.

    PubMed

    Long, Xi; Parks, Joseph W; Stone, Michael D

    2016-08-01

    Many enzymes promote structural changes in their nucleic acid substrates via application of piconewton forces over nanometer length scales. Magnetic tweezers (MT) is a single molecule force spectroscopy method widely used for studying the energetics of such mechanical processes. MT permits stable application of a wide range of forces and torques over long time scales with nanometer spatial resolution. However, in any force spectroscopy experiment, the ability to monitor structural changes in nucleic acids with nanometer sensitivity requires the system of interest to be held under high degrees of tension to improve signal to noise. This limitation prohibits measurement of structural changes within nucleic acids under physiologically relevant conditions of low stretching forces. To overcome this challenge, researchers have integrated a spatially sensitive fluorescence spectroscopy method, single molecule-FRET, with MT to allow simultaneous observation and manipulation of nanoscale structural transitions over a wide range of forces. Here, we describe a method for using this hybrid instrument to analyze the mechanical properties of nucleic acids. We expect that this method for analysis of nucleic acid structure will be easily adapted for experiments aiming to interrogate the mechanical responses of other biological macromolecules. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Ammonia Transporters and Their Role in Acid-Base Balance

    PubMed Central

    2017-01-01

    Acid-base homeostasis is critical to maintenance of normal health. Renal ammonia excretion is the quantitatively predominant component of renal net acid excretion, both under basal conditions and in response to acid-base disturbances. Although titratable acid excretion also contributes to renal net acid excretion, the quantitative contribution of titratable acid excretion is less than that of ammonia under basal conditions and is only a minor component of the adaptive response to acid-base disturbances. In contrast to other urinary solutes, ammonia is produced in the kidney and then is selectively transported either into the urine or the renal vein. The proportion of ammonia that the kidney produces that is excreted in the urine varies dramatically in response to physiological stimuli, and only urinary ammonia excretion contributes to acid-base homeostasis. As a result, selective and regulated renal ammonia transport by renal epithelial cells is central to acid-base homeostasis. Both molecular forms of ammonia, NH3 and NH4+, are transported by specific proteins, and regulation of these transport processes determines the eventual fate of the ammonia produced. In this review, we discuss these issues, and then discuss in detail the specific proteins involved in renal epithelial cell ammonia transport. PMID:28151423

  15. Multiple functions of the crustacean gill: osmotic/ionic regulation, acid-base balance, ammonia excretion, and bioaccumulation of toxic metals

    PubMed Central

    Henry, Raymond P.; Lucu, Čedomil; Onken, Horst; Weihrauch, Dirk

    2012-01-01

    The crustacean gill is a multi-functional organ, and it is the site of a number of physiological processes, including ion transport, which is the basis for hemolymph osmoregulation; acid-base balance; and ammonia excretion. The gill is also the site by which many toxic metals are taken up by aquatic crustaceans, and thus it plays an important role in the toxicology of these species. This review provides a comprehensive overview of the ecology, physiology, biochemistry, and molecular biology of the mechanisms of osmotic and ionic regulation performed by the gill. The current concepts of the mechanisms of ion transport, the structural, biochemical, and molecular bases of systemic physiology, and the history of their development are discussed. The relationship between branchial ion transport and hemolymph acid-base regulation is also treated. In addition, the mechanisms of ammonia transport and excretion across the gill are discussed. And finally, the toxicology of heavy metal accumulation via the gill is reviewed in detail. PMID:23162474

  16. [Research update of effectiveness and mechanism of essential fatty acids in treating dry eye].

    PubMed

    Liu, Y; Liang, Q F

    2017-03-11

    Topical anti-inflammatory therapy has become the significant way of treating dry eye so far. However, as the long-term use of routine anti-inflammatory medications are restricted from their side effects, it is inevitable to explore safer and more effective alternatives. Essential fatty acids have proven to be anti-inflammatory systemically, which makes it possible to treat dry eye. Clinical trials have demonstrated that supplementation with either ω-3 or ω-6 essential fatty acids or both has multifactorial efficacies including improvement of subjective symptoms, alleviation of inflammation of ocular surface and eyelid margin, prolongation of tear break-up time and increase of tear flow secretion. Besides anti-inflammation effects, several basic researches have revealed that other mechanisms of essential fatty acids treating dry eye might lie in the corneal epithelial healing and tear secretion promotion. This review puts emphasis on the effectiveness, feasibility and mechanism of treating dry eye with essential fatty acids. (Chin J Ophthalmol, 2017, 53: 225-229) .

  17. The unit event of sliding of the chemo-mechanical enzyme composed of myosin and actin with regulatory proteins.

    PubMed

    Oosawa, Fumio

    2008-04-25

    Various myosin-actin systems do not always show the same sliding behaviors. To make the situation clear, discussions are concentrated on the unit event of sliding of the chemo-mechanical enzyme composed of a single myosin head and a single actin filament with regulatory proteins. The popular idea of the one-to-one correspondence between the chemical state and the physical state or between the chemical reaction step and the physical conformational change is reexamined. It is likely that the sites and the modes of interaction between myosin head and actin filament during the ATP hydrolysis are more multiple and variable, and the input-output coupling in the chemo-mechanical enzyme is loose.

  18. RNA-based regulation of genes of tryptophan synthesis and degradation, in bacteria

    PubMed Central

    Yanofsky, Charles

    2007-01-01

    We are now aware that RNA-based regulatory mechanisms are commonly used to control gene expression in many organisms. These mechanisms offer the opportunity to exploit relatively short, unique RNA sequences, in altering transcription, translation, and/or mRNA stability, in response to the presence of a small or large signal molecule. The ability of an RNA segment to fold and form alternative hairpin secondary structures—each dedicated to a different regulatory function—permits selection of specific sequences that can affect transcription and/or translation. In the present paper I will focus on our current understanding of the RNA-based regulatory mechanisms used by Escherichia coli and Bacillus subtilis in controlling expression of the tryptophan biosynthetic operon. The regulatory mechanisms they use for this purpose differ, suggesting that these organisms, or their ancestors, adopted different strategies during their evolution. I will also describe the RNA-based mechanism used by E. coli in regulating expression of its operon responsible for tryptophan degradation, the tryptophanase operon. PMID:17601995

  19. Uncovering MicroRNA and Transcription Factor Mediated Regulatory Networks in Glioblastoma

    PubMed Central

    Sun, Jingchun; Gong, Xue; Purow, Benjamin; Zhao, Zhongming

    2012-01-01

    Glioblastoma multiforme (GBM) is the most common and lethal brain tumor in humans. Recent studies revealed that patterns of microRNA (miRNA) expression in GBM tissue samples are different from those in normal brain tissues, suggesting that a number of miRNAs play critical roles in the pathogenesis of GBM. However, little is yet known about which miRNAs play central roles in the pathology of GBM and their regulatory mechanisms of action. To address this issue, in this study, we systematically explored the main regulation format (feed-forward loops, FFLs) consisting of miRNAs, transcription factors (TFs) and their impacting GBM-related genes, and developed a computational approach to construct a miRNA-TF regulatory network. First, we compiled GBM-related miRNAs, GBM-related genes, and known human TFs. We then identified 1,128 3-node FFLs and 805 4-node FFLs with statistical significance. By merging these FFLs together, we constructed a comprehensive GBM-specific miRNA-TF mediated regulatory network. Then, from the network, we extracted a composite GBM-specific regulatory network. To illustrate the GBM-specific regulatory network is promising for identification of critical miRNA components, we specifically examined a Notch signaling pathway subnetwork. Our follow up topological and functional analyses of the subnetwork revealed that six miRNAs (miR-124, miR-137, miR-219-5p, miR-34a, miR-9, and miR-92b) might play important roles in GBM, including some results that are supported by previous studies. In this study, we have developed a computational framework to construct a miRNA-TF regulatory network and generated the first miRNA-TF regulatory network for GBM, providing a valuable resource for further understanding the complex regulatory mechanisms in GBM. The observation of critical miRNAs in the Notch signaling pathway, with partial verification from previous studies, demonstrates that our network-based approach is promising for the identification of new and important

  20. The acid-base titration of montmorillonite

    NASA Astrophysics Data System (ADS)

    Bourg, I. C.; Sposito, G.; Bourg, A. C.

    2003-12-01

    Proton binding to clay minerals plays an important role in the chemical reactivity of soils (e.g., acidification, retention of nutrients or pollutants). If should also affect the performance of clay barriers for waste disposal. The surface acidity of clay minerals is commonly modelled empirically by assuming generic amphoteric surface sites (>SOH) on a flat surface, with fitted site densities and acidity constant. Current advances in experimental methods (notably spectroscopy) are rapidly improving our understanding of the structure and reactivity of the surface of clay minerals (arrangement of the particles, nature of the reactive surface sites, adsorption mechanisms). These developments are motivated by the difficulty of modelling the surface chemistry of mineral surfaces at the macro-scale (e.g., adsorption or titration) without a detailed (molecular-scale) picture of the mechanisms, and should be progressively incorporated into surface complexation models. In this view, we have combined recent estimates of montmorillonite surface properties (surface site density and structure, edge surface area, surface electrostatic potential) with surface site acidities obtained from the titration of alpha-Al2O3 and SiO2, and a novel method of accounting for the unknown initial net proton surface charge of the solid. The model predictions were compared to experimental titrations of SWy-1 montmorillonite and purified MX-80 bentonite in 0.1-0.5 mol/L NaClO4 and 0.005-0.5 mol/L NaNO3 background electrolytes, respectively. Most of the experimental data were appropriately described by the model after we adjusted a single parameter (silanol sites on the surface of montmorillonite were made to be slightly more acidic than those of silica). At low ionic strength and acidic pH the model underestimated the buffering capacity of the montmorillonite, perhaps due to clay swelling or to the interlayer adsorption of dissolved aluminum. The agreement between our model and the experimental

  1. Mouse regulatory DNA landscapes reveal global principles of cis-regulatory evolution.

    PubMed

    Vierstra, Jeff; Rynes, Eric; Sandstrom, Richard; Zhang, Miaohua; Canfield, Theresa; Hansen, R Scott; Stehling-Sun, Sandra; Sabo, Peter J; Byron, Rachel; Humbert, Richard; Thurman, Robert E; Johnson, Audra K; Vong, Shinny; Lee, Kristen; Bates, Daniel; Neri, Fidencio; Diegel, Morgan; Giste, Erika; Haugen, Eric; Dunn, Douglas; Wilken, Matthew S; Josefowicz, Steven; Samstein, Robert; Chang, Kai-Hsin; Eichler, Evan E; De Bruijn, Marella; Reh, Thomas A; Skoultchi, Arthur; Rudensky, Alexander; Orkin, Stuart H; Papayannopoulou, Thalia; Treuting, Piper M; Selleri, Licia; Kaul, Rajinder; Groudine, Mark; Bender, M A; Stamatoyannopoulos, John A

    2014-11-21

    To study the evolutionary dynamics of regulatory DNA, we mapped >1.3 million deoxyribonuclease I-hypersensitive sites (DHSs) in 45 mouse cell and tissue types, and systematically compared these with human DHS maps from orthologous compartments. We found that the mouse and human genomes have undergone extensive cis-regulatory rewiring that combines branch-specific evolutionary innovation and loss with widespread repurposing of conserved DHSs to alternative cell fates, and that this process is mediated by turnover of transcription factor (TF) recognition elements. Despite pervasive evolutionary remodeling of the location and content of individual cis-regulatory regions, within orthologous mouse and human cell types the global fraction of regulatory DNA bases encoding recognition sites for each TF has been strictly conserved. Our findings provide new insights into the evolutionary forces shaping mammalian regulatory DNA landscapes. Copyright © 2014, American Association for the Advancement of Science.

  2. Psychological entitlement and abusive supervision: political skill as a self-regulatory mechanism.

    PubMed

    Whitman, Marilyn V; Halbesleben, Jonathon R B; Shanine, Kristen K

    2013-01-01

    Abusive supervision in the workplace is steadily increasing. Such behavior has been linked to a host of negative individual and organizational consequences. In a health care environment particularly, such behavior can have detrimental effects. This study advances self-regulation theory by framing the entitlement-abusive supervision relationship in terms of a motive to obtain resources via a behavior that is not socially sanctioned. Furthermore, we argue that political skill serves as a self-regulating mechanism that reduces the motivation to secure personal resources through abusive behavior. Our hypotheses were tested using a sample of nurses and their supervisors who were asked to complete a survey. A final sample of 132 supervisor-subordinate dyads was obtained. Analysis suggests that supervisors high in psychological entitlement are more likely to be perceived by their subordinates as abusive. Political skill, however, moderated this relationship by serving as a regulatory mechanism that thwarts entitled supervisors from engaging in abusive behaviors. Our findings underscore the common concern that entitlement and abuse can be harmful for organizations. Entitled supervisors who are high in political skill may recognize that engaging in less aggressive influence behaviors may be more effective in achieving self-serving motives. Consequently, health care organizations need to be proactive in order to reduce entitlement and prevent abusive behaviors in the workplace.

  3. Structure reveals regulatory mechanisms of a MaoC-like hydratase from Phytophthora capsici involved in biosynthesis of polyhydroxyalkanoates (PHAs).

