Science.gov

Sample records for acid-base regulatory mechanisms

  1. Recent advances in understanding trans-epithelial acid-base regulation and excretion mechanisms in cephalopods

    PubMed Central

    Hu, Marian Y; Hwang, Pung-Pung; Tseng, Yung-Che

    2015-01-01

    Cephalopods have evolved complex sensory systems and an active lifestyle to compete with fish for similar resources in the marine environment. Their highly active lifestyle and their extensive protein metabolism has led to substantial acid-base regulatory abilities enabling these organisms to cope with CO2 induced acid-base disturbances. In convergence to teleost, cephalopods possess an ontogeny-dependent shift in ion-regulatory epithelia with epidermal ionocytes being the major site of embryonic acid-base regulation and ammonia excretion, while gill epithelia take these functions in adults. Although the basic morphology and excretory function of gill epithelia in cephalopods were outlined almost half a century ago, modern immunohistological and molecular techniques are bringing new insights to the mechanistic basis of acid-base regulation and excretion of nitrogenous waste products (e.g. NH3/NH4+) across ion regulatory epithelia of cephalopods. Using cephalopods as an invertebrate model, recent findings reveal partly conserved mechanisms but also novel aspects of acid-base regulation and nitrogen excretion in these exclusively marine animals. Comparative studies using a range of marine invertebrates will create a novel and exciting research direction addressing the evolution of pH regulatory and excretory systems. PMID:26716070

  2. Recent advances in understanding trans-epithelial acid-base regulation and excretion mechanisms in cephalopods.

    PubMed

    Hu, Marian Y; Hwang, Pung-Pung; Tseng, Yung-Che

    2015-01-01

    Cephalopods have evolved complex sensory systems and an active lifestyle to compete with fish for similar resources in the marine environment. Their highly active lifestyle and their extensive protein metabolism has led to substantial acid-base regulatory abilities enabling these organisms to cope with CO2 induced acid-base disturbances. In convergence to teleost, cephalopods possess an ontogeny-dependent shift in ion-regulatory epithelia with epidermal ionocytes being the major site of embryonic acid-base regulation and ammonia excretion, while gill epithelia take these functions in adults. Although the basic morphology and excretory function of gill epithelia in cephalopods were outlined almost half a century ago, modern immunohistological and molecular techniques are bringing new insights to the mechanistic basis of acid-base regulation and excretion of nitrogenous waste products (e.g. NH3/NH4 (+)) across ion regulatory epithelia of cephalopods. Using cephalopods as an invertebrate model, recent findings reveal partly conserved mechanisms but also novel aspects of acid-base regulation and nitrogen excretion in these exclusively marine animals. Comparative studies using a range of marine invertebrates will create a novel and exciting research direction addressing the evolution of pH regulatory and excretory systems.

  3. Reaction mechanisms of riboflavin triplet state with nucleic acid bases.

    PubMed

    Lin, Weizhen; Lu, Changyuan; Du, Fuqiang; Shao, Zhiyong; Han, Zhenhui; Tu, Tiecheng; Yao, Side; Lin, Nianyun

    2006-04-01

    ESR and laser flash photolysis studies have determined a reasonable order of reactivity of nucleotides with triplet riboflavin (3Rb*) for the first time. ESR detection of triplet state reactivity of Rb with nucleoside, polynucleotide and DNA has been obtained simultaneously. In addition, ESR spin elimination measurement of the reactivity of 3Rb* with nucleotides in good accord with laser flash photolysis determination of the corresponding rate constants offers a simple and reliable method to detect the reactivities of nucleic acids and its components with photoexcited flavins. Kinetic, ESR and thermodynamic studies have demonstrated that Rb should be a strong endogenous photosensitizer capable of oxidizing all nucleic acid bases, and preferentially two purine nucleotides with high rate constants.

  4. Regulatory Mechanisms of Hsp90

    PubMed Central

    Prodromou, Chrisostomos

    2017-01-01

    The ability of Hsp90 to activate a disparate clientele implicates this chaperone in diverse biological processes. To accommodate such varied roles, Hsp90 requires a variety of regulatory mechanisms that are coordinated in order to modulate its activity appropriately. Amongst these, the master-regulator heat shock factor 1 (HSF1) is critically important in upregulating Hsp90 during stress, but is also responsible, through interaction with specific transcription factors (such as STAT1 and Strap/p300) for the integration of a variety of biological signals that ultimately modulate Hsp90 expression. Additionally, transcription factors, such as STAT1, STAT3 (including STAT1-STAT3 oligomers), NF-IL6, and NF-kB, are known to influence Hsp90 expression directly. Co-chaperones offer another mechanism for Hsp90 regulation, and these can modulate the chaperone cycle appropriately for specific clientele. Co-chaperones include those that deliver specific clients to Hsp90, and others that regulate the chaperone cycle for specific Hsp90-client complexes by modulating Hsp90s ATPase activity. Finally, post-translational modification (PTM) of Hsp90 and its co-chaperones helps too further regulate the variety of different Hsp90 complexes found in cells. PMID:28289734

  5. IA channels: diverse regulatory mechanisms.

    PubMed

    Carrasquillo, Yarimar; Nerbonne, Jeanne M

    2014-04-01

    In many peripheral and central neurons, A-type K(+) currents, IA, have been identified and shown to be key determinants in shaping action potential waveforms and repetitive firing properties, as well as in the regulation of synaptic transmission and synaptic plasticity. The functional properties and physiological roles of native neuronal IA, however, have been shown to be quite diverse in different types of neurons. Accumulating evidence suggests that this functional diversity is generated by multiple mechanisms, including the expression and subcellular distributions of IA channels encoded by different voltage-gated K(+) (Kv) channel pore-forming (α) subunits, interactions of Kv α subunits with cytosolic and/or transmembrane accessory subunits and regulatory proteins and post-translational modifications of channel subunits. Several recent reports further suggest that local protein translation in the dendrites of neurons and interactions between IA channels with other types of voltage-gated ion channels further expands the functional diversity of native neuronal IA channels. Here, we review the diverse molecular mechanisms that have been shown or proposed to underlie the functional diversity of native neuronal IA channels.

  6. Acid-base transport in pancreatic cancer: molecular mechanisms and clinical potential.

    PubMed

    Kong, Su Chii; Giannuzzo, Andrea; Gianuzzo, Andrea; Novak, Ivana; Pedersen, Stine Falsig

    2014-12-01

    Solid tumors are characterized by a microenvironment that is highly acidic, while intracellular pH (pHi) is normal or even elevated. This is the result of elevated metabolic rates in the highly proliferative cancer cells, in conjunction with often greatly increased rates of net cellular acid extrusion. Studies in various cancers have suggested that while the acid extrusion mechanisms employed are generally the same as those in healthy cells, the specific transporters upregulated vary with the cancer type. The main such transporters include Na(+)/H(+) exchangers, various HCO3(-) transporters, H(+) pumps, and lactate-H(+) cotransporters. The mechanisms leading to their dysregulation in cancer are incompletely understood but include changes in transporter expression levels, trafficking and membrane localization, and posttranslational modifications. In turn, accumulating evidence has revealed that in addition to supporting their elevated metabolic rate, their increased acid efflux capacity endows the cancer cells with increased capacity for invasiveness, proliferation, and chemotherapy resistance. The pancreatic duct exhibits an enormous capacity for acid-base transport, rendering pHi dysregulation a potentially very important topic in pancreatic ductal adenocarcinoma (PDAC). PDAC - accounting for about 90% of all pancreatic cancers - has one of the highest cancer mortality rates known, and new diagnostic and treatment options are highly needed. However, very little is known about whether pH regulation is altered in PDAC and, if so, the possible role of this in cancer development. Here, we review current models for pancreatic acid-base transport and pH homeostasis and summarize current views on acid-base dysregulation in cancer, focusing where possible on the few studies to date in PDAC. Finally, we present new data-mining analyses of acid-base transporter expression changes in PDAC and discuss essential directions for future work.

  7. Comparative studies of gene regulatory mechanisms.

    PubMed

    Pai, Athma A; Gilad, Yoav

    2014-12-01

    It has become increasingly clear that changes in gene regulation have played an important role in adaptive evolution both between and within species. Over the past five years, comparative studies have moved beyond simple characterizations of differences in gene expression levels within and between species to studying variation in regulatory mechanisms. We still know relatively little about the precise chain of events that lead to most regulatory adaptations, but we have taken significant steps towards understanding the relative importance of changes in different mechanisms of gene regulatory evolution. In this review, we first discuss insights from comparative studies in model organisms, where the available experimental toolkit is extensive. We then focus on a few recent comparative studies in primates, where the limited feasibility of experimental manipulation dictates the approaches that can be used to study gene regulatory evolution.

  8. What is the Ultimate Goal in Acid-Base Regulation?

    ERIC Educational Resources Information Center

    Balakrishnan, Selvakumar; Gopalakrishnan, Maya; Alagesan, Murali; Prakash, E. Sankaranarayanan

    2007-01-01

    It is common to see chapters on acid-base physiology state that the goal of acid-base regulatory mechanisms is to maintain the pH of arterial plasma and not arterial PCO [subscript 2] (Pa[subscript CO[subscript 2

  9. Advances in Autophagy Regulatory Mechanisms

    PubMed Central

    Gallagher, Laura E.; Williamson, Leon E.; Chan, Edmond Y. W.

    2016-01-01

    Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK) complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1). Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1. PMID:27187479

  10. Regulatory mechanisms link phenotypic plasticity to evolvability.

    PubMed

    van Gestel, Jordi; Weissing, Franz J

    2016-04-18

    Organisms have a remarkable capacity to respond to environmental change. They can either respond directly, by means of phenotypic plasticity, or they can slowly adapt through evolution. Yet, how phenotypic plasticity links to evolutionary adaptability is largely unknown. Current studies of plasticity tend to adopt a phenomenological reaction norm (RN) approach, which neglects the mechanisms underlying plasticity. Focusing on a concrete question - the optimal timing of bacterial sporulation - we here also consider a mechanistic approach, the evolution of a gene regulatory network (GRN) underlying plasticity. Using individual-based simulations, we compare the RN and GRN approach and find a number of striking differences. Most importantly, the GRN model results in a much higher diversity of responsive strategies than the RN model. We show that each of the evolved strategies is pre-adapted to a unique set of unseen environmental conditions. The regulatory mechanisms that control plasticity therefore critically link phenotypic plasticity to the adaptive potential of biological populations.

  11. α-Ketoglutarate regulates acid-base balance through an intrarenal paracrine mechanism

    PubMed Central

    Tokonami, Natsuko; Morla, Luciana; Centeno, Gabriel; Mordasini, David; Ramakrishnan, Suresh Krishna; Nikolaeva, Svetlana; Wagner, Carsten A.; Bonny, Olivier; Houillier, Pascal; Doucet, Alain; Firsov, Dmitri

    2013-01-01

    Paracrine communication between different parts of the renal tubule is increasingly recognized as an important determinant of renal function. Previous studies have shown that changes in dietary acid-base load can reverse the direction of apical α-ketoglutarate (αKG) transport in the proximal tubule and Henle’s loop from reabsorption (acid load) to secretion (base load). Here we show that the resulting changes in the luminal concentrations of αKG are sensed by the αKG receptor OXGR1 expressed in the type B and non-A–non-B intercalated cells of the connecting tubule (CNT) and the cortical collecting duct (CCD). The addition of 1 mM αKG to the tubular lumen strongly stimulated Cl–-dependent HCO3– secretion and electroneutral transepithelial NaCl reabsorption in microperfused CCDs of wild-type mice but not Oxgr1–/– mice. Analysis of alkali-loaded mice revealed a significantly reduced ability of Oxgr1–/– mice to maintain acid-base balance. Collectively, these results demonstrate that OXGR1 is involved in the adaptive regulation of HCO3– secretion and NaCl reabsorption in the CNT/CCD under acid-base stress and establish αKG as a paracrine mediator involved in the functional coordination of the proximal and the distal parts of the renal tubule. PMID:23934124

  12. Major regulatory mechanisms involved in sperm motility.

    PubMed

    Pereira, Rute; Sá, Rosália; Barros, Alberto; Sousa, Mário

    2017-01-01

    The genetic bases and molecular mechanisms involved in the assembly and function of the flagellum components as well as in the regulation of the flagellar movement are not fully understood, especially in humans. There are several causes for sperm immotility, of which some can be avoided and corrected, whereas other are related to genetic defects and deserve full investigation to give a diagnosis to patients. This review was performed after an extensive literature search on the online databases PubMed, ScienceDirect, and Web of Science. Here, we review the involvement of regulatory pathways responsible for sperm motility, indicating possible causes for sperm immotility. These included the calcium pathway, the cAMP-dependent protein kinase pathway, the importance of kinases and phosphatases, the function of reactive oxygen species, and how the regulation of cell volume and osmolarity are also fundamental components. We then discuss main gene defects associated with specific morphological abnormalities. Finally, we slightly discuss some preventive and treatments approaches to avoid development of conditions that are associated with unspecified sperm immotility. We believe that in the near future, with the development of more powerful techniques, the genetic causes of sperm immotility and the regulatory mechanisms of sperm motility will be better understand, thus enabling to perform a full diagnosis and uncover new therapies.

  13. Major regulatory mechanisms involved in sperm motility

    PubMed Central

    Pereira, Rute; Sá, Rosália; Barros, Alberto; Sousa, Mário

    2017-01-01

    The genetic bases and molecular mechanisms involved in the assembly and function of the flagellum components as well as in the regulation of the flagellar movement are not fully understood, especially in humans. There are several causes for sperm immotility, of which some can be avoided and corrected, whereas other are related to genetic defects and deserve full investigation to give a diagnosis to patients. This review was performed after an extensive literature search on the online databases PubMed, ScienceDirect, and Web of Science. Here, we review the involvement of regulatory pathways responsible for sperm motility, indicating possible causes for sperm immotility. These included the calcium pathway, the cAMP-dependent protein kinase pathway, the importance of kinases and phosphatases, the function of reactive oxygen species, and how the regulation of cell volume and osmolarity are also fundamental components. We then discuss main gene defects associated with specific morphological abnormalities. Finally, we slightly discuss some preventive and treatments approaches to avoid development of conditions that are associated with unspecified sperm immotility. We believe that in the near future, with the development of more powerful techniques, the genetic causes of sperm immotility and the regulatory mechanisms of sperm motility will be better understand, thus enabling to perform a full diagnosis and uncover new therapies. PMID:26680031

  14. Mechanisms of T regulatory cell function.

    PubMed

    Askenasy, Nadir; Kaminitz, Ayelet; Yarkoni, Shai

    2008-05-01

    Regulatory T cells (Treg) play a pivotal role in tolerance to self-antigens and tissue grafts, and suppression of autoimmune reactions. These cells modulate the intensity and quality of immune reactions through attenuation of the cytolytic activities of reactive immune cells. Treg cells operate primarily at the site of inflammation where they modulate the immune reaction through three major mechanisms: a) direct killing of cytotoxic cells through cell-to-cell contact, b) inhibition of cytokine production by cytotoxic cells, in particular interleukin-2, c) direct secretion of immunomodulatory cytokines, in particular TGF-beta and interleukin-10. In addition to differential contributions of these mechanisms under variable inflammatory conditions, mechanistic complexity and diversity evolves from the diverse tasks performed by various Treg cell subsets in different stages of the immune reaction. Here we attempt to integrate the current experimental evidence to delineate the major suppressive pathways of Treg cells.

  15. Disaggregation is a Mechanism for Emission Turn-On of ortho-Aminomethylphenylboronic Acid-Based Saccharide Sensors.

    PubMed

    Chapin, Brette M; Metola, Pedro; Vankayala, Sai Lakshmana; Woodcock, H Lee; Mooibroek, Tiddo J; Lynch, Vincent M; Larkin, Joseph D; Anslyn, Eric Van

    2017-03-30

    ortho-Aminomethylphenylboronic acid-based receptors with appended fluorophores are commonly used as molecular sensors for saccharides in aqueous media. The mechanism for fluorescence modulation in these sensors has been attributed to some form of photoinduced electron transfer (PET) quenching, which is diminished in the presence of saccharides. Using a well-known boronic acid-based saccharide sensor (3), this work reveals a new mechanism for fluorescence turn-on in these types of sensors. Compound 3 exhibits an excimer, and the associated ground-state aggregation is responsible for fluorescence modulation under certain conditions. When fructose was titrated into a solution of 3 in 2:1 water/methanol with NaCl, the fluorescence intensity increased. Yet, when the same titration was repeated in pure methanol, a solvent in which the sensor does not aggregate, no fluorescence response to fructose was observed. This reveals that the fluorescence increase is not fully associated with fructose binding, but instead disaggregation of the sensor in the presence of fructose. Further, an analogue of the sensor that does not contain a boronic acid (4) responded nearly identically to 3 in the presence of fructose, despite having no functional group with which to bind the saccharide. This further supports the claim that fluorescence modulation is not primarily a result of binding, but of disaggregation. Using an indicator displacement assay and isothermal titration calorimetry, it was confirmed that fructose does indeed bind to the sensor. Thus, our evidence reveals that while binding occurs with fructose in the aqueous solvent system used, it is not related to the majority of the fluorescence modulation. Instead, disaggregation dominates the signal turn-on, and is thus a mechanism that should be investigated in other ortho-aminomethylphenylboronic acid-based sensors.

  16. Multiphoton imaging of renal regulatory mechanisms.

    PubMed

    Peti-Peterdi, János; Toma, Ildikó; Sipos, Arnold; Vargas, Sarah L

    2009-04-01

    Most physiological functions of the kidneys, including the clearance of metabolic waste products, maintenance of body fluid, electrolyte homeostasis, and blood pressure, are achieved by complex interactions between multiple renal cell types and previously inaccessible structures in many organ parts that have been difficult to study. Multiphoton fluorescence microscopy offers a state-of-the-art imaging technique for deep optical sectioning of living tissues and organs with minimal deleterious effects. Dynamic regulatory processes and multiple functions in the intact kidney can be quantitatively visualized in real time, noninvasively, and with submicron resolution. This article reviews innovative multiphoton imaging technologies and their applications that provided the most complex, immediate, and dynamic portrayal of renal function-clearly depicting as well as analyzing the components and mechanisms involved in renal (patho)physiology.

  17. Biochemical Features and Functional Implications of the RNA-Based T-Box Regulatory Mechanism

    PubMed Central

    Gutiérrez-Preciado, Ana; Henkin, Tina M.; Grundy, Frank J.; Yanofsky, Charles; Merino, Enrique

    2009-01-01

    Summary: The T-box mechanism is a common regulatory strategy used for modulating the expression of genes of amino acid metabolism-related operons in gram-positive bacteria, especially members of the Firmicutes. T-box regulation is usually based on a transcription attenuation mechanism in which an interaction between a specific uncharged tRNA and the 5′ region of the transcript stabilizes an antiterminator structure in preference to a terminator structure, thereby preventing transcription termination. Although single T-box regulatory elements are common, double or triple T-box arrangements are also observed, expanding the regulatory range of these elements. In the present study, we predict the functional implications of T-box regulation in genes encoding aminoacyl-tRNA synthetases, proteins of amino acid biosynthetic pathways, transporters, and regulatory proteins. We also consider the global impact of the use of this regulatory mechanism on cell physiology. Novel biochemical relationships between regulated genes and their corresponding metabolic pathways were revealed. Some of the genes identified, such as the quorum-sensing gene luxS, in members of the Lactobacillaceae were not previously predicted to be regulated by the T-box mechanism. Our analyses also predict an imbalance in tRNA sensing during the regulation of operons containing multiple aminoacyl-tRNA synthetase genes or biosynthetic genes involved in pathways common to more than one amino acid. Based on the distribution of T-box regulatory elements, we propose that this regulatory mechanism originated in a common ancestor of members of the Firmicutes, Chloroflexi, Deinococcus-Thermus group, and Actinobacteria and was transferred into the Deltaproteobacteria by horizontal gene transfer. PMID:19258532

  18. Kinetics and Mechanisms of the Acid-base Reaction Between NH3 and HCOOH in Interstellar Ice Analogs

    NASA Astrophysics Data System (ADS)

    Bergner, Jennifer B.; Öberg, Karin I.; Rajappan, Mahesh; Fayolle, Edith C.

    2016-10-01

    Interstellar complex organic molecules are commonly observed during star formation, and are proposed to form through radical chemistry in icy grain mantles. Reactions between ions and neutral molecules in ices may provide an alternative cold channel to complexity, as ion-neutral reactions are thought to have low or even no-energy barriers. Here we present a study of the kinetics and mechanisms of a potential ion-generating, acid-base reaction between NH3 and HCOOH to form the salt NH{}4+HCOO-. We observe salt growth at temperatures as low as 15 K, indicating that this reaction is feasible in cold environments. The kinetics of salt growth are best fit by a two-step model involving a slow “pre-reaction” step followed by a fast reaction step. The reaction energy barrier is determined to be 70 ± 30 K with a pre-exponential factor 1.4 ± 0.4 × 10-3 s-1. The pre-reaction rate varies under different experimental conditions and likely represents a combination of diffusion and orientation of reactant molecules. For a diffusion-limited case, the pre-reaction barrier is 770 ± 110 K with a pre-exponential factor of ˜7.6 × 10-3 s-1. Acid-base chemistry of common ice constituents is thus a potential cold pathway to generating ions in interstellar ices.

  19. Distribution of sea urchins living near shallow water CO2 vents is dependent upon species acid-base and ion-regulatory abilities.

    PubMed

    Calosi, P; Rastrick, S P S; Graziano, M; Thomas, S C; Baggini, C; Carter, H A; Hall-Spencer, J M; Milazzo, M; Spicer, J I

    2013-08-30

    To reduce the negative effect of climate change on Biodiversity, the use of geological CO2 sequestration has been proposed; however leakage from underwater storages may represent a risk to marine life. As extracellular homeostasis is important in determining species' ability to cope with elevated CO2, we investigated the acid-base and ion regulatory responses, as well as the density, of sea urchins living around CO2 vents at Vulcano, Italy. We conducted in situ transplantation and field-based laboratory exposures to different pCO2/pH regimes. Our results confirm that sea urchins have some ability to regulate their extracellular fluid under elevated pCO2. Furthermore, we show that even in closely-related taxa divergent physiological capabilities underlie differences in taxa distribution around the CO2 vent. It is concluded that species distribution under the sort of elevated CO2 conditions occurring with leakages from geological storages and future ocean acidification scenarios, may partly be determined by quite subtle physiological differentiation.

  20. Physical and mechanical properties of extruded poly(lactic acid)-based Paulownia elongata biocomposites

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Paulownia wood flour (PWF), a byproduct of milling lumber, was tested as bio-filler with polylactic acid (PLA). Paulownia wood (PW) shavings were milled and separated into particle fractions and then blended with PLA with a single screw extruder. Mechanical and thermal properties were tested. Dif...

  1. Structural Analysis and Mechanical Characterization of Hyaluronic Acid-Based Doubly Cross-Linked Networks

    PubMed Central

    Jha, Amit K.; Hule, Rohan A.; Jiao, Tong; Teller, Sean S.; Clifton, Rodney J.; Duncan, Randall L.; Pochan, Darrin J.; Jia, Xinqiao

    2009-01-01

    We have created a new class of hyaluronic acid (HA)-based hydrogel materials with HA hydrogel particles (HGPs) embedded in and covalently cross-linked to a secondary network. HA HGPs with an average diameter of ∼900 nm and narrow particle size distribution were synthesized using a refined reverse micelle polymerization technique. The average mesh size of the HGPs was estimated to be approximately 5.5 to 7.0 nm by a protein uptake experiment. Sodium periodate oxidation not only introduced aldehyde groups to the particles but also reduced the average particle size. The aldehyde groups generated were used as reactive handles for subsequent cross-linking with an HA derivative containing hydrazide groups. The resulting macroscopic gels contain two distinct hierarchical networks (doubly cross-linked networks, DXNs): one within individual particles and another among different particles. Bulk gels (BGs) formed by direct mixing of HA derivatives with mutually reactive groups were included for comparison. The hydrogel microstructures were collectively characterized by microscopy and neutron scattering techniques. Their viscoelasticity was quantified at low frequencies (0.1−10 Hz) using a controlled stress rheometer and at high frequencies (up to 200 Hz) with a home-built torsional wave apparatus. Both BGs and DXNs are stable elastic gels that become stiffer at higher frequencies. The HA-based DXN offers unique structural hierarchy and mechanical properties that are suitable for soft tissue regeneration. PMID:20046226

  2. Aminolevulinic Acid-Based Tumor Detection and Therapy: Molecular Mechanisms and Strategies for Enhancement

    PubMed Central

    Yang, Xue; Palasuberniam, Pratheeba; Kraus, Daniel; Chen, Bin

    2015-01-01

    Aminolevulinic acid (ALA) is the first metabolite in the heme biosynthesis pathway in humans. In addition to the end product heme, this pathway also produces other porphyrin metabolites. Protoporphyrin (PpIX) is one heme precursor porphyrin with good fluorescence and photosensitizing activity. Because tumors and other proliferating cells tend to exhibit a higher level of PpIX than normal cells after ALA incubation, ALA has been used as a prodrug to enable PpIX fluorescence detection and photodynamic therapy (PDT) of lesion tissues. Extensive studies have been carried out in the past twenty years to explore why some tumors exhibit elevated ALA-mediated PpIX and how to enhance PpIX levels to achieve better tumor detection and treatment. Here we would like to summarize previous research in order to stimulate future studies on these important topics. In this review, we focus on summarizing tumor-associated alterations in heme biosynthesis enzymes, mitochondrial functions and porphyrin transporters that contribute to ALA-PpIX increase in tumors. Mechanism-based therapeutic strategies for enhancing ALA-based modalities including iron chelators, differentiation agents and PpIX transporter inhibitors are also discussed. PMID:26516850

  3. Preparation of a multifunctional material with superhydrophobicity, superparamagnetism, mechanical stability and acids-bases resistance by electrospinning

    NASA Astrophysics Data System (ADS)

    Wang, Shuai; Liu, Qingwen; Zhang, Yang; Wang, Shaodan; Li, Yaoxian; Yang, Qingbiao; Song, Yan

    2013-08-01

    A multifunctional material with superhydrophobicity, superparamagnetism, mechanical stability and acids-bases resistance was developed from the bead-on-string PVDF and Fe3O4@SiO2@POTS nanoparticles by electrospinning in this work. The Fe3O4@SiO2@POTS nanoparticles which have excellent superparamagnetism were successfully prepared and subsequently introduced into PVDF precursor solution. Through electrospinning, Fe3O4@SiO2@POTS nanoparticles irregularly distributed in the membrane to not only make a dual-scale roughness which is beneficial to obtain a superhydrophobic surface but also stimulate the material turns to superparamagnetic for wider use in different fields. More importantly, the film shows stable superhydrophobicity even for many corrosive solutions, such as acidic or basic solutions over a wide pH range and remarkable mechanical stability. The composition and surface structure of the film are the two critical factors that induce such unusual properties. The weight ratio of Fe3O4@SiO2@POTS/PVDF can strongly influence the superhydrophobicity and mechanical properties of the composite films.

  4. Modeling Transport and Flow Regulatory Mechanisms of the Kidney

    PubMed Central

    Layton, Anita T.

    2013-01-01

    The kidney plays an indispensable role in the regulation of whole-organism water balance, electrolyte balance, and acid-base balance, and in the excretion of metabolic wastes and toxins. In this paper, we review representative mathematical models that have been developed to better understand kidney physiology and pathophysiology, including the regulation of glomerular filtration, the regulation of renal blood flow by means of the tubuloglomerular feedback mechanisms and of the myogenic mechanism, the urine concentrating mechanism, and regulation of renal oxygen transport. We discuss how such modeling efforts have significantly expanded our understanding of renal function in both health and disease. PMID:23914303

  5. Mechanical Behavior and Thermal Stability of Acid-Base Phosphate Cements and Composites Fabricated at Ambient Temperature

    NASA Astrophysics Data System (ADS)

    Colorado Lopera, Henry Alonso

    This dissertation presents the study of the mechanical behavior and thermal stability of acid-base phosphate cements (PCs) and composites fabricated at ambient temperature. These materials are also known as chemically bonded phosphate ceramics (CBPCs). Among other advantages of using PCs when compared with traditional cements are the better mechanical properties (compressive and flexural strength), lower density, ultra-fast (controllable) setting time, controllable pH, and an environmentally benign process. Several PCs based on wollastonite and calcium and alumino phosphates after thermal exposure up to 1000°C have been investigated. First, the thermo-mechanical and chemical stability of wollastonite-based PC (Wo-PC) exposed to temperatures up to 1000°C in air environment were studied. The effects of processing conditions on the curing and shrinkage of the wollastonite-based PC were studied. The chemical reactions and phase transformations during the fabrication and during the thermal exposure are analyzed in detail using scanning electron microscopy (SEM), X-ray diffraction (XRD), and thermo-gravimetric analysis (TGA Then, the thermo-mechanical and chemical stability of glass, carbon and basalt fiber reinforced Wo-PC composites, were studied using SEM, XRD, TGA. The flexural strength and Weibull statistics were analyzed. A significant strength degradation in the composites were found after the thermal exposure at elevated temperatures due to the interdifusion and chemical reactions across the fibers and the matrix at temperatures over 600°C. To overcome this barrier, we have developed a new PC based on calcium and alumino-phosphates (Ca-Al PCs). The Ca-Al PCs were studied in detail using SEM, XRD, TGA, curing, shrinkage, Weibull statistics, and compression tests. Our study has confirmed that this new composite material is chemically and mechanically stable at temperatures up to 1000°C. Moreover, the compression strength increases after exposure to 1000

  6. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    PubMed Central

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine

    2015-01-01

    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution. PMID:26184971

  7. Iron and ageing: an introduction to iron regulatory mechanisms.

    PubMed

    Levenson, Cathy W; Tassabehji, Nadine M

    2004-07-01

    While there have been significant advances made in our understanding of the cellular and molecular mechanisms that regulate iron absorption, transport, storage, and utilization, the effect of ageing on these mechanisms and the role of iron in the ageing process is not fully understood. Thus, this review will provide an overview of the iron regulatory mechanisms that may be a factor in the ageing process. Additional reviews in this volume represent an attempt to explore the very latest information on the regulation of iron with a particular emphasis on age-related pathology including mitochondrial function, Parkinson's disease, Alzheimer's disease, stroke, and cardiovascular disease.

  8. Regulatory mechanisms underlying the differential growth of dendrites and axons.

    PubMed

    Wang, Xin; Sterne, Gabriella R; Ye, Bing

    2014-08-01

    A typical neuron is comprised of an information input compartment, or the dendrites, and an output compartment, known as the axon. These two compartments are the structural basis for functional neural circuits. However, little is known about how dendritic and axonal growth are differentially regulated. Recent studies have uncovered two distinct types of regulatory mechanisms that differentiate dendritic and axonal growth: dedicated mechanisms and bimodal mechanisms. Dedicated mechanisms regulate either dendritespecific or axon-specific growth; in contrast, bimodal mechanisms direct dendritic and axonal development in opposite manners. Here, we review the dedicated and bimodal regulators identified by recent Drosophila and mammalian studies. The knowledge of these underlying molecular mechanisms not only expands our understanding about how neural circuits are wired, but also provides insights that will aid in the rational design of therapies for neurological diseases.

  9. Secretory pattern and regulatory mechanism of growth hormone in cattle

    PubMed Central

    2016-01-01

    Abstract The ultradian rhythm of growth hormone (GH) secretion has been known in several animal species for years and has recently been observed in cattle. Although the physiological significance of the rhythm is not yet fully understood, it appears essential for normal growth. In this review, previous studies concerning the GH secretory pattern in cattle, including its ultradian rhythm, are introduced and the regulatory mechanism is discussed on the basis of recent findings. PMID:26260675

  10. Secretory pattern and regulatory mechanism of growth hormone in cattle.

    PubMed

    Kasuya, Etsuko

    2016-02-01

    The ultradian rhythm of growth hormone (GH) secretion has been known in several animal species for years and has recently been observed in cattle. Although the physiological significance of the rhythm is not yet fully understood, it appears essential for normal growth. In this review, previous studies concerning the GH secretory pattern in cattle, including its ultradian rhythm, are introduced and the regulatory mechanism is discussed on the basis of recent findings.

  11. Gene regulatory network inference using out of equilibrium statistical mechanics

    PubMed Central

    Benecke, Arndt

    2008-01-01

    Spatiotemporal control of gene expression is fundamental to multicellular life. Despite prodigious efforts, the encoding of gene expression regulation in eukaryotes is not understood. Gene expression analyses nourish the hope to reverse engineer effector-target gene networks using inference techniques. Inference from noisy and circumstantial data relies on using robust models with few parameters for the underlying mechanisms. However, a systematic path to gene regulatory network reverse engineering from functional genomics data is still impeded by fundamental problems. Recently, Johannes Berg from the Theoretical Physics Institute of Cologne University has made two remarkable contributions that significantly advance the gene regulatory network inference problem. Berg, who uses gene expression data from yeast, has demonstrated a nonequilibrium regime for mRNA concentration dynamics and was able to map the gene regulatory process upon simple stochastic systems driven out of equilibrium. The impact of his demonstration is twofold, affecting both the understanding of the operational constraints under which transcription occurs and the capacity to extract relevant information from highly time-resolved expression data. Berg has used his observation to predict target genes of selected transcription factors, and thereby, in principle, demonstrated applicability of his out of equilibrium statistical mechanics approach to the gene network inference problem. PMID:19404429

  12. Sociocognitive self-regulatory mechanisms governing transgressive behavior.

    PubMed

    Bandura, A; Caprara, G V; Barbaranelli, C; Pastorelli, C; Regalia, C

    2001-01-01

    This longitudinal research examined a structural model of the self-regulatory mechanisms governing transgressive conduct. Perceived academic and self-regulatory efficacy concurrently and longitudinally deterred transgressiveness both directly and by fostering prosocialness and adherence to moral self-sanctions for harmful conduct. The impact of perceived social self-efficacy was mediated through prosocialness. Moral disengagement and prosocialness affected transgressiveness through the mediating influence of irascible affectivity and hostile rumination. Ruminative affectivity, in turn, both concurrently and longitudinally affected transgressiveness. Moral disengagement also contributed independently to variance in transgressiveness over time. This pattern of relations was obtained after controlling for prior transgressiveness. The structural model was replicated across gender and provided a better fit to the data than did several alternative models.

  13. Regulatory mechanisms of EGFR signalling during Drosophila eye development.

    PubMed

    Malartre, Marianne

    2016-05-01

    EGFR signalling is a well-conserved signalling pathway playing major roles during development and cancers. This review explores what studying the EGFR pathway during Drosophila eye development has taught us in terms of the diversity of its regulatory mechanisms. This model system has allowed the identification of numerous positive and negative regulators acting at specific time and place, thus participating to the tight control of signalling. EGFR signalling regulation is achieved by a variety of mechanisms, including the control of ligand processing, the availability of the receptor itself and the transduction of the cascade in the cytoplasm. Ultimately, the transcriptional responses contribute to the establishment of positive and negative feedback loops. The combination of these multiple mechanisms employed to regulate the EGFR pathway leads to specific cellular outcomes involved in functions as diverse as the acquisition of cell fate, proliferation, survival, adherens junction remodelling and morphogenesis.

  14. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms.

    PubMed

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-03-21

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms.

  15. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms

    PubMed Central

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-01-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  16. Structural and catalytic effects of an invariant purine substitution in the hammerhead ribozyme: implications for the mechanism of acid-base catalysis.

    PubMed

    Schultz, Eric P; Vasquez, Ernesto E; Scott, William G

    2014-09-01

    The hammerhead ribozyme catalyzes RNA cleavage via acid-base catalysis. Whether it does so by general acid-base catalysis, in which the RNA itself donates and abstracts protons in the transition state, as is typically assumed, or by specific acid-base catalysis, in which the RNA plays a structural role and proton transfer is mediated by active-site water molecules, is unknown. Previous biochemical and crystallographic experiments implicate an invariant purine in the active site, G12, as the general base. However, G12 may play a structural role consistent with specific base catalysis. To better understand the role of G12 in the mechanism of hammerhead catalysis, a 2.2 Å resolution crystal structure of a hammerhead ribozyme from Schistosoma mansoni with a purine substituted for G12 in the active site of the ribozyme was obtained. Comparison of this structure (PDB entry 3zd4), in which A12 is substituted for G, with three previously determined structures that now serve as important experimental controls, allows the identification of structural perturbations that are owing to the purine substitution itself. Kinetic measurements for G12 purine-substituted schistosomal hammerheads confirm a previously observed dependence of rate on the pK(a) of the substituted purine; in both cases inosine, which is similar to G in pK(a) and hydrogen-bonding properties, is unexpectedly inactive. Structural comparisons indicate that this may primarily be owing to the lack of the exocyclic 2-amino group in the G12A and G12I substitutions and its structural effect upon both the nucleotide base and phosphate of A9. The latter involves the perturbation of a previously identified and well characterized metal ion-binding site known to be catalytically important in both minimal and full-length hammerhead ribozyme sequences. The results permit it to be suggested that G12 plays an important role in stabilizing the active-site structure. This result, although not inconsistent with the potential

  17. Toxin-mediated gene regulatory mechanism in Staphylococcus aureus

    PubMed Central

    Joo, Hwang-Soo; Otto, Michael

    2016-01-01

    The dangerous human pathogen Staphylococcus aureus relies heavily on toxins to cause disease, but toxin production can put a strong burden on the bacteria’s energy balance. Thus, controlling the synthesis of proteins solely needed in times of toxin production represents a way for the bacteria to avoid wasting energy. One hypothetical manner to accomplish this sort of regulation is by gene regulatory functions of the toxins themselves. There have been several reports about gene regulation by toxins in S. aureus, but these were never verified on the molecular level. In our study published in MBio [Joo et al., 7(5). pii: e01579-16], we show that phenol-soluble modulins (PSMs), important peptide toxins of S. aureus, release a repressor from the promoter of the operon encoding the toxin export system, thereby enabling toxin secretion. This study describes the first molecular regulatory mechanism exerted by an S. aureus toxin, setting a paradigmatic example of how S. aureus toxins may influence cell functions to adjust them to times of toxin production.

  18. The Molecular Mechanisms of Regulatory T Cell Immunosuppression

    PubMed Central

    Pandiyan, Pushpa; Zheng, Lixin; Lenardo, Michael J.

    2011-01-01

    CD4+CD25+Foxp3+ T lymphocytes, known as regulatory T cells or Tregs, have been proposed to be a lineage of professional immune suppressive cells that exclusively counteract the effects of the immunoprotective “helper” and “cytotoxic” lineages of T lymphocytes. Here we discuss new concepts on the mechanisms and functions of Tregs. There are several key points we emphasize: 1. Tregs exert suppressive effects both directly on effector T cells and indirectly through antigen-presenting cells; 2. Regulation can occur through a novel mechanism of cytokine consumption to regulate as opposed to the usual mechanism of cytokine/chemokine production; 3. In cases where CD4+ effector T cells are directly inhibited by Tregs, it is chiefly through a mechanism of lymphokine withdrawal apoptosis leading to polyclonal deletion; and 4. Contrary to the current view, we discuss new evidence that Tregs, similar to other T-cells lineages, can promote protective immune responses in certain infectious contexts (Chen et al., 2011; Pandiyan et al., 2011). Although these points are at variance to varying degrees with the standard model of Treg behavior, we will recount developing findings that support these new concepts. PMID:22566849

  19. Glucose- and nitrogen sensing and regulatory mechanisms in Saccharomyces cerevisiae.

    PubMed

    Rødkaer, Steven V; Faergeman, Nils J

    2014-08-01

    Pro- and eukaryotic cells are constantly challenged by varying concentrations of nutrients in their environment. Perceiving and adapting to such changes are therefore crucial for cellular viability. Thus, numerous specialized cellular receptors continuously sense and react to the availability of nutrients such as glucose and nitrogen. When stimulated, these receptors initiate various cellular signaling pathways, which in concert constitute a complex regulatory network. To ensure a highly specific response, these pathways and networks cross-communicate with each other and are regulated at several steps and by numerous different regulators. As numerous of these regulating proteins, biochemical mechanisms, and cellular pathways are evolutionary conserved, complex biochemical information relevant to humans can be obtained by studying simple organisms. Thus, the yeast Saccharomyces cerevisiae has been recognized as a powerful model system to study fundamental biochemical processes. In the present review, we highlight central signaling pathways and molecular circuits conferring nitrogen- and glucose sensing in S. cerevisiae.

  20. Restricted autoantigen recognition associated with deletional and adaptive regulatory mechanisms.

    PubMed

    Gebe, John A; Yue, Betty B; Unrath, Kelly A; Falk, Ben A; Nepom, Gerald T

    2009-07-01

    Autoimmune diabetes (T1D) is characterized by CD4(+) T cell reactivity to a variety of islet-associated Ags. At-risk individuals, genetically predisposed to T1D, often have similar T cell reactivity, but nevertheless fail to progress to clinically overt disease. To study the immune tolerance and regulatory environment permissive for such autoreactive T cells, we expressed TCR transgenes derived from two autoreactive human T cells, 4.13 and 164, in HLA-DR4 transgenic mice on a C57BL/6-derived "diabetes-resistant" background. Both TCR are responsive to an immunodominant epitope of glutamic acid decarboxylase 65(555-567), which is identical in sequence between humans and mice, is restricted by HLA-DR4, and is a naturally processed self Ag associated with T1D. Although both TCR use the identical Valpha and Vbeta genes, differing only in CDR3, we found stark differences in the mechanisms utilized in vivo in the maintenance of immune tolerance. A combination of thymic deletion (negative selection), TCR down-regulation, and peripheral activation-induced cell death dominated the phenotype of 164 T cells, which nevertheless still maintain their Ag responsiveness in the periphery. In contrast, 4.13 T cells are much less influenced by central and deletional tolerance mechanisms, and instead display a peripheral immune deviation including differentiation into IL-10-secreting Tr1 cells. These findings indicate a distinct set of regulatory alternatives for autoreactive T cells, even within a single highly restricted HLA-peptide-TCR recognition profile.

  1. Chemical Feasibility of the General Acid/Base Mechanism of glmS Ribozyme Self-Cleavage

    PubMed Central

    Dubecký, Matúš; Walter, Nils G.; Šponer, Jiří; Otyepka, Michal; Banáš, Pavel

    2015-01-01

    In numerous Gram-positive bacteria, the glmS ribozyme or catalytic riboswitch regulates the expression of glucosamine-6-phosphate (GlcN6P) synthase via site-specific cleavage of its sugar-phosphate backbone in response to GlcN6P ligand binding. Biochemical data have suggested a crucial catalytic role for an active site guanine (G40 in Thermoanaerobacter tengcongensis, G33 in Bacillus anthracis). We used hybrid quantum chemical/molecular mechanical (QM/MM) calculations to probe the mechanism where G40 is deprotonated and acts as a general base. The calculations suggest that the deprotonated guanine G40− is sufficiently reactive to overcome the thermodynamic penalty arising from its rare protonation state, and thus is able to activate the A-1(2’-OH) group toward nucleophilic attack on the adjacent backbone. Furthermore, deprotonation of A-1(2’-OH) and nucleophilic attack are predicted to occur as separate steps, where activation of A-1(2’-OH) precedes nucleophilic attack. Conversely, the transition state associated with the rate-determining step corresponds to concurrent nucleophilic attack and protonation of the G1(O5’) leaving group by the ammonium moiety of the GlcN6P cofactor. Overall, our calculations help to explain the crucial roles of G40 (as a general base) and GlcN6P (as a general acid) during glmS ribozyme self-cleavage. In addition, we show that the QM/MM description of the glmS ribozyme self-cleavage reaction is significantly more sensitive to the size of the QM region and the quality of the QM-MM coupling than that of other small ribozymes. PMID:25858644

  2. Lewis pair polymerization by classical and frustrated Lewis pairs: acid, base and monomer scope and polymerization mechanism.

    PubMed

    Zhang, Yuetao; Miyake, Garret M; John, Mallory G; Falivene, Laura; Caporaso, Lucia; Cavallo, Luigi; Chen, Eugene Y-X

    2012-08-14

    induction period, and the polymerization is significantly catalyzed by the LA, thus pointing to a bimetallic, activated monomer propagation mechanism. Computational study on the active species formation as well as the chain initiation and propagation events involved in the LPP of MMA with some of the most representative LPs has added our understanding of fundamental steps of LPP. The main difference between NHC and PR(3) bases is in the energetics of zwitterion formation, with the NHC-based zwitterions being remarkably more stable than the PR(3)-based zwitterions. Comparison of the monometallic and bimetallic mechanisms for MMA addition shows a clear preference for the bimetallic mechanism.

  3. Electrochemical characterization of surface complexes formed on Cu and Ta in succinic acid based solutions used for chemical mechanical planarization

    NASA Astrophysics Data System (ADS)

    Sulyma, Christopher M.; Roy, Dipankar

    2010-02-01

    Open-circuit potential measurements, cyclic voltammetry and Fourier transform impedance spectroscopy have been used to study pH dependent surface reactions of Cu and Ta rotating disc electrodes (RDEs) in aqueous solutions of succinic acid (SA, a complexing agent), hydrogen peroxide (an oxidizer), and ammonium dodecyl sulfate (ADS, a corrosion inhibitor for Cu). The surface chemistries of these systems are relevant for the development of a single-slurry approach to chemical mechanical planarization (CMP) of Cu lines and Ta barriers in the fabrication of semiconductor devices. It is shown that in non-alkaline solutions of H 2O 2, the SA-promoted surface complexes of Cu and Ta can potentially support chemically enhanced material removal in low-pressure CMP of surface topographies overlying fragile low-k dielectrics. ADS can suppress Cu dissolution without significantly affecting the surface chemistry of Ta. The data analysis steps are discussed in detail to demonstrate how the D.C. and A.C. electrochemical probes can be combined in the framework of the RDE technique to design and test CMP slurry solutions.

  4. Regulatory mechanisms of growth hormone secretion are sexually dimorphic.

    PubMed Central

    Jaffe, C A; Ocampo-Lim, B; Guo, W; Krueger, K; Sugahara, I; DeMott-Friberg, R; Bermann, M; Barkan, A L

    1998-01-01

    Sexually dimorphic growth hormone (GH) secretory pattern is important in the determination of gender-specific patterns of growth and metabolism in rats. Whether GH secretion in humans is also sexually dimorphic and the neuroendocrine mechanisms governing this potential difference are not fully established. We have compared pulsatile GH secretion profiles in young men and women in the baseline state and during a continuous intravenous infusion of recombinant human insulin-like growth factor I (rhIGF-I). During the baseline study, men had large nocturnal GH pulses and relatively small pulses during the rest of the day. In contrast, women had more continuous GH secretion and more frequent GH pulses that were of more uniform size. The infusion of rhIGF-I (10 microg/kg/h) potently suppressed both spontaneous and growth hormone-releasing hormone (GHRH)-induced GH secretion in men. In women, however, rhIGF-I had less effect on pulsatile GH secretion and did not suppress the GH response to GHRH. These data demonstrate the existence of sexual dimorphism in the regulatory mechanisms involved in GH secretion in humans. The persistence of GH responses to GHRH in women suggests that negative feedback by IGF-I might be expressed, in part, through suppression of hypothalamic GHRH. PMID:9649569

  5. Striking influence of the catalyst support and its acid-base properties: new insight into the growth mechanism of carbon nanotubes.

    PubMed

    Magrez, Arnaud; Smajda, Rita; Seo, Jin Won; Horváth, Endre; Ribic, Primoz Rebernik; Andresen, Juan Carlos; Acquaviva, Donatello; Olariu, Areta; Laurenczy, Gábor; Forró, László

    2011-05-24

    In the accepted mechanisms of carbon nanotube (CNT) growth by catalytic chemical vapor deposition (CCVD), the catalyst support is falsely considered as a passive material whose only role is to prevent catalytic particles from coarsening. The chemical changes that occur to the carbon source molecules on the surface are mainly overlooked. Here, we demonstrate the strong influence of the support on the growth of CNTs and show that it can be tuned by controlling the acid-base character of the support surface. This finding largely clarifies the CCVD growth mechanism. The CNTs' growth stems from the support where the presence of basic sites catalyzes the aromatization and reduces the complexity of CNT precursor molecules. On basic supports, the growth is activated and CNTs are more than 1000 times longer than those produced on acidic supports. These results could be the bedrock of future development of more efficient growth of CNTs on surfaces of functional materials. Finally, the modification of the aciditiy of the catalyst support during the super growth process is also discussed.

  6. Lung compliance, plasma electrolyte levels and acid-base balance are affected by scorpion envenomation in anesthetized rats under mechanical ventilation.

    PubMed

    Andrade, Marcus V; Caramez, Maria Paula R; Abreu, Elnara Marcia N N; Dolnikoff, Marisa; Omar, Erick D; Velasco, Irineu T; Cunha-Melo, José R

    2004-05-01

    To determine the effects of Tityus serrulatus scorpion toxin on lung compliance and resistance, ionic equilibrium and acid-base balance over time in anesthetized and mechanically ventilated rats, we measured air flow, tracheal and esophageal pressure. Lung volume was obtained by electronic integration of airflow signal. Arterial blood samples were collected through a catheter at baseline (before) and 5, 15, 30 and 60 min after scorpion toxin injection for arterial blood gases, bicarbonate, and alkali reserve levels as well as for, sodium, potassium, magnesium, glucose, lactate, hematocrit, and osmolality analysis. Injection of the gamma fraction of the T. serrulatus scorpion venom in rats under mechanical ventilatory support leads to a continuous decrease in lung compliance secondary to pulmonary edema, but no change in airway resistance. The changes in arterial blood gases characterizing metabolic acidosis were accompanied by an increase in arterial lactate and glucose values, suggesting a scorpion toxin-induced lactic acidosis, in association with poor tissue perfusion (hypotension and low cardiac output). Moreover, scorpion toxin injection resulted in hyperosmolality, hyperkalemia, hypermagnesemia and an increase in hematocrit. The experiments have shown a clinically relevant animal model to study severe scorpion envenoming and may help to better understand the scorpion envenoming syndrome.

  7. Redox-switch regulatory mechanism of thiolase from Clostridium acetobutylicum

    PubMed Central

    Kim, Sangwoo; Jang, Yu-Sin; Ha, Sung-Chul; Ahn, Jae-Woo; Kim, Eun-Jung; Hong Lim, Jae; Cho, Changhee; Shin Ryu, Yong; Kuk Lee, Sung; Lee, Sang Yup; Kim, Kyung-Jin

    2015-01-01

    Thiolase is the first enzyme catalysing the condensation of two acetyl-coenzyme A (CoA) molecules to form acetoacetyl-CoA in a dedicated pathway towards the biosynthesis of n-butanol, an important solvent and biofuel. Here we elucidate the crystal structure of Clostridium acetobutylicum thiolase (CaTHL) in its reduced/oxidized states. CaTHL, unlike those from other aerobic bacteria such as Escherichia coli and Zoogloea ramegera, is regulated by the redox-switch modulation through reversible disulfide bond formation between two catalytic cysteine residues, Cys88 and Cys378. When CaTHL is overexpressed in wild-type C. acetobutylicum, butanol production is reduced due to the disturbance of acidogenic to solventogenic shift. The CaTHLV77Q/N153Y/A286K mutant, which is not able to form disulfide bonds, exhibits higher activity than wild-type CaTHL, and enhances butanol production upon overexpression. On the basis of these results, we suggest that CaTHL functions as a key enzyme in the regulation of the main metabolism of C. acetobutylicum through a redox-switch regulatory mechanism. PMID:26391388

  8. Naturally occurring regulatory T cells: markers, mechanisms, and manipulation.

    PubMed

    Schmetterer, Klaus G; Neunkirchner, Alina; Pickl, Winfried F

    2012-06-01

    Naturally occurring CD4(+)CD25(high) forkhead box protein 3 (FOXP3)(+) regulatory T cells (nTregs) are key mediators of immunity, which orchestrate and maintain tolerance to self and foreign antigens. In the recent 1.5 decades, a multitude of studies have aimed to define the phenotype and function of nTregs and to assess their therapeutic potential for modulating immune mediated disorders such as autoimmunity, allergy, and episodes of transplant rejection. In this review, we summarize the current knowledge on the biology of nTregs. We address the exact definition of nTregs by specific markers and combinations thereof, which is a prerequisite for the state-of-the-art isolation of defined nTreg populations. Furthermore, we discuss the mechanism by which nTregs mediate immunosuppression and how this knowledge might translate into novel therapeutic modalities. With first clinical studies of nTreg-based therapies being finished, questions concerning the reliable sources of nTregs are becoming more and more eminent. Consequently, approaches allowing conversion of CD4(+) T cells into nTregs by coculture with antigen-presenting cells, cytokines, and/or pharmacological agents are discussed. In addition, genetic engineering approaches for the generation of antigen-specific nTregs are described.

  9. Acid-base treated vermiculite as high performance adsorbent: Insights into the mechanism of cationic dyes adsorption, regeneration, recyclability and stability studies.

    PubMed

    Stawiński, Wojciech; Węgrzyn, Agnieszka; Dańko, Tomasz; Freitas, Olga; Figueiredo, Sónia; Chmielarz, Lucjan

    2017-04-01

    Additional treatment with NaOH of acid activated vermiculite results in even higher increase in the adsorption capacity in comparison to samples modified only in acidic solution (first step of activation) with respect to raw material. Optimization of treatment conditions and adsorption capacity for two cationic dyes (methylene blue (MB) and astrazon red (AR)), also as binary mixture, was evaluated. The capacity, based on column studies, increased from 48 ± 2 to 203 ± 4 mg g(-1) in the case of methylene blue and from 51 ± 1 to 127 ± 2 mg g(-1) in the case of astrazon red on starting and acid-base treated material, respectively. It was shown that adsorption mechanism changes for both cationic dyes after NaOH treatment and it results in decrease of adsorption rate. In binary mixtures methylene blue is bound stronger by adsorbent and astrazon red may be removed in initial stage of adsorption. Extensive studies on desorption/regeneration process proved high efficiency in recyclable use of all materials. Although cation exchange capacity decreases due to acid treatment, after base treatment exchange properties are used more efficiently. On the other hand, increased specific surface area has less significant contribution into the adsorption potential of studied materials. Obtained adsorbents worked efficiently in 7 adsorption-regeneration cycles and loss of adsorption capacity was observed only in two first cycles.

  10. Regulatory and pathogenic mechanisms in human autoimmune myasthenia gravis.

    PubMed

    Le Panse, Rozen; Cizeron-Clairac, Géraldine; Cuvelier, Mélinée; Truffault, Frédérique; Bismuth, Jacky; Nancy, Patrice; De Rosbo, Nicole Kerlero; Berrih-Aknin, Sonia

    2008-01-01

    The thymus is frequently hyperplastic in young female myasthenia gravis (MG) patients presenting with anti-acetylcholine receptor (AChR) antibodies. This thymic pathology is characterized by the presence of ectopic germinal centers (GCs) containing B cells involved at least partially in the production of pathogenic anti-AChR antibodies. Our recent studies have furthered our understanding of the mechanisms leading to GC formation in the hyperplastic thymus. First, we showed that CXCL13 and CCL21, chemokines involved in GC formation, are overexpressed in MG thymus. Second, we demonstrated an increase in pro-inflammatory activity in the thymus from MG patients and its partial normalization by glucocorticoids, as evidenced by gene expression profile. Third, we found that pro-inflammatory cytokines are able to upregulate the expression of AChR subunits in thymic epithelial and myoid cells. Fourth, we showed that the function of T regulatory (Treg) cells, whose role is to downregulate the immune response, is severely impaired in the thymus of MG patients; such a defect could explain the chronic immune activation observed consistently in MG thymic hyperplasia. Altogether, these new data suggest that CXCL13 and CCL21, which are produced in excess in MG thymus, attract peripheral B cells and activated T cells, which are maintained chronically activated in the inflammatory thymic environment because of the defect in suppressive activity of Treg cells. Presence of AChR in the thymus and upregulation of its expression by the pro-inflammatory environment contribute to the triggering and maintenance of the anti-AChR autoimmune response.

  11. Acid-base homeostasis in the human system

    NASA Technical Reports Server (NTRS)

    White, R. J.

    1974-01-01

    Acid-base regulation is a cooperative phenomena in vivo with body fluids, extracellular and intracellular buffers, lungs, and kidneys all playing important roles. The present account is much too brief to be considered a review of present knowledge of these regulatory systems, and should be viewed, instead, as a guide to the elements necessary to construct a simple model of the mutual interactions of the acid-base regulatory systems of the body.

  12. A clinical approach to acid-base conundrums.

    PubMed

    Garrubba, Carl; Truscott, Judy

    2016-04-01

    Acid-base disorders can provide essential clues to underlying patient conditions. This article provides a simple, practical approach to identifying simple acid-base disorders and their compensatory mechanisms. Using this stepwise approach, clinicians can quickly identify and appropriately treat acid-base disorders.

  13. The Cellular and Molecular Mechanisms of Immuno-Suppression by Human Type 1 Regulatory T Cells

    PubMed Central

    Gregori, Silvia; Goudy, Kevin S.; Roncarolo, Maria Grazia

    2011-01-01

    The immuno-regulatory mechanisms of IL-10-producing type 1 regulatory T (Tr1) cells have been widely studied over the years. However, several recent discoveries have shed new light on the cellular and molecular mechanisms that human Tr1 cells use to control immune responses and induce tolerance. In this review we outline the well known and newly discovered regulatory properties of human Tr1 cells and provide an in-depth comparison of the known suppressor mechanisms of Tr1 cells with FOXP3+ Treg. We also highlight the role that Tr1 cells play in promoting and maintaining tolerance in autoimmunity, allergy, and transplantation. PMID:22566914

  14. [Stewart's acid-base approach].

    PubMed

    Funk, Georg-Christian

    2007-01-01

    In addition to paCO(2), Stewart's acid base model takes into account the influence of albumin, inorganic phosphate, electrolytes and lactate on acid-base equilibrium. It allows a comprehensive and quantitative analysis of acid-base disorders. Particularly simultaneous and mixed metabolic acid-base disorders, which are common in critically ill patients, can be assessed. Stewart's approach is therefore a valuable tool in addition to the customary acid-base approach based on bicarbonate or base excess. However, some chemical aspects of Stewart's approach remain controversial.

  15. Mechanisms of Regulatory B cell Function in Autoimmune and Inflammatory Diseases beyond IL-10

    PubMed Central

    Ray, Avijit; Dittel, Bonnie N.

    2017-01-01

    In the past two decades it has become clear that in addition to antigen presentation and antibody production B cells play prominent roles in immune regulation. While B cell-derived IL-10 has garnered much attention, B cells also effectively regulate inflammation by a variety of IL-10-independent mechanisms. B cell regulation has been studied in both autoimmune and inflammatory diseases. While collectively called regulatory B cells (Breg), no definitive phenotype has emerged for B cells with regulatory potential. This has made their study challenging and thus unique B cell regulatory mechanisms have emerged in a disease-dependent manner. Thus to harness the therapeutic potential of Breg, further studies are needed to understand how they emerge and are induced to evoke their regulatory activities. PMID:28124981

  16. A fundamental approach to adhesion: Synthesis, surface analysis, thermodynamics and mechanics. [acid-base properties of titanium 6-4 surfaces

    NASA Technical Reports Server (NTRS)

    Siriwardane, R.; Wightman, J. P.

    1980-01-01

    The acid-base properties of titanium 6-4 plates (low surface area) were investigated after three different pretreatments, namely Turco, phosphate-fluoride and Pasa-Jell. A series of indicators was used and color changes were detected using diffuse reflectance visible spectroscopy. Electron spectroscopy for chemical analysis was used to examine the indicator on the Ti 6-4 surface. Specular reflectance infra-red spectroscopy was used to study the adsorption of stearic acid from cyclohexane solutions on the Ti 6-4 surface.

  17. Potential self-regulatory mechanisms of yoga for psychological health

    PubMed Central

    Gard, Tim; Noggle, Jessica J.; Park, Crystal L.; Vago, David R.; Wilson, Angela

    2014-01-01

    Research suggesting the beneficial effects of yoga on myriad aspects of psychological health has proliferated in recent years, yet there is currently no overarching framework by which to understand yoga’s potential beneficial effects. Here we provide a theoretical framework and systems-based network model of yoga that focuses on integration of top-down and bottom-up forms of self-regulation. We begin by contextualizing yoga in historical and contemporary settings, and then detail how specific components of yoga practice may affect cognitive, emotional, behavioral, and autonomic output under stress through an emphasis on interoception and bottom-up input, resulting in physical and psychological health. The model describes yoga practice as a comprehensive skillset of synergistic process tools that facilitate bidirectional feedback and integration between high- and low-level brain networks, and afferent and re-afferent input from interoceptive processes (somatosensory, viscerosensory, chemosensory). From a predictive coding perspective we propose a shift to perceptual inference for stress modulation and optimal self-regulation. We describe how the processes that sub-serve self-regulation become more automatized and efficient over time and practice, requiring less effort to initiate when necessary and terminate more rapidly when no longer needed. To support our proposed model, we present the available evidence for yoga affecting self-regulatory pathways, integrating existing constructs from behavior theory and cognitive neuroscience with emerging yoga and meditation research. This paper is intended to guide future basic and clinical research, specifically targeting areas of development in the treatment of stress-mediated psychological disorders. PMID:25368562

  18. Translational regulatory mechanisms in persistent forms of synaptic plasticity.

    PubMed

    Kelleher, Raymond J; Govindarajan, Arvind; Tonegawa, Susumu

    2004-09-30

    Memory and synaptic plasticity exhibit distinct temporal phases, with long-lasting forms distinguished by their dependence on macromolecular synthesis. Prevailing models for the molecular mechanisms underlying long-lasting synaptic plasticity have largely focused on transcriptional regulation. However, a growing body of evidence now supports a crucial role for neuronal activity-dependent mRNA translation, which may occur in dendrites for a subset of neuronal mRNAs. Recent work has begun to define the signaling mechanisms coupling synaptic activation to the protein synthesis machinery. The ERK and mTOR signaling pathways have been shown to regulate the activity of the general translational machinery, while the translation of particular classes of mRNAs is additionally controlled by gene-specific mechanisms. Rapid enhancement of the synthesis of a diverse array of neuronal proteins through such mechanisms provides the components necessary for persistent forms of LTP and LTD. These findings have important implications for the synapse specificity and associativity of protein synthesis-dependent changes in synaptic strength.

  19. Sociocognitive self-regulatory mechanisms governing judgments of the acceptability and likelihood of sport cheating.

    PubMed

    d'Arripe-Longueville, Fabienne; Corrion, Karine; Scoffier, Stéphanie; Roussel, Peggy; Chalabaev, Aïna

    2010-10-01

    This study extends previous psychosocial literature (Bandura et al., 2001, 2003) by examining a structural model of the self-regulatory mechanisms governing the acceptability and likelihood of cheating in a sport context. Male and female adolescents (N = 804), aged 15-20 years, took part in this study. Negative affective self-regulatory efficacy influenced the acceptability and likelihood of cheating through the mediating role of moral disengagement, in females and males. Affective efficacy positively influenced prosocial behavior through moral disengagement or through resistive self-regulatory efficacy and social efficacy, in both groups. The direct effects of affective efficacy on beliefs about cheating were only evident in females. These results extend the findings of Bandura et al. (2001, 2003) to the sport context and suggest that affective and resistive self-regulatory efficacy operate in concert in governing adolescents' moral disengagement and transgressive behaviors in sport.

  20. Regulatory mechanisms for specification and patterning of plant vascular tissues.

    PubMed

    Caño-Delgado, Ana; Lee, Ji-Young; Demura, Taku

    2010-01-01

    Plant vascular tissues, the conduits of water, nutrients, and small molecules, play important roles in plant growth and development. Vascular tissues have allowed plants to successfully adapt to various environmental conditions since they evolved 450 Mya. The majority of plant biomass, an important source of renewable energy, comes from the xylem of the vascular tissues. Efforts have been made to identify the underlying mechanisms of cell specification and patterning of plant vascular tissues and their proliferation. The formation of the plant vascular system is a complex process that integrates signaling and gene regulation at transcriptional and posttranscriptional levels. Recently, a wealth of molecular genetic studies and the advent of cell biology and genomic tools have enabled important progress toward understanding its underlying mechanisms. Here, we provide a comprehensive review of the cell and developmental processes of plant vascular tissue and resources recently available for studying them that will enable the discovery of new ways to develop sustainable energy using plant biomass.

  1. Calcium-regulatory mechanisms. Functional classification using skinned fibers

    PubMed Central

    1981-01-01

    The primary purpose of this study was to determine whether various agents (adenosine 3-thiotriphosphate [ATP gamma S], trifluoperazine [TFP], troponin I, the catalytic subunit of the cyclic adenosine 3',5'- monophosphate dependent protein kinase [C-subunit], and calmodulin [CaM]) could be used to classify skinned fiber types, and then to determine whether the proposed mechanisms for Ca2+ regulation were consistent with the results. Agents (ATP gamma S, TFP, C-subunit, CaM) expected to alter a light chain kinase-phosphatase system strongly affect the Ca2+-activated tension in skinned gizzard smooth muscle fibers, whereas these agents have no effect on skinned mammalian striated and scallop adductor fibers. Troponin I, which is known to bind strongly to troponin C and CaM, inhibits Ca2+ activation of skinned mammalian striated and gizzard fibers but not scallop adductor muscle. The results in different types of skinned fibers are consistent with proposed mechanisms for Ca2+ regulation. PMID:6267161

  2. Gap junction-mediated electrical transmission: regulatory mechanisms and plasticity

    PubMed Central

    Pereda, Alberto E.; Curti, Sebastian; Hoge, Gregory; Cachope, Roger; Flores, Carmen E.; Rash, John E.