    PubMed

    Wang, Huizheng; Zhang, Kai; Zhu, Jie; Song, Weiwei; Zhao, Li; Zhang, Xiuguo

    2013-01-01

    Polyhydroxyalkanoates (PHAs) have attracted increasing attention as "green plastic" due to their biodegradable, biocompatible, thermoplastic, and mechanical properties, and considerable research has been undertaken to develop low cost/high efficiency processes for the production of PHAs. MaoC-like hydratase (MaoC), which belongs to (R)-hydratase involved in linking the β-oxidation and the PHA biosynthetic pathways, has been identified recently. Understanding the regulatory mechanisms of (R)-hydratase catalysis is critical for efficient production of PHAs that promise synthesis an environment-friendly plastic. We have determined the crystal structure of a new MaoC recognized from Phytophthora capsici. The crystal structure of the enzyme was solved at 2.00 Å resolution. The structure shows that MaoC has a canonical (R)-hydratase fold with an N-domain and a C-domain. Supporting its dimerization observed in structure, MaoC forms a stable homodimer in solution. Mutations that disrupt the dimeric MaoC result in a complete loss of activity toward crotonyl-CoA, indicating that dimerization is required for the enzymatic activity of MaoC. Importantly, structure comparison reveals that a loop unique to MaoC interacts with an α-helix that harbors the catalytic residues of MaoC. Deletion of the loop enhances the enzymatic activity of MaoC, suggesting its inhibitory role in regulating the activity of MaoC. The data in our study reveal the regulatory mechanism of an (R)-hydratase, providing information on enzyme engineering to produce low cost PHAs.

  4. Polymeric nucleic acid vehicles exploit active interorganelle trafficking mechanisms.

    PubMed

    Fichter, Katye M; Ingle, Nilesh P; McLendon, Patrick M; Reineke, Theresa M

    2013-01-22

    Materials that self-assemble with nucleic acids into nanocomplexes (e.g. polyplexes) are widely used in many fundamental biological and biomedical experiments. However, understanding the intracellular transport mechanisms of these vehicles remains a major hurdle in their effective usage. Here, we investigate two polycation models, Glycofect (which slowly degrades via hydrolysis) and linear polyethyleneimine (PEI) (which does not rapidly hydrolyze), to determine the impact of polymeric structure on intracellular trafficking. Cells transfected using Glycofect underwent increasing transgene expression over the course of 40 h and remained benign over the course of 7 days. Transgene expression in cells transfected with PEI peaked at 16 h post-transfection and resulted in less than 10% survival after 7 days. While saccharide-containing Glycofect has a higher buffering capacity than PEI, polyplexes created with Glycofect demonstrate more sustained endosomal release, possibly suggesting an additional or alternative delivery mechanism to the classical "proton sponge mechanism". PEI appeared to promote release of DNA from acidic organelles more than Glycofect. Immunofluorescence images indicate that both Glycofect and linear PEI traffic oligodeoxynucleotides to the Golgi and endoplasmic reticulum, which may be a route towards nuclear delivery. However, Glycofect polyplexes demonstrated higher co-localization with the ER than PEI polyplexes, and co-localization experiments indicate the retrograde transport of polyplexes via COP I vesicles from the Golgi to the ER. We conclude that slow release and unique trafficking behaviors of Glycofect polyplexes may be due to the presence of saccharide units and the degradable nature of the polymer, allowing more efficacious and benign delivery.

  5. The mechanism of improved intracellular organic selenium and glutathione contents in selenium-enriched Candida utilis by acid stress.

    PubMed

    Zhang, Gao-Chuan; Wang, Da-Hui; Wang, Dong-Hua; Wei, Gong-Yuan

    2017-03-01

    Batch culture of Candida utilis CCTCC M 209298 for the preparation of selenium (Se)-enriched yeast was carried out under different pH conditions, and maximal intracellular organic Se and glutathione (GSH) contents were obtained in a moderate acid stress environment (pH 3.5). In order to elucidate the physiological mechanism of improved performance of Se-enriched yeast by acid stress, assays of the key enzymes involved in GSH biosynthesis and determinations of energy supply and regeneration were performed. The results indicated that moderate acid stress increased the activity of γ-glutamylcysteine synthetase and the ratios of NADH/NAD + and ATP/ADP, although no significant changes in intracellular pH were observed. In addition, the molecular mechanism of moderate acid stress favoring the improvement of Se-yeast performance was revealed by comparing whole transcriptomes of yeast cells cultured at pH 3.5 and 5.5. Comparative analysis of RNA-Seq data indicated that 882 genes were significantly up-regulated by moderate acid stress. Functional annotation of the up-regulated genes based on gene ontology and the Kyoto Encyclopedia of Genes and Genome (KEGG) pathway showed that these genes are involved in ATP synthesis and sulfur metabolism, including the biosynthesis of methionine, cysteine, and GSH in yeast cells. Increased intracellular ATP supply and more amounts of sulfur-containing substances in turn contributed to Na 2 SeO 3 assimilation and biotransformation, which ultimately improved the performance of the Se-enriched C. utilis.

  6. Kinetic Reaction Mechanism of Sinapic Acid Scavenging NO2 and OH Radicals: A Theoretical Study

    PubMed Central

    Lu, Yang; Wang, AiHua; Shi, Peng; Zhang, Hui; Li, ZeSheng

    2016-01-01

    The mechanism and kinetics underlying reactions between the naturally-occurring antioxidant sinapic acid (SA) and the very damaging ·NO2 and ·OH were investigated through the density functional theory (DFT). Two most possible reaction mechanisms were studied: hydrogen atom transfer (HAT) and radical adduct formation (RAF). Different reaction channels of neutral and anionic sinapic acid (SA-) scavenging radicals in both atmosphere and water medium were traced independently, and the thermodynamic and kinetic parameters were calculated. We find the most active site of SA/SA- scavenging ·NO2 and ·OH is the –OH group in benzene ring by HAT mechanism, while the RAF mechanism for SA/SA- scavenging ·NO2 seems thermodynamically unfavorable. In water phase, at 298 K, the total rate constants of SA eliminating ·NO2 and ·OH are 1.30×108 and 9.20×109 M-1 S-1 respectively, indicating that sinapic acid is an efficient scavenger for both ·NO2 and ·OH. PMID:27622460

  7. The lack of foundation in the mechanism on which are based the physico-chemical theories for the origin of the genetic code is counterposed to the credible and natural mechanism suggested by the coevolution theory.

    PubMed

    Di Giulio, Massimo

    2016-06-21

    I analyze the mechanism on which are based the majority of theories that put to the center of the origin of the genetic code the physico-chemical properties of amino acids. As this mechanism is based on excessive mutational steps, I conclude that it could not have been operative or if operative it would not have allowed a full realization of predictions of these theories, because this mechanism contained, evidently, a high indeterminacy. I make that disapproving the four-column theory of the origin of the genetic code (Higgs, 2009) and reply to the criticism that was directed towards the coevolution theory of the origin of the genetic code. In this context, I suggest a new hypothesis that clarifies the mechanism by which the domains of codons of the precursor amino acids would have evolved, as predicted by the coevolution theory. This mechanism would have used particular elongation factors that would have constrained the evolution of all amino acids belonging to a given biosynthetic family to the progenitor pre-tRNA, that for first recognized, the first codons that evolved in a certain codon domain of a determined precursor amino acid. This happened because the elongation factors recognized two characteristics of the progenitor pre-tRNAs of precursor amino acids, which prevented the elongation factors from recognizing the pre-tRNAs belonging to biosynthetic families of different precursor amino acids. Finally, I analyze by means of Fisher's exact test, the distribution, within the genetic code, of the biosynthetic classes of amino acids and the ones of polarity values of amino acids. This analysis would seem to support the biosynthetic classes of amino acids over the ones of polarity values, as the main factor that led to the structuring of the genetic code, with the physico-chemical properties of amino acids playing only a subsidiary role in this evolution. As a whole, the full analysis brings to the conclusion that the coevolution theory of the origin of the

  8. Paper-based electroanalytical devices for in situ determination of salicylic acid in living tomato leaves.

    PubMed

    Sun, Li-Jun; Feng, Qiu-Mei; Yan, Yong-Feng; Pan, Zhong-Qin; Li, Xiao-Hui; Song, Feng-Ming; Yang, Haibing; Xu, Jing-Juan; Bao, Ning; Gu, Hai-Ying

    2014-10-15

    Detection of phytohormones in situ has gained significant attention due to their critical roles in regulating developmental processes and signaling for defenses in plants at low concentration. As one type of plant hormones, salicylic acid has recently been found to be one of pivotal signal molecules for physiological behaviors of plants. Here we report the application of paper-based electroanalytical devices for sensitively in situ detection of salicylic acid in tomato leaves with the sample volume of several microliters. Specifically, disposable working electrodes were fabricated by coating carbon tape with the mixture of multiwall carbon nanotubes and nafion. We observed that the treatment of the modified carbon tape electrodes with oxygen plasma could significantly improve electrochemical responses of salicylic acid. The tomato leaves had a punched hole of 1.5mm diameter to release salicylic acid with minor influence on continuous growth of tomatoes. By incorporating the tomato leaf with the paper-based analytical device, we were able to perform in situ determination of salicylic acid based on its electrocatalytic oxidation. Our experimental results demonstrated that the amounts of salicylic acid differed statistically in normal, phytoene desaturase (PDS) gene silent and diseased (infected by Botrytis cinerea) tomato leaves. By quantifying salicylic acid at the level of several nanograms in situ, the simple paper-based electroanalytical devices could potentially facilitate the study of defense mechanism of plants under biotic and abiotic stresses. This study might also provide a sensitive method with spatiotemporal resolution for mapping of chemicals released from living organisms. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Preparation and Optimization of Amorphous Ursodeoxycholic Acid Nano-suspensions by Nanoprecipitation based on Acid-base Neutralization for Enhanced Dissolution.

    PubMed

    Xie, Yike; Chen, Zhongjian; Su, Rui; Li, Ye; Qi, Jianping; Wu, Wei; Lu, Yi

    2017-01-01

    Ursodeoxycholic acid, usually used to dissolve cholesterol gallstones in clinic, is a typical hydrophobic drug with poor oral bioavailability due to dissolution rate-limited performance. The objective of this study was to increase the dissolution of ursodeoxycholic acid by amorphous nanosuspensions. Nanoprecipitation based on acid-base neutralization was used to prepare the nanosuspensions with central composite design to optimize the formula. The nanosuspensions were characterized by particle size, morphology, crystallology and dissolution. The ursodeoxycholic acid nanosuspensions showed mean particle size around 380 nm with polydispersion index value about 0.25. Scanning electron microscope observed high coverage of HPMC-E50 onto the surface of the nanosuspensions. Differential scanning calorimetry and powder X-ray diffractometry revealed amorphous structure of the ursodeoxycholic acid nanosuspensions. A significant increase of dissolution in acidic media was achieved by the amorphous nanosuspensions compared with the physical mixture. It can be predicted that the amorphous nanosuspensions show great potential in improving the oral bioavailability of ursodeoxycholic acid. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  10. Enhancing gene regulatory network inference through data integration with markov random fields

    DOE PAGES

    Banf, Michael; Rhee, Seung Y.

    2017-02-01

    Here, a gene regulatory network links transcription factors to their target genes and represents a map of transcriptional regulation. Much progress has been made in deciphering gene regulatory networks computationally. However, gene regulatory network inference for most eukaryotic organisms remain challenging. To improve the accuracy of gene regulatory network inference and facilitate candidate selection for experimentation, we developed an algorithm called GRACE (Gene Regulatory network inference ACcuracy Enhancement). GRACE exploits biological a priori and heterogeneous data integration to generate high- confidence network predictions for eukaryotic organisms using Markov Random Fields in a semi-supervised fashion. GRACE uses a novel optimization schememore » to integrate regulatory evidence and biological relevance. It is particularly suited for model learning with sparse regulatory gold standard data. We show GRACE’s potential to produce high confidence regulatory networks compared to state of the art approaches using Drosophila melanogaster and Arabidopsis thaliana data. In an A. thaliana developmental gene regulatory network, GRACE recovers cell cycle related regulatory mechanisms and further hypothesizes several novel regulatory links, including a putative control mechanism of vascular structure formation due to modifications in cell proliferation.« less

  11. Enhancing gene regulatory network inference through data integration with markov random fields

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Banf, Michael; Rhee, Seung Y.

    Here, a gene regulatory network links transcription factors to their target genes and represents a map of transcriptional regulation. Much progress has been made in deciphering gene regulatory networks computationally. However, gene regulatory network inference for most eukaryotic organisms remain challenging. To improve the accuracy of gene regulatory network inference and facilitate candidate selection for experimentation, we developed an algorithm called GRACE (Gene Regulatory network inference ACcuracy Enhancement). GRACE exploits biological a priori and heterogeneous data integration to generate high- confidence network predictions for eukaryotic organisms using Markov Random Fields in a semi-supervised fashion. GRACE uses a novel optimization schememore » to integrate regulatory evidence and biological relevance. It is particularly suited for model learning with sparse regulatory gold standard data. We show GRACE’s potential to produce high confidence regulatory networks compared to state of the art approaches using Drosophila melanogaster and Arabidopsis thaliana data. In an A. thaliana developmental gene regulatory network, GRACE recovers cell cycle related regulatory mechanisms and further hypothesizes several novel regulatory links, including a putative control mechanism of vascular structure formation due to modifications in cell proliferation.« less

  12. Regulatory T cells ameliorate tissue plasminogen activator-induced brain haemorrhage after stroke.

    PubMed

    Mao, Leilei; Li, Peiying; Zhu, Wen; Cai, Wei; Liu, Zongjian; Wang, Yanling; Luo, Wenli; Stetler, Ruth A; Leak, Rehana K; Yu, Weifeng; Gao, Yanqin; Chen, Jun; Chen, Gang; Hu, Xiaoming

    2017-07-01

    studies demonstrated that regulatory T cells completely abolished the tPA-induced elevation of MMP9 and CCL2 after stroke. Using MMP9 and CCL2 knockout mice, we discovered that both molecules partially contributed to the protective actions of regulatory T cells. In an in vitro endothelial cell-based model of the blood-brain barrier, we confirmed that regulatory T cells inhibited tPA-induced endothelial expression of CCL2 and preserved blood-brain barrier integrity after an ischaemic challenge. Lentivirus-mediated CCL2 knockdown in endothelial cells completely abolished the blood-brain barrier protective effect of regulatory T cells in vitro. Altogether, our studies suggest that regulatory T cell adoptive transfer may alleviate thrombolytic treatment-induced haemorrhage in stroke victims. Furthermore, regulatory T cell-afforded protection in the tPA-treated stroke model is mediated by two inhibitory mechanisms involving CCL2 and MMP9. Thus, regulatory T cell adoptive transfer may be useful as a cell-based therapy to improve the efficacy and safety of thrombolytic treatment for ischaemic stroke. © The Author (2017). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. Mechanism underlying the suppressor activity of retinoic acid on IL4-induced IgE synthesis and its physiological implication.

    PubMed

    Seo, Goo-Young; Lee, Jeong-Min; Jang, Young-Saeng; Kang, Seung Goo; Yoon, Sung-Il; Ko, Hyun-Jeong; Lee, Geun-Shik; Park, Seok-Rae; Nagler, Cathryn R; Kim, Pyeung-Hyeun

    2017-12-01

    The present study extends an earlier report that retinoic acid (RA) down-regulates IgE Ab synthesis in vitro. Here, we show the suppressive activity of RA on IgE production in vivo and its underlying mechanisms. We found that RA down-regulated IgE class switching recombination (CSR) mainly through RA receptor α (RARα). Additionally, RA inhibited histone acetylation of germ-line ε (GL ε) promoter, leading to suppression of IgE CSR. Consistently, serum IgE levels were substantially elevated in vitamin A-deficient (VAD) mice and this was more dramatic in VAD-lecithin:retinol acyltransferase deficient (LRAT -/- ) mice. Further, serum mouse mast cell protease-1 (mMCP-1) level was elevated while frequency of intestinal regulatory T cells (Tregs) were diminished in VAD LRAT -/- mice, reflecting that deprivation of RA leads to allergic immune response. Taken together, our results reveal that RA has an IgE-repressive activity in vivo, which may ameliorate IgE-mediated allergic disease. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Response of Fe-S cluster assembly machinery of Escherichia coli to mechanical stress in a model of amino-acid crystal fermentation.

    PubMed

    Okutani, Satoshi; Iwai, Takayoshi; Iwatani, Shintaro; Matsuno, Kiyoshi; Takahashi, Yasuhiro; Hase, Toshiharu

    2015-09-01

    During amino-acid crystal fermentation, mechanical stress on bacterial cells caused by crystal collision often impacts negatively on bacterial growth and amino-acid production. When Escherichia coli cells were cultivated under mechanical stress of polyvinyl chloride particles as a model of the crystal fermentation, activities of iron-sulfur (Fe-S) cluster-containing enzymes were apparently decreased. Based on an assumption that function of Fe-S cluster assembly machinery would be elevated to recover the enzyme activities in such stressed cells, we analyzed levels of various components of Fe-S cluster assembly machinery by western blotting. It was found that the expression of HscA, a chaperon component of the machinery, was up-regulated and that shorter forms of HscA with the N-terminal region truncated were accumulated, suggesting an important role of HscA against the mechanical stress. An overexpression of HscA gene in E. coli cells gave a positive effect on rescue of the stress-induced decrease of the activity of Fe-S cluster-containing enzyme. These results may provide a new strategy to alleviate the mechanical stress during the amino-acid crystal fermentation. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  15. Acid generation mechanism in anion-bound chemically amplified resists used for extreme ultraviolet lithography

    NASA Astrophysics Data System (ADS)

    Komuro, Yoshitaka; Yamamoto, Hiroki; Kobayashi, Kazuo; Utsumi, Yoshiyuki; Ohomori, Katsumi; Kozawa, Takahiro

    2014-11-01

    Extreme ultraviolet (EUV) lithography is the most promising candidate for the high-volume production of semiconductor devices with half-pitches of sub-10 nm. An anion-bound polymer (ABP), in which the anion part of onium salts is polymerized, has attracted much attention from the viewpoint of the control of acid diffusion. In this study, the acid generation mechanism in ABP films was investigated using electron (pulse), γ, and EUV radiolyses. On the basis of experimental results, the acid generation mechanism in anion-bound chemically amplified resists was proposed. The major path for proton generation in the absence of effective proton sources is considered to be the reaction of phenyl radicals with diphenylsulfide radical cations that are produced through hole transfer to the decomposition products of onium salts.

  16. An approach to complex acid-base problems

    PubMed Central

    Herd, Anthony M.

    2005-01-01

    OBJECTIVE To review rules and formulas for solving even the most complex acid-base problems. SOURCES OF INFORMATION MEDLINE was searched from January 1966 to December 2003. The search was limited to English-language review articles involving human subjects. Nine relevant review papers were found and provide the background. As this information is well established and widely accepted, it is not judged for strength of evidence, as is standard practice. MAIN MESSAGE An understanding of the body’s responses to acidemia or alkalemia can be gained through a set of four rules and two formulas that can be used to interpret almost any acid-base problems. Physicians should, however, remember the “golden rule” of acid-base interpretation: always look at a patient’s clinical condition. CONCLUSION Physicians practising in acute care settings commonly encounter acid-base disturbances. While some of these are relatively simple and easy to interpret, some are more complex. Even complex cases can be resolved using the four rules and two formulas. PMID:15751566

  17. Autoantibodies against aromatic amino acid hydroxylases in patients with autoimmune polyendocrine syndrome type 1 target multiple antigenic determinants and reveal regulatory regions crucial for enzymatic activity.

    PubMed

    Bratland, Eirik; Magitta, Ng'weina Francis; Bøe Wolff, Anette Susanne; Ekern, Trude; Knappskog, Per Morten; Kämpe, Olle; Haavik, Jan; Husebye, Eystein Sverre

    2013-06-01

    Patients with autoimmune polyendocrine syndrome type 1 (APS-1) frequently have autoantibodies directed against the aromatic amino acid hydroxylases tryptophan hydroxylase (TPH) and tyrosine hydroxylase (TH). We aimed to characterize these autoantibodies with regard to their antigenic determinants, their influence on enzymatic activity and their clinical associations. In particular, we wanted to compare autoantibodies against the two different isoforms of TPH, which display different tissue distribution. Using sera from 48 Scandinavian APS-1 patients we identified 36 patients (75%) with antibodies against one or more of these three enzymes. Antibodies against TPH1, but not TPH2, were associated with malabsorption in the whole Scandinavian cohort, while TH antibodies were associated with dental enamel hypoplasia in Norwegian patients. Subsequent experiments with selected patient sera indicated that while the C-terminal domain was the immunodominant part of TPH1, the epitopes of TPH2 and TH were mainly located in the N-terminal regulatory domains. We also identified a TPH1 specific epitope involved in antibody mediated inhibition of enzyme activity, a finding that provides new insight into the enzymatic mechanisms of the aromatic amino acid hydroxylases and knowledge about structural determinants of enzyme autoantigens. In conclusion, TPH1, TPH2 and TH all have unique antigenic properties in spite of their structural similarity. Copyright © 2012 Elsevier GmbH. All rights reserved.

  18. Nucleic acid duplexes incorporating a dissociable covalent base pair

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  19. Nucleic acid duplexes incorporating a dissociable covalent base pair

    PubMed Central

    Gao, Kui; Orgel, Leslie E.

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299

  20. Salicylic acid-induced abiotic stress tolerance and underlying mechanisms in plants

    PubMed Central

    Khan, M. Iqbal R.; Fatma, Mehar; Per, Tasir S.; Anjum, Naser A.; Khan, Nafees A.

    2015-01-01

    Abiotic stresses (such as metals/metalloids, salinity, ozone, UV-B radiation, extreme temperatures, and drought) are among the most challenging threats to agricultural system and economic yield of crop plants. These stresses (in isolation and/or combination) induce numerous adverse effects in plants, impair biochemical/physiological and molecular processes, and eventually cause severe reductions in plant growth, development and overall productivity. Phytohormones have been recognized as a strong tool for sustainably alleviating adverse effects of abiotic stresses in crop plants. In particular, the significance of salicylic acid (SA) has been increasingly recognized in improved plant abiotic stress-tolerance via SA-mediated control of major plant-metabolic processes. However, the basic biochemical/physiological and molecular mechanisms that potentially underpin SA-induced plant-tolerance to major abiotic stresses remain least discussed. Based on recent reports, this paper: (a) overviews historical background and biosynthesis of SA under both optimal and stressful environments in plants; (b) critically appraises the role of SA in plants exposed to major abiotic stresses; (c) cross-talks potential mechanisms potentially governing SA-induced plant abiotic stress-tolerance; and finally (d) briefly highlights major aspects so far unexplored in the current context. PMID:26175738

  1. Using Willie's Acid-Base Box for Blood Gas Analysis

    ERIC Educational Resources Information Center

    Dietz, John R.

    2011-01-01

    In this article, the author describes a method developed by Dr. William T. Lipscomb for teaching blood gas analysis of acid-base status and provides three examples using Willie's acid-base box. Willie's acid-base box is constructed using three of the parameters of standard arterial blood gas analysis: (1) pH; (2) bicarbonate; and (3) CO[subscript…

  2. Students' Alternate Conceptions on Acids and Bases

    ERIC Educational Resources Information Center

    Pan, Hanqing; Henriques, Laura

    2015-01-01

    Knowing what students bring to the classroom can and should influence how we teach them. This study is a review of the literature associated with secondary and postsecondary students' ideas about acids and bases. It was found that there are six types of alternate ideas about acids and bases that students hold. These are: macroscopic properties of…

  3. Novel naproxen/esomeprazole magnesium compound pellets based on acid-independent mechanism: in vitro and in vivo evaluation.

    PubMed

    Lu, Jing; Kan, Shuling; Zhao, Yi; Zhang, Wenli; Liu, Jianping

    2016-09-01

    The purpose of this study was to develop the novel naproxen/esomeprazole magnesium compound pellets (novel-NAP/EMZ) depending on EMZ acid-independent mechanism which has been proved to be predominate in the mechanism of co-therapy with nonsteroidal anti-inflammatory drug. The novel-NAP/EMZ compound pellets, composed of NAP colon-specific pellets (NAP-CSPs) and EMZ modified-release pellets (EMZ-MRPs), were prepared by fluid-bed coating technology with desired in vitro release profiles. The resulting pellets were filled into hard gelatin capsules for in vivo evaluation in rats and compared with the reference compound pellets, consisted of NAP enteric-coated pellets (NAP-ECPs) and EMZ immediate-release pellets (EMZ-IRPs). The reference compound pellets were prepared simulating the drug delivery system of VIMOVO(®). In vivo pharmacokinetics, EMZ-MRPs had significantly larger AUC0-t (p < 0.01), 1.67 times more than that of EMZ-IRPs, and prolonged mean residence time (7.55 ± 0.12 h) than that of IRPs (1.46 ± 0.39 h). NAP-CSPs and NAP-ECPs showed similar AUC0-t. Compared to the reference compound pellets, the novel-NAP/EMZ compound pellets did not show distinct differences in histological mucosal morphology. However, biochemical tests exhibited enhanced total antioxidant capacity, increased nitric oxide content and reduced malondialdehyde level for novel-NAP/EMZ compound pellets, indicating that the acid-independent action took effect. The gastric pH values of novel-NAP/EMZ compound pellets were at a low and stable level, which could ensure normal physiological range of human gastric pH. As a result, the novel-NAP/EMZ compound pellets may be a more suitable formulation with potential advantages by improving bioavailability of drug and further reducing undesirable gastrointestinal damages.

  4. Whey Peptide-Based Formulas With ω-3 Fatty Acids Are Protective in Lipopolysaccharide-Mediated Sepsis.

    PubMed

    Tsutsumi, Rie; Horikawa, Yousuke T; Kume, Katsuyoshi; Tanaka, Katsuya; Kasai, Asuka; Kadota, Takako; Tsutsumi, Yasuo M

    2015-07-01

    Sepsis and septic shock syndrome are among the leading causes of death in critically ill patients. Lipopolysaccharide (LPS) released by bacteria within the colon may translocate across a compromised epithelium, leading to oxidative stress, inflammation, sepsis, and eventually death. We examined the effects of a whey-based enteral formula high in cysteine (antioxidant precursor) and the addition of ω-3 fatty acids, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), against a mouse model of LPS-induced sepsis. Mice were fed either a whey-based diet with EPA-DHA (PAF), a whey-based diet without EPA-DHA (PSTD), or a casein-based control diet (CONT). Mice fed PAF or PSTD were protected against LPS-induced weight loss. Whey-based diets suppressed inflammatory cytokine release and oxidative stress damage. Furthermore, PAF and PSTD were able to inhibit autophagy, a mechanism in which the cell recycles damaged organelles. These anti-inflammatory and antioxidative effects of PSTD and PAF resulted in decreased liver inflammation and intestinal damage and promoted protective microbiota within the intestines. These data suggest a clinical role for whey peptide-based diets in promoting healing and recovery in critically ill patients. © 2014 American Society for Parenteral and Enteral Nutrition.

  5. Hydroxamic acids as weak base indicators: protonation in strong acid media.

    PubMed

    García, B; Ibeas, S; Hoyuelos, F J; Leal, J M; Secco, F; Venturini, M

    2001-11-30

    The protonation equilibria of N-phenylbenzohydroxamic, benzohydroxamic, salicylhydroxamic, and N-p-tolylcinnamohydroxamic acids have been studied at 25 degrees C in concentrated sulfuric, hydrochloric, and perchloric acid media; the UV-vis spectral measurements were analyzed using the Hammett equation and the Bunnett-Olsen and excess acidity methods. The medium effects observed in the UV spectral curves were corrected with the Cox-Yates and vector analysis methods. The H(A) acidity function based on benzamides provided the best results. The range of variation of the solvation coefficient m is similar to that of amides, this indicating similar solvation requirements for amides and hydroxamic acids. For the same substrate, the observed variations of pK(BH)(+) with the mineral acid used was justified by formation of solvent-separated ion pairs; for the same mineral acid, the observed changes in pK(BH)(+) can be explained by the solvation of BH(+). The change of the pK(BH)(+) values was in reasonably good agreement with the sequence of the catalytic efficiency of the mineral acids used, HCl > H(2)SO(4) > HClO(4).