    2012-01-01

    The term synapse applies to cellular specializations that articulate the processing of information within neural circuits by providing a mechanism for the transfer of information between two different neurons. There are two main modalities of synaptic transmission: chemical and electrical. While most efforts have been dedicated to the understanding of the properties and modifiability of chemical transmission, less is still known regarding the plastic properties of electrical synapses, whose structural correlate is the gap junction. A wealth of data indicates that, rather than passive intercellular channels, electrical synapses are more dynamic and modifiable than was generally perceived. This article will discuss the factors determining the strength of electrical transmission and review current evidence demonstrating its dynamic properties. Like their chemical counterparts, electrical synapses can also be plastic and modifiable. PMID:22659675

  3. Ser/Thr phosphorylation as a regulatory mechanism in bacteria.

    PubMed

    Dworkin, Jonathan

    2015-04-01

    This review will discuss some recent work describing the role of Ser/Thr phosphorylation as a post-translational mechanism of regulation in bacteria. I will discuss the interaction between bacterial eukaryotic-like Ser/Thr kinases (eSTKs) and two-component systems as well as hints as to physiological function of eSTKs and their cognate eukaryotic-like phosphatases (eSTPs). In particular, I will highlight the role of eSTKs and eSTPs in the regulation of peptidoglycan metabolism and protein synthesis. In addition, I will discuss how data from phosphoproteomic surveys suggest that Ser/Thr phosphorylation plays a much more significant physiological role than would be predicted simply based on in vivo and in vitro analyses of individual kinases.

  4. Thick filament mechano-sensing is a calcium-independent regulatory mechanism in skeletal muscle

    PubMed Central

    Fusi, L.; Brunello, E.; Yan, Z.; Irving, M.

    2016-01-01

    Recent X-ray diffraction studies on actively contracting fibres from skeletal muscle showed that the number of myosin motors available to interact with actin-containing thin filaments is controlled by the stress in the myosin-containing thick filaments. Those results suggested that thick filament mechano-sensing might constitute a novel regulatory mechanism in striated muscles that acts independently of the well-known thin filament-mediated calcium signalling pathway. Here we test that hypothesis using probes attached to the myosin regulatory light chain in demembranated muscle fibres. We show that both the extent and kinetics of thick filament activation depend on thick filament stress but are independent of intracellular calcium concentration in the physiological range. These results establish direct control of myosin motors by thick filament mechano-sensing as a general regulatory mechanism in skeletal muscle that is independent of the canonical calcium signalling pathway. PMID:27796302

  5. Photosynthesis Control: An underrated short-term regulatory mechanism essential for plant viability.

    PubMed

    Colombo, Monica; Suorsa, Marjaana; Rossi, Fabio; Ferrari, Roberto; Tadini, Luca; Barbato, Roberto; Pesaresi, Paolo

    2016-01-01

    Regulation of photosynthetic electron transport provides efficient performance of oxygenic photosynthesis in plants. During the last 15 years, the molecular bases of various photosynthesis short-term regulatory processes have been elucidated, however the wild type-like phenotypes of mutants lacking of State Transitions, Non Photochemical Quenching, or Cyclic Electron Transport, when grown under constant light conditions, have also raised doubts about the acclimatory significance of these short-regulatory mechanisms on plant performance. Interestingly, recent studies performed by growing wild type and mutant plants under field conditions revealed a prominent role of State Transitions and Non Photochemical Quenching on plant fitness, with almost no effect on vegetative plant growth. Conversely, the analysis of plants lacking the regulation of electron transport by the cytochrome b6f complex, also known as Photosynthesis Control, revealed the fundamental role of this regulatory mechanism in the survival of young, developing seedlings under fluctuating light conditions.

  6. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus.

    PubMed

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-06-16

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic.

  7. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    PubMed Central

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  8. BIOCHEMICAL ANALYSES OF TRANSCRIPTIONAL REGULATORY MECHANISMS IN A CHROMATIN CONTEXT

    PubMed Central

    KONESKY, KASEY L.; LAYBOURN, PAUL J.

    2007-01-01

    We have optimized a recombinant chromatin assembly system that properly incorporates core histones and histone H1 into a chromatin template containing a natural promoter sequence. This article provides a step-by-step procedure for expression and purification of the proteins required for assembling well-defined chromatin templates. We describe how the degree of chromatin assembly in the absence and presence of histone H1 is measured using topological analysis and the use of micrococcal nuclease digestion performed to confirm H1 incorporation and determine the quality of in vitro chromatin templates. Further we describe the use sucrose gradient ultracentrifugation to verify that no unincorporated H1 remains as a second means for deciding on the proper H1 to core histone ratio during assembly. Additionally, we discuss the use of both yeast and Drosophila NAP-1 (yNAP-1 and dNAP-1, respectively) in the assembly of H1-containing chromatin. Finally, we provide detailed description of functional assays for investigating the mechanism of transcriptional regulation in a chromatin context (transcription, histone acetyltransferase activity, and protein association with promoter-bound complexes using immobilized chromatin templates). PMID:17309835

  9. Cis-regulatory mechanisms governing stem and progenitor cell transitions

    PubMed Central

    Johnson, Kirby D.; Kong, Guangyao; Gao, Xin; Chang, Yuan-I; Hewitt, Kyle J.; Sanalkumar, Rajendran; Prathibha, Rajalekshmi; Ranheim, Erik A.; Dewey, Colin N.; Zhang, Jing; Bresnick, Emery H.

    2015-01-01

    Cis-element encyclopedias provide information on phenotypic diversity and disease mechanisms. Although cis-element polymorphisms and mutations are instructive, deciphering function remains challenging. Mutation of an intronic GATA motif (+9.5) in GATA2, encoding a master regulator of hematopoiesis, underlies an immunodeficiency associated with myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). Whereas an inversion relocalizes another GATA2 cis-element (−77) to the proto-oncogene EVI1, inducing EVI1 expression and AML, whether this reflects ectopic or physiological activity is unknown. We describe a mouse strain that decouples −77 function from proto-oncogene deregulation. The −77−/− mice exhibited a novel phenotypic constellation including late embryonic lethality and anemia. The −77 established a vital sector of the myeloid progenitor transcriptome, conferring multipotentiality. Unlike the +9.5−/− embryos, hematopoietic stem cell genesis was unaffected in −77−/− embryos. These results illustrate a paradigm in which cis-elements in a locus differentially control stem and progenitor cell transitions, and therefore the individual cis-element alterations cause unique and overlapping disease phenotypes. PMID:26601269

  10. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  11. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  12. Hospital closures and survivals: an analysis of operating characteristics and regulatory mechanisms in three states.

    PubMed Central

    Kennedy, L; Dumas, M B

    1983-01-01

    This article examines factors related to hospital closures, using a longitudinal sample of surviving and closed hospitals. The hospitals are drawn from three states with different regulatory programs. Size of hospital and occupancy rate are shown to be related to likelihood of closure, while ownership, length of stay, and expenditures are not. These findings are observed both in the aggregate and within the individual states between 1960 and 1980. The three states--Arizona, Pennsylvania, and Maryland--represent different population trends and regulatory mechanisms and goals. The findings indicate that some programs appear to guarantee survival, whereas others are more neutral. PMID:6668180

  13. Control and regulatory mechanisms associated with thermogenesis in flying insects and birds.

    PubMed

    Loli, Denise; Bicudo, José Eduardo P W

    2005-01-01

    Most insects and birds are able to fly. The chitin made exoskeleton of insects poses them several constraints, and this is one the reasons they are in general small sized animals. On the other hand, because birds possess an endoskeleton made of bones they may grow much larger when compared to insects. The two taxa are quite different with regards to their general "design" platform, in particular with respect to their respiratory and circulatory systems. However, because they fly, they may share in common several traits, namely those associated with the control and regulatory mechanisms governing thermogenesis. High core temperatures are essential for animal flight irrespective of the taxa they belong to. Birds and insects have thus evolved mechanisms which allowed them to control and regulate high rates of heat fluxes. This article discusses possible convergent thermogenic control and regulatory mechanisms associated with flight in insects and birds.

  14. Catecholamine Stress Hormones Regulate Cellular Iron Homeostasis by a Posttranscriptional Mechanism Mediated by Iron Regulatory Protein

    PubMed Central

    Tapryal, Nisha; Vivek G, Vishnu; Mukhopadhyay, Chinmay K.

    2015-01-01

    Adequate availability of iron is important for cellular energy metabolism. Catecholamines such as epinephrine and norepinephrine promote energy expenditure to adapt to conditions that arose due to stress. To restore the energy balance, epinephrine/norepinephrine-exposed cells may face higher iron demand. So far, no direct role of epinephrine/norepinephrine in cellular iron homeostasis has been reported. Here we show that epinephrine/norepinephrine regulates iron homeostasis components such as transferrin receptor-1 and ferritin-H in hepatic and skeletal muscle cells by promoting the binding of iron regulatory proteins to iron-responsive elements present in the UTRs of transferrin receptor-1 and ferritin-H transcripts. Increased transferrin receptor-1, decreased ferritin-H, and increased iron-responsive element-iron regulatory protein interaction are also observed in liver and muscle tissues of epinephrine/norepinephrine-injected mice. We demonstrate the role of epinephrine/norepinephrine-induced generation of reactive oxygen species in converting cytosolic aconitase (ACO1) into iron regulatory protein-1 to bind iron-responsive elements present in UTRs of transferrin receptor-1 and ferritin-H. Our study further reveals that mitochondrial iron content and mitochondrial aconitase (ACO2) activity are elevated by epinephrine/norepinephrine that are blocked by the antioxidant N-acetyl cysteine and iron regulatory protein-1 siRNA, suggesting involvement of reactive oxygen species and iron regulatory protein-1 in this mechanism. This study reveals epinephrine and norepinephrine as novel regulators of cellular iron homeostasis. PMID:25572399

  15. Diversity of regulatory mechanisms of photosynthetic carbon metabolism in plants and algae.

    PubMed

    Tamoi, Masahiro; Shigeoka, Shigeru

    2015-01-01

    To clarify the regulatory mechanisms of the Calvin cycle in algae, we analyzed the molecular properties of the enzymes involved in this cycle. We demonstrated that these enzymes were not regulated by redox modulation through the ferredoxin/thioredoxin system under light/dark conditions and were not sensitive to treatments with hydrogen peroxide in vitro, unlike the chloroplastic thiol-modulated enzymes of plants. On the other hand, we found that cyanobacteria possessed a unique enzyme involved in the Calvin cycle. The CP12 protein played an important role in regulating carbon metabolism in the Calvin cycle in cyanobacteria and eukaryotic algae. This review described the regulatory mechanisms of the Calvin cycle in algae and also the effects of alterations to photosynthetic carbon metabolism on plant productivity, carbon partitioning, and the carbon/nitrogen balance using transgenic plants expressing algal genes.

  16. Gene regulatory mechanisms orchestrated by p63 in epithelial development and related disorders.

    PubMed

    Kouwenhoven, Evelyn N; van Bokhoven, Hans; Zhou, Huiqing

    2015-06-01

    The transcription factor p63 belongs to the p53 family and is a key regulator in epithelial commitment and development. Mutations in p63 give rise to several epithelial related disorders with defects in skin, limb and orofacial structures. Since the discovery of p63, efforts have been made to identify its target genes using individual gene approaches and to understand p63 function in normal epithelial development and related diseases. Recent genome-wide approaches have identified tens of thousands of potential p63-regulated target genes and regulatory elements, and reshaped the concept of gene regulation orchestrated by p63. These data also provide insights into p63-related disease mechanisms. In this review, we discuss the regulatory role of p63 in normal and diseased epithelial development in light of these novel findings. We also propose future perspectives for dissecting the molecular mechanism of p63-mediated epithelial development and related disorders as well as for potential therapeutic strategies.

  17. Structural Instability Tuning as a Regulatory Mechanism in Protein-Protein Interactions

    PubMed Central

    Chen, Li; Balabanidou, Vassilia; Remeta, David P.; Minetti, Conceição A.S.A.; Portaliou, Athina G.; Economou, Anastassios; Kalodimos, Charalampos G.

    2011-01-01

    SUMMARY Protein-protein interactions mediate a vast number of cellular processes. Here we present a regulatory mechanism in protein-protein interactions mediated by finely-tuned structural instability coupled with molecular mimicry. We show that a set of type III secretion (TTS) autoinhibited homodimeric chaperones adopt a molten-globule-like state that transiently exposes the substrate binding site as a means to become rapidly poised for binding to their cognate protein substrates. Packing defects at the homodimeric interface stimulate binding whereas correction of these defects results in less labile chaperones that give rise to non-functional biological systems. The protein substrates use structural mimicry to offset the “weak spots” in the chaperones and to counteract their autoinhibitory conformation. This regulatory mechanism of protein activity is evolutionary conserved among several TSS systems and presents a lucid example of functional advantage conferred upon a biological system by finely-tuned structural instability. PMID:22152477

  18. Exploring associations between self-regulatory mechanisms and neuropsychological functioning and driver behaviour after brain injury.

    PubMed

    Rike, Per-Ola; Johansen, Hans J; Ulleberg, Pål; Lundqvist, Anna; Schanke, Anne-Kristine

    2016-04-11

    The objective of this prospective one-year follow-up study was to explore the associations between self-regulatory mechanisms and neuropsychological tests as well as baseline and follow-up ratings of driver behaviour. The participants were a cohort of subjects with stroke and traumatic brain injury (TBI) who were found fit to drive after a multi-disciplinary driver assessment (baseline). Baseline measures included neuropsychological tests and ratings of self-regulatory mechanisms, i.e., executive functions (Behavior Rating Inventory of Executive Function-Adult Version; BRIEF-A) and impulsive personality traits (UPPS Impulsive Behavior Scale). The participants rated pre-injury driving behaviour on the Driver Behaviour Qestionnaire (DBQ) retrospectively at baseline and after one year of post-injury driving (follow-up). Better performance on neuropsychological tests was significantly associated with more post-injury DBQ Violations. The BRIEF-A main indexes were significantly associated with baseline and follow-up ratings of DBQ Mistakes and follow-up DBQ Inattention. UPPS (lack of) Perseverance was significantly associated with baseline DBQ Inattention, whereas UPPS Urgency was significantly associated with baseline DBQ Inexperience and post-injury DBQ Mistakes. There were no significant changes in DBQ ratings from baseline (pre-injury) to follow-up (post-injury). It was concluded that neuropsychological functioning and self-regulatory mechanisms are related to driver behaviour. Some aspects of driver behaviour do not necessarily change after brain injury, reflecting the influence of premorbid driving behaviour or impaired awareness of deficits on post-injury driving behaviour. Further evidence is required to predict the role of self-regulatory mechanisms on driver behaviour and crashes or near misses.

  19. Modeling the Regulatory Mechanisms by Which NLRX1 Modulates Innate Immune Responses to Helicobacter pylori Infection

    PubMed Central

    Philipson, Casandra W.; Bassaganya-Riera, Josep; Viladomiu, Monica; Kronsteiner, Barbara; Abedi, Vida; Hoops, Stefan; Michalak, Pawel; Kang, Lin; Girardin, Stephen E.; Hontecillas, Raquel

    2015-01-01

    Helicobacter pylori colonizes half of the world’s population as the dominant member of the gastric microbiota resulting in a lifelong chronic infection. Host responses toward the bacterium can result in asymptomatic, pathogenic or even favorable health outcomes; however, mechanisms underlying the dual role of H. pylori as a commensal versus pathogenic organism are not well characterized. Recent evidence suggests mononuclear phagocytes are largely involved in shaping dominant immunity during infection mediating the balance between host tolerance and succumbing to overt disease. We combined computational modeling, bioinformatics and experimental validation in order to investigate interactions between macrophages and intracellular H. pylori. Global transcriptomic analysis on bone marrow-derived macrophages (BMDM) in a gentamycin protection assay at six time points unveiled the presence of three sequential host response waves: an early transient regulatory gene module followed by sustained and late effector responses. Kinetic behaviors of pattern recognition receptors (PRRs) are linked to differential expression of spatiotemporal response waves and function to induce effector immunity through extracellular and intracellular detection of H. pylori. We report that bacterial interaction with the host intracellular environment caused significant suppression of regulatory NLRC3 and NLRX1 in a pattern inverse to early regulatory responses. To further delineate complex immune responses and pathway crosstalk between effector and regulatory PRRs, we built a computational model calibrated using time-series RNAseq data. Our validated computational hypotheses are that: 1) NLRX1 expression regulates bacterial burden in macrophages; and 2) early host response cytokines down-regulate NLRX1 expression through a negative feedback circuit. This paper applies modeling approaches to characterize the regulatory role of NLRX1 in mechanisms of host tolerance employed by macrophages to

  20. Type 1 regulatory T cells: a new mechanism of peripheral immune tolerance.

    PubMed

    Zeng, Hanyu; Zhang, Rong; Jin, Boquan; Chen, Lihua

    2015-09-01

    The lack of immune response to an antigen, a process known as immune tolerance, is essential for the preservation of immune homeostasis. To date, two mechanisms that drive immune tolerance have been described extensively: central tolerance and peripheral tolerance. Under the new nomenclature, thymus-derived regulatory T (tT(reg)) cells are the major mediators of central immune tolerance, whereas peripherally derived regulatory T (pT(reg)) cells function to regulate peripheral immune tolerance. A third type of T(reg) cells, termed iT(reg), represents only the in vitro-induced T(reg) cells(1). Depending on whether the cells stably express Foxp3, pT(reg), and iT(reg) cells may be divided into two subsets: the classical CD4(+)Foxp3(+) T(reg) cells and the CD4(+)Foxp3(-) type 1 regulatory T (Tr1) cells(2). This review focuses on the discovery, associated biomarkers, regulatory functions, methods of induction, association with disease, and clinical trials of Tr1 cells.

  1. Salt secretion is linked to acid-base regulation of ionocytes in seawater-acclimated medaka: new insights into the salt-secreting mechanism

    PubMed Central

    Liu, Sian-Tai; Horng, Jiun-Lin; Chen, Po-Yen; Hwang, Pung-Pung; Lin, Li-Yih

    2016-01-01

    Ionocytes in the skin and gills of seawater (SW) teleosts are responsible for both salt and acid secretion. However, the mechanism through which ionocytes secrete acid is still unclear. Here, we hypothesized that apical Na+/H+ exchangers (NHE2/3), carbonic anhydrase (CA2-like), and basolateral HCO3−/Cl− exchanger (AE1) are involved in acid secretion. In addition, the hypothesized involvement of basolateral AE1 suggested that acid secretion may be linked to Cl− secretion by ionocytes. The scanning ion-selective electrode technique (SIET) was used to measure H+ and Cl− secretion by ionocytes in the skin of medaka larvae acclimated to SW. Treatment with inhibitors of NHE, CA, and AE suppressed both H+ and Cl− secretion by ionocytes. Short-term exposure to hypercapnic SW stimulated both H+ and Cl− secretion. mRNA of CA2-like and AE1 were localized to ionocytes in the skin. Branchial mRNA levels of NKCC1a, CA2-like, and AE1a increased together with the salinity to which fish were acclimated. In addition, both AE1a and AE1b mRNA increased in fish acclimated to acidified (pH 7) SW; NKCC1a mRNA increased in fish acclimated to pH 9 SW. This study reveals the mechanism of H+ secretion by ionocytes, and refines our understanding of the well-established mechanism of Cl− secretion by ionocytes of SW fish. PMID:27511107

  2. Regulatory mechanism of human vascular smooth muscle cell phenotypic transformation induced by NELIN

    PubMed Central

    PEI, CHANGAN; QIN, SHIYONG; WANG, MINGHAI; ZHANG, SHUGUANG

    2015-01-01

    Vascular disorders, including hypertension, atherosclerosis and restenosis, arise from dysregulation of vascular smooth muscle cell (VSMC) differentiation, which can be controlled by regulatory factors. The present study investigated the regulatory mechanism of the phenotypic transformation of human VSMCs by NELIN in order to evaluate its potential as a preventive and therapeutic of vascular disorders. An in vitro model of NELIN-overexpressing VSMCs was prepared by transfection with a lentiviral (LV) vector (NELIN-VSMCs) and NELIN was slienced using an a lentiviral vector with small interfering (si)RNA in another group (LV-NELIN-siRNA-VSMCs). The effects of NELIN overexpression or knockdown on the phenotypic transformation of human VSMCs were observed, and its regulatory mechanism was studied. Compared with the control group, cells in the NELIN-VSMCs group presented a contractile phenotype with a significant increase of NELIN mRNA, NELIN protein, smooth muscle (SM)α-actin and total Ras homolog gene family member A (RhoA) protein expression. The intra-nuclear translocation of SMα-actin-serum response factor (SMα-actin-SRF) occurred in these cells simultaneously. Following exposure to Rho kinsase inhibitor Y-27632, SRF and SMα-actin expression decreased. However, cells in the LV-NELIN-siRNA-VSMCs group presented a synthetic phenotype, and the expression of NELIN mRNA, NELIN protein, SMα-actin protein and total RhoA protein was decreased. The occurrence of SRF extra-nuclear translocation was observed. In conclusion, the present study suggested that NELIN was able to activate regulatory factors of SMα-actin, RhoA and SRF successively in human VSMCs cultured in vitro. Furthermore, NELIN-induced phenotypic transformation of human VSMCs was regulated via the RhoA/SRF signaling pathway. The results of the present study provide a foundation for the use of NELIN in preventive and therapeutic treatment of vascular remodeling diseases, including varicosity and

  3. Biological and mechanical evaluation of poly(lactic-co-glycolic acid) based composites reinforced with one, two and three dimensional carbon biomaterials for bone tissue regeneration.

    PubMed

    Kaur, Tejinder; Kulanthaivel, Senthilguru; Arunachalam, Thirugnanam; Banerjee, Indranil; Pramanik, Krishna

    2017-02-09

    Considering the fact that life on earth is carbon based, carbon materials are being introduced in biological systems. However, very limited information is existing concerning the potential effects of different structures of carbon materials on biological systems. In the present study, poly(lactic-co-glycolic acid) (PLGA) based carbonaceous composites were developed by reinforcing 1 wt% of three different carbon based materials i.e. carbon nanotubes (CNTs-one dimensional), graphene nanoplatelets (GNPs-two dimensional) and activated carbon (AC-three dimensional). The developed composites were characterized for physicochemical, biological and mechanical properties. Along with their hemocompatible nature, the composites exhibited better swelling ratio, degradation percentage, bioactivity and tensile strength. The improvement in hydrophilicity and protein adsorption resulted in enhancement of cell proliferation and differentiation. Amongst all, sheet like GNPs showed strongest effect on composite's properties due to its larger area exposed. These results demonstrate the potential of PLGA based carbonaceous composites for accelerating bone tissue regeneration.

  4. Latent Tuberculosis: Models, Computational Efforts and the Pathogen’s Regulatory Mechanisms during Dormancy

    PubMed Central

    Magombedze, Gesham; Dowdy, David; Mulder, Nicola

    2013-01-01

    Latent tuberculosis is a clinical syndrome that occurs after an individual has been exposed to the Mycobacterium tuberculosis (Mtb) Bacillus, the infection has been established and an immune response has been generated to control the pathogen and force it into a quiescent state. Mtb can exit this quiescent state where it is unresponsive to treatment and elusive to the immune response, and enter a rapid replicating state, hence causing infection reactivation. It remains a gray area to understand how the pathogen causes a persistent infection and it is unclear whether the organism will be in a slow replicating state or a dormant non-replicating state. The ability of the pathogen to adapt to changing host immune response mechanisms, in which it is exposed to hypoxia, low pH, nitric oxide (NO), nutrient starvation, and several other anti-microbial effectors, is associated with a high metabolic plasticity that enables it to metabolize under these different conditions. Adaptive gene regulatory mechanisms are thought to coordinate how the pathogen changes their metabolic pathways through mechanisms that sense changes in oxygen tension and other stress factors, hence stimulating the pathogen to make necessary adjustments to ensure survival. Here, we review studies that give insights into latency/dormancy regulatory mechanisms that enable infection persistence and pathogen adaptation to different stress conditions. We highlight what mathematical and computational models can do and what they should do to enhance our current understanding of TB latency. PMID:25023946

  5. Poly(lactic acid)-Based in Situ Microfibrillar Composites with Enhanced Crystallization Kinetics, Mechanical Properties, Rheological Behavior, and Foaming Ability.

    PubMed

    Kakroodi, Adel Ramezani; Kazemi, Yasamin; Ding, WeiDan; Ameli, Aboutaleb; Park, Chul B

    2015-12-14

    Melt blending is one of the most promising techniques for eliminating poly(lactic acid)'s (PLA) numerous drawbacks. However, success in a typical melt blending process is usually achieved through the inclusion of high concentrations of a second polymeric phase which can compromise PLA's green nature. In a pioneering study, we introduce the production of in situ microfibrillar PLA/polyamide-6 (PA6) blends as a cost-effective and efficient technique for improving PLA's properties while minimizing the required PA6 content. Predominantly biobased products, with only 3 wt % of in situ generated PA6 microfibrils (diameter ≈200 nm), were shown to have dramatically improved crystallization kinetics, mechanical properties, melt elasticity and strength, and foaming-ability compared with PLA. Crucially, the microfibrillar blends were produced using an environmentally friendly and cost-effective process. Both of these qualities are essential in guarantying the viability of the proposed technique for overcoming the obstacles associated with the vast commercialization of PLA.

  6. Characterization of Na(+) transport to gain insight into the mechanism of acid-base and ion regulation in white sturgeon (Acipenser transmontanus).

    PubMed

    Shartau, Ryan B; Brix, Kevin V; Brauner, Colin J

    2017-02-01

    Freshwater fish actively take up ions via specific transporters to counter diffusive losses to their hypotonic environment. While much is known about the specific mechanisms employed by teleosts, almost nothing is known about the basal fishes, such as white sturgeon (Acipenser transmontanus) which may offer insight into the evolution of osmo- and ionoregulation in fishes. We investigated Na(+) uptake in juvenile white sturgeon in the presence and absence of transporter inhibitors. We found that sturgeon acclimated to 100μmoll(-1) Na(+) have Na(+) uptake kinetics typical of teleosts and that a Na(+)/H(+) exchanger (NHE) is the predominant transporter for Na(+) uptake. White sturgeon are tolerant to hypercarbia-induced respiratory acidoses and recover blood pH (pHe) at 1.5kPa PCO2 but not at higher PCO2 (6kPa PCO2) where they preferentially regulate intracellular pH (pHi). It was hypothesized that during exposure to hypercarbia Na(+) uptake would increase at CO2 tensions at which fish were capable of pHe regulation but decrease at higher tensions when they were preferentially regulating pHi. We found that Na(+) uptake did not increase at 1.5kPa PCO2, but at 6kPa PCO2 Na(+) uptake was reduced by 95% while low water pH equivalent to 6kPa PCO2 reduced Na(+) uptake by 71%. Lastly, we measured net acid flux during hypercarbia, which indicates that net acid flux is not associated with Na(+) uptake. These findings indicate Na(+) uptake in sturgeon is not different from freshwater teleosts but is sensitive to hypercarbia and is not associated with pHe compensation during hypercarbia.

  7. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci

    PubMed Central

    Miller, Clint L.; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D.; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K.; Majmudar, Deshna; Kim, Juyong B.; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L.; Montgomery, Stephen B.; Schadt, Eric E.; Björkegren, Johan L.M.; Quertermous, Thomas

    2016-01-01

    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  8. Defining Transcriptional Regulatory Mechanisms for Primary let-7 miRNAs.

    PubMed

    Gaeta, Xavier; Le, Luat; Lin, Ying; Xie, Yuan; Lowry, William E

    2017-01-01

    The let-7 family of miRNAs have been shown to control developmental timing in organisms from C. elegans to humans; their function in several essential cell processes throughout development is also well conserved. Numerous studies have defined several steps of post-transcriptional regulation of let-7 production; from pri-miRNA through pre-miRNA, to the mature miRNA that targets endogenous mRNAs for degradation or translational inhibition. Less-well defined are modes of transcriptional regulation of the pri-miRNAs for let-7. let-7 pri-miRNAs are expressed in polycistronic fashion, in long transcripts newly annotated based on chromatin-associated RNA-sequencing. Upon differentiation, we found that some let-7 pri-miRNAs are regulated at the transcriptional level, while others appear to be constitutively transcribed. Using the Epigenetic Roadmap database, we further annotated regulatory elements of each polycistron identified putative promoters and enhancers. Probing these regulatory elements for transcription factor binding sites identified factors that regulate transcription of let-7 in both promoter and enhancer regions, and identified novel regulatory mechanisms for this important class of miRNAs.

  9. Defining Transcriptional Regulatory Mechanisms for Primary let-7 miRNAs

    PubMed Central

    Gaeta, Xavier; Le, Luat; Lin, Ying; Xie, Yuan; Lowry, William E.

    2017-01-01

    The let-7 family of miRNAs have been shown to control developmental timing in organisms from C. elegans to humans; their function in several essential cell processes throughout development is also well conserved. Numerous studies have defined several steps of post-transcriptional regulation of let-7 production; from pri-miRNA through pre-miRNA, to the mature miRNA that targets endogenous mRNAs for degradation or translational inhibition. Less-well defined are modes of transcriptional regulation of the pri-miRNAs for let-7. let-7 pri-miRNAs are expressed in polycistronic fashion, in long transcripts newly annotated based on chromatin-associated RNA-sequencing. Upon differentiation, we found that some let-7 pri-miRNAs are regulated at the transcriptional level, while others appear to be constitutively transcribed. Using the Epigenetic Roadmap database, we further annotated regulatory elements of each polycistron identified putative promoters and enhancers. Probing these regulatory elements for transcription factor binding sites identified factors that regulate transcription of let-7 in both promoter and enhancer regions, and identified novel regulatory mechanisms for this important class of miRNAs. PMID:28052101

  10. Timing Embryo Segmentation: Dynamics and Regulatory Mechanisms of the Vertebrate Segmentation Clock

    PubMed Central

    Resende, Tatiana P.; Andrade, Raquel P.; Palmeirim, Isabel

    2014-01-01

    All vertebrate species present a segmented body, easily observed in the vertebrate column and its associated components, which provides a high degree of motility to the adult body and efficient protection of the internal organs. The sequential formation of the segmented precursors of the vertebral column during embryonic development, the somites, is governed by an oscillating genetic network, the somitogenesis molecular clock. Herein, we provide an overview of the molecular clock operating during somite formation and its underlying molecular regulatory mechanisms. Human congenital vertebral malformations have been associated with perturbations in these oscillatory mechanisms. Thus, a better comprehension of the molecular mechanisms regulating somite formation is required in order to fully understand the origin of human skeletal malformations. PMID:24895605

  11. USP1 deubiquitinase: cellular functions, regulatory mechanisms and emerging potential as target in cancer therapy

    PubMed Central

    2013-01-01

    Reversible protein ubiquitination is emerging as a key process for maintaining cell homeostasis, and the enzymes that participate in this process, in particular E3 ubiquitin ligases and deubiquitinases (DUBs), are increasingly being regarded as candidates for drug discovery. Human DUBs are a group of approximately 100 proteins, whose cellular functions and regulatory mechanisms remain, with some exceptions, poorly characterized. One of the best-characterized human DUBs is ubiquitin-specific protease 1 (USP1), which plays an important role in the cellular response to DNA damage. USP1 levels, localization and activity are modulated through several mechanisms, including protein-protein interactions, autocleavage/degradation and phosphorylation, ensuring that USP1 function is carried out in a properly regulated spatio-temporal manner. Importantly, USP1 expression is deregulated in certain types of human cancer, suggesting that USP1 could represent a valid target in cancer therapy. This view has gained recent support with the finding that USP1 inhibition may contribute to revert cisplatin resistance in an in vitro model of non-small cell lung cancer (NSCLC). Here, we describe the current knowledge on the cellular functions and regulatory mechanisms of USP1. We also summarize USP1 alterations found in cancer, combining data from the literature and public databases with our own data. Finally, we discuss the emerging potential of USP1 as a target, integrating published data with our novel findings on the effects of the USP1 inhibitor pimozide in combination with cisplatin in NSCLC cells. PMID:23937906

  12. Regulatory T cells: Mechanisms of suppression and impairment in autoimmune liver disease.

    PubMed

    Liberal, Rodrigo; Grant, Charlotte R; Longhi, Maria Serena; Mieli-Vergani, Giorgina; Vergani, Diego

    2015-02-01

    There are three classic liver diseases with probable autoimmune etiology: primary biliary cirrhosis, primary sclerosing cholangitis, and autoimmune hepatitis. The occurrence of these autoimmune conditions is determined by the breakdown of immune-regulatory mechanisms that in health are responsible for maintaining immunological tolerance against self-antigens. Among the multiple T cell subsets with suppressive function, the regulatory T cells (Tregs), defined by the expression of CD4, the IL-2 receptor α chain (CD25), and the transcription factor FOXP3, have emerged as having a central role in maintaining immune-tolerance to autoantigens. Tregs are equipped with an array of mechanisms of suppression, including the modulation of antigen presenting cell maturation and function, the killing of target cells, the disruption of metabolic pathways, and the production of anti-inflammatory cytokines. In all the three autoimmune liver diseases mentioned above, there is evidence pointing for either a reduced frequency and/or function of Tregs. Here, we review the definition, phenotypic characteristics, and mechanisms of suppression employed by Tregs and then we discuss the evidence available pointing to their impairment in patients with autoimmune liver disease.

  13. Biosafety, biosecurity and internationally mandated regulatory regimes: compliance mechanisms for education and global health security

    PubMed Central

    Sture, Judi; Whitby, Simon; Perkins, Dana

    2015-01-01

    This paper highlights the biosafety and biosecurity training obligations that three international regulatory regimes place upon states parties. The duty to report upon the existence of such provisions as evidence of compliance is discussed in relation to each regime. We argue that such mechanisms can be regarded as building blocks for the development and delivery of complementary biosafety and biosecurity teaching and training materials. We show that such building blocks represent foundations upon which life and associated scientists – through greater awareness of biosecurity concerns – can better fulfil their responsibilities to guard their work from misuse in the future. PMID:24494580

  14. Distinct Regulatory Mechanisms Act to Establish and Maintain Pax3 Expression in the Developing Neural Tube

    PubMed Central

    Moore, Steven; Ribes, Vanessa; Terriente, Javier; Wilkinson, David; Relaix, Frédéric; Briscoe, James

    2013-01-01

    Pattern formation in developing tissues is driven by the interaction of extrinsic signals with intrinsic transcriptional networks that together establish spatially and temporally restricted profiles of gene expression. How this process is orchestrated at the molecular level by genomic cis-regulatory modules is one of the central questions in developmental biology. Here we have addressed this by analysing the regulation of Pax3 expression in the context of the developing spinal cord. Pax3 is induced early during neural development in progenitors of the dorsal spinal cord and is maintained as pattern is subsequently elaborated, resulting in the segregation of the tissue into dorsal and ventral subdivisions. We used a combination of comparative genomics and transgenic assays to define and dissect several functional cis-regulatory modules associated with the Pax3 locus. We provide evidence that the coordinated activity of two modules establishes and refines Pax3 expression during neural tube development. Mutational analyses of the initiating element revealed that in addition to Wnt signaling, Nkx family homeodomain repressors restrict Pax3 transcription to the presumptive dorsal neural tube. Subsequently, a second module mediates direct positive autoregulation and feedback to maintain Pax3 expression. Together, these data indicate a mechanism by which transient external signals are converted into a sustained expression domain by the activities of distinct regulatory elements. This transcriptional logic differs from the cross-repression that is responsible for the spatiotemporal patterns of gene expression in the ventral neural tube, suggesting that a variety of circuits are deployed within the neural tube regulatory network to establish and elaborate pattern formation. PMID:24098141

  15. Comparative genetic screens in human cells reveal new regulatory mechanisms in WNT signaling

    PubMed Central

    Lebensohn, Andres M; Dubey, Ramin; Neitzel, Leif R; Tacchelly-Benites, Ofelia; Yang, Eungi; Marceau, Caleb D; Davis, Eric M; Patel, Bhaven B; Bahrami-Nejad, Zahra; Travaglini, Kyle J; Ahmed, Yashi; Lee, Ethan; Carette, Jan E; Rohatgi, Rajat

    2016-01-01

    The comprehensive understanding of cellular signaling pathways remains a challenge due to multiple layers of regulation that may become evident only when the pathway is probed at different levels or critical nodes are eliminated. To discover regulatory mechanisms in canonical WNT signaling, we conducted a systematic forward genetic analysis through reporter-based screens in haploid human cells. Comparison of screens for negative, attenuating and positive regulators of WNT signaling, mediators of R-spondin-dependent signaling and suppressors of constitutive signaling induced by loss of the tumor suppressor adenomatous polyposis coli or casein kinase 1α uncovered new regulatory features at most levels of the pathway. These include a requirement for the transcription factor AP-4, a role for the DAX domain of AXIN2 in controlling β-catenin transcriptional activity, a contribution of glycophosphatidylinositol anchor biosynthesis and glypicans to R-spondin-potentiated WNT signaling, and two different mechanisms that regulate signaling when distinct components of the β-catenin destruction complex are lost. The conceptual and methodological framework we describe should enable the comprehensive understanding of other signaling systems. DOI: http://dx.doi.org/10.7554/eLife.21459.001 PMID:27996937

  16. Transancestral fine-mapping of four type 2 diabetes susceptibility loci highlights potential causal regulatory mechanisms

    PubMed Central

    Horikoshi, Momoko; Pasquali, Lorenzo; Wiltshire, Steven; Huyghe, Jeroen R.; Mahajan, Anubha; Asimit, Jennifer L.; Ferreira, Teresa; Locke, Adam E.; Robertson, Neil R.; Wang, Xu; Sim, Xueling; Fujita, Hayato; Hara, Kazuo; Young, Robin; Zhang, Weihua; Choi, Sungkyoung; Chen, Han; Kaur, Ismeet; Takeuchi, Fumihiko; Fontanillas, Pierre; Thuillier, Dorothée; Yengo, Loic; Below, Jennifer E.; Tam, Claudia H.T.; Wu, Ying; Abecasis, Gonçalo; Altshuler, David; Bell, Graeme I.; Blangero, John; Burtt, Noél P.; Duggirala, Ravindranath; Florez, Jose C.; Hanis, Craig L.; Seielstad, Mark; Atzmon, Gil; Chan, Juliana C.N.; Ma, Ronald C.W.; Froguel, Philippe; Wilson, James G.; Bharadwaj, Dwaipayan; Dupuis, Josee; Meigs, James B.; Cho, Yoon Shin; Park, Taesung; Kooner, Jaspal S.; Chambers, John C.; Saleheen, Danish; Kadowaki, Takashi; Tai, E. Shyong; Mohlke, Karen L.; Cox, Nancy J.; Ferrer, Jorge; Zeggini, Eleftheria; Kato, Norihiro; Teo, Yik Ying; Boehnke, Michael; McCarthy, Mark I.; Morris, Andrew P.

    2016-01-01

    To gain insight into potential regulatory mechanisms through which the effects of variants at four established type 2 diabetes (T2D) susceptibility loci (CDKAL1, CDKN2A-B, IGF2BP2 and KCNQ1) are mediated, we undertook transancestral fine-mapping in 22 086 cases and 42 539 controls of East Asian, European, South Asian, African American and Mexican American descent. Through high-density imputation and conditional analyses, we identified seven distinct association signals at these four loci, each with allelic effects on T2D susceptibility that were homogenous across ancestry groups. By leveraging differences in the structure of linkage disequilibrium between diverse populations, and increased sample size, we localised the variants most likely to drive each distinct association signal. We demonstrated that integration of these genetic fine-mapping data with genomic annotation can highlight potential causal regulatory elements in T2D-relevant tissues. These analyses provide insight into the mechanisms through which T2D association signals are mediated, and suggest future routes to understanding the biology of specific disease susceptibility loci. PMID:26911676

  17. [Influence of geomagnetic storms on the balance of autonomic regulatory mechanisms].

    PubMed

    Chichinadze, G; Tvildiani, L; Kvachadze, I; Tarkhan-Mouravi, I

    2005-09-01

    The investigation aimed to evaluate autonomic regulatory mechanisms in practically healthy persons during the geomagnetically quiet periods and during geomagnetic storms. The examinations were conducted among the volunteer young men (n=64) 18-22 years of age. The autonomic function was studied on the basis of the heart rate variability. The geomagnetically quiet periods were considered when the value of the K-index was no more then 2 and a geomagnetic storm was considered when the value of the index was 5 and more. It is ascertained that in the both cases the basic statistical indices of the heart rate were identical. The analysis of R-R intervals spectral power gave the possibility to sort the persons examined into the three different groups. The data obtained allowed to suggest that geomagnetic storms influence human organisms through the vagus centers by means of their excitation. This phenomenon may be considered as a self-regulatory physiologic mechanism of the adaptive character. The analysis of the spectral power of R-R intervals may be considered as a sensitive method for the detection of the magnitolabile persons.

  18. Anti-Sigma Factors in E. coli: Common Regulatory Mechanisms Controlling Sigma Factors Availability

    PubMed Central

    Treviño-Quintanilla, Luis Gerardo; Freyre-González, Julio Augusto; Martínez-Flores, Irma

    2013-01-01

    In bacteria, transcriptional regulation is a key step in cellular gene expression. All bacteria contain a core RNA polymerase that is catalytically competent but requires an additional σ factor for specific promoter recognition and correct transcriptional initiation. The RNAP core is not able to selectively bind to a given σ factor. In contrast, different σ factors have different affinities for the RNAP core. As a consequence, the concentration of alternate σ factors requires strict regulation in order to properly control the delicate interplay among them, which favors the competence for the RNAP core. This control is archived by different σ/anti-σ controlling mechanisms that shape complex regulatory networks and cascades, and enable the response to sudden environmental cues, whose global understanding is a current challenge for systems biology. Although there have been a number of excellent studies on each of these σ/anti-σ post-transcriptional regulatory systems, no comprehensive comparison of these mechanisms in a single model organism has been conducted. Here, we survey all these systems in E. coli dissecting and analyzing their inner workings and highlightin their differences. Then, following an integral approach, we identify their commonalities and outline some of the principles exploited by the cell to effectively and globally reprogram the transcriptional machinery. These principles provide guidelines for developing biological synthetic circuits enabling an efficient and robust response to sudden stimuli. PMID:24396271

  19. Anti-Sigma Factors in E. coli: Common Regulatory Mechanisms Controlling Sigma Factors Availability.

    PubMed

    Treviño-Quintanilla, Luis Gerardo; Freyre-González, Julio Augusto; Martínez-Flores, Irma

    2013-09-01

    In bacteria, transcriptional regulation is a key step in cellular gene expression. All bacteria contain a core RNA polymerase that is catalytically competent but requires an additional σ factor for specific promoter recognition and correct transcriptional initiation. The RNAP core is not able to selectively bind to a given σ factor. In contrast, different σ factors have different affinities for the RNAP core. As a consequence, the concentration of alternate σ factors requires strict regulation in order to properly control the delicate interplay among them, which favors the competence for the RNAP core. This control is archived by different σ/anti-σ controlling mechanisms that shape complex regulatory networks and cascades, and enable the response to sudden environmental cues, whose global understanding is a current challenge for systems biology. Although there have been a number of excellent studies on each of these σ/anti-σ post-transcriptional regulatory systems, no comprehensive comparison of these mechanisms in a single model organism has been conducted. Here, we survey all these systems in E. coli dissecting and analyzing their inner workings and highlightin their differences. Then, following an integral approach, we identify their commonalities and outline some of the principles exploited by the cell to effectively and globally reprogram the transcriptional machinery. These principles provide guidelines for developing biological synthetic circuits enabling an efficient and robust response to sudden stimuli.

  20. Molecular mechanism underlying the regulatory specificity of a Drosophila homeodomain protein that specifies myoblast identity

    PubMed Central

    Busser, Brian W.; Shokri, Leila; Jaeger, Savina A.; Gisselbrecht, Stephen S.; Singhania, Aditi; Berger, Michael F.; Zhou, Bo; Bulyk, Martha L.; Michelson, Alan M.

    2012-01-01

    A subfamily of Drosophila homeodomain (HD) transcription factors (TFs) controls the identities of individual muscle founder cells (FCs). However, the molecular mechanisms by which these TFs generate unique FC genetic programs remain unknown. To investigate this problem, we first applied genome-wide mRNA expression profiling to identify genes that are activated or repressed by the muscle HD TFs Slouch (Slou) and Muscle segment homeobox (Msh). Next, we used protein-binding microarrays to define the sequences that are bound by Slou, Msh and other HD TFs that have mesodermal expression. These studies revealed that a large class of HDs, including Slou and Msh, predominantly recognize TAAT core sequences but that each HD also binds to unique sites that deviate from this canonical motif. To understand better the regulatory specificity of an individual FC identity HD, we evaluated the functions of atypical binding sites that are preferentially bound by Slou relative to other HDs within muscle enhancers that are either activated or repressed by this TF. These studies showed that Slou regulates the activities of particular myoblast enhancers through Slou-preferred sequences, whereas swapping these sequences for sites that are capable of binding to multiple HD family members does not support the normal regulatory functions of Slou. Moreover, atypical Slou-binding sites are overrepresented in putative enhancers associated with additional Slou-responsive FC genes. Collectively, these studies provide new insights into the roles of individual HD TFs in determining cellular identity, and suggest that the diversity of HD binding preferences can confer regulatory specificity. PMID:22296846

  1. Innovation of a Regulatory Mechanism Modulating Semi-determinate Stem Growth through Artificial Selection in Soybean

    PubMed Central

    Ping, Jieqing; Li, Shuai; Chen, Zhixiang; Ma, Jianxin

    2016-01-01

    It has been demonstrated that Terminal Flowering 1 (TFL1) in Arabidopsis and its functional orthologs in other plants specify indeterminate stem growth through their specific expression that represses floral identity genes in shoot apical meristems (SAMs), and that the loss-of-function mutations at these functional counterparts result in the transition of SAMs from the vegetative to reproductive state that is essential for initiation of terminal flowering and thus formation of determinate stems. However, little is known regarding how semi-determinate stems, which produce terminal racemes similar to those observed in determinate plants, are specified in any flowering plants. Here we show that semi-determinacy in soybean is modulated by transcriptional repression of Dt1, the functional ortholog of TFL1, in SAMs. Such repression is fulfilled by recently enabled spatiotemporal expression of Dt2, an ancestral form of the APETALA1/FRUITFULL orthologs, which encodes a MADS-box factor directly binding to the regulatory sequence of Dt1. In addition, Dt2 triggers co-expression of the putative SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (GmSOC1) in SAMs, where GmSOC1 interacts with Dt2, and also directly binds to the Dt1 regulatory sequence. Heterologous expression of Dt2 and Dt1 in determinate (tfl1) Arabidopsis mutants enables creation of semi-determinacy, but the same forms of the two genes in the tfl1 and soc1 background produce indeterminate stems, suggesting that Dt2 and SOC1 both are essential for transcriptional repression of Dt1. Nevertheless, the expression of Dt2 is unable to repress TFL1 in Arabidopsis, further demonstrating the evolutionary novelty of the regulatory mechanism underlying stem growth in soybean. PMID:26807727

  2. Regulatory Mechanisms Underlying the Expression of Prolactin Receptor in Chicken Granulosa Cells

    PubMed Central

    Hu, Shenqiang; Duggavathi, Raj; Zadworny, David

    2017-01-01

    Prolactin (PRL) has both pro- and anti-gonadal roles in the regulation of avian ovarian functions through its interaction with the receptor (PRLR). However, neither the pattern of expression of PRLR nor its regulatory mechanisms during follicle development have been clearly defined. The objective of the present study was to investigate mechanisms of PRLR expression in chicken granulosa cells. Levels of PRLR transcript were highest in the stroma and walls of follicles < 2 mm in diameter and progressively declined with the maturation of follicles. In preovulatory follicles, PRLR was expressed at higher levels in granulosa than theca layers. FSH exerted the greatest stimulatory effect on PRLR and StAR expression in cultured granulosa cells of the 6–8 mm follicles but this effect declined as follicles matured to F1. In contrast, LH did not alter the expression of PRLR in granulosa cells of all follicular classes but increased levels of StAR in F2 and F1 granulosa cells. Both non-glycosylated- (NG-) and glycosylated- (G-) PRL upregulated basal PRLR expression in granulosa cells of the 6–8 mm, F3 or F1 follicles but had little effect in F2 follicles. Furthermore, FSH-stimulated PRLR expression was reduced by the addition of either isoform of PRL especially in F2 granulosa cells. These results indicate that PRLR is differentially distributed and regulated by FSH or PRL variants independently or in combination in the follicular hierarchy. By using activators and inhibitors, we further demonstrated that multiple signaling pathways, including PKA, PKC, PI3K, mTOR and AMPK, are not only directly involved in, but they can also converge to modulate ERK2 activity to regulate FSH-mediated PRLR and StAR expression in undifferentiated granulosa cells. These data provide new insights into the regulatory mechanisms controlling the expression of PRLR in granulosa cells. PMID:28107515

  3. Putting theory to the test: which regulatory mechanisms can drive realistic growth of a root?

    PubMed

    De Vos, Dirk; Vissenberg, Kris; Broeckhove, Jan; Beemster, Gerrit T S

    2014-10-01

    In recent years there has been a strong development of computational approaches to mechanistically understand organ growth regulation in plants. In this study, simulation methods were used to explore which regulatory mechanisms can lead to realistic output at the cell and whole organ scale and which other possibilities must be discarded as they result in cellular patterns and kinematic characteristics that are not consistent with experimental observations for the Arabidopsis thaliana primary root. To aid in this analysis, a 'Uniform Longitudinal Strain Rule' (ULSR) was formulated as a necessary condition for stable, unidirectional, symplastic growth. Our simulations indicate that symplastic structures are robust to differences in longitudinal strain rates along the growth axis only if these differences are small and short-lived. Whereas simple cell-autonomous regulatory rules based on counters and timers can produce stable growth, it was found that steady developmental zones and smooth transitions in cell lengths are not feasible. By introducing spatial cues into growth regulation, those inadequacies could be avoided and experimental data could be faithfully reproduced. Nevertheless, a root growth model based on previous polar auxin-transport mechanisms violates the proposed ULSR due to the presence of lateral gradients. Models with layer-specific regulation or layer-driven growth offer potential solutions. Alternatively, a model representing the known cross-talk between auxin, as the cell proliferation promoting factor, and cytokinin, as the cell differentiation promoting factor, predicts the effect of hormone-perturbations on meristem size. By down-regulating PIN-mediated transport through the transcription factor SHY2, cytokinin effectively flattens the lateral auxin gradient, at the basal boundary of the division zone, (thereby imposing the ULSR) to signal the exit of proliferation and start of elongation. This model exploration underlines the value of

  4. Putting Theory to the Test: Which Regulatory Mechanisms Can Drive Realistic Growth of a Root?

    PubMed Central

    De Vos, Dirk; Vissenberg, Kris; Broeckhove, Jan; Beemster, Gerrit T. S.

    2014-01-01

    In recent years there has been a strong development of computational approaches to mechanistically understand organ growth regulation in plants. In this study, simulation methods were used to explore which regulatory mechanisms can lead to realistic output at the cell and whole organ scale and which other possibilities must be discarded as they result in cellular patterns and kinematic characteristics that are not consistent with experimental observations for the Arabidopsis thaliana primary root. To aid in this analysis, a ‘Uniform Longitudinal Strain Rule’ (ULSR) was formulated as a necessary condition for stable, unidirectional, symplastic growth. Our simulations indicate that symplastic structures are robust to differences in longitudinal strain rates along the growth axis only if these differences are small and short-lived. Whereas simple cell-autonomous regulatory rules based on counters and timers can produce stable growth, it was found that steady developmental zones and smooth transitions in cell lengths are not feasible. By introducing spatial cues into growth regulation, those inadequacies could be avoided and experimental data could be faithfully reproduced. Nevertheless, a root growth model based on previous polar auxin-transport mechanisms violates the proposed ULSR due to the presence of lateral gradients. Models with layer-specific regulation or layer-driven growth offer potential solutions. Alternatively, a model representing the known cross-talk between auxin, as the cell proliferation promoting factor, and cytokinin, as the cell differentiation promoting factor, predicts the effect of hormone-perturbations on meristem size. By down-regulating PIN-mediated transport through the transcription factor SHY2, cytokinin effectively flattens the lateral auxin gradient, at the basal boundary of the division zone, (thereby imposing the ULSR) to signal the exit of proliferation and start of elongation. This model exploration underlines the value of

  5. Visual- and Vestibular-Autonomic Influence on Short-Term Cardiovascular Regulatory Mechanisms

    NASA Technical Reports Server (NTRS)

    Mullen, Thomas J.; Ramsdell, Craig D.

    1999-01-01

    This synergy project was a one-year effort conducted cooperatively by members of the NSBRI Cardiovascular Alterations and Neurovestibular Adaptation Teams in collaboration with NASA Johnson Space Center (JSC) colleagues. The objective of this study was to evaluate visual autonomic interactions on short-term cardiovascular regulatory mechanisms. Based on established visual-vestibular and vestibular-autonomic shared neural pathways, we hypothesized that visually induced changes in orientation will trigger autonomic cardiovascular reflexes. A second objective was to compare baroreflex changes during postural changes as measured with the new Cardiovascular System Identification (CSI) technique with those measured using a neck barocuff. While the neck barocuff stimulates only the carotid baroreceptors, CSI provides a measure of overall baroreflex responsiveness. This study involved a repeated measures design with 16 healthy human subjects (8 M, 8 F) to examine cardiovascular regulatory responses during actual and virtual head-upright tilts. Baroreflex sensitivity was first evaluated with subjects in supine and upright positions during actual tilt-table testing using both neck barocuff and CSI methods. The responses to actual tilts during this first session were then compared to responses during visually induced tilt and/or rotation obtained during a second session.

  6. Use of lactobacilli and their pheromone-based regulatory mechanism in gene expression and drug delivery.

    PubMed

    Diep, D B; Mathiesen, G; Eijsink, V G H; Nes, I F

    2009-01-01

    Lactobacilli are common microorganisms in diverse vegetables and meat products and several of these are also indigenous inhabitants in the gastro-intestinal (GI) tract of humans and animals where they are believed to have health promoting effects on the host. One of the highly appreciated probiotic effects is their ability to inhibit the growth of pathogens by producing antimicrobial peptides, so-called bacteriocins. Production of some bacteriocins has been shown to be strictly regulated through a quorum-sensing based mechanism mediated by a secreted peptide-pheromone (also called induction peptide; IP), a membrane-located sensor (histidine protein kinase; HPK) and a cytoplasmic response regulator (RR). The interaction between an IP and its sensor, which is highly specific, leads to activation of the cognate RR which in turn binds to regulated promoters and activates gene expression. The HPKs and RRs are built up by conserved modules, and the signalling between them within a network is efficient and directional, and can easily be activated by exogenously added synthetic IPs. Consequently, components from such regulatory networks have successfully been exploited in construction of a number of inducible gene expression systems. In this review, we discuss some well-characterised quorum sensing networks involved in bacteriocin production in lactobacilli, with special focus on the use of the regulatory components in gene expression and on lactobacilli as potential delivery vehicle for therapeutic and vaccine purposes.

  7. Regulatory mechanisms of metabolic flexibility in the dark-eyed junco (Junco hyemalis).

    PubMed

    Stager, Maria; Swanson, David L; Cheviron, Zachary A

    2015-03-01

    Small temperate birds reversibly modify their aerobic performance to maintain thermoregulatory homeostasis under seasonally changing environmental conditions and these physiological adjustments may be attributable to changes in the expression of genes in the underlying regulatory networks. Here, we report the results of an experimental procedure designed to gain insight into the fundamental mechanisms of metabolic flexibility in the dark-eyed junco (Junco hyemalis). We combined genomic transcriptional profiles with measures of metabolic enzyme activities and whole-animal thermogenic performance from juncos exposed to four 6-week acclimation treatments that varied in temperature (cold, 3°C; warm, 24°C) and photoperiod (short day, 8 h light:16 h dark; long day, 16 h light:8 h dark). Cold-acclimated birds increased thermogenic capacity compared with warm-acclimated birds, and this enhanced performance was associated with upregulation of genes involved in muscle hypertrophy, angiogenesis, and lipid transport and oxidation, as well as with catabolic enzyme activities. These physiological changes occurred over ecologically relevant timescales, suggesting that birds make regulatory adjustments to interacting, hierarchical pathways in order to seasonally enhance thermogenic capacity.

  8. A systems biology approach to defining regulatory mechanisms for cartilage and tendon cell phenotypes

    PubMed Central

    Mueller, A. J.; Tew, S. R.; Vasieva, O.; Clegg, P. D.; Canty-Laird, E. G.

    2016-01-01

    Phenotypic plasticity of adult somatic cells has provided emerging avenues for the development of regenerative therapeutics. In musculoskeletal biology the mechanistic regulatory networks of genes governing the phenotypic plasticity of cartilage and tendon cells has not been considered systematically. Additionally, a lack of strategies to effectively reproduce in vitro functional models of cartilage and tendon is retarding progress in this field. De- and redifferentiation represent phenotypic transitions that may contribute to loss of function in ageing musculoskeletal tissues. Applying a systems biology network analysis approach to global gene expression profiles derived from common in vitro culture systems (monolayer and three-dimensional cultures) this study demonstrates common regulatory mechanisms governing de- and redifferentiation transitions in cartilage and tendon cells. Furthermore, evidence of convergence of gene expression profiles during monolayer expansion of cartilage and tendon cells, and the expression of key developmental markers, challenges the physiological relevance of this culture system. The study also suggests that oxidative stress and PI3K signalling pathways are key modulators of in vitro phenotypes for cells of musculoskeletal origin. PMID:27670352

  9. Regulatory motifs on ISWI chromatin remodelers: molecular mechanisms and kinetic proofreading

    NASA Astrophysics Data System (ADS)

    Brysbaert, Guillaume; Lensink, Marc F.; Blossey, Ralf

    2015-02-01

    Recently, kinetic proofreading scenarios have been proposed for the regulation of chromatin remodeling, first on purely theoretical grounds (Blossey and Schiessel 2008 HFSP J. 2 167-70) and deduced from experiments on the ISWI/ACF system (Narlikar 2010 Curr. Opin. Chem. Biol. 14 660). In the kinetic proofreading scenario of chromatin remodeling, the combination of the recognition of a histone tail state and ATP-hydrolysis in the remodeler motor act together to select (i.e. proofread) a nucleosomal substrate. ISWI remodelers have recently been shown to have an additional level of regulation as they contain auto-inhibitory motifs which need to be inactivated through an interaction with the nucleosome. In this paper we show that the auto-regulatory effect enhances substrate recognition in kinetic proofreading. We further report some suggestive additional insights into the molecular mechanism underlying ISWI-autoregulation.

  10. Mechanistic Basis for Plant Responses to Drought Stress : Regulatory Mechanism of Abscisic Acid Signaling

    NASA Astrophysics Data System (ADS)

    Miyakawa, Takuya; Tanokura, Masaru

    The phytohormone abscisic acid (ABA) plays a key role in the rapid adaptation of plants to environmental stresses such as drought and high salinity. Accumulated ABA in plant cells promotes stomatal closure in guard cells and transcription of stress-tolerant genes. Our understanding of ABA responses dramatically improved by the discovery of both PYR/PYL/RCAR as a soluble ABA receptor and inhibitory complex of a protein phospatase PP2C and a protein kinase SnRK2. Moreover, several structural analyses of PYR/PYL/RCAR revealed the mechanistic basis for the regulatory mechanism of ABA signaling, which provides a rational framework for the design of alternative agonists in future.

  11. Regulatory mechanisms of nitric oxide and reactive oxygen species generation and their role in plant immunity.

    PubMed

    Yoshioka, Hirofumi; Mase, Keisuke; Yoshioka, Miki; Kobayashi, Michie; Asai, Shuta

    2011-08-01

    Rapid production of nitric oxide (NO) and reactive oxygen species (ROS) has been implicated in diverse physiological processes, such as programmed cell death, development, cell elongation and hormonal signaling, in plants. Much attention has been paid to the regulation of plant innate immunity by these signal molecules. Recent studies provide evidence that an NADPH oxidase, respiratory burst oxidase homolog, is responsible for pathogen-responsive ROS burst. However, we still do not know about NO-producing enzymes, except for nitrate reductase, although many studies suggest the existence of NO synthase-like activity responsible for NO burst in plants. Here, we introduce regulatory mechanisms of NO and ROS bursts by mitogen-activated protein kinase cascades, calcium-dependent protein kinase or riboflavin and its derivatives, flavin mononucleotide and flavin adenine dinucleotide, and we discuss the roles of the bursts in defense responses against plant pathogens.

  12. Acute-Phase Serum Amyloid A in Osteoarthritis: Regulatory Mechanism and Proinflammatory Properties

    PubMed Central

    de Seny, Dominique; Cobraiville, Gaël; Charlier, Edith; Neuville, Sophie; Esser, Nathalie; Malaise, Denis; Malaise, Olivier; Calvo, Florence Quesada; Relic, Biserka; Malaise, Michel G.

    2013-01-01

    Objective To determine if serum amyloid A (A-SAA) could be detected in human osteoarthritic (OA) joints and further clarify if high A-SAA level in joints result from a local production or from a diffusion process from abnormally elevated plasma concentration. Regulatory mechanism of A-SAA expression and its pro-inflammatory properties were also investigated. Methods A-SAA levels in serum and synovial fluid of OA (n = 29) and rheumatoid arthritis (RA) (n = 27) patients were measured and compared to matched-healthy volunteers (HV) (n = 35). In vitro cell cultures were performed on primary joint cells provided from osteoarthritis patients. Regulatory mechanisms were studied using Western-blotting, ELISA and lentiviral transfections. Results A-SAA was statistically increased in OA plasma patients compared to HV. Moreover, A-SAA level in OA plasma and synovial fluid increased with the Kellgren & Lauwrence grade. For all OA and RA patients, A-SAA plasma level was higher and highly correlated with its corresponding level in the synovial fluid, therefore supporting that A-SAA was mainly due to the passive diffusion process from blood into the joint cavity. However, A-SAA expression was also observed in vitro under corticosteroid treatment and/or under IL-1beta stimuli. A-SAA expression was down-regulated by PPAR-γ agonists (genistein and rosiglitazone) and up-regulated by TGF-β1 through Alk1 (Smad1/5) pathway. RhSAA induced proinflammatory cytokines (IL-6, IL-8, GRO-α and MCP-1) and metalloproteinases (MMP-1, MMP-3 and MMP-13) expression in FLS and chondrocytes, which expression was downregulated by TAK242, a specific TLR4 inhibitor. Conclusion Systemic or local A-SAA expression inside OA joint cavity may play a key role in inflammatory process seen in osteoarthritis, which could be counteracted by TLR4 inhibition. PMID:23776697

  13. Restricted Autoantigen Recognition Associated With Deletional and Adaptive Regulatory Mechanisms1

    PubMed Central

    Gebe, John A.; Yue, Betty B.; Unrath, Kelly A; Falk, Ben A.; Nepom, Gerald T.

    2009-01-01

    Autoimmune diabetes (T1D) is characterized by CD4+ T cell reactivity to a variety of islet-associated antigens. At-risk individuals, genetically predisposed to T1D, often have similar T cell reactivity, but nevertheless fail to progress to clinically overt disease. In order to study the immune tolerance and regulatory environment permissive for such autoreactive T cells, we expressed TcR transgenes derived from two autoreactive human T cells, 4.13 and 164, in HLA-DR4 transgenic mice on a C57Bl/6-derived “diabetes-resistant” background. Both TcR are responsive to an immunodominant epitope of glutamic acid decarboxylase 65 (555–567), which is identical in sequence between humans and mice, is restricted by HLA-DR4, and is a naturally processed self antigen associated with T1D. Although both TcR use the identical Vα and Vβ genes, differing only in CDR3, we found stark differences in the mechanisms utilized in vivo in the maintenance of immune tolerance. A combination of thymic deletion (negative selection), TcR down-regulation, and peripheral activation-induced cell death dominated the phenotype of 164 T cells, which nevertheless still maintain their antigen responsiveness in the periphery. In contrast, 4.13 T cells are much less influenced by central and deletional tolerance mechanisms, and instead display a peripheral immune deviation including differentiation into IL-10 secreting Tr1 cells. These findings indicate a distinct set of regulatory alternatives for autoreactive T cells, even within a single highly restricted HLA-peptide-TcR recognition profile. PMID:19535636

  14. Interplay of cis- and trans-regulatory mechanisms in the spliceosomal RNA helicase Brr2.

    PubMed

    Absmeier, Eva; Becke, Christian; Wollenhaupt, Jan; Santos, Karine F; Wahl, Markus C

    2017-01-02

    RNA helicase Brr2 is implicated in multiple phases of pre-mRNA splicing and thus requires tight regulation. Brr2 can be auto-inhibited via a large N-terminal region folding back onto its helicase core and auto-activated by a catalytically inactive C-terminal helicase cassette. Furthermore, it can be regulated in trans by the Jab1 domain of the Prp8 protein, which can inhibit Brr2 by intermittently inserting a C-terminal tail in the enzyme's RNA-binding tunnel or activate the helicase after removal of this tail. Presently it is unclear, whether these regulatory mechanisms functionally interact and to which extent they are evolutionarily conserved. Here, we report crystal structures of Saccharomyces cerevisiae and Chaetomium thermophilum Brr2-Jab1 complexes, demonstrating that Jab1-based inhibition of Brr2 presumably takes effect in all eukaryotes but is implemented via organism-specific molecular contacts. Moreover, the structures show that Brr2 auto-inhibition can act in concert with Jab1-mediated inhibition, and suggest that the N-terminal region influences how the Jab1 C-terminal tail interacts at the RNA-binding tunnel. Systematic RNA binding and unwinding studies revealed that the N-terminal region and the Jab1 C-terminal tail specifically interfere with accommodation of double-stranded and single-stranded regions of an RNA substrate, respectively, mutually reinforcing each other. Additionally, such analyses show that regulation based on the N-terminal region requires the presence of the inactive C-terminal helicase cassette. Together, our results outline an intricate system of regulatory mechanisms, which control Brr2 activities during snRNP assembly and splicing.

  15. Systemic blood loss affects NF-kappa B regulatory mechanisms in the lungs.

    PubMed

    Moine, P; Shenkar, R; Kaneko, D; Le Tulzo, Y; Abraham, E

    1997-07-01

    The nuclear regulatory factor (NF)-kappa B is activated in the lungs of patients with acute respiratory distress syndrome (ARDS). In experimental models of acute lung injury, activation of NF-kappa B contributes to the increased expression of immunoregulatory cytokines and other proinflammatory mediators in the lungs. Because of the important role that NF-kappa B activation appears to play in the development of acute lung injury, we examined cytoplasmic and nuclear NF-kappa B counterregulatory mechanisms in lung mononuclear cells, using a murine model in which inflammatory lung injury develops after blood loss. Sustained activation of NF-kappa B was present in lung mononuclear cells over the 4-h period after blood loss. The activation of NF-kappa B after hemorrhage was accompanied by alterations in levels of the NF-kappa B regulatory proteins I kappa B alpha and Bcl-3. Cytoplasmic and nuclear I kappa B alpha were increased and nuclear Bcl-3 was decreased during the first hour after blood loss, but, by 4 h posthemorrhage, cytoplasmic and nuclear I kappa B alpha levels were decreased and nuclear levels of Bcl-3 were increased. Inhibition of xanthine oxidase activity in otherwise unmanipulated unhemorrhaged mice resulted in increased levels of I kappa B alpha and decreased amounts of Bcl-3 in nuclear extracts from lung mononuclear cells. No changes in the levels of nuclear I kappa B alpha or Bcl-3 occurred after hemorrhage when xanthine oxidase activity was inhibited. These results demonstrate that blood loss, at least partly through xanthine oxidase-dependent mechanisms, produces alterations in the levels of both I kappa B alpha and Bcl-3 in lung mononuclear cell populations. The effects of hemorrhage on proteins that regulate activation of NF-kappa B may contribute to the frequent development of inflammatory lung injury in this setting.

  16. The regulatory mechanisms of myogenin expression in doxorubicin-treated rat cardiomyocytes.

    PubMed

    Liu, Shu-Ting; Huang, Shih-Ming; Ho, Ching-Liang; Yen, Li-Chen; Huang, Chi-Jung; Lin, Wei-Shiang; Chan, James Yi-Hsin

    2015-11-10

    Doxorubicin, an anthracycline antibiotic, has been used as an anti-neoplastic drug for almost 60 years. However, the mechanism(s) by which anthracyclines cause irreversible myocardial injury remains unclear. In order to delineate possible molecular signals involved in the myocardial toxicity, we assessed candidate genes using mRNA expression profiling in the doxorubicin-treated rat cardiomyocyte H9c2 cell line. In the study, it was confirmed that myogenin, an important transcriptional factor for muscle terminal differentiation, was significantly reduced by doxorubicin in a dose-dependent manner using both RT-PCR and western blot analyses. Also, it was identified that the doxorubicin-reduced myogenin gene level could not be rescued by most cardio-protectants. Furthermore, it was demonstrated how the signaling of the decreased myogenin expression by doxorubicin was altered at the transcriptional, post-transcriptional and translational levels. Based on these findings, a working model was proposed for relieving doxorubicin-associated myocardial toxicity by down-regulating miR-328 expression and increasing voltage-gated calcium channel β1 expression, which is a repressor of myogenin gene regulation. In summary, this study provides several lines of evidence indicating that myogenin is the target for doxorubicin-induced cardio-toxicity and a novel therapeutic strategy for doxorubicin clinical applications based on the regulatory mechanisms of myogenin expression.

  17. Adjunct Strategies for Tuberculosis Vaccines: Modulating Key Immune Cell Regulatory Mechanisms to Potentiate Vaccination

    PubMed Central

    Jayashankar, Lakshmi; Hafner, Richard

    2016-01-01

    Tuberculosis (TB) remains a global health threat of alarming proportions, resulting in 1.5 million deaths worldwide. The only available licensed vaccine, Bacillus Calmette–Guérin, does not confer lifelong protection against active TB. To date, development of an effective vaccine against TB has proven to be elusive, and devising newer approaches for improved vaccination outcomes is an essential goal. Insights gained over the last several years have revealed multiple mechanisms of immune manipulation by Mycobacterium tuberculosis (Mtb) in infected macrophages and dendritic cells that support disease progression and block development of protective immunity. This review provides an assessment of the known immunoregulatory mechanisms altered by Mtb, and how new interventions may reverse these effects. Examples include blocking of inhibitory immune cell coreceptor checkpoints (e.g., programed death-1). Conversely, immune mechanisms that strengthen immune cell effector functions may be enhanced by interventions, including stimulatory immune cell coreceptors (e.g., OX40). Modification of the activity of key cell “immunometabolism” signaling pathway molecules, including mechanistic target of rapamycin, glycogen synthase kinase-3β, wnt/β-catenin, adenosine monophosophate-activated protein kinase, and sirtuins, related epigenetic changes, and preventing induction of immune regulatory cells (e.g., regulatory T cells, myeloid-derived suppressor cells) are powerful new approaches to improve vaccine responses. Interventions to favorably modulate these components have been studied primarily in oncology to induce efficient antitumor immune responses, often by potentiation of cancer vaccines. These agents include antibodies and a rapidly increasing number of small molecule drug classes that have contributed to the dramatic immune-based advances in treatment of cancer and other diseases. Because immune responses to malignancies and to Mtb share many similar mechanisms

  18. Development of neurodevelopmental disorders: a regulatory mechanism involving bromodomain-containing proteins.

    PubMed

    Li, Junlin; Zhao, Guifang; Gao, Xiaocai

    2013-02-20

    Neurodevelopmental disorders are classified as diseases that cause abnormal functions of the brain or central nervous system. Children with neurodevelopmental disorders show impaired language and speech abilities, learning and memory damage, and poor motor skills. However, we still know very little about the molecular etiology of these disorders. Recent evidence implicates the bromodomain-containing proteins (BCPs) in the initiation and development of neurodevelopmental disorders. BCPs have a particular domain, the bromodomain (Brd), which was originally identified as specifically binding acetyl-lysine residues at the N-terminus of histone proteins in vitro and in vivo. Other domains of BCPs are responsible for binding partner proteins to form regulatory complexes. Once these complexes are assembled, BCPs alter chromosomal states and regulate gene expression. Some BCP complexes bind nucleosomes, are involved in basal transcription regulation, and influence the transcription of many genes. However, most BCPs are involved in targeting. For example, some BCPs function as a recruitment platform or scaffold through their Brds-binding targeting sites. Others are recruited to form a complex to bind the targeting sites of their partners. The regulation mediated by these proteins is especially critical during normal and abnormal development. Mutant BCPs or dysfunctional BCP-containing complexes are implicated in the initiation and development of neurodevelopmental disorders. However, the pathogenic molecular mechanisms are not fully understood. In this review, we focus on the roles of regulatory BCPs associated with neurodevelopmental disorders, including mental retardation, Fragile X syndrome (FRX), Williams syndrome (WS), Rett syndrome and Rubinstein-Taybi syndrome (RTS). A better understanding of the molecular pathogenesis, based upon the roles of BCPs, will lead to screening of targets for the treatment of neurodevelopmental disorders.

  19. NF-kappaB regulatory mechanisms in alveolar macrophages from patients with acute respiratory distress syndrome.

    PubMed

    Moine, P; McIntyre, R; Schwartz, M D; Kaneko, D; Shenkar, R; Le Tulzo, Y; Moore, E E; Abraham, E

    2000-02-01

    Activation of the nuclear regulatory factor NF-kappaB occurs in the lungs of patients with the acute respiratory distress syndrome (ARDS) and may contribute to the increased expression of immunoregulatory cytokines and other proinflammatory mediators in this setting. Because of the important role that NF-kappaB activation appears to play in the development of acute lung injury, we examined cytoplasmic and nuclear NF-kapppaB counterregulatory mechanisms, involving IkappaB proteins, in alveolar macrophages obtained from 7 control patients without lung injury and 11 patients with established ARDS. Cytoplasmic levels of the NF-kappaB subunits p50, p65, and c-Rel were significantly decreased in alveolar macrophages from patients with ARDS, consistent with enhanced migration of liberated NF-kappaB dimers from the cytoplasm to the nucleus. Cytoplasmic and nuclear levels of IkappaBalpha were not significantly altered in alveolar macrophages from patients with established ARDS, compared with controls. In contrast, nuclear levels of Bcl-3 were significantly decreased in patients with ARDS compared with controls (P = 0.02). No IkappaBgamma, IkappaBbeta, or p105 proteins were detected in the cytoplasm of alveolar macrophages from control patients or patients with ARDS. The presence of activated NF-kappaB in alveolar macrophages from patients with established ARDS implies the presence of an ongoing stimulus for NF-kappaB activation. In this setting, appropriate counterregulatory mechanisms to normalize nuclear levels of NF-kappaB and to suppress NF-kappaB-mediated transcription, such as increased cytoplasmic and nuclear IkappaBalpha levels or decreased Bcl-3 levels, appeared to be induced. Nevertheless, even though counterregulatory mechanisms to NF-kappaB activation are activated in lung macrophages of patients with ARDS, NF-kappaB remains activated. These results suggest that fundamental abnormalities in transcriptional mechanisms involving NF-kappaB and important in the

  20. A model for the volume regulatory mechanism of the Airway Surface Layer

    NASA Astrophysics Data System (ADS)

    Lang, Michael; Rubinstein, Michael; Davis, C. William; Tarran, Robert; Boucher, Richard

    2006-03-01

    The airway surface layer (ASL) of a lung consists of two parts: a mucus layer with thickness of about 30 μm in contact with air and a periciliary layer (PCL) of about 7 μm below. Mucus collects dust and bacteria and is swept to throat by beating cilia, while riding on top of PCL. It is important that the thickness of PCL is matched with the length of cilia in order to optimize clearance of mucus. Decrease of PCL thickness would finally lead to an occlusion of the respiratory system. Experiments show that the height of PCL stays constant after removing mucus. When modifying height or composition of this open PCL by removing fluid or adding isotonic solution leads to the same final height of PCL. Thus, there must be a regulatory mechanism, that controls height, i.e. ASL volume. Additional experiments show that mechanical stimulus of the cells like shear leads to an increase of ASL volume, thus, the cell is able to actively adjust this volume. Based on these observations a class of models is introduced that describes the experiments and a specific minimum model for the given problem is proposed.

  1. Comprehensive population-based genome sequencing provides insight into hematopoietic regulatory mechanisms

    PubMed Central

    Guo, Michael H.; Nandakumar, Satish K.; Ulirsch, Jacob C.; Zekavat, Seyedeh M.; Buenrostro, Jason D.; Natarajan, Pradeep; Salem, Rany M.; Chiarle, Roberto; Mitt, Mario; Kals, Mart; Pärn, Kalle; Fischer, Krista; Milani, Lili; Mägi, Reedik; Palta, Priit; Gabriel, Stacey B.; Metspalu, Andres; Lander, Eric S.; Kathiresan, Sekar; Hirschhorn, Joel N.; Esko, Tõnu; Sankaran, Vijay G.

    2017-01-01

    Genetic variants affecting hematopoiesis can influence commonly measured blood cell traits. To identify factors that affect hematopoiesis, we performed association studies for blood cell traits in the population-based Estonian Biobank using high-coverage whole-genome sequencing (WGS) in 2,284 samples and SNP genotyping in an additional 14,904 samples. Using up to 7,134 samples with available phenotype data, our analyses identified 17 associations across 14 blood cell traits. Integration of WGS-based fine-mapping and complementary epigenomic datasets provided evidence for causal mechanisms at several loci, including at a previously undiscovered basophil count-associated locus near the master hematopoietic transcription factor CEBPA. The fine-mapped variant at this basophil count association near CEBPA overlapped an enhancer active in common myeloid progenitors and influenced its activity. In situ perturbation of this enhancer by CRISPR/Cas9 mutagenesis in hematopoietic stem and progenitor cells demonstrated that it is necessary for and specifically regulates CEBPA expression during basophil differentiation. We additionally identified basophil count-associated variation at another more pleiotropic myeloid enhancer near GATA2, highlighting regulatory mechanisms for ordered expression of master hematopoietic regulators during lineage specification. Our study illustrates how population-based genetic studies can provide key insights into poorly understood cell differentiation processes of considerable physiologic relevance. PMID:28031487

  2. Apoptosis as a mechanism of T-regulatory cell homeostasis and suppression.

    PubMed

    Yolcu, Esma S; Ash, Shifra; Kaminitz, Ayelet; Sagiv, Yuval; Askenasy, Nadir; Yarkoni, Shai

    2008-01-01

    Activation-induced cell death is a general mechanism of immune homeostasis through negative regulation of clonal expansion of activated immune cells. This mechanism is involved in the maintenance of self- and transplant tolerance through polarization of the immune responses. The Fas/Fas-ligand interaction is a major common executioner of apoptosis in lymphocytes, with a dual role in regulatory T cell (Treg) function: Treg cell homeostasis and Treg cell-mediated suppression. Sensitivity to apoptosis and the patterns of Treg-cell death are of outmost importance in immune homeostasis that affects the equilibrium between cytolytic and suppressor forces in activation and termination of immune activity. Naive innate (naturally occurring) Treg cells present variable sensitivities to apoptosis, related to their turnover rates in tissue under steady state conditions. Following activation, Treg cells are less sensitive to apoptosis than cytotoxic effector subsets. Their susceptibility to apoptosis is influenced by cytokines within the inflammatory environment (primarily interleukin-2), the mode of antigenic stimulation and the proliferation rates. Here, we attempt to resolve some controversies surrounding the sensitivity of Treg cells to apoptosis under various experimental conditions, to delineate the function of cell death in regulation of immunity.

  3. Unravelling the regulatory mechanisms that modulate the MEP pathway in higher plants.

    PubMed

    Cordoba, Elizabeth; Salmi, Mari; León, Patricia

    2009-01-01

    The methyl-D-erythritol 4-phosphate pathway is responsible for the biosynthesis of a substantial number of natural compounds of biological and biotechnological importance. In recent years, this pathway has become an obvious target to develop new herbicides and antimicrobial drugs. In addition, the production of a variety of compounds of medical and agricultural interest may be possible through the genetic manipulation of this pathway. To this end, a complete understanding of the molecular mechanisms that regulate this pathway is of tremendous importance. Recent data have accumulated that show some of the multiple mechanisms that regulate the methyl-D-erythritol 4-phosphate pathway in plants. In this review we will describe some of these and discuss their implications. It has been demonstrated that 1-deoxy-D-xylulose-5-phosphate synthase (DXS), the first enzyme of this route, plays a major role in the overall regulation of the pathway. A small gene family codes for this enzyme in most of the plants which have been analysed so far, and the members of these gene families belong to different phylogenetic groups. Each of these genes exhibits a distinct expression pattern, suggesting unique functions. One of the most interesting regulatory mechanisms recently described for this pathway is the post-transcriptional regulation of the level of DXS and DXR proteins. In the case of DXS, this regulation appears conserved among plants, supporting its importance. The evidence accumulated suggests that this regulation might link the activity of this pathway with the plant's physiological conditions and the metabolic demand for the final products of this route.

  4. Regulatory mechanism of protein metabolic pathway during the differentiation process of chicken male germ cell.

    PubMed

    Li, Dong; Zuo, Qisheng; Lian, Chao; Zhang, Lei; Shi, Qingqing; Zhang, Zhentao; Wang, Yingjie; Ahmed, Mahmoud F; Tang, Beibei; Xiao, Tianrong; Zhang, Yani; Li, Bichun

    2015-08-01

    We explored the regulatory mechanism of protein metabolism during the differentiation process of chicken male germ cells and provide a basis for improving the induction system of embryonic stem cell differentiation to male germ cells in vitro. We sequenced the transcriptome of embryonic stem cells, primordial germ cells, and spermatogonial stem cells with RNA sequencing (RNA-Seq), bioinformatics analysis methods, and detection of the key genes by quantitative reverse transcription PCR (qRT-PCR). Finally, we found 16 amino acid metabolic pathways enriched in the biological metabolism during the differentiation process of embryonic stem cells to primordial germ cells and 15 amino acid metabolic pathways enriched in the differentiation stage of primordial germ cells to spermatogonial stem cells. We found three pathways, arginine-proline metabolic pathway, tyrosine metabolic pathway, and tryptophan metabolic pathway, significantly enriched in the whole differentiation process of embryonic stem cells to spermatogonial stem cells. Moreover, for these three pathways, we screened key genes such as NOS2, ADC, FAH, and IDO. qRT-PCR results showed that the expression trend of these genes were the same to RNA-Seq. Our findings showed that the three pathways and these key genes play an important role in the differentiation process of embryonic stem cells to male germ cells. These results provide basic information for improving the induction system of embryonic stem cell differentiation to male germ cells in vitro.

  5. Morphogenetic and Regulatory Mechanisms During Developmental Chondrogenesis: New Paradigms for Cartilage Tissue Engineering

    PubMed Central

    Quintana, Lluís; zur Nieden, Nicole I.

    2009-01-01

    Cartilage is the first skeletal tissue to be formed during embryogenesis leading to the creation of all mature cartilages and bones, with the exception of the flat bones in the skull. Therefore, errors occurring during the process of chondrogenesis, the formation of cartilage, often lead to severe skeletal malformations such as dysplasias. There are hundreds of skeletal dysplasias, and the molecular genetic etiology of some remains more elusive than of others. Many efforts have aimed at understanding the morphogenetic event of chondrogenesis in normal individuals, of which the main morphogenetic and regulatory mechanisms will be reviewed here. For instance, many signaling molecules that guide chondrogenesis—for example, transforming growth factor-β, bone morphogenetic proteins, fibroblast growth factors, and Wnts, as well as transcriptional regulators such as the Sox family—have already been identified. Moreover, extracellular matrix components also play an important role in this developmental event, as evidenced by the promotion of the chondrogenic potential of chondroprogenitor cells caused by collagen II and proteoglycans like versican. The growing evidence of the elements that control chondrogenesis and the increasing number of different sources of progenitor cells will, hopefully, help to create tissue engineering platforms that could overcome many developmental or degenerative diseases associated with cartilage defects. PMID:19063663

  6. Regulatory mechanisms and clinical perspectives of miRNA in tumor radiosensitivity

    PubMed Central

    Cao, Ya; Dong, Zigang

    2012-01-01

    MicroRNA (miRNA) influences carcinogenesis at multiple stages and it can effectively control tumor radiosensitivity by affecting DNA damage repair, cell cycle checkpoint, apoptosis, radio-related signal transduction pathways and tumor microenvironment. MiRNA also efficiently modulates tumor radiosensitivity at multiple levels by blocking the two essential non-homologous end-joining repair and homologous recombination repair pathways in the DNA damage response. It interferes with four radio-related pathways in ionizing radiation, including the PI3-K/Akt, NF-κB, MAPK and TGFβ signaling pathways. Moreover, the regulatory effect of miRNA in radiosensitivity can be enhanced when interacting with various key molecules, including H2AX, BRCA1, ATM, DNA-PK, RAD51, Chk1, Cdc25A, p53, PLK1, HIF-1 and VEGF, which are involved in these processes. Therefore, thoroughly understanding the mechanism of miRNA in tumor radiosensitivity could assist in finding novel targets to improve the radiotherapeutic effects and provide new clinical perspectives and insights for developing effective cancer treatments. PMID:22798379

  7. The regulatory mechanism of Tremella mesenterica on steroidogenesis in MA-10 mouse Leydig tumor cells.

    PubMed

    Chen, Yen-Wen; Lo, Hui-Chen; Yang, Jyuer-Ger; Chien, Chi-Hsien; Lee, Shi-Hsiung; Tseng, Chi-Yu; Huang, Bu-Miin

    2006-07-04

    Tremella mesenterica (TM), a yellow jelly mushroom, has been traditionally used as tonic food to improve body condition in Chinese society for a long time. We have previously demonstrated that TM reduced in vitro hCG-treated steroidogenesis in MA-10 mouse Leydig tumor cells without any toxicity effect. In the present study, the mechanism how TM suppressed hCG-treated steroidogenesis in MA-10 cells was investigated. MA-10 cells were treated with vehicle, human chorionic gonadotropin (hCG, 50 ng/ml), or different reagents with or without TM to clarify the effects. TM significantly suppressed progesterone production with the presences of forskolin (10 and 100 microM) or dbcAMP (0.5 and 1mM), respectively, in MA-10 cells (p<0.05), which indicated that TM suppressed steroidogenesis after PKA activation along the signal pathway. Beyond our expectation, TM induced the expression of steroidogenic acute regulatory (StAR) protein with or without hCG treatments. However, TM profoundly decreased P450 side chain cleavage (P450scc) and 3beta-hydroxysteroid dehydrogenase (3beta-HSD) enzyme activities without any influences on the expression of both enzymes. These inhibitions on steroidogenic enzyme activities might counteract the stimulation of StAR protein expression. In conclusion, results suggest that TM suppressed hCG-treated steroidogenesis in MA-10 cells by inhibiting PKA signal pathway and steroidogenic enzyme activities.

  8. Acid-base bifunctional catalytic surfaces for nucleophilic addition reactions.

    PubMed

    Motokura, Ken; Tada, Mizuki; Iwasawa, Yasuhiro

    2008-09-01

    This article illustrates the modification of oxide surfaces with organic amine functional groups to create acid-base bifunctional catalysts, summarizing our previous reports and also presenting new data. Immobilization of organic amines as bases on inorganic solid-acid surfaces afforded highly active acid-base bifunctional catalysts, which enabled various organic transformations including C--C coupling reactions, though these reactions did not proceed with either the homogeneous amine precursors or the acidic supports alone. Spectroscopic characterization, such as by solid-state MAS NMR and FTIR, revealed not only the interactions between acidic and basic sites but also bifunctional catalytic reaction mechanisms.

  9. Dynamic responsiveness of the vascular bed as a regulatory mechanism in vasomotor control.

    PubMed

    Zamir, Mair; Norton, Katelyn; Fleischhauer, Arlene; Frances, Maria F; Goswami, Ruma; Usselman, Charlotte W; Nolan, Robert P; Shoemaker, J Kevin

    2009-07-01

    The dynamics of blood supply to a vascular bed depend on lumped mechanical properties of that bed, namely the compliance (C), resistance (R), viscoelasticity (K), and inertance (L). While the study of regulatory mechanisms has so far placed the emphasis largely on R, it is not known how the remaining properties contribute collectively to the play of dynamics in vasomotor control. To examine this question and to establish some benchmark values of these properties, simultaneous measurements of pressure and flow waveforms in the vascular bed of the forearm were obtained from three groups: young healthy individuals, older hypertensives with controlled blood pressure, and older hypertensives with uncontrolled blood pressure. The values of R and C were found to vary within a wide range in each of the three groups to the extent that neither R nor C could be used independently as an indicator of health or age of the subjects tested. However, higher level dynamic properties of the bed, such as the time constants and damping index, which depend on combinations of C,K, and L, and which may reflect measures of the dynamic responsiveness or "sluggishness" of the system, were found to be maintained over a wide range of pulse pressures. These findings support a hypothesis that the pulsatile dynamics of blood supply to a vascular bed are adapted to the individual baseline values of R and C in different subjects with the effect of optimizing the level of dynamic responsiveness to changes in pressure or flow, and that this dynamic property of the vascular bed may be a protected and/or regulated property.

  10. Renal acidification responses to respiratory acid-base disorders.

    PubMed

    Madias, Nicolaos E

    2010-01-01

    Respiratory acid-base disorders are those abnormalities in acid-base equilibrium that are expressed as primary changes in the arterial carbon dioxide tension (PaCO2). An increase in PaCO2 (hypercapnia) acidifies body fluids and initiates the acid-base disturbance known as respiratory acidosis. By contrast, a decrease in PaCO2 (hypocapnia) alkalinizes body fluids and initiates the acid-base disturbance known as respiratory alkalosis. The impact on systemic acidity of these primary changes in PaCO2 is ameliorated by secondary, directional changes in plasma [HCO3¯] that occur in 2 stages. Acutely, hypercapnia or hypocapnia yields relatively small changes in plasma [HCO3¯] that originate virtually exclusively from titration of the body's nonbicarbonate buffers. During sustained hypercapnia or hypocapnia, much larger changes in plasma [HCO3¯] occur that reflect adjustments in renal acidification mechanisms. Consequently, the deviation of systemic acidity from normal is smaller in the chronic forms of these disorders. Here we provide an overview of the renal acidification responses to respiratory acid-base disorders. We also identify gaps in knowledge that require further research.

  11. Controlling the fire--tissue-specific mechanisms of effector regulatory T-cell homing.

    PubMed

    Chow, Zachary; Banerjee, Ashish; Hickey, Michael J

    2015-04-01

    Regulatory T cells have essential roles in regulating immune responses and limiting inappropriate inflammation. Evidence now indicates that to achieve this function, regulatory T cells must be able to migrate to the most appropriate locations within both lymphoid and non-lymphoid organs. This function is achieved via the spatiotemporally controlled expression of adhesion molecules and chemokine receptors, varying according to the developmental stage of the regulatory T cell and the location and environment where they undergo activation. In this Review, we summarise information on the roles of adhesion molecules and chemokine receptors in mediating regulatory T-cell migration and function throughout the body under homeostatic and inflammatory conditions. In addition, we review recent studies that have used in vivo imaging to examine the actions of regulatory T cells in vivo, in lymph nodes, in the microvasculature and in the interstitium of peripheral organs. These studies reveal that the capacity of regulatory T cells to undergo selective migration serves a critical role in their ability to suppress immune responses. As such, the cellular and molecular requirements of regulatory T-cell migration need to be completely understood to enable the most effective use of these cells in clinical settings.

  12. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk.

    PubMed

    McCraty, Rollin; Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems.

  13. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk

    PubMed Central

    Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems. PMID:25694852

  14. Acute inflammation in peritoneal dialysis: experimental studies in rats. Characterization of regulatory mechanisms.

    PubMed

    Bazargani, Farhan

    2005-01-01

    The predominant problems associated with peritoneal dialysis (PD) are ultrafiltration failure and peritonitis. PD maintains a state of intraperitoneal inflammation that affects the structure and function of the peritoneal membrane, potentially impairing ultrafiltration efficiency. Paradoxically, some PD fluids also have anti-inflammatory properties that may compromise the immune defense against peritonitis. This anti-inflammatory feature is mostly due to the glucose degradation products (GDPs), formed during heat-sterilization and storage of PD fluids. The main purpose of the present thesis was to study regulatory mechanisms behind the acute intraperitoneal inflammatory response in PD in the presence and absence of experimental peritonitis. Rats were exposed to a single dose of heat- or filter sterilized PD fluids either as an i.p. injection or as an infusion through an indwelling catheter, with or without supplementations, or pretreatment of the animals. The dwell fluid was analyzed zero, two and four hours later concerning activation of the complement and coagulation cascades, neutrophil recruitment and respiratory burst, ultrafiltration volumes, cytokine-induced neutrophil chemoattractant (CINC-1), rat mast cell protease 2 (RMCP-2), glucose, urea and histamine concentrations and ex vivo/in vitro intraperitoneal chemotactic activity. Exposure to filter sterilized PD fluid alone induced intraperitoneal complement activation and coagulation, neutrophil recruitment and increased the levels of CINC-1 during the dwell. Intraperitoneal concentrations of the mast cell markers histamine and RMCP-2 changed little during the dwells and did not indicate mast cell activation. Low molecular weight heparin (LMWH) and C5 blockade improved ultrafiltration. Pretreatment with cobra venom factor, known decomplementing agent, blocked the CINC-1 release and the neutrophil recruitment and improved ultrafiltration. In combination with experimental peritonitis, heat sterilized PD fluid

  15. The Conjugate Acid-Base Chart.

    ERIC Educational Resources Information Center

    Treptow, Richard S.

    1986-01-01

    Discusses the difficulties that beginning chemistry students have in understanding acid-base chemistry. Describes the use of conjugate acid-base charts in helping students visualize the conjugate relationship. Addresses chart construction, metal ions, buffers and pH titrations, and the organic functional groups and nonaqueous solvents. (TW)

  16. The Kidney and Acid-Base Regulation

    ERIC Educational Resources Information Center

    Koeppen, Bruce M.

    2009-01-01

    Since the topic of the role of the kidneys in the regulation of acid base balance was last reviewed from a teaching perspective (Koeppen BM. Renal regulation of acid-base balance. Adv Physiol Educ 20: 132-141, 1998), our understanding of the specific membrane transporters involved in H+, HCO , and NH transport, and especially how these…

  17. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-01-01

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  18. microRNA regulatory mechanism by which PLLA aligned nanofibers influence PC12 cell differentiation

    NASA Astrophysics Data System (ADS)

    Yu, Yadong; Lü, Xiaoying; Ding, Fei

    2015-08-01

    Objective. Aligned nanofibers (AFs) are regarded as promising biomaterials in nerve tissue engineering. However, a full understanding of the biocompatibility of AFs at the molecular level is still challenging. Therefore, the present study focused on identifying the microRNA (miRNA)-mediated regulatory mechanism by which poly-L-lactic acid (PLLA) AFs influence PC12 cell differentiation. Approach. Firstly, the effects of PLLA random nanofibers (RFs)/AFs and PLLA films (control) on the biological responses of PC12 cells that are associated with neuronal differentiation were examined. Then, SOLiD sequencing and cDNA microarray were employed to profile the expressions of miRNAs and mRNAs. The target genes of the misregulated miRNAs were predicted and compared with the mRNA profile data. Functions of the matched target genes (the intersection between the predicted target genes and the experimentally-determined, misregulated genes) were analyzed. Main results. The results revealed that neurites spread in various directions in control and RF groups. In the AF group, most neurites extended in parallel with each other. The glucose consumption and lactic acid production in the RF and AF groups were higher than those in the control group. Compared with the control group, 42 and 94 miRNAs were significantly dysregulated in the RF and AF groups, respectively. By comparing the predicted target genes with the mRNA profile data, five and 87 matched target genes were found in the RF and AF groups, respectively. Three of the matched target genes in the AF group were found to be associated with neuronal differentiation, whereas none had this association in the RF group. The PLLA AFs induced the dysregulation of miRNAs that regulate many biological functions, including axonal guidance, lipid metabolism and long-term potentiation. In particular, two miRNA-matched target gene-biological function modules associated with neuronal differentiation were identified as follows: (1) miR-23b, mi

  19. Nitrous Oxide Metabolism in Nitrate-Reducing Bacteria: Physiology and Regulatory Mechanisms.

    PubMed

    Torres, M J; Simon, J; Rowley, G; Bedmar, E J; Richardson, D J; Gates, A J; Delgado, M J

    2016-01-01

    Nitrous oxide (N2O) is an important greenhouse gas (GHG) with substantial global warming potential and also contributes to ozone depletion through photochemical nitric oxide (NO) production in the stratosphere. The negative effects of N2O on climate and stratospheric ozone make N2O mitigation an international challenge. More than 60% of global N2O emissions are emitted from agricultural soils mainly due to the application of synthetic nitrogen-containing fertilizers. Thus, mitigation strategies must be developed which increase (or at least do not negatively impact) on agricultural efficiency whilst decrease the levels of N2O released. This aim is particularly important in the context of the ever expanding population and subsequent increased burden on the food chain. More than two-thirds of N2O emissions from soils can be attributed to bacterial and fungal denitrification and nitrification processes. In ammonia-oxidizing bacteria, N2O is formed through the oxidation of hydroxylamine to nitrite. In denitrifiers, nitrate is reduced to N2 via nitrite, NO and N2O production. In addition to denitrification, respiratory nitrate ammonification (also termed dissimilatory nitrate reduction to ammonium) is another important nitrate-reducing mechanism in soil, responsible for the loss of nitrate and production of N2O from reduction of NO that is formed as a by-product of the reduction process. This review will synthesize our current understanding of the environmental, regulatory and biochemical control of N2O emissions by nitrate-reducing bacteria and point to new solutions for agricultural GHG mitigation.

  20. Regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor-α genetic variations

    PubMed Central

    LIU, YANGZHOU; HAN, NING; LI, QINCHUAN; LI, ZENGCHUN

    2016-01-01

    The present study aimed to investigate the regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor (TNF)-α genetic variations. The GSE5760 expression profile data, which was downloaded from the Gene Expression Omnibus database, contained 30 wild-type (WT) and 28 mutation (MUT) samples. Differentially expressed genes (DEGs) between the two types of samples were identified using the Student's t-test, and the corresponding microRNAs (miRNAs) were screened using WebGestalt software. An integrated miRNA-DEG network was constructed using the Cytoscape software, based on the interactions between the DEGs, as identified using the Search Tool for the Retrieval of Interacting Genes/Proteins database, and the correlation between miRNAs and their target genes. Furthermore, Gene Ontology and pathway enrichment analyses were conducted for the DEGs using the Database for Annotation, Visualization and Integrated Discovery and the KEGG Orthology Based Annotation System, respectively. A total of 390 DEGS between the WT and MUT samples, along with 11 -associated miRNAs, were identified. The integrated miRNA-DEG network consisted of 38 DEGs and 11 miRNAs. Within this network, COPS2 was found to be associated with transcriptional functions, while FUS was found to be involved in mRNA metabolic processes. Other DEGs, including FBXW7 and CUL3, were enriched in the ubiquitin-mediated proteolysis pathway. In addition, miR-15 was predicted to target COPS2 and CUL3. The results of the present study suggested that COPS2, FUS, FBXW7 and CUL3 may be associated with sepsis in patients with TNF-α genetic variations. In the progression of sepsis, FBXW7 and CUL3 may participate in the ubiquitin-mediated proteolysis pathway, whereas COPS2 may regulate the phosphorylation and ubiquitination of the FUS protein. Furthermore, COPS2 and CUL3 may be novel targets of miR-15. PMID:27347057

  1. An examination of the regulatory mechanism of Pxdn mutation-induced eye disorders using microarray analysis

    PubMed Central

    YANG, YANG; XING, YIQIAO; LIANG, CHAOQUN; HU, LIYA; XU, FEI; MEI, QI

    2016-01-01

    The present study aimed to identify biomarkers for peroxidasin (Pxdn) mutation-induced eye disorders and study the underlying mechanisms involved in this process. The microarray dataset GSE49704 was used, which encompasses 4 mouse samples from embryos with Pxdn mutation and 4 samples from normal tissues. After data preprocessing, the differentially expressed genes (DEGs) between Pxdn mutation and normal tissues were identified using the t-test in the limma package, followed by functional enrichment analysis. The protein-protein interaction (PPI) network was constructed based on the STRING database, and the transcriptional regulatory (TR) network was established using the GeneCodis database. Subsequently, the overlapping DEGs with high degrees in two networks were identified, as well as the sub-network extracted from the TR network. In total, 121 (75 upregulated and 46 downregulated) DEGs were identified, and these DEGs play important roles in biological processes (BPs), including neuron development and differentiation. A PPI network containing 25 nodes such as actin, alpha 1, skeletal muscle (Acta1) and troponin C type 2 (fast) (Tnnc2), and a TR network including 120 nodes were built. By comparing the two networks, seven crucial genes which overlapped were identified, including cyclin-dependent kinase inhibitor 1B (Cdkn1b), Acta1 and troponin T type 3 (Tnnt3). In the sub-network, Cdkn1b was predicted as the target of miRNAs such as mmu-miR-24 and transcription factors (TFs) including forkhead box O4 (FOXO4) and activating enhancer binding protein 4 (AP4). Thus, we suggest that seven crucial genes, including Cdkn1b, Acta1 and Tnnt3, play important roles in the progression of eye disorders such as glaucoma. We suggest that Cdkn1b exert its effects via the inhibition of proliferation and is mediated by mmu-miR-24 and targeted by the TFs FOXO4 and AP4. PMID:27121343

  2. Deciphering Transcriptional Regulatory Mechanisms Associated with Hemicellulose Degradation in Neurospora crassa

    PubMed Central

    Sun, Jianping; Tian, Chaoguang; Diamond, Spencer

    2012-01-01

    Hemicellulose, the second most abundant plant biomass fraction after cellulose, is widely viewed as a potential substrate for the production of liquid fuels and other value-added materials. Degradation of hemicellulose by filamentous fungi requires production of many different enzymes, which are induced by biopolymers or its derivatives and regulated mainly at the transcriptional level through transcription factors (TFs). Neurospora crassa, a model filamentous fungus, expresses and secretes enzymes required for plant cell wall deconstruction. To better understand genes specifically associated with degradation of hemicellulose, we applied secretome and transcriptome analysis to N. crassa grown on beechwood xylan. We identified 34 secreted proteins and 353 genes with elevated transcription on xylan. The xylanolytic phenotype of strains with deletions in genes identified from the secretome and transcriptome analysis of the wild type was assessed, revealing functions for known and unknown proteins associated with hemicellulose degradation. By evaluating phenotypes of strains containing deletions of predicted TF genes in N. crassa, we identified a TF (XLR-1; xylan degradation regulator 1) essential for hemicellulose degradation that is an ortholog to XlnR/XYR1 in Aspergillus and Trichoderma species, respectively, a major transcriptional regulator of genes encoding both cellulases and hemicellulases. Deletion of xlr-1 in N. crassa abolished growth on xylan and xylose, but growth on cellulose and cellulolytic activity were only slightly affected. To determine the regulatory mechanisms for hemicellulose degradation, we explored the transcriptional regulon of XLR-1 under xylose, xylanolytic, and cellulolytic conditions. XLR-1 regulated only some predicted hemicellulase genes in N. crassa and was required for a full induction of several cellulase genes. Hemicellulase gene expression was induced by a combination of release from carbon catabolite repression (CCR) and induction

  3. High-risk medical devices, children and the FDA: regulatory challenges facing pediatric mechanical circulatory support devices.

    PubMed

    Almond, Christopher S D; Chen, Eric A; Berman, Michael R; Less, Joanne R; Baldwin, J Timothy; Linde-Feucht, Sarah R; Hoke, Tracey R; Pearson, Gail D; Jenkins, Kathy; Duncan, Brian W; Zuckerman, Bram D

    2007-01-01

    Pediatric mechanical circulatory support is a critical unmet need in the United States. Infant- and child-sized ventricular assist devices are currently being developed largely through federal contracts and grants through the National Heart, Lung, and Blood Institute (NHLBI). Human testing and marketing of high-risk devices for children raises epidemiologic and regulatory issues that will need to be addressed. Leaders from the US Food and Drug Administration (FDA), NHLBI, academic pediatric community, and industry convened in January 2006 for the first FDA Workshop on the Regulatory Process for Pediatric Mechanical Circulatory Support Devices. The purpose was to provide the pediatric community with an overview of the federal regulatory process for high-risk medical devices and to review the challenges specific to the development and regulation of pediatric mechanical circulatory support devices. Pediatric mechanical circulatory support present significant epidemiologic, logistic, and financial challenges to industry, federal regulators, and the pediatric community. Early interactions with the FDA, shared appreciation of challenges, and careful planning will be critical to avoid unnecessary delays in making potentially life-saving devices available for children. Collaborative efforts to address these challenges are warranted.

  4. Brucella BioR regulator defines a complex regulatory mechanism for bacterial biotin metabolism.

    PubMed

    Feng, Youjun; Xu, Jie; Zhang, Huimin; Chen, Zeliang; Srinivas, Swaminath

    2013-08-01

    The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that can repress the expression of the bioBFDAZ operon in the plant pathogen Agrobacterium tumefaciens. However, quite unusually, a closely related human pathogen, Brucella melitensis, has four putative BioR-binding sites (both bioR and bioY possess one site in the promoter region, whereas the bioBFDAZ [bio] operon contains two tandem BioR boxes). This raised the question of whether BioR mediates the complex regulatory network of biotin metabolism. Here, we report that this is the case. The B. melitensis BioR ortholog was overexpressed and purified to homogeneity, and its solution structure was found to be dimeric. Functional complementation in a bioR isogenic mutant of A. tumefaciens elucidated that Brucella BioR is a functional repressor. Electrophoretic mobility shift assays demonstrated that the four predicted BioR sites of Brucella plus the BioR site of A. tumefaciens can all interact with the Brucella BioR protein. In a reporter strain that we developed on the basis of a double mutant of A. tumefaciens (the ΔbioR ΔbioBFDA mutant), the β-galactosidase (β-Gal) activity of three plasmid-borne transcriptional fusions (bioBbme-lacZ, bioYbme-lacZ, and bioRbme-lacZ) was dramatically decreased upon overexpression of Brucella bioR. Real-time quantitative PCR analyses showed that the expression of bioBFDA and bioY is significantly elevated upon removal of bioR from B. melitensis. Together, we conclude that Brucella BioR is not only a negative autoregulator but also a repressor of

  5. Regulatory Mechanisms of the Molecular Pathways in Fibrosis Induced by MicroRNAs

    PubMed Central

    Yang, Cui; Zheng, Si-Dao; Wu, Hong-Jin; Chen, Shao-Jun

    2016-01-01

    Objective: MicroRNAs (miRNAs or miRs) play critical roles in the fibrotic process in different organs. We summarized the latest research progress on the roles and mechanisms of miRNAs in the regulation of the molecular signaling pathways involved in fibrosis. Data Sources: Papers published in English from January 2010 to August 2015 were selected from the PubMed and Web of Science databases using the search terms “microRNA”, “miR”, “transforming growth factor β”, “tgf β”, “mitogen-activated protein kinase”, “mapk”, “integrin”, “p38”, “c-Jun NH2-terminal kinase”, “jnk”, “extracellular signal-regulated kinase”, “erk”, and “fibrosis”. Study Selection: Articles were obtained and reviewed to analyze the regulatory effects of miRNAs on molecular signaling pathways involved in the fibrosis. Results: Recent evidence has shown that miRNAs are involved in regulating fibrosis by targeting different substrates in the molecular processes that drive fibrosis, such as immune cell sensitization, effector cell activation, and extracellular matrix remodeling. Moreover, several important molecular signaling pathways involve in fibrosis, such as the transforming growth factor-beta (TGF-β) pathway, mitogen-activated protein kinase (MAPK) pathways, and the integrin pathway are regulated by miRNAs. Third, regulation of the fibrotic pathways induced by miRNAs is found in many other tissues in addition to the heart, lung, liver, and kidney. Interestingly, the actions of many drugs on the human body are also induced by miRNAs. It is encouraging that the fibrotic process can be blocked or reversed by targeting specific miRNAs and their signaling pathways, thereby protecting the structures and functions of different organs. Conclusions: miRNAs not only regulate molecular signaling pathways in fibrosis but also serve as potential targets of novel therapeutic interventions for fibrosing diseases. PMID:27647197

  6. [Peripheral blood circulation in the skin and the regulatory mechanisms in the course of primary transmural myocardial infarction].

    PubMed

    Khalepo, O V; Molotkov, O V; Eshkina, S L

    2009-01-01

    Laser Doppler flowmetry was used to study the indicators characterizing the peripheral blood circulation in the skin, regulatory mechanisms, and the compensatory capacities of the microcirculatory bed in 32 patients aged 45-60 years in the course of primary transmural myocardial infarction during exercise tests. Significant disturbances of the mechanism responsible for regulating the peripheral blood circulation system and chiefly its active components were detected in the presence of adequate blood filling of microvessels. There was a drastic decrease in the reserves of skin microvascular endothelial activity during ionophoresis of sodium nitroprusside and acetylcholine, the maximum degree of disturbances being observed on day 10 of myocardial infarction development.

  7. The Regulation of Acid-Base Balance--A Microprocessor Simulation.

    ERIC Educational Resources Information Center

    Rasch, Robert W.

    1983-01-01

    Describes a computer program designed to simulate the regulation of acid-base balance, emphasizing regulatory compensations involved in the total process. Includes discussion of equations involved, a sample run of the program, and program listing (MicroSoft Basic). (JN)

  8. Analysis of the Transcription Regulatory Mechanism of Otx During the Development of the Sensory Vesicle in Ciona intestinalis.

    PubMed

    Oonuma, Kouhei; Hirose, Dan; Takatori, Naohito; Saiga, Hidetoshi

    2014-09-01

    Establishment of the anterior-posterior axis is an important event in the development of bilateral animals. A homeodomain transcription factor, Otx, is important for the formation of the anterior part of the embryo, and its mRNA is expressed in a continuous manner in a wide range of animals. This pattern of expression is thought to be important for the formation of anterior neural structures, but the mechanism that regulates Otx expression remains largely unknown. Towards understanding how the transcription of Otx is maintained in the cells of anterior neural structure, the sensory vesicle, during embryogenesis, we examined transcription regulatory mechanisms of Otx, using embryos of the ascidian, Ciona intestinalis, from the gastrula to tailbud stages, which have not been studied previously. We identified two genomic regions capable of mimicking the Otx expression pattern from the gastrula to tailbud stages. Putative transcription factor binding sites required for this activity were identified. Notably, distinct sets of transcription factor binding sites were required at different developmental stages for the expression of Otx, suggesting that the continuity of Otx is supported by distinct transcriptional mechanisms in the gastrula and neurula stages. Along with previous studies using Halocynthia roretzi, the present results provide insight into the evolution of transcriptional regulatory mechanism of Otx.

  9. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms

    PubMed Central

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R

    2014-01-01

    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix. PMID:24988880

  10. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms.

    PubMed

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R

    2014-08-01

    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix.

  11. CHOOSING A CHEMICAL MECHANISM FOR REGULATORY AND RESEARCH AIR QUALITY MODELING APPLICATIONS

    EPA Science Inventory

    There are numerous, different chemical mechanisms currently available for use in air quality models, and new mechanisms and versions of mechanisms are continually being developed. The development of Morphecule-type mechanisms will add a near-infinite number of additional mecha...

  12. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp.

    PubMed

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-10-13

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5'-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism.

  13. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp

    PubMed Central

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-01-01

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5′-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism. PMID:26459861

  14. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands.

    PubMed

    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo

    2015-01-01

    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1.

  15. Mechanisms of diabetic autoimmunity: II--Is diabetes a central or peripheral disorder of effector and regulatory cells?

    PubMed

    Askenasy, Nadir

    2016-02-01

    Two competing hypotheses aiming to explain the onset of autoimmune reactions are discussed in the context of genetic and environmental predisposition to type 1 diabetes (T1D). The first hypothesis has evolved along characterization of the mechanisms of self-discrimination and attributes diabetic autoimmunity to escape of reactive T cells from central regulation in the thymus. The second considers frequent occurrence of autoimmune reactions within the immune homunculus, which are adequately suppressed by regulatory T cells originating from the thymus, and occasionally, insufficient suppression results in autoimmunity. Besides thymic dysfunction, deregulation of both effector and suppressor cells can in fact result from homeostatic aberrations at the peripheral level during initial stages of evolution of adaptive immunity. Pathogenic cells sensitized in the islets are efficiently expanded in the target tissue and pancreatic lymph nodes of lymphopenic neonates. In parallel, the same mechanisms of peripheral sensitization contribute to tolerization through education of naïve/effector T cells and expansion of regulatory T cells. Experimental evidence presented for each individual mechanism implies that T1D may result from a primary effector or suppressor immune abnormality. Disturbed self-tolerance leading to T1D may well result from peripheral deregulation of innate and adaptive immunity, with variable contribution of central thymic dysfunction.

  16. Going Beyond, Going Further: The Preparation of Acid-Base Titration Curves.

    ERIC Educational Resources Information Center

    McClendon, Michael

    1984-01-01

    Background information, list of materials needed, and procedures used are provided for a simple technique for generating mechanically plotted acid-base titration curves. The method is suitable for second-year high school chemistry students. (JN)

  17. Probing the chemical mechanism and critical regulatory amino acid residues of Drosophila melanogaster arylalkylamine N-acyltransferase like 2.

    PubMed

    Dempsey, Daniel R; Carpenter, Anne-Marie; Ospina, Santiago Rodriguez; Merkler, David J

    2015-11-01

    Arylalkylamine N-acyltransferase like 2 (AANATL2) catalyzes the formation of N-acylarylalkylamides from the corresponding acyl-CoA and arylalkylamine. The N-acylation of biogenic amines in Drosophila melanogaster is a critical step for the inactivation of neurotransmitters, cuticle sclerotization, and melatonin biosynthesis. In addition, D. melanogaster has been used as a model system to evaluate the biosynthesis of fatty acid amides: a family of potent cell signaling lipids. We have previously showed that AANATL2 catalyzes the formation of N-acylarylakylamides, including long-chain N-acylserotonins and N-acyldopamines. Herein, we define the kinetic mechanism for AANATL2 as an ordered sequential mechanism with acetyl-CoA binding first followed by tyramine to generate the ternary complex prior to catalysis. Bell shaped kcat,app - acetyl-CoA and (kcat/Km)app - acetyl-CoA pH-rate profiles identified two apparent pKa,app values of ∼7.4 and ∼8.9 that are critical to catalysis, suggesting the AANATL2-catalyzed formation of N-acetyltyramine occurs through an acid/base chemical mechanism. Site-directed mutagenesis of a conserved glutamate that corresponds to the catalytic base for other D. melanogaster AANATL enzymes did not produce a substantial depression in the kcat,app value nor did it abolish the pKa,app value attributed to the general base in catalysis (pKa ∼7.4). These data suggest that AANATL2 catalyzes the formation of N-acylarylalkylamides using either different catalytic residues or a different chemical mechanism relative to other D. melanogaster AANATL enzymes. In addition, we constructed other site-directed mutants of AANATL2 to help define the role of targeted amino acids in substrate binding and/or enzyme catalysis.

  18. Mosaic gene network modelling identified new regulatory mechanisms in HCV infection.

    PubMed

    Popik, Olga V; Petrovskiy, Evgeny D; Mishchenko, Elena L; Lavrik, Inna N; Ivanisenko, Vladimir A

    2016-06-15

    Modelling of gene networks is widely used in systems biology to study the functioning of complex biological systems. Most of the existing mathematical modelling techniques are useful for analysis of well-studied biological processes, for which information on rates of reactions is available. However, complex biological processes such as those determining the phenotypic traits of organisms or pathological disease processes, including pathogen-host interactions, involve complicated cross-talk between interacting networks. Furthermore, the intrinsic details of the interactions between these networks are often missing. In this study, we developed an approach, which we call mosaic network modelling, that allows the combination of independent mathematical models of gene regulatory networks and, thereby, description of complex biological systems. The advantage of this approach is that it allows us to generate the integrated model despite the fact that information on molecular interactions between parts of the model (so-called mosaic fragments) might be missing. To generate a mosaic mathematical model, we used control theory and mathematical models, written in the form of a system of ordinary differential equations (ODEs). In the present study, we investigated the efficiency of this method in modelling the dynamics of more than 10,000 simulated mosaic regulatory networks consisting of two pieces. Analysis revealed that this approach was highly efficient, as the mean deviation of the dynamics of mosaic network elements from the behaviour of the initial parts of the model was less than 10%. It turned out that for construction of the control functional, data on perturbation of one or two vertices of the mosaic piece are sufficient. Further, we used the developed method to construct a mosaic gene regulatory network including hepatitis C virus (HCV) as the first piece and the tumour necrosis factor (TNF)-induced apoptosis and NF-κB induction pathways as the second piece. Thus

  19. Comparative analysis of mutant plants impaired in the main regulatory mechanisms of photosynthetic light reactions - From biophysical measurements to molecular mechanisms.

    PubMed

    Tikkanen, Mikko; Rantala, Sanna; Grieco, Michele; Aro, Eva-Mari

    2017-03-01

    Chlorophyll (chl) fluorescence emission by photosystem II (PSII) and light absorption by P700 reaction center chl a of photosystem I (PSI) provide easy means to probe the function of the photosynthetic machinery. The exact relationship between the measured optical variables and the molecular processes have, however, remained elusive. Today, the availability of mutants with distinct molecular characterization of photosynthesis regulatory processes should make it possible to gain further insights into this relationship, yet a systematic comparative analysis of such regulatory mutants has been missing. Here we have systematically compared the behavior of Dual-PAM fluorescence and P700 variables from well-characterized photosynthesis regulation mutants. The analysis revealed a very convincing relationship between the given molecular deficiency in the photosynthetic apparatus and the original fluorescence and P700 signals obtained by using varying intensities of actinic light and by applying a saturating pulse. Importantly, the specific information on the underlying molecular mechanism, present in these authentic signals of a given photosynthesis mutant, was largely nullified when using the commonly accepted parameters that are based on further treatment of the original signals. Understanding the unique relationship between the investigated molecular process of photosynthesis and the measured variable is an absolute prerequisite for comprehensive interpretation of fluorescence and P700 measurements. The data presented here elucidates the relationships between the main regulatory mechanisms controlling the photosynthetic light reactions and the variables obtained by fluorescence and P700 measurements. It is discussed how the full potential of optical photosynthesis measurements can be utilized in investigation of a given molecular mechanism.

  20. Transcriptional regulatory network triggered by oxidative signals configures the early response mechanisms of japonica rice to chilling stress

    PubMed Central

    2010-01-01

    Background The transcriptional regulatory network involved in low temperature response leading to acclimation has been established in Arabidopsis. In japonica rice, which can only withstand transient exposure to milder cold stress (10°C), an oxidative-mediated network has been proposed to play a key role in configuring early responses and short-term defenses. The components, hierarchical organization and physiological consequences of this network were further dissected by a systems-level approach. Results Regulatory clusters responding directly to oxidative signals were prominent during the initial 6 to 12 hours at 10°C. Early events mirrored a typical oxidative response based on striking similarities of the transcriptome to disease, elicitor and wounding induced processes. Targets of oxidative-mediated mechanisms are likely regulated by several classes of bZIP factors acting on as1/ocs/TGA-like element enriched clusters, ERF factors acting on GCC-box/JAre-like element enriched clusters and R2R3-MYB factors acting on MYB2-like element enriched clusters. Temporal induction of several H2O2-induced bZIP, ERF and MYB genes coincided with the transient H2O2 spikes within the initial 6 to 12 hours. Oxidative-independent responses involve DREB/CBF, RAP2 and RAV1 factors acting on DRE/CRT/rav1-like enriched clusters and bZIP factors acting on ABRE-like enriched clusters. Oxidative-mediated clusters were activated earlier than ABA-mediated clusters. Conclusion Genome-wide, physiological and whole-plant level analyses established a holistic view of chilling stress response mechanism of japonica rice. Early response regulatory network triggered by oxidative signals is critical for prolonged survival under sub-optimal temperature. Integration of stress and developmental responses leads to modulated growth and vigor maintenance contributing to a delay of plastic injuries. PMID:20100339

  1. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  2. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis

    PubMed Central

    Jones, Danielle M.; Murray, Christian M.; Ketelaar, KassaDee J.; Thomas, Joseph J.; Villalobos, Jose A.; Wallace, Ian S.

    2016-01-01

    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  3. Jigsaw Cooperative Learning: Acid-Base Theories

    ERIC Educational Resources Information Center

    Tarhan, Leman; Sesen, Burcin Acar

    2012-01-01

    This study focused on investigating the effectiveness of jigsaw cooperative learning instruction on first-year undergraduates' understanding of acid-base theories. Undergraduates' opinions about jigsaw cooperative learning instruction were also investigated. The participants of this study were 38 first-year undergraduates in chemistry education…

  4. Separation of Acids, Bases, and Neutral Compounds

    NASA Astrophysics Data System (ADS)

    Fujita, Megumi; Mah, Helen M.; Sgarbi, Paulo W. M.; Lall, Manjinder S.; Ly, Tai Wei; Browne, Lois M.

    2003-01-01

    Separation of Acids, Bases, and Neutral Compounds requires the following software, which is available for free download from the Internet: Netscape Navigator, version 4.75 or higher, or Microsoft Internet Explorer, version 5.0 or higher; Chime plug-in, version compatible with your OS and browser (available from MDL); and Flash player, version 5 or higher (available from Macromedia).

  5. Biochemistry on a leash: Confinement as a regulatory mechanism for bimolecular reaction rates

    NASA Astrophysics Data System (ADS)

    Reeves, Daniel; Cheveralls, Keith; Kondev, Jane

    2009-03-01

    We describe two mechanisms by which confinement regulates diffusion-limited bimolecular reaction rates. The first mechanism, illustrated by the actin capping protein formin, uses a flexible polymer to tether ligand binding sites, which serve as intermediaries, to the reactive site. The second mechanism uses a potential (e.g. hard wall potential), to constrain the motion of a ligand receptor within a confining volume. We analyze both mechanisms theoretically, using a combination of analytic and numerical techniques, to obtain the steady state binding kinetics. We explore how the reaction rates are regulated by parameters of the model such as the length of the polymer tether, and use our findings to explain the key features of the formin system. Finally, we suggest other systems, both synthetic and biological, in which these mechanisms for regulating bimolecular reactions might be at play.

  6. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues.

    PubMed

    Suzuki, Takashi; Swift, Larry L

    2016-06-03

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5'-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5'-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity.

  7. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues

    PubMed Central

    Suzuki, Takashi; Swift, Larry L.

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5′-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5′-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  8. Immunomodulation of mesenchymal stromal cells on regulatory T cells and its possible mechanism.

    PubMed

    Yan, Zhidong; Zhuansun, Yongxun; Chen, Rui; Li, Jianguo; Ran, Pixin

    2014-05-15

    Mesenchymal stromal cells (MSCs) and regulatory T cells (Tregs) have both garnered abundant interests from immunologists worldwide, as both MSCs and Tregs can be considered immunosuppressive in their own right. But a little attention has been paid to the impacts of MSCs on Tregs. To clarify the effects of MSCs on Tregs, we performed the coculture systems within MSCs and Tregs. We confirmed that MSC-exposed Tregs are capable of more immunosuppressive than Tregs without coculturing with MSCs. And this augmenting suppressive capacity was accompanied with an upregulation of programmed cell death 1 receptor (PD-1) on Tregs. Importantly, we found that cell viability of Tregs was excluded from the influences of MSCs. Finally, we showed that PD-1/B7-H1 interactions and IL-10 might be responsible for the enhanced suppressive capability of MSC-exposed Tregs. Further analysis revealed that PD-1/B7-H1 interactions were not responsible for the productions of IL-10 and TGF-β1 in the MSC-Treg coculture systems; in contrast, IL-10 rather than TGF-β1 played a role in the upregualtion of PD-1. Furthermore, this is the first explorative study to evaluate the immunomodulation of MSCs on the suppressive capacity of Tregs in MSC-Treg in vitro coculture setting.

  9. Analysis of microRNA and Gene Expression Profiles in Multiple Sclerosis: Integrating Interaction Data to Uncover Regulatory Mechanisms

    PubMed Central

    Freiesleben, Sherry; Hecker, Michael; Zettl, Uwe Klaus; Fuellen, Georg; Taher, Leila

    2016-01-01

    MicroRNAs (miRNAs) have been reported to contribute to the pathophysiology of multiple sclerosis (MS), an inflammatory disorder of the central nervous system. Here, we propose a new consensus-based strategy to analyse and integrate miRNA and gene expression data in MS as well as other publically available data to gain a deeper understanding of the role of miRNAs in MS and to overcome the challenges posed by studies with limited patient sample sizes. We processed and analysed microarray datasets, and compared the expression of genes and miRNAs in the blood of MS patients and controls. We then used our consensus and integration approach to construct two molecular networks dysregulated in MS: a miRNA- and a gene-based network. We identified 18 differentially expressed (DE) miRNAs and 128 DE genes that may contribute to the regulatory alterations behind MS. The miRNAs were linked to immunological and neurological pathways, and we exposed let-7b-5p and miR-345-5p as promising blood-derived disease biomarkers in MS. The results suggest that DE miRNAs are more informative than DE genes in uncovering pathways potentially involved in MS. Our findings provide novel insights into the regulatory mechanisms and networks underlying MS. PMID:27694855

  10. Reactive oxygen species regulatory mechanisms associated with rapid response of MC3T3-E1 cells for vibration stress.

    PubMed

    Zhang, Ling; Gan, Xueqi; Zhu, Zhuoli; Yang, Yang; He, Yuting; Yu, Haiyang

    2016-02-12

    Although many previous studies have shown that refractory period-dependent memory effect of vibration stress is anabolic for skeletal homeostasis, little is known about the rapid response of osteoblasts simply derived from vibration itself. In view of the potential role of reactive oxygen species (ROS) in mediating differentiated activity of osteoblasts, whether and how ROS regulates the rapid effect of vibration deserve to be demonstrated. Our findings indicated that MC3T3-E1 cells underwent decreased gene expression of Runx2, Col-I and ALP and impaired ALP activity accompanied by increased mitochondrial fission immediately after vibration loading. Moreover, we also revealed the involvement of ERK-Drp1 signal transduction in ROS regulatory mechanisms responsible for the rapid effect of vibration stress.

  11. Single-Nucleotide Mutations in FMR1 Reveal Novel Functions and Regulatory Mechanisms of the Fragile X Syndrome Protein FMRP

    PubMed Central

    Suhl, Joshua A.; Warren, Stephen T.

    2015-01-01

    Fragile X syndrome is a monogenic disorder and a common cause of intellectual disability. Despite nearly 25 years of research on FMR1, the gene underlying the syndrome, very few pathological mutations other than the typical CGG-repeat expansion have been reported. This is in contrast to other X-linked, monogenic, intellectual disability disorders, such as Rett syndrome, where many point mutations have been validated as causative of the disorder. As technology has improved and significantly driven down the cost of sequencing, allowing for whole genes to be sequenced with relative ease, in-depth sequencing studies on FMR1 have recently been performed. These studies have led to the identification of novel variants in FMR1, where some of which have been functionally evaluated and are likely pathogenic. In this review, we discuss recently identified FMR1 variants, the ways these novel variants cause dysfunction, and how they reveal new regulatory mechanisms and functionalities of the gene. PMID:26819560

  12. Catalytic control in the EGF Receptor and its connection to general kinase regulatory mechanisms

    PubMed Central

    Jura, Natalia; Zhang, Xuewu; Endres, Nicholas F.; Seeliger, Markus A.; Schindler, Thomas; Kuriyan, John

    2011-01-01

    Summary In contrast to the active conformations of protein kinases, which are essentially the same for all kinases, inactive kinase conformations are structurally diverse. Some inactive conformations are, however, observed repeatedly in different kinases, perhaps reflecting an important role in catalysis. In this review, we analyze one of these recurring conformations, first identified in CDK and Src kinases, which turned out to be central to understanding of how kinase domain of the EGF receptor is activated. This mechanism, which involves the stabilization of the active conformation of an α helix, has features in common with mechanisms operative in several other kinases. PMID:21474065

  13. Transition into inflammatory cancer-associated adipocytes in breast cancer microenvironment requires microRNA regulatory mechanism

    PubMed Central

    Ryu, Han Suk; Lee, Han-Byoel; Lee, Minju; Park, In Ae; Kim, Jisun; Han, Wonshik; Noh, Dong-Young

    2017-01-01

    The role of adipocytes in cancer microenvironment has gained focus during the recent years. However, the characteristics of the cancer-associated adipocytes (CAA) in human breast cancer tissues and the underlying regulatory mechanism are not clearly understood. We reviewed pathology specimens of breast cancer patients to understand the morphologic characteristics of CAA, and profiled the mRNA and miRNA expression of CAA by using indirect co-culture system in vitro. The CAAs in human breast cancers showed heterogeneous topographic relationship with breast cancer cells within the breast microenvironment. The CAAs exhibited the characteristics of de-differentiation determined by their microscopic appearance and the expression levels of adipogenic markers. Additionally, the 3T3-L1 adipocytes indirectly co-cultured with breast cancer cells showed up-regulation of inflammation-related genes including Il6 and Ptx3. The up-regulation of IL6 in CAA was further observed in human breast cancer tissues. miRNA array of indirectly co-cultured 3T3-L1 cells showed increased expression of mmu-miR-5112 which may target Cpeb1. Cpeb1 is a negative regulator of Il6. The suppressive role of mmu-miR-5112 was confirmed by dual luciferase reporter assay, and mmu-miR-5112-treated adipocytes showed up-regulation of Il6. The transition of adipocytes into more inflammatory CAA resulted in proliferation-promoting effect in ER positive breast cancer cells such as MCF7 and ZR-75-1 but not in ER negative cells. In this study, we have determined the de-differentiated and inflammatory natures of CAA in breast cancer microenvironment. Additionally, we propose a miRNA-based regulatory mechanism underlying the process of acquiring inflammatory phenotypes in CAA. PMID:28333977

  14. Large-scale profiling and identification of potential regulatory mechanisms for allelic gene expression in colorectal cancer cells.