  6. A fundamental approach to adhesion: Synthesis, surface analysis, thermodynamics and mechanics. [acid-base properties of titanium 6-4 surfaces

    NASA Technical Reports Server (NTRS)

    Siriwardane, R.; Wightman, J. P.

    1980-01-01

    The acid-base properties of titanium 6-4 plates (low surface area) were investigated after three different pretreatments, namely Turco, phosphate-fluoride and Pasa-Jell. A series of indicators was used and color changes were detected using diffuse reflectance visible spectroscopy. Electron spectroscopy for chemical analysis was used to examine the indicator on the Ti 6-4 surface. Specular reflectance infra-red spectroscopy was used to study the adsorption of stearic acid from cyclohexane solutions on the Ti 6-4 surface.

  7. Evaluation of a proposed standardized analytical method for the determination of humic and fulvic acids in commercial products

    USDA-ARS?s Scientific Manuscript database

    A constraint to growth of the commercial humic products industry has been the lack of a widely accepted procedure for determining humic acid and fulvic acid concentrations of the products, which has raised regulatory issues. On behalf of the U.S.-based Humic Products Trade Association, we developed ...

  8. Integrative FourD omics approach profiles the target network of the carbon storage regulatory system

    PubMed Central

    Sowa, Steven W.; Gelderman, Grant; Leistra, Abigail N.; Buvanendiran, Aishwarya; Lipp, Sarah; Pitaktong, Areen; Vakulskas, Christopher A.; Romeo, Tony; Baldea, Michael

    2017-01-01

    Abstract Multi-target regulators represent a largely untapped area for metabolic engineering and anti-bacterial development. These regulators are complex to characterize because they often act at multiple levels, affecting proteins, transcripts and metabolites. Therefore, single omics experiments cannot profile their underlying targets and mechanisms. In this work, we used an Integrative FourD omics approach (INFO) that consists of collecting and analyzing systems data throughout multiple time points, using multiple genetic backgrounds, and multiple omics approaches (transcriptomics, proteomics and high throughput sequencing crosslinking immunoprecipitation) to evaluate simultaneous changes in gene expression after imposing an environmental stress that accentuates the regulatory features of a network. Using this approach, we profiled the targets and potential regulatory mechanisms of a global regulatory system, the well-studied carbon storage regulatory (Csr) system of Escherichia coli, which is widespread among bacteria. Using 126 sets of proteomics and transcriptomics data, we identified 136 potential direct CsrA targets, including 50 novel ones, categorized their behaviors into distinct regulatory patterns, and performed in vivo fluorescence-based follow up experiments. The results of this work validate 17 novel mRNAs as authentic direct CsrA targets and demonstrate a generalizable strategy to integrate multiple lines of omics data to identify a core pool of regulator targets. PMID:28126921

  9. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  10. Theoretical studies on the inactivation mechanism of γ-aminobutyric acid aminotransferase.

    PubMed

    Durak, A T; Gökcan, H; Konuklar, F A S

    2011-07-21

    The inactivation mechanism of γ-aminobutyric acid aminotransferase (GABA-AT) in the presence of γ-vinyl-aminobutyric acid, an anti-epilepsy drug, has been studied by means of theoretical calculations. Density functional theory methods have been applied to compare the three experimentally proposed inactivation mechanisms (Silverman et al., J. Biol. Chem., 2004, 279, 363). All the calculations were performed at the B3LYP/6-31+G(d,p) level of theory. Single point solvent calculations were carried out in water, by means of an integral equation formalism-polarizable continuum model (IEFPCM) at the B3LYP/6-31+G(d,p) level of theory. The present calculations provide an insight into the mechanistic preferences of the inactivation reaction of GABA-AT. The results also allow us to elucidate the key factors behind the mechanistic preferences. The computations also confirm the importance of explicit water molecules around the reacting center in the proton transfer steps.

  11. Structure-based conformational preferences of amino acids

    PubMed Central

    Koehl, Patrice; Levitt, Michael

    1999-01-01

    Proteins can be very tolerant to amino acid substitution, even within their core. Understanding the factors responsible for this behavior is of critical importance for protein engineering and design. Mutations in proteins have been quantified in terms of the changes in stability they induce. For example, guest residues in specific secondary structures have been used as probes of conformational preferences of amino acids, yielding propensity scales. Predicting these amino acid propensities would be a good test of any new potential energy functions used to mimic protein stability. We have recently developed a protein design procedure that optimizes whole sequences for a given target conformation based on the knowledge of the template backbone and on a semiempirical potential energy function. This energy function is purely physical, including steric interactions based on a Lennard-Jones potential, electrostatics based on a Coulomb potential, and hydrophobicity in the form of an environment free energy based on accessible surface area and interatomic contact areas. Sequences designed by this procedure for 10 different proteins were analyzed to extract conformational preferences for amino acids. The resulting structure-based propensity scales show significant agreements with experimental propensity scale values, both for α-helices and β-sheets. These results indicate that amino acid conformational preferences are a natural consequence of the potential energy we use. This confirms the accuracy of our potential and indicates that such preferences should not be added as a design criterion. PMID:10535955

  12. Clofibric acid stimulates branched-chain amino acid catabolism by three mechanisms.

    PubMed

    Kobayashi, Rumi; Murakami, Taro; Obayashi, Mariko; Nakai, Naoya; Jaskiewicz, Jerzy; Fujiwara, Yoko; Shimomura, Yoshiharu; Harris, Robert A

    2002-11-15

    Clofibrate promotes catabolism of branched-chain amino acids by increasing the activity of the branched-chain alpha-keto acid dehydrogenase [BCKDH] complex. Depending upon the sex of the rats, nutritional state, and tissue being studied, clofibrate can affect BCKDH complex activity by three different mechanisms. First, by directly inhibiting BCKDH kinase activity, clofibrate can increase the proportion of the BCKDH complex in the active, dephosphorylated state. This occurs in situations in which the BCKDH complex is largely inactive due to phosphorylation, e.g., in the skeletal muscle of chow-fed rats or in the liver of female rats late in the light cycle. Second, by increasing the levels at which the enzyme components of the BCKDH complex are expressed, clofibrate can increase the total enzymatic activity of the BCKDH complex. This is readily demonstrated in livers of rats fed a low-protein diet, a nutritional condition that induces a decrease in the level of expression of the BCKDH complex. Third, by decreasing the amount of BCKDH kinase expressed and therefore its activity, clofibrate induces an increase in the percentage of the BCKDH complex in the active, dephosphorylated state. This occurs in the livers of rats fed a low-protein diet, a nutritional condition that causes inactivation of the BCKDH complex due to upregulation of the amount of BCKDH kinase. WY-14,643, which, like clofibric acid, is a ligand for the peroxisome-proliferator-activated receptor alpha [PPARalpha], does not directly inhibit BCKDH kinase but produces the same long-term effects as clofibrate on expression of the BCKDH complex and its kinase. Thus, clofibrate is unique in its capacity to stimulate BCAA oxidation through inhibition of BCKDH kinase activity, whereas PPARalpha activators in general promote BCAA oxidation by increasing expression of components of the BCKDH complex and decreasing expression of the BCKDH kinase.

  13. Functional Evolution of a cis-Regulatory Module

    PubMed Central

    Palsson, Arnar; Alekseeva, Elena; Bergman, Casey M; Nathan, Janaki; Kreitman, Martin

    2005-01-01

    Lack of knowledge about how regulatory regions evolve in relation to their structure–function may limit the utility of comparative sequence analysis in deciphering cis-regulatory sequences. To address this we applied reverse genetics to carry out a functional genetic complementation analysis of a eukaryotic cis-regulatory module—the even-skipped stripe 2 enhancer—from four Drosophila species. The evolution of this enhancer is non-clock-like, with important functional differences between closely related species and functional convergence between distantly related species. Functional divergence is attributable to differences in activation levels rather than spatiotemporal control of gene expression. Our findings have implications for understanding enhancer structure–function, mechanisms of speciation and computational identification of regulatory modules. PMID:15757364

  14. Biochemical Characterization of Ferulic Acid and Caffeic Acid Which Effectively Inhibit Melanin Synthesis via Different Mechanisms in B16 Melanoma Cells.

    PubMed

    Maruyama, Hiroko; Kawakami, Fumitaka; Lwin, Thet-Thet; Imai, Motoki; Shamsa, Fazel

    2018-01-01

    In this study, we examined the inhibitory effects of ferulic acid and caffeic acid on melanin production using a murine B16 melanoma cell line. The mechanisms by which the two acids inhibit melanin production were investigated by evaluating their effects on the activity of tyrosinase, which is involved is the first step of melanin biosynthesis. Ferulic acid showed no toxicity against the melanoma cells at any dose, whereas caffeic acid exerted cellular toxicity at concentrations higher than 0.35 mM. Both ferulic and caffeic acids effectively inhibited melanin production in the B16 melanoma cells. Ferulic acid reduced tyrosinase activity by directly binding to the enzyme, whereas no binding was observed between caffeic acid and tyrosinase. Both ferulic acid and caffeic acid inhibited casein kinase 2 (CK2)-induced phosphorylation of tyrosinase in a dose-dependent manner in vitro. Ferulic acid was found to be a more effective inhibitor of melanin production than caffeic acid; this difference in the inhibitory efficacy between the two substances could be attributable to the difference in their tyrosine-binding activity. Our analysis revealed that both substances also inhibited the CK2-mediated phosphorylation of tyrosinase.

  15. Emerging principles of regulatory evolution.

    PubMed

    Prud'homme, Benjamin; Gompel, Nicolas; Carroll, Sean B

    2007-05-15

    Understanding the genetic and molecular mechanisms governing the evolution of morphology is a major challenge in biology. Because most animals share a conserved repertoire of body-building and -patterning genes, morphological diversity appears to evolve primarily through changes in the deployment of these genes during development. The complex expression patterns of developmentally regulated genes are typically controlled by numerous independent cis-regulatory elements (CREs). It has been proposed that morphological evolution relies predominantly on changes in the architecture of gene regulatory networks and in particular on functional changes within CREs. Here, we discuss recent experimental studies that support this hypothesis and reveal some unanticipated features of how regulatory evolution occurs. From this growing body of evidence, we identify three key operating principles underlying regulatory evolution, that is, how regulatory evolution: (i) uses available genetic components in the form of preexisting and active transcription factors and CREs to generate novelty; (ii) minimizes the penalty to overall fitness by introducing discrete changes in gene expression; and (iii) allows interactions to arise among any transcription factor and downstream CRE. These principles endow regulatory evolution with a vast creative potential that accounts for both relatively modest morphological differences among closely related species and more profound anatomical divergences among groups at higher taxonomical levels.

  16. Involvement of organic acids and amino acids in ameliorating Ni(II) toxicity induced cell cycle dysregulation in Caulobacter crescentus: a metabolomics analysis.

    PubMed

    Jain, Abhishek; Chen, Wei Ning

    2018-05-01

    Nickel (Ni(II)) toxicity is addressed by many different bacteria, but bacterial responses to nickel stress are still unclear. Therefore, we studied the effect of Ni(II) toxicity on cell proliferation of α-proteobacterium Caulobacter crescentus. Next, we showed the mechanism that allows C. crescentus to survive in Ni(II) stress condition. Our results revealed that the growth of C. crescentus is severely affected when the bacterium was exposed to different Ni(II) concentrations, 0.003 mM slightly affected the growth, 0.008 mM reduced the growth by 50%, and growth was completely inhibited at 0.015 mM. It was further shown that Ni(II) toxicity induced mislocalization of major regulatory proteins such as MipZ, FtsZ, ParB, and MreB, resulting in dysregulation of the cell cycle. GC-MS metabolomics analysis of Ni(II) stressed C. crescentus showed an increased level of nine important metabolites including TCA cycle intermediates and amino acids. This indicates that changes in central carbon metabolism and nitrogen metabolism are linked with the disruption of cell division process. Addition of malic acid, citric acid, alanine, proline, and glutamine to 0.015 mM Ni(II)-treated C. crescentus restored its growth. Thus, the present work shows a protective effect of these organic acids and amino acids on Ni(II) toxicity. Metabolic stimulation through the PutA/GlnA pathway, accelerated degradation of CtrA, and Ni-chelation by organic acids or amino acids are some of the possible mechanisms suggested to be involved in enhancing C. crescentus's tolerance. Our results shed light on the mechanism of increased Ni(II) tolerance in C. crescentus which may be useful in bioremediation strategies and synthetic biology applications such as the development of whole cell biosensor.

  17. Regulatory science based approach in development of novel medical devices.

    PubMed

    Sakuma, Ichiro

    2015-08-01

    For development rational evaluation method for medical devices' safety and efficacy, regulatory science studies are important. Studies on regulatory affairs related to a medical device under development should be conducted as well as its technological development. Clinical performance of a medical device is influenced by performance of the device, medical doctors' skill, pathological condition of a patient, and so on. Thus it is sometimes difficult to demonstrate superiority of the device in terms of clinical outcome although its efficacy as a medical device is accepted. Setting of appropriate end points is required to evaluate a medical device appropriately. Risk assessment and risk management are the basis of medical device safety assurance. In case of medical device software, there are difficulties in identifying the risk due to its complexity of user environment and different design and manufacturing procedure compared with conventional hardware based medical devices. Recent technological advancement such as information and communication technologies (ICT) for medical devices and wireless network has raised new issue on risk management: cybersecurity. We have to watch closely the progress of safety standard development.