    PubMed

    Lee, Robin Dong-Woo; Song, Min-Young; Lee, Jong-Keuk

    2013-01-01

    Allelic variation in gene expression is common in humans and this variation is associated with phenotypic variation. In this study, we employed high-density single nucleotide polymorphism (SNP) chips containing 13,900 exonic SNPs to identify genes with allelic gene expression in cells from colorectal cancer cell lines. We found 2 monoallelically expressed genes (ERAP2 and MYLK4), 32 genes with an allelic imbalance in their expression, and 13 genes showing allele substitution by RNA editing. Among a total of 34 allelically expressed genes in colorectal cancer cells, 15 genes (44.1%) were associated with cis-acting eQTL, indicating that large portions of allelically expressed genes are regulated by cis-acting mechanisms of gene expression. In addition, potential regulatory variants present in the proximal promoter regions of genes showing either monoallelic expression or allelic imbalance were not tightly linked with coding SNPs, which were detected with allelic gene expression. These results suggest that multiple rare variants could be involved in the cis-acting regulatory mechanism of allelic gene expression. In the comparison with allelic gene expression data from Centre d'Etude du Polymorphisme Humain (CEPH) family B cells, 12 genes showed B-cell specific allelic imbalance and 1 noncoding SNP showed colorectal cancer cell-specific allelic imbalance. In addition, different patterns of allele substitution were observed between B cells and colorectal cancer cells. Overall, our study not only indicates that allelic gene expression is common in colorectal cancer cells, but our study also provides a better understanding of allele-specific gene expression in colorectal cancer cells.

  15. Whole body acid-base modeling revisited.

    PubMed

    Ring, Troels; Nielsen, Søren

    2017-04-01

    The textbook account of whole body acid-base balance in terms of endogenous acid production, renal net acid excretion, and gastrointestinal alkali absorption, which is the only comprehensive model around, has never been applied in clinical practice or been formally validated. To improve understanding of acid-base modeling, we managed to write up this conventional model as an expression solely on urine chemistry. Renal net acid excretion and endogenous acid production were already formulated in terms of urine chemistry, and we could from the literature also see gastrointestinal alkali absorption in terms of urine excretions. With a few assumptions it was possible to see that this expression of net acid balance was arithmetically identical to minus urine charge, whereby under the development of acidosis, urine was predicted to acquire a net negative charge. The literature already mentions unexplained negative urine charges so we scrutinized a series of seminal papers and confirmed empirically the theoretical prediction that observed urine charge did acquire negative charge as acidosis developed. Hence, we can conclude that the conventional model is problematic since it predicts what is physiologically impossible. Therefore, we need a new model for whole body acid-base balance, which does not have impossible implications. Furthermore, new experimental studies are needed to account for charge imbalance in urine under development of acidosis.

  16. Transport mechanism and regulatory properties of the human amino acid transporter ASCT2 (SLC1A5).

    PubMed

    Scalise, Mariafrancesca; Pochini, Lorena; Panni, Simona; Pingitore, Piero; Hedfalk, Kristina; Indiveri, Cesare

    2014-11-01

    The kinetic mechanism of the transport catalyzed by the human glutamine/neutral amino acid transporter hASCT2 over-expressed in P. pastoris was determined in proteoliposomes by pseudo-bi-substrate kinetic analysis of the Na(+)-glutamineex/glutaminein transport reaction. A random simultaneous mechanism resulted from the experimental analysis. Purified functional hASCT2 was chemically cross-linked to a stable dimeric form. The oligomeric structure correlated well with the kinetic mechanism of transport. Half-saturation constants (Km) of the transporter for the other substrates Ala, Ser, Asn and Thr were measured both on the external and internal side. External Km were much lower than the internal ones confirming the asymmetry of the transporter. The electric nature of the transport reaction was determined imposing a negative inside membrane potential generated by K(+) gradients in the presence of valinomycin. The transport reaction resulted to be electrogenic and the electrogenicity originated from external Na(+). Internal Na(+) exerted a stimulatory effect on the transport activity which could be explained by a regulatory, not a counter-transport, effect. Native and deglycosylated hASCT2 extracted from HeLa showed the same transport features demonstrating that the glycosyl moiety has no role in transport function. Both in vitro and in vivo interactions of hASCT2 with the scaffold protein PDZK1 were revealed.

  17. Mechanisms of autoimmunity in the non-obese diabetic mouse: effector/regulatory cell equilibrium during peak inflammation.

    PubMed

    Askenasy, Nadir

    2016-04-01

    Immune imbalance in autoimmune disorders such as type 1 diabetes may originate from aberrant activities of effector cells or dysfunction of suppressor cells. All possible defective mechanisms have been proposed for diabetes-prone species: (i) quantitative dominance of diabetogenic cells and decreased numbers of regulatory T cells, (ii) excessive aggression of effectors and defective function of suppressors, (iii) perturbed interaction between effector and suppressor cells, and (iv) variations in sensitivity to negative regulation. The experimental evidence available to date presents conflicting information on these mechanisms, with identification of perturbed equilibrium on the one hand and negation of critical role of each mechanism in propagation of diabetic autoimmunity on the other hand. In our analysis, there is no evidence that inherent abnormalities in numbers and function of effector and suppressor T cells are responsible for the immune imbalance responsible for propagation of type 1 diabetes as a chronic inflammatory process. Possibly, the experimental tools for investigation of these features of immune activity are still underdeveloped and lack sufficient resolution, in the presence of the extensive biological viability and functional versatility of effector and suppressor elements.

  18. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods

    NASA Astrophysics Data System (ADS)

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay; Chatterjee, Suvro; Patra, Chitta Ranjan

    2015-05-01

    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role.Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular

  19. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods†

    PubMed Central

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay

    2016-01-01

    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role. PMID:25963768

  20. Novel Regulatory Mechanisms for Generation of the Soluble Leptin Receptor: Implications for Leptin Action

    PubMed Central

    Schaab, Michael; Kausch, Henriette; Klammt, Juergen; Nowicki, Marcin; Anderegg, Ulf; Gebhardt, Rolf; Rose-John, Stefan; Scheller, Juergen; Thiery, Joachim; Kratzsch, Juergen

    2012-01-01

    Background The adipokine leptin realizes signal transduction via four different membrane-anchored leptin receptor (Ob-R) isoforms in humans. However, the amount of functionally active Ob-R is affected by constitutive shedding of the extracellular domain via a so far unknown mechanism. The product of the cleavage process the so-called soluble leptin receptor (sOb-R) is the main binding protein for leptin in human blood and modulates its bioavailability. sOb-R levels are differentially regulated in metabolic disorders like type 1 diabetes mellitus or obesity and can, therefore, enhance or reduce leptin sensitivity. Methodology/Principal Findings To describe mechanisms of Ob-R cleavage and to investigate the functional significance of differential sOb-R levels we established a model of HEK293 cells transiently transfected with different human Ob-R isoforms. Using siRNA knockdown experiments we identified ADAM10 (A Disintegrin And Metalloproteinase 10) as a major protease for constitutive and activated Ob-R cleavage. Additionally, the induction of lipotoxicity and apoptosis led to enhanced shedding shown by increased levels of the soluble leptin receptor (sOb-R) in cell supernatants. Conversely, high leptin concentrations and ER stress reduced sOb-R levels. Decreased amounts of sOb-R due to ER stress were accompanied by impaired leptin signaling and reduced leptin binding. Conclusions Lipotoxicity and apoptosis increased Ob-R cleavage via ADAM10-dependent mechanisms. In contrast high leptin levels and ER stress led to reduced sOb-R levels. While increased sOb-R concentrations seem to directly block leptin action, reduced amounts of sOb-R may reflect decreased membrane expression of Ob-R. These findings could explain changes of leptin sensitivity which are associated with variations of serum sOb-R levels in metabolic diseases. PMID:22545089

  1. [Research progress in biofilm formation and regulatory mechanism of Campylobacter jejuni].

    PubMed

    Wu, Qingping; Zhong, Xian; Zhang, Jumei

    2016-02-04

    Biofilm of Campylobacter jejuni was formed by cross-linking its extracellular secretion, polysaccharides, various extracellular proteins, nucleic acids etc to enhance its survival in hostile environments, especially for detergents, antibiotics and disinfectants. This paper elaborated C. jejuni biofilm formation and regulation mechanisms in the surface properties of the media, temperatures, gas environment, the regulation of gene etc, also analysed and discussed a variety of biofilm removal practical applications. We hope it can provide a reference for studies on biofilm control of C. jejuni.

  2. Global regulatory mechanism underlying the activation of an exon network required for neurogenesis

    PubMed Central

    Raj, Bushra; Irimia, Manuel; Braunschweig, Ulrich; Sterne-Weiler, Timothy; O’Hanlon, Dave; Yuan-Lin, Zhen; Chen, Ginny I.; Easton, Laura; Ule, Jernej; Gingras, Anne-Claude; Eyras, Eduardo; Blencowe, Benjamin J.

    2015-01-01

    SUMMARY The vertebrate and neural-specific SR-related protein nSR100/SRRM4 regulates an extensive program of alternative splicing with critical roles in nervous system development. However, the mechanism by which nSR100 controls its target exons is poorly understood. We demonstrate that nSR100-dependent neural exons are associated with a unique configuration of intronic cis-elements that promote rapid switch-like regulation during neurogenesis. A key feature of this configuration is the insertion of specialized intronic enhancers between polypyrimidine tracts and acceptor sites that bind nSR100 to potently activate exon inclusion in neural cells, while weakening 3′ splice site recognition and contributing to exon skipping in non-neural cells. nSR100 further operates by forming multiple interactions with early spliceosome components bound proximal to 3′ splice sites. These multifaceted interactions achieve dominance over neural exon silencing mediated by the splicing regulator PTBP1. The results thus illuminate a widespread mechanism by which a critical neural exon network is activated during neurogenesis. PMID:25219497

  3. Subchromoplast sequestration of carotenoids affects regulatory mechanisms in tomato lines expressing different carotenoid gene combinations.

    PubMed

    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M A; Bramley, Peter M; Fraser, Paul D

    2013-11-01

    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed.

  4. Novel Sinorhizobium meliloti quorum sensing positive and negative regulatory feedback mechanisms respond to phosphate availability.

    PubMed

    McIntosh, Matthew; Meyer, Stefan; Becker, Anke

    2009-12-01

    The Sin quorum sensing system of Sinorhizobium meliloti depends upon at least three genes, sinR, sinI and expR, and N-acyl homoserine lactones (AHLs) as signals to regulate multiple processes in its free-living state in the rhizosphere and in the development towards symbiosis with its plant host. In this study, we have characterized novel mechanisms of transcription control through which the system regulates itself. At low AHL levels a positive feedback loop activates expression of sinI (AHL synthase), resulting in amplification of AHL levels. At high AHL levels, expression of sinI is reduced by a negative feedback loop. These feedback mechanisms are mediated by the LuxR-type regulators ExpR and SinR. Expression of sinR and expR is regulated by ExpR in the presence of AHLs. A novel ExpR binding site in the promoter of sinR is responsible for the reduction of expression of this gene. In addition, expression of sinR, upon which sinI expression is dependent, is induced by phoB during growth under phosphate-limiting conditions. This indicates that this response ensures quorum sensing in phosphate-restricted growth.

  5. Ocean warming and acidification modulate energy budget and gill ion regulatory mechanisms in Atlantic cod (Gadus morhua).

    PubMed

    Kreiss, C M; Michael, K; Lucassen, M; Jutfelt, F; Motyka, R; Dupont, S; Pörtner, H-O

    2015-10-01

    Ocean warming and acidification are threatening marine ecosystems. In marine animals, acidification is thought to enhance ion regulatory costs and thereby baseline energy demand, while elevated temperature also increases baseline metabolic rate. Here we investigated standard metabolic rates (SMR) and plasma parameters of Atlantic cod (Gadus morhua) after 3-4 weeks of exposure to ambient and future PCO2 levels (550, 1200 and 2200 µatm) and at two temperatures (10, 18 °C). In vivo branchial ion regulatory costs were studied in isolated, perfused gill preparations. Animals reared at 18 °C responded to increasing CO2 by elevating SMR, in contrast to specimens at 10 °C. Isolated gills at 10 °C and elevated PCO2 (≥1200 µatm) displayed increased soft tissue mass, in parallel to increased gill oxygen demand, indicating an increased fraction of gill in whole animal energy budget. Altered gill size was not found at 18 °C, where a shift in the use of ion regulation mechanisms occurred towards enhanced Na(+)/H(+)-exchange and HCO3 (-) transport at high PCO2 (2200 µatm), paralleled by higher Na(+)/K(+)-ATPase activities. This shift did not affect total gill energy consumption leaving whole animal energy budget unaffected. Higher Na(+)/K(+)-ATPase activities in the warmth might have compensated for enhanced branchial permeability and led to reduced plasma Na(+) and/or Cl(-) concentrations and slightly lowered osmolalities seen at 18 °C and 550 or 2200 µatm PCO2 in vivo. Overall, the gill as a key ion regulation organ seems to be highly effective in supporting the resilience of cod to effects of ocean warming and acidification.

  6. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons.

    PubMed

    Berndt, Anthony J E; Tang, Jonathan C Y; Ridyard, Marc S; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W

    2015-12-01

    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  7. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons

    PubMed Central

    Ridyard, Marc S.; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W.

    2015-01-01

    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  8. The T box mechanism: tRNA as a regulatory molecule

    PubMed Central

    Green, Nicholas J.; Grundy, Frank J.; Henkin, Tina M.

    2009-01-01

    The T box mechanism is widely used in Gram-positive bacteria to regulate expression of aminoacyl-tRNA synthetase genes and genes involved in amino acid biosynthesis and uptake. Binding of a specific uncharged tRNA to a riboswitch element in the nascent transcript causes a structural change in the transcript that promotes expression of the downstream coding sequence. In most cases, this occurs by stabilization of an antiterminator element that competes with formation of a terminator helix. Specific tRNA recognition by the nascent transcript results in increased expression of genes important for tRNA aminoacylation in response to decreased pools of charged tRNA. PMID:19932103

  9. Ca2+ regulatory mechanisms of exercise protection against coronary artery disease in metabolic syndrome and diabetes

    PubMed Central

    2011-01-01

    Chronic exercise attenuates coronary artery disease (CAD) in humans largely independent of reductions in risk factors; thus major protective mechanisms of exercise are directly within the coronary vasculature. Further, tight control of diabetes, e.g., blood glucose, can be detrimental. Accordingly, knowledge of mechanisms by which exercise attenuates diabetic CAD could catalyze development of molecular therapies. Exercise attenuates CAD (atherosclerosis) and restenosis in miniature swine models, which enable precise control of exercise parameters (intensity, duration, and frequency) and characterization of the metabolic syndrome (MetS) and diabetic milieu. Intracellular Ca2+ is a pivotal second messenger for coronary smooth muscle (CSM) excitation-contraction and excitation-transcription coupling that modulates CSM proliferation, migration, and calcification. CSM of diabetic dyslipidemic Yucatan swine have impaired Ca2+ extrusion via the plasmalemma Ca2+ ATPase (PMCA), downregulation of L-type voltage-gated Ca2+ channels (VGCC), increased Ca2+ sequestration by the sarcoplasmic reticulum (SR) Ca2+ ATPase (SERCA), increased nuclear Ca2+ localization, and greater activation of K channels by Ca2+ release from the SR. Endurance exercise training prevents Ca2+ transport changes with virtually no effect on the diabetic milieu (glucose, lipids). In MetS Ossabaw swine transient receptor potential canonical (TRPC) channels are upregulated and exercise training reverses expression and TRPC-mediated Ca2+ influx with almost no change in the MetS milieu. Overall, exercise effects on Ca2+ signaling modulate CSM phenotype. Future studies should 1) selectively target key Ca2+ transporters to determine definitively their causal role in atherosclerosis and 2) combine mechanistic studies with clinical outcomes, e.g., reduction of myocardial infarction. PMID:21596923

  10. Mathematical modeling of acid-base physiology

    PubMed Central

    Occhipinti, Rossana; Boron, Walter F.

    2015-01-01

    pH is one of the most important parameters in life, influencing virtually every biological process at the cellular, tissue, and whole-body level. Thus, for cells, it is critical to regulate intracellular pH (pHi) and, for multicellular organisms, to regulate extracellular pH (pHo). pHi regulation depends on the opposing actions of plasma-membrane transporters that tend to increase pHi, and others that tend to decrease pHi. In addition, passive fluxes of uncharged species (e.g., CO2, NH3) and charged species (e.g., HCO3− , NH4+) perturb pHi. These movements not only influence one another, but also perturb the equilibria of a multitude of intracellular and extracellular buffers. Thus, even at the level of a single cell, perturbations in acid-base reactions, diffusion, and transport are so complex that it is impossible to understand them without a quantitative model. Here we summarize some mathematical models developed to shed light onto the complex interconnected events triggered by acids-base movements. We then describe a mathematical model of a spherical cell–which to our knowledge is the first one capable of handling a multitude of buffer reaction–that our team has recently developed to simulate changes in pHi and pHo caused by movements of acid-base equivalents across the plasma membrane of a Xenopus oocyte. Finally, we extend our work to a consideration of the effects of simultaneous CO2 and HCO3− influx into a cell, and envision how future models might extend to other cell types (e.g., erythrocytes) or tissues (e.g., renal proximal-tubule epithelium) important for whole-body pH homeostasis. PMID:25617697

  11. Evidence of unbalanced regulatory mechanism of heart rate and systolic pressure after acute myocardial infarction.

    PubMed

    Nollo, Giandomenico; Faes, Luca; Porta, Alberto; Pellegrini, Barbara; Ravelli, Flavia; Del Greco, Maurizio; Disertori, Marcello; Antolini, Renzo

    2002-09-01

    The interactions between systolic arterial pressure (SAP) and R-R interval (RR) fluctuations after acute myocardial infarction (AMI) were investigated by measures of synchronization separating the feedback from the feedforward control and capturing both linear and nonlinear contributions. The causal synchronization, evaluating the ability of RR to predict SAP (chi(s/t)) or vice versa (chi(t/s)), and the global synchronization (chi) were estimated at rest and after head-up tilt in 35 post-AMI patients, 20 young and 12 old. Significance and nonlinearity of the coupling were assessed by surrogate data analysis. Tilting increased the number of young subjects in which RR-SAP link was significant (from 17 to 19) and linear (from 11 to 18). In AMI, both significance and linearity of the coupling were low at rest (26 significant and 24 nonlinear) and further reduced after tilt (17 significant and 16 nonlinear). Old subjects showed a partial recovery of linearity after tilt (rest: 1 linear of 7 significant; tilt: 5 linear of 8 significant). In young subjects, the causal synchronization indexes were balanced and increased from rest (chi(t/s) = 0.072 +/- 0.037 and chi(s/t) = 0.054 +/- 0.028) to tilt (chi(t/s) = 0.125 +/- 0.071 and chi(s/t) = 0.108 +/- 0.053). On the contrary, in old subjects and AMI patients, the feedforward was prevalent to the feedback coupling at rest (old: chi(t/s) = 0.041 +/- 0.023 and chi(s/t) = 0.069 +/- 0.042; AMI: chi(t/s) = 0.050 +/- 0.030 and chi(s/t) = 0.089 +/- 0.053). Tilting blunted the unbalance in old subjects (chi(t/s) = 0.065 +/- 0.052 and chi(s/t) = 0.069 +/- 0.044) but not in AMI patients (chi(t/s) = 0.040 +/- 0.019 and chi(s/t) = 0.060 +/- 0.040). Thus, after AMI, nonlinear mechanisms are elicited in RR-SAP interactions. Furthermore, the neural regulation of the cardiovascular system resulted in imbalance as a consequence of impaired feedback and enhanced feedforward control mechanisms.

  12. Sweat, the driving force behind normal skin: an emerging perspective on functional biology and regulatory mechanisms.

    PubMed

    Murota, Hiroyuki; Matsui, Saki; Ono, Emi; Kijima, Akiko; Kikuta, Junichi; Ishii, Masaru; Katayama, Ichiro

    2015-01-01

    The various symptoms associated with excessive or insufficient perspiration can significantly reduce a patient's quality of life. If a versatile and minimally invasive method could be established for returning sweat activity to normalcy, there is no question that it could be used in the treatment of many diseases that are believed to involve perspiration. For this reason, based on an understanding of the sweat-gland control function and sweat activity, it was necessary to conduct a comprehensive search for the factors that control sweating, such as the central and peripheral nerves that control sweat-gland function, the microenvironment surrounding the sweat glands, and lifestyle. We focused on the mechanism by which atopic dermatitis leads to hypohidrosis and confirmed that histamine inhibits acetylcholinergic sweating. Acetylcholine promotes the phosphorylation of glycogen synthesis kinase 3β (GSK3β) in the sweat-gland secretory cells and leads to sensible perspiration. By suppressing the phosphorylation of GSK3β, histamine inhibits the movement of sweat from the sweat-gland secretory cells through the sweat ducts, which could presumably be demonstrated by dynamic observations of the sweat glands using two-photon microscopy. It is expected that the discovery of new factors that control sweat-gland function can contribute to the treatment of diseases associated with dyshidrosis.

  13. Inducible nitric oxide synthase (NOS-2) in subarachnoid hemorrhage: Regulatory mechanisms and therapeutic implications.

    PubMed

    Iqbal, Sana; Hayman, Erik G; Hong, Caron; Stokum, Jesse A; Kurland, David B; Gerzanich, Volodymyr; Simard, J Marc

    2016-01-01

    Aneurysmal subarachnoid hemorrhage (SAH) typically carries a poor prognosis. Growing evidence indicates that overabundant production of nitric oxide (NO) may be responsible for a large part of the secondary injury that follows SAH. Although SAH modulates the activity of all three isoforms of nitric oxide synthase (NOS), the inducible isoform, NOS-2, accounts for a majority of NO-mediated secondary injuries after SAH. Here, we review the indispensable physiological roles of NO that must be preserved, even while attempting to downmodulate the pathophysiologic effects of NO that are induced by SAH. We examine the effects of SAH on the function of the various NOS isoforms, with a particular focus on the pathological effects of NOS-2 and on the mechanisms responsible for its transcriptional upregulation. Finally, we review interventions to block NOS-2 upregulation or to counteract its effects, with an emphasis on the potential therapeutic strategies to improve outcomes in patients afflicted with SAH. There is still much to be learned regarding the apparently maladaptive response of NOS-2 and its harmful product NO in SAH. However, the available evidence points to crucial effects that, on balance, are adverse, making the NOS-2/NO/peroxynitrite axis an attractive therapeutic target in SAH.

  14. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress

    PubMed Central

    Hossain, M. Sazzad; Dietz, Karl-Josef

    2016-01-01

    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  15. Seasonality of reproduction in mammals: intimate regulatory mechanisms and practical implications.

    PubMed

    Chemineau, P; Guillaume, D; Migaud, M; Thiéry, J C; Pellicer-Rubio, M T; Malpaux, B

    2008-07-01

    Farm mammals generally express seasonal variations in their production traits, thus inducing changing availability of fresh derived animal products (meat, milk and cheese) or performances (horses). This is due to a more or less marked seasonal birth distribution in sheep and goats, in horses but not cattle. Birth peak occurs at the end of winter-early spring, the most favourable period for the progeny to survive. Most species show seasonal variations in their ovulation frequency (presence or absence of ovulation), spermatogenic activity (from moderate decrease to complete absence of sperm production), gamete quality (variations in fertilization rates and embryo survival), and also sexual behaviour. The intimate mechanism involved is a complex combination of endogenous circannual rhythm driven and synchronized by light and melatonin. Profound and long-term neuroendocrine changes involving different neuromediator systems were described to play a role in these processes. In most species artificial photoperiodic treatments consisting of extra-light during natural short days (in sheep and goats and mares) or melatonin during long days (in sheep and goats) are extensively used to either adjust the breeding season to animal producer needs and/or to completely overcome seasonal variations of sperm production in artificial insemination centres. Pure light treatments (without melatonin), especially when applied in open barns, could be considered as non-invasive ones which fully respect animal welfare. Genetic selection could be one of the future ways to decrease seasonality in sheep and goats.

  16. The regulatory mechanism of fungal elicitor-induced secondary metabolite biosynthesis in medical plants.

    PubMed

    Zhai, Xin; Jia, Min; Chen, Ling; Zheng, Cheng-Jian; Rahman, Khalid; Han, Ting; Qin, Lu-Ping

    2017-03-01

    A wide range of external stress stimuli trigger plant cells to undergo complex network of reactions that ultimately lead to the synthesis and accumulation of secondary metabolites. Accumulation of such metabolites often occurs in plants subjected to stresses including various elicitors or signal molecules. Throughout evolution, endophytic fungi, an important constituent in the environment of medicinal plants, have known to form long-term stable and mutually beneficial symbiosis with medicinal plants. The endophytic fungal elicitor can rapidly and specifically induce the expression of specific genes in medicinal plants which can result in the activation of a series of specific secondary metabolic pathways resulting in the significant accumulation of active ingredients. Here we summarize the progress made on the mechanisms of fungal elicitor including elicitor signal recognition, signal transduction, gene expression and activation of the key enzymes and its application. This review provides guidance on studies which may be conducted to promote the efficient synthesis and accumulation of active ingredients by the endogenous fungal elicitor in medicinal plant cells, and provides new ideas and methods of studying the regulation of secondary metabolism in medicinal plants.

  17. The route of passive chloride movement across amphibian skin: localization and regulatory mechanisms.

    PubMed

    Nagel, Wolfram; Somieski, Petra; Katz, Uri

    2002-11-13

    Transepithelial Cl(-) conductance (G(Cl)) in amphibian skin can be activated in several species by serosa positive potentials. Mitochondria-rich cells (MRC) or tight junctions (TJ) between the epithelial cells are possible sites for this pathway. The properties and the techniques used to investigate this pathway are reviewed in the present paper. In situ techniques are preferable, since specific properties of the MRC are apparently not maintained in isolated cells. Volume measurements and electronprobe microanalysis of intracellular ions suggest the localization of voltage-activated G(Cl) to MRC. G(Cl) correlates poorly with the density of MRC. The vibrating voltage probe allows quantitative correlation of the local Cl(-) current through morphologically identified structures and the transepithelial Cl(-) current. Our analysis shows that 80% of the voltage-activated Cl(-) current is accounted for by current through MRC or their immediate vicinity. The activation patterns of this current and the inhibition by the alpha(1)-adrenergic agonist, epinephrine, conform to those of the transepithelial current. However, less than 20% of the MRC are active at a certain moment and the activity is spontaneously variable with time. The molecular nature of this pathway, physiological control mechanisms and their relation to the temporal activity of MRC remain to be studied.

  18. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps.

    PubMed

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low.

  19. Molecular mechanism for differential recognition of membrane phosphatidylserine by the immune regulatory receptor Tim4.

    PubMed

    Tietjen, Gregory T; Gong, Zhiliang; Chen, Chiu-Hao; Vargas, Ernesto; Crooks, James E; Cao, Kathleen D; Heffern, Charles T R; Henderson, J Michael; Meron, Mati; Lin, Binhua; Roux, Benot; Schlossman, Mark L; Steck, Theodore L; Lee, Ka Yee C; Adams, Erin J

    2014-04-15

    Recognition of phosphatidylserine (PS) lipids exposed on the extracellular leaflet of plasma membranes is implicated in both apoptotic cell removal and immune regulation. The PS receptor T cell immunoglobulin and mucin-domain-containing molecule 4 (Tim4) regulates T-cell immunity via phagocytosis of both apoptotic (high PS exposure) and nonapoptotic (intermediate PS exposure) activated T cells. The latter population must be removed at lower efficiency to sensitively control immune tolerance and memory cell population size, but the molecular basis for how Tim4 achieves this sensitivity is unknown. Using a combination of interfacial X-ray scattering, molecular dynamics simulations, and membrane binding assays, we demonstrate how Tim4 recognizes PS in the context of a lipid bilayer. Our data reveal that in addition to the known Ca(2+)-coordinated, single-PS binding pocket, Tim4 has four weaker sites of potential ionic interactions with PS lipids. This organization makes Tim4 sensitive to PS surface concentration in a manner capable of supporting differential recognition on the basis of PS exposure level. The structurally homologous, but functionally distinct, Tim1 and Tim3 are significantly less sensitive to PS surface density, likely reflecting the differences in immunological function between the Tim proteins. These results establish the potential for lipid membrane parameters, such as PS surface density, to play a critical role in facilitating selective recognition of PS-exposing cells. Furthermore, our multidisciplinary approach overcomes the difficulties associated with characterizing dynamic protein/membrane systems to reveal the molecular mechanisms underlying Tim4's recognition properties, and thereby provides an approach capable of providing atomic-level detail to uncover the nuances of protein/membrane interactions.

  20. Phosphoproteomic analysis of interacting tumor and endothelial cells identifies regulatory mechanisms of transendothelial migration.

    PubMed

    Locard-Paulet, Marie; Lim, Lindsay; Veluscek, Giulia; McMahon, Kelly; Sinclair, John; van Weverwijk, Antoinette; Worboys, Jonathan D; Yuan, Yinyin; Isacke, Clare M; Jørgensen, Claus

    2016-02-09

    The exit of metastasizing tumor cells from the vasculature, extravasation, is regulated by their dynamic interactions with the endothelial cells that line the internal surface of vessels. To elucidate signals controlling tumor cell adhesion to the endothelium and subsequent transendothelial migration, we performed phosphoproteomic analysis to map cell-specific changes in protein phosphorylation that were triggered by contact between metastatic MDA-MB-231 breast cancer cells and endothelial cells. From the 2669 unique phosphorylation sites identified, 77 and 43 were differentially phosphorylated in the tumor cells and endothelial cells, respectively. The receptor tyrosine kinase ephrin type A receptor 2 (EPHA2) exhibited decreased Tyr(772) phosphorylation in the cancer cells upon endothelial contact. Knockdown of EPHA2 increased adhesion of the breast cancer cells to human umbilical vein endothelial cells (HUVECs) and their transendothelial migration in coculture cell assays, as well as early-stage lung colonization in vivo. EPHA2-mediated inhibition of transendothelial migration of breast cancer cells depended on interaction with the ligand ephrinA1 on HUVECs and phosphorylation of EPHA2-Tyr(772). When EPHA2 phosphorylation dynamics were compared between cell lines of different metastatic ability, EPHA2-Tyr(772) was rapidly dephosphorylated after ephrinA1 stimulation specifically in cells targeting the lung. Knockdown of the phosphatase LMW-PTP reduced adhesion and transendothelial migration of the breast cancer cells. Overall, cell-specific phosphoproteomic analysis provides a bidirectional map of contact-initiated signaling between tumor and endothelial cells that can be further investigated to identify mechanisms controlling the transendothelial cell migration of cancer cells.

  1. Anaerobic transcription activation in Bacillus subtilis: identification of distinct FNR-dependent and -independent regulatory mechanisms.

    PubMed Central

    Cruz Ramos, H; Boursier, L; Moszer, I; Kunst, F; Danchin, A; Glaser, P

    1995-01-01

    Bacillus subtilis is able to grow anaerobically using alternative electron acceptors, including nitrate or fumarate. We characterized an operon encoding the dissimilatory nitrate reductase subunits homologous to the Escherichia coli narGHJI operon and the narK gene encoding a protein with nitrite extrusion activity. Downstream from narK and co-transcribed with it a gene (fnr) encoding a protein homologous to E.coli FNR was found. Disruption of fnr abolished both nitrate and fumarate utilization as electron acceptors and anaerobic induction of narK. Four putative FNR binding sites were found in B.subtilis sequences. The consensus sequence, centred at position -41.5, is identical to the consensus for the DNA site for E.coli CAP. Bs-FNR contained a four cysteine residue cluster at its C-terminal end. This is in contrast to Ec-FNR, where a similar cluster is present at the N-terminal end. It is possible that oxygen modulates the activity of both activators by a similar mechanism involving iron. Unlike in E.coli, where fnr expression is weakly repressed by anaerobiosis, fnr gene expression in B.subtilis is strongly activated by anaerobiosis. We have identified in the narK-fnr intergenic region a promotor activated by anaerobiosis independently of FNR. Thus induction of genes involved in anaerobic respiration requires in B.subtilis at least two levels of regulation: activation of fnr transcription and activation of FNR to induce transcription of FNR-dependent promoters. Images PMID:8846791

  2. Just-in-Time Control of Spo0A Synthesis in Bacillus subtilis by Multiple Regulatory Mechanisms ▿ §

    PubMed Central

    Chastanet, Arnaud; Losick, Richard

    2011-01-01

    The response regulator Spo0A governs multiple developmental processes in Bacillus subtilis, including most conspicuously sporulation. Spo0A is activated by phosphorylation via a multicomponent phosphorelay. Previous work has shown that the Spo0A protein is not rate limiting for sporulation. Rather, Spo0A is present at high levels in growing cells, rapidly rising to yet higher levels under sporulation-inducing conditions, suggesting that synthesis of the response regulator is subject to a just-in-time control mechanism. Transcription of spo0A is governed by a promoter switching mechanism, involving a vegetative, σA-recognized promoter, Pv, and a sporulation σH-recognized promoter, Ps, that is under phosphorylated Spo0A (Spo0A∼P) control. The spo0A regulatory region also contains four (including one identified in the present work) conserved elements that conform to the consensus binding site for Spo0A∼P binding sites. These are herein designated O1, O2, O3, and O4 in reverse order of their proximity to the coding sequence. Here we report that O1 is responsible for repressing Pv during the transition to stationary phase, that O2 is responsible for repressing Ps during growth, that O3 is responsible for activating Ps at the start of sporulation, and that O4 is dispensable for promoter switching. We also report that Spo0A synthesis is subject to a posttranscriptional control mechanism such that translation of mRNAs originating from Pv is impeded due to RNA secondary structure whereas mRNAs originating from Ps are fully competent for protein synthesis. We propose that the opposing actions of O2 and O3 and the enhanced translatability of mRNAs originating from Ps create a highly sensitive, self-reinforcing switch that is responsible for producing a burst of Spo0A synthesis at the start of sporulation. PMID:21949067

  3. Teaching Acid/Base Physiology in the Laboratory

    ERIC Educational Resources Information Center

    Friis, Ulla G.; Plovsing, Ronni; Hansen, Klaus; Laursen, Bent G.; Wallstedt, Birgitta

    2010-01-01

    Acid/base homeostasis is one of the most difficult subdisciplines of physiology for medical students to master. A different approach, where theory and practice are linked, might help students develop a deeper understanding of acid/base homeostasis. We therefore set out to develop a laboratory exercise in acid/base physiology that would provide…

  4. Using Willie's Acid-Base Box for Blood Gas Analysis

    ERIC Educational Resources Information Center

    Dietz, John R.

    2011-01-01

    In this article, the author describes a method developed by Dr. William T. Lipscomb for teaching blood gas analysis of acid-base status and provides three examples using Willie's acid-base box. Willie's acid-base box is constructed using three of the parameters of standard arterial blood gas analysis: (1) pH; (2) bicarbonate; and (3) CO[subscript…

  5. Investigating Students' Reasoning about Acid-Base Reactions

    ERIC Educational Resources Information Center

    Cooper, Melanie M.; Kouyoumdjian, Hovig; Underwood, Sonia M.

    2016-01-01

    Acid-base chemistry is central to a wide range of reactions. If students are able to understand how and why acid-base reactions occur, it should provide a basis for reasoning about a host of other reactions. Here, we report the development of a method to characterize student reasoning about acid-base reactions based on their description of…

  6. Bipolar Membranes for Acid Base Flow Batteries

    NASA Astrophysics Data System (ADS)

    Anthamatten, Mitchell; Roddecha, Supacharee; Jorne, Jacob; Coughlan, Anna

    2011-03-01

    Rechargeable batteries can provide grid-scale electricity storage to match power generation with consumption and promote renewable energy sources. Flow batteries offer modular and flexible design, low cost per kWh and high efficiencies. A novel flow battery concept will be presented based on acid-base neutralization where protons (H+) and hydroxyl (OH-) ions react electrochemically to produce water. The large free energy of this highly reversible reaction can be stored chemically, and, upon discharge, can be harvested as usable electricity. The acid-base flow battery concept avoids the use of a sluggish oxygen electrode and utilizes the highly reversible hydrogen electrode, thus eliminating the need for expensive noble metal catalysts. The proposed flow battery is a hybrid of a battery and a fuel cell---hydrogen gas storing chemical energy is produced at one electrode and is immediately consumed at the other electrode. The two electrodes are exposed to low and high pH solutions, and these solutions are separated by a hybrid membrane containing a hybrid cation and anion exchange membrane (CEM/AEM). Membrane design will be discussed, along with ion-transport data for synthesized membranes.

  7. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato

    PubMed Central

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-01-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  8. Regulatory Mechanisms of the Ihh/PTHrP Signaling Pathway in Fibrochondrocytes in Entheses of Pig Achilles Tendon

    PubMed Central

    Han, Xuesong; Zhuang, Yanfeng; Zhang, Zhihong

    2016-01-01

    This study is aimed at exploring the effect of stress stimulation on the proliferation and differentiation of fibrochondrocytes in entheses mediated via the Indian hedgehog (Ihh)/parathyroid hormone-related protein (PTHrP) signaling pathway. Differential stress stimulation on fibrochondrocytes in entheses was imposed. Gene expression and protein levels of signaling molecules including collagen type I (Col I), Col II, Col X, Ihh, and PTHrP in the cytoplasm of fibrochondrocytes were detected. Ihh signal blocking group was set up using Ihh signaling pathway-specific blocking agent cyclopamine. PTHrP enhancement group was set up using PTHrP reagent. Ihh/PTHrP double intervention group, as well as control group, was included to study the regulatory mechanisms of the Ihh/PTHrP signaling pathway in fibrochondrocytes. Under low cyclic stress tensile (CTS), PTHrP, Col I, and Col II gene expression and protein synthesis increased. Under high CTS, Ihh and Col X gene expression and protein synthesis increased. Blocking Ihh signaling with cyclopamine resulted in reduced PTHrP gene expression and protein synthesis and increased Col X gene expression and protein synthesis. Ihh and PTHrP coregulate fibrochondrocyte proliferation and differentiation in entheses through negative feedback regulation. Fibrochondrocyte is affected by the CTS. This phenomenon is regulated by stress stimulation through the Ihh/PTHrP signaling pathway. PMID:27994624

  9. Transcriptome Profiling Reveals the Regulatory Mechanism Underlying Pollination Dependent and Parthenocarpic Fruit Set Mainly Mediated by Auxin and Gibberellin

    PubMed Central

    Tang, Ning; Deng, Wei; Hu, Guojian; Hu, Nan; Li, Zhengguo

    2015-01-01

    Background Fruit set is a key process for crop production in tomato which occurs after successful pollination and fertilization naturally. However, parthenocarpic fruit development can be uncoupled from fertilization triggered by exogenous auxin or gibberellins (GAs). Global transcriptome knowledge during fruit initiation would help to characterize the molecular mechanisms by which these two hormones regulate pollination-dependent and -independent fruit set. Principal Findings In this work, digital gene expression tag profiling (DGE) technology was applied to compare the transcriptomes from pollinated and 2, 4-D/GA3-treated ovaries. Activation of carbohydrate metabolism, cell division and expansion as well as the down-regulation of MADS-box is a comprehensive regulatory pathway during pollination-dependent and parthenocarpic fruit set. The signaling cascades of auxin and GA are significantly modulated. The feedback regulations of Aux/IAAs and DELLA genes which functioned to fine-tune auxin and GA response respectively play fundamental roles in triggering fruit initiation. In addition, auxin regulates GA synthesis via up-regulation of GA20ox1 and down-regulation of KNOX. Accordingly, the effect of auxin on fruit set is mediated by GA via ARF2 and IAA9 down-regulation, suggesting that both pollination-dependent and parthenocarpic fruit set depend on the crosstalk between auxin and GA. Significance This study characterizes the transcriptomic features of ovary development and more importantly unravels the integral roles of auxin and GA on pollination-dependent and parthenocarpic fruit set. PMID:25909657

  10. Multistructure index in revealing complexity of regulatory mechanisms of human cardiovascular system at rest and orthostatic stress in healthy humans

    NASA Astrophysics Data System (ADS)

    Makowiec, Danuta; Graff, Beata; Struzik, Zbigniew R.

    2017-02-01

    Biological regulation is sufficiently complex to pose an enduring challenge for characterization of both its equilibrium and transient non-equilibrium dynamics. Two univariate but coupled observables, heart rate and systolic blood pressure, are commonly characterized in the benchmark example of the human cardiovascular regulatory system. Asymmetric distributions of accelerations and decelerations of heart rate, as well as rises and falls in systolic blood pressure, recorded in humans during a head-up tilt test provide insights into the dynamics of cardiovascular response to a rapid, controlled deregulation of the system's homeostasis. The baroreflex feedback loop is assumed to be the fundamental physiological mechanism for ensuring homeostatic blood supply to distant organs at rest and during orthostatic stress, captured in a classical beat-to-beat autoregressive model of baroreflex by de Boer et al. (1987). For model corroboration, a multistructure index statistic is proposed, seamlessly evaluating the size spectrum of magnitudes of neural reflexes such as baroreflex, responsible for maintaining the homeostatic dynamics. The multistructure index exposes a distinctly different dynamics of multiscale asymmetry between results obtained from real-life signals recorded from healthy subjects and those simulated using both the classical and perturbed versions of the model. Nonlinear effects observed suggest the pronounced presence of complex mechanisms resulting from baroreflex regulation when a human is at rest, which is aggravated in the system's response to orthostatic stress. Using our methodology of multistructure index, we therefore show a marked difference between model and real-life scenarios, which we attribute to multiscale asymmetry of non-linear origin in real-life signals, which we are not reproducible by the classical model.

  11. The function of the RNA-binding protein TEL1 in moss reveals ancient regulatory mechanisms of shoot development.

    PubMed

    Vivancos, Julien; Spinner, Lara; Mazubert, Christelle; Charlot, Florence; Paquet, Nicolas; Thareau, Vincent; Dron, Michel; Nogué, Fabien; Charon, Céline

    2012-03-01

    The shoot represents the basic body plan in land plants. It consists of a repeated structure composed of stems and leaves. Whereas vascular plants generate a shoot in their diploid phase, non-vascular plants such as mosses form a shoot (called the gametophore) in their haploid generation. The evolution of regulatory mechanisms or genetic networks used in the development of these two kinds of shoots is unclear. TERMINAL EAR1-like genes have been involved in diploid shoot development in vascular plants. Here, we show that disruption of PpTEL1 from the moss Physcomitrella patens, causes reduced protonema growth and gametophore initiation, as well as defects in gametophore development. Leafy shoots formed on ΔTEL1 mutants exhibit shorter stems with more leaves per shoot, suggesting an accelerated leaf initiation (shortened plastochron), a phenotype shared with the Poaceae vascular plants TE1 and PLA2/LHD2 mutants. Moreover, the positive correlation between plastochron length and leaf size observed in ΔTEL1 mutants suggests a conserved compensatory mechanism correlating leaf growth and leaf initiation rate that would minimize overall changes in plant biomass. The RNA-binding protein encoded by PpTEL1 contains two N-terminus RNA-recognition motifs, and a third C-terminus non-canonical RRM, specific to TEL proteins. Removal of the PpTEL1 C-terminus (including this third RRM) or only 16-18 amino acids within it seriously impairs PpTEL1 function, suggesting a critical role for this third RRM. These results show a conserved function of the RNA-binding PpTEL1 protein in the regulation of shoot development, from early ancestors to vascular plants, that depends on the third TEL-specific RRM.

  12. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    PubMed Central

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-01

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal/mol. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called `finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle and

  13. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose.

    PubMed

    Knott, Brandon C; Crowley, Michael F; Himmel, Michael E; Zimmer, Jochen; Beckham, Gregg T

    2016-05-01

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal/mol. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called `finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle and

  14. Simulating molecular mechanisms of the MDM2-mediated regulatory interactions: a conformational selection model of the MDM2 lid dynamics.

    PubMed

    Verkhivker, Gennady M

    2012-01-01

    Diversity and complexity of MDM2 mechanisms govern its principal function as the cellular antagonist of the p53 tumor suppressor. Structural and biophysical studies have demonstrated that MDM2 binding could be regulated by the dynamics of a pseudo-substrate lid motif. However, these experiments and subsequent computational studies have produced conflicting mechanistic models of MDM2 function and dynamics. We propose a unifying conformational selection model that can reconcile experimental findings and reveal a fundamental role of the lid as a dynamic regulator of MDM2-mediated binding. In this work, structure, dynamics and energetics of apo-MDM2 are studied as a function of posttranslational modifications and length of the lid. We found that the dynamic equilibrium between "closed" and "semi-closed" lid forms may be a fundamental characteristic of MDM2 regulatory interactions, which can be modulated by phosphorylation, phosphomimetic mutation as well as by the lid size. Our results revealed that these factors may regulate p53-MDM2 binding by fine-tuning the thermodynamic equilibrium between preexisting conformational states of apo-MDM2. In agreement with NMR studies, the effect of phosphorylation on MDM2 interactions was more pronounced with the truncated lid variant that favored the thermodynamically dominant closed form. The phosphomimetic mutation S17D may alter the lid dynamics by shifting the thermodynamic equilibrium towards the ensemble of "semi-closed" conformations. The dominant "semi-closed" lid form and weakened dependence on the phosphorylation seen in simulations with the complete lid can provide a rationale for binding of small p53-based mimetics and inhibitors without a direct competition with the lid dynamics. The results suggested that a conformational selection model of preexisting MDM2 states may provide a robust theoretical framework for understanding MDM2 dynamics. Probing biological functions and mechanisms of MDM2 regulation would require

  15. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    SciTech Connect

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-29

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal mol-1. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called 'finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle

  16. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    DOE PAGES

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; ...

    2016-01-29

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations tomore » the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal mol-1. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called 'finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive

  17. Strong Ion Regulatory Abilities Enable the Crab Xenograpsus testudinatus to Inhabit Highly Acidified Marine Vent Systems

    PubMed Central

    Hu, Marian Y.; Guh, Ying-Jey; Shao, Yi-Ta; Kuan, Pou-Long; Chen, Guan-Lin; Lee, Jay-Ron; Jeng, Ming-Shiou; Tseng, Yung-Che

    2016-01-01

    Hydrothermal vent organisms have evolved physiological adaptations to cope with extreme abiotic conditions including temperature and pH. To date, acid-base regulatory abilities of vent organisms are poorly investigated, although this physiological feature is essential for survival in low pH environments. We report the acid-base regulatory mechanisms of a hydrothermal vent crab, Xenograpsus testudinatus, endemic to highly acidic shallow-water vent habitats with average environment pH-values ranging between 5.4 and 6.6. Within a few hours, X. testudinatus restores extracellular pH (pHe) in response to environmental acidification of pH 6.5 (1.78 kPa pCO2) accompanied by an increase in blood HCO3- levels from 8.8 ± 0.3 to 31 ± 6 mM. Branchial Na+/K+-ATPase (NKA) and V-type H+-ATPase (VHA), the major ion pumps involved in branchial acid-base regulation, showed dynamic increases in response to acidified conditions on the mRNA, protein and activity level. Immunohistochemical analyses demonstrate the presence of NKA in basolateral membranes, whereas the VHA is predominantly localized in cytoplasmic vesicles of branchial epithelial- and pillar-cells. X. testudinatus is closely related to other strong osmo-regulating brachyurans, which is also reflected in the phylogeny of the NKA. Accordingly, our results suggest that the evolution of strong ion regulatory abilities in brachyuran crabs that allowed the occupation of ecological niches in euryhaline, freshwater, and terrestrial habitats are probably also linked to substantial acid-base regulatory abilities. This physiological trait allowed X. testudinatus to successfully inhabit one of the world's most acidic marine environments. PMID:26869933

  18. Just-in-time control of Spo0A synthesis in Bacillus subtilis by multiple regulatory mechanisms.

    PubMed

    Chastanet, Arnaud; Losick, Richard

    2011-11-01

    The response regulator Spo0A governs multiple developmental processes in Bacillus subtilis, including most conspicuously sporulation. Spo0A is activated by phosphorylation via a multicomponent phosphorelay. Previous work has shown that the Spo0A protein is not rate limiting for sporulation. Rather, Spo0A is present at high levels in growing cells, rapidly rising to yet higher levels under sporulation-inducing conditions, suggesting that synthesis of the response regulator is subject to a just-in-time control mechanism. Transcription of spo0A is governed by a promoter switching mechanism, involving a vegetative, σ(A)-recognized promoter, P(v), and a sporulation σ(H)-recognized promoter, P(s), that is under phosphorylated Spo0A (Spo0A∼P) control. The spo0A regulatory region also contains four (including one identified in the present work) conserved elements that conform to the consensus binding site for Spo0A∼P binding sites. These are herein designated O(1), O(2), O(3), and O(4) in reverse order of their proximity to the coding sequence. Here we report that O(1) is responsible for repressing P(v) during the transition to stationary phase, that O(2) is responsible for repressing P(s) during growth, that O(3) is responsible for activating P(s) at the start of sporulation, and that O(4) is dispensable for promoter switching. We also report that Spo0A synthesis is subject to a posttranscriptional control mechanism such that translation of mRNAs originating from P(v) is impeded due to RNA secondary structure whereas mRNAs originating from P(s) are fully competent for protein synthesis. We propose that the opposing actions of O(2) and O(3) and the enhanced translatability of mRNAs originating from P(s) create a highly sensitive, self-reinforcing switch that is responsible for producing a burst of Spo0A synthesis at the start of sporulation.

  19. ZNF148 modulates TOP2A expression and cell proliferation via ceRNA regulatory mechanism in colorectal cancer

    PubMed Central

    Gao, Xian Hua; Li, Juan; Liu, Yan; Liu, Qi Zhi; Hao, Li Qiang; Liu, Lian Jie; Zhang, Wei

    2017-01-01

    Abstract Background: Competing endogenous RNA (ceRNA) regulation is a novel hypothesized mechanism that states RNA molecules share common target microRNAs (miRNAs) and may competitively combine into the same miRNA pool. Methods: Zinc finger protein 148 (ZNF148) and TOP2A expression were analyzed in 742 colorectal cancer (CRC) tissues using immunohistochemistry (IHC). ZNF148 mRNA, TOP2A mRNA, miR101, miR144, miR335, and miR365 expression were estimated in 53 fresh frozen CRC tissues by reverse transcription polymerase chain reaction. Mechanisms underpinning ceRNA were examined using bioinformatics, correlation analysis, RNA interference, gene over-expression, and luciferase assays. Results: Protein levels of ZNF148 and TOP2A detected by IHC positively correlated (Spearman correlation coefficient [rs] = 0.431, P < 0.001); mRNA levels of ZNF148 and TOP2A also positively correlated (r = 0.591, P < 0.001). Bioinformatics analysis demonstrated that ZNF148 and TOP2A mRNA had 13 common target miRNAs, including miR101, miR144, miR335, and miR365. Correlation analysis demonstrated that levels of ZNF148 mRNA were negatively associated with levels of miR144, miR335, and miR365. Knockdown and overexpression tests showed that ZNF148 mRNA and TOP2A mRNA regulated each other in HCT116 cells, respectively, but not in Dicer-deficient HCT116 cells. Luciferase assays demonstrated that ZNF148 and TOP2A regulated each other through 3′UTR. Overexpression of ZNF148 mRNA and TOP2A mRNA caused significant downregulation of miR101, miR144, miR335, and miR365 in the HCT116 cells. We also found that knockdown of ZNF148 and TOP2A significantly promoted cell growth, and overexpression of ZNF148 and TOP2A inhibited cell proliferation, which was abrogated in Dicer-deficient HCT116 cells. Conclusion: ZNF148 and TOP2A regulate each other through ceRNA regulatory mechanism in CRC, which has biological effects on cell proliferation. PMID:28072746

  20. The Escherichia coli L-arabinose operon: binding sites of the regulatory proteins and a mechanism of positive and negative regulation.

    PubMed

    Ogden, S; Haggerty, D; Stoner, C M; Kolodrubetz, D; Schleif, R

    1980-06-01

    The locations of DNA binding by the proteins involved with positive and negative regulation of transcription initiation of the L-arabinose operon in Escherichia coli have been determined by the DNase I protection method. Two cyclic AMP receptor protein sites were found, at positions -78 to -107 and -121 to -146, an araC protein--arabinose binding site was found at position -40 to -78, and an araC protein-fucose binding site was found at position -106 to -144. These locations, combined with in vivo data on induction of the two divergently oriented arabinose promoters, suggest the following regulatory mechanism: induction of the araBAD operon occurs when cyclic AMP receptor protein, araC protein, and RNA polymerase are all present and able to bind to DNA. Negative regulation is accomplished by the repressing form of araC protein binding to a site in the regulatory region such that it stimultaneously blocks access of cyclic AMP receptor protein to two sites on the DNA, one site of which serves each of the two promoters. Thus, from a single operator site, the negative regulator represses the two outwardly oriented ara promoters. This regulatory mechanism explains the known positive and negative regulatory properties of the ara promoters.

  1. The central role of chloride in the metabolic acid-base changes in canine parvoviral enteritis.

    PubMed

    Burchell, Richard K; Schoeman, Johan P; Leisewitz, Andrew L

    2014-04-01

    The acid-base disturbances in canine parvoviral (CPV) enteritis are not well described. In addition, the mechanisms causing these perturbations have not been fully elucidated. The purpose of the present study was to assess acid-base changes in puppies suffering from CPV enteritis, using a modified strong ion model (SIM). The hypothesis of the study was that severe acid-base disturbances would be present and that the SIM would provide insights into pathological mechanisms, which have not been fully appreciated by the Henderson-Hasselbalch model. The study analysed retrospective data, obtained from 42 puppies with confirmed CPV enteritis and 10 healthy control dogs. The CPV-enteritis group had been allocated a clinical score, to allow classification of the data according to clinical severity. The effects of changes in free water, chloride, l-lactate, albumin and phosphate were calculated, using a modification of the base excess algorithm. When the data were summated for each patient, and correlated to each individual component, the most important contributor to the metabolic acid-base changes, according to the SIM, was chloride (P<0.001). Severely-affected animals tended to demonstrate hypochloraemic alkalosis, whereas mildly-affected puppies had a hyperchloraemic acidosis (P=0.007). In conclusion, the acid-base disturbances in CPV enteritis are multifactorial and complex, with the SIM providing information in terms of the origin of these changes.

  2. Nucleic Acid-Based Therapy Approaches for Huntington's Disease

    PubMed Central

    Vagner, Tatyana; Young, Deborah; Mouravlev, Alexandre

    2012-01-01

    Huntington's disease (HD) is caused by a dominant mutation that results in an unstable expansion of a CAG repeat in the huntingtin gene leading to a toxic gain of function in huntingtin protein which causes massive neurodegeneration mainly in the striatum and clinical symptoms associated with the disease. Since the mutation has multiple effects in the cell and the precise mechanism of the disease remains to be elucidated, gene therapy approaches have been developed that intervene in different aspects of the condition. These approaches include increasing expression of growth factors, decreasing levels of mutant huntingtin, and restoring cell metabolism and transcriptional balance. The aim of this paper is to outline the nucleic acid-based therapeutic strategies that have been tested to date. PMID:22288011

  3. Regulatory mechanisms and the role of calcium and potassium channels controlling supercontractile crop muscles in adult Phormia regina.

    PubMed

    Solari, Paolo; Stoffolano, John G; Fitzpatrick, Joanna; Gelperin, Alan; Thomson, Alan; Talani, Giuseppe; Sanna, Enrico; Liscia, Anna

    2013-09-01

    Bioassays and electrophysiological recordings were conducted in the adult blowfly Phormia regina to provide new insights into the regulatory mechanisms governing the crop filling and emptying processes of the supercontractile crop muscles. The cibarial pump drives ingestion. Simultaneous multisite extracellular recordings show that crop lobe (P5) distension during ingestion of a 4.7 μl sugar meal does not require muscle activity by any of the other pumps of the system. Conversely, pumping of fluids toward the anterior of the crop system during crop emptying is brought about by active muscle contraction, in the form of a highly coordinated peristaltic wave starting from P5 and progressively propagating to P6, P4 and P3 pumps, with P5 contracting with a frequency about 3.4 times higher than the other pumps. The crop contraction rate is also modulated by hemolymph-borne factors such as sugars, through ligand recognition at a presumptive receptor site rather than by an osmotic effect, as assessed by both behavioural and electrophysiological experiments. In this respect, sugars of equal osmolarity produce different effects, glucose being inhibitory and mannose ineffective for crop muscles, while trehalose enhances crop activity. Finally, voltage and current clamp experiments show that the muscle action potentials (mAPs) at the P4 pump are sustained by a serotonin-sensitive calcium conductance. Serotonin enhances calcium entry into the muscle cells and this could lead, as an indirect modulatory effect, to activation of a Ca(2+)-activated K(+) conductance (IK(Ca)), which sustains the following mAP repolarization phase in such a way that further mAPs can be generated early and the frequency consequently increased.

  4. Bacillus subtilis as a platform for molecular characterisation of regulatory mechanisms of Enterococcus faecalis resistance against cell wall antibiotics.

    PubMed

    Fang, Chong; Stiegeler, Emanuel; Cook, Gregory M; Mascher, Thorsten; Gebhard, Susanne

    2014-01-01

    To combat antibiotic resistance of Enterococcus faecalis, a better understanding of the molecular mechanisms, particularly of antibiotic detection, signal transduction and gene regulation is needed. Because molecular studies in this bacterium can be challenging, we aimed at exploiting the genetically highly tractable Gram-positive model organism Bacillus subtilis as a heterologous host. Two fundamentally different regulators of E. faecalis resistance against cell wall antibiotics, the bacitracin sensor BcrR and the vancomycin-sensing two-component system VanSB-VanRB, were produced in B. subtilis and their functions were monitored using target promoters fused to reporter genes (lacZ and luxABCDE). The bacitracin resistance system BcrR-BcrAB of E. faecalis was fully functional in B. subtilis, both regarding regulation of bcrAB expression and resistance mediated by the transporter BcrAB. Removal of intrinsic bacitracin resistance of B. subtilis increased the sensitivity of the system. The lacZ and luxABCDE reporters were found to both offer sensitive detection of promoter induction on solid media, which is useful for screening of large mutant libraries. The VanSB-VanRB system displayed a gradual dose-response behaviour to vancomycin, but only when produced at low levels in the cell. Taken together, our data show that B. subtilis is a well-suited host for the molecular characterization of regulatory systems controlling resistance against cell wall active compounds in E. faecalis. Importantly, B. subtilis facilitates the careful adjustment of expression levels and genetic background required for full functionality of the introduced regulators.

  5. Regulatory T Cells from Colon Cancer Patients Inhibit Effector T-cell Migration through an Adenosine-Dependent Mechanism.

    PubMed

    Sundström, Patrik; Stenstad, Hanna; Langenes, Veronica; Ahlmanner, Filip; Theander, Lisa; Ndah, Tapuka Gordon; Fredin, Kamilla; Börjesson, Lars; Gustavsson, Bengt; Bastid, Jérémy; Quiding-Järbrink, Marianne

    2016-03-01

    T cell-mediated immunity is a major component of antitumor immunity. In order to be efficient, effector T cells must leave the circulation and enter into the tumor tissue. Regulatory T cells (Treg) from gastric cancer patients, but not from healthy volunteers, potently inhibit migration of conventional T cells through activated endothelium. In this study, we compared T cells from colon cancer patients and healthy donors to determine the mechanisms used by Tregs from cancer patients to inhibit conventional T-cell migration. Our results showed that circulating Tregs from cancer patients expressed high levels of CD39, an ectoenzyme mediating hydrolysis of ATP to AMP, as a rate-determining first step in the generation of immunosuppressive adenosine. Tumor-associated Tregs expressed even more CD39, and we therefore examined the importance of adenosine in Treg-mediated inhibition of T-cell transendothelial migration in vitro. Exogenous adenosine significantly reduced migration of conventional T cells from healthy volunteers, and blocking either adenosine receptors or CD39 enzymatic activity during transmigration restored the ability of conventional T cells from cancer patients to migrate. Adenosine did not directly affect T cells or endothelial cells, but reduced the ability of monocytes to activate the endothelium. Taken together, our results indicate that Treg-derived adenosine acts on monocytes and contributes to reduced transendothelial migration of effector T cells into tumors. This effect of Tregs is specific for cancer patients, and our results indicate that Tregs may affect not only T-cell effector functions but also their migration into tumors.

  6. Ionic mechanisms of regulatory volume increase (RVI) in the human hepatoma cell-line HepG2.

    PubMed

    Wehner, Frank; Lawonn, Peter; Tinel, Hanna

    2002-03-01

    We studied the effects of hypertonic stress on ion transport and cell volume regulation (regulatory volume increase; RVI) in the human tumor cell-line HepG2. Ion conductances were monitored in intracellular current-clamp measurements with rapid ion-substitutions and in whole-cell patch-clamp recordings; intracellular pH buffering capacity and activation of Na(+)/H(+) antiport were determined fluorometrically; the rates of Na(+)-K(+)-2Cl(-) symport and Na(+)/K(+)-ATPase were quantified on the basis of time-dependent and furosemide- or ouabain-sensitive (86)Rb(+) uptake, respectively; changes in cell volume were recorded by means of confocal laser-scanning microscopy. It was found that hypertonic conditions led to the activation of a cation conductance that was inhibited by Gd(3+), flufenamate as well as amiloride, but not by benzamil or ethyl-isopropyl-amiloride (EIPA). Most likely, this cation conductance was non-selective for Na(+) over K(+). Hypertonic stress did not change K(+) conductance, whereas possible changes in Cl(-) conductance remain ambiguous. The contribution of Na(+)/H(+)antiport to the RVI process appeared to be minor. Under hypertonic conditions an approximately 3.5-fold stimulation of Na(+)-K(+)-2Cl(-)symport was observed but this transporter did not significantly contribute to the overall RVI process. Hypertonic stress did not increase the activity of Na(+)/K(+)-ATPase, which even under isotonic conditions appeared to be working at its limit. It is concluded that the main mechanism in the RVI of HepG2 cells is the activation of a novel non-selective cation conductance. In contrast, there is little if any contribution of K(+) conductance, Na(+)/H(+) antiport, Na(+)-K(+)-2Cl(-) symport, and Na(+)/K(+)-ATPase to this process.

  7. Morphological and molecular characterization of a spontaneously tuberizing potato mutant: an insight into the regulatory mechanisms of tuber induction

    PubMed Central

    Fischer, Lukas; Lipavska, Helena; Hausman, Jean-Francois; Opatrny, Zdenek

    2008-01-01

    Background Tuberization in potato (Solanum tuberosum L.) represents a morphogenetic transition of stolon growth to tuber formation, which is under complex environmental and endogenous regulation. In the present work, we studied the regulatory mechanisms and the role of different morphogenetic factors in a newly isolated potato mutant, which exhibited spontaneous tuberization (ST). The ST mutant was characterized in detail at morphological, physiological and biochemical levels. Results Tuberization of the ST mutant grown in the soil was photoperiod-insensitive; predominantly sessile tubers formed directly from axillary buds even under continuous light. Single-node cuttings of the ST mutant cultured in vitro frequently formed tubers or basal tuber-like swellings instead of normal shoots under conditions routinely used for shoot propagation. The tuberization response of ST cuttings under light was dependent on sucrose, the concentration of which had to exceed certain threshold that inversely correlated with irradiance. Gibberellic acid prevented tuberization of ST cuttings, but failed to restore normal shoot phenotype and caused severe malformations. Carbohydrate analysis showed increased levels of both soluble sugars and starch in ST plants, with altered carbohydrate partitioning and metabolism. Comparative proteomic analysis revealed only a few differences between ST- and wild-type plants, primary amongst which seemed to be the absence of an isoform of manganese-stabilizing protein, a key subunit of photosystem II. Conclusion ST mutant exhibits complex developmental and phenotypic modifications, with features that are typical for plants strongly induced to tuberize. These changes are likely to be related to altered regulation of photosynthesis and carbohydrate metabolism rather than impaired transduction of inhibitory gibberellin or photoperiod-based signals. The effect of gibberellins on tuberization of ST mutant suggests that gibberellins inhibit tuberization

  8. Awareness of federal regulatory mechanisms relevant to community-engaged research: survey of health disparities-oriented NIH-funded investigators

    PubMed Central

    Fullerton, Stephanie M.; Anderson, Emily E.; Cowan, Ketch; Malen, Rachel C.; Brugge, Doug

    2015-01-01

    Few studies or investigators involved in community engaged research or community-based participatory research have examined awareness and adoption of federal regulatory mechanisms. We conducted a survey of investigators affiliated with the ten National Institutes of Health (NIH) Centers for Population Health and Health Disparities. A questionnaire designed to capture experience with the conduct and oversight of community engaged research, and awareness of pertinent regulatory mechanisms, including Federalwide Assurances (FWAs), Individual Investigator Agreements (IIAs), and Institutional Review Board Authorization Agreements (IAAs), was completed by 101 respondents (68% response rate). Although most were aware of FWAs, only a minority of those surveyed reported knowledge of IAAs and IIAs and even fewer had used them in their research with community partners. Implications for future training and oversight are discussed. PMID:25742662

  9. Photochemistry of nucleic acid bases and their thio- and aza-analogues in solution.

    PubMed

    Pollum, Marvin; Martínez-Fernández, Lara; Crespo-Hernández, Carlos E

    2015-01-01

    The steady-state and time-resolved photochemistry of the natural nucleic acid bases and their sulfur- and nitrogen-substituted analogues in solution is reviewed. Emphasis is given to the experimental studies performed over the last 3-5 years that showcase topical areas of scientific inquiry and those that require further scrutiny. Significant progress has been made toward mapping the radiative and nonradiative decay pathways of nucleic acid bases. There is a consensus that ultrafast internal conversion to the ground state is the primary relaxation pathway in the nucleic acid bases, whereas the mechanism of this relaxation and the level of participation of the (1)πσ*, (1) nπ*, and (3)ππ* states are still matters of debate. Although impressive research has been performed in recent years, the microscopic mechanism(s) by which the nucleic acid bases dissipate excess vibrational energy to their environment, and the role of the N-glycosidic group in this and in other nonradiative decay pathways, are still poorly understood. The simple replacement of a single atom in a nucleobase with a sulfur or nitrogen atom severely restricts access to the conical intersections responsible for the intrinsic internal conversion pathways to the ground state in the nucleic acid bases. It also enhances access to ultrafast and efficient inter-system crossing pathways that populate the triplet manifold in yields close to unity. Determining the coupled nuclear and electronic pathways responsible for the significantly different photochemistry in these nucleic acid base analogues serves as a convenient platform to examine the current state of knowledge regarding the photodynamic properties of the DNA and RNA bases from both experimental and computational perspectives. Further investigations should also aid in forecasting the prospective use of sulfur- and nitrogen-substituted base analogues in photochemotherapeutic applications.

  10. Nutrition, acid-base status and growth in early childhood.

    PubMed

    Kalhoff, H; Manz, F

    2001-10-01

    associated with impaired growth. Activation of secondary homeostatic mechanisms (extracellular volume contraction, depletion of disposable net base pools) might be important for impaired growth. Production of new formulas for reduced renal NAE could be an effective general preventive measure to reduce the clinical importance of one component of mixed acid-base disorders in early childhood.

  11. A conserved RNA structural element within the hepatitis B virus post-transcriptional regulatory element enhance nuclear export of intronless transcripts and repress the splicing mechanism.

    PubMed

    Visootsat, Akasit; Payungporn, Sunchai; T-Thienprasert, Nattanan P

    2015-12-01

    Hepatitis B virus (HBV) infection is a primary cause of hepatocellular carcinoma and liver cirrhosis worldwide. To develop novel antiviral drugs, a better understanding of HBV gene expression regulation is vital. One important aspect is to understand how HBV hijacks the cellular machinery to export unspliced RNA from the nucleus. The HBV post-transcriptional regulatory element (HBV PRE) has been proposed to be the HBV RNA nuclear export element. However, the function remains controversial, and the core element is unclear. This study, therefore, aimed to identify functional regulatory elements within the HBV PRE and investigate their functions. Using bioinformatics programs based on sequence conservation and conserved RNA secondary structures, three regulatory elements were predicted, namely PRE 1151-1410, PRE 1520-1620 and PRE 1650-1684. PRE 1151-1410 significantly increased intronless and unspliced luciferase activity in both HepG2 and COS-7 cells. Likewise, PRE 1151-1410 significantly elevated intronless and unspliced HBV surface transcripts in liver cancer cells. Moreover, motif analysis predicted that PRE 1151-1410 contains several regulatory motifs. This study reported the roles of PRE 1151-1410 in intronless transcript nuclear export and the splicing mechanism. Additionally, these results provide knowledge in the field of HBV RNA regulation. Moreover, PRE 1151-1410 may be used to enhance the expression of other mRNAs in intronless reporter plasmids.

  12. Contrasting evolutionary dynamics of the developmental regulator PAX9, among bats, with evidence for a novel post-transcriptional regulatory mechanism.

    PubMed

    Phillips, Caleb D; Butler, Boyd; Fondon, John W; Mantilla-Meluk, Hugo; Baker, Robert J

    2013-01-01

    Morphological evolution can be the result of natural selection favoring modification of developmental signaling pathways. However, little is known about the genetic basis of such phenotypic diversity. Understanding these mechanisms is difficult for numerous reasons, yet studies in model organisms often provide clues about the major developmental pathways involved. The paired-domain gene, PAX9, is known to be a key regulator of development, particularly of the face and teeth. In this study, using a comparative genetics approach, we investigate PAX9 molecular evolution among mammals, focusing on craniofacially diversified (Phyllostomidae) and conserved (Vespertilionidae) bat families, and extend our comparison to other orders of mammal. Open-reading frame analysis disclosed signatures of selection, in which a small percentage of residues vary, and lineages acquire different combinations of variation through recurrent substitution and lineage specific changes. A few instances of convergence for specific residues were observed between morphologically convergent bat lineages. Bioinformatic analysis for unknown PAX9 regulatory motifs indicated a novel post-transcriptional regulatory mechanism involving a Musashi protein. This regulation was assessed through fluorescent reporter assays and gene knockdowns. Results are compatible with the hypothesis that the number of Musashi binding-elements in PAX9 mRNA proportionally regulates protein translation rate. Although a connection between morphology and binding element frequency was not apparent, results indicate this regulation would vary among craniofacially divergent bat species, but be static among conserved species. Under this model, Musashi's regulatory control of alternative human PAX9 isoforms would also vary. The presence of Musashi-binding elements within PAX9 of all mammals examined, chicken, zebrafish, and the fly homolog of PAX9, indicates this regulatory mechanism is ancient, originating basal to much of the

  13. The in Silico Insight into Carbon Nanotube and Nucleic Acid Bases Interaction

    PubMed Central

    Karimi, Ali Asghar; Ghalandari, Behafarid; Tabatabaie, Seyed Saleh; Farhadi, Mohammad

    2016-01-01

    Background To explore practical applications of carbon nanotubes (CNTs) in biomedical fields the properties of their interaction with biomolecules must be revealed. Recent years, the interaction of CNTs with biomolecules is a subject of research interest for practical applications so that previous research explored that CNTs have complementary structure properties with single strand DNA (ssDNA). Objectives Hence, the quantum mechanics (QM) method based on ab initio was used for this purpose. Therefore values of binding energy, charge distribution, electronic energy and other physical properties of interaction were studied for interaction of nucleic acid bases and SCNT. Materials and Methods In this study, the interaction between nucleic acid bases and a (4, 4) single-walled carbon nanotube (SCNT) were investigated through calculations within quantum mechanics (QM) method at theoretical level of Hartree-Fock (HF) method using 6-31G basis set. Hence, the physical properties such as electronic energy, total dipole moment, charge distributions and binding energy of nucleic acid bases interaction with SCNT were investigated based on HF method. Results It has been found that the guanine base adsorption is bound stronger to the outer surface of nanotube in comparison to the other bases, consistent with the recent theoretical studies. In the other words, the results explored that guanine interaction with SCNT has optimum level of electronic energy so that their interaction is stable. Also, the calculations illustrated that SCNT interact to nucleic acid bases by noncovalent interaction because of charge distribution an electrostatic area is created in place of interaction. Conclusions Consequently, small diameter SCNT interaction with nucleic acid bases is noncovalent. Also, the results revealed that small diameter SCNT interaction especially SCNT (4, 4) with nucleic acid bases can be useful in practical application area of biomedical fields such detection and drug delivery

  14. Regulatory mechanisms underlying oil palm fruit mesocarp maturation, ripening, and functional specialization in lipid and carotenoid metabolism.

    PubMed

    Tranbarger, Timothy J; Dussert, Stéphane; Joët, Thierry; Argout, Xavier; Summo, Marilyne; Champion, Antony; Cros, David; Omore, Alphonse; Nouy, Bruno; Morcillo, Fabienne

    2011-06-01

    Fruit provide essential nutrients and vitamins for the human diet. Not only is the lipid-rich fleshy mesocarp tissue of the oil palm (Elaeis guineensis) fruit the main source of edible oil for the world, but it is also the richest dietary source of provitamin A. This study examines the transcriptional basis of these two outstanding metabolic characters in the oil palm mesocarp. Morphological, cellular, biochemical, and hormonal features defined key phases of mesocarp development. A 454 pyrosequencing-derived transcriptome was then assembled for the developmental phases preceding and during maturation and ripening, when high rates of lipid and carotenoid biosynthesis occur. A total of 2,629 contigs with differential representation revealed coordination of metabolic and regulatory components. Further analysis focused on the fatty acid and triacylglycerol assembly pathways and during carotenogenesis. Notably, a contig similar to the Arabidopsis (Arabidopsis thaliana) seed oil transcription factor WRINKLED1 was identified with a transcript profile coordinated with those of several fatty acid biosynthetic genes and the high rates of lipid accumulation, suggesting some common regulatory features between seeds and fruits. We also focused on transcriptional regulatory networks of the fruit, in particular those related to ethylene transcriptional and GLOBOSA/PISTILLATA-like proteins in the mesocarp and a central role for ethylene-coordinated transcriptional regulation of type VII ethylene response factors during ripening. Our results suggest that divergence has occurred in the regulatory components in this monocot fruit compared with those identified in the dicot tomato (Solanum lycopersicum) fleshy fruit model.

  15. Acid-base properties of titanium-antimony oxides catalysts

    SciTech Connect

    Zenkovets, G.A.; Paukshtis, E.A.; Tarasova, D.V.; Yurchenko, E.N.

    1982-06-01

    The acid-base properties of titanium-antimony oxide catalysts were studied by the methods of back titration and ir spectroscopy. The interrelationship between the acid-base and catalytic properties in the oxidative ammonolysis of propylene was discussed. 3 figures, 1 table.

  16. A Closer Look at Acid-Base Olfactory Titrations

    ERIC Educational Resources Information Center

    Neppel, Kerry; Oliver-Hoyo, Maria T.; Queen, Connie; Reed, Nicole

    2005-01-01

    Olfactory titrations using raw onions and eugenol as acid-base indicators are reported. An in-depth investigation on olfactory titrations is presented to include requirements for potential olfactory indicators and protocols for using garlic, onions, and vanillin as acid-base olfactory indicators are tested.

  17. Distinct regulatory mechanisms of the human ferritin gene by hypoxia and hypoxia mimetic cobalt chloride at the transcriptional and post-transcriptional levels.

    PubMed

    Huang, Bo-Wen; Miyazawa, Masaki; Tsuji, Yoshiaki

    2014-12-01

    Cobalt chloride has been used as a hypoxia mimetic because it stabilizes hypoxia inducible factor-1α (HIF1-α) and activates gene transcription through a hypoxia responsive element (HRE). However, differences between hypoxia and hypoxia mimetic cobalt chloride in gene regulation remain elusive. Expression of ferritin, the major iron storage protein, is regulated at the transcriptional and posttranscriptional levels through DNA and RNA regulatory elements. Here we demonstrate that hypoxia and cobalt chloride regulate ferritin heavy chain (ferritin H) expression by two distinct mechanisms. Both hypoxia and cobalt chloride increased HIF1-α but a putative HRE in the human ferritin H gene was not activated. Instead, cobalt chloride but not hypoxia activated ferritin H transcription through an antioxidant responsive element (ARE), to which Nrf2 was recruited. Intriguingly, cobalt chloride downregulated ferritin H protein expression while it upregulated other ARE-regulated antioxidant genes in K562 cells. Further characterization demonstrated that cobalt chloride increased interaction between iron regulatory proteins (IRP1 and IRP2) and iron responsive element (IRE) in the 5'UTR of ferritin H mRNA, resulting in translational block of the accumulated ferritin H mRNA. In contrast, hypoxia had marginal effect on ferritin H transcription but increased its translation through decreased IRP1-IRE interaction. These results suggest that hypoxia and hypoxia mimetic cobalt chloride employ distinct regulatory mechanisms through the interplay between DNA and mRNA elements at the transcriptional and post-transcriptional levels.

  18. Assessment of acid-base balance. Stewart's approach.

    PubMed

    Fores-Novales, B; Diez-Fores, P; Aguilera-Celorrio, L J

    2016-04-01

    The study of acid-base equilibrium, its regulation and its interpretation have been a source of debate since the beginning of 20th century. Most accepted and commonly used analyses are based on pH, a notion first introduced by Sorensen in 1909, and on the Henderson-Hasselbalch equation (1916). Since then new concepts have been development in order to complete and make easier the understanding of acid-base disorders. In the early 1980's Peter Stewart brought the traditional interpretation of acid-base disturbances into question and proposed a new method. This innovative approach seems more suitable for studying acid-base abnormalities in critically ill patients. The aim of this paper is to update acid-base concepts, methods, limitations and applications.

  19. α -Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism.

    PubMed

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system.

  20. Hyaluronic acid-based hydrogel enhances neuronal survival in spinal cord slice cultures from postnatal mice.

    PubMed

    Schizas, Nikos; Rojas, Ramiro; Kootala, Sujit; Andersson, Brittmarie; Pettersson, Jennie; Hilborn, Jons; Hailer, Nils P

    2014-02-01

    Numerous biomaterials based on extracellular matrix-components have been developed. It was our aim to investigate whether a hyaluronic acid-based hydrogel improves neuronal survival and tissue preservation in organotypic spinal cord slice cultures. Organotypic spinal cord slice cultures were cultured for 4 days in vitro (div), either on hyaluronic acid-based hydrogel (hyaluronic acid-gel group), collagen gel (collagen group), directly on polyethylene terephthalate membrane inserts (control group), or in the presence of soluble hyaluronic acid (soluble hyaluronic acid group). Cultures were immunohistochemically stained against neuronal antigen NeuN and analyzed by confocal laser scanning microscopy. Histochemistry for choline acetyltransferance, glial fibrillary acidic protein, and Griffonia simplicifolia isolectin B4 followed by quantitative analysis was performed to assess motorneurons and different glial populations. Confocal microscopic analysis showed a 4-fold increase in the number of NeuN-positive neurons in the hyaluronic acid-gel group compared to both collagen (p < 0.001) and control groups (p < 0.001). Compared to controls, organotypic spinal cord slice cultures maintained on hyaluronic acid-based hydrogel showed 5.9-fold increased survival of choline acetyltransferance-positive motorneurons (p = 0.008), 2-fold more numerous resting microglial cells in the white matter (p = 0.031), and a 61.4% reduction in the number of activated microglial cells within the grey matter (p = 0.05). Hyaluronic acid-based hydrogel had a shear modulus (G') of ≈1200 Pascals (Pa), which was considerably higher than the ≈25 Pa measured for collagen gel. Soluble hyaluronic acid failed to improve tissue preservation. In conclusion, hyaluronic acid-based hydrogel improves neuronal and - most notably - motorneuron survival in organotypic spinal cord slice cultures and microglial activation is limited. The positive effects of hyaluronic acid-based hydrogel

  1. The Legionella pneumophila genome evolved to accommodate multiple regulatory mechanisms controlled by the CsrA-system

    PubMed Central

    Sahr, Tobias; Rusniok, Christophe; Impens, Francis; Oliva, Giulia; Sismeiro, Odile; Coppée, Jean-Yves

    2017-01-01

    The carbon storage regulator protein CsrA regulates cellular processes post-transcriptionally by binding to target-RNAs altering translation efficiency and/or their stability. Here we identified and analyzed the direct targets of CsrA in the human pathogen Legionella pneumophila. Genome wide transcriptome, proteome and RNA co-immunoprecipitation followed by deep sequencing of a wild type and a csrA mutant strain identified 479 RNAs with potential CsrA interaction sites located in the untranslated and/or coding regions of mRNAs or of known non-coding sRNAs. Further analyses revealed that CsrA exhibits a dual regulatory role in virulence as it affects the expression of the regulators FleQ, LqsR, LetE and RpoS but it also directly regulates the timely expression of over 40 Dot/Icm substrates. CsrA controls its own expression and the stringent response through a regulatory feedback loop as evidenced by its binding to RelA-mRNA and links it to quorum sensing and motility. CsrA is a central player in the carbon, amino acid, fatty acid metabolism and energy transfer and directly affects the biosynthesis of cofactors, vitamins and secondary metabolites. We describe the first L. pneumophila riboswitch, a thiamine pyrophosphate riboswitch whose regulatory impact is fine-tuned by CsrA, and identified a unique regulatory mode of CsrA, the active stabilization of RNA anti-terminator conformations inside a coding sequence preventing Rho-dependent termination of the gap operon through transcriptional polarity effects. This allows L. pneumophila to regulate the pentose phosphate pathway and the glycolysis combined or individually although they share genes in a single operon. Thus the L. pneumophila genome has evolved to acclimate at least five different modes of regulation by CsrA giving it a truly unique position in its life cycle. PMID:28212376

  2. Cis- and Trans-Regulatory Mechanisms of Gene Expression in the ASJ Sensory Neuron of Caenorhabditis elegans

    PubMed Central

    González-Barrios, María; Fierro-González, Juan Carlos; Krpelanova, Eva; Mora-Lorca, José Antonio; Pedrajas, José Rafael; Peñate, Xenia; Chavez, Sebastián; Swoboda, Peter; Jansen, Gert; Miranda-Vizuete, Antonio

    2015-01-01

    The identity of a given cell type is determined by the expression of a set of genes sharing common cis-regulatory motifs and being regulated by shared transcription factors. Here, we identify cis and trans regulatory elements that drive gene expression in the bilateral sensory neuron ASJ, located in the head of the nematode Caenorhabditis elegans. For this purpose, we have dissected the promoters of the only two genes so far reported to be exclusively expressed in ASJ, trx-1 and ssu-1. We hereby identify the ASJ motif, a functional cis-regulatory bipartite promoter region composed of two individual 6 bp elements separated by a 3 bp linker. The first element is a 6 bp CG-rich sequence that presumably binds the Sp family member zinc-finger transcription factor SPTF-1. Interestingly, within the C. elegans nervous system SPTF-1 is also found to be expressed only in ASJ neurons where it regulates expression of other genes in these neurons and ASJ cell fate. The second element of the bipartite motif is a 6 bp AT-rich sequence that is predicted to potentially bind a transcription factor of the homeobox family. Together, our findings identify a specific promoter signature and SPTF-1 as a transcription factor that functions as a terminal selector gene to regulate gene expression in C. elegans ASJ sensory neurons. PMID:25769980

  3. PARP-2 and PARP-3 are selectively activated by 5′ phosphorylated DNA breaks through an allosteric regulatory mechanism shared with PARP-1

    PubMed Central

    Langelier, Marie-France; Riccio, Amanda A.; Pascal, John M.

    2014-01-01

    PARP-1, PARP-2 and PARP-3 are DNA-dependent PARPs that localize to DNA damage, synthesize poly(ADP-ribose) (PAR) covalently attached to target proteins including themselves, and thereby recruit repair factors to DNA breaks to increase repair efficiency. PARP-1, PARP-2 and PARP-3 have in common two C-terminal domains—Trp-Gly-Arg (WGR) and catalytic (CAT). In contrast, the N-terminal region (NTR) of PARP-1 is over 500 residues and includes four regulatory domains, whereas PARP-2 and PARP-3 have smaller NTRs (70 and 40 residues, respectively) of unknown structural composition and function. Here, we show that PARP-2 and PARP-3 are preferentially activated by DNA breaks harboring a 5′ phosphate (5′P), suggesting selective activation in response to specific DNA repair intermediates, in particular structures that are competent for DNA ligation. In contrast to PARP-1, the NTRs of PARP-2 and PARP-3 are not strictly required for DNA binding or for DNA-dependent activation. Rather, the WGR domain is the central regulatory domain of PARP-2 and PARP-3. Finally, PARP-1, PARP-2 and PARP-3 share an allosteric regulatory mechanism of DNA-dependent catalytic activation through a local destabilization of the CAT. Collectively, our study provides new insights into the specialization of the DNA-dependent PARPs and their specific roles in DNA repair pathways. PMID:24928857

  4. PARP-2 and PARP-3 are selectively activated by 5' phosphorylated DNA breaks through an allosteric regulatory mechanism shared with PARP-1.

    PubMed

    Langelier, Marie-France; Riccio, Amanda A; Pascal, John M

    2014-07-01

    PARP-1, PARP-2 and PARP-3 are DNA-dependent PARPs that localize to DNA damage, synthesize poly(ADP-ribose) (PAR) covalently attached to target proteins including themselves, and thereby recruit repair factors to DNA breaks to increase repair efficiency. PARP-1, PARP-2 and PARP-3 have in common two C-terminal domains-Trp-Gly-Arg (WGR) and catalytic (CAT). In contrast, the N-terminal region (NTR) of PARP-1 is over 500 residues and includes four regulatory domains, whereas PARP-2 and PARP-3 have smaller NTRs (70 and 40 residues, respectively) of unknown structural composition and function. Here, we show that PARP-2 and PARP-3 are preferentially activated by DNA breaks harboring a 5' phosphate (5'P), suggesting selective activation in response to specific DNA repair intermediates, in particular structures that are competent for DNA ligation. In contrast to PARP-1, the NTRs of PARP-2 and PARP-3 are not strictly required for DNA binding or for DNA-dependent activation. Rather, the WGR domain is the central regulatory domain of PARP-2 and PARP-3. Finally, PARP-1, PARP-2 and PARP-3 share an allosteric regulatory mechanism of DNA-dependent catalytic activation through a local destabilization of the CAT. Collectively, our study provides new insights into the specialization of the DNA-dependent PARPs and their specific roles in DNA repair pathways.

  5. FarR regulates the farAB-encoded efflux pump of Neisseria gonorrhoeae via an MtrR regulatory mechanism.

    PubMed

    Lee, E-H; Rouquette-Loughlin, C; Folster, J P; Shafer, W M

    2003-12-01

    The farAB operon of Neisseria gonorrhoeae encodes an efflux pump which mediates gonococcal resistance to antibacterial fatty acids. It was previously observed that expression of the farAB operon was positively regulated by MtrR, which is a repressor of the mtrCDE-encoded efflux pump system (E.-H. Lee and W. M. Shafer, Mol. Microbiol. 33:839-845, 1999). This regulation was believed to be indirect since MtrR did not bind to the farAB promoter. In this study, computer analysis of the gonococcal genome sequence database, lacZ reporter fusions, and gel mobility shift assays were used to elucidate the regulatory mechanism by which expression of the farAB operon is modulated by MtrR in gonococci. We identified a regulatory protein belonging to the MarR family of transcriptional repressors and found that it negatively controls expression of farAB by directly binding to the farAB promoter. We designated this regulator FarR to signify its role in regulating the farAB operon. We found that MtrR binds to the farR promoter, thereby repressing farR expression. Hence, MtrR regulates farAB in a positive fashion by modulating farR expression. This MtrR regulatory cascade seems to play an important role in adjusting levels of the FarAB and MtrCDE efflux pumps to prevent their excess expression in gonococci.

  6. Poly (ricinoleic acid) based novel thermosetting elastomer.

    PubMed

    Ebata, Hiroki; Yasuda, Mayumi; Toshima, Kazunobu; Matsumura, Shuichi

    2008-01-01

    A novel bio-based thermosetting elastomer was prepared by the lipase-catalyzed polymerization of methyl ricinoleate with subsequent vulcanization. Some mechanical properties of the cured carbon black-filled polyricinoleate compounds were evaluated as a thermosetting elastomer. It was found that the carbon black-filled polyricinoleate compounds were readily cured by sulfur curatives to produce a thermosetting elastomer that formed a rubber-like sheet with a smooth and non-sticky surface. The curing behaviors and mechanical properties were dependent on both the molecular weight of the polyricinoleate and the amount of the sulfur curatives. Cured compounds consisting of polyricinoleate with a molecular weight of 100,800 showed good mechanical properties, such as a hardness of 48 A based on the durometer A measurements, a tensile strength at break of 6.91 MPa and an elongation at break of 350%.

  7. Acid-base transport by the renal proximal tubule

    PubMed Central

    Skelton, Lara A.; Boron, Walter F.; Zhou, Yuehan

    2015-01-01

    Each day, the kidneys filter 180 L of blood plasma, equating to some 4,300 mmol of the major blood buffer, bicarbonate (HCO3−). The glomerular filtrate enters the lumen of the proximal tubule (PT), and the majority of filtered HCO3− is reclaimed along the early (S1) and convoluted (S2) portions of the PT in a manner coupled to the secretion of H+ into the lumen. The PT also uses the secreted H+ to titrate non-HCO3− buffers in the lumen, in the process creating “new HCO3−” for transport into the blood. Thus, the PT – along with more distal renal segments – is largely responsible for regulating plasma [HCO3−]. In this review we first focus on the milestone discoveries over the past 50+ years that define the mechanism and regulation of acid-base transport by the proximal tubule. Further on in the review, we will summarize research still in progress from our laboratory, work that addresses the problem of how the PT is able to finely adapt to acid–base disturbances by rapidly sensing changes in basolateral levels of HCO3− and CO2 (but not pH), and thereby to exert tight control over the acid–base composition of the blood plasma. PMID:21170887

  8. [Development of Nucleic Acid-Based Adjuvant for Cancer Immunotherapy].

    PubMed

    Kobiyama, Kouji; Ishii, Ken J

    2015-09-01

    Since the discovery of the human T cell-defined tumor antigen, the cancer immunotherapy field has rapidly progressed, with the research and development of cancer immunotherapy, including cancer vaccines, being conducted actively. However, the disadvantages of most cancer vaccines include relatively weak immunogenicity and immune escape or exhaustion. Adjuvants with innate immunostimulatory activities have been used to overcome these issues, and these agents have been shown to enhance the immunogenicity of cancer vaccines and to act as mono-therapeutic anti-tumor agents. CpG ODN, an agonist for TLR9, is one of the promising nucleic acid-based adjuvants, and it is a potent inducer of innate immune effector functions. CpG ODN suppresses tumor growth in the absence of tumor antigens and peptide administration. Therefore, CpG ODN is expected to be useful as a cancer vaccine adjuvant as well as a cancer immunotherapy agent. In this review, we discuss the potential therapeutic applications and mechanisms of CpG ODN for cancer immunotherapy.

  9. Acid-base transport in pancreas—new challenges

    PubMed Central

    Novak, Ivana; Haanes, Kristian A.; Wang, Jing

    2013-01-01

    Along the gastrointestinal tract a number of epithelia contribute with acid or basic secretions in order to aid digestive processes. The stomach and pancreas are the most extreme examples of acid (H+) and base (HCO−3) transporters, respectively. Nevertheless, they share the same challenges of transporting acid and bases across epithelia and effectively regulating their intracellular pH. In this review, we will make use of comparative physiology to enlighten the cellular mechanisms of pancreatic HCO−3 and fluid secretion, which is still challenging physiologists. Some of the novel transporters to consider in pancreas are the proton pumps (H+-K+-ATPases), as well as the calcium-activated K+ and Cl− channels, such as KCa3.1 and TMEM16A/ANO1. Local regulators, such as purinergic signaling, fine-tune, and coordinate pancreatic secretion. Lastly, we speculate whether dys-regulation of acid-base transport contributes to pancreatic diseases including cystic fibrosis, pancreatitis, and cancer. PMID:24391597

  10. Modeling the Acid-Base Properties of Montmorillonite Edge Surfaces.

    PubMed

    Tournassat, Christophe; Davis, James A; Chiaberge, Christophe; Grangeon, Sylvain; Bourg, Ian C

    2016-12-20

    The surface reactivity of clay minerals remains challenging to characterize because of a duality of adsorption surfaces and mechanisms that does not exist in the case of simple oxide surfaces: edge surfaces of clay minerals have a variable proton surface charge arising from hydroxyl functional groups, whereas basal surfaces have a permanent negative charge arising from isomorphic substitutions. Hence, the relationship between surface charge and surface potential on edge surfaces cannot be described using the Gouy-Chapman relation, because of a spillover of negative electrostatic potential from the basal surface onto the edge surface. While surface complexation models can be modified to account for these features, a predictive fit of experimental data was not possible until recently, because of uncertainty regarding the densities and intrinsic pKa values of edge functional groups. Here, we reexamine this problem in light of new knowledge on intrinsic pKa values obtained over the past decade using ab initio molecular dynamics simulations, and we propose a new formalism to describe edge functional groups. Our simulation results yield reasonable predictions of the best available experimental acid-base titration data.

  11. The Bronsted-Lowery Acid-Base Concept.

    ERIC Educational Resources Information Center

    Kauffman, George B.

    1988-01-01

    Gives the background history of the simultaneous discovery of acid-base relationships by Johannes Bronsted and Thomas Lowry. Provides a brief biographical sketch of each. Discusses their concept of acids and bases in some detail. (CW)

  12. An Olfactory Indicator for Acid-Base Titrations.

    ERIC Educational Resources Information Center

    Flair, Mark N.; Setzer, William N.

    1990-01-01

    The use of an olfactory acid-base indicator in titrations for visually impaired students is discussed. Potential olfactory indicators include eugenol, thymol, vanillin, and thiophenol. Titrations performed with each indicator with eugenol proved to be successful. (KR)

  13. Soluble adenylyl cyclase is an acid-base sensor in epithelial base-secreting cells.

    PubMed

    Roa, Jinae N; Tresguerres, Martin

    2016-08-01

    Blood acid-base regulation by specialized epithelia, such as gills and kidney, requires the ability to sense blood acid-base status. Here, we developed primary cultures of ray (Urolophus halleri) gill cells to study mechanisms for acid-base sensing without the interference of whole animal hormonal regulation. Ray gills have abundant base-secreting cells, identified by their noticeable expression of vacuolar-type H(+)-ATPase (VHA), and also express the evolutionarily conserved acid-base sensor soluble adenylyl cyclase (sAC). Exposure of cultured cells to extracellular alkalosis (pH 8.0, 40 mM HCO3 (-)) triggered VHA translocation to the cell membrane, similar to previous reports in live animals experiencing blood alkalosis. VHA translocation was dependent on sAC, as it was blocked by the sAC-specific inhibitor KH7. Ray gill base-secreting cells also express transmembrane adenylyl cyclases (tmACs); however, tmAC inhibition by 2',5'-dideoxyadenosine did not prevent alkalosis-dependent VHA translocation, and tmAC activation by forskolin reduced the abundance of VHA at the cell membrane. This study demonstrates that sAC is a necessary and sufficient sensor of extracellular alkalosis in ray gill base-secreting cells. In addition, this study indicates that different sources of cAMP differentially modulate cell biology.

  14. Identification of acid-base catalytic residues of high-Mr thioredoxin reductase from Plasmodium falciparum.

    PubMed

    McMillan, Paul J; Arscott, L David; Ballou, David P; Becker, Katja; Williams, Charles H; Müller, Sylke

    2006-11-03

    High-M(r) thioredoxin reductase from the malaria parasite Plasmodium falciparum (PfTrxR) contains three redox active centers (FAD, Cys-88/Cys-93, and Cys-535/Cys-540) that are in redox communication. The catalytic mechanism of PfTrxR, which involves dithiol-disulfide interchanges requiring acid-base catalysis, was studied by steady-state kinetics, spectral analyses of anaerobic static titrations, and rapid kinetics analysis of wild-type enzyme and variants involving the His-509-Glu-514 dyad as the presumed acid-base catalyst. The dyad is conserved in all members of the enzyme family. Substitution of His-509 with glutamine and Glu-514 with alanine led to TrxR with only 0.5 and 7% of wild type activity, respectively, thus demonstrating the crucial roles of these residues for enzymatic activity. The H509Q variant had rate constants in both the reductive and oxidative half-reactions that were dramatically less than those of wild-type enzyme, and no thiolateflavin charge-transfer complex was observed. Glu-514 was shown to be involved in dithiol-disulfide interchange between the Cys-88/Cys-93 and Cys-535/Cys-540 pairs. In addition, Glu-514 appears to greatly enhance the role of His-509 in acid-base catalysis. It can be concluded that the His-509-Glu-514 dyad, in analogy to those in related oxidoreductases, acts as the acid-base catalyst in PfTrxR.

  15. Mass Spectrometric Analysis of TRPM6 and TRPM7 Phosphorylation Reveals Regulatory Mechanisms of the Channel-Kinases

    PubMed Central

    Cai, Na; Bai, Zhiyong; Nanda, Vikas; Runnels, Loren W.

    2017-01-01

    TRPM7 and TRPM6 were the first identified bifunctional channels to contain their own kinase domains, but how these channel-kinases are regulated is poorly understood. Previous studies identified numerous phosphorylation sites on TRPM7, but very little is known about TRPM6 phosphorylation or sites on TRPM7 transphosphorylated by TRPM6. Our mass spectrometric analysis of homomeric and heteromeric TRPM7 and TRPM6 channels identified phosphorylation sites on both proteins, as well as several prominent sites on TRPM7 that are commonly modified through autophosphorylation and transphosphorylation by TRPM6. We conducted a series of amino acid substitution analyses and identified S1777, in TRPM7’s catalytic domain, and S1565, in TRPM7’s exchange domain that mediates kinase dimerization, as potential regulatory sites. The phosphomimetic S1777D substitution disrupted catalytic activity, most likely by causing an electrostatic perturbation at the active site. The S1565D phosphomimetic substitution also inactivated the kinase but did so without interfering with kinase dimerization. Molecular modeling indicates that phosphorylation of S1565 is predicted to structurally affect TRPM7’s functionally conserved N/D loop, which is thought to influence the access of substrate to the active site pocket. We propose that phosphorylation of S1565 within the exchange domain functions as a regulatory switch to control TRPM7 catalytic activity. PMID:28220887

  16. Positive and Negative Regulatory Mechanisms for Fine-Tuning Cellularity and Functions of Medullary Thymic Epithelial Cells

    PubMed Central

    Akiyama, Taishin; Tateishi, Ryosuke; Akiyama, Nobuko; Yoshinaga, Riko; Kobayashi, Tetsuya J.

    2015-01-01

    Self-tolerant T cells and regulatory T cells develop in the thymus. A wide variety of cell–cell interactions in the thymus is required for the differentiation, proliferation, and repertoire selection of T cells. Various secreted and cell surface molecules expressed in thymic epithelial cells (TECs) mediate these processes. Moreover, cytokines expressed by cells of hematopoietic origin regulate the cellularity of TECs. Tumor necrosis factor (TNF) family RANK ligand, lymphotoxin, and CD40 ligand, expressed in T cells and innate lymphoid cells (ILCs), promote the differentiation and proliferation of medullary TECs (mTECs) that play critical roles in the induction of immune tolerance. A recent study suggests that interleukin-22 (IL-22) produced by ILCs promotes regeneration of TECs after irradiation. Intriguingly, tumor growth factor-β and osteoprotegerin limit cellularity of mTECs, thereby attenuating regulatory T cell generation. We will review recent insights into the molecular basis for cell–cell interactions regulating differentiation and proliferation of mTECs and also discuss about a perspective on use of mathematical models for understanding this complicated system. PMID:26441966

  17. Mass Spectrometric Analysis of TRPM6 and TRPM7 Phosphorylation Reveals Regulatory Mechanisms of the Channel-Kinases.

    PubMed

    Cai, Na; Bai, Zhiyong; Nanda, Vikas; Runnels, Loren W

    2017-02-21

    TRPM7 and TRPM6 were the first identified bifunctional channels to contain their own kinase domains, but how these channel-kinases are regulated is poorly understood. Previous studies identified numerous phosphorylation sites on TRPM7, but very little is known about TRPM6 phosphorylation or sites on TRPM7 transphosphorylated by TRPM6. Our mass spectrometric analysis of homomeric and heteromeric TRPM7 and TRPM6 channels identified phosphorylation sites on both proteins, as well as several prominent sites on TRPM7 that are commonly modified through autophosphorylation and transphosphorylation by TRPM6. We conducted a series of amino acid substitution analyses and identified S1777, in TRPM7's catalytic domain, and S1565, in TRPM7's exchange domain that mediates kinase dimerization, as potential regulatory sites. The phosphomimetic S1777D substitution disrupted catalytic activity, most likely by causing an electrostatic perturbation at the active site. The S1565D phosphomimetic substitution also inactivated the kinase but did so without interfering with kinase dimerization. Molecular modeling indicates that phosphorylation of S1565 is predicted to structurally affect TRPM7's functionally conserved N/D loop, which is thought to influence the access of substrate to the active site pocket. We propose that phosphorylation of S1565 within the exchange domain functions as a regulatory switch to control TRPM7 catalytic activity.

  18. Hydrogen bonding: a channel for protons to transfer through acid-base pairs.

    PubMed

    Wu, Liang; Huang, Chuanhui; Woo, Jung-Je; Wu, Dan; Yun, Sung-Hyun; Seo, Seok-Jun; Xu, Tongwen; Moon, Seung-Hyeon

    2009-09-10

    Different from H(3)O(+) transport as in the vehicle mechanism, protons find another channel to transfer through the poorly hydrophilic interlayers in a hydrated multiphase membrane. This membrane was prepared from poly(phthalazinone ether sulfone kentone) (SPPESK) and H(+)-form perfluorosulfonic resin (FSP), and poorly hydrophilic electrostatically interacted acid-base pairs constitute the interlayer between two hydrophilic phases (FSP and SPPESK). By hydrogen bonds forming and breaking between acid-base pairs and water molecules, protons transport directly through these poorly hydrophilic zones. The multiphase membrane, due to this unique transfer mechanism, exhibits better electrochemical performances during fuel cell tests than those of pure FSP and Nafion-112 membranes: 0.09-0.12 S cm(-1) of proton conductivity at 25 degrees C and 990 mW cm(-2) of the maximum power density at a current density of 2600 mA cm(-2) and a cell voltage of 0.38 V.

  19. More than one way to control hair growth: regulatory mechanisms in enterobacteria that affect fimbriae assembled by the chaperone/usher pathway.

    PubMed

    Clegg, Steven; Wilson, Janet; Johnson, Jeremiah

    2011-05-01

    Many gram-negative enterobacteria produce surface-associated fimbriae that facilitate attachment and adherence to eucaryotic cells and tissues. These organelles are believed to play an important role during infection by enabling bacteria to colonize specific niches within their hosts. One class of these fimbriae is assembled using a periplasmic chaperone and membrane-associated scaffolding protein that has been referred to as an usher because of its function in fimbrial biogenesis. The presence of multiple types of fimbriae assembled by the chaperone/usher pathway can be found both within a single bacterial species and also among different genera. One way of controlling fimbrial assembly in these bacteria is at the genetic level by positively or negatively regulating fimbrial gene expression. This minireview considers the mechanisms that have been described to control fimbrial gene expression and uses specific examples to demonstrate both unique and shared properties of such regulatory mechanisms.

  20. Impact of guided exploration and enactive exploration on self-regulatory mechanisms and information acquisition through electronic search.

    PubMed

    Debowski, S; Wood, R E; Bandura, A

    2001-12-01

    Following instruction in basic skills for electronic search, participants who practiced in a guided exploration mode developed stronger self-efficacy and greater satisfaction than those who practiced in a self-guided exploratory mode. Intrinsic motivation was not affected by exploration mode. On 2 post-training tasks, guided exploration participants produced more effective search strategies. expended less effort, made fewer errors, rejected fewer lines of search, and achieved higher performance. Relative lack of support for self-regulatory factors as mediators of exploration mode impacts was attributed to the uninformative feedback from electronic search, which causes most people to remain at a novice level and to require external guidance for development of self-efficacy and skills. Self-guided learning will be more effective on structured tasks with more informative feedback and for individuals with greater expertise on dynamic tasks.

  1. Thioarsenides: A case for long-range Lewis acid-base-directed van der Waals interactions

    SciTech Connect

    Gibbs, Gerald V.; Wallace, Adam F.; Downs, R. T.; Ross, Nancy L.; Cox, David F.; Rosso, Kevin M.

    2011-04-01

    Electron density distributions, bond paths, Laplacian and local energy density properties have been calculated for a number of As4Sn (n = 3,4,5) thioarsenide molecular crystals. On the basis of the distributions, the intramolecular As-S and As-As interactions classify as shared bonded interactions and the intermolecular As-S, As-As and S-S interactions classify as closed-shell van der Waals bonded interactions. The bulk of the intermolecular As-S bond paths link regions of locally concentrated electron density (Lewis base regions) with aligned regions of locally depleted electron density (Lewis acid regions) on adjacent molecules. The paths are comparable with intermolecular paths reported for several other molecular crystals that link aligned Lewis base and acid regions in a key-lock fashion, interactions that classified as long range Lewis acid-base directed van der Waals interactions. As the bulk of the intermolecular As-S bond paths (~70%) link Lewis acid-base regions on adjacent molecules, it appears that molecules adopt an arrangement that maximizes the number of As-S Lewis acid-base intermolecular bonded interactions. The maximization of the number of Lewis acid-base interactions appears to be connected with the close-packed array adopted by molecules: distorted cubic close-packed arrays are adopted for alacránite, pararealgar, uzonite, realgar and β-AsS and the distorted hexagonal close-packed arrays adopted by α- and β-dimorphite. A growth mechanism is proposed for thioarsenide molecular crystals from aqueous species that maximizes the number of long range Lewis acid-base vdW As-S bonded interactions with the resulting directed bond paths structuralizing the molecules as a molecular crystal.

  2. The acid-base titration of montmorillonite

    NASA Astrophysics Data System (ADS)

    Bourg, I. C.; Sposito, G.; Bourg, A. C.

    2003-12-01

    Proton binding to clay minerals plays an important role in the chemical reactivity of soils (e.g., acidification, retention of nutrients or pollutants). If should also affect the performance of clay barriers for waste disposal. The surface acidity of clay minerals is commonly modelled empirically by assuming generic amphoteric surface sites (>SOH) on a flat surface, with fitted site densities and acidity constant. Current advances in experimental methods (notably spectroscopy) are rapidly improving our understanding of the structure and reactivity of the surface of clay minerals (arrangement of the particles, nature of the reactive surface sites, adsorption mechanisms). These developments are motivated by the difficulty of modelling the surface chemistry of mineral surfaces at the macro-scale (e.g., adsorption or titration) without a detailed (molecular-scale) picture of the mechanisms, and should be progressively incorporated into surface complexation models. In this view, we have combined recent estimates of montmorillonite surface properties (surface site density and structure, edge surface area, surface electrostatic potential) with surface site acidities obtained from the titration of alpha-Al2O3 and SiO2, and a novel method of accounting for the unknown initial net proton surface charge of the solid. The model predictions were compared to experimental titrations of SWy-1 montmorillonite and purified MX-80 bentonite in 0.1-0.5 mol/L NaClO4 and 0.005-0.5 mol/L NaNO3 background electrolytes, respectively. Most of the experimental data were appropriately described by the model after we adjusted a single parameter (silanol sites on the surface of montmorillonite were made to be slightly more acidic than those of silica). At low ionic strength and acidic pH the model underestimated the buffering capacity of the montmorillonite, perhaps due to clay swelling or to the interlayer adsorption of dissolved aluminum. The agreement between our model and the experimental

  3. Acid-Base and the Skeleton

    NASA Astrophysics Data System (ADS)

    Bushinsky, David A.

    2008-09-01

    Chronic metabolic acidosis increases urine calcium (Ca) excretion in the absence of a concomitant increase in intestinal Ca absorption resulting in a net loss of total body. The source of this additional urine Ca is almost certainly the skeleton, the primary reservoir of body Ca. In vitro metabolic acidosis, modeled as a primary reduction in medium bicarbonate concentration, acutely (<24 h) stimulates Ca efflux primarily through physicochemical mineral dissolution while at later time periods (>24 h) cell-mediated mechanisms predominate. In cultured neonatal mouse calvariae, acidosis-induced, cell-mediated Ca efflux is mediated by effects on both osteoblasts and osteoclasts. Metabolic acidosis inhibits extracellular matrix production by osteoblasts, as determined by measurement of collagen levels and levels for the non-collagenous matrix proteins osteopontin and matrix gla protein. Metabolic acidosis upregulates osteoblastic expression of RANKL (Receptor Activator of NFκB Ligand), an important osteoclastogenic and osteoclast-activating factor. Acidosis also increases osteoclastic activity as measured by release of β-glucuronidase, an enzyme whose secretion correlates with osteoclast-mediated bone resorption.

  4. Ammonia Transporters and Their Role in Acid-Base Balance.

    PubMed

    Weiner, I David; Verlander, Jill W

    2017-04-01

    Acid-base homeostasis is critical to maintenance of normal health. Renal ammonia excretion is the quantitatively predominant component of renal net acid excretion, both under basal conditions and in response to acid-base disturbances. Although titratable acid excretion also contributes to renal net acid excretion, the quantitative contribution of titratable acid excretion is less than that of ammonia under basal conditions and is only a minor component of the adaptive response to acid-base disturbances. In contrast to other urinary solutes, ammonia is produced in the kidney and then is selectively transported either into the urine or the renal vein. The proportion of ammonia that the kidney produces that is excreted in the urine varies dramatically in response to physiological stimuli, and only urinary ammonia excretion contributes to acid-base homeostasis. As a result, selective and regulated renal ammonia transport by renal epithelial cells is central to acid-base homeostasis. Both molecular forms of ammonia, NH3 and NH4(+), are transported by specific proteins, and regulation of these transport processes determines the eventual fate of the ammonia produced. In this review, we discuss these issues, and then discuss in detail the specific proteins involved in renal epithelial cell ammonia transport.

  5. Mechanisms by Which B Cells and Regulatory T Cells Influence Development of Murine Organ-Specific Autoimmune Diseases

    PubMed Central

    Ellis, Jason S.; Braley-Mullen, Helen

    2017-01-01

    Experiments with B cell-deficient (B−/−) mice indicate that a number of autoimmune diseases require B cells in addition to T cells for their development. Using B−/− Non-obese diabetic (NOD) and NOD.H-2h4 mice, we demonstrated that development of spontaneous autoimmune thyroiditis (SAT), Sjogren’s syndrome and diabetes do not develop in B−/− mice, whereas all three diseases develop in B cell-positive wild-type (WT) mice. B cells are required early in life, since reconstitution of adult mice with B cells or autoantibodies did not restore their ability to develop disease. B cells function as important antigen presenting cells (APC) to initiate activation of autoreactive CD4+ effector T cells. If B cells are absent or greatly reduced in number, other APC will present the antigen, such that Treg are preferentially activated and effector T cells are not activated. In these situations, B−/− or B cell-depleted mice develop the autoimmune disease when T regulatory cells (Treg) are transiently depleted. This review focuses on how B cells influence Treg activation and function, and briefly considers factors that influence the effectiveness of B cell depletion for treatment of autoimmune diseases. PMID:28134752

  6. Allergic contact dermatitis: epidemiology, molecular mechanisms, in vitro methods and regulatory aspects. Current knowledge assembled at an international workshop at BfR, Germany.

    PubMed

    Peiser, M; Tralau, T; Heidler, J; Api, A M; Arts, J H E; Basketter, D A; English, J; Diepgen, T L; Fuhlbrigge, R C; Gaspari, A A; Johansen, J D; Karlberg, A T; Kimber, I; Lepoittevin, J P; Liebsch, M; Maibach, H I; Martin, S F; Merk, H F; Platzek, T; Rustemeyer, T; Schnuch, A; Vandebriel, R J; White, I R; Luch, A

    2012-03-01

    Contact allergies are complex diseases, and one of the important challenges for public health and immunology. The German 'Federal Institute for Risk Assessment' hosted an 'International Workshop on Contact Dermatitis'. The scope of the workshop was to discuss new discoveries and developments in the field of contact dermatitis. This included the epidemiology and molecular biology of contact allergy, as well as the development of new in vitro methods. Furthermore, it considered regulatory aspects aiming to reduce exposure to contact sensitisers. An estimated 15-20% of the general population suffers from contact allergy. Workplace exposure, age, sex, use of consumer products and genetic predispositions were identified as the most important risk factors. Research highlights included: advances in understanding of immune responses to contact sensitisers, the importance of autoxidation or enzyme-mediated oxidation for the activation of chemicals, the mechanisms through which hapten-protein conjugates are formed and the development of novel in vitro strategies for the identification of skin-sensitising chemicals. Dendritic cell cultures and structure-activity relationships are being developed to identify potential contact allergens. However, the local lymph node assay (LLNA) presently remains the validated method of choice for hazard identification and characterisation. At the workshop the use of the LLNA for regulatory purposes and for quantitative risk assessment was also discussed.

  7. Structure of a Construct of a Human Poly(C)-binding Protein Containing the First and Second KH Domains Reveals Insights into Its Regulatory Mechanisms*

    PubMed Central

    Du, Zhihua; Fenn, Sebastian; Tjhen, Richard; James, Thomas L.

    2008-01-01

    Poly(C)-binding proteins (PCBPs) are important regulatory proteins that contain three KH (hnRNP K homology) domains. Binding poly(C) D/RNA sequences via KH domains is essential for multiple PCBP functions. To reveal the basis for PCBP-D/RNA interactions and function, we determined the structure of a construct containing the first two domains (KH1-KH2) of human PCBP2 by NMR. KH1 and KH2 form an intramolecular pseudodimer. The large hydrophobic dimerization surface of each KH domain is on the side opposite the D/RNA binding interface. Chemical shift mapping indicates both domains bind poly(C) DNA motifs without disrupting the KH1-KH2 interaction. Spectral comparison of KH1-KH2, KH3, and full-length PCBP2 constructs suggests that the KH1-KH2 pseudodimer forms, but KH3 does not interact with other parts of the protein. From NMR studies and modeling, we propose possible modes of cooperative binding tandem poly(C) motifs by the KH domains. D/RNA binding may induce pseudodimer dissociation or stabilize dissociated KH1 and KH2, making protein interaction surfaces available to PCBP-binding partners. This conformational change may represent a regulatory mechanism linking D/RNA binding to PCBP functions. PMID:18701464

  8. [Microspeciation of amphoteric molecules of unusual acid-base properties].

    PubMed

    Kóczián, Kristóf

    2007-01-01

    The phisico-chemical properties of bio- and drug molecules greatly influence their interactions in the body and strongly effect the mechanism of drug action. Among these properties, macroscopic and site-specific protonation constants are of crucial importance. Latter one is the tool to calculate the relative concentration of the various microspecies in the compartments of the body at different pH values, and also, it is the versatile parameter to improve the pharmacokinetic properties of a new molecule in a particular family of drugs. In the present thesis work, the microspeciation of three molecules of great pharmaceutical importance and unusual acid-base properties, were carried out. The microconstants of tenoxicam, the non-steroidal anti-inflammatory drug, were described, introducing a novel deductive method using Hammett constants. For this purpose, a total of 8 tenoxicam and piroxicam derivatives were synthesised. To the best of our knowledge, the log k(N)O microconstant of tenoxicam obtained thus is the lowest enolate basicity value, which, however, can be well explained by the effects of the intramolecular environment. The developed evaluation procedure is suitable for microconstant determination of compounds in other molecule families. Besides, prodrug-type compounds and analogues similar to the structures of selective COX-2 isoenzyme inhibitors were synthesised. The other two molecules studied, the 6-aminopenicillanic acid and 7-cephalosporanic acid, the core molecules of the two most important beta-lactam antibiotic-types were derivatised and investigated by 1D and 2D NMR techniques. The NMR-pH titration on the parent compounds and their ester derivatives, combined with in situ pH-measurements allowed the microspeciation of these easily decomposing molecules. One of the protonation constant of 7-ACA (log kN(O) = 4.12), to the best of our knowledge, is the least non-aromatic basic amino-site among the natural compounds.

  9. Acid-base equilibrium dynamics in methanol and dimethyl sulfoxide probed by two-dimensional infrared spectroscopy.

    PubMed

    Lee, Chiho; Son, Hyewon; Park, Sungnam

    2015-07-21

    Two-dimensional infrared (2DIR) spectroscopy, which has been proven to be an excellent experimental method for studying thermally-driven chemical processes, was successfully used to investigate the acid dissociation equilibrium of HN3 in methanol (CH3OH) and dimethyl sulfoxide (DMSO) for the first time. Our 2DIR experimental results indicate that the acid-base equilibrium occurs on picosecond timescales in CH3OH but that it occurs on much longer timescales in DMSO. Our results imply that the different timescales of the acid-base equilibrium originate from different proton transfer mechanisms between the acidic (HN3) and basic (N3(-)) species in CH3OH and DMSO. In CH3OH, the acid-base equilibrium is assisted by the surrounding CH3OH molecules which can directly donate H(+) to N3(-) and accept H(+) from HN3 and the proton migrates through the hydrogen-bonded chain of CH3OH. On the other hand, the acid-base equilibrium in DMSO occurs through the mutual diffusion of HN3 and N3(-) or direct proton transfer. Our 2DIR experimental results corroborate different proton transfer mechanisms in the acid-base equilibrium in protic (CH3OH) and aprotic (DMSO) solvents.

  10. Potential of acute phase proteins as predictor of postpartum uterine infections during transition period and its regulatory mechanism in dairy cattle

    PubMed Central

    Manimaran, A.; Kumaresan, A.; Jeyakumar, S.; Mohanty, T. K.; Sejian, V.; Kumar, Narender; Sreela, L.; Prakash, M. Arul; Mooventhan, P.; Anantharaj, A.; Das, D. N.

    2016-01-01

    Among the various systemic reactions against infection or injury, the acute phase response is the cascade of reaction and mostly coordinated by cytokines-mediated acute phase proteins (APPs) production. Since APPs are sensitive innate immune molecules, they are useful for early detection of inflammation in bovines and believed to be better discriminators than routine hematological parameters. Therefore, the possibility of using APPs as a diagnostic and prognostic marker of inflammation in major bovine health disorders including postpartum uterine infection has been explored by many workers. In this review, we discussed specifically importance of postpartum uterine infection, the role of energy balance in uterine infections and potential of APPs as a predictor of postpartum uterine infections during the transition period and its regulatory mechanism in dairy cattle. PMID:27051191

  11. Autophagy Regulatory Network - a systems-level bioinformatics resource for studying the mechanism and regulation of autophagy.

    PubMed

    Türei, Dénes; Földvári-Nagy, László; Fazekas, Dávid; Módos, Dezső; Kubisch, János; Kadlecsik, Tamás; Demeter, Amanda; Lenti, Katalin; Csermely, Péter; Vellai, Tibor; Korcsmáros, Tamás

    2015-01-01

    Autophagy is a complex cellular process having multiple roles, depending on tissue, physiological, or pathological conditions. Major post-translational regulators of autophagy are well known, however, they have not yet been collected comprehensively. The precise and context-dependent regulation of autophagy necessitates additional regulators, including transcriptional and post-transcriptional components that are listed in various datasets. Prompted by the lack of systems-level autophagy-related information, we manually collected the literature and integrated external resources to gain a high coverage autophagy database. We developed an online resource, Autophagy Regulatory Network (ARN; http://autophagy-regulation.org), to provide an integrated and systems-level database for autophagy research. ARN contains manually curated, imported, and predicted interactions of autophagy components (1,485 proteins with 4,013 interactions) in humans. We listed 413 transcription factors and 386 miRNAs that could regulate autophagy components or their protein regulators. We also connected the above-mentioned autophagy components and regulators with signaling pathways from the SignaLink 2 resource. The user-friendly website of ARN allows researchers without computational background to search, browse, and download the database. The database can be downloaded in SQL, CSV, BioPAX, SBML, PSI-MI, and in a Cytoscape CYS file formats. ARN has the potential to facilitate the experimental validation of novel autophagy components and regulators. In addition, ARN helps the investigation of transcription factors, miRNAs and signaling pathways implicated in the control of the autophagic pathway. The list of such known and predicted regulators could be important in pharmacological attempts against cancer and neurodegenerative diseases.

  12. Functional anatomy and ion regulatory mechanisms of the antennal gland in a semi-terrestrial crab, Ocypode stimpsoni

    PubMed Central

    Tsai, Jyuan-Ru; Lin, Hui-Chen

    2014-01-01

    ABSTRACT Brachyuran crabs from diverse habitats show great differences in their osmoregulatory processes, especially in terms of the structural and physiological characteristics of the osmoregulatory organs. In crustaceans, the antennal glands are known to be important in osmoregulation, and they play a functional role analogous to that of the vertebrate kidney. Nevertheless, the detailed structure and function of the antennal glands in different species have rarely been described. The aim of this study is to investigate the role of the antennal gland in ion regulation by examining the ultrastructure of the cells and the distribution of the ion regulatory proteins in each cell type in the antennal gland of a semi-terrestrial crab. The results showed that Na+, K+-ATPase activity significantly increased in the antennal gland after a 4-day acclimation in dilute seawater and returned to its original (day 0) level after 7 days. Three major types of cells were identified in the antennal gland, including coelomic cells (COEs), labyrinthine cells (LBRs) and end-labyrinthine cells (ELBRs). The proximal tubular region (PT) and distal tubular region (DT) of the antennal gland consist of LBRs and COEs, whereas the end tubular region (ET) consists of all three types of cells, with fewer COEs and more ELBRs. We found a non-uniform distribution of NKA immunoreactivity, with increasing intensity from the proximal to the distal regions of the antennal gland. We summarise our study with a proposed model for the urine reprocessing pathway and the role of each cell type or segment of the antennal gland. PMID:24795144

  13. “Curcumin, the King of Spices”: Epigenetic Regulatory Mechanisms in the Prevention of Cancer, Neurological, and Inflammatory Diseases

    PubMed Central

    Boyanapalli, Sarandeep S. S.

    2015-01-01

    Curcumin (diferuloylmethane), a polyphenolic compound, is a component of Curcuma longa, commonly known as turmeric. It is a well-known anti-inflammatory, anti-oxidative, and anti-lipidemic agent and has recently been shown to modulate several diseases via epigenetic regulation. Many recent studies have demonstrated the role of epigenetic inactivation of pivotal genes that regulate human pathologies, such as neurocognitive disorders, inflammation, obesity, and cancers. Epigenetic changes involve changes in DNA methylation, histone modifications, or altered microRNA expression patterns which are known to be interconnected and play a key role in tumor progression and failure of conventional chemotherapy. The majority of epigenetic changes are influenced by lifestyle and diets. In this regard, dietary phytochemicals as dietary supplements have emerged as a promising source that are able to reverse these epigenetic alterations, to actively regulate gene expression and molecular targets that are known to promote tumorigenesis, and also to prevent age-related diseases through epigenetic modifications. There have been several studies which reported the role of curcumin as an epigenetic regulator in neurological disorders, inflammation, and in diabetes apart from cancers. The epigenetic regulatory roles of curcumin include (1) inhibition of DNA methyltransferases (DNMTs), which has been well defined from the recent studies on its function as a DNA hypomethylating agent; (2) regulation of histone modifications via regulation of histone acetyltransferases (HATs) and histone deacetylases (HDACs); and (3) regulation of micro RNAs (miRNA). This review summarizes the current knowledge on the effect of curcumin in the treatment and/or prevention of inflammation, neurodegenerative diseases, and cancers by regulating histone deacetylases, histone acetyltransferases, and DNA methyltransferases. PMID:26457241

  14. Control of liver size by RNAi-mediated multiplex knockdown and its application for discovery of regulatory mechanisms

    PubMed Central

    Yin, Hao; Bogorad, Roman L.; Barnes, Carmen; Walsha, Stephen; Zhuang, Iris; Nonaka, Hidenori; Ruda, Vera; Kuchimanchi, Satya; Nechev, Lubomir; Akinc, Akin; Xue, Wen; Zerial, Marino; Langer, Robert; Anderson, Daniel G.; Koteliansky, Victor

    2017-01-01

    Background and aims The Hippo pathway controls organ size through a negative regulation of the transcription co-activator Yap1. The overexpression of hyperactive mutant Yap1 or deletion of key components in the Hippo pathway leads to increased organ size in different species. Analysis of interactions of this pathway with other cellular signals corroborating organ size control is limited in part due to the difficulties associated with development of rodent models. Methods Here, we develop a new model of reversible induction of the liver size in mice using siRNA-nanoparticles targeting two kinases of Hippo pathway, namely, mammalian Ste20 family kinases 1 and 2 (Mst1 and Mst2), and an upstream regulator, neurofibromatosis type II (NF2). Results The triple siRNAs nanoparticle-induced hepatomegaly in mice phenocopies one observed with Mst1-/- Mst2-/- liver-specific depletion, as shown by extensive proliferation of hepatocytes and activation of Yap1. The simultaneous co-treatment with a fourth siRNA nanoparticle against Yap1 fully blocked the liver growth. Hippo pathway-induced liver enlargement is associated with p53 activation, evidenced by its accumulation in the nuclei and upregulation of its target genes. Moreover, injections of the triple siRNAs nanoparticle in p53LSL/LSL mice shows that livers lacking p53 expression grow faster and exceed the size of livers in p53 wild type animals, indicating a role of p53 in controlling Yap1-induced liver growth. Conclusion Our data show that siRNA-nanoparticulate manipulation of gene expression can provide the reversible control of organ size in adult animals, which presents a new avenue for the investigation of complex regulatory networks in liver. PMID:26658687

  15. Acid Base Titrations in Nonaqueous Solvents and Solvent Mixtures

    NASA Astrophysics Data System (ADS)

    Barcza, Lajos; Buvári-Barcza, Ágnes

    2003-07-01

    The acid base determination of different substances by nonaqueous titrations is highly preferred in pharmaceutical analyses since the method is quantitative, exact, and reproducible. The modern interpretation of the reactions in nonaqueous solvents started in the last century, but several inconsistencies and unsolved problems can be found in the literature. The acid base theories of Brønsted Lowry and Lewis as well as the so-called solvent theory are outlined first, then the promoting (and leveling) and the differentiating effects are discussed on the basis of the hydrogen-bond concept. Emphasis is put on the properties of formic acid and acetic anhydride since their importance is increasing.

  16. Acid-base properties of adhesive dental polymers.

    PubMed

    Morra, M

    1993-11-01

    The surface energetics of three resins (polymethylmethacrylate, polyhydroxyethylmethacrylate, and Bis-GMA/triethyleneglycoldimethacrylate) commonly used in adhesive interactions with tooth hard tissues were evaluated according to the Fowkes acid-base theory of interfacial interactions. From the measurement of the contact angle of test acidic and basic liquids on the sample surfaces, the acid-base contribution to the work of adhesion was evaluated. Results show that polyhydroxyethylmethacrylate is a comparatively strong Lewis base, a finding that can explain the important role played by this material in the formulation of dentin adhesive.

  17. An Acid-Base Chemistry Example: Conversion of Nicotine

    NASA Astrophysics Data System (ADS)

    Summerfield, John H.

    1999-10-01

    The current government interest in nicotine conversion by cigarette companies provides an example of acid-base chemistry that can be explained to students in the second semester of general chemistry. In particular, the conversion by ammonia of the +1 form of nicotine to the easier-to-assimilate free-base form illustrates the effect of pH on acid-base equilibrium. The part played by ammonia in tobacco smoke is analogous to what takes place when cocaine is "free-based".

  18. Acid-base and ion balance in fishes with bimodal respiration.

    PubMed

    Shartau, R B; Brauner, C J

    2014-03-01

    The evolution of air breathing during the Devonian provided early fishes with bimodal respiration with a stable O2 supply from air. This was, however, probably associated with challenges and trade-offs in terms of acid-base balance and ionoregulation due to reduced gill:water interaction and changes in gill morphology associated with air breathing. While many aspects of acid-base and ionoregulation in air-breathing fishes are similar to water breathers, the specific cellular and molecular mechanisms involved remain largely unstudied. In general, reduced ionic permeability appears to be an important adaptation in the few bimodal fishes investigated but it is not known if this is a general characteristic. The kidney appears to play an important role in minimizing ion loss to the freshwater environment in the few species investigated, and while ion uptake across the gut is probably important, it has been largely unexplored. In general, air breathing in facultative air-breathing fishes is associated with an acid-base disturbance, resulting in an increased partial pressure of arterial CO2 and a reduction in extracellular pH (pHE ); however, several fishes appear to be capable of tightly regulating tissue intracellular pH (pHI ), despite a large sustained reduction in pHE , a trait termed preferential pHI regulation. Further studies are needed to determine whether preferential pHI regulation is a general trait among bimodal fishes and if this confers reduced sensitivity to acid-base disturbances, including those induced by hypercarbia, exhaustive exercise and hypoxia or anoxia. Additionally, elucidating the cellular and molecular mechanisms may yield insight into whether preferential pHI regulation is a trait ultimately associated with the early evolution of air breathing in vertebrates.

  19. Robustness and evolvability in natural chemical resistance: identification of novel systems properties, biochemical mechanisms and regulatory interactions.

    PubMed

    Venancio, Thiago M; Balaji, S; Geetha, S; Aravind, L

    2010-08-01

    A vast amount of data on the natural resistance of Saccharomyces cerevisiae to a diverse array of chemicals has been generated over the past decade (chemical genetics). We endeavored to use this data to better characterize the "systems" level properties of this phenomenon. By collating data from over 30 different genome-scale studies on growth of gene deletion mutants in presence of diverse chemicals, we assembled the largest currently available gene-chemical network. We also derived a second gene-gene network that links genes with significantly overlapping chemical-genetic profiles. We analyzed properties of these networks and investigated their significance by overlaying various sources of information, such as presence of TATA boxes in their promoters (which typically correlate with transcriptional noise), association with TFIID or SAGA, and propensity to function as phenotypic capacitors. We further combined these networks with ubiquitin and protein kinase-substrate networks to understand chemical tolerance in the context of major post-translational regulatory processes. Hubs in the gene-chemical network (multidrug resistance genes) are notably enriched for phenotypic capacitors (buffers against phenotypic variation), suggesting the generality of these players in buffering mechanistically unrelated deleterious forces impinging on the cell. More strikingly, analysis of the gene-gene network derived from the gene-chemical network uncovered another set of genes that appear to function in providing chemical tolerance in a cooperative manner. These appear to be enriched in lineage-specific and rapidly diverging members that also show a corresponding tendency for SAGA-dependent regulation, evolutionary divergence and noisy expression patterns. This set represents a previously underappreciated component of the chemical response that enables cells to explore alternative survival strategies. Thus, systems robustness and evolvability are simultaneously active as general

  20. Immune-Regulatory Mechanisms of Classical and Experimental Multiple Sclerosis Drugs: A Special Focus on Helminth-Derived Treatments.