  18. Solid-state acid-base interactions in complexes of heterocyclic bases with dicarboxylic acids: crystallography, hydrogen bond analysis, and 15N NMR spectroscopy.

    PubMed

    Li, Z Jane; Abramov, Yuriy; Bordner, Jon; Leonard, Jason; Medek, Ales; Trask, Andrew V

    2006-06-28

    A cancer candidate, compound 1, is a weak base with two heterocyclic basic nitrogens and five hydrogen-bonding functional groups, and is sparingly soluble in water rendering it unsuitable for pharmaceutical development. The crystalline acid-base pairs of 1, collectively termed solid acid-base complexes, provide significant increases in the solubility and bioavailability compared to the free base, 1. Three dicarboxylic acid-base complexes, sesquisuccinate 2, dimalonate 3, and dimaleate 4, show the most favorable physicochemical profiles and are studied in greater detail. The structural analyses of the three complexes using crystal structure and solid-state NMR reveal that the proton-transfer behavior in these organic acid-base complexes vary successively correlating with Delta pKa. As a result, 2 is a neutral complex, 3 is a mixed ionic and zwitterionic complex and 4 is an ionic salt. The addition of the acidic components leads to maximized hydrogen bond interactions forming extended three-dimensional networks. Although structurally similar, the packing arrangements of the three complexes are considerably different due to the presence of multiple functional groups and the flexible backbone of 1. The findings in this study provide insight into the structural characteristics of complexes involving heterocyclic bases and carboxylic acids, and demonstrate that X-ray crystallography and 15N solid-state NMR are truly complementary in elucidating hydrogen bonding interactions and the degree of proton transfer of these complexes.

  19. Synthesis and characterization of boric acid mediated metal-organic frameworks based on trimesic acid and terephthalic acid

    NASA Astrophysics Data System (ADS)

    Ozer, Demet; Köse, Dursun A.; Şahin, Onur; Oztas, Nursen Altuntas

    2017-08-01

    The new metal-organic framework materials based on boric acid reported herein. Sodium and boron containing metal-organic frameworks were synthesized by one-pot self-assembly reaction in the presence of trimesic acid and terephthalic acid in water/ethanol solution. Boric acid is a relatively cheap boron source and boric acid mediated metal-organic framework prepared mild conditions compared to the other boron source based metal-organic framework. The synthesized compounds were characterized by FT-IR, p-XRD, TGA/DTA, elemental analysis, 13C-MAS NMR, 11B-NMR and single crystal measurements. The molecular formulas of compounds were estimated as C18H33B2Na5O28 and C8H24B2Na2O17 according to the structural analysis. The obtained complexes were thermally stable. Surface properties of inorganic polymer complexes were investigated by BET analyses and hydrogen storage properties of compound were also calculated.

  20. The plastidial retrograde signal methyl erythritol cyclopyrophosphate is a regulator of salicylic acid and jasmonic acid crosstalk.

    PubMed

    Lemos, Mark; Xiao, Yanmei; Bjornson, Marta; Wang, Jin-Zheng; Hicks, Derrick; Souza, Amancio de; Wang, Chang-Quan; Yang, Panyu; Ma, Shisong; Dinesh-Kumar, Savithramma; Dehesh, Katayoon

    2016-03-01

    The exquisite harmony between hormones and their corresponding signaling pathways is central to prioritizing plant responses to simultaneous and/or successive environmental trepidations. The crosstalk between jasmonic acid (JA) and salicylic acid (SA) is an established effective mechanism that optimizes and tailors plant adaptive responses. However, the underlying regulatory modules of this crosstalk are largely unknown. Global transcriptomic analyses of mutant plants (ceh1) with elevated levels of the stress-induced plastidial retrograde signaling metabolite 2-C-methyl-D-erythritol cyclopyrophosphate (MEcPP) revealed robustly induced JA marker genes, expected to be suppressed by the presence of constitutively high SA levels in the mutant background. Analyses of a range of genotypes with varying SA and MEcPP levels established the selective role of MEcPP-mediated signal(s) in induction of JA-responsive genes in the presence of elevated SA. Metabolic profiling revealed the presence of high levels of the JA precursor 12-oxo-phytodienoic acid (OPDA), but near wild type levels of JA in the ceh1 mutant plants. Analyses of coronatine-insensitive 1 (coi1)/ceh1 double mutant plants confirmed that the MEcPP-mediated induction is JA receptor COI1 dependent, potentially through elevated OPDA. These findings identify MEcPP as a previously unrecognized central regulatory module that induces JA-responsive genes in the presence of high SA, thereby staging a multifaceted plant response within the environmental context. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  1. Amino Acids Regulate mTORC1 by an Obligate Two-step Mechanism*

    PubMed Central

    Dyachok, Julia; Earnest, Svetlana; Iturraran, Erica N.; Cobb, Melanie H.

    2016-01-01

    The mechanistic target of rapamycin complex 1 (mTORC1) coordinates cell growth with its nutritional, hormonal, energy, and stress status. Amino acids are critical regulators of mTORC1 that permit other inputs to mTORC1 activity. However, the roles of individual amino acids and their interactions in mTORC1 activation are not well understood. Here we demonstrate that activation of mTORC1 by amino acids includes two discrete and separable steps: priming and activation. Sensitizing mTORC1 activation by priming amino acids is a prerequisite for subsequent stimulation of mTORC1 by activating amino acids. Priming is achieved by a group of amino acids that includes l-asparagine, l-glutamine, l-threonine, l-arginine, l-glycine, l-proline, l-serine, l-alanine, and l-glutamic acid. The group of activating amino acids is dominated by l-leucine but also includes l-methionine, l-isoleucine, and l-valine. l-Cysteine predominantly inhibits priming but not the activating step. Priming and activating steps differ in their requirements for amino acid concentration and duration of treatment. Priming and activating amino acids use mechanisms that are distinct both from each other and from growth factor signaling. Neither step requires intact tuberous sclerosis complex of proteins to activate mTORC1. Concerted action of priming and activating amino acids is required to localize mTORC1 to lysosomes and achieve its activation. PMID:27587390

  2. Boronic acid-tethered amphiphilic hyaluronic acid derivative-based nanoassemblies for tumor targeting and penetration.

    PubMed

    Jeong, Jae Young; Hong, Eun-Hye; Lee, Song Yi; Lee, Jae-Young; Song, Jae-Hyoung; Ko, Seung-Hak; Shim, Jae-Seong; Choe, Sunghwa; Kim, Dae-Duk; Ko, Hyun-Jeong; Cho, Hyun-Jong

    2017-04-15

    (3-Aminomethylphenyl)boronic acid (AMPB)-installed hyaluronic acid-ceramide (HACE)-based nanoparticles (NPs), including manassantin B (MB), were fabricated for tumor-targeted delivery. The amine group of AMPB was conjugated to the carboxylic acid group of hyaluronic acid (HA) via amide bond formation, and synthesis was confirmed by spectroscopic methods. HACE-AMPB/MB NPs with a 239-nm mean diameter, narrow size distribution, negative zeta potential, and >90% drug encapsulation efficiency were fabricated. Exposed AMPB in the outer surface of HACE-AMPB NPs (in the aqueous environment) may react with sialic acid of cancer cells. The improved cellular accumulation efficiency, in vitro antitumor efficacy, and tumor penetration efficiency of HACE-AMPB/MB NPs, compared with HACE/MB NPs, in MDA-MB-231 cells (CD44 receptor-positive human breast adenocarcinoma cells) may be based on the CD44 receptor-mediated endocytosis and phenylboronic acid-sialic acid interaction. Enhanced in vivo tumor targetability, infiltration efficiency, and antitumor efficacies of HACE-AMPB NPs, compared with HACE NPs, were observed in a MDA-MB-231 tumor-xenografted mouse model. In addition to passive tumor targeting (based on an enhanced permeability and retention effect) and active tumor targeting (interaction between HA and CD44 receptor), the phenylboronic acid-sialic acid interaction can play important roles in augmented tumor targeting and penetration of HACE-AMPB NPs. STATEMENT OF SIGNIFICANCE: (3-Aminomethylphenyl)boronic acid (AMPB)-tethered hyaluronic acid-ceramide (HACE)-based nanoparticles (NPs), including manassantin B (MB), were fabricated and their tumor targeting and penetration efficiencies were assessed in MDA-MB-231 (CD44 receptor-positive human adenocarcinoma) tumor models. MB, which exhibited antitumor efficacies via the inhibition of angiogenesis and hypoxia inducible factor (HIF)-1, was entrapped in HACE-AMPB NPs in this study. Phenylboronic acid located in the outer surface

  3. Radiation and the regulatory landscape of neo2-Darwinism.

    PubMed

    Rollo, C David

    2006-05-11

    Several recently revealed features of eukaryotic genomes were not predicted by earlier evolutionary paradigms, including the relatively small number of genes, the very large amounts of non-functional code and its quarantine in heterochromatin, the remarkable conservation of many functionally important genes across relatively enormous phylogenetic distances, and the prevalence of extra-genomic information associated with chromatin structure and histone proteins. All of these emphasize a paramount role for regulatory evolution, which is further reinforced by recent perspectives highlighting even higher-order regulation governing epigenetics and development (EVO-DEVO). Modern neo2-Darwinism, with its emphasis on regulatory mechanisms and regulatory evolution provides new vision for understanding radiation biology, particularly because free radicals and redox states are central to many regulatory mechanisms and free radicals generated by radiation mimic and amplify endogenous signalling. This paper explores some of these aspects and their implications for low-dose radiation biology.

  4. Applications of synchrotron-based spectroscopic techniques in studying nucleic acids and nucleic acid-functionalized nanomaterials

    PubMed Central

    Wu, Peiwen; Yu, Yang; McGhee, Claire E.; Tan, Li Huey

    2014-01-01

    In this review, we summarize recent progresses in the application of synchrotron-based spectroscopic techniques for nucleic acid research that takes advantage of high-flux and high-brilliance electromagnetic radiation from synchrotron sources. The first section of the review focuses on the characterization of the structure and folding processes of nucleic acids using different types of synchrotron-based spectroscopies, such as X-ray absorption spectroscopy, X-ray emission spectroscopy, X-ray photoelectron spectroscopy, synchrotron radiation circular dichroism, X-ray footprinting and small-angle X-ray scattering. In the second section, the characterization of nucleic acid-based nanostructures, nucleic acid-functionalized nanomaterials and nucleic acid-lipid interactions using these spectroscopic techniques is summarized. Insights gained from these studies are described and future directions of this field are also discussed. PMID:25205057

  5. Applications of synchrotron-based spectroscopic techniques in studying nucleic acids and nucleic acid-functionalized nanomaterials

    DOE PAGES

    Wu, Peiwen; Yu, Yang; McGhee, Claire E.; ...

    2014-09-10

    In this paper, we summarize recent progress in the application of synchrotron-based spectroscopic techniques for nucleic acid research that takes advantage of high-flux and high-brilliance electromagnetic radiation from synchrotron sources. The first section of the review focuses on the characterization of the structure and folding processes of nucleic acids using different types of synchrotron-based spectroscopies, such as X-ray absorption spectroscopy, X-ray emission spectroscopy, X-ray photoelectron spectroscopy, synchrotron radiation circular dichroism, X-ray footprinting and small-angle X-ray scattering. In the second section, the characterization of nucleic acid-based nanostructures, nucleic acid-functionalized nanomaterials and nucleic acid-lipid interactions using these spectroscopic techniques is summarized. Insightsmore » gained from these studies are described and future directions of this field are also discussed.« less

  6. A Hox regulatory network of hindbrain segmentation is conserved to the base of vertebrates.

    PubMed

    Parker, Hugo J; Bronner, Marianne E; Krumlauf, Robb

    2014-10-23

    A defining feature governing head patterning of jawed vertebrates is a highly conserved gene regulatory network that integrates hindbrain segmentation with segmentally restricted domains of Hox gene expression. Although non-vertebrate chordates display nested domains of axial Hox expression, they lack hindbrain segmentation. The sea lamprey, a jawless fish, can provide unique insights into vertebrate origins owing to its phylogenetic position at the base of the vertebrate tree. It has been suggested that lamprey may represent an intermediate state where nested Hox expression has not been coupled to the process of hindbrain segmentation. However, little is known about the regulatory network underlying Hox expression in lamprey or its relationship to hindbrain segmentation. Here, using a novel tool that allows cross-species comparisons of regulatory elements between jawed and jawless vertebrates, we report deep conservation of both upstream regulators and segmental activity of enhancer elements across these distant species. Regulatory regions from diverse gnathostomes drive segmental reporter expression in the lamprey hindbrain and require the same transcriptional inputs (for example, Kreisler (also known as Mafba), Krox20 (also known as Egr2a)) in both lamprey and zebrafish. We find that lamprey hox genes display dynamic segmentally restricted domains of expression; we also isolated a conserved exonic hox2 enhancer from lamprey that drives segmental expression in rhombomeres 2 and 4. Our results show that coupling of Hox gene expression to segmentation of the hindbrain is an ancient trait with origin at the base of vertebrates that probably led to the formation of rhombomeric compartments with an underlying Hox code.