    PubMed

    Peón, Alberto N; Terrazas, Luis I

    2016-01-01

    Multiple sclerosis (MS) is the most prevalent autoimmune disease affecting the central nervous system (CNS). Its pathophysiology is centered on neuron myelin sheath destruction in a manner largely dependent upon CD4+/CD8+ T-cell autoreactivity against myelin antigens, inducing Th1/Th17 pathogenic responses with the resulting production of free radicals and soluble mediators that exhibit the effector mechanisms of neurodegeneration. The immune response responsible for this disease is complex and challenges modern medicine. Consequently, many experimental therapies have been proposed in addition to the classical array of immunoregulatory/ immunosuppressive drugs that are normally used to treat MS. In this review, we will describe the effects and mechanisms of action of widely used disease-modifying MS drugs as well as those of select treatments that are currently in the experimental phase. Special emphasis is placed on helminth-derived immunoregulators, as some of them have shown promising results. Additionally, we will compare the mechanisms of action of both the MS drugs and the helminth-derived treatments to discuss the potential importance of some signaling pathways in the control of MS.

  1. Co-Expression Analysis of Blood Cell Genome Expression to Preliminary Investigation of Regulatory Mechanisms in Uremia

    PubMed Central

    Cheng, Liu; Yonggui, Wu

    2017-01-01

    Background Uremia involves a series of clinical manifestations and is a common syndrome that occurs in nearly all end-stage kidney diseases. However, the exact genetic and/or molecular mechanisms that underlie uremia remain poorly understood. Material/Methods In this case-control study, we analyzed whole-genome microarray of 75 uremia patients and 20 healthy controls to investigate changes in gene expression and cellular mechanisms relevant to uremia. Gene co-expression network analysis was performed to construct co-expression networks using differentially expressed genes (DEGs) in uremia. We then determined hub models of co-expressed gene networks by MCODE, and we used miRNA enrichment analysis to detect key miRNAs in each hub module. Results We found nine co-expressed hub modules implicated in uremia. These modules were enriched in specific biological functions, including “proteolysis”, “membrane-enclosed lumen”, and “apoptosis”. Finally, miRNA enrichment analysis to detect key miRNAs in each hub module found 15 miRNAs that were specifically targeted to uremia-related hub modules. Of these, miRNA-21-3p and miRNA-210-3p have been identified in other studies as being important for uremia. Conclusions In summary, our study connected biological functions, genes, and miRNAs that underpin the network modules that can be used to elucidate the molecular mechanisms involved in uremia. PMID:28050009

  2. Evolution of Acid-Base Concept (1917-1984).

    ERIC Educational Resources Information Center

    Gamble, James L., Jr.

    1984-01-01

    Evaluates the accuracy and usefulness of a simpler rationale for teaching acid-base physiology as compared to more complex approaches frequently taught in physiology courses. Also reviews problems of terminology, giving emphasis to the significant effects that the choice of words can have on students' concepts. (JN)

  3. Soil Studies: Applying Acid-Base Chemistry to Environmental Analysis.

    ERIC Educational Resources Information Center

    West, Donna M.; Sterling, Donna R.

    2001-01-01

    Laboratory activities for chemistry students focus attention on the use of acid-base chemistry to examine environmental conditions. After using standard laboratory procedures to analyze soil and rainwater samples, students use web-based resources to interpret their findings. Uses CBL probes and graphing calculators to gather and analyze data and…

  4. Using Spreadsheets to Produce Acid-Base Titration Curves.

    ERIC Educational Resources Information Center

    Cawley, Martin James; Parkinson, John

    1995-01-01

    Describes two spreadsheets for producing acid-base titration curves, one uses relatively simple cell formulae that can be written into the spreadsheet by inexperienced students and the second uses more complex formulae that are best written by the teacher. (JRH)

  5. Dynamic Buffer Capacity in Acid-Base Systems.

    PubMed

    Michałowska-Kaczmarczyk, Anna M; Michałowski, Tadeusz

    The generalized concept of 'dynamic' buffer capacity βV is related to electrolytic systems of different complexity where acid-base equilibria are involved. The resulting formulas are presented in a uniform and consistent form. The detailed calculations are related to two Britton-Robinson buffers, taken as examples.

  6. Acid-Base Disorders--A Computer Simulation.

    ERIC Educational Resources Information Center

    Maude, David L.

    1985-01-01

    Describes and lists a program for Apple Pascal Version 1.1 which investigates the behavior of the bicarbonate-carbon dioxide buffer system in acid-base disorders. Designed specifically for the preclinical medical student, the program has proven easy to use and enables students to use blood gas parameters to arrive at diagnoses. (DH)

  7. Students' Understanding of Acids/Bases in Organic Chemistry Contexts

    ERIC Educational Resources Information Center

    Cartrette, David P.; Mayo, Provi M.

    2011-01-01

    Understanding key foundational principles is vital to learning chemistry across different contexts. One such foundational principle is the acid/base behavior of molecules. In the general chemistry sequence, the Bronsted-Lowry theory is stressed, because it lends itself well to studying equilibrium and kinetics. However, the Lewis theory of…

  8. Renal contribution to acid-base regulation during the menstrual cycle.

    PubMed

    Takano, N; Kaneda, T

    1983-03-01

    Menstruating women exhibit a light but sustained hypocapnia during the luteal phase. To elucidate whether the hypocapnia results primarily from a respiratory or renal mechanism, we measured the rate of urinary excretion of acid at intervals during the menstrual cycle in five subjects. The acid-base composition of arterial blood in three subjects and end-tidal PCO2 in the remaining two subjects were also determined. During the follicular phase, the acid-base composition of blood and the rate of net acid excretion remained virtually constant. After ovulation, significant decreases in PaCO2 (3.5 mmHg), [HCO3]p (2 meq/liter), and net acid excretion (2 meq/h) occurred in the first 4-6 days of the luteal phase (14 days long). Following this, net acid excretion returned to the preovulatory level. PaCO2 and [HCO3]p, however, remained decreased for 3 more days. At the end of the luteal phase, restoration of PaCO2 proceeded faster than that of [HCO3]p. The acid-base changes in blood and urine observed during the luteal phase were comparable to those occurring during adaptation and recovery from sustained hypocapnia, suggesting that hypocapnia during the luteal phase is primarily respiratory in origin.

  9. Disparate Regulatory Mechanisms Control Fat3 and P75NTR Protein Transport through a Conserved Kif5-Interaction Domain

    PubMed Central

    Birkness, Jacqueline E.; Trinidad, Jonathan C.

    2016-01-01

    Directed transport delivers proteins to specific cellular locations and is one mechanism by which cells establish and maintain polarized cellular architectures. The atypical cadherin Fat3 directs the polarized extension of dendrites in retinal amacrine cells by influencing the distribution of cytoskeletal regulators during retinal development, however the mechanisms regulating the distribution of Fat3 remain unclear. We report a novel Kinesin/Kif5 Interaction domain (Kif5-ID) in Fat3 that facilitates Kif5B binding, and determines the distribution of Fat3 cytosolic domain constructs in neurons and MDCK cells. The Kif5-ID sequence is conserved in the neurotrophin receptor P75NTR, which also binds Kif5B, and Kif5-ID mutations similarly result in P75NTR mislocalization. Despite these similarities, Kif5B-mediated protein transport is differentially regulated by these two cargos. For Fat3, the Kif5-ID is regulated by alternative splicing, and the timecourse of splicing suggests that the distribution of Fat3 may switch between early and later stages of retinal development. In contrast, P75NTR binding to Kif5B is enhanced by tyrosine phosphorylation and thus has the potential to be dynamically regulated on a more rapid time scale. PMID:27788242

  10. Transcriptomes reveal the genetic mechanisms underlying ionic regulatory adaptations to salt in the crab-eating frog

    PubMed Central

    Shao, Yong; Wang, Li-Jun; Zhong, Li; Hong, Mei-Ling; Chen, Hong-Man; Murphy, Robert W.; Wu, Dong-Dong; Zhang, Ya-Ping; Che, Jing

    2015-01-01

    The crab-eating frog, Fejervarya cancrivora, is the only frog that lives near seas. It tolerates increased environmental concentrations of sodium, chloride and potassium partly by raising ion and urea levels in its blood plasma. The molecular mechanism of the adaptation remains rarely documented. Herein, we analyze transcriptomes of the crab-eating frog and its closely related saline-intolerant species, F. limnocharis, to explore the molecular basis of adaptations to such extreme environmental conditions. Analyses reveal the potential genetic mechanism underlying the adaptation to salinity for the crab-eating frog. Genes in categories associated with ion transport appear to have evolved rapidly in F. cancrivora. Both positively selected and differentially expressed genes exhibit enrichment in the GO category regulation of renal sodium excretion. In this category, the positively selected sites of ANPEP and AVPR2 encode CD13 and V2 receptors, respectively; they fall precisely on conserved domains. More differentially expressed rapidly evolved genes occur in the kidney of F. cancrivora than in F. limnocharis. Four genes involved in the regulation of body fluid levels show signs of positive selection and increased expression. Significant up-regulation occurs in several genes of F. cancrivora associated with renin-angiotensin system and aldosterone-regulated sodium reabsorption pathways, which relate to osmotic regulation. PMID:26619819

  11. Complementary vascular and matrix regulatory pathways underlie the beneficial mechanism of action of sorafenib in liver fibrosis

    PubMed Central

    Thabut, Dominique; Routray, Chittaranjan; Lomberk, Gwen; Shergill, Uday; Glaser, Kevin; Huebert, Robert; Patel, Leena; Masyuk, Tetyana; Blechacz, Boris; Vercnocke, Andrew; Ritman, Erik; Ehman, Richard; Urrutia, Raul; Shah, Vijay

    2011-01-01

    Background Paracrine signaling between hepatic stellate cells (HSC) and liver endothelial cells (LEC) modulates fibrogenesis, angiogenesis, and portal hypertension. However, mechanisms regulating these processes are not fully defined. Sorafenib is a receptor tyrosine kinase inhibitor that blocks growth factor signaling in tumor cells but also displays important and not yet fully characterized effects on liver nonparenchymal cells including HSC and LEC. The aim of this study was to test the hypothesis that sorafenib influences paracrine signaling between HSC and LEC and thereby regulates matrix and vascular changes associated with chronic liver injury. Results Complementary magnetic resonance elastography, micro-CT, and histochemical analyses indicate that sorafenib attenuates the changes in both matrix and vascular compartments that occur in response to bile-duct ligation induced liver injury in rats. Cell biology studies demonstrate that sorafenib markedly reduces cell to cell apposition and junctional complexes, thus reducing the proximity typically observed between these sinusoidal barrier cells. At the molecular level, sorafenib down-regulates angiopoietin-1 and fibronectin, both released by HSC in a manner dependent on the transcription factor KLF6, suggesting that this pathway underlies both matrix and vascular changes associated with chronic liver disease. Conclusion Collectively, our results demonstrate that sorafenib inhibits both matrix restructuring and vascular remodeling that accompany chronic liver diseases and characterize cell and molecular mechanisms underlying this effect. These data may help to refine future therapies for advanced gastrointestinal and liver diseases characterized by abundant fibrosis and neovascularization. PMID:21567441

  12. Complementary transcriptomic and proteomic analyses reveal regulatory mechanisms of milk protein production in dairy cows consuming different forages

    PubMed Central

    Dai, Wenting; Chen, Qiong; Wang, Quanjuan; White, Robin R.; Liu, Jianxin; Liu, Hongyun

    2017-01-01

    Forage plays a critical role in the milk production of dairy cows; however, the mechanisms regulating bovine milk synthesis in dairy cows fed high forage rations with different basal forage types are not well-understood. In the study, rice straw (RS, low-quality) and alfalfa hay (AH, high-quality) diets were fed to lactating cows to explore how forage quality affected the molecular mechanisms regulating milk production using RNA-seq transcriptomic method with iTRAQ proteomic technique. A total of 554 transcripts (423 increased and 131 decreased) and 517 proteins (231 up-regulated and 286 down-regulated) were differentially expressed in the mammary glands of the two groups. The correlation analysis demonstrated seven proteins (six up-regulated and one down-regulated) had consistent mRNA expression. Functional analysis of the differentially expressed transcripts/proteins suggested that enhanced capacity for energy and fatty acid metabolism, increased protein degradation, reduced protein synthesis, decreased amino acid metabolism and depressed cell growth were related to RS consumption. The results indicated cows consuming RS diets may have had depressed milk protein synthesis because these animals had decreased capacity for protein synthesis, enhanced proteolysis, inefficient energy generation and reduced cell growth. Additional work evaluating RS- and AH-based rations may help better isolate molecular adaptations to low nutrient availability during lactation. PMID:28290485

  13. Subchromoplast Sequestration of Carotenoids Affects Regulatory Mechanisms in Tomato Lines Expressing Different Carotenoid Gene Combinations[C][W

    PubMed Central

    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M.A.; Bramley, Peter M.; Fraser, Paul D.

    2013-01-01

    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed. PMID:24249831

  14. First Insights into the Subterranean Crustacean Bathynellacea Transcriptome: Transcriptionally Reduced Opsin Repertoire and Evidence of Conserved Homeostasis Regulatory Mechanisms

    PubMed Central

    Kim, Bo-Mi; Kang, Seunghyun; Ahn, Do-Hwan; Kim, Jin-Hyoung; Ahn, Inhye; Lee, Chi-Woo; Cho, Joo-Lae; Min, Gi-Sik; Park, Hyun

    2017-01-01

    Bathynellacea (Crustacea, Syncarida, Parabathynellidae) are subterranean aquatic crustaceans that typically inhabit freshwater interstitial spaces (e.g., groundwater) and are occasionally found in caves and even hot springs. In this study, we sequenced the whole transcriptome of Allobathynella bangokensis using RNA-seq. De novo sequence assembly produced 74,866 contigs including 28,934 BLAST hits. Overall, the gene sequences were most similar to those of the waterflea Daphnia pulex. In the A. bangokensis transcriptome, no opsin or related sequences were identified, and no contig aligned to the crustacean visual opsins and non-visual opsins (i.e. arthropsins, peropsins, and melaopsins), suggesting potential regressive adaptation to the dark environment. However, A. bangokensis expressed conserved gene family sets, such as heat shock proteins and those related to key innate immunity pathways and antioxidant defense systems, at the transcriptional level, suggesting that this species has evolved adaptations involving molecular mechanisms of homeostasis. The transcriptomic information of A. bangokensis will be useful for investigating molecular adaptations and response mechanisms to subterranean environmental conditions. PMID:28107438

  15. Depletion of Foxp3+ regulatory T cells increases severity of mechanical allodynia and significantly alters systemic cytokine levels following peripheral nerve injury.

    PubMed

    Lees, Justin G; Duffy, Samuel S; Perera, Chamini J; Moalem-Taylor, Gila

    2015-02-01

    Neuropathic pain is a debilitating condition caused by damage to the somatosensory nervous system, such as peripheral nerve injury. The immune system, and in particular the adaptive T cell response, plays a key role in mediating such pain. Regulatory T (Treg) cells are a small subpopulation of inhibitory T cells that prevent autoimmunity, limit immunopathology and maintain immune homeostasis. Here, we investigated the effects of conditional depletion of Treg cells on mechanical allodynia and serum cytokines in mice with chronic constriction injury (CCI) of the sciatic nerve, an animal model of neuropathic pain. We demonstrate that CCI induced the infiltration of small numbers of Treg cells within effected neuronal tissue. Utilising the transgenic DEREG (DEpletion of REGulatory T cells) mice, we confirmed effective depletion of Foxp3+ Treg cells by diphtheria toxin injections. Following CCI we observed a transient, though significant, increase in pain hypersensitivity for Treg-depleted DEREG mice compared to non-Treg-depleted mice. Analysis of systemic cytokine levels demonstrated significant changes in serum cytokine expression profiles. In particular, we observed significant increases in systemic concentration of RANTES, IL-2 and IL-5, and significant decreases in IL-12 and IFN-γ in nerve-injured Treg-depleted DEREG mice. Further analysis indicated a substantial increase in the serum concentration of IL-12p40 as a direct result of Treg cell depletion. These results suggest that depletion of Foxp3+ Treg cells promote nerve injury-induced pain hypersensitivity, partially by inducing altered systemic concentrations of cytokines, which may act to regulate neuropathic pain.

  16. Regulatory mechanisms of cAMP levels as a multiple target for antiplatelet activity and less bleeding risk.

    PubMed

    Fuentes, Eduardo; Palomo, Iván

    2014-08-01

    Platelet activation is a critical component of atherothrombosis. The multiple pathways of platelet activation limit the effect of specific receptor/pathway inhibitors, resulting in limited clinical efficacy. Recent research has confirmed that combination therapy results in enhanced antithrombotic efficacy without increasing bleeding risk. In this way, the best-known inhibitor and turn off signaling in platelet activation is cAMP. In this article we discuss the mechanisms of regulation of intraplatelet cAMP levels, a) platelet-dependent pathway: Gi/Gs protein-coupled receptors, phosphodiesterase inhibition and activation of PPARs and b) platelet-independent pathway: inhibition of adenosine uptake by erythrocytes. With respect to the association between intraplatelet cAMP levels and bleeding risk it is possible to establish that compounds/drugs with pleitropic effect for increased intraplatelet cAMP level could have an antithrombotic activity with less risk of bleeding.

  17. GTP cyclohydrolase I inhibition by the prototypic inhibitor 2, 4-diamino-6-hydroxypyrimidine. Mechanisms and unanticipated role of GTP cyclohydrolase I feedback regulatory protein.

    PubMed

    Xie, L; Smith, J A; Gross, S S

    1998-08-14

    2,4-Diamino-6-hydroxypyrimidine (DAHP) is considered to be a selective and direct-acting inhibitor of GTP cyclohydrolase I (GTPCH), the first and rate-limiting enzyme in the pathway for synthesis of tetrahydrobiopterin (BH4). Accordingly, DAHP has been widely employed to distinguish whether de novo BH4 synthesis is required in a given biological system. Although it has been assumed that DAHP inhibits GTPCH by direct competition with substrate GTP, this has never been formally demonstrated. In view of apparent structural homology between DAHP and BH4, we questioned whether DAHP may mimic BH4 in its inhibition of GTPCH by an indirect mechanism, involving interaction with a recently cloned 9.5-kDa protein termed GTPCH Feedback Regulatory Protein (GFRP). We show by reverse transcription-polymerase chain reaction that GFRP mRNA is constitutively expressed in rat aortic smooth muscle cells and further induced by treatment with immunostimulants. Moreover, functional GFRP is expressed and immunostimulant-induced BH4 accumulates in sufficient quantity to trigger feedback inhibition of GTPCH. Studies with DAHP reveal that GFRP is also essential to achieve potent inhibition of GTPCH. Indeed, DAHP inhibits GTPCH by dual mechanisms. At a relatively low concentration, DAHP emulates BH4 and engages the GFRP-dependent feedback inhibitory system; at higher concentrations, DAHP competes directly for binding with GTP substrate. This knowledge predicts that DAHP would preferably target GTPCH in tissues with abundant GFRP.

  18. Histone Deacetylases 6 and 9 and Sirtuin-1 Control Foxp3+ Regulatory T Cell Function Through Shared and Isotype-Specific Mechanisms

    PubMed Central

    Beier, Ulf H.; Wang, Liqing; Han, Rongxiang; Akimova, Tatiana; Liu, Yujie; Hancock, Wayne W.

    2013-01-01

    Therapeutic targeting of histone/protein deacetylase 6 (HDAC6), HDAC9, or the sirtuin-1 (Sirt1) augments the suppressive functions of regulatory T cells (Tregs) that contain the transcription factor Foxp3. However, it is unclear whether distinct mechanisms are involved or whether combined inhibition of these targets would be more beneficial. We compared the suppressive functions of Tregs from wild-type C57BL/6 mice with those from mice with either global (HDAC6−/−, HDAC9−/−, and HDAC6−/−HDAC9−/−), or conditional (fl-Sirt1/CD4-Cre or fl-Sirt1/Foxp3-Cre) HDAC deletion, as well as treatment with isoform-selective HDAC inhibitors. We found that the heat shock response was important for the improvement of Treg suppressive function mediated by HDAC6 inhibition, but not Sirt1 inhibition. Furthermore, although HDAC6, HDAC9, and Sirt1 all deacetylated Foxp3, each protein had diverse effects on transcription factors controlling Foxp3 gene expression. For example, loss of HDAC9 was associated with stabilization of the acetylation of signal transducer and activator of transcription 5 (STAT5) and of its transcriptional activity. Hence, targeting different HDACs increased Treg function by multiple and additive mechanisms, which indicates the therapeutic potential for combinations of HDAC inhibitors in the management of autoimmunity and organ transplantation. PMID:22715468

  19. A novel regulatory mechanism of the mitochondrial Ca2+ uniporter revealed by the p38 mitogen-activated protein kinase inhibitor SB202190.

    PubMed

    Montero, Mayte; Lobaton, Carmen D; Moreno, Alfredo; Alvarez, Javier

    2002-12-01

    It is widely acknowledged that mitochondrial Ca2+ uptake modulates the cytosolic [Ca2+] ([Ca2+]c) acting as a transient Ca2+ buffer. In addition, mitochondrial [Ca2+] ([Ca2+]M) regulates the rate of respiration and may trigger opening of the permeability transition pore and start apoptosis. However, no mechanism for the physiological regulation of mitochondrial Ca2+ uptake has been described. We show here that SB202190, an inhibitor of p38 mitogen-activated protein (MAP) kinase, strongly stimulates ruthenium red-sensitive mitochondrial Ca2+ uptake, both in intact and in permeabilized HeLa cells. The [Ca2+]M peak induced by agonists was increased about fourfold in the presence of the inhibitor, with a concomitant reduction in the [Ca2+]c peak. The stimulation occurred fast and was rapidly reversible. In addition, experiments in permeabilized cells perfused with controlled [Ca2+] showed that SB202190 stimulated mitochondrial Ca2+ uptake by more than 10-fold, but only in the physiological [Ca2+]c range (1-4 mM). Other structurally related p38 MAP kinase inhibitors (SB203580, PD169316, or SB220025) produced little or no effect. Our data suggest that in HeLa cells, a protein kinase sensitive to SB202190 tonically inhibits the mitochondrial Ca2+ uniporter. This novel regulatory mechanism may be of paramount importance to modulate mitochondrial Ca2+ uptake under different physiopathological conditions.

  20. Insights into the mechanism of FTY720 and compatibility with regulatory T cells for the inhibition of graft-versus-host disease (GVHD).

    PubMed

    Taylor, Patricia A; Ehrhardt, Michael J; Lees, Christopher J; Tolar, Jakub; Weigel, Brenda J; Panoskaltsis-Mortari, Angela; Serody, Jonathan S; Brinkmann, Volker; Blazar, Bruce R

    2007-11-01

    The immunomodulator FTY720 (FTY) has been shown to be beneficial in experimental models of organ transplantation and autoimmunity. We show that FTY significantly inhibited but did not prevent graft-versus-host disease (GVHD) in lethally irradiated or nonirradiated allogeneic recipients. Although most studies implicate prevention of lymphocyte egress from lymphoid organs as the primary mechanism of action, our data indicate that FTY effects on the host are more likely to be responsible for GVHD inhibition. FTY reduced splenic CD11c+ cells by 50%, and similarly reduced CD4+ and CD8+ T-cell responder frequencies in the spleen early after transplantation. Imaging of GFP+ effectors indicated that FTY modified donor effector T-cell migration to secondary lymphoid organs, but did not uniformly trap T cells in lymph nodes or prevent early effector migration to GVHD parenchymal target organs. Administration of FTY only prior to transplantation inhibited GVHD, indicating that the primary function of FTY may be targeted to host cells. FTY was additive with regulatory T cells for GVHD inhibition. FTY slightly impaired but did not abrogate a graft-versus-leukemia (GVL) effect against C1498, a myeloid leukemia. Our data further define the mechanisms of action and provide insight as to the potential clinical uses of FTY in allogeneic bone marrow transplant recipients.

  1. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences.

    PubMed

    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M; Puisieux, Alain; Payen, Léa

    2016-06-20

    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers.

  2. Studies on the regulatory effect of Peony-Glycyrrhiza Decoction on prolactin hyperactivity and underlying mechanism in hyperprolactinemia rat model.

    PubMed

    Wang, Di; Wang, Wei; Zhou, Yulin; Wang, Juan; Jia, Dongxu; Wong, Hei Kiu; Zhang, Zhang-Jin

    2015-10-08

    Clinical trials have demonstrated the beneficial effects of Peony-Glycyrrhiza Decoction (PGD) in alleviating antipsychotic-induced hyperprolactinemia (hyperPRL) in schizophrenic patients. In previous experiment, PGD suppressed prolactin (PRL) level in MMQ cells, involving modulating the expression of D2 receptor (DRD2) and dopamine transporter (DAT). In the present study, hyperPRL female rat model induced by dopamine blocker metoclopramide (MCP) was applied to further confirm the anti-hyperpPRL activity of PGD and underlying mechanism. In MCP-induced hyperPRL rats, the elevated serum PRL level was significantly suppressed by either PGD (2.5-10 g/kg) or bromocriptine (BMT) (0.6 mg/kg) administration for 14 days. However, in MCP-induced rats, only PGD restored the under-expressed serum progesterone (P) to control level. Both PGD and BMT administration restore the under-expression of DRD2, DAT and TH resulted from MCP in pituitary gland and hypothalamus. Compared to untreated group, hyperPRL animals had a marked reduction on DRD2 and DAT expression in the arcuate nucleus. PGD (10 g/kg) and BMT (0.6 mg/kg) treatment significant reversed the expression of DRD2 and DAT. Collectively, the anti-hyperPRL activity of PGD associates with the modulation of dopaminergic neuronal system and the restoration of serum progesterone level. Our finding supports PGD as an effective agent against hyperPRL.

  3. Genetic and regulatory mechanism of susceptibility to high-hyperdiploid acute lymphoblastic leukaemia at 10p21.2

    PubMed Central

    Studd, James B.; Vijayakrishnan, Jayaram; Yang, Minjun; Migliorini, Gabriele; Paulsson, Kajsa; Houlston, Richard S.

    2017-01-01

    Despite high-hyperdiploid acute lymphoblastic leukaemia (HD-ALL) being the most common subgroup of paediatric ALL, its aetiology remains unknown. Genome-wide association studies have demonstrated association at 10q21.2. Here, we sought to determine how this region influences HD-ALL risk. We impute genotypes across the locus, finding the single nucleotide polymorphism rs7090445 highly associated with HD-ALL (P=1.54 × 10−38), and residing in a predicted enhancer element. We show this region physically interacts with the transcription start site of ARID5B, that alleles of rs7090445 have differential enhancer activity and influence RUNX3 binding. RUNX3 knock-down reduces ARID5B expression and rs7090445 enhancer activity. Individuals carrying the rs7090445-C risk allele also have reduced ARID5B expression. Finally, the rs7090445-C risk allele is preferentially retained in HD-ALL blasts consistent with inherited genetic variation contributing to arrest of normal lymphocyte development, facilitating leukaemic clonal expansion. These data provide evidence for a biological mechanism underlying hereditary risk of HD-ALL at 10q21.2. PMID:28256501

  4. Thermal clamping of temperature-regulating flowers reveals the precision and limits of the biochemical regulatory mechanism.

    PubMed

    Seymour, Roger S; Lindshau, Gemma; Ito, Kikukatsu

    2010-05-01

    The flowers of several families of seed plants warm themselves when they bloom. In some species, thermogenesis is regulated, increasing the rate of respiration at lower ambient temperature (T (a)) to maintain a somewhat stable floral temperature (T (f)). The precision of this regulation is usually measured by plotting T (f) over T (a). However, such measurements are influenced by environmental conditions, including wind speed, humidity, radiation, etc. This study eliminates environmental effects by experimentally 'clamping' T (f) at constant, selected levels and then measuring stabilized respiration rate. Regulating flowers show decreasing respiration with rising T (f) (Q (10) < 1). Q (10) therefore becomes a measure of the biochemical 'precision' of temperature regulation: lower Q (10) values indicate greater sensitivity of respiration to T (f) and a narrower range of regulated temperatures. At the lower end of the regulated range, respiration is maximal, and further decreases in floral temperature cause heat production to diminish. Below a certain tissue temperature ('switching temperature'), heat loss always exceeds heat production, so thermoregulation becomes impossible. This study compared three species of thermoregulatory flowers with distinct values of precision and switching temperature. Precision was highest in Nelumbo nucifera (Q (10) = 0.16) moderate in Symplocarpus renifolius (Q (10) = 0.48) and low in Dracunculus vulgaris (Q (10) = 0.74). Switching temperatures were approximately 30, 15 and 20 degrees C, respectively. There were no relationships between precision, switching temperature or maximum respiration rate. High precision reveals a powerful inhibitory mechanism that overwhelms the tendency of temperature to increase respiration. Variability in the shape and position of the respiration-temperature curves must be accounted for in any explanation of the control of respiration in thermoregulatory flowers.

  5. S-nitrosation of β-catenin and p120 catenin: a novel regulatory mechanism in endothelial hyperpermeability

    PubMed Central

    Marín, N.; Zamorano, P.; Carrasco, R.; Mujica, P.; González, FG.; Quezada, C.; Meininger, CJ.; Boric, MP.; Durán, WN.; Sánchez, FA.

    2014-01-01

    Rationale Endothelial adherens junction proteins constitute an important element in the control of microvascular permeability. Platelet-activating factor (PAF) increases permeability to macromolecules via translocation of eNOS to cytosol and stimulation of eNOS-derived NO signaling cascade. The mechanisms by which NO signaling regulates permeability at adherens junctions are still incompletely understood. Objective We explored the hypothesis that PAF stimulates hyperpermeability via S-nitrosation (SNO) of adherens junction proteins. Methods and Results We measured PAF-stimulated S-nitrosation of β-catenin and p120-catenin (p120) in three cell lines: ECV-eNOSGFP, EAhy926 (derived from human umbilical vein) and CVEC (derived from bovine heart endothelium) and in the mouse cremaster muscle in vivo. SNO correlated with diminished abundance of β-catenin and p120 at the adherens junction and with hyperpermeability. TNF-α increased NO production and caused similar increase in S-nitrosation as PAF. To ascertain the importance of eNOS subcellular location in this process, we used ECV-304 cells transfected with cytosolic eNOS (GFPeNOSG2A) and plasma membrane eNOS (GFPeNOSCAAX). PAF induced S-nitrosation of β-catenin and p120 and significantly diminished association between these proteins in cells with cytosolic eNOS but not in cells wherein eNOS is anchored to the cell membrane. Inhibitors of NO production and of S-nitrosation blocked PAF-induced S-nitrosation and hyperpermeability whereas inhibition of the cGMP pathway had no effect. Mass spectrometry analysis of purified p120 identified cysteine 579 as the main S-nitrosated residue in the region that putatively interacts with VE-cadherin. Conclusions Our results demonstrate that agonist-induced SNO contributes to junctional membrane protein changes that enhance endothelial permeability. PMID:22777005

  6. Defects in the regulatory clearance mechanisms favor the breakdown of self-tolerance during spontaneous autoimmune orchitis.

    PubMed

    Pelletier, R-Marc; Yoon, Suk Ran; Akpovi, Casimir D; Silvas, Emil; Vitale, María Leiza

    2009-03-01

    We identified aberrations leading to spontaneous autoimmune orchitis (AIO) in mink, a seasonal breeder and natural model for autoimmunity. This study provides evidence favoring the view that a malfunction of the clearance mechanisms for apoptotic cell debris arising from imbalances in phagocyte receptors or cytokines acting on Sertoli cells constitutes a major factor leading to breakdown of self-tolerance during spontaneous AIO. Serum anti-sperm antibody titers measured by ELISA reflected spermatogenic activity without causing immune inflammatory responses. Orchitic mink showed excess antibody production accompanied by spermatogenic arrest, testicular leukocyte infiltration, and infertility. AIO serum labeled the postacrosomal region, the mid and end piece of mink sperm, whereas normal mink serum did not. Normal serum labeled plasma membranes, whereas AIO serum reacted with germ cell nuclei. Western blot analyses revealed that AIO serum reacted specifically to a 23- and 50-kDa protein. The number of apostain-labeled apoptotic cells was significantly higher in orchitic compared with normal tubules. However, apoptosis levels measured by ELISA in seminiferous tubular fractions (STf) were not significantly different in normal and orchitic tubules. The levels of CD36, TNF-alpha, TNF-alpha RI, IL-6, and Fas but not Fas-ligand (L), and ATP-binding cassette transporter ABCA1 were changed in AIO STf. TNF-alpha and IL-6 serum levels were increased during AIO. Fas localized to germ cells, Sertoli cells, and the lamina propria of the tubules and Fas-L, to germ cells. Fas colocalized with Fas-L in residual bodies in normal testis and in giant cells and infiltrating leukocytes in orchitic tubules.

  7. Lycopene treatment against loss of bone mass, microarchitecture and strength in relation to regulatory mechanisms in a postmenopausal osteoporosis model.

    PubMed

    Ardawi, Mohammed-Salleh M; Badawoud, Mohammed H; Hassan, Sherif M; Rouzi, Abdulrahim A; Ardawi, Jumanah M S; AlNosani, Nouf M; Qari, Mohammed H; Mousa, Shaker A

    2016-02-01

    Lycopene supplementation decreases oxidative stress and exhibits beneficial effects on bone health, but the mechanisms through which it alters bone metabolism in vivo remain unclear. The present study aims to evaluate the effects of lycopene treatment on postmenopausal osteoporosis. Six-month-old female Wistar rats (n=264) were sham-operated (SHAM) or ovariectomized (OVX). The SHAM group received oral vehicle only and the OVX rats were randomized into five groups receiving oral daily lycopene treatment (mg/kg body weight per day): 0 OVX (control), 15 OVX, 30 OVX, and 45 OVX, and one group receiving alendronate (ALN) (2μg/kg body weight per day), for 12weeks. Bone densitometry measurements, bone turnover markers, biomechanical testing, and histomorphometric analysis were conducted. Micro computed tomography was also used to evaluate changes in microarchitecture. Lycopene treatment suppressed the OVX-induced increase in bone turnover, as indicated by changes in biomarkers of bone metabolism: serum osteocalcin (s-OC), serum N-terminal propeptide of type 1 collagen (s-PINP), serum crosslinked carboxyterminal telopeptides (s-CTX-1), and urinary deoxypyridinoline (u-DPD). Significant improvement in OVX-induced loss of bone mass, bone strength, and microarchitectural deterioration was observed in lycopene-treated OVX animals. These effects were observed mainly at sites rich in trabecular bone, with less effect in cortical bone. Lycopene treatment down-regulated osteoclast differentiation concurrent with up-regulating osteoblast together with glutathione peroxidase (GPx) catalase (CAT) and superoxide dismutase (SOD) activities. These findings demonstrate that lycopene treatment in OVX rats primarily suppressed bone turnover to restore bone strength and microarchitecture.

  8. A Novel Regulatory Mechanism of Type II Collagen Expression via a SOX9-dependent Enhancer in Intron 6.

    PubMed

    Yasuda, Hideyo; Oh, Chun-do; Chen, Di; de Crombrugghe, Benoit; Kim, Jin-Hoi

    2017-01-13

    Type II collagen α1 is specific for cartilaginous tissues, and mutations in its gene are associated with skeletal diseases. Its expression has been shown to be dependent on SOX9, a master transcription factor required for chondrogenesis that binds to an enhancer region in intron 1. However, ChIP sequencing revealed that SOX9 does not strongly bind to intron 1, but rather it binds to intron 6 and a site 30 kb upstream of the transcription start site. Here, we aimed to determine the role of the novel SOX9-binding site in intron 6. We prepared reporter constructs that contain a Col2a1 promoter, intron 1 with or without intron 6, and the luciferase gene. Although the reporter constructs were not activated by SOX9 alone, the construct that contained both introns 1 and 6 was activated 5-10-fold by the SOX9/SOX5 or the SOX9/SOX6 combination in transient-transfection assays in 293T cells. This enhancement was also observed in rat chondrosarcoma cells that stably expressed the construct. CRISPR/Cas9-induced deletion of intron 6 in RCS cells revealed that a 10-bp region of intron 6 is necessary both for Col2a1 expression and SOX9 binding. Furthermore, SOX9, but not SOX5, binds to this region as demonstrated in an electrophoretic mobility shift assay, although both SOX9 and SOX5 bind to a larger 325-bp fragment of intron 6 containing this small sequence. These findings suggest a novel mechanism of action of SOX5/6; namely, the SOX9/5/6 combination enhances Col2a1 transcription through a novel enhancer in intron 6 together with the enhancer in intron 1.

  9. Antigen- and receptor-driven regulatory mechanisms. I. Induction of suppressor T cells with anti-idiotypic antibodies

    PubMed Central

    1979-01-01

    Delayed-type hypersensitivity (DTH) to the azobenzenearsonate (ABA) hapten can be readily induced in A/J mice injecting ABA-coupled syngeneic spleen cells subcutaneously. To further characterize this T- cell-dependent immunological phenomenon, the effect of passively administered anti-cross-reactive idiotype common to anti-ABA antibodies of A/J mice (CRI) antibodies on the development of ABA-specific DTH was investigated. Animals given daily injections (of minute amounts) of anti-CRI antibodies subsequent to immunization with ABA-coupled cells show significant reduction of ABA specific responses. This inhibition is antigen specific and requires the intact immunoglobulin molecule, as F(ab')2 treatments were ineffective in suppressing the reaction. Investigations of the mechanism of the anti-CRI-induced suppression of ABA DTH revealed that the observed suppression is a result of the activation of suppressor cells. Spleen cells taken from animals which received anti-CRI antibodies were able to adoptively transfer suppression to naive recipients. This suppression was shown to be mediated by T cells, as anti-Thy1.2 plus complement completely abrogated the transfer of suppression. In addition, animals pretreated with low doses of cyclophosphamide were not suppressed by the administration of anti-CRI antibodies. The genetic restriction of anti- CRI-induced suppression was demonstrated. Antibodies to the major cross- reactive idiotype, (CRI) associated with anti-ABA antibodies in A/J mice were unable to suppress the development of DTH to ABA in BALB/c mice (H-2d, Igh-1a). Such antibodies were, however, fully active in suppressing ABA DTH in the allotype-congenic C.AL-20 strain which has an allotype (Igh-1d) similar to that of A/J (Igh-1e) on a BALB/c background, and which produces humoral antibodies with the CRI. PMID:91656

  10. Regulatory mechanisms of interleukin-8 production induced by tumour necrosis factor-α in human hepatocellular carcinoma cells

    PubMed Central

    Wang, Yaohui; Wang, Weimin; Wang, Lingyan; Wang, Xiangdong; Xia, Jinglin

    2012-01-01

    Abstract Interleukin (IL)-8 plays the critical role in the initiation of micro-environmental inflammation responsible for tumour growth and patient prognosis. This study aimed at investigating the molecular mechanisms of IL-8 production from human hepatocellular carcinoma (HCC) cells. The levels of IL-8 and phosphorylation of p38 mitogen-activated protein kinase (MAPK), ERK1/2 and Akt in MHCC-97H cells were measured by ELISA, Western blot and immunofluorescence. NF-κB p65 protein nuclear translocation was determined by non-radioactive NF-κB p50/p65 transcription factor activity kit and cell bio-behaviours were detected by the real-time cell-monitoring system. Tumour necrosis factor-α (TNF-α) significantly induced phosphorylation of p38 MAPK, ERK, Akt and production of IL-8 from HCC cells, which were prevented by SB203580 (p38 MAPK inhibitor), PD98059 (ERK inhibitor), LY294002 and Wortmannin (PI3K inhibitor) and SB328437 (CCR3 inhibitor). TNF-α could significantly increase the translocation of NF-κB p65 protein into the nucleus in a dose-dependent manner, while SB203580 partially inhibited. In inflammatory micro-environment, HCC auto-produced IL-8 through p38 MAPK, ERK and PI3K/Akt signalling pathways, where the p38 MAPK is a central factor to activate the NF-κB pathway and regulate the expression of IL-8 production. There was a potential cross-talking between receptors. PMID:21545687

  11. Identification of a Novel Regulatory Mechanism of Nutrient Transport Controlled by TORC1-Npr1-Amu1/Par32

    PubMed Central

    Boeckstaens, Mélanie; Merhi, Ahmad; Llinares, Elisa; Van Vooren, Pascale; Springael, Jean-Yves; Wintjens, René; Marini, Anna Maria

    2015-01-01

    Fine-tuning the plasma-membrane permeability to essential nutrients is fundamental to cell growth optimization. Nutritional signals including nitrogen availability are integrated by the TORC1 complex which notably regulates arrestin-mediated endocytosis of amino-acid transporters. Ammonium is a ubiquitous compound playing key physiological roles in many, if not all, organisms. In yeast, it is a preferred nitrogen source transported by three Mep proteins which are orthologues of the mammalian Rhesus factors. By combining genetic, kinetic, biochemical and cell microscopy analyses, the current study reveals a novel mechanism enabling TORC1 to regulate the inherent activity of ammonium transport proteins, independently of arrestin-mediated endocytosis, identifying the still functional orphan Amu1/Par32 as a selective regulator intermediate. We show that, under poor nitrogen supply, the TORC1 effector kinase' Npr1' promotes phosphorylation of Amu1/Par32 which appears mainly cytosolic while ammonium transport proteins are active. Upon preferred nitrogen supplementation, like glutamine or ammonium addition, TORC1 upregulation enables Npr1 inhibition and Amu1/Par32 dephosphorylation. In these conditions, as in Npr1-lacking cells, hypophosphorylated Amu1/Par32 accumulates at the cell surface and mediates the inhibition of specific ammonium transport proteins. We show that the integrity of a conserved repeated motif of Amu1/Par32 is required for the interaction with these transport proteins. This study underscores the diversity of strategies enabling TORC1-Npr1 to selectively monitor cell permeability to nutrients by discriminating between transporters to be degraded or transiently inactivated and kept stable at the plasma membrane. This study further identifies the function of Amu1/Par32 in acute control of ammonium transport in response to variations in nitrogen availability. PMID:26172854

  12. Regulatory Dendritic Cells Restrain NK Cell IFN-γ Production through Mechanisms Involving NKp46, IL-10, and MHC Class I-Specific Inhibitory Receptors.

    PubMed

    Spallanzani, Raúl G; Torres, Nicolás I; Avila, Damián E; Ziblat, Andrea; Iraolagoitia, Ximena L Raffo; Rossi, Lucas E; Domaica, Carolina I; Fuertes, Mercedes B; Rabinovich, Gabriel A; Zwirner, Norberto W

    2015-09-01

    Cross-talk between mature dendritic cells (mDC) and NK cells through the cell surface receptors NKp30 and DNAM-1 leads to their reciprocal activation. However, the impact of regulatory dendritic cells (regDC) on NK cell function remains unknown. As regDC constrain the immune response in different physiological and pathological conditions, the aim of this work was to investigate the functional outcome of the interaction between regDC and NK cells and the associated underlying mechanisms. RegDC generated from monocyte-derived DC treated either with LPS and dexamethasone, vitamin D3, or vitamin D3 and dexamethasone instructed NK cells to secrete lower amounts of IFN-γ than NK cells exposed to mDC. Although regDC triggered upregulation of the activation markers CD69 and CD25 on NK cells, they did not induce upregulation of CD56 as mDC, and silenced IFN-γ secretion through mechanisms involving insufficient secretion of IL-18, but not IL-12 or IL-15 and/or induction of NK cell apoptosis. Blocking experiments demonstrated that regDC curb IFN-γ secretion by NK cells through a dominant suppressive mechanism involving IL-10, NK cell inhibitory receptors, and, unexpectedly, engagement of the activating receptor NKp46. Our findings unveil a previously unrecognized cross-talk through which regDC shape NK cell function toward an alternative activated phenotype unable to secrete IFN-γ, highlighting the plasticity of NK cells in response to tolerogenic stimuli. In addition, our findings contribute to identify a novel inhibitory role for NKp46 in the control of NK cell function, and have broad implications in the resolution of inflammatory responses and evasion of antitumor responses.

  13. Differential response of regulatory and conventional CD4⁺ lymphocytes to CD3 engagement: clues to a possible mechanism of anti-CD3 action?

    PubMed

    Li, Li; Nishio, Junko; van Maurik, André; Mathis, Diane; Benoist, Christophe

    2013-10-01

    Several clinical trials have shown anti-CD3 treatment to be a promising therapy for autoimmune diabetes, but its mechanism of action remains unclear. Foxp3(+) regulatory T cells (Tregs) are likely to be involved, but through unknown mechanistic pathways. We profiled the transcriptional consequences in CD4(+) Tregs and conventional T cells (Tconvs) in the first hours and days after anti-CD3 treatment of NOD mice. Anti-CD3 treatment led to a transient transcriptional response, terminating faster than most Ag-induced responses. Most transcripts were similarly induced in Tregs and Tconvs, but several were differential, in particular, those encoding the IL-7R and transcription factors Id2/3 and Gfi1, upregulated in Tregs but repressed in Tconvs. Because IL-7R was a plausible candidate for driving the homeostatic response of Tregs to anti-CD3, we tested its relevance by supplementation of anti-CD3 treatment with IL-7/anti-IL-7 complexes. Although ineffective alone, IL-7 significantly improved the rate of remission induced by anti-CD3. Four anti-human CD3 mAbs exhibited the same differential effect on IL-7R expression in human as in mouse cells, suggesting that the mechanism also underlies therapeutic effect in human cells, and perhaps a rationale for testing a combination of anti-CD3 and IL-7 for the treatment of recent-onset human type 1 diabetes. Thus, systems-level analysis of the response to anti-CD3 in the early phase of the treatment demonstrates different responses in Tregs and Tconvs, and provides new leads to a mechanistic understanding of its mechanism of action in reverting recent-onset diabetes.

  14. UVB Induces a Genome-Wide Acting Negative Regulatory Mechanism That Operates at the Level of Transcription Initiation in Human Cells

    PubMed Central

    Gyenis, Ákos; Umlauf, David; Újfaludi, Zsuzsanna; Boros, Imre; Ye, Tao; Tora, Làszlò

    2014-01-01

    Faithful transcription of DNA is constantly threatened by different endogenous and environmental genotoxic effects. Transcription coupled repair (TCR) has been described to stop transcription and quickly remove DNA lesions from the transcribed strand of active genes, permitting rapid resumption of blocked transcription. This repair mechanism has been well characterized in the past using individual target genes. Moreover, numerous efforts investigated the fate of blocked RNA polymerase II (Pol II) during DNA repair mechanisms and suggested that stopped Pol II complexes can either backtrack, be removed and degraded or bypass the lesions to allow TCR. We investigated the effect of a non-lethal dose of UVB on global DNA-bound Pol II distribution in human cells. We found that the used UVB dose did not induce Pol II degradation however surprisingly at about 93% of the promoters of all expressed genes Pol II occupancy was seriously reduced 2–4 hours following UVB irradiation. The presence of Pol II at these cleared promoters was restored 5–6 hours after irradiation, indicating that the negative regulation is very dynamic. We also identified a small set of genes (including several p53 regulated genes), where the UVB-induced Pol II clearing did not operate. Interestingly, at promoters, where Pol II promoter clearance occurs, TFIIH, but not TBP, follows the behavior of Pol II, suggesting that at these genes upon UVB treatment TFIIH is sequestered for DNA repair by the TCR machinery. In agreement, in cells where the TCR factor, the Cockayne Syndrome B protein, was depleted UVB did not induce Pol II and TFIIH clearance at promoters. Thus, our study reveals a UVB induced negative regulatory mechanism that targets Pol II transcription initiation on the large majority of transcribed gene promoters, and a small subset of genes, where Pol II escapes this negative regulation. PMID:25058334

  15. A computational study of ultrafast acid dissociation and acid-base neutralization reactions. I. The model

    NASA Astrophysics Data System (ADS)

    Maurer, Patrick; Thomas, Vibin; Rivard, Ugo; Iftimie, Radu

    2010-07-01

    Ultrafast, time-resolved investigations of acid-base neutralization reactions have recently been performed using systems containing the photoacid 8-hydroxypyrene-1,3,6-trisulfonic acid trisodium salt (HPTS) and various Brønsted bases. Two conflicting neutralization mechanisms have been formulated by Mohammed et al. [Science 310, 83 (2005)] and Siwick et al. [J. Am. Chem. Soc. 129, 13412 (2007)] for the same acid-base system. Herein an ab initio molecular dynamics based computational model is formulated, which is able to investigate the validity of the proposed mechanisms in the general context of ground-state acid-base neutralization reactions. Our approach consists of using 2,4,6-tricyanophenol (exp. pKa≅1) as a model for excited-state HPTS∗ (pKa≅1.4) and carboxylate ions for the accepting base. We employ our recently proposed dipole-field/quantum mechanics (QM) treatment [P. Maurer and R. Iftimie, J. Chem. Phys. 132, 074112 (2010)] of the proton donor and acceptor molecules. This approach allows one to tune the free energy of neutralization to any desired value as well as model initial nonequilibrium hydration effects caused by a sudden increase in acidity, making it possible to achieve a more realistic comparison with experimental data than could be obtained via a full-QM treatment of the entire system. It is demonstrated that the dipole-field/QM model reproduces correctly key properties of the 2,4,6-tricyanophenol acid molecule including gas-phase proton dissociation energies and dipole moments, and condensed-phase hydration structure and pKa values.

  16. Acid-base interactions and complex formation while recovering copper(II) ions from aqueous solutions using cellulose adsorbent in the presence of polyvinylpyrrolidone

    NASA Astrophysics Data System (ADS)

    Nikiforova, T. E.; Kozlov, V. A.; Islyaikin, M. K.

    2012-12-01

    The sorption properties of nontreated cotton cellulose and cellulose modified with polyvinylpyrrolidone with respect to copper(II) ions are investigated. It is established that modified cellulose adsorbents have high sorption capability associated with the formation of new sorption centers during treatment with nitrogen-containing polymer. A mechanism is proposed for acid-base interactions in aqueous solutions of acids, bases, and salts during copper(II) cation recovery using cellulose adsorbent with the participation of polyvinylpyrrolidone.

  17. Acid-base properties of bentonite rocks with different origins.

    PubMed

    Nagy, Noémi M; Kónya, József

    2006-03-01

    Five bentonite samples (35-47% montmorillonite) from a Sarmatian sediment series with bentonite sites around Sajóbábony (Hungary) is studied. Some of these samples were tuffogenic bentonite (sedimentary), the others were bentonitized tuff with volcano sedimentary origin. The acid-base properties of the edge sites were studied by potentiometric titrations and surface complexation modeling. It was found that the number and the ratio of silanol and aluminol sites as well as the intrinsic stability constants are different for the sedimentary bentonite and bentonitized tuff. The characteristic properties of the edges sites depend on the origins. The acid-base properties are compared to other commercial and standard bentonites.

  18. Honeybee Colony Thermoregulation – Regulatory Mechanisms and Contribution of Individuals in Dependence on Age, Location and Thermal Stress

    PubMed Central

    Stabentheiner, Anton; Kovac, Helmut; Brodschneider, Robert

    2010-01-01

    Honeybee larvae and pupae are extremely stenothermic, i.e. they strongly depend on accurate regulation of brood nest temperature for proper development (33–36°C). Here we study the mechanisms of social thermoregulation of honeybee colonies under changing environmental temperatures concerning the contribution of individuals to colony temperature homeostasis. Beside migration activity within the nest, the main active process is “endothermy on demand” of adults. An increase of cold stress (cooling of the colony) increases the intensity of heat production with thoracic flight muscles and the number of endothermic individuals, especially in the brood nest. As endothermy means hard work for bees, this eases much burden of nestmates which can stay ectothermic. Concerning the active reaction to cold stress by endothermy, age polyethism is reduced to only two physiologically predetermined task divisions, 0 to ∼2 days and older. Endothermic heat production is the job of bees older than about two days. They are all similarly engaged in active heat production both in intensity and frequency. Their active heat production has an important reinforcement effect on passive heat production of the many ectothermic bees and of the brood. Ectothermy is most frequent in young bees (<∼2 days) both outside and inside of brood nest cells. We suggest young bees visit warm brood nest cells not only to clean them but also to speed up flight muscle development for proper endothermy and foraging later in their life. Young bees inside brood nest cells mostly receive heat from the surrounding cell wall during cold stress, whereas older bees predominantly transfer heat from the thorax to the cell wall. Endothermic bees regulate brood comb temperature more accurately than local air temperature. They apply the heat as close to the brood as possible: workers heating cells from within have a higher probability of endothermy than those on the comb surface. The findings show that thermal

  19. Regulatory effect and mechanisms of carbon monoxide-releasing molecule II on hepatic energy metabolism in septic mice

    PubMed Central

    Liang, Feng; Cao, Jie; Qin, Wei-Ting; Wang, Xu; Qiu, Xue-Feng; Sun, Bing-Wei

    2014-01-01

    AIM: To investigate the possible mechanisms of exogenous carbon monoxide-releasing molecule II (CORM-2) intervention on hepatic energy metabolism in experimental sepsis. METHODS: Forty-eight C57BL/6 mice were randomly divided into four groups (n = 12): sham group; cecal ligation and puncture (CLP) group; CLP + CORM-2 group and CLP + iCORM-2 (inactive CORM-2) group. Survival rates were determined after 72 h. Twenty-four similarly treated mice (n = 6 in each group) were assayed for post-operative continuous blood glucose in the first 36 h. Thirty-six similarly treated mice (n = 9 in each group) underwent micro-positron emission tomography (PET) scanning after tail vein injection of 18F-fluorodeoxyglucose (FDG) 24 h after operation. Plasma and liver specimens were collected for assay of liver pathology, alanine transaminase (ALT) and aspartate transaminase (AST) activities. Hepatic glucokinase activity, lactic acid levels and mitochondrial swelling were also determined. RESULTS: Improved survival was observed in CORM-2 treated mice. Both the CLP and CLP + CORM-2 groups had sustained low blood glucose levels within the first post-operative 36 h. 18F-FDG micro-PET images showed abnormally high levels of hepatic glucose metabolism (standardized uptake value) in the CLP group (2.76 ± 0.39 vs 0.84 ± 0.14, P < 0.01), which declined to normal levels after CORM-2 intervention (1.29 ± 0.32 vs 2.76 ± 0.39, P < 0.05). glucokinase activity was markedly increased in the CLP group (6.38 ± 0.56 U/g vs 4.60 ± 0.21 U/g, P < 0.01), but was normal after CORM-2 intervention (4.74 ± 0.14 U/g vs 6.38 ± 0.56 U/g, P < 0.05). CORM-2 suppressed plasma lactic acid levels (4.02 ± 0.02 mmol/L vs 7.72 ± 2.37 mmol/L, P < 0.05) and protected hepatic mitochondria in CLP mice. CORM-2 intervention also reduced elevated plasma AST (199.67 ± 11.08 U/L vs 379.67 ± 16.34 U/L, P < 0.05) and ALT (63.67 ± 12.23 U/L vs 112.67 ± 9.74 U/L, P < 0.05) activities in CLP mice. CONCLUSION: The release

  20. Acid-Base Balance in Uremic Rats with Vascular Calcification

    PubMed Central

    Peralta-Ramírez, Alan; Raya, Ana Isabel; Pineda, Carmen; Rodríguez, Mariano; Aguilera-Tejero, Escolástico; López, Ignacio

    2014-01-01

    Background/Aims Vascular calcification (VC), a major complication in humans and animals with chronic kidney disease (CKD), is influenced by changes in acid-base balance. The purpose of this study was to describe the acid-base balance in uremic rats with VC and to correlate the parameters that define acid-base equilibrium with VC. Methods Twenty-two rats with CKD induced by 5/6 nephrectomy (5/6 Nx) and 10 nonuremic control rats were studied. Results The 5/6 Nx rats showed extensive VC as evidenced by a high aortic calcium (9.2 ± 1.7 mg/g of tissue) and phosphorus (20.6 ± 4.9 mg/g of tissue) content. Uremic rats had an increased pH level (7.57 ± 0.03) as a consequence of both respiratory (PaCO2 = 28.4 ± 2.1 mm Hg) and, to a lesser degree, metabolic (base excess = 4.1 ± 1 mmol/l) derangements. A high positive correlation between both anion gap (AG) and strong ion difference (SID) with aortic calcium (AG: r = 0.604, p = 0.02; SID: r = 0.647, p = 0.01) and with aortic phosphorus (AG: r = 0.684, p = 0.007; SID: r = 0.785, p = 0.01) was detected. Conclusions In an experimental model of uremic rats, VC showed high positive correlation with AG and SID. PMID:25177336

  1. Early tissue response to citric acid-based micro- and nanocomposites

    PubMed Central

    Chung, Eun Ji; Qiu, Hongjin; Kodali, Pradeep; Yang, Scott; Sprague, Stuart M.; Hwong, James; Koh, Jason; Ameer, Guillermo A.

    2010-01-01

    Composites based on calcium phosphates and biodegradable polymers are desirable for orthopaedic applications due to their potential to mimic bone. Herein, we describe the fabrication, characterization, and in vivo response of novel citric acid-based microcomposites and nanocomposites. Poly(1,8-octanediol-co-citrate) (POC) was mixed with increasing amounts of HA nanoparticles or microparticles (up to 60 wt%), and the morphology and mechanical properties of the resulting composites were assessed. To investigate tissue response, nanocomposites, microcomposites, POC, and poly(L-lactide) (PLL) were implanted in osteochondral defects in rabbits and harvested at 6 weeks for histological evaluation. SEM confirmed increased surface roughness of microcomposites relative to nanocomposites. The mechanical properties of both types of composites increased with increasing amounts of HA (8–328 MPa), although nanocomposites with 60 wt.% HA displayed the highest strength and stiffness. Based on tissue-implant interfacial assessments, all implants integrated well with the surrounding bone and cartilage with no evidence of inflammation. Both nanocomposites and microcomposites supported bone remodeling; however, nanocomposites induced more trabecular bone formation at the tissue-implant interface. The mechanical properties of citric acid-based composites are within the range of human trabecular bone (1–1524 MPa, 211±78 MPa mean modulus) and tissue response was dependent on the size and content of HA, providing new perspectives of design and fabrication criteria for orthopaedic devices such as interference screws and fixation pins. PMID:20949482

  2. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism.

    PubMed

    Shahriari, Ali; Dawson, Neal J; Bell, Ryan A V; Storey, Kenneth B

    2013-01-01

    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD(+), which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. 1.1.1.28) from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in V max (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves.

  3. Mechanism of araC autoregulation and the domains of two overlapping promoters, Pc and PBAD, in the L-arabinose regulatory region of Escherichia coli.

    PubMed

    Lee, N L; Gielow, W O; Wallace, R G

    1981-02-01

    The DNA-protein contact sites in the ara regulatory region, which contains the promoters for araBAD and araC, have been determined for araC protein, the cyclic AMP-binding protein, and RNA polymerase, by using the methylation protection and DNase I protection methods. The functional significance of binding was assessed by correlating the state of occupancy of these sites with promoter activity in transcription initiation. Our results suggest that the basis for araC autoregulation is that araC protein, in either its activator (P2) or repressor (P1) form, acts as a repressor for araC, by binding to the RNA polymerase attachment site at the araC promoter. We also found that the araC and araBAD promoters share a common site of positive control by the cyclic AMP-binding protein, located 90 bases from the araBAD and 60 bases from the araC transcriptional start points. A model for the mechanism of regulation of araBAD and araC expression by the catabolite gene-activator protein, P1, and Pe is proposed. An earlier model proposed by Ogden et al. [Ogden S., Haggerty, D., Stoner, C. M., Kolodrubetz, D. & Schleif, R. (1980) Proc. Natl. Acad. Sci, USA 77, 3346-3350] is discussed in the light of the data presented in this paper.

  4. The mechanism of potent GTP cyclohydrolase I inhibition by 2,4-diamino-6-hydroxypyrimidine: requirement of the GTP cyclohydrolase I feedback regulatory protein.

    PubMed

    Kolinsky, Monica A; Gross, Steven S

    2004-09-24

    Inhibition of GTP cyclohydrolase I (GTPCH) has been used as a selective tool to assess the role of de novo synthesis of (6R)-5,6,7,8-tetrahydro-L-biopterin (BH4) in a biological system. Toward this end, 2,4-diamino-6-hydroxypyrimidine (DAHP) has been used as the prototypical GTPCH inhibitor. Using a novel real-time kinetic microplate assay for GTPCH activity and purified prokaryote-expressed recombinant proteins, we show that potent inhibition by DAHP is not the result of a direct interaction with GTPCH. Rather, inhibition by DAHP in phosphate buffer occurs via an indirect mechanism that requires the presence of GTPCH feedback regulatory protein (GFRP). Notably, GFRP was previously discovered as the essential factor that reconstitutes inhibition of pure recombinant GTPCH by the pathway end product BH4. Thus, DAHP inhibits GTPCH by engaging the endogenous feedback inhibitory system. We further demonstrate that L-Phe fully reverses the inhibition of GTPCH by DAHP/GFRP, which is also a feature in common with inhibition by BH4/GFRP. These findings suggest that DAHP is not an indiscriminate inhibitor of GTPCH in biological systems; instead, it is predicted to preferentially attenuate GTPCH activity in cells that most abundantly express GFRP and/or contain the lowest levels of L-Phe.

  5. The control of actin nucleotide exchange by thymosin beta 4 and profilin. A potential regulatory mechanism for actin polymerization in cells.

    PubMed Central

    Goldschmidt-Clermont, P J; Furman, M I; Wachsstock, D; Safer, D; Nachmias, V T; Pollard, T D

    1992-01-01

    We present evidence for a new mechanism by which two major actin monomer binding proteins, thymosin beta 4 and profilin, may control the rate and the extent of actin polymerization in cells. Both proteins bind actin monomers transiently with a stoichiometry of 1:1. When bound to actin, thymosin beta 4 strongly inhibits the exchange of the nucleotide bound to actin by blocking its dissociation, while profilin catalytically promotes nucleotide exchange. Because both proteins exchange rapidly between actin molecules, low concentrations of profilin can overcome the inhibitory effects of high concentrations of thymosin beta 4 on the nucleotide exchange. These reactions may allow variations in profilin concentration (which may be regulated by membrane polyphosphoinositide metabolism) to control the ratio of ATP-actin to ADP-actin. Because ATP-actin subunits polymerize more readily than ADP-actin subunits, this ratio may play a key regulatory role in the assembly of cellular actin structures, particularly under circumstances of rapid filament turnover. Images PMID:1330091

  6. A multilayered regulatory mechanism for the autoinhibition and activation of a plant CC-NB-LRR resistance protein with an extra N-terminal domain.

    PubMed

    Chen, Xiaojiao; Zhu, Min; Jiang, Lei; Zhao, Wenyang; Li, Jia; Wu, Jianyan; Li, Chun; Bai, Baohui; Lu, Gang; Chen, Hongyu; Moffett, Peter; Tao, Xiaorong

    2016-10-01

    The tomato resistance protein Sw-5b differs from the classical coiled-coil nucleotide-binding leucine-rich repeat (CC-NB-LRR) resistance proteins by having an extra N-terminal domain (NTD). To understand how NTD, CC and NB-LRR regulate autoinhibition and activation of Sw-5b, we dissected the function(s) of each domain. When viral elicitor was absent, Sw-5b LRR suppressed the central NB-ARC to maintain autoinhibition of the NB-LRR segment. The CC and NTD domains independently and additively enhanced the autoinhibition of NB-LRR. When viral elicitor was present, the NB-LRR segment of Sw-5b was specifically activated to trigger a hypersensitive response. Surprisingly, Sw-5b CC suppressed the activation of NB-LRR, whereas the extra NTD of Sw-5b became a positive regulator and fully activated the resistance protein, probably by relieving the inhibitory effects of the CC. In infection assays of transgenic plants, the NB-LRR segment alone was insufficient to confer resistance against Tomato spotted wilt tospovirus; the layers of NTD and CC regulation on NB-LRR were required for Sw-5b to confer resistance. Based on these findings, we propose that, to counter the negative regulation of the CC on NB-LRR, Sw-5b evolved an extra NTD to coordinate with the CC, thus developing a multilayered regulatory mechanism to control autoinhibition and activation.

  7. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism

    PubMed Central

    Shahriari, Ali; Dawson, Neal J.; Bell, Ryan A. V.; Storey, Kenneth B.

    2013-01-01

    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD+, which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. 1.1.1.28) from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in Vmax (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves. PMID:24233354

  8. The normal acid-base status of mice.

    PubMed

    Iversen, Nina K; Malte, Hans; Baatrup, Erik; Wang, Tobias

    2012-03-15

    Rodent models are commonly used for various physiological studies including acid-base regulation. Despite the widespread use of especially genetic modified mice, little attention have been made to characterise the normal acid-base status in these animals in order to reveal proper control values. Furthermore, several studies report blood gas values obtained in anaesthetised animals. We, therefore, decided to characterise blood CO(2) binding characteristic of mouse blood in vitro and to characterise normal acid-base status in conscious BALBc mice. In vitro CO(2) dissociation curves, performed on whole blood equilibrated to various PCO₂ levels in rotating tonometers, revealed a typical mammalian pK' (pK'=7.816-0.234 × pH (r=0.34)) and a non-bicarbonate buffer capacity (16.1 ± 2.6 slyke). To measure arterial acid-base status, small blood samples were taken from undisturbed mice with indwelling catheters in the carotid artery. In these animals, pH was 7.391 ± 0.026, plasma [HCO(3)(-)] 18.4 ± 0.83 mM, PCO₂ 30.3 ± 2.1 mm Hg and lactate concentration 4.6 ± 0.7 mM. Our study, therefore, shows that mice have an arterial pH that resembles other mammals, although arterial PCO₂ tends to be lower than in larger mammals. However, pH from arterial blood sampled from mice anaesthetised with isoflurane was significantly lower (pH 7.239 ± 0.021), while plasma [HCO(3)(-)] was 18.5 ± 1.4 mM, PCO₂ 41.9 ± 2.9 mm Hg and lactate concentration 4.48 ± 0.67 mM. Furthermore, we measured metabolism and ventilation (V(E)) in order to determine the ventilation requirements (VE/VO₂) to answer whether small mammals tend to hyperventilate. We recommend, therefore, that studies on acid-base regulation in mice should be based on samples taken for indwelling catheters rather than cardiac puncture of terminally anaesthetised mice.

  9. Evolutionarily conserved regulatory mechanisms of abscisic acid signaling in land plants: characterization of ABSCISIC ACID INSENSITIVE1-like type 2C protein phosphatase in the liverwort Marchantia polymorpha.

    PubMed

    Tougane, Ken; Komatsu, Kenji; Bhyan, Salma Begum; Sakata, Yoichi; Ishizaki, Kimitsune; Yamato, Katsuyuki T; Kohchi, Takayuki; Takezawa, Daisuke

    2010-03-01

    Abscisic acid (ABA) is postulated to be a ubiquitous hormone that plays a central role in seed development and responses to environmental stresses of vascular plants. However, in liverworts (Marchantiophyta), which represent the oldest extant lineage of land plants, the role of ABA has been least emphasized; thus, very little information is available on the molecular mechanisms underlying ABA responses. In this study, we isolated and characterized MpABI1, an ortholog of ABSCISIC ACID INSENSITIVE1 (ABI1), from the liverwort Marchantia polymorpha. The MpABI1 cDNA encoded a 568-amino acid protein consisting of the carboxy-terminal protein phosphatase 2C (PP2C) domain and a novel amino-terminal regulatory domain. The MpABI1 transcript was detected in the gametophyte, and its expression level was increased by exogenous ABA treatment in the gemma, whose growth was strongly inhibited by ABA. Experiments using green fluorescent protein fusion constructs indicated that MpABI1 was mainly localized in the nucleus and that its nuclear localization was directed by the amino-terminal domain. Transient overexpression of MpABI1 in M. polymorpha and Physcomitrella patens cells resulted in suppression of ABA-induced expression of the wheat Em promoter fused to the beta -glucuronidase gene. Transgenic P. patens expressing MpABI1 and its mutant construct, MpABI1-d2, lacking the amino-terminal domain, had reduced freezing and osmotic stress tolerance, and associated with reduced accumulation of ABA-induced late embryogenesis abundant-like boiling-soluble proteins. Furthermore, ABA-induced morphological changes leading to brood cells were not prominent in these transgenic plants. These results suggest that MpABI1 is a negative regulator of ABA signaling, providing unequivocal molecular evidence of PP2C-mediated ABA response mechanisms functioning in liverworts.

  10. Mutually exclusive splicing regulates the Nav 1.6 sodium channel function through a combinatorial mechanism that involves three distinct splicing regulatory elements and their ligands

    PubMed Central

    Zubović, Lorena; Baralle, Marco; Baralle, Francisco E.

    2012-01-01

    Mutually exclusive splicing is a form of alternative pre-mRNA processing that consists in the use of only one of a set of two or more exons. We have investigated the mechanisms involved in this process for exon 18 of the Nav 1.6 sodium channel transcript and its significance regarding gene-expression regulation. The 18N exon (neonatal form) has a stop codon in phase and although the mRNA can be detected by amplification methods, the truncated protein has not been observed. The switch from 18N to 18A (adult form) occurs only in a restricted set of neural tissues producing the functional channel while other tissues display the mRNA with the 18N exon also in adulthood. We demonstrate that the mRNA species carrying the stop codon is subjected to Nonsense-Mediated Decay, providing a control mechanism of channel expression. We also map a string of cis-elements within the mutually exclusive exons and in the flanking introns responsible for their strict tissue and temporal specificity. These elements bind a series of positive (RbFox-1, SRSF1, SRSF2) and negative (hnRNPA1, PTB, hnRNPA2/B1, hnRNPD-like JKTBP) splicing regulatory proteins. These splicing factors, with the exception of RbFox-1, are ubiquitous but their levels vary during development and differentiation, ensuing unique sets of tissue and temporal levels of splicing factors. The combinatorial nature of these elements is highlighted by the dominance of the elements that bind the ubiquitous factors over the tissue specific RbFox-1. PMID:22434879

  11. The glmS ribozyme cofactor is a general acid-base catalyst.

    PubMed

    Viladoms, Júlia; Fedor, Martha J

    2012-11-21

    The glmS ribozyme is the first natural self-cleaving ribozyme known to require a cofactor. The d-glucosamine-6-phosphate (GlcN6P) cofactor has been proposed to serve as a general acid, but its role in the catalytic mechanism has not been established conclusively. We surveyed GlcN6P-like molecules for their ability to support self-cleavage of the glmS ribozyme and found a strong correlation between the pH dependence of the cleavage reaction and the intrinsic acidity of the cofactors. For cofactors with low binding affinities, the contribution to rate enhancement was proportional to their intrinsic acidity. This linear free-energy relationship between cofactor efficiency and acid dissociation constants is consistent with a mechanism in which the cofactors participate directly in the reaction as general acid-base catalysts. A high value for the Brønsted coefficient (β ~ 0.7) indicates that a significant amount of proton transfer has already occurred in the transition state. The glmS ribozyme is the first self-cleaving RNA to use an exogenous acid-base catalyst.

  12. The glmS Ribozyme Cofactor is a General Acid-Base Catalyst

    PubMed Central

    Viladoms, Julia; Fedor, Martha J.

    2012-01-01

    The glmS ribozyme is the first natural self-cleaving ribozyme known to require a cofactor. The D-glucosamine-6-phosphate (GlcN6P) cofactor has been proposed to serve as a general acid, but its role in the catalytic mechanism has not been established conclusively. We surveyed GlcN6P-like molecules for their ability to support self-cleavage of the glmS ribozyme and found a strong correlation between the pH dependence of the cleavage reaction and the intrinsic acidity of the cofactors. For cofactors with low binding affinities the contribution to rate enhancement was proportional to their intrinsic acidity. This linear free-energy relationship between cofactor efficiency and acid dissociation constants is consistent with a mechanism in which the cofactors participate directly in the reaction as general acid-base catalysts. A high value for the Brønsted coefficient (β ~ 0.7) indicates that a significant amount of proton transfer has already occurred in the transition state. The glmS ribozyme is the first self-cleaving RNA to use an exogenous acid-base catalyst. PMID:23113700

  13. Developing nucleic acid-based electrical detection systems

    PubMed Central

    Gabig-Ciminska, Magdalena

    2006-01-01

    Development of nucleic acid-based detection systems is the main focus of many research groups and high technology companies. The enormous work done in this field is particularly due to the broad versatility and variety of these sensing devices. From optical to electrical systems, from label-dependent to label-free approaches, from single to multi-analyte and array formats, this wide range of possibilities makes the research field very diversified and competitive. New challenges and requirements for an ideal detector suitable for nucleic acid analysis include high sensitivity and high specificity protocol that can be completed in a relatively short time offering at the same time low detection limit. Moreover, systems that can be miniaturized and automated present a significant advantage over conventional technology, especially if detection is needed in the field. Electrical system technology for nucleic acid-based detection is an enabling mode for making miniaturized to micro- and nanometer scale bio-monitoring devices via the fusion of modern micro- and nanofabrication technology and molecular biotechnology. The electrical biosensors that rely on the conversion of the Watson-Crick base-pair recognition event into a useful electrical signal are advancing rapidly, and recently are receiving much attention as a valuable tool for microbial pathogen detection. Pathogens may pose a serious threat to humans, animal and plants, thus their detection and analysis is a significant element of public health. Although different conventional methods for detection of pathogenic microorganisms and their toxins exist and are currently being applied, improvements of molecular-based detection methodologies have changed these traditional detection techniques and introduced a new era of rapid, miniaturized and automated electrical chip detection technologies into pathogen identification sector. In this review some developments and current directions in nucleic acid-based electrical

  14. Functional nucleic-acid-based sensors for environmental monitoring.

    PubMed

    Sett, Arghya; Das, Suradip; Bora, Utpal

    2014-10-01

    Efforts to replace conventional chromatographic methods for environmental monitoring with cheaper and easy to use biosensors for precise detection and estimation of hazardous environmental toxicants, water or air borne pathogens as well as various other chemicals and biologics are gaining momentum. Out of the various types of biosensors classified according to their bio-recognition principle, nucleic-acid-based sensors have shown high potential in terms of cost, sensitivity, and specificity. The discovery of catalytic activities of RNA (ribozymes) and DNA (DNAzymes) which could be triggered by divalent metallic ions paved the way for their extensive use in detection of heavy metal contaminants in environment. This was followed with the invention of small oligonucleotide sequences called aptamers which can fold into specific 3D conformation under suitable conditions after binding to target molecules. Due to their high affinity, specificity, reusability, stability, and non-immunogenicity to vast array of targets like small and macromolecules from organic, inorganic, and biological origin, they can often be exploited as sensors in industrial waste management, pollution control, and environmental toxicology. Further, rational combination of the catalytic activity of DNAzymes and RNAzymes along with the sequence-specific binding ability of aptamers have given rise to the most advanced form of functional nucleic-acid-based sensors called aptazymes. Functional nucleic-acid-based sensors (FNASs) can be conjugated with fluorescent molecules, metallic nanoparticles, or quantum dots to aid in rapid detection of a variety of target molecules by target-induced structure switch (TISS) mode. Although intensive research is being carried out for further improvements of FNAs as sensors, challenges remain in integrating such bio-recognition element with advanced transduction platform to enable its use as a networked analytical system for tailor made analysis of environmental

  15. A fully automatic system for acid-base coulometric titrations

    PubMed Central

    Cladera, A.; Caro, A.; Estela, J. M.; Cerdà, V.

    1990-01-01

    An automatic system for acid-base titrations by electrogeneration of H+ and OH- ions, with potentiometric end-point detection, was developed. The system includes a PC-compatible computer for instrumental control, data acquisition and processing, which allows up to 13 samples to be analysed sequentially with no human intervention. The system performance was tested on the titration of standard solutions, which it carried out with low errors and RSD. It was subsequently applied to the analysis of various samples of environmental and nutritional interest, specifically waters, soft drinks and wines. PMID:18925283

  16. The physiological assessment of acid-base balance.

    PubMed

    Howorth, P J

    1975-04-01

    Acid-base terminology including the sue of SI units is reviewed. The historical reasons why nomograms have been particularly used in acid-base work are discussed. The theoretical basis of the Henderson-Hasselbalch equation is considered. It is emphasized that the solubility of CO2 in plasma and the apparent first dissociation constant of carbonic acid are not chemical constants when applied to media of uncertain and varying composition such as blood plasma. The use of the Henderson-Hasselbalch equation in making hypothermia corrections for PCO2 is discussed. The Astrup system for the in vitro determination of blood gases and derived parameters is described and the theoretical weakness of the base excess concept stressed. A more clinically-oriented approach to the assessment of acid-base problems is presented. Measurement of blood [H+] and PCO2 are considered to be primary data which should be recorded on a chart with in vivo CO2-titration lines (see below). Clinical information and results of other laboratory investigations such as plasma bicarbonate, PO2,P50 are then to be considered together with the primary data. In order to interpret this combined information it is essential to take into account the known ventilatory response to metabolic acidosis and alkalosis, and the renal response to respiratory acidosis and alkalosis. The use is recommended of a chart showing the whole-body CO2-titration points obtained when patients with different initial levels of non-respiratory [H+] are ventilated. A number of examples are given of the use of this [H+] and PCO2 in vivo chart in the interpretation of acid-base data. The aetiology, prognosis and treatment of metabolic alkalosis is briefly reviewed. Treatment with intravenous acid is recommended for established cases. Attention is drawn to the possibility of iatrogenic production of metabolic alkalosis. Caution is expressed over the use of intravenous alkali in all but the severest cases of metabolic acidosis. The role of

  17. A Computer-Based Simulation of an Acid-Base Titration

    ERIC Educational Resources Information Center

    Boblick, John M.

    1971-01-01

    Reviews the advantages of computer simulated environments for experiments, referring in particular to acid-base titrations. Includes pre-lab instructions and a sample computer printout of a student's use of an acid-base simulation. Ten references. (PR)

  18. Exploring Regulatory Mechanisms of Atrial Myocyte Hypertrophy of Mitral Regurgitation through Gene Expression Profiling Analysis: Role of NFAT in Cardiac Hypertrophy

    PubMed Central

    Chang, Tzu-Hao; Chen, Mien-Cheng; Chang, Jen-Ping; Huang, Hsien-Da; Ho, Wan-Chun; Lin, Yu-Sheng; Pan, Kuo-Li; Huang, Yao-Kuang; Liu, Wen-Hao; Wu, Chia-Chen

    2016-01-01

    Background Left atrial enlargement in mitral regurgitation (MR) predicts a poor prognosis. The regulatory mechanisms of atrial myocyte hypertrophy of MR patients remain unknown. Methods and Results This study comprised 14 patients with MR, 7 patients with aortic valve disease (AVD), and 6 purchased samples from normal subjects (NC). We used microarrays, enrichment analysis and quantitative RT-PCR to study the gene expression profiles in the left atria. Microarray results showed that 112 genes were differentially up-regulated and 132 genes were differentially down-regulated in the left atria between MR patients and NC. Enrichment analysis of differentially expressed genes demonstrated that “NFAT in cardiac hypertrophy” pathway was not only one of the significant associated canonical pathways, but also the only one predicted with a non-zero score of 1.34 (i.e. activated) through Ingenuity Pathway Analysis molecule activity predictor. Ingenuity Pathway Analysis Global Molecular Network analysis exhibited that the highest score network also showed high association with cardiac related pathways and functions. Therefore, 5 NFAT associated genes (PPP3R1, PPP3CB, CAMK1, MEF2C, PLCE1) were studies for validation. The mRNA expressions of PPP3CB and MEF2C were significantly up-regulated, and CAMK1 and PPP3R1 were significantly down-regulated in MR patients compared to NC. Moreover, MR patients had significantly increased mRNA levels of PPP3CB, MEF2C and PLCE1 compared to AVD patients. The atrial myocyte size of MR patients significantly exceeded that of the AVD patients and NC. Conclusions Differentially expressed genes in the “NFAT in cardiac hypertrophy” pathway may play a critical role in the atrial myocyte hypertrophy of MR patients. PMID:27907007

  19. Rab27a negatively regulates CFTR chloride channel function in colonic epithelia: Involvement of the effector proteins in the regulatory mechanism

    SciTech Connect

    Saxena, Sunil K. . E-mail: ssaxena@stevens.edu; Kaur, Simarna

    2006-07-21

    Cystic fibrosis, an autosomal recessive disorder, is caused by the disruption of biosynthesis or function of CFTR. CFTR regulatory mechanisms include channel transport to plasma membrane and protein-protein interactions. Rab proteins are small GTPases involved in vesicle transport, docking, and fusion. The colorectal epithelial HT-29 cells natively express CFTR and respond to cAMP with an increase in CFTR-mediated currents. DPC-inhibited currents could be completely eliminated with CFTR-specific SiRNA. Over-expression of Rab27a inhibited, while isoform specific SiRNA and Rab27a antibody stimulated CFTR-mediated currents in HT-29 cells. CFTR activity is inhibited both by Rab27a (Q78L) (constitutive active GTP-bound form of Rab27a) and Rab27a (T23N) (constitutive negative form that mimics the GDP-bound form). Rab27a mediated effects could be reversed by Rab27a-binding proteins, the synaptotagmin-like protein (SLP-5) and Munc13-4 accessory protein (a putative priming factor for exocytosis). The SLP reversal of Rab27a effect was restricted to C2A/C2B domains while the SHD motif imparted little more inhibition. The CFTR-mediated currents remain unaffected by Rab3 though SLP-5 appears to weakly bind it. The immunoprecipitation experiments suggest protein-protein interactions between Rab27a and CFTR. Rab27a appears to impair CFTR appearance at the cell surface by trapping CFTR in the intracellular compartments. Munc13-4 and SLP-5, on the other hand, limit Rab27a availability to CFTR, thus minimizing its effect on channel function. These observations decisively prove that Rab27a is involved in CFTR channel regulation through protein-protein interactions involving Munc13-4 and SLP-5 effector proteins, and thus could be a potential target for cystic fibrosis therapy.

  20. The Functional and Regulatory Mechanisms of the Thellungiella salsuginea Ascorbate Peroxidase 6 (TsAPX6) in Response to Salinity and Water Deficit Stresses.

    PubMed

    Li, Zeqin; Zhang, Jilong; Li, Jingxiao; Li, Hongjie; Zhang, Genfa

    2016-01-01

    Soil salinization is a resource and ecological problem in the world. Thellungiella salsuginea is becoming a new model plant because it resembles its relative species, Arabidopsis thaliana, in small genome and short life cycle. It is highly tolerant to salinity and drought stresses. Ascorbate peroxidase (APX) is an enzyme that clears H2O2 in plants. The function and molecular and regulation mechanisms of APX in T. salsuginea have rarely been reported. In this study, an APX gene, TsApx6, was cloned from T. salsuginea and its responses to abiotic stresses in transgenic Arabidopsis were studied. Under high salinity treatment, the expression of TsApx6 was significantly induced. Under drought treatment, overexpression of TsApx6 increased the survival rate and reduced leaf water loss rate in Arabidopsis. Compared to the wild type plants, high salinity treatment reduced the concentrations of MDA, H2O2 and proline but elevated the activities of APX, GPX, CAT and SOD in the TsApx6-overexpressing plants. Meanwhile, germination rate, cotyledon greening, and root length were improved in the transgenic plants compared to the wild type plants under salt and water deficit conditions. Based on these findings, TsApx6 has an important function in the resistance of plants to certain abiotic stresses. The TsApx6 promoter sequence was obtained using Genome Walking technology. Bioinformatics analysis indicated that it contains some cis-acting elements related to stress response. The treatments of salt, dehydration, and ABA induced the expression of Gus gene under the regulation of the TsApx6 promoter. Mutation analysis showed that the MBS motif present in the TsApx6 promoter might be a key negative regulatory element which has an important effect on the growth and developmental process of plants.

  1. Cognitive regulatory control therapies.

    PubMed

    Bowins, Brad

    2013-01-01

    Cognitive regulatory control processes play an essential but typically unappreciated role in maintaining mental health. The purpose of the current paper is to identify this role and demonstrate how cognitive-behavioral and related techniques can compensate for impairments. Impaired cognitive regulation contributes to the overly intense emotional states present in anxiety disorders, depression, and personality disorders; progression of adaptive hypomania to mania; expression of psychosis in the conscious and awake state; dominance of immature defense mechanisms in borderline and other personality disorders. A wide variety of standard (monitoring, reappraisal, response inhibition, relaxation training) and more novel (suppression therapy, willful detachment, cost-benefit analysis, normalization, mature defense mechanism training) cognitive-behavioral and related techniques can be applied to compensate for cognitive regulatory control impairments, and their success probably aligns with this capacity.

  2. Acid-base and bio-energetics during balanced versus unbalanced normovolaemic haemodilution.

    PubMed

    Morgan, T J; Venkatesh, B; Beindorf, A; Andrew, I; Hall, J

    2007-04-01

    Fluids balanced to avoid acid-base disturbances may be preferable to saline, which causes metabolic acidosis in high volume. We evaluated acid-base and bio-energetic effects of haemodilution with a crystalloid balanced on physical chemical principles, versus crystalloids causing metabolic acidosis or metabolic alkalosis. Anaesthetised, mechanically ventilated Sprague-Dawley rats (n=32, allocated to four groups) underwent six exchanges of 9 ml crystalloid for 3 ml blood. Exchange was with one of three crystalloids with strong ion difference (SID) values of 0, 24 (balanced) and 40 mEq/l. Controls did not undergo haemodilution. Mean haemoglobin concentration fell to approximately 50 g/l after haemodilution. With SID 24 mEq/l fluid, metabolic acid-base remained unchanged. Dilution with SID 0 mEq/l and 40 mEq/l fluids caused a progressive metabolic acidosis and alkalosis respectively. Standard base excess (SBE) and haemoglobin concentration were directly correlated in the SID 0 mEq/l group (R2 = 0.61), indirectly correlated in the SBE 40 mEq/l group (R2 = 0.48) and showed no correlation in the SID 24 mEq/l group (R2 = 0.003). There were no significant differences between final ileal values of CO2 gap, nucleotides concentration, energy charge, or luminal lactate concentration. SID 40 mEq/l crystalloid dilution caused a significant rise in subcutaneous lactate. In this group mean kidney ATP concentration was significantly less than controls and renal energy charge significantly lower than SID 0 mEq/l and control groups. We conclude that a crystalloid SID of 24 mEq/l provides balanced haemodilution. Bio-energetic perturbations with higher SID haemodilution may be more severe and need further investigation.

  3. How Do Undergraduate Students Conceptualize Acid-Base Chemistry? Measurement of a Concept Progression

    ERIC Educational Resources Information Center

    Romine, William L.; Todd, Amber N.; Clark, Travis B.

    2016-01-01

    We developed and validated a new instrument, called "Measuring Concept progressions in Acid-Base chemistry" (MCAB) and used it to better understand the progression of undergraduate students' understandings about acid-base chemistry. Items were developed based on an existing learning progression for acid-base chemistry. We used the Rasch…

  4. Acid-base catalysis of N-[(morpholine)methylene]daunorubicin.

    PubMed

    Krause, Anna; Jelińska, Anna; Cielecka-Piontek, Judyta; Klawitter, Maria; Zalewski, Przemysław; Oszczapowicz, Irena; Wąsowska, Małgorzata

    2012-08-01

    The stability of N-[(morpholine)methylene]-daunorubicin hydrochloride (MMD) was investigated in the pH range 0.44-13.54, at 313, 308, 303 and 298 K. The degradation of MMD as a result of hydrolysis is a pseudo-first-order reaction described by the following equation: ln c = ln c(0) - k(obs)• t. In the solutions of hydrochloric acid, sodium hydroxide, borate, acetate and phosphate buffers, k(obs) = k(pH) because general acid-base catalysis was not observed. Specific acid-base catalysis of MMD comprises the following reactions: hydrolysis of the protonated molecules of MMD catalyzed by hydrogen ions (k(1)) and spontaneous hydrolysis of MMD molecules other than the protonated ones (k(2)) under the influence of water. The total rate of the reaction is equal to the sum of partial reactions: k(pH) = k(1) • a(H)+ • f(1) + k(2) • f(2) where: k(1) is the second-order rate constant (mol(-1) l s(-1)) of the specific hydrogen ion-catalyzed degradation of the protonated molecules of MMD; k(2) is the pseudo-first-order rate constant (s(-1)) of the water-catalyzed degradation of MMD molecules other than the protonated ones, f(1) - f(2) are fractions of the compound. MMD is the most stable at approx. pH 2.5.

  5. [On improvement of the mechanism for establishing and changing indicators of quality and food safety in the regulatory and legal acts of the Eurasian Economical Union].

    PubMed

    Arnautov, O V

    2016-01-01

    In accordance with the Treaty on the Eurasian Economic Union (EAEU) to ensure the sanitary and epidemiological welfare of the population within the Union, a coordinated policy in agreed policy in the sphere of application of sanitary measures is carried out. Sanitary measures are the obligatory requirements and procedures, including requirements for the final product, processing methods, production, transportation, storage and disposal, sampling procedures, methods of research (tests), risk assessment, the state registration, requirements for packaging directly aimed at ensuring the safety of products (goods) in order to protect human welfare, and they should be applied on the basis having a scientific explanation, and only to the extent that is necessary to protect human welfare. Sanitary measures applied within the Union should be based on international and regional standards, guidelines and (or) the recommendations, except when they based on appropriate scientific studies and explanations. In this case sanitary measures which could provide a higher level of sanitary protection are introduced. At present, the mechanism of the development, justification and approval of common sanitary and epidemiological requirements (ESR) and procedures of the Eurasian Economic Commission (the Commission) is not installed. The absence of a clear mechanism for the development, approval and implementation of the ESR to the products (goods) on the basis having a scientific explanation on the one hand could lead to the creation of unjustified barriers to foreign and mutual trade, on the other--to weaken the level of safety for human life and health of products (goods) placed on markets of the Union. In order to bring the regulatory legal acts of the Customs Union in accordance with the Treaty on the Eurasian Economic Union the Commission in cooperation with the competent authorities of the Member States in the field of sanitary and epidemiological welfare developed the project of

  6. A Prebiotic Chemistry Experiment on the Adsorption of Nucleic Acids Bases onto a Natural Zeolite

    NASA Astrophysics Data System (ADS)

    Anizelli, Pedro R.; Baú, João Paulo T.; Gomes, Frederico P.; da Costa, Antonio Carlos S.; Carneiro, Cristine E. A.; Zaia, Cássia Thaïs B. V.; Zaia, Dimas A. M.

    2015-09-01

    There are currently few mechanisms that can explain how nucleic acid bases were synthesized, concentrated from dilute solutions, and/or protected against degradation by UV radiation or hydrolysis on the prebiotic Earth. A natural zeolite exhibited the potential to adsorb adenine, cytosine, thymine, and uracil over a range of pH, with greater adsorption of adenine and cytosine at acidic pH. Adsorption of all nucleic acid bases was decreased in artificial seawater compared to water, likely due to cation complexation. Furthermore, adsorption of adenine appeared to protect natural zeolite from thermal degradation. The C=O groups from thymine, cytosine and uracil appeared to assist the dissolution of the mineral while the NH2 group from adenine had no effect. As shown by FT-IR spectroscopy, adenine interacted with a natural zeolite through the NH2 group, and cytosine through the C=O group. A pseudo-second-order model best described the kinetics of adenine adsorption, which occurred faster in artificial seawaters.

  7. Sample pretreatment and nucleic acid-based detection for fast diagnosis utilizing microfluidic systems.

    PubMed

    Wang, Jung-Hao; Wang, Chih-Hung; Lee, Gwo-Bin

    2012-06-01

    Recently, micro-electro-mechanical-systems (MEMS) technology and micromachining techniques have enabled miniaturization of biomedical devices and systems. Not only do these techniques facilitate the development of miniaturized instrumentation for biomedical analysis, but they also open a new era for integration of microdevices for performing accurate and sensitive diagnostic assays. A so-called "micro-total-analysis-system", which integrates sample pretreatment, transport, reaction, and detection on a small chip in an automatic format, can be realized by combining functional microfluidic components manufactured by specific MEMS technologies. Among the promising applications using microfluidic technologies, nucleic acid-based detection has shown considerable potential recently. For instance, micro-polymerase chain reaction chips for rapid DNA amplification have attracted considerable interest. In addition, microfluidic devices for rapid sample pretreatment prior to nucleic acid-based detection have also achieved significant progress in the recent years. In this review paper, microfluidic systems for sample preparation, nucleic acid amplification and detection for fast diagnosis will be reviewed. These microfluidic devices and systems have several advantages over their large-scale counterparts, including lower sample/reagent consumption, lower power consumption, compact size, faster analysis, and lower per unit cost. The development of these microfluidic devices and systems may provide a revolutionary platform technology for fast sample pretreatment and accurate, sensitive diagnosis.

  8. Acid-base regulation during heating and cooling in the lizard, Varanus exanthematicus.

    PubMed

    Wood, S C; Johansen, K; Glass, M L; Hoyt, R W

    1981-04-01

    Current concepts of acid-base balance in ectothermic animals require that arterial pH vary inversely with body temperature in order to maintain a constant OH-/H+ and constant net charge on proteins. The present study evaluates acid-base regulation in Varanus exanthematicus under various regimes of heating and cooling between 15 and 38 degrees C. Arterial blood was sampled during heating and cooling at various rates, using restrained and unrestrained animals with and without face masks. Arterial pH was found to have a small temperature dependence, i.e., pH = 7.66--0.005 (T). The slope (dpH/dT = -0.005), while significantly greater than zero (P less than 0.05), is much less than that required for a constant OH-/H+ or a constant imidazole alphastat (dpH/dT congruent to 0.018). The physiological mechanism that distinguishes this species from most other ectotherms is the presence of a ventilatory response to temperature-induced changes in CO2 production and O2 uptake, i.e., VE/VO2 is constant. This results in a constant O2 extraction and arterial saturation (approx. 90%), which is adaptive to the high aerobic requirements of this species.

  9. General acid-base catalysis mediated by nucleobases in the hairpin ribozyme

    PubMed Central

    Kath-Schorr, Stephanie; Wilson, Timothy J.; Li, Nan-Sheng; Lu, Jun; Piccirilli, Joseph A.; Lilley, David M. J.

    2012-01-01

    The catalytic mechanism by which the hairpin ribozyme accelerates cleavage or ligation of the phosphodiester backbone of RNA has been incompletely understood. There is experimental evidence for an important role for an adenine (A38) and a guanine (G8), and it has been proposed that these act in general acid-base catalysis. In this work we show that a large reduction in cleavage rate on substitution of A38 by purine (A38P) can be reversed by replacement of the 5′-oxygen atom at the scissile phosphate by sulfur (5′-PS), which is a much better leaving group. This is consistent with A38 acting as the general acid in the unmodified ribozyme. The rate of cleavage of the 5′-PS substrate by the A38P ribozyme increases with pH log-linearly, indicative of a requirement for a deprotonated base with a relatively high pKa. On substitution of G8 by diaminopurine, the 5′-PS substrate cleavage rate at first increases with pH and then remains at a plateau, exhibiting an apparent pKa consistent with this nucleotide acting in general base catalysis. Alternative explanations for the pH dependence of hairpin ribozyme reactivity are discussed, from which we conclude that general acid-base catalysis by A38 and G8 is the simplest and most probable explanation consistent with all the experimental data. PMID:22958171

  10. A Prebiotic Chemistry Experiment on the Adsorption of Nucleic Acids Bases onto a Natural Zeolite.

    PubMed

    Anizelli, Pedro R; Baú, João Paulo T; Gomes, Frederico P; da Costa, Antonio Carlos S; Carneiro, Cristine E A; Zaia, Cássia Thaïs B V; Zaia, Dimas A M

    2015-09-01

    There are currently few mechanisms that can explain how nucleic acid bases were synthesized, concentrated from dilute solutions, and/or protected against degradation by UV radiation or hydrolysis on the prebiotic Earth. A natural zeolite exhibited the potential to adsorb adenine, cytosine, thymine, and uracil over a range of pH, with greater adsorption of adenine and cytosine at acidic pH. Adsorption of all nucleic acid bases was decreased in artificial seawater compared to water, likely due to cation complexation. Furthermore, adsorption of adenine appeared to protect natural zeolite from thermal degradation. The C=O groups from thymine, cytosine and uracil appeared to assist the dissolution of the mineral while the NH2 group from adenine had no effect. As shown by FT-IR spectroscopy, adenine interacted with a natural zeolite through the NH2 group, and cytosine through the C=O group. A pseudo-second-order model best described the kinetics of adenine adsorption, which occurred faster in artificial seawaters.

  11. Regulatory Forum.

    PubMed

    Peden, W Michael

    2016-12-01

    Revision of the International Council for Harmonization (ICH) S1 guidance for rat carcinogenicity studies to be more selective of compounds requiring a 2-year rat carcinogenicity study has been proposed following extensive evaluation of rat carcinogenicity and chronic toxicity studies by industry and drug regulatory authorities. To inform the ICH S1 expert working group in their potential revision of ICH S1, a prospective evaluation study was initiated in 2013, in which sponsors would assess the pharmacologic and toxicologic findings present in the chronic toxicity studies and predict a positive or negative carcinogenicity outcome using a weight of evidence argument (a carcinogenicity assessment document [CAD]). The Scientific and Regulatory Policy Committee was asked by the Society of Toxicology Pathology (STP) executive committee to track these changes with ICH S1 and inform the STP membership of status changes. This commentary is intended to provide a brief summary of recent changes to the CAD guidance and highlight the importance of STP membership participation in the process of CAD submissions.

  12. Diagnostic strategies in disorders of fluid, electrolyte and acid-base homeostasis.

    PubMed

    Narins, R G; Jones, E R; Stom, M C; Rudnick, M R; Bastl, C P

    1982-03-01

    Our understanding of the physiology and biochemistry of acid-base and fluid-electrolyte regulations has greatly expanded in recent years. Key physiologic principles have emerged that now permit rational diagnosis and therapy of clinical disorders of serum electrolyte concentration. This paper describes diagnostic strategies based upon these principles. The etiology of the myriad factors in hyponatremia is best derived by first measuring serum tonicity and then assessing extracellular fluid volume. The hyper-, iso- and hypotonic hyponatremia are defined, and the hypotonic group is subclassified into hypo-, iso- and hyper volemic forms. The hypernatremias are best categorized by their state of volume expansion. Classification into the hypo-, hyper- and isovolemic hypernatremias simplifies their diagnosis. Metabolic acidoses are classified in terms of the anion gap. Clinical and chemical aspects of increased and normal anion gap acidoses are described. Metabolic alkaloses require a source of new bicarbonate and its retention by the kidney. The means by which new alkali is synthesized and urinary loss prevented serve to effectively classify the alkaloses. Hypokalemic syndromes are defined in terms of associated changes in body potassium. The potassium-depleted states are further subclassified by whether normotension or hypertension is associated. Hyperkalemia is produced by redistribution of cellular and extracellular potassium or by increased body potassium. Defects in the renin-angiotensin-aldosterone-distal renal tubule effector arm usually underlie hyperkalemic states, which are than classified in terms of this regulatory hormonal cascade. Classifications for disordered serum concentrations of calcium, magnesium, phosphorus and uric acid are presented. Hormonal, metabolic and renal regulatory factors form the basis for an organized approach to these disorders.

  13. The Significance of Acid/Base Properties in Drug Discovery

    PubMed Central

    Manallack, David T.; Prankerd, Richard J.; Yuriev, Elizabeth; Oprea, Tudor I.; Chalmers, David K.

    2013-01-01

    While drug discovery scientists take heed of various guidelines concerning drug-like character, the influence of acid/base properties often remains under-scrutinised. Ionisation constants (pKa values) are fundamental to the variability of the biopharmaceutical characteristics of drugs and to underlying parameters such as logD and solubility. pKa values affect physicochemical properties such as aqueous solubility, which in turn influences drug formulation approaches. More importantly, absorption, distribution, metabolism, excretion and toxicity (ADMET) are profoundly affected by the charge state of compounds under varying pH conditions. Consideration of pKa values in conjunction with other molecular properties is of great significance and has the potential to be used to further improve the efficiency of drug discovery. Given the recent low annual output of new drugs from pharmaceutical companies, this review will provide a timely reminder of an important molecular property that influences clinical success. PMID:23099561

  14. Ultrasonic and densimetric titration applied for acid-base reactions.

    PubMed

    Burakowski, Andrzej; Gliński, Jacek

    2014-01-01

    Classical acoustic acid-base titration was monitored using sound speed and density measurements. Plots of these parameters, as well as of the adiabatic compressibility coefficient calculated from them, exhibit changes with the volume of added titrant. Compressibility changes can be explained and quantitatively predicted theoretically in terms of Pasynski theory of non-compressible hydrates combined with that of the additivity of the hydration numbers with the amount and type of ions and molecules present in solution. It also seems that this development could be applied in chemical engineering for monitoring the course of chemical processes, since the applied experimental methods can be carried out almost independently on the medium under test (harmful, aggressive, etc.).

  15. Differential competence of redox-regulatory mechanism under extremes of temperature determines growth performances and cross tolerance in two indica rice cultivars.

    PubMed

    Chakraborty, Ananya; Bhattacharjee, Soumen

    2015-03-15

    The present study investigated the relationship between reactive oxygen species (ROS) accumulation (total and individual), antioxidant and radical scavenging capacity (total and individual), transcript abundance of some antioxidative genes and oxidative damages to membrane protein and lipid in germinating tissues of a salt resistant (SR26B) and salt sensitive (Ratna) rice cultivars under extremes of temperature to elucidate redox-regulatory mechanism governing differential oxidative stress tolerance associated with better growth and yield potential and identification of cross tolerance, if any. Imbibitional heat and chilling stress caused disruption of redox-homeostasis and oxidative damage to a newly assembled membrane system by increasing pro-oxidant/antioxidant ratio and by aggravating membrane lipid peroxidation and protein oxidation [measured in terms of accumulation of thiobarbituric acid reactive substances (TBARS), free carbonyl content (CO groups), and membrane protein thiol level (MPTL)]. A concomitant increase in accumulation of individual ROS (superoxide and hydrogen peroxide) and significant reduction of radical scavenging activity (assessed in terms of ABTS, FRAP and DPPH methods), non-enzymatic and enzymatic anti-oxidative defense [assessed in terms of total thiol content and activities of superoxide dismutase (EC 1.15.1.1), catalase (EC 1.11.1.6), ascorbate peroxidase (EC 1.11.1.11), and glutathione reductase (EC 1.6.4.2)] are also noticed in both the salt sensitive (Ratna) and resistant (SR26B) germinating tissues of rice cultivars. When compared, salt resistant cultivar SR26B was found to suffer significantly less redox-imbalance and related oxidative damages to membrane protein and lipid as compared to salt sensitive cultivar Ratna. The salt tolerant cultivar SR26B resisted imbibitional chilling and heat stress due to its early preparedness to combat oxidative stress by up-regulation of gene expression of anti-oxidative enzymes and better

  16. Bicarbonate-sensing soluble adenylyl cyclase is an essential sensor for acid/base homeostasis

    PubMed Central

    Tresguerres, Martin; Parks, Scott K.; Salazar, Eric; Levin, Lonny R.; Goss, Greg G.; Buck, Jochen

    2009-01-01

    pH homeostasis is essential for life, yet it remains unclear how animals sense their systemic acid/base (A/B) status. Soluble adenylyl cyclase (sAC) is an evolutionary conserved signaling enzyme that produces the second messenger cAMP in response to bicarbonate ions (HCO3−). We cloned the sAC ortholog from the dogfish, a shark that regulates blood A/B by absorbing and secreting protons (H+) and HCO3− at its gills. Similar to mammalian sAC, dogfish soluble adenylyl cyclase (dfsAC) is activated by HCO3− and can be inhibited by two structurally and mechanistically distinct small molecule inhibitors. dfsAC is expressed in the gill epithelium, where the subset of base-secreting cells resides. Injection of inhibitors into animals under alkaline stress confirmed that dfsAC is essential for maintaining systemic pH and HCO3− levels in the whole organism. One of the downstream effects of dfsAC is to promote the insertion of vacuolar proton pumps into the basolateral membrane to absorb H+ into the blood. sAC orthologs are present throughout metazoans, and mammalian sAC is expressed in A/B regulatory organs, suggesting that systemic A/B sensing via sAC is widespread in the animal kingdom. PMID:20018667

  17. Bicarbonate-sensing soluble adenylyl cyclase is an essential sensor for acid/base homeostasis.

    PubMed

    Tresguerres, Martin; Parks, Scott K; Salazar, Eric; Levin, Lonny R; Goss, Greg G; Buck, Jochen

    2010-01-05

    pH homeostasis is essential for life, yet it remains unclear how animals sense their systemic acid/base (A/B) status. Soluble adenylyl cyclase (sAC) is an evolutionary conserved signaling enzyme that produces the second messenger cAMP in response to bicarbonate ions (HCO(3)(-)). We cloned the sAC ortholog from the dogfish, a shark that regulates blood A/B by absorbing and secreting protons (H(+)) and HCO(3)(-) at its gills. Similar to mammalian sAC, dogfish soluble adenylyl cyclase (dfsAC) is activated by HCO(3)(-) and can be inhibited by two structurally and mechanistically distinct small molecule inhibitors. dfsAC is expressed in the gill epithelium, where the subset of base-secreting cells resides. Injection of inhibitors into animals under alkaline stress confirmed that dfsAC is essential for maintaining systemic pH and HCO(3)(-) levels in the whole organism. One of the downstream effects of dfsAC is to promote the insertion of vacuolar proton pumps into the basolateral membrane to absorb H(+) into the blood. sAC orthologs are present throughout metazoans, and mammalian sAC is expressed in A/B regulatory organs, suggesting that systemic A/B sensing via sAC is widespread in the animal kingdom.

  18. Regulatory Anatomy

    PubMed Central

    2015-01-01

    This article proposes the term “safety logics” to understand attempts within the European Union (EU) to harmonize member state legislation to ensure a safe and stable supply of human biological material for transplants and transfusions. With safety logics, I refer to assemblages of discourses, legal documents, technological devices, organizational structures, and work practices aimed at minimizing risk. I use this term to reorient the analytical attention with respect to safety regulation. Instead of evaluating whether safety is achieved, the point is to explore the types of “safety” produced through these logics as well as to consider the sometimes unintended consequences of such safety work. In fact, the EU rules have been giving rise to complaints from practitioners finding the directives problematic and inadequate. In this article, I explore the problems practitioners face and why they arise. In short, I expose the regulatory anatomy of the policy landscape. PMID:26139952

  19. Regulatory Physiology

    NASA Technical Reports Server (NTRS)

    Lane, Helen W.; Whitson, Peggy A.; Putcha, Lakshmi; Baker, Ellen; Smith, Scott M.; Stewart, Karen; Gretebeck, Randall; Nimmagudda, R. R.; Schoeller, Dale A.; Davis-Street, Janis

    1999-01-01

    As noted elsewhere in this report, a central goal of the Extended Duration Orbiter Medical Project (EDOMP) was to ensure that cardiovascular and muscle function were adequate to perform an emergency egress after 16 days of spaceflight. The goals of the Regulatory Physiology component of the EDOMP were to identify and subsequently ameliorate those biochemical and nutritional factors that deplete physiological reserves or increase risk for disease, and to facilitate the development of effective muscle, exercise, and cardiovascular countermeasures. The component investigations designed to meet these goals focused on biochemical and physiological aspects of nutrition and metabolism, the risk of renal (kidney) stone formation, gastrointestinal function, and sleep in space. Investigations involved both ground-based protocols to validate proposed methods and flight studies to test those methods. Two hardware tests were also completed.

  20. Regulatory Mechanisms Underlying Oil Palm Fruit Mesocarp Maturation, Ripening, and Functional Specialization in Lipid and Carotenoid Metabolism1[W][OA

    PubMed Central

    Tranbarger, Timothy J.; Dussert, Stéphane; Joët, Thierry; Argout, Xavier; Summo, Marilyne; Champion, Antony; Cros, David; Omore, Alphonse; Nouy, Bruno; Morcillo, Fabienne

    2011-01-01

    Fruit provide essential nutrients and vitamins for the human diet. Not only is the lipid-rich fleshy mesocarp tissue of the oil palm (Elaeis guineensis) fruit the main source of edible oil for the world, but it is also the richest dietary source of provitamin A. This study examines the transcriptional basis of these two outstanding metabolic characters in the oil palm mesocarp. Morphological, cellular, biochemical, and hormonal features defined key phases of mesocarp development. A 454 pyrosequencing-derived transcriptome was then assembled for the developmental phases preceding and during maturation and ripening, when high rates of lipid and carotenoid biosynthesis occur. A total of 2,629 contigs with differential representation revealed coordination of metabolic and regulatory components. Further analysis focused on the fatty acid and triacylglycerol assembly pathways and during carotenogenesis. Notably, a contig similar to the Arabidopsis (Arabidopsis thaliana) seed oil transcription factor WRINKLED1 was identified with a transcript profile coordinated with those of several fatty acid biosynthetic genes and the high rates of lipid accumulation, suggesting some common regulatory features between seeds and fruits. We also focused on transcriptional regulatory networks of the fruit, in particular those related to ethylene transcriptional and GLOBOSA/PISTILLATA-like proteins in the mesocarp and a central role for ethylene-coordinated transcriptional regulation of type VII ethylene response factors during ripening. Our results suggest that divergence has occurred in the regulatory components in this monocot fruit compared with those identified in the dicot tomato (Solanum lycopersicum) fleshy fruit model. PMID:21487046

  1. Regulatory Mechanisms for Nursing Training and Practice: Meeting Primary Health Care Needs. World Health Organization Technical Report Series No. 738. Report of a WHO Study Group.

    ERIC Educational Resources Information Center

    World Health Organization, Geneva (Switzerland).

    A report on laws and regulations governing nursing education and practice in 81 countries belonging to the World Health Organization and effects on primary health care is presented by an international group of experts. Suggestions for training and licensure are provided to national governments and nursing regulatory bodies to promote the goal of…

  2. Effect of temperature on the acid-base properties of the alumina surface: microcalorimetry and acid-base titration experiments.

    PubMed

    Morel, Jean-Pierre; Marmier, Nicolas; Hurel, Charlotte; Morel-Desrosiers, Nicole

    2006-06-15

    Sorption reactions on natural or synthetic materials that can attenuate the migration of pollutants in the geosphere could be affected by temperature variations. Nevertheless, most of the theoretical models describing sorption reactions are at 25 degrees C. To check these models at different temperatures, experimental data such as the enthalpies of sorption are thus required. Highly sensitive microcalorimeters can now be used to determine the heat effects accompanying the sorption of radionuclides on oxide-water interfaces, but enthalpies of sorption cannot be extracted from microcalorimetric data without a clear knowledge of the thermodynamics of protonation and deprotonation of the oxide surface. However, the values reported in the literature show large discrepancies and one must conclude that, amazingly, this fundamental problem of proton binding is not yet resolved. We have thus undertaken to measure by titration microcalorimetry the heat effects accompanying proton exchange at the alumina-water interface at 25 degrees C. Based on (i) the surface sites speciation provided by a surface complexation model (built from acid-base titrations at 25 degrees C) and (ii) results of the microcalorimetric experiments, calculations have been made to extract the enthalpic variations associated respectively to first and second deprotonation of the alumina surface. Values obtained are deltaH1 = 80+/-10 kJ mol(-1) and deltaH2 = 5+/-3 kJ mol(-1). In a second step, these enthalpy values were used to calculate the alumina surface acidity constants at 50 degrees C via the van't Hoff equation. Then a theoretical titration curve at 50 degrees C was calculated and compared to the experimental alumina surface titration curve. Good agreement between the predicted acid-base titration curve and the experimental one was observed.

  3. The role of acid-base effects on particle charging in apolar media.

    PubMed

    Gacek, Matthew Michael; Berg, John C

    2015-06-01

    The creation and stabilization of electric charge in apolar environments (dielectric constant≈2) have been an area of interest dating back to when an explanation was sought for the occurrence of what are now known as electrokinetic explosions during the pumping of fuels. More recently attention has focused on the charging of suspended particles in such media, underlying such applications as electrophoretic displays (e.g., the Amazon Kindle® reader) and new printing devices (e.g., the HP Indigo® Digital Press). The endeavor has been challenging owing to the complexity of the systems involved and the large number of factors that appear to be important. A number of different, and sometimes conflicting, theories for particle surface charging have been advanced, but most observations obtained in the authors' laboratory, as well as others, appear to be explainable in terms of an acid-base mechanism. Adducts formed between chemical functional groups on the particle surface and monomers of reverse micelle-forming surfactants dissociate, leaving charged groups on the surface, while the counter-charges formed are sequestered in the reverse micelles. For a series of mineral oxides in a given medium with a given surfactant, surface charging (as quantified by the maximum electrophoretic mobility or zeta potential obtained as surfactant concentration is varied) was found to scale linearly with the aqueous PZC (or IEP) values of the oxides. Different surfactants, with the same oxide series, yielded similar behavior, but with different PZC crossover points between negative and positive particle charging, and different slopes of charge vs. PZC. Thus the oxide series could be used as a yardstick to characterize the acid-base properties of the surfactants. This has led directly to the study of other materials, including surface-modified oxides, carbon blacks, pigments (charge transfer complexes), and polymer latices. This review focuses on the acid-base mechanism of particle

  4. Acid Base Equilibrium in a Lipid/Water Gel

    NASA Astrophysics Data System (ADS)

    Streb, Kristina K.; Ilich, Predrag-Peter

    2003-12-01

    A new and original experiment in which partition of bromophenol blue dye between water and lipid/water gel causes a shift in the acid base equilibrium of the dye is described. The dye-absorbing material is a monoglyceride food additive of plant origin that mixes freely with water to form a stable cubic phase gel; the nascent gel absorbs the dye from aqueous solution and converts it to the acidic form. There are three concurrent processes taking place in the experiment: (a) formation of the lipid/water gel, (b) absorption of the dye by the gel, and (c) protonation of the dye in the lipid/water gel environment. As the aqueous solution of the dye is a deep purple-blue color at neutral pH and yellow at acidic pH the result of these processes is visually striking: the strongly green-yellow particles of lipid/water gel are suspended in purple-blue aqueous solution. The local acidity of the lipid/water gel is estimated by UV vis spectrophotometry. This experiment is an example of host-guest (lipid/water gel dye) interaction and is suitable for project-type biophysics, physical chemistry, or biochemistry labs. The experiment requires three, 3-hour lab sessions, two of which must not be separated by more than two days.

  5. Solution influence on biomolecular equilibria - Nucleic acid base associations

    NASA Technical Reports Server (NTRS)

    Pohorille, A.; Pratt, L. R.; Burt, S. K.; Macelroy, R. D.

    1984-01-01

    Various attempts to construct an understanding of the influence of solution environment on biomolecular equilibria at the molecular level using computer simulation are discussed. First, the application of the formal statistical thermodynamic program for investigating biomolecular equilibria in solution is presented, addressing modeling and conceptual simplications such as perturbative methods, long-range interaction approximations, surface thermodynamics, and hydration shell. Then, Monte Carlo calculations on the associations of nucleic acid bases in both polar and nonpolar solvents such as water and carbon tetrachloride are carried out. The solvent contribution to the enthalpy of base association is positive (destabilizing) in both polar and nonpolar solvents while negative enthalpies for stacked complexes are obtained only when the solute-solute in vacuo energy is added to the total energy. The release upon association of solvent molecules from the first hydration layer around a solute to the bulk is accompanied by an increase in solute-solvent energy and decrease in solvent-solvent energy. The techniques presented are expectd to displace less molecular and more heuristic modeling of biomolecular equilibria in solution.

  6. Ionic liquid supported acid/base-catalyzed production of biodiesel.

    PubMed

    Lapis, Alexandre A M; de Oliveira, Luciane F; Neto, Brenno A D; Dupont, Jairton

    2008-01-01

    The transesterification (alcoholysis) reaction was successfully applied to synthesize biodiesel from vegetable oils using imidazolium-based ionic liquids under multiphase acidic and basic conditions. Under basic conditions, the combination of the ionic liquid 1-n-butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide (BMINTf2), alcohols, and K2CO3 (40 mol %) results in the production of biodiesel from soybean oil in high yields (>98%) and purity. H2SO4 immobilized in BMINTf2 efficiently promotes the transesterification reaction of soybean oil and various primary and secondary alcohols. In this multiphase process the acid is almost completely retained in the ionic liquid phase, while the biodiesel forms a separate phase. The recovered ionic liquid containing the acid could be reused at least six times without any significant loss in the biodiesel yield or selectivity. In both catalytic processes (acid and base), the reactions proceed as typical multiphasic systems in which the formed biodiesel accumulates as the upper phase and the glycerol by-product is selectively captured by the alcohol-ionic liquid-acid/base phase. Classical ionic liquids such as 1-n-butyl-3-methylimidazolium tetrafluoroborate and hexafluorophosphate are not stable under these acidic or basic conditions and decompose.

  7. Nucleic acid-based nanoengineering: novel structures for biomedical applications

    PubMed Central

    Li, Hanying; LaBean, Thomas H.; Leong, Kam W.

    2011-01-01

    Nanoengineering exploits the interactions of materials at the nanometre scale to create functional nanostructures. It relies on the precise organization of nanomaterials to achieve unique functionality. There are no interactions more elegant than those governing nucleic acids via Watson–Crick base-pairing rules. The infinite combinations of DNA/RNA base pairs and their remarkable molecular recognition capability can give rise to interesting nanostructures that are only limited by our imagination. Over the past years, creative assembly of nucleic acids has fashioned a plethora of two-dimensional and three-dimensional nanostructures with precisely controlled size, shape and spatial functionalization. These nanostructures have been precisely patterned with molecules, proteins and gold nanoparticles for the observation of chemical reactions at the single molecule level, activation of enzymatic cascade and novel modality of photonic detection, respectively. Recently, they have also been engineered to encapsulate and release bioactive agents in a stimulus-responsive manner for therapeutic applications. The future of nucleic acid-based nanoengineering is bright and exciting. In this review, we will discuss the strategies to control the assembly of nucleic acids and highlight the recent efforts to build functional nucleic acid nanodevices for nanomedicine. PMID:23050076

  8. Acid-base metabolism: implications for kidney stones formation.

    PubMed

    Hess, Bernhard

    2006-04-01

    The physiology and pathophysiology of renal H+ ion excretion and urinary buffer systems are reviewed. The main focus is on the two major conditions related to acid-base metabolism that cause kidney stone formation, i.e., distal renal tubular acidosis (dRTA) and abnormally low urine pH with subsequent uric acid stone formation. Both the entities can be seen on the background of disturbances of the major urinary buffer system, NH3+ <--> NH4+. On the one hand, reduced distal tubular secretion of H+ ions results in an abnormally high urinary pH and either incomplete or complete dRTA. On the other hand, reduced production/availability of NH4+ is the cause of an abnormally low urinary pH, which predisposes to uric acid stone formation. Most recent research indicates that the latter abnormality may be a renal manifestation of the increasingly prevalent metabolic syndrome. Despite opposite deviations from normal urinary pH values, both the dRTA and uric acid stone formation due to low urinary pH require the same treatment, i.e., alkali. In the dRTA, alkali is needed for improving the body's buffer capacity, whereas the goal of alkali treatment in uric acid stone formers is to increase the urinary pH to 6.2-6.8 in order to minimize uric acid crystallization.

  9. Kinetics of acid base catalyzed transesterification of Jatropha curcas oil.

    PubMed

    Jain, Siddharth; Sharma, M P

    2010-10-01

    Out of various non-edible oil resources, Jatropha curcas oil (JCO) is considered as future feedstock for biodiesel production in India. Limited work is reported on the kinetics of transesterification of high free fatty acids containing oil. The present study reports the results of kinetic study of two-step acid base catalyzed transesterification process carried out at an optimum temperature of 65 °C and 50 °C for esterification and transesterification respectively under the optimum methanol to oil ratio of 3:7 (v/v), catalyst concentration 1% (w/w) for H₂SO₄ and NaOH. The yield of methyl ester (ME) has been used to study the effect of different parameters. The results indicate that both esterification and transesterification reaction are of first order with reaction rate constant of 0.0031 min⁻¹ and 0.008 min⁻¹ respectively. The maximum yield of 21.2% of ME during esterification and 90.1% from transesterification of pretreated JCO has been obtained.

  10. Science review: quantitative acid-base physiology using the Stewart model.

    PubMed

    Wooten, E Wrenn

    2004-12-01

    There has been renewed interest in quantifying acid-base disorders in the intensive care unit. One of the methods that has become increasingly used to calculate acid-base balance is the Stewart model. This model is briefly discussed in terms of its origin, its relationship to other methods such as the base excess approach, and the information it provides for the assessment and treatment of acid-base disorders in critically ill patients.

  11. Acid-base bifunctional catalysis of silica-alumina-supported organic amines for carbon-carbon bond-forming reactions.

    PubMed

    Motokura, Ken; Tomita, Mitsuru; Tada, Mizuki; Iwasawa, Yasuhiro

    2008-01-01

    Acid-base bifunctional heterogeneous catalysts were prepared by the reaction of an acidic silica-alumina (SA) surface with silane-coupling reagents possessing amino functional groups. The obtained SA-supported amines (SA-NR2) were characterized by solid-state 13C and 29Si NMR spectroscopy, FT-IR spectroscopy, and elemental analysis. The solid-state NMR spectra revealed that the amines were immobilized by acid-base interactions at the SA surface. The interactions between the surface acidic sites and the immobilized basic amines were weaker than the interactions between the SA and free amines. The catalytic performances of the SA-NR2 catalysts for various carbon-carbon bond-forming reactions, such as cyano-ethoxycarbonylation, the Michael reaction, and the nitro-aldol reaction, were investigated and compared with those of homogeneous and other heterogeneous catalysts. The SA-NR2 catalysts showed much higher catalytic activities for the carbon-carbon bond-forming reactions than heterogeneous amine catalysts using other supports, such as SiO2 and Al2O3. On the other hand, homogeneous amines hardly promoted these reactions under similar reaction conditions, and the catalytic behavior of SA-NR2 was also different from that of MgO, which was employed as a typical heterogeneous base. An acid-base dual-activation mechanism for the carbon-carbon bond-forming reactions is proposed.

  12. Design of Lewis acid-base complex: enhancing the stability and first hyperpolarizability of large excess electron compound.

    PubMed

    Ma, Fang; Miao, Tifang; Zhou, Zhongjun; Sun, Dengming

    2013-11-01

    In the present paper, a new type of Lewis acid-base complex BX3...Li@Calix[4]pyrrole (X = H and F) was designed and assembled based on electride molecule Li@calix[4]pyrrole (as a Lewis base) and the electron deficient molecule BX3 (as a Lewis acid) by employing quantum mechanical calculation. The new Lewis acid-base complex offers an interesting push-excess electron-pull (P-e-P) framework to enhance the stability and nonlinear optical (NLO) response. To measure the nonlinear optical response, static first hyperpolarizabilities (β 0) are exhibited. Significantly, point-face assembled Lewis acid-base complex BF3...Li@Calix[4]pyrrole (II) has considerable first hyperpolarizabilities (β 0) value (1.4  ×  106 a.u.), which is about 117 times larger than reported 11,721 a.u. of electride Li@Calix[4]pyrrole. Further investigations show that, in BX3...Li@Calix[4]pyrrole with P-e-P framework, a strong charge-transfer transition from the ground state to the excited state contributes to the enhancement of first hyperpolarizability. Theory calculation of enthalpies of reaction (ΔrH0) at 298 K demonstrates that it is feasible to synthetize the complexes BX3...Li@Calix[4]pyrrole. In addition, compared with Li@Calix[4]pyrrole, the vertical ionization potential (VIP) and HOMO-LUMO gap of BX3...Li@Calix[4]pyrrole have obviously increased, due to the introduction of the Lewis acid molecule BX3. The novel Lewis acid-base NLO complex possesses not only a large nonlinear optical response but also higher stability.

  13. Acid-base thermochemistry of gaseous aliphatic α-aminoacids.

    PubMed

    Bouchoux, Guy; Huang, Sihua; Inda, Bhawani Singh

    2011-01-14

    Acid-base thermochemistry of isolated aliphatic amino acids (denoted AAA): glycine, alanine, valine, leucine, isoleucine and proline has been examined theoretically by quantum chemical computations at the G3MP2B3 level. Conformational analysis on neutral, protonated and deprotonated species has been used to identify the lowest energy conformers and to estimate the population of conformers expected to be present at thermal equilibrium at 298 K. Comparison of the G3MP2B3 theoretical proton affinities, PA, and ΔH(acid) with experimental results is shown to be correct if experimental thermochemistry is re-evaluated and adapted to the most recent acidity-basicity scales. From this point of view, a set of evaluated proton affinities of 887, 902, 915, 916, 919 and 941 kJ mol(-1), and a set of evaluated ΔH(acid) of 1433, 1430, 1423, 1423, 1422 and 1426 kJ mol(-1), is proposed for glycine, alanine, valine, leucine, isoleucine and proline, respectively. Correlations with structural parameters (Taft's σ(α) polarizability parameter and molecular size) suggest that polarizability of the side chain is the major origin of the increase in PA and decrease in ΔH(acid) along the homologous series glycine, alanine, valine and leucine/isoleucine. Heats of formation of gaseous species AAA, AAAH(+) and [AAA-H](-) were computed at the G3MP2B3 level. The present study provides previously unavailable Δ(f)H°(298) for the ionized species AAAH(+) and [AAA-H](-). Comparison with Benson's estimate, and correlation with molecular size, show that several experimental Δ(f)H°(298) values of neutral or gaseous AAA might be erroneous.

  14. The Regulatory Plan

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-20

    ... [The Regulatory Plan and Unified Agenda of Federal Regulatory and Deregulatory Actions] #7; #7; The Regulatory Plan #7; #7; ] OPEN GOVERNMENT AND EVIDENCE-BASED REGULATION There is a close connection, even an inextricable relationship, between open government and evidence- based regulation. If regulatory choices are based on careful analysis of...

  15. Targeting regulatory T cells.

    PubMed

    Ménétrier-Caux, Christine; Curiel, Tyler; Faget, Julien; Manuel, Manuarii; Caux, Christophe; Zou, Weiping

    2012-03-01

    Cancers express tumor-associated antigens that should elicit immune response to antagonize the tumor growth, but spontaneous immune rejection of established cancer is rare, suggesting an immunosuppressive environment hindering host antitumor immunity. Among the specific and active tumor-mediated mechanisms, CD4(+)CD25(high) T regulatory cells (Treg) are important mediators of active immune evasion in cancer. In this review, we will discuss Treg subpopulations and the mechanisms of their suppressive functions. Treg depletion improves endogenous antitumor immunity and the efficacy of active immunotherapy in animal models for cancer, suggesting that inhibiting Treg function could also improve the limited successes of human cancer immunotherapy. We will also discuss specific strategies for devising effective cancer immunotherapy targeting Treg.

  16. Collaborative Strategies for Teaching Common Acid-Base Disorders to Medical Students

    ERIC Educational Resources Information Center

    Petersen, Marie Warrer; Toksvang, Linea Natalie; Plovsing, Ronni R.; Berg, Ronan M. G.

    2014-01-01

    The ability to recognize and diagnose acid-base disorders is of the utmost importance in the clinical setting. However, it has been the experience of the authors that medical students often have difficulties learning the basic principles of acid-base physiology in the respiratory physiology curriculum, particularly when applying this knowledge to…

  17. The acid-base resistant zone in three dentin bonding systems.

    PubMed

    Inoue, Go; Nikaido, Toru; Foxton, Richard M; Tagami, Junji

    2009-11-01

    An acid-base resistant zone has been found to exist after acid-base challenge adjacent to the hybrid layer using SEM. The aim of this study was to examine the acid-base resistant zone using three different bonding systems. Dentin disks were applied with three different bonding systems, and then a resin composite was light-cured to make dentin disk sandwiches. After acid-base challenge, the polished surfaces were observed using SEM. For both one- and two-step self-etching primer systems, an acid-base resistant zone was clearly observed adjacent to the hybrid layer - but with differing appearances. For the wet bonding system, the presence of an acid-base resistant zone was unclear. This was because the self-etching primer systems etched the dentin surface mildly, such that the remaining mineral phase of dentin and the bonding agent yielded clear acid-base resistant zones. In conclusion, the acid-base resistant zone was clearly observed when self-etching primer systems were used, but not so for the wet bonding system.

  18. Mixed acid-base disorder secondary to topiramate use in traumatic brain injury

    PubMed Central

    Golla, S.; Anandh, U.; Balasubramaniam, A.

    2016-01-01

    We report a case of a man with traumatic brain injury. He was started on to prophylactic topiramate which led to a mixed acid-base disorder. He had severe metabolic acidosis secondary to renal tubular acidification defect and respiratory alkalosis secondary to hyperventilation. Withdrawal of the offending drug led to the prompt resolution of the acid-base disturbance. PMID:27942179

  19. Thai Grade 11 Students' Alternative Conceptions for Acid-Base Chemistry

    ERIC Educational Resources Information Center

    Artdej, Romklao; Ratanaroutai, Thasaneeya; Coll, Richard Kevin; Thongpanchang, Tienthong

    2010-01-01

    This study involved the development of a two-tier diagnostic instrument to assess Thai high school students' understanding of acid-base chemistry. The acid-base diagnostic test (ABDT) comprising 18 items was administered to 55 Grade 11 students in a science and mathematics programme during the second semester of the 2008 academic year. Analysis of…

  20. Using the Logarithmic Concentration Diagram, Log "C", to Teach Acid-Base Equilibrium

    ERIC Educational Resources Information Center

    Kovac, Jeffrey

    2012-01-01

    Acid-base equilibrium is one of the most important and most challenging topics in a typical general chemistry course. This article introduces an alternative to the algebraic approach generally used in textbooks, the graphical log "C" method. Log "C" diagrams provide conceptual insight into the behavior of aqueous acid-base systems and allow…

  1. High School Students' Understanding of Acid-Base Concepts: An Ongoing Challenge for Teachers

    ERIC Educational Resources Information Center

    Damanhuri, Muhd Ibrahim Muhamad; Treagust, David F.; Won, Mihye; Chandrasegaran, A. L.

    2016-01-01

    Using a quantitative case study design, the "Acids-Bases Chemistry Achievement Test" ("ABCAT") was developed to evaluate the extent to which students in Malaysian secondary schools achieved the intended curriculum on acid-base concepts. Responses were obtained from 260 Form 5 (Grade 11) students from five schools to initially…

  2. A Comparative Study of French and Turkish Students' Ideas on Acid-Base Reactions

    ERIC Educational Resources Information Center

    Cokelez, Aytekin

    2010-01-01

    The goal of this comparative study was to determine the knowledge that French and Turkish upper secondary-school students (grades 11 and 12) acquire on the concept of acid-base reactions. Following an examination of the relevant curricula and textbooks in the two countries, 528 students answered six written questions about the acid-base concept.…

  3. Canonical Pedagogical Content Knowledge by Cores for Teaching Acid-Base Chemistry at High School

    ERIC Educational Resources Information Center

    Alvarado, Clara; Cañada, Florentina; Garritz, Andoni; Mellado, Vicente

    2015-01-01

    The topic of acid-base chemistry is one of the oldest in general chemistry courses and it has been almost continuously in academic discussion. The central purpose of documenting the knowledge and beliefs of a group of ten Mexican teachers with experience in teaching acid-base chemistry in high school was to know how they design, prepare and…

  4. Interaction of osmoregulatory and acid-base compensation in white sturgeon (Acipenser transmontanus) during exposure to aquatic hypercarbia and elevated salinity.