  7. Structure of GlnK1 with bound effectors indicates regulatory mechanism for ammonia uptake.

    PubMed

    Yildiz, Ozkan; Kalthoff, Christoph; Raunser, Stefan; Kühlbrandt, Werner

    2007-01-24

    A binary complex of the ammonia channel Amt1 from Methanococcus jannaschii and its cognate P(II) signalling protein GlnK1 has been produced and characterized. Complex formation is prevented specifically by the effector molecules Mg-ATP and 2-ketoglutarate. Single-particle electron microscopy of the complex shows that GlnK1 binds on the cytoplasmic side of Amt1. Three high-resolution X-ray structures of GlnK1 indicate that the functionally important T-loop has an extended, flexible conformation in the absence of Mg-ATP, but assumes a compact, tightly folded conformation upon Mg-ATP binding, which in turn creates a 2-ketoglutarate-binding site. We propose a regulatory mechanism by which nitrogen uptake is controlled by the binding of both effector molecules to GlnK1. At normal effector levels, a 2-ketoglutarate molecule binding at the apex of the compact T-loop would prevent complex formation, ensuring uninhibited ammonia uptake. At low levels of Mg-ATP, the extended loops would seal the ammonia channels in the complex. Binding of both effector molecules to P(II) signalling proteins may thus represent an effective feedback mechanism for regulating ammonium uptake through the membrane.

  8. Oxalic acid pretreatment for mechanical pulping greatly improves paper strength while maintaining scattering power and reducing shives and triglycerides

    Treesearch

    Ross Swaney; Masood Akhtar; Eric Horn; Michael Lentz; John Klungness; Marc Sabourin

    2003-01-01

    In this paper we introduce a new technology based on a mild chemical pretreatment process prior to mechanical pulping. Chips are treated with a dilute solution of oxalic acid (OA) for only 10 minute at 130°C, in a typical example. The properties of the pulp produced by this OA process are quite different from those obtained via conventional chemical pretreatments,...

  9. The long-term use of soap does not affect the pH-maintenance mechanism of human skin.

    PubMed

    Takagi, Y; Kaneda, K; Miyaki, M; Matsuo, K; Kawada, H; Hosokawa, H

    2015-05-01

    The pH at the surface of healthy human skin is around 5. Cleansing the skin with soap increases the pH of the skin, which then returns to a more acidic pH within a few hours. However, the effects of skin cleansing with soap over a long time on the pH regulatory system is still unclear. We compared the pH of the skin between users of a soap-based cleanser and of a mild-acidic cleanser prior to and following the cleansing. This study had two groups of subjects, one group who had used a soap-based cleanser for more than 5 years and the other group who had used a mild-acidic cleanser for more than 5 years. The pH on the inner forearm of each subject was measured prior to and for 6 h after cleansing with a soap bar. There were no differences between the pH of the skin these two groups prior to cleansing, immediately after cleansing or in the pH recovery rate for 6 h. These results suggest that long-term continuous use of a soap-based cleanser does not affect the pH-maintaining mechanism of human skin. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Acid-base chemistry and aluminum transport in an acidic watershed and pond in New Hampshire

    Treesearch

    Scott W. Bailey; Charles T. Driscoll; James W. Hornbeck

    1995-01-01

    Cone Pond is one of the few acidic, clear-water ponds in the White Mountains of New Hampshire, a region dominated by high inputs of strong acids from atmospheric deposition and low base content of bedrock. Monitoring was conducted for 13 months to compare and contrast the acid-base chemistry of the terrestrial and aquatic portions of the watershed. Variations in Al...

  11. RSAT 2015: Regulatory Sequence Analysis Tools.

    PubMed

    Medina-Rivera, Alejandra; Defrance, Matthieu; Sand, Olivier; Herrmann, Carl; Castro-Mondragon, Jaime A; Delerce, Jeremy; Jaeger, Sébastien; Blanchet, Christophe; Vincens, Pierre; Caron, Christophe; Staines, Daniel M; Contreras-Moreira, Bruno; Artufel, Marie; Charbonnier-Khamvongsa, Lucie; Hernandez, Céline; Thieffry, Denis; Thomas-Chollier, Morgane; van Helden, Jacques

    2015-07-01

    RSAT (Regulatory Sequence Analysis Tools) is a modular software suite for the analysis of cis-regulatory elements in genome sequences. Its main applications are (i) motif discovery, appropriate to genome-wide data sets like ChIP-seq, (ii) transcription factor binding motif analysis (quality assessment, comparisons and clustering), (iii) comparative genomics and (iv) analysis of regulatory variations. Nine new programs have been added to the 43 described in the 2011 NAR Web Software Issue, including a tool to extract sequences from a list of coordinates (fetch-sequences from UCSC), novel programs dedicated to the analysis of regulatory variants from GWAS or population genomics (retrieve-variation-seq and variation-scan), a program to cluster motifs and visualize the similarities as trees (matrix-clustering). To deal with the drastic increase of sequenced genomes, RSAT public sites have been reorganized into taxon-specific servers. The suite is well-documented with tutorials and published protocols. The software suite is available through Web sites, SOAP/WSDL Web services, virtual machines and stand-alone programs at http://www.rsat.eu/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Comprehensive analysis of microRNA-Seq and target mRNAs of rice sheath blight pathogen provides new insights into pathogenic regulatory mechanisms.

    PubMed

    Lin, Runmao; He, Liye; He, Jiayu; Qin, Peigang; Wang, Yanran; Deng, Qiming; Yang, Xiaoting; Li, Shuangcheng; Wang, Shiquan; Wang, Wenming; Liu, Huainian; Li, Ping; Zheng, Aiping

    2016-07-03

    MicroRNAs (miRNAs) are ∼22 nucleotide non-coding RNAs that regulate gene expression by targeting mRNAs for degradation or inhibiting protein translation. To investigate whether miRNAs regulate the pathogenesis in necrotrophic fungus Rhizoctonia solani AG1 IA, which causes significant yield loss in main economically important crops, and to determine the regulatory mechanism occurring during pathogenesis, we constructed hyphal small RNA libraries from six different infection periods of the rice leaf. Through sequencing and analysis, 177 miRNA-like small RNAs (milRNAs) were identified, including 15 candidate pathogenic novel milRNAs predicted by functional annotations of their target mRNAs and expression patterns of milRNAs and mRNAs during infection. Reverse transcription-quantitative polymerase chain reaction results for randomly selected milRNAs demonstrated that our novel comprehensive predictions had a high level of accuracy. In our predicted pathogenic protein-protein interaction network of R. solani, we added the related regulatory milRNAs of these core coding genes into the network, and could understand the relationships among these regulatory factors more clearly at the systems level. Furthermore, the putative pathogenic Rhi-milR-16, which negatively regulates target gene expression, was experimentally validated to have regulatory functions by a dual-luciferase reporter assay. Additionally, 23 candidate rice miRNAs that may involve in plant immunity against R. solani were discovered. This first study on novel pathogenic milRNAs of R. solani AG1 IA and the recognition of target genes involved in pathogenicity, as well as rice miRNAs, participated in defence against R. solani could provide new insights into revealing the pathogenic mechanisms of the severe rice sheath blight disease. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  13. Structural imprints in vivo decode RNA regulatory mechanisms

    PubMed Central

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-01-01

    Visualizing the physical basis for molecular behavior inside living cells is a grand challenge in biology. RNAs are central to biological regulation, and RNA’s ability to adopt specific structures intimately controls every step of the gene expression program1. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles view only two of four nucleotides that make up RNA2,3. Here we present a novel biochemical approach, In Vivo Click SHAPE (icSHAPE), that enables the first global view of RNA secondary structures of all four bases in living cells. icSHAPE of mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguishes different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA binding proteins or RNA modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome-wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression. PMID:25799993

  14. Self-assembled polyhydroxy fatty acids vesicles: a mechanism for plant cutin synthesis.

    PubMed

    Heredia-Guerrero, José A; Benítez, José J; Heredia, Antonio

    2008-03-01

    Despite its biological importance, the mechanism of formation of cutin, the polymeric matrix of plant cuticles, has not yet been fully clarified. Here, for the first time, we show the participation in the process of lipid vesicles formed by the self-assembly of endogenous polyhydroxy fatty acids. The accumulation and fusion of these vesicles (cutinsomes) at the outer part of epidermal cell wall is proposed as the mechanism for early cuticle formation.

  15. Transition State Charge Stabilization and Acid-Base Catalysis of mRNA Cleavage by the Endoribonuclease RelE

    PubMed Central

    Dunican, Brian F.; Hiller, David A.; Strobel, Scott A.

    2015-01-01

    The bacterial toxin RelE is a ribosome-dependent endoribonuclease. It is part of a type II toxin-antitoxin system that contributes to antibiotic resistance and biofilm formation. During amino acid starvation RelE cleaves mRNA in the ribosomal A-site, globally inhibiting protein translation. RelE is structurally similar to microbial RNases that employ general acid-base catalysis to facilitate RNA cleavage. The RelE active-site is atypical for acid-base catalysis, in that it is enriched for positively charged residues and lacks the prototypical histidine-glutamate catalytic pair, making the mechanism of mRNA cleavage unclear. In this study we use a single-turnover kinetic analysis to measure the effect of pH and phosphorothioate substitution on the rate constant for cleavage of mRNA by wild-type RelE and seven active-site mutants. Mutation and thio-effects indicate a major role for stabilization of increased negative change in the transition state by arginine 61. The wild-type RelE cleavage rate constant is pH-independent, but the reaction catalyzed by many of the mutants is strongly pH dependent, suggestive of general acid-base catalysis. pH-rate curves indicate that wild-type RelE operates with the pKa of at least one catalytic residue significantly downshifted by the local environment. Mutation of any single active-site residue is sufficient to disrupt this microenvironment and revert the shifted pKa back above neutrality. pH-rate curves are consistent with K54 functioning as a general base and R81 as a general acid. The capacity of RelE to effect a large pKa shift and facilitate a common catalytic mechanism by uncommon means furthers our understanding of other atypical enzymatic active sites. PMID:26535789

  16. Silver(I) complexes of 2,4-dihydroxybenzaldehyde-amino acid Schiff bases-Novel noncompetitive α-glucosidase inhibitors.

    PubMed

    Zheng, Jingwei; Ma, Lin

    2015-01-01

    A series of silver(I) complexes of 2,4-dihydroxybenzaldehyde-amino acid Schiff bases were designed and tested for α-glucosidase inhibition. Our results indicate that all the silver complexes (4a-18a) possessed strong inhibitory activity at μmolL(-1) level, especially glutamine (12a) and histidine (18a) Schiff base silver(I) complexes exhibited an IC50 value of less than 0.01μmolL(-1). This series of compounds exhibited noncompetitive inhibition characteristics in kinetic studies. In addition, we investigated the mechanism of inhibition and the structure-activity relationships of the amino acid Schiff base silver complexes. Our results reveal that Schiff base silver complexes may be explored for their therapeutic potential as alternatives of α-glucosidase inhibitors. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Acetaminophen hepatotoxicity and sterile inflammation: The mechanism of protection of Chlorogenic acid.

    PubMed

    Jaeschke, Hartmut

    2016-01-05

    Acetaminophen hepatotoxicity is characterized by extensive necrotic cell death and a sterile inflammatory response. A recent report suggested that a therapeutic intervention with chlorogenic acid, a dietary polyphenolic compound, protects against acetaminophen-induced liver injury by inhibiting the inflammatory injury. The purpose of this letter is to discuss a number of reasons why the protective mechanism of chlorogenic acid against acetaminophen hepatotoxicity does not involve an anti-inflammatory effect and provides an alternative explanation for the observed protection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  18. A Closer Look at Acid-Base Olfactory Titrations

    ERIC Educational Resources Information Center

    Neppel, Kerry; Oliver-Hoyo, Maria T.; Queen, Connie; Reed, Nicole

    2005-01-01

    Olfactory titrations using raw onions and eugenol as acid-base indicators are reported. An in-depth investigation on olfactory titrations is presented to include requirements for potential olfactory indicators and protocols for using garlic, onions, and vanillin as acid-base olfactory indicators are tested.

  19. Posttraumatic Stress Disorder Disturbs Coronary Tone and Its Regulatory Mechanisms.

    PubMed

    Lazuko, Svetlana S; Kuzhel, Olga P; Belyaeva, Lyudmila E; Manukhina, Eugenia B; Fred Downey, H; Tseilikman, Olga B; Komelkova, Maria V; Tseilikman, Vadim E

    2018-01-01

    Posttraumatic stress disorder (PTSD) is associated with myocardial injury, but changes in coronary regulatory mechanisms in PTSD have not been investigated. This study evaluated the effect of PTSD-inducing stress on coronary tone and its regulation by nitric oxide (NO) and voltage-gated K + channels. PTSD was induced by exposing rats to predator stress, 15 min daily for 10 days, followed by 14 stress-free days. Presence of PTSD was confirmed by the elevated plus-maze test. Coronary tone was evaluated from changes in coronary perfusion pressure of Langendorff isolated hearts. Predator stress induced significant decreases in coronary tone of isolated hearts and in blood pressure of intact rats. L-NAME, a non-selective NO synthase (NOS) inhibitor, but not S-MT, a selective iNOS inhibitor, and increased coronary tone of control rats. In PTSD rats, both L-NAME and S-MT increased coronary tone. Therefore, the stress-induced coronary vasodilation resulted from NO overproduction by both iNOS and eNOS. NOS induction was apparently due to systemic inflammation as evidenced by increased serum interleukin-1β and C-reactive protein in PTSD rats. Decreased corticosterone in PTSD rats may have contributed to inflammation and its effect on coronary tone. PTSD was also associated with voltage-gated K + channel dysfunction, which would have also reduced coronary tone.

  20. [Research of mechanism of secondary metabolites of phenolic acids in Salvia miltiorrhiza hairy root induced by jasmonate].

    PubMed

    Li, Wenyuan; Gao, Wei; Zhao, Jing; Cui, Guanghong; Shao, Aijuan; Huang, Luqi

    2012-01-01

    To study the mechanism of secondary metabolites of some phenolic acids in the hairy roots of Salvia miltiorrhiza induced by methyl jasmonate. The hairy roots of S. miltiorrhiza were induced with methyl jasmonate (100 micromol x L(-1)) and collected at 0, 12, 24, 36 h after treatment. Real-time quantitative PCR was used for detecting the mRNA expression level of the key enzyme genes on the secondary metabolites pathway of rosmarinic acid, while a LC-MS method was developed to determine the content of rosmarinic acid, caffeic acid and salvianolic acid B. The concentration of phenolic acids grew up and accumulated quickly in the hairy roots with exogenous signal molecule MJ induced, and it was showed that the content of CA and RA reached the maximum after 24 h and the content of LAB reached the maximum in 36 h by MJ induced. The induction mechanism may be activated with different levels of RA synthesis in PAL, 4CL, C4H genes on the key enzyme phenylalanine pathway and TAT, HPPR genes on tyrosine pathway. The time of gene expression was different, among them, 4CL and PAL genes were more important. In a word, the result can provide some basis data about the mechanism of secondary metabolites of phenolic acids for further research.

  1. Co-culture-inducible bacteriocin production in lactic acid bacteria.

    PubMed

    Chanos, Panagiotis; Mygind, Tina

    2016-05-01

    It is common knowledge that microorganisms have capabilities, like the production of antimicrobial compounds, which do not normally appear in ideal laboratory conditions. Common antimicrobial discovery techniques require the isolation of monocultures and their individual screening against target microorganisms. One strategy to achieve expression of otherwise hidden antimicrobials is induction by co-cultures. In the area of bacteriocin-producing lactic acid bacteria, there has been some research focusing into the characteristics of co-culture-inducible bacteriocin production and particularly the molecular mechanism(s) of such interactions. No clear relationship has been seen between bacteriocin-inducing and bacteriocin-producing microorganisms. The three-component regulatory system seems to be playing a central role in the induction, but inducing compounds have not been identified or characterized. However, the presence of the universal messenger molecule autoinducer-2 has been associated in some cases with the co-culture-inducible bacteriocin phenotype and it may play the role in the additional regulation of the three-component regulatory system. Understanding the mechanisms of induction would facilitate the development of strategies for screening and development of co-culture bacteriocin-producing systems and novel products as well as the perseverance of such systems in food and down to the intestinal tract, possibly conferring a probiotic effect on the host.

  2. A Systems' Biology Approach to Study MicroRNA-Mediated Gene Regulatory Networks

    PubMed Central

    Kunz, Manfred; Vera, Julio; Wolkenhauer, Olaf

    2013-01-01

    MicroRNAs (miRNAs) are potent effectors in gene regulatory networks where aberrant miRNA expression can contribute to human diseases such as cancer. For a better understanding of the regulatory role of miRNAs in coordinating gene expression, we here present a systems biology approach combining data-driven modeling and model-driven experiments. Such an approach is characterized by an iterative process, including biological data acquisition and integration, network construction, mathematical modeling and experimental validation. To demonstrate the application of this approach, we adopt it to investigate mechanisms of collective repression on p21 by multiple miRNAs. We first construct a p21 regulatory network based on data from the literature and further expand it using algorithms that predict molecular interactions. Based on the network structure, a detailed mechanistic model is established and its parameter values are determined using data. Finally, the calibrated model is used to study the effect of different miRNA expression profiles and cooperative target regulation on p21 expression levels in different biological contexts. PMID:24350286

  3. [Regulatory requirements regarding cell-based medicinal products for human and veterinary use - a comparison].

    PubMed

    Kuhlmann-Gottke, Johanna; Duchow, Karin

    2015-11-01

    At present, there is no separate regulatory framework for cell-based medicinal products (CBMP) for veterinary use at the European or German level. Current European and national regulations exclusively apply to the corresponding medicinal products for human use. An increasing number of requests for the regulatory classification of CBMP for veterinary use, such as allogeneic stem cell preparations and dendritic cell-based autologous tumour vaccines, and a rise in scientific advice for companies developing these products, illustrate the need for adequate legislation. Currently, advice is given and decisions are made on a case-by-case basis regarding the regulatory classification and authorisation requirements.Since some of the CBMP - in particular in the area of stem-cell products - are developed in parallel for human and veterinary use, there is an urgent need to create specific legal definitions, regulations, and guidelines for these complex innovative products in the veterinary sector as well. Otherwise, there is a risk that that the current legal grey area regarding veterinary medicinal products will impede therapeutic innovations in the long run. A harmonised EU-wide approach is desirable. Currently the European legislation on veterinary medicinal products is under revision. In this context, veterinary therapeutics based on allogeneic cells and tissues will be defined and regulated. Certainly, the legal framework does not have to be as comprehensive as for human CBMP; a leaner solution is conceivable, similar to the special provisions for advanced-therapy medicinal products laid down in the German Medicines Act.

  4. [Nutrition, acid-base metabolism, cation-anion difference and total base balance in humans].

    PubMed

    Mioni, R; Sala, P; Mioni, G

    2008-01-01

    The relationship between dietary intake and acid-base metabolism has been investigated in the past by means of the inorganic cation-anion difference (C(+)(nm)-A(-)(nm)) method based on dietary ash-acidity titration after the oxidative combustion of food samples. Besides the inorganic components of TA (A(-)(nm)-C(+)(nm)), which are under renal control, there are also metabolizable components (A(-)(nm)-C(+)(nm)) of TA, which are under the control of the intermediate metabolism. The whole body base balance, NBb(W), is obtained only by the application of C(+)(nm)-A(-)(nm) to food, feces and urine, while the metabolizable component (A(-)(nm)-C(+)(nm)) is disregarded. A novel method has been subsequently suggested to calculate the net balance of fixed acid, made up by the difference between the input of net endogenous acid production: NEAP = SO(4)(2-)+A(-)(m)-(C(+)(nm)-A(-)(nm)), and the output of net acid excretion: NAE = TA + NH(4)(+) - HCO(3)(-). This approach has been criticized because 1) it includes metabolizable acids, whose production cannot be measured independently; 2) the specific control of metabolizable acid and base has been incorrectly attributed to the kidney; 3) the inclusion of A-m in the balance input generates an acid overload; 4) the object of measurement in making up a balance has to be the same, a condition not fulfilled as NEAP is different from NAE. Lastly, by rearranging the net balance of the acid equation, the balance of nonmetabolizable acid equation is obtained. Therefore, any discrepancy between these two equations is due to the inaccuracy in the urine measurement of metabolizable cations and/or anions.

  5. Different inhibition mechanisms of gentisic acid and cyaniding-3-O-glucoside on polyphenoloxidase.

    PubMed

    Zhou, Lei; Xiong, Zhiqiang; Liu, Wei; Zou, Liqiang

    2017-11-01

    Gentisic acid and cyanidin-3-O-glucoside are important bioactive polyphenols which are widely distributed in many fruits and cereals. In this work, kinetic study, spectral analysis and computational simulation were used to compare the inhibitory effects and inhibition mechanisms of gentisic acid and cyanidin-3-O-glucoside on mushroom polyphenoloxidase (PPO). The inhibitory effect of cyanidin-3-O-glucoside on PPO was much stronger than that of gentisic acid. Gentisic acid inhibited PPO in a reversible mixed-type manner while cyanidin-3-O-glucoside was an irreversible inhibitor. Gentisic acid and cyanidin-3-O-glucoside made the thermal inactivation of PPO easier, and induced apparent conformational changes of PPO. Compared with gentisic acid, cyanidin-3-O-glucoside had stronger effects on the thermal inactivation and conformation of PPO. Molecular docking results revealed gentisic acid bound to the active site of PPO by hydrogen bonding, π-π stacking and van der Waals forces. However, cyanidin-3-O-glucoside might irreversibly interact with the Met or Cys in PPO by covalent bonds. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Effect of ration size on fillet fatty acid composition, phospholipid allostasis and mRNA expression patterns of lipid regulatory genes in gilthead sea bream (Sparus aurata).

    PubMed

    Benedito-Palos, Laura; Calduch-Giner, Josep A; Ballester-Lozano, Gabriel F; Pérez-Sánchez, Jaume

    2013-04-14

    The effect of ration size on muscle fatty acid (FA) composition and mRNA expression levels of key regulatory enzymes of lipid and lipoprotein metabolism have been addressed in juveniles of gilthead sea bream fed a practical diet over the course of an 11-week trial. The experimental setup included three feeding levels: (i) full ration until visual satiety, (ii) 70 % of satiation and (iii) 70 % of satiation with the last 2 weeks at the maintenance ration. Feed restriction reduced lipid content of whole body by 30 % and that of fillet by 50 %. In this scenario, the FA composition of fillet TAG was not altered by ration size, whereas that of phospholipids was largely modified with a higher retention of arachidonic acid and DHA. The mRNA transcript levels of lysophosphatidylcholine acyltransferases, phosphatidylethanolamine N-methyltransferase and FA desaturase 2 were not regulated by ration size in the present experimental model. In contrast, mRNA levels of stearoyl-CoA desaturases were markedly down-regulated by feed restriction. An opposite trend was found for a muscle-specific lipoprotein lipase, which is exclusive of fish lineage. Several upstream regulatory transcriptions were also assessed, although nutritionally mediated changes in mRNA transcripts were almost reduced to PPARα and β, which might act in a counter-regulatory way on lipolysis and lipogenic pathways. This gene expression pattern contributes to the construction of a panel of biomarkers to direct marine fish production towards muscle lean phenotypes with increased retentions of long-chain PUFA.

  7. Stereoconversion of amino acids and peptides in uryl-pendant binol schiff bases.

    PubMed

    Park, Hyunjung; Nandhakumar, Raju; Hong, Jooyeon; Ham, Sihyun; Chin, Jik; Kim, Kwan Mook

    2008-01-01

    (S)-2-Hydroxy-2'-(3-phenyluryl-benzyl)-1,1'-binaphthyl-3-carboxaldehyde (1) forms Schiff bases with a wide range of nonderivatized amino acids, including unnatural ones. Multiple hydrogen bonds, including resonance-assisted ones, fix the whole orientation of the imine and provoke structural rigidity around the imine C==N bond. Due to the structural difference and the increase in acidity of the alpha proton of the amino acid, the imine formed with an L-amino acid (1-l-aa) is converted into the imine of the D-amino acid (1-D-aa), with a D/L ratio of more than 10 for most amino acids at equilibrium. N-terminal amino acids in dipeptides are also predominantly epimerized to the D form upon imine formation with 1. Density functional theory calculations show that 1-D-Ala is more stable than 1-L-Ala by 1.64 kcal mol(-1), a value that is in qualitative agreement with the experimental result. Deuterium exchange of the alpha proton of alanine in the imine form was studied by (1)H NMR spectroscopy and the results support a stepwise mechanism in the L-into-D conversion rather than a concerted one; that is, deprotonation and protonation take place in a sequential manner. The deprotonation rate of L-Ala is approximately 16 times faster than that of D-Ala. The protonation step, however, appears to favor L-amino acid production, which prevents a much higher predominance of the D form in the imine. Receptor 1 and the predominantly D-form amino acid can be recovered from the imine by simple extraction under acidic conditions. Hence, 1 is a useful auxiliary to produce D-amino acids of industrial interest by the conversion of naturally occurring L-amino acids or relatively easily obtainable racemic amino acids.

  8. A novel small RNA S042 increases acid tolerance in Lactococcus lactis F44.

    PubMed

    Wu, Hao; Song, Shunyi; Tian, Kairen; Zhou, Dandan; Wang, Binbin; Liu, Jiaheng; Zhu, Hongji; Qiao, Jianjun

    2018-06-07

    Lactococcus lactis, a gram-positive bacterium, encounters various environmental stresses, especially acid stress, during fermentation. Small RNAs (sRNAs) that serve as regulators at post-transcriptional level play important roles in acid stress response. Here, a novel sRNA S042 was identified by RNA-Seq, RT-PCR and Northern blot. The transcription level of s042 was upregulated 2.29-fold under acid stress by Quantitative RT-PCR (qRT-PCR) analysis. Acid tolerance assay showed that overexpressing s042 increased the survival rate of L. lactis F44 and deleting s042 significantly inhibited the viability under acidic conditions. Moreover, the targets were predicted by online software and four genes were chosen as candidates. Among them, argR (arginine regulator) and accD (acetyl-CoA carboxylase carboxyl transferase subunit beta) were validated to be the direct targets activated by S042 through reporter fusion assay. The regulatory mechanism between S042 and its targets was further investigated through Bioinformatics and qRT-PCR. This study served to highlight the role of the novel sRNA S042 in acid resistance of L. lactis and provided new insights into the response mechanism of acid stress. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Deduced catalytic mechanism of d-amino acid amidase from Ochrobactrum anthropi SV3

    PubMed Central

    Okazaki, Seiji; Suzuki, Atsuo; Komeda, Hidenobu; Asano, Yasuhisa; Yamane, Takashi

    2008-01-01

    d-Amino acid amidase (DAA) from Ochrobactrum anthropi SV3 catalyzes d-stereospecific hydrolysis of amino acid amides. DAA has attracted attention as a catalyst for the stereospecific production of d-amino acids, although the mechanism that drives the reaction has not been clear. Previously, the structure of DAA was classified into two types, a substrate-bound state with an ordered Ω loop, and a ground state with a disordered Ω loop. Because the binding of the substrate facilitates ordering, this transition was regarded to be induced fit motion. The angles and distances of hydrogen bonds at Tyr149 Oη, Ser60 Oγ and Lys63 Nζ revealed that Tyr149 Oη donates an H atom to a water molecule in the substrate-bound state, and that Tyr149 Oη donates an H atom to Ser60 Oγ or Lys63 Nζ in the ground state. Taking into consideration the locations of the H atoms of Tyr149 Oη, Ser60 Oγ and Lys63 Nζ, a catalytic mechanism of DAA activity is presented, wherein a shift of an H atom at Tyr149 Oη in the substrate-bound versus the ground state plays a significant role in the reaction. This mechanism explains well why acylation proceeds and deacylation does not proceed in the substrate-bound state. PMID:18421151

  10. MIRA: An R package for DNA methylation-based inference of regulatory activity.

    PubMed

    Lawson, John T; Tomazou, Eleni M; Bock, Christoph; Sheffield, Nathan C

    2018-03-01

    DNA methylation contains information about the regulatory state of the cell. MIRA aggregates genome-scale DNA methylation data into a DNA methylation profile for independent region sets with shared biological annotation. Using this profile, MIRA infers and scores the collective regulatory activity for each region set. MIRA facilitates regulatory analysis in situations where classical regulatory assays would be difficult and allows public sources of open chromatin and protein binding regions to be leveraged for novel insight into the regulatory state of DNA methylation datasets. R package available on Bioconductor: http://bioconductor.org/packages/release/bioc/html/MIRA.html. nsheffield@virginia.edu.

  11. Molecular mechanisms of adaptation emerging from the physics and evolution of nucleic acids and proteins.

    PubMed

    Goncearenco, Alexander; Ma, Bin-Guang; Berezovsky, Igor N

    2014-03-01

    DNA, RNA and proteins are major biological macromolecules that coevolve and adapt to environments as components of one highly interconnected system. We explore here sequence/structure determinants of mechanisms of adaptation of these molecules, links between them, and results of their mutual evolution. We complemented statistical analysis of genomic and proteomic sequences with folding simulations of RNA molecules, unraveling causal relations between compositional and sequence biases reflecting molecular adaptation on DNA, RNA and protein levels. We found many compositional peculiarities related to environmental adaptation and the life style. Specifically, thermal adaptation of protein-coding sequences in Archaea is characterized by a stronger codon bias than in Bacteria. Guanine and cytosine load in the third codon position is important for supporting the aerobic life style, and it is highly pronounced in Bacteria. The third codon position also provides a tradeoff between arginine and lysine, which are favorable for thermal adaptation and aerobicity, respectively. Dinucleotide composition provides stability of nucleic acids via strong base-stacking in ApG dinucleotides. In relation to coevolution of nucleic acids and proteins, thermostability-related demands on the amino acid composition affect the nucleotide content in the second codon position in Archaea.

  12. Molecular mechanisms of adaptation emerging from the physics and evolution of nucleic acids and proteins

    PubMed Central

    Goncearenco, Alexander; Ma, Bin-Guang; Berezovsky, Igor N.

    2014-01-01

    DNA, RNA and proteins are major biological macromolecules that coevolve and adapt to environments as components of one highly interconnected system. We explore here sequence/structure determinants of mechanisms of adaptation of these molecules, links between them, and results of their mutual evolution. We complemented statistical analysis of genomic and proteomic sequences with folding simulations of RNA molecules, unraveling causal relations between compositional and sequence biases reflecting molecular adaptation on DNA, RNA and protein levels. We found many compositional peculiarities related to environmental adaptation and the life style. Specifically, thermal adaptation of protein-coding sequences in Archaea is characterized by a stronger codon bias than in Bacteria. Guanine and cytosine load in the third codon position is important for supporting the aerobic life style, and it is highly pronounced in Bacteria. The third codon position also provides a tradeoff between arginine and lysine, which are favorable for thermal adaptation and aerobicity, respectively. Dinucleotide composition provides stability of nucleic acids via strong base-stacking in ApG dinucleotides. In relation to coevolution of nucleic acids and proteins, thermostability-related demands on the amino acid composition affect the nucleotide content in the second codon position in Archaea. PMID:24371267

  13. α -Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism.

    PubMed

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system.

  14. α-Actinin TvACTN3 of Trichomonas vaginalis Is an RNA-Binding Protein That Could Participate in Its Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system. PMID:24719864

  15. Augmenting Microarray Data with Literature-Based Knowledge to Enhance Gene Regulatory Network Inference

    PubMed Central

    Kilicoglu, Halil; Shin, Dongwook; Rindflesch, Thomas C.

    2014-01-01

    Gene regulatory networks are a crucial aspect of systems biology in describing molecular mechanisms of the cell. Various computational models rely on random gene selection to infer such networks from microarray data. While incorporation of prior knowledge into data analysis has been deemed important, in practice, it has generally been limited to referencing genes in probe sets and using curated knowledge bases. We investigate the impact of augmenting microarray data with semantic relations automatically extracted from the literature, with the view that relations encoding gene/protein interactions eliminate the need for random selection of components in non-exhaustive approaches, producing a more accurate model of cellular behavior. A genetic algorithm is then used to optimize the strength of interactions using microarray data and an artificial neural network fitness function. The result is a directed and weighted network providing the individual contribution of each gene to its target. For testing, we used invasive ductile carcinoma of the breast to query the literature and a microarray set containing gene expression changes in these cells over several time points. Our model demonstrates significantly better fitness than the state-of-the-art model, which relies on an initial random selection of genes. Comparison to the component pathways of the KEGG Pathways in Cancer map reveals that the resulting networks contain both known and novel relationships. The p53 pathway results were manually validated in the literature. 60% of non-KEGG relationships were supported (74% for highly weighted interactions). The method was then applied to yeast data and our model again outperformed the comparison model. Our results demonstrate the advantage of combining gene interactions extracted from the literature in the form of semantic relations with microarray analysis in generating contribution-weighted gene regulatory networks. This methodology can make a significant contribution to

  16. Augmenting microarray data with literature-based knowledge to enhance gene regulatory network inference.

    PubMed

    Chen, Guocai; Cairelli, Michael J; Kilicoglu, Halil; Shin, Dongwook; Rindflesch, Thomas C

    2014-06-01

    Gene regulatory networks are a crucial aspect of systems biology in describing molecular mechanisms of the cell. Various computational models rely on random gene selection to infer such networks from microarray data. While incorporation of prior knowledge into data analysis has been deemed important, in practice, it has generally been limited to referencing genes in probe sets and using curated knowledge bases. We investigate the impact of augmenting microarray data with semantic relations automatically extracted from the literature, with the view that relations encoding gene/protein interactions eliminate the need for random selection of components in non-exhaustive approaches, producing a more accurate model of cellular behavior. A genetic algorithm is then used to optimize the strength of interactions using microarray data and an artificial neural network fitness function. The result is a directed and weighted network providing the individual contribution of each gene to its target. For testing, we used invasive ductile carcinoma of the breast to query the literature and a microarray set containing gene expression changes in these cells over several time points. Our model demonstrates significantly better fitness than the state-of-the-art model, which relies on an initial random selection of genes. Comparison to the component pathways of the KEGG Pathways in Cancer map reveals that the resulting networks contain both known and novel relationships. The p53 pathway results were manually validated in the literature. 60% of non-KEGG relationships were supported (74% for highly weighted interactions). The method was then applied to yeast data and our model again outperformed the comparison model. Our results demonstrate the advantage of combining gene interactions extracted from the literature in the form of semantic relations with microarray analysis in generating contribution-weighted gene regulatory networks. This methodology can make a significant contribution to

  17. Identification of acid-base catalytic residues of high-Mr thioredoxin reductase from Plasmodium falciparum.

    PubMed

    McMillan, Paul J; Arscott, L David; Ballou, David P; Becker, Katja; Williams, Charles H; Müller, Sylke

    2006-11-03

    High-M(r) thioredoxin reductase from the malaria parasite Plasmodium falciparum (PfTrxR) contains three redox active centers (FAD, Cys-88/Cys-93, and Cys-535/Cys-540) that are in redox communication. The catalytic mechanism of PfTrxR, which involves dithiol-disulfide interchanges requiring acid-base catalysis, was studied by steady-state kinetics, spectral analyses of anaerobic static titrations, and rapid kinetics analysis of wild-type enzyme and variants involving the His-509-Glu-514 dyad as the presumed acid-base catalyst. The dyad is conserved in all members of the enzyme family. Substitution of His-509 with glutamine and Glu-514 with alanine led to TrxR with only 0.5 and 7% of wild type activity, respectively, thus demonstrating the crucial roles of these residues for enzymatic activity. The H509Q variant had rate constants in both the reductive and oxidative half-reactions that were dramatically less than those of wild-type enzyme, and no thiolateflavin charge-transfer complex was observed. Glu-514 was shown to be involved in dithiol-disulfide interchange between the Cys-88/Cys-93 and Cys-535/Cys-540 pairs. In addition, Glu-514 appears to greatly enhance the role of His-509 in acid-base catalysis. It can be concluded that the His-509-Glu-514 dyad, in analogy to those in related oxidoreductases, acts as the acid-base catalyst in PfTrxR.

  18. Surface decoration of polyimide fiber with carbon nanotubes and its application for mechanical enhancement of phosphoric acid-based geopolymers

    NASA Astrophysics Data System (ADS)

    Yang, Tao; Han, Enlin; Wang, Xiaodong; Wu, Dezhen

    2017-09-01

    A new methodology to decorate the surface of polyimide (PI) fiber with carbon nanotubes (CNTs) has been developed in this study. This surface decoration was carried out through a surface alkali treatment, a carboxylation modification, surface functionalization with acyl chloride groups and then with amino groups, and a surface graft of CNTs onto PI fiber. Fourier-transform infrared and X-ray photoelectron spectroscopic characterizations confirmed that CNTs were chemically grafted onto the surface of PI fiber, and scanning electron microscopic observation demonstrated the fiber surface was uniformly and densely covered with CNTs. The surface energy and wettability of PI fiber were improved in the presence of CNTs on the fiber surface, which made a contribution to enhance the interfacial adhesion of PI fiber with other inorganic matrices when used as a reinforcing fiber. The application of CNTs-decorated PI fiber for the reinforcement of phosphoric acid-based geopolymers was investigated, and the results indicated that the geopolymeric composites gained a noticeable reinforcement. Compared to unreinforced geopolymer, the geopolymeric composites achieved a remarkable increase in compressive strength by 120% and in flexural strength by 283%. Fractography investigation demonstrated that the interaction adhesion between the fibers and matrix was enhanced due to the surface decoration of PI fiber with CNTs, which contributed to an improvement in fracture-energy dissipation by fiber pullout and fiber debonding from the matrix. As a result, a significant reinforcement effect on geopolymeric composites was achieved through a fiber-bridging mechanism. This study provided an effective methodology to improve the interracial bonding force for PI fiber and also proves a highly efficient application of CNTs-decorated PI fiber for the mechanical enhancement of geopolymeric composites.

  19. Response of cricopharyngeus muscle to esophageal stimulation by mechanical distension and acid and bile perfusion.

    PubMed

    Chernichenko, Natalya; Woo, Jeong-Soo; Hundal, Jagdeep S; Sasaki, Clarence T

    2011-02-01

    The aim of this study was to identify the response of the cricopharyngeus muscle (CPM) to esophageal stimulation by intraluminal mechanical distension and intraluminal acid and bile perfusion. In 3 adult pigs, electromyographic (EMG) activity of the CPM was recorded at baseline and after esophageal stimulation at 3 levels: proximal, middle, and distal. The esophagus was stimulated with 20-mL balloon distension and intraluminal perfusion of 40 mL 0.1N hydrochloric acid, taurocholic acid (pH 1.5), and chenodeoxycholic acid (pH 7.4) at the rate of 40 mL/min. The EMG spike density was defined as peak-to-peak spikes greater than 10 microV averaged over 10-ms intervals. In all 3 animals, the spike density at baseline was 0. The spike densities increased after proximal and middle distensions to 15.2 +/- 1.5 and 5.1 +/- 1.2 spikes per 10 ms, respectively. No change in CPM EMG activity occurred after distal distension. The spike density following intraluminal perfusion with hydrochloric acid at the distal level was 10.1 +/- 1.1 spikes per 10 ms. No significant change in CPM EMG activity occurred after acid perfusion at the middle and proximal levels. No change in CPM EMG activity occurred after intraluminal esophageal perfusion with either taurocholic acid or chenodeoxycholic acid. Proximal esophageal distension, as well as distal intraluminal acid perfusion, appeared to be important mechanisms in generation of CPM activity. Bile acids, on the other hand, failed to evoke such CPM activity. The data suggest that transpyloric refluxate may not be significant enough to evoke the CPM protective sphincteric function, thereby placing supraesophageal structures at risk of bile injury.

  20. Thai Grade 11 students' alternative conceptions for acid-base chemistry

    NASA Astrophysics Data System (ADS)

    Artdej, Romklao; Ratanaroutai, Thasaneeya; Coll, Richard Kevin; Thongpanchang, Tienthong

    2010-07-01

    This study involved the development of a two-tier diagnostic instrument to assess Thai high school students' understanding of acid-base chemistry. The acid-base diagnostic test (ABDT) comprising 18 items was administered to 55 Grade 11 students in a science and mathematics programme during the second semester of the 2008 academic year. Analysis of students' responses from this study followed the methodology outlined by Çalik and Ayas. The research findings suggest that the ABDT, the multiple choice diagnostic instrument, enables researchers and teachers to classify students' understanding at different levels. Most students exhibited alternative conceptions for several concepts: acid-base theory, dissociation of strong acids or bases, and dissociation of weak acids/bases. Interestingly, one of the concepts that students appeared to find most difficult, and for which they exhibited the most alternative conceptions, was acid-base theory. Some alternative conceptions revealed in this study differ from earlier reports, such as the concept of electrolyte and non-electrolyte solutions as well as the concentration changes of H3O+and OH- in water. These research findings present valuable information for facilitating better understanding of acid-base chemistry by providing insight into the preventable and correctable alternative conceptions exhibited by students.