    PubMed

    Shaughnessy, Ciaran A; Baker, Dan W; Brauner, Colin J; Morgan, John D; Bystriansky, Jason S

    2015-07-10

    Migratory fishes encounter a variety of environmental conditions, including changes in salinity, temperature, and dissolved gases, and it is important to understand how these fishes are able to acclimate to multiple environmental stressors. The gill is the primary site of both acid-base balance and ion regulation in fishes. Many ion transport mechanisms involved with acid-base compensation are also required for the regulation of plasma Na(+) and Cl(+), the predominant extracellular ions, potentially resulting in a strong interaction between iono- and acid-base regulation. The present study examined the physiological interaction of elevated dissolved CO2 (an acid-base disturbance) on osmoregulation during seawater acclimation (an ionoregulatory disturbance) in juvenile white sturgeon (Acipenser transmontanus). Blood pH (pHe), plasma [HCO3(-)], [Na(+)], [Cl(-)], and osmolality, white muscle water content, and gill Na(+)/K(+)-ATPase (NKA) and Na(+)/K(+)/2Cl(-) cotransporter (NKCC) abundance were examined over a 10-day seawater (SW) acclimation period under normocarbia (NCSW) or during prior and continued exposure to hypercarbia (HCSW), and compared to a normocarbic freshwater (NCFW) control. Hypercarbia induced a severe extracellular acidosis (from pH 7.65 to pH 7.2) in HCSW sturgeon, and these fish had a 2-fold greater rise in plasma osmolarity over NCSW by day 2 of SW exposure. Interestingly, pHe recovery in HCSW was associated more prominently with an elevation in plasma Na(+) prior to osmotic recovery and more prominently with a reduction in plasma Cl(-) following osmotic recovery, indicating a biphasic response as the requirements of osmoregulation transitioned from ion-uptake to ion-excretion throughout SW acclimation. These results imply a prioritization of osmoregulatory recovery over acid-base recovery in this period of combined exposure to acid-base and ionoregulatory disturbances.

  5. Interaction of osmoregulatory and acid-base compensation in white sturgeon (Acipenser transmontanus) during exposure to aquatic hypercarbia and elevated salinity.

    PubMed

    Shaughnessy, Ciaran A; Baker, Dan W; Brauner, Colin J; Morgan, John D; Bystriansky, Jason S

    2015-09-01

    Migratory fishes encounter a variety of environmental conditions, including changes in salinity, temperature and dissolved gases, and it is important to understand how these fishes are able to acclimate to multiple environmental stressors. The gill is the primary site of both acid-base balance and ion regulation in fishes. Many ion transport mechanisms involved with acid-base compensation are also required for the regulation of plasma Na(+) and Cl(+), the predominant extracellular ions, potentially resulting in a strong interaction between ionoregulation and acid-base regulation. The present study examined the physiological interaction of elevated dissolved CO2 (an acid-base disturbance) on osmoregulation during seawater acclimation (an ionoregulatory disturbance) in juvenile white sturgeon (Acipenser transmontanus). Blood pH (pHe), plasma [HCO3 (-)], [Na(+)], [Cl(-)] and osmolality, white muscle water content, and gill Na(+)/K(+)-ATPase (NKA) and Na(+)/K(+)/2Cl(-) co-transporter (NKCC) abundance were examined over a 10 day seawater (SW) acclimation period under normocarbia (NCSW) or during prior and continued exposure to hypercarbia (HCSW), and compared with a normocarbic freshwater (NCFW) control. Hypercarbia induced a severe extracellular acidosis (from pH 7.65 to pH 7.2) in HCSW sturgeon, and these fish had a 2-fold greater rise in plasma osmolarity over NCSW by day 2 of SW exposure. Interestingly, pHe recovery in HCSW was associated more prominently with an elevation in plasma Na(+) prior to osmotic recovery and more prominently with a reduction in plasma Cl(-) following osmotic recovery, indicating a biphasic response as the requirements of osmoregulation transitioned from ion-uptake to ion-excretion throughout SW acclimation. These results imply a prioritization of osmoregulatory recovery over acid-base recovery in this period of combined exposure to acid-base and ionoregulatory disturbances.

  6. Transition State Charge Stabilization and Acid-Base Catalysis of mRNA Cleavage by the Endoribonuclease RelE.

    PubMed

    Dunican, Brian F; Hiller, David A; Strobel, Scott A

    2015-12-01

    The bacterial toxin RelE is a ribosome-dependent endoribonuclease. It is part of a type II toxin-antitoxin system that contributes to antibiotic resistance and biofilm formation. During amino acid starvation, RelE cleaves mRNA in the ribosomal A-site, globally inhibiting protein translation. RelE is structurally similar to microbial RNases that employ general acid-base catalysis to facilitate RNA cleavage. The RelE active site is atypical for acid-base catalysis, in that it is enriched with positively charged residues and lacks the prototypical histidine-glutamate catalytic pair, making the mechanism of mRNA cleavage unclear. In this study, we use a single-turnover kinetic analysis to measure the effect of pH and phosphorothioate substitution on the rate constant for cleavage of mRNA by wild-type RelE and seven active-site mutants. Mutation and thio effects indicate a major role for stabilization of increased negative change in the transition state by arginine 61. The wild-type RelE cleavage rate constant is pH-independent, but the reaction catalyzed by many of the mutants is strongly dependent on pH, suggestive of general acid-base catalysis. pH-rate curves indicate that wild-type RelE operates with the pK(a) of at least one catalytic residue significantly downshifted by the local environment. Mutation of any single active-site residue is sufficient to disrupt this microenvironment and revert the shifted pK(a) back above neutrality. pH-rate curves are consistent with K54 functioning as a general base and R81 as a general acid. The capacity of RelE to effect a large pK(a) shift and facilitate a common catalytic mechanism by uncommon means furthers our understanding of other atypical enzymatic active sites.

  7. Regulatory considerations for biosimilars.

    PubMed

    Nellore, Ranjani

    2010-01-01

    Currently there is considerable interest in the legislative debate around generic biological drugs or "biosimilars" in the EU and US due to the large, lucrative market that it offers to the industry. While some countries have issued a few regulatory guidelines as well as product specific requirements, there is no general consensus as to a single, simple mechanism similar to the bioequivalence determination that leads to approval of generic small molecules all over the world. The inherent complex nature of the molecules, along with complicated manufacturing and analytical techniques to characterize them make it difficult to rely on a single human pharmacokinetic study for assurance of safety and efficacy. In general, the concept of comparability has been used for evaluation of the currently approved "similar" biological where a step by step assessment on the quality, preclinical and clinical aspects is made. In India, the focus is primarily on the availability and affordability of life-saving drugs. In this context every product needs to be evaluated on its own merit irrespective of the innovator brand. The formation of the National Biotechnology Regulatory Authority may provide a step in the right direction for regulation of these complex molecules. However, in order to have an efficient machinery for initial approval and ongoing oversight with a country-specific focus, cooperation with international authorities for granting approvals and continuous risk-benefit review is essential. Several steps are still needed for India to be perceived as a country that leads the world in providing quality biological products.

  8. Regulatory physiology discipline science plan

    NASA Technical Reports Server (NTRS)

    1991-01-01

    The focus of the Regulatory Physiology discipline of the Space Physiology and Countermeasures Program is twofold. First, to determine and study how microgravity and associated factors of space flight affect the regulatory mechanisms by which humans adapt and achieve homeostasis and thereby regulate their ability to respond to internal and external signals; and, second, to study selected physiological systems that have been demonstrated to be influenced by gravity. The Regulatory Physiology discipline, as defined here, is composed of seven subdisciplines: (1) Circadian Rhythms, (2) Endocrinology, (3) Fluid and Electrolyte Regulation, (4) Hematology, (5) Immunology, (6) Metabolism and Nutrition, and (7) Temperature Regulation. The purpose of this Discipline Science Plan is to provide a conceptual strategy for NASA's Life Sciences Division research and development activities in the area of regulatory physiology. It covers the research areas critical to NASA's programmatic requirements for the Extended-Duration Orbiter, Space Station Freedom, and exploration mission science activities. These science activities include ground-based and flight; basic, applied, and operational; and animal and human research and development. This document summarizes the current status of the program, outlines available knowledge, establishes goals and objectives, identifies science priorities, and defines critical questions in regulatory physiology. It contains a general plan that will be used by both NASA Headquarters Program Offices and the field centers to review and plan basic, applied, and operational intramural and extramural research and development activities in this area.

  9. Multiple functions of the crustacean gill: osmotic/ionic regulation, acid-base balance, ammonia excretion, and bioaccumulation of toxic metals.

    PubMed

    Henry, Raymond P; Lucu, Cedomil; Onken, Horst; Weihrauch, Dirk

    2012-01-01

    The crustacean gill is a multi-functional organ, and it is the site of a number of physiological processes, including ion transport, which is the basis for hemolymph osmoregulation; acid-base balance; and ammonia excretion. The gill is also the site by which many toxic metals are taken up by aquatic crustaceans, and thus it plays an important role in the toxicology of these species. This review provides a comprehensive overview of the ecology, physiology, biochemistry, and molecular biology of the mechanisms of osmotic and ionic regulation performed by the gill. The current concepts of the mechanisms of ion transport, the structural, biochemical, and molecular bases of systemic physiology, and the history of their development are discussed. The relationship between branchial ion transport and hemolymph acid-base regulation is also treated. In addition, the mechanisms of ammonia transport and excretion across the gill are discussed. And finally, the toxicology of heavy metal accumulation via the gill is reviewed in detail.

  10. Improving pharmacy students' understanding and long-term retention of acid-base chemistry.

    PubMed

    Roche, Victoria F

    2007-12-15

    Despite repeated exposure to the principles underlying the behavior of organic acids and bases in aqueous solution, some pharmacy students remain confused about the topic of acid-base chemistry. Since a majority of organic drug molecules have acid-base character, the ability to predict their reactivity and the extent to which they will ionize in a given medium is paramount to students' understanding of essentially all aspects of drug action in vivo and in vitro. This manuscript presents a medicinal chemistry lesson in the fundamentals of acid-base chemistry that many pharmacy students have found enlightening and clarifying.

  11. Improving Pharmacy Students' Understanding and Long-term Retention of Acid-Base Chemistry

    PubMed Central

    2007-01-01

    Despite repeated exposure to the principles underlying the behavior of organic acids and bases in aqueous solution, some pharmacy students remain confused about the topic of acid-base chemistry. Since a majority of organic drug molecules have acid-base character, the ability to predict their reactivity and the extent to which they will ionize in a given medium is paramount to students' understanding of essentially all aspects of drug action in vivo and in vitro. This manuscript presents a medicinal chemistry lesson in the fundamentals of acid-base chemistry that many pharmacy students have found enlightening and clarifying PMID:19503706

  12. Acid-base chemistry of frustrated water at protein interfaces.

    PubMed

    Fernández, Ariel

    2016-01-01

    Water molecules at a protein interface are often frustrated in hydrogen-bonding opportunities due to subnanoscale confinement. As shown, this condition makes them behave as a general base that may titrate side-chain ammonium and guanidinium cations. Frustration-based chemistry is captured by a quantum mechanical treatment of proton transference and shown to remove same-charge uncompensated anticontacts at the interface found in the crystallographic record and in other spectroscopic information on the aqueous interface. Such observations are untenable within classical arguments, as hydronium is a stronger acid than ammonium or guanidinium. Frustration enables a directed Grotthuss mechanism for proton transference stabilizing same-charge anticontacts.

  13. Heart rate variability indices as bio-markers of top-down self-regulatory mechanisms: A meta-analytic review.

    PubMed

    Holzman, Jacob B; Bridgett, David J

    2017-03-01

    Theoretical perspectives posit that heart-rate variability (HRV) reflects self-regulatory capacity and therefore can be employed as a bio-marker of top-down self-regulation (the ability to regulate behavioral, cognitive, and emotional processes). However, existing findings of relations between self-regulation and HRV indices are mixed. To clarify the nature of such relations, we conducted a meta-analysis of 123 studies (N=14,347) reporting relations between HRV indices and aspects of top-down self-regulation (e.g., executive functioning, emotion regulation, effortful control). A significant, albeit small, effect was observed (r=0.09) such that greater HRV was related to better top-down self-regulation. Differences in relations were negligible across aspects of self-regulation, self-regulation measurement methods, HRV computational techniques, at-risk compared with healthy samples, and the context of HRV measurement. Stronger relations were observed in older relative to younger samples and in published compared to unpublished studies. These findings generally support the notion that HRV indices can tentatively be employed as bio-markers of top-down self-regulation. Conceptual and theoretical implications, and critical gaps in current knowledge to be addressed by future work, are discussed.

  14. Downregulation of Lnc-Spry1 mediates TGF-β-induced epithelial-mesenchymal transition by transcriptional and posttranscriptional regulatory mechanisms.

    PubMed

    Rodríguez-Mateo, Cristina; Torres, Belén; Gutiérrez, Gabriel; Pintor-Toro, José A

    2017-02-10

    Long non-coding RNAs (lncRNAs) are a class of regulatory genes that participate in a wide range of biological processes, including proliferation, differentiation and development, as well as in a broad spectrum of diseases. Although the role of lncRNAs in TGF-β-induced epithelial-to-mesenchymal transition (EMT) has been well established, little is known about the role of lncRNAs as immediate-early regulators of EMT. Here lnc-Spry1 is identified as an immediate-early regulator of EMT that is downregulated by TGF-β. It is also found that knockdown of lnc-Spry1 promotes a mesenchymal-like phenotype and results in increased cell migration and invasion. In addition, it is shown that lnc-Spry1 depletion preferentially affects the expression of TGF-β-regulated gene targets. Moreover, lnc-Spry1 associates with U2AF65 splicing factor, suggesting a role in alternative splicing. Depletion of lnc-Spry1 induces, as TGF-β, isoform switching of fibroblast growth factor receptors, resulting in FGF-2-sensitive cells. Taken together, these results show that lnc-Spry1 could act as an early mediator of TGF-β signaling and reveal different roles for a lncRNA in modulating transcriptional and posttranscriptional gene expressionCell Death and Differentiation advance online publication, 10 February 2017; doi:10.1038/cdd.2017.9.

  15. Eliminating roles for T-bet and IL-2 but revealing superior activation and proliferation as mechanisms underpinning dominance of regulatory T cells in tumors

    PubMed Central

    Smart, Kathryn; Jones, Emma; Bloom, Anja; Bridgeman, Hayley; McPherson, Rhoanne C.; Turner, Darryl G.; Ladell, Kristin; Price, David A.; O'Connor, Richard A.; Anderton, Stephen M.; Godkin, Andrew J.; Gallimore, Awen M.

    2015-01-01

    Foxp3+ regulatory T cells (Tregs) are often highly enriched within the tumor-infiltrating T cell pool. Using a well-characterised model of carcinogen-induced fibrosarcomas we show that the enriched tumor-infiltrating Treg population comprises largely of CXCR3+ T-bet+ ‘TH1-like’ Tregs which are thymus-derived Helios+ cells. Whilst IL-2 maintains homeostatic ratios of Tregs in lymphoid organs, we found that the perturbation in Treg frequencies in tumors is IL-2 independent. Moreover, we show that the TH1 phenotype of tumor-infiltrating Tregs is dispensable for their ability to influence tumor progression. We did however find that unlike Tconvs, the majority of intra-tumoral Tregs express the activation markers CD69, CD25, ICOS, CD103 and CTLA4 and are significantly more proliferative than Tconvs. Moreover, we have found that CD69+ Tregs are more suppressive than their CD69− counterparts. Collectively, these data indicate superior activation of Tregs in the tumor microenvironment, promoting their suppressive ability and selective proliferation at this site. PMID:26433463

  16. 5-Aminolaevulinic Acid-Based Photodynamic Therapy Restrains Pathological Hyperplasia of Fibroblasts

    PubMed Central

    Wang, Xiaochuan; Cao, Ping; Liu, Jian; Du, Peng; Wang, Zhiqiong; Chen, Wei; Liu, Chang; Wu, Yifei

    2017-01-01

    Background This study aimed to explore whether 5-aminolaevulinic acid-based photodynamic therapy (ALA-PDT) restrains pathological hyperplasia of fibroblasts from hyperplastic scar tissues, and to investigate the potential mechanism. Material/Methods We used MTT assay, flow cytometry, and terminal-deoxynucleotidyl transferase mediated nick-end labeling (TUNEL) to examine the effects of ALA-PDT on proliferation, cell cycle, and apoptosis of fibroblasts isolated from hyperplastic scar tissues. The growth-promoting effect of fibroblasts on vascular endothelial cells was measured by cell co-culture. Real-time PCR and Western blot analysis were performed to detect the expression levels of transforming growth factor-β1 (TGF-β1), α-smooth muscle actin (α-SMA), Collagen I, Collagen III, vascular endothelial growth factor-A (VEGFA), and basic fibroblast growth factor (bFGF). Results ALA-PDT inhibited proliferation delayed cell cycle progress, promoted apoptosis of fibroblasts, and suppressed its growth-promoting effect on vascular endothelial cells, and decreased expression of TGF-β1, α-SMA, Collagen I, Collagen III, VEGFA, and bFGF. Conclusions ALA-PDT effectively restrained pathological hyperplasia of fibroblasts from hyperplastic scar tissues, which may provide a research basis for clinical therapy of hyperplastic scars. PMID:28052053

  17. Comparison of the acid-base properties of ribose and 2'-deoxyribose nucleotides.

    PubMed

    Mucha, Ariel; Knobloch, Bernd; Jezowska-Bojczuk, Małgorzata; Kozłowski, Henryk; Sigel, Roland K O

    2008-01-01

    The extent to which the replacement of a ribose unit by a 2'-deoxyribose unit influences the acid-base properties of nucleotides has not hitherto been determined in detail. In this study, by potentiometric pH titrations in aqueous solution, we have measured the acidity constants of the 5'-di- and 5'-triphosphates of 2'-deoxyguanosine [i.e., of H(2)(dGDP)(-) and H(2)(dGTP)(2-)] as well as of the 5'-mono-, 5'-di-, and 5'-triphosphates of 2'-deoxyadenosine [i.e., of H(2)(dAMP)(+/-), H(2)(dADP)(-), and H(2)(dATP)(2-)]. These 12 acidity constants (of the 56 that are listed) are compared with those of the corresponding ribose derivatives (published data) measured under the same experimental conditions. The results show that all protonation sites in the 2'-deoxynucleotides are more basic than those in their ribose counterparts. The influence of the 2'-OH group is dependent on the number of 5'-phosphate groups as well as on the nature of the purine nucleobase. The basicity of N7 in guanine nucleotides is most significantly enhanced (by about 0.2 pK units), while the effect on the phosphate groups and the N1H or N1H(+) sites is less pronounced but clearly present. In addition, (1)H NMR chemical shift change studies in dependence on pD in D(2)O have been carried out for the dAMP, dADP, and dATP systems, which confirmed the results from the potentiometric pH titrations and showed the nucleotides to be in their anti conformations. Overall, our results are not only of relevance for metal ion binding to nucleotides or nucleic acids, but also constitute an exact basis for the calculation, determination, and understanding of perturbed pK(a) values in DNAzymes and ribozymes, as needed for the delineation of acid-base mechanisms in catalysis.

  18. Envisioning an enzymatic Diels-Alder reaction by in situ acid-base catalyzed diene generation.

    PubMed

    Linder, Mats; Johansson, Adam Johannes; Manta, Bianca; Olsson, Philip; Brinck, Tore

    2012-06-07

    We present and evaluate a new and potentially efficient route for enzyme-mediated Diels-Alder reactions, utilizing general acid-base catalysis. The viability of employing the active site of ketosteroid isomerase is demonstrated.

  19. Superior SWNT dispersion by amino acid based amphiphiles: designing biocompatible cationic nanohybrids.

    PubMed

    Brahmachari, Sayanti; Das, Dibyendu; Das, Prasanta Kumar

    2010-11-28

    Stable aqueous SWNT dispersion up to 92% was achieved using amino acid based amphiphiles through a structure-property investigation. The nanohybrids showed remarkable serum stability and biocompatibility to mammalian cells.

  20. Ultrastructural observation of the acid-base resistant zone of all-in-one adhesives using three different acid-base challenges.

    PubMed

    Tsujimoto, Miho; Nikaido, Toru; Inoue, Go; Sadr, Alireza; Tagami, Junji

    2010-11-01

    The aim of this study was to analyze the ultrastructure of the dentin-adhesive interface using two all-in-one adhesive systems (Clearfil Tri-S Bond, TB; Tokuyama Bond Force, BF) after different acid-base challenges. Three solutions were used as acidic solutions for the acid-base challenges: a demineralizing solution (DS), a phosphoric acid solution (PA), and a hydrochloric acid solution (HCl). After the acid-base challenges, the bonded interfaces were examined by scanning electron microscopy. Thickness of the acid-base resistant zone (ABRZ) created in PA and HCl was thinner than in DS for both adhesive systems. For BF adhesive, an eroded area was observed beneath the ABRZ after immersion in PA and HCl, but not in DS. Conversely for TB adhesive, the eroded area was observed only after immersion in PA. In conclusion, although the ABRZ was observed for both all-in-one adhesive systems, its morphological features were influenced by the ingredients of both the adhesive material and acidic solution.

  1. The angiosperm gibberellin-GID1-DELLA growth regulatory mechanism: how an "inhibitor of an inhibitor" enables flexible response to fluctuating environments.

    PubMed

    Harberd, Nicholas P; Belfield, Eric; Yasumura, Yuki

    2009-05-01

    The phytohormone gibberellin (GA) has long been known to regulate the growth, development, and life cycle progression of flowering plants. However, the molecular GA-GID1-DELLA mechanism that enables plants to respond to GA has only recently been discovered. In addition, studies published in the last few years have highlighted previously unsuspected roles for the GA-GID1-DELLA mechanism in regulating growth response to environmental variables. Here, we review these advances within a general plant biology context and speculate on the answers to some remaining questions. We also discuss the hypothesis that the GA-GID1-DELLA mechanism enables flowering plants to maintain transient growth arrest, giving them the flexibility to survive periods of adversity.

  2. Characterization of regulatory mechanism of Poncirus trifoliata microRNAs on their target genes with an integrated strategy of newly developed PPM-RACE and RLM-RACE.

    PubMed

    Shangguan, Lingfei; Song, Changnian; Han, Jian; Leng, Xiangpeng; Kibet, Korir Nicholas; Mu, Qian; Kayesh, Emrul; Fang, Jinggui

    2014-02-01

    MicroRNAs (miRNAs) play an important role in post-transcriptional gene regulation that involved various biological and metabolic processes. Many extensive studies have been done in model plant species, to discover miRNAs' regulating expression of their target genes and analyze their functions. But, the function of Poncirus trifoliata miRNAs has not been properly investigated. In this study, we employed the RNA ligase-mediated 5' rapid amplification of cDNA ends (RLM-RACE) and the newly developed method called poly (A) polymerase-mediated 3' rapid amplification of cDNA ends (PPM-RACE), which mapped the cleavage site of target mRNAs and detected expression patterns of cleaved fragments that could in turn indicate the regulatory functions of the miRNAs on their target genes. Furthermore, the spatiotemporal expression levels of target genes were analyzed by qRT-PCR, with exhibiting different expression trends from their corresponding miRNAs, thus indicating the cleavage mode of miRNAs on their target genes. The expression patterns of miRNAs, their target mRNAs and cleaved target mRNAs in different organs of juvenile and adult trifoliate orange were studied. The results showed that the expression of miRNAs and their target mRNAs was in a trade-off trend. When the miRNA expression was high, its corresponding target mRNA expression was low, while the cleaved target mRNA expression was high; when the miRNA expression was low, its target mRNA expression was high, while the expression of cleaved target mRNAs follows that of the miRNA. The validation of the cleavage site of target mRNAs and the detection of expression patterns of cleaved fragments can further broaden the knowledge of small RNA-mediated regulation in P. trifoliate.

  3. Sterol regulatory element binding protein-1 expression is suppressed by dietary polyunsaturated fatty acids. A mechanism for the coordinate suppression of lipogenic genes by polyunsaturated fats.

    PubMed

    Xu, J; Nakamura, M T; Cho, H P; Clarke, S D

    1999-08-13

    Polyunsaturated fatty acids (PUFA) coordinately suppress the transcription of a wide array of hepatic lipogenic genes including fatty acid synthase (FAS) and acetyl-CoA carboxylase. Interestingly, the over-expression of sterol regulatory element binding protein-1 (SREBP-1) induces the expression of all of the enzymes suppressed by PUFA. This observation led us to hypothesize that PUFA coordinately inhibit lipogenic gene transcription by suppressing the expression of SREBP-1. Our initial studies revealed that the SREBP-1 and FAS mRNA contents of HepG2 cells were reduced by 20:4(n-6) in a dose-dependent manner (i.e. EC(50) approximately 10 microM), whereas 18:1(n-9) had no effect. Similarly, supplementing a fat-free, high glucose diet with oils rich in (n-6) or (n-3) PUFA reduced the hepatic content of precursor and nuclear SREBP-1 60 and 85%, respectively; however, PUFA had no effect on the nuclear content of upstream stimulatory factor (USF)-1. The PUFA-dependent decrease in nuclear content of mature SREBP-1 was paralleled by a 70-90% suppression in FAS gene transcription. In contrast, dietary 18:1(n-9), i.e. triolein, had no inhibitory influence on the expression of SREBP-1 or FAS. The decrease in hepatic expression of SREBP-1 and FAS associated with PUFA ingestion was mimicked by supplementing the fat-free diet with the PPARalpha-activator, WY 14, 643. Interestingly, nuclear run-on assays revealed that changes in SREBP-1 mRNA abundance were not accompanied by changes in SREBP-1 gene transcription. These results support the concept that PUFA coordinately inhibit lipogenic gene transcription by suppressing the expression of SREBP-1 and that the PUFA regulation of SREBP-1 appears to occur at the post-transcriptional level.

  4. Metabolomics analysis of fungal biofilm development and of arachidonic acid-based quorum sensing mechanism.

    PubMed

    Ząbek, Adam; Junka, Adam; Szymczyk, Patrycja; Wojtowicz, Wojciech; Klimek-Ochab, Magdalena; Młynarz, Piotr

    2017-04-03

    The infections caused by filamentous fungi are becoming worldwide problem of healthcare systems due to increasing drug-resistance of this microorganism and increasing number of immunocompromised nosocomial patients. These infections are related with Aspergillus ability to form sessile communities referred to as the biofilms. The small compounds known as quorum sensing (QS) molecules allow this microorganism to coordinate all processes taking place during biofilm formation and maturation. In the study presented, the HRMAS (1) H NMR metabolomic approach was applied to define composition of extra and intracellular metabolites produced by biofilmic and planktonic (aka free-swimming) cultures of this microorganism and to evaluate impact of quorum sensing molecule, arachidonic acid (AA) on biofilm formation. The Scanning Electron Microscopy was used to confirm Aspergillus ability to form biofilm in vitro, while multivariate and univariate data analysis was applied to analyze data obtained. The Aspergillus strain was able to form strong biofilm structures in vitro. The statistical analysis revealed significant changes of metabolite production depending on Aspergillus culture type (biofilm vs. plankton), time and presence of QS molecules. The data obtained, if developed, might be used in future NMR diagnostics as markers of Aspergillus biofilm-related infections and lead to shorten time between pathogen identification and introduction of treatment.

  5. Predicting the Viscosity of Low VOC Vinyl Ester and Fatty Acid-Based Resins

    DTIC Science & Technology

    2005-12-01

    The sample was titrated with the perchloric acid / peracetic acid solution (Aldrich) until the indicator, 0.1% crystal violet in acetic acid (Aldrich...Predicting the Viscosity of Low VOC Vinyl Ester and Fatty Acid -Based Resins by John J. La Scala, Amutha Jeyarajasingam, Cherise Winston...Aberdeen Proving Ground, MD 21005-5069 ARL-TR-3681 December 2005 Predicting the Viscosity of Low VOC Vinyl Ester and Fatty Acid -Based

  6. Transcription regulatory mechanism of Pitx in the papilla-forming region in the ascidian, Halocynthia roretzi, implies conserved involvement of Otx as the upstream gene in the adhesive organ development of chordates.

    PubMed

    Yoshida, Keita; Ueno, Motoko; Niwano, Tomoko; Saiga, Hidetoshi

    2012-08-01

    Pitx genes play important roles in a variety of developmental processes in vertebrates. In an ascidian species, Halocynthia roretzi, Hr-Pitx, the only Pitx gene of this species, has been reported to be expressed in the left epidermis at the tailbud stage. In the present study, first, we have shown that Hr-Pitx is also expressed in the papilla-forming region at the neurula to tailbud stages, and then we addressed transcription regulatory mechanisms for the expression of Hr-Pitx in the papilla-forming region. We have identified the genomic region ranging from 850 to 1211 bp upstream from the translation start site of the Hr-Pitx gene as an enhancer region that drives the transcription of Hr-Pitx in the papilla-forming region. Within the enhancer region, putative transcriptional factor binding sites for Otx as well as Fox were shown to be required for its activity. Finally, we carried out knocking down experiments of Hr-Otx function using an antisense morpholino oligonucleotide, in which the knocking down of Hr-Otx function resulted in reduction of the enhancer activity and loss of the expression of Hr-Pitx in the papilla-forming region. In Xenopus laevis, it has been reported that Pitx genes are expressed downstream of Otx function during development of the cement gland, an adhesive organ of its larva. Taken together, it is suggested that the expression regulatory mechanism of Pitx, involving Otx as the upstream gene, in the developing adhesive organ is conserved between ascidians and vertebrates.

  7. Interpretation of pH-activity profiles for acid-base catalysis from molecular simulations.

    PubMed

    Dissanayake, Thakshila; Swails, Jason M; Harris, Michael E; Roitberg, Adrian E; York, Darrin M

    2015-02-17

    The measurement of reaction rate as a function of pH provides essential information about mechanism. These rates are sensitive to the pK(a) values of amino acids directly involved in catalysis that are often shifted by the enzyme active site environment. Experimentally observed pH-rate profiles are usually interpreted using simple kinetic models that allow estimation of "apparent pK(a)" values of presumed general acid and base catalysts. One of the underlying assumptions in these models is that the protonation states are uncorrelated. In this work, we introduce the use of constant pH molecular dynamics simulations in explicit solvent (CpHMD) with replica exchange in the pH-dimension (pH-REMD) as a tool to aid in the interpretation of pH-activity data of enzymes and to test the validity of different kinetic models. We apply the methods to RNase A, a prototype acid-base catalyst, to predict the macroscopic and microscopic pK(a) values, as well as the shape of the pH-rate profile. Results for apo and cCMP-bound RNase A agree well with available experimental data and suggest that deprotonation of the general acid and protonation of the general base are not strongly coupled in transphosphorylation and hydrolysis steps. Stronger coupling, however, is predicted for the Lys41 and His119 protonation states in apo RNase A, leading to the requirement for a microscopic kinetic model. This type of analysis may be important for other catalytic systems where the active forms of the implicated general acid and base are oppositely charged and more highly correlated. These results suggest a new way for CpHMD/pH-REMD simulations to bridge the gap with experiments to provide a molecular-level interpretation of pH-activity data in studies of enzyme mechanisms.

  8. Inferring the Impact of Regulatory Mechanisms that Underpin CD8+ T Cell Control of B16 Tumor Growth In vivo Using Mechanistic Models and Simulation

    PubMed Central

    Klinke, David J.; Wang, Qing

    2017-01-01

    A major barrier for broadening the efficacy of immunotherapies for cancer is identifying key mechanisms that limit the efficacy of tumor infiltrating lymphocytes. Yet, identifying these mechanisms using human samples and mouse models for cancer remains a challenge. While interactions between cancer and the immune system are dynamic and non-linear, identifying the relative roles that biological components play in regulating anti-tumor immunity commonly relies on human intuition alone, which can be limited by cognitive biases. To assist natural intuition, modeling and simulation play an emerging role in identifying therapeutic mechanisms. To illustrate the approach, we developed a multi-scale mechanistic model to describe the control of tumor growth by a primary response of CD8+ T cells against defined tumor antigens using the B16 C57Bl/6 mouse model for malignant melanoma. The mechanistic model was calibrated to data obtained following adenovirus-based immunization and validated to data obtained following adoptive transfer of transgenic CD8+ T cells. More importantly, we use simulation to test whether the postulated network topology, that is the modeled biological components and their associated interactions, is sufficient to capture the observed anti-tumor immune response. Given the available data, the simulation results also provided a statistical basis for quantifying the relative importance of different mechanisms that underpin CD8+ T cell control of B16F10 growth. By identifying conditions where the postulated network topology is incomplete, we illustrate how this approach can be used as part of an iterative design-build-test cycle to expand the predictive power of the model. PMID:28101055

  9. Inferring the Impact of Regulatory Mechanisms that Underpin CD8+ T Cell Control of B16 Tumor Growth In vivo Using Mechanistic Models and Simulation.

    PubMed

    Klinke, David J; Wang, Qing

    2016-01-01

    A major barrier for broadening the efficacy of immunotherapies for cancer is identifying key mechanisms that limit the efficacy of tumor infiltrating lymphocytes. Yet, identifying these mechanisms using human samples and mouse models for cancer remains a challenge. While interactions between cancer and the immune system are dynamic and non-linear, identifying the relative roles that biological components play in regulating anti-tumor immunity commonly relies on human intuition alone, which can be limited by cognitive biases. To assist natural intuition, modeling and simulation play an emerging role in identifying therapeutic mechanisms. To illustrate the approach, we developed a multi-scale mechanistic model to describe the control of tumor growth by a primary response of CD8+ T cells against defined tumor antigens using the B16 C57Bl/6 mouse model for malignant melanoma. The mechanistic model was calibrated to data obtained following adenovirus-based immunization and validated to data obtained following adoptive transfer of transgenic CD8+ T cells. More importantly, we use simulation to test whether the postulated network topology, that is the modeled biological components and their associated interactions, is sufficient to capture the observed anti-tumor immune response. Given the available data, the simulation results also provided a statistical basis for quantifying the relative importance of different mechanisms that underpin CD8+ T cell control of B16F10 growth. By identifying conditions where the postulated network topology is incomplete, we illustrate how this approach can be used as part of an iterative design-build-test cycle to expand the predictive power of the model.

  10. Potential Nociceptive Regulatory Effect of Probiotic Lactobacillus rhamnosus PB01 (DSM 14870) on Mechanical Sensitivity in Diet-Induced Obesity Model

    PubMed Central

    Brandsborg, Erik

    2016-01-01

    Treatments for obesity have been shown to reduce pain secondary to weight loss. Intestinal microbiota, as an endogenous factor, influences obesity and pain sensitivity but the effect of oral probiotic supplementation on musculoskeletal pain perception has not been studied systematically. The present study examined the effect of a single daily oral dose (1 × 109 CFU) of probiotics (Lactobacillus rhamnosus PB01, DSM14870) supplement on mechanical pain thresholds in behaving diet-induced obese (DIO) mice and their normal weight (NW) controls. The mice (N = 24, 6-week-old male) were randomly divided into four groups on either standard or high fat diet with and without probiotic supplementation. Both DIO and NW groups with probiotic supplementation maintained an insignificant weight gain while the control groups gained significant weight (P < 0.05). Similarly, both DIO and NW probiotics supplemented groups demonstrated a significantly (P < 0.05) lower sensitivity to mechanical stimulation compared to their corresponding control. The results of this study suggest a protective effect of probiotics on nociception circuits, which propose a direct result of the weight reduction or an indirect result of anti-inflammatory properties of the probiotics. Deciphering the exact underlying mechanism of the weight loss and lowering nociception effect of the probiotic applied in this study require further investigation. PMID:27647980

  11. Development of polylactic acid-based materials through reactive modification

    NASA Astrophysics Data System (ADS)

    Fowlks, Alison Camille

    2009-12-01

    Polylactic acid (PLA)-based systems have shown to be of great potential for the development of materials requiring biobased content, biodegradation, and sufficient properties. The efforts in this study are directed toward addressing the current research need to overcome some of the inherent drawbacks of PLA. To meet this need, reactive extrusion was employed to develop new materials based on PLA by grafting, compounding, and polymer blending. In the first part of this work, maleic anhydride (MA) was grafted onto PLA by reactive extrusion. Two structurally different peroxides were used to initiate grafting and results were reported on the basis of grafting, molecular weight, and thermal behavior. An inverse relationship between degree of grafting and molecular weight was established. It was also found that, regardless of peroxide type, there is an optimum peroxid-to-MA ratio of 0.5:2 that promotes maximum grafting, beyond which degradation reactions become predominant. Overall, it was found that the maleated copolymer (MAPLA) could be used as an interfacial modifier in PLA-based composites. Therefore, MAPLA was incorporated into PLA-talc composites in varying concentrations. The influence of the MAPLA addition on the mechanical and thermal behavior was investigated. When added in an optimum concentration, MAPLA improved the tensile strength and crystallization of the composite. Furthermore, microscopic observation confirmed the compatibilization effect of MAPLA in PLA-talc composites. Vinyltrimethoxysilane was free-radically grafted onto the backbone of PLA and subsequently moisture crosslinked. The effects of monomer, initiator, and catalyst concentration on the degree of crosslinking and the mechanical and thermal properties were investigated. The presence of a small amount of catalyst showed to be a major contributor to the crosslinking formation in the time frame investigated, shown by an increase in gel content and decrease in crystallinity. Furthermore

  12. Polylactic Acid-Based Polymer Blends for Durable Applications

    NASA Astrophysics Data System (ADS)

    Finniss, Adam

    There has been considerable scientific interest in both research and commercial communities as of late in the area of biologically based or sourced plastics. As the consumption of petroleum rises and concerns about climate change increase, this field is likely to grow even larger. One bioplastic that has received a great deal of attention is polylactic acid (PLA). In the past, this material was used mainly in medical or specialty applications, but advancements in manufacturing have led to a desire to use PLA more widely, especially in durable applications. Unfortunately, PLA has several drawbacks that hinder more widespread usage of the material as a durable item: it has low ductility and impact strength in bulk applications, along with poor stability in the face of heat, humidity or liquid media. To combat these deficiencies, a number of techniques were investigated. Samples were annealed to create crystalline domains that would improve mechanical properties and reduce diffusion, blended with graphene to create barriers to diffusion throughout the material, or compounded with a polycarbonate (PC) polymer phase to protect the PLA phase and to enhance the mechanical properties of the blend. If a material containing biologically sourced components with good mechanical properties can be created, it would be desirable for durable uses such as electronics components or as an automotive grade resin. Crystallization experiments were carried out in a differential scanning calorimeter to determine the effects of heat treatment and additives on the rather slow crystallization kinetics of PLA polymer. It was determined that the blending in of the PC phase did not significantly alter the kinetics or mechanism of crystal growth. The addition of graphene to any PC/PLA formulation served as a nucleating agent which speeded up the crystallization kinetics markedly, in some cases by several orders of magnitude. Results obtained from these experiments were internally consistent

  13. Regulatory Considerations for Biosimilars

    PubMed Central

    Nellore, Ranjani

    2010-01-01

    Currently there is considerable interest in the legislative debate around generic biological drugs or “biosimilars” in the EU and US due to the large, lucrative market that it offers to the industry. While some countries have issued a few regulatory guidelines as well as product specific requirements, there is no general consensus as to a single, simple mechanism similar to the bioequivalence determination that leads to approval of generic small molecules all over the world. The inherent complex nature of the molecules, along with complicated manufacturing and analytical techniques to characterize them make it difficult to rely on a single human pharmacokinetic study for assurance of safety and efficacy. In general, the concept of comparability has been used for evaluation of the currently approved “similar” biological where a step by step assessment on the quality, preclinical and clinical aspects is made. In India, the focus is primarily on the availability and affordability of life-saving drugs. In this context every product needs to be evaluated on its own merit irrespective of the innovator brand. The formation of the National Biotechnology Regulatory Authority may provide a step in the right direction for regulation of these complex molecules. However, in order to have an efficient machinery for initial approval and ongoing oversight with a country-specific focus, cooperation with international authorities for granting approvals and continuous risk-benefit review is essential. Several steps are still needed for India to be perceived as a country that leads the world in providing quality biological products. PMID:21829775

  14. CD4(+)CD25(+) T regulatory cells inhibit CD8(+) IFN-gamma production during acute and chronic FIV infection utilizing a membrane TGF-beta-dependent mechanism.

    PubMed

    Fogle, Jonathan E; Mexas, Angela M; Tompkins, Wayne A; Tompkins, Mary B

    2010-02-01

    CD8(+) lymphocytes are critical to the control and elimination of viral pathogens. Impaired CD8(+) responses are well recognized in lentiviral infections; however, the mechanisms underlying CD8(+) impairment remain elusive. Using the feline immunodeficiency virus (FIV) model for human AIDS, we reported previously that CD4(+)CD25(+) Treg cells in both the acute and long-term, asymptomatic phase of infection are constitutively activated and suppress CD4(+)CD25(-) T cell responses. In the current study, we have demonstrated that CD4(+)CD25(+) Treg cells suppress CD8(+) responses to immune stimulation during both the acute and chronic, asymptomatic phase of FIV infection and that the mechanism of suppression may be mediated by membrane-associated TGF-beta (mTGF-beta) on CD4(+)CD25(+) lymphocytes. Depletion of CD4(+)CD25(+) lymphocytes from lymph node suspensions significantly enhanced production of IFN-gamma during the acute phase of infection and coculture of CD8(+) lymphocytes with CD4(+)CD25(+) lymphocytes resulted in suppression of CD8(+) IFN-gamma during both the acute and chronic stages of infection. FACS analysis indicated that there was TGF-betaRII upregulation on CD8(+) cells from FIV(+) cats during the acute and chronic stage of infection. In addition, there was upregulation of mTGF-beta on the CD4(+)CD25(+) subset in chronically infected cats. In support of activation of the TGF-beta signaling pathway, Western blotting showed Smad 2 phosphorylation in CD8(+) targets following CD4(+)CD25(+)/CD8(+) coculture. These results demonstrate the suppressive effect CD4(+)CD25(+) Treg cells have on the CD8(+) immune response during the acute and chronic stages of FIV infection and suggest that the mechanism of suppression may be mediated by mTGF-beta.

  15. CD4+CD25+ T Regulatory Cells Inhibit CD8+ IFN-γ Production During Acute and Chronic FIV Infection Utilizing a Membrane TGF-β-Dependent Mechanism

    PubMed Central

    Fogle, Jonathan E.; Mexas, Angela M.; Tompkins, Wayne A.

    2010-01-01

    Abstract CD8+ lymphocytes are critical to the control and elimination of viral pathogens. Impaired CD8+ responses are well recognized in lentiviral infections; however, the mechanisms underlying CD8+ impairment remain elusive. Using the feline immunodeficiency virus (FIV) model for human AIDS, we reported previously that CD4+CD25+ Treg cells in both the acute and long-term, asymptomatic phase of infection are constitutively activated and suppress CD4+CD25– T cell responses. In the current study, we have demonstrated that CD4+CD25+ Treg cells suppress CD8+ responses to immune stimulation during both the acute and chronic, asymptomatic phase of FIV infection and that the mechanism of suppression may be mediated by membrane-associated TGF-β (mTGF-β) on CD4+CD25+ lymphocytes. Depletion of CD4+CD25+ lymphocytes from lymph node suspensions significantly enhanced production of IFN-γ during the acute phase of infection and coculture of CD8+ lymphocytes with CD4+CD25+ lymphocytes resulted in suppression of CD8+ IFN-γ during both the acute and chronic stages of infection. FACS analysis indicated that there was TGF-βRII upregulation on CD8+ cells from FIV+ cats during the acute and chronic stage of infection. In addition, there was upregulation of mTGF-β on the CD4+CD25+ subset in chronically infected cats. In support of activation of the TGF-β signaling pathway, Western blotting showed Smad 2 phosphorylation in CD8+ targets following CD4+CD25+/CD8+ coculture. These results demonstrate the suppressive effect CD4+CD25+ Treg cells have on the CD8+ immune response during the acute and chronic stages of FIV infection and suggest that the mechanism of suppression may be mediated by mTGF-β. PMID:20156102

  16. Genomics in the land of regulatory science.

    PubMed

    Tong, Weida; Ostroff, Stephen; Blais, Burton; Silva, Primal; Dubuc, Martine; Healy, Marion; Slikker, William

    2015-06-01

    Genomics science has played a major role in the generation of new knowledge in the basic research arena, and currently question arises as to its potential to support regulatory processes. However, the integration of genomics in the regulatory decision-making process requires rigorous assessment and would benefit from consensus amongst international partners and research communities. To that end, the Global Coalition for Regulatory Science Research (GCRSR) hosted the fourth Global Summit on Regulatory Science (GSRS2014) to discuss the role of genomics in regulatory decision making, with a specific emphasis on applications in food safety and medical product development. Challenges and issues were discussed in the context of developing an international consensus for objective criteria in the analysis, interpretation and reporting of genomics data with an emphasis on transparency, traceability and "fitness for purpose" for the intended application. It was recognized that there is a need for a global path in the establishment of a regulatory bioinformatics framework for the development of transparent, reliable, reproducible and auditable processes in the management of food and medical product safety risks. It was also recognized that training is an important mechanism in achieving internationally consistent outcomes. GSRS2014 provided an effective venue for regulators andresearchers to meet, discuss common issues, and develop collaborations to address the challenges posed by the application of genomics to regulatory science, with the ultimate goal of wisely integrating novel technical innovations into regulatory decision-making.

  17. A Negative Regulatory Mechanism Involving 14-3-3ζ Limits Signaling Downstream of ROCK to Regulate Tissue Stiffness in Epidermal Homeostasis.

    PubMed

    Kular, Jasreen; Scheer, Kaitlin G; Pyne, Natasha T; Allam, Amr H; Pollard, Anthony N; Magenau, Astrid; Wright, Rebecca L; Kolesnikoff, Natasha; Moretti, Paul A; Wullkopf, Lena; Stomski, Frank C; Cowin, Allison J; Woodcock, Joanna M; Grimbaldeston, Michele A; Pitson, Stuart M; Timpson, Paul; Ramshaw, Hayley S; Lopez, Angel F; Samuel, Michael S

    2015-12-21

    ROCK signaling causes epidermal hyper-proliferation by increasing ECM production, elevating dermal stiffness, and enhancing Fak-mediated mechano-transduction signaling. Elevated dermal stiffness in turn causes ROCK activation, establishing mechano-reciprocity, a positive feedback loop that can promote tumors. We have identified a negative feedback mechanism that limits excessive ROCK signaling during wound healing and is lost in squamous cell carcinomas (SCCs). Signal flux through ROCK was selectively tuned down by increased levels of 14-3-3ζ, which interacted with Mypt1, a ROCK signaling antagonist. In 14-3-3ζ(-/-) mice, unrestrained ROCK signaling at wound margins elevated ECM production and reduced ECM remodeling, increasing dermal stiffness and causing rapid wound healing. Conversely, 14-3-3ζ deficiency enhanced cutaneous SCC size. Significantly, inhibiting 14-3-3ζ with a novel pharmacological agent accelerated wound healing 2-fold. Patient samples of chronic non-healing wounds overexpressed 14-3-3ζ, while cutaneous SCCs had reduced 14-3-3ζ. These results reveal a novel 14-3-3ζ-dependent mechanism that negatively regulates mechano-reciprocity, suggesting new therapeutic opportunities.

  18. Deep Sequencing-Based Transcriptome Analysis Reveals the Regulatory Mechanism of Bemisia tabaci (Hemiptera: Aleyrodidae) Nymph Parasitized by Encarsia sophia (Hymenoptera: Aphelinidae)

    PubMed Central

    Wang, Ran; Li, Fei; Zhang, Fan; Wang, Su

    2016-01-01

    The whitefly Bemisia tabaci is a genetically diverse complex with multiple cryptic species, and some are the most destructive invasive pests of many ornamentals and crops worldwide. Encarsia sophia is an autoparasitoid wasp that demonstrated high efficiency as bio-control agent of whiteflies. However, the immune mechanism of B. tabaci parasitization by E. sophia is unknown. In order to investigate immune response of B. tabaci to E. Sophia parasitization, the transcriptome of E. sophia parasitized B. tabaci nymph was sequenced by Illumina sequencing. De novo assembly generated 393,063 unigenes with average length of 616 bp, in which 46,406 unigenes (15.8% of all unigenes) were successfully mapped. Parasitization by E. sophia had significant effects on the transcriptome profile of B. tabaci nymph. A total of 1482 genes were significantly differentially expressed, of which 852 genes were up-regulated and 630 genes were down-regulated. These genes were mainly involved in immune response, development, metabolism and host signaling pathways. At least 52 genes were found to be involved in the host immune response, 33 genes were involved in the development process, and 29 genes were involved in host metabolism. Taken together, the assembled and annotated transcriptome sequences provided a valuable genomic resource for further understanding the molecular mechanism of immune response of B. tabaci parasitization by E. sophia. PMID:27332546

  19. Genome-Wide Mapping of Targets of Maize Histone Deacetylase HDA101 Reveals Its Function and Regulatory Mechanism during Seed Development[OPEN

    PubMed Central

    Yang, Hua; Liu, Xinye; Xin, Mingming; Du, Jinkun; Hu, Zhaorong; Peng, HuiRu; Sun, Qixin; Ni, Zhongfu; Yao, Yingyin

    2016-01-01

    Histone deacetylases (HDACs) regulate histone acetylation levels by removing the acetyl group from lysine residues. The maize (Zea mays) HDAC HDA101 influences several aspects of development, including kernel size; however, the molecular mechanism by which HDA101 affects kernel development remains unknown. In this study, we find that HDA101 regulates the expression of transfer cell-specific genes, suggesting that their misregulation may be associated with the defects in differentiation of endosperm transfer cells and smaller kernels observed in hda101 mutants. To investigate HDA101 function during the early stages of seed development, we performed genome-wide mapping of HDA101 binding sites. We observed that, like mammalian HDACs, HDA101 mainly targets highly and intermediately expressed genes. Although loss of HDA101 can induce histone hyperacetylation of its direct targets, this often does not involve variation in transcript levels. A small subset of inactive genes that must be negatively regulated during kernel development is also targeted by HDA101 and its loss leads to hyperacetylation and increased expression of these inactive genes. Finally, we report that HDA101 interacts with members of different chromatin remodeling complexes, such as NFC103/MSI1 and SNL1/SIN3-like protein corepressors. Taken together, our results reveal a complex genetic network regulated by HDA101 during seed development and provide insight into the different mechanisms of HDA101-mediated regulation of transcriptionally active and inactive genes. PMID:26908760

  20. Regulatory mechanism of length-dependent activation in skinned porcine ventricular muscle: role of thin filament cooperative activation in the Frank-Starling relation.

    PubMed

    Terui, Takako; Shimamoto, Yuta; Yamane, Mitsunori; Kobirumaki, Fuyu; Ohtsuki, Iwao; Ishiwata, Shin'ichi; Kurihara, Satoshi; Fukuda, Norio

    2010-10-01

    Cardiac sarcomeres produce greater active force in response to stretch, forming the basis of the Frank-Starling mechanism of the heart. The purpose of this study was to provide the systematic understanding of length-dependent activation by investigating experimentally and mathematically how the thin filament "on-off" switching mechanism is involved in its regulation. Porcine left ventricular muscles were skinned, and force measurements were performed at short (1.9 µm) and long (2.3 µm) sarcomere lengths. We found that 3 mM MgADP increased Ca(2+) sensitivity of force and the rate of rise of active force, consistent with the increase in thin filament cooperative activation. MgADP attenuated length-dependent activation with and without thin filament reconstitution with the fast skeletal troponin complex (sTn). Conversely, 20 mM of inorganic phosphate (Pi) decreased Ca(2+) sensitivity of force and the rate of rise of active force, consistent with the decrease in thin filament cooperative activation. Pi enhanced length-dependent activation with and without sTn reconstitution. Linear regression analysis revealed that the magnitude of length-dependent activation was inversely correlated with the rate of rise of active force. These results were quantitatively simulated by a model that incorporates the Ca(2+)-dependent on-off switching of the thin filament state and interfilament lattice spacing modulation. Our model analysis revealed that the cooperativity of the thin filament on-off switching, but not the Ca(2+)-binding ability, determines the magnitude of the Frank-Starling effect. These findings demonstrate that the Frank-Starling relation is strongly influenced by thin filament cooperative activation.

  1. Regulatory mechanism of length-dependent activation in skinned porcine ventricular muscle: role of thin filament cooperative activation in the Frank-Starling relation

    PubMed Central

    Terui, Takako; Shimamoto, Yuta; Yamane, Mitsunori; Kobirumaki, Fuyu; Ohtsuki, Iwao; Ishiwata, Shin’ichi; Kurihara, Satoshi

    2010-01-01

    Cardiac sarcomeres produce greater active force in response to stretch, forming the basis of the Frank-Starling mechanism of the heart. The purpose of this study was to provide the systematic understanding of length-dependent activation by investigating experimentally and mathematically how the thin filament “on–off” switching mechanism is involved in its regulation. Porcine left ventricular muscles were skinned, and force measurements were performed at short (1.9 µm) and long (2.3 µm) sarcomere lengths. We found that 3 mM MgADP increased Ca2+ sensitivity of force and the rate of rise of active force, consistent with the increase in thin filament cooperative activation. MgADP attenuated length-dependent activation with and without thin filament reconstitution with the fast skeletal troponin complex (sTn). Conversely, 20 mM of inorganic phosphate (Pi) decreased Ca2+ sensitivity of force and the rate of rise of active force, consistent with the decrease in thin filament cooperative activation. Pi enhanced length-dependent activation with and without sTn reconstitution. Linear regression analysis revealed that the magnitude of length-dependent activation was inversely correlated with the rate of rise of active force. These results were quantitatively simulated by a model that incorporates the Ca2+-dependent on–off switching of the thin filament state and interfilament lattice spacing modulation. Our model analysis revealed that the cooperativity of the thin filament on–off switching, but not the Ca2+-binding ability, determines the magnitude of the Frank-Starling effect. These findings demonstrate that the Frank-Starling relation is strongly influenced by thin filament cooperative activation. PMID:20876361

  2. RhoA S-nitrosylation as a regulatory mechanism influencing endothelial barrier function in response to G(+)-bacterial toxins.

    PubMed

    Chen, F; Wang, Y; Rafikov, R; Haigh, S; Zhi, W B; Kumar, S; Doulias, P T; Rafikova, O; Pillich, H; Chakraborty, T; Lucas, R; Verin, A D; Catravas, J D; She, J X; Black, S M; Fulton, D J R

    2017-03-01

    Disruption of the endothelial barrier in response to Gram positive (G(+)) bacterial toxins is a major complication of acute lung injury (ALI) and can be further aggravated by antibiotics which stimulate toxin release. The integrity of the pulmonary endothelial barrier is mediated by the balance of disruptive forces such as the small GTPase RhoA, and protective forces including endothelium-derived nitric oxide (NO). How NO protects against the barrier dysfunction is incompletely understood and our goal was to determine whether NO and S-nitrosylation can modulate RhoA activity and whether this mechanism is important for G(+) toxin-induced microvascular permeability. We found that the G(+) toxin listeriolysin-O (LLO) increased RhoA activity and that NO and S-NO donors inhibit RhoA activity. RhoA was robustly S-nitrosylated as determined by biotin-switch and mercury column analysis. MS revealed that three primary cysteine residues are S-nitrosylated including cys16, cys20 and cys159. Mutation of these residues to serine diminished S-nitrosylation to endogenous NO and mutant RhoA was less sensitive to inhibition by S-NO. G(+)-toxins stimulated the denitrosylation of RhoA which was not mediated by S-nitrosoglutathione reductase (GSNOR), thioredoxin (TRX) or thiol-dependent enzyme activity but was instead stimulated directly by elevated calcium levels. Calcium-promoted the direct denitrosylation of WT but not mutant RhoA and mutant RhoA adenovirus was more effective than WT in disrupting the barrier integrity of human lung microvascular endothelial cells. In conclusion, we reveal a novel mechanism by which NO and S-nitrosylation reduces RhoA activity which may be of significance in the management of pulmonary endothelial permeability induced by G(+)-toxins.

  3. Characterization of the functional role of allosteric site residue Asp102 in the regulatory mechanism of human mitochondrial NAD(P)+-dependent malate dehydrogenase (malic enzyme).

    PubMed

    Hung, Hui-Chih; Kuo, Meng-Wei; Chang, Gu-Gang; Liu, Guang-Yaw

    2005-11-15

    Human mitochondrial NAD(P)+-dependent malate dehydrogenase (decarboxylating) (malic enzyme) can be specifically and allosterically activated by fumarate. X-ray crystal structures have revealed conformational changes in the enzyme in the absence and in the presence of fumarate. Previous studies have indicated that fumarate is bound to the allosteric pocket via Arg67 and Arg91. Mutation of these residues almost abolishes the activating effect of fumarate. However, these amino acid residues are conserved in some enzymes that are not activated by fumarate, suggesting that there may be additional factors controlling the activation mechanism. In the present study, we tried to delineate the detailed molecular mechanism of activation of the enzyme by fumarate. Site-directed mutagenesis was used to replace Asp102, which is one of the charged amino acids in the fumarate binding pocket and is not conserved in other decarboxylating malate dehydrogenases. In order to explore the charge effect of this residue, Asp102 was replaced by alanine, glutamate or lysine. Our experimental data clearly indicate the importance of Asp102 for activation by fumarate. Mutation of Asp102 to Ala or Lys significantly attenuated the activating effect of fumarate on the enzyme. Kinetic parameters indicate that the effect of fumarate was mainly to decrease the K(m) values for malate, Mg2+ and NAD+, but it did not notably elevate kcat. The apparent substrate K(m) values were reduced by increasing concentrations of fumarate. Furthermore, the greatest effect of fumarate activation was apparent at low malate, Mg2+ or NAD+ concentrations. The K(act) values were reduced with increasing concentrations of malate, Mg2+ and NAD+. The Asp102 mutants, however, are much less sensitive to regulation by fumarate. Mutation of Asp102 leads to the desensitization of the co-operative effect between fumarate and substrates of the enzyme.

  4. Regulatory RNAs in Planarians.

    PubMed

    Pawlicka, Kamila; Perrigue, Patrick M; Barciszewski, Jan

    2016-01-01

    The full scope of regulatory RNA evolution and function in epigenetic processes is still not well understood. The development of planarian flatworms to be used as a simple model organism for research has shown a great potential to address gaps in the knowledge in this field of study. The genomes of planarians encode a wide array of regulatory RNAs that function in gene regulation. Here, we review planarians as a suitable model organism for the identification and function of regulatory RNAs.

  5. Mitochondrial TCA cycle intermediates regulate body fluid and acid-base balance.

    PubMed

    Peti-Peterdi, János

    2013-07-01

    Intrarenal control mechanisms play an important role in the maintenance of body fluid and electrolyte balance and pH homeostasis. Recent discoveries of new ion transport and regulatory pathways in the distal nephron and collecting duct system have helped to better our understanding of these critical kidney functions and identified new potential therapeutic targets and approaches. In this issue of the JCI, Tokonami et al. report on the function of an exciting new paracrine mediator, the mitochondrial the citric acid(TCA) cycle intermediate α-ketoglutarate (αKG), which via its OXGR1 receptor plays an unexpected, nontraditional role in the adaptive regulation of renal HCO(3⁻) secretion and salt reabsorption.

  6. Mitochondrial TCA cycle intermediates regulate body fluid and acid-base balance

    PubMed Central

    Peti-Peterdi, János

    2013-01-01

    Intrarenal control mechanisms play an important role in the maintenance of body fluid and electrolyte balance and pH homeostasis. Recent discoveries of new ion transport and regulatory pathways in the distal nephron and collecting duct system have helped to better our understanding of these critical kidney functions and identified new potential therapeutic targets and approaches. In this issue of the JCI, Tokonami et al. report on the function of an exciting new paracrine mediator, the mitochondrial the citric acid (TCA) cycle intermediate α-ketoglutarate (αKG), which via its OXGR1 receptor plays an unexpected, nontraditional role in the adaptive regulation of renal HCO3– secretion and salt reabsorption. PMID:23926603

  7. Regulatory Information By Sector

    EPA Pesticide Factsheets

    Find environmental regulatory, compliance, & enforcement information for various business, industry and government sectors, listed by NAICS code. Sectors include agriculture, automotive, petroleum manufacturing, oil & gas extraction & other manufacturing

  8. Salicylic Acid-Based Polymers for Guided Bone Regeneration Using Bone Morphogenetic Protein-2

    PubMed Central

    Subramanian, Sangeeta; Mitchell, Ashley; Yu, Weiling; Snyder, Sabrina; Uhrich, Kathryn

    2015-01-01

    Bone morphogenetic protein-2 (BMP-2) is used clinically to promote spinal fusion, treat complex tibia fractures, and to promote bone formation in craniomaxillofacial surgery. Excessive bone formation at sites where BMP-2 has been applied is an established complication and one that could be corrected by guided tissue regeneration methods. In this study, anti-inflammatory polymers containing salicylic acid [salicylic acid-based poly(anhydride-ester), SAPAE] were electrospun with polycaprolactone (PCL) to create thin flexible matrices for use as guided bone regeneration membranes. SAPAE polymers hydrolyze to release salicylic acid, which is a nonsteroidal anti-inflammatory drug. PCL was used to enhance the mechanical integrity of the matrices. Two different SAPAE-containing membranes were produced and compared: fast-degrading (FD-SAPAE) and slow-degrading (SD-SAPAE) membranes that release salicylic acid at a faster and slower rate, respectively. Rat femur defects were treated with BMP-2 and wrapped with FD-SAPAE, SD-SAPAE, or PCL membrane or were left unwrapped. The effects of different membranes on bone formation within and outside of the femur defects were measured by histomorphometry and microcomputed tomography. Bone formation within the defect was not affected by membrane wrapping at BMP-2 doses of 12 μg or more. In contrast, the FD-SAPAE membrane significantly reduced bone formation outside the defect compared with all other treatments. The rapid release of salicylic acid from the FD-SAPAE membrane suggests that localized salicylic acid treatment during the first few days of BMP-2 treatment can limit ectopic bone formation. The data support development of SAPAE polymer membranes for guided bone regeneration applications as well as barriers to excessive bone formation. PMID:25813520

  9. Salicylic Acid-Based Polymers for Guided Bone Regeneration Using Bone Morphogenetic Protein-2.

    PubMed

    Subramanian, Sangeeta; Mitchell, Ashley; Yu, Weiling; Snyder, Sabrina; Uhrich, Kathryn; O'Connor, J Patrick

    2015-07-01

    Bone morphogenetic protein-2 (BMP-2) is used clinically to promote spinal fusion, treat complex tibia fractures, and to promote bone formation in craniomaxillofacial surgery. Excessive bone formation at sites where BMP-2 has been applied is an established complication and one that could be corrected by guided tissue regeneration methods. In this study, anti-inflammatory polymers containing salicylic acid [salicylic acid-based poly(anhydride-ester), SAPAE] were electrospun with polycaprolactone (PCL) to create thin flexible matrices for use as guided bone regeneration membranes. SAPAE polymers hydrolyze to release salicylic acid, which is a nonsteroidal anti-inflammatory drug. PCL was used to enhance the mechanical integrity of the matrices. Two different SAPAE-containing membranes were produced and compared: fast-degrading (FD-SAPAE) and slow-degrading (SD-SAPAE) membranes that release salicylic acid at a faster and slower rate, respectively. Rat femur defects were treated with BMP-2 and wrapped with FD-SAPAE, SD-SAPAE, or PCL membrane or were left unwrapped. The effects of different membranes on bone formation within and outside of the femur defects were measured by histomorphometry and microcomputed tomography. Bone formation within the defect was not affected by membrane wrapping at BMP-2 doses of 12 μg or more. In contrast, the FD-SAPAE membrane significantly reduced bone formation outside the defect compared with all other treatments. The rapid release of salicylic acid from the FD-SAPAE membrane suggests that localized salicylic acid treatment during the first few days of BMP-2 treatment can limit ectopic bone formation. The data support development of SAPAE polymer membranes for guided bone regeneration applications as well as barriers to excessive bone formation.

  10. Cirrus cloud mimic surfaces in the laboratory: organic acids, bases and NOx heterogeneous reactions

    NASA Astrophysics Data System (ADS)

    Sodeau, J.; Oriordan, B.

    2003-04-01

    CIRRUS CLOUD MIMIC SURFACES IN THE LABORATORY:ORGANIC ACIDS, BASES AND NOX HETEROGENEOUS REACTIONS. B. ORiordan, J. Sodeau Department of Chemistry and Environment Research Institute, University College Cork, Ireland j.sodeau@ucc.ie /Fax: +353-21-4902680 There are a variety of biogenic and anthropogenic sources for the simple carboxylic acids to be found in the troposphere giving rise to levels as high as 45 ppb in certain urban areas. In this regard it is of note that ants of genus Formica produce some 10Tg of formic acid each year; some ten times that produced by industry. The expected sinks are those generally associated with tropospheric chemistry: the major routes studied, to date, being wet and dry deposition. No studies have been carried out hitherto on the role of water-ice surfaces in the atmospheric chemistry of carboxylic acids and the purpose of this paper is to indicate their potential function in the heterogeneous release of atmospheric species such as HONO. The deposition of formic acid on a water-ice surface was studied using FT-RAIR spectroscopy over a range of temperatures between 100 and 165K. In all cases ionization to the formate (and oxonium) ions was observed. The results were confirmed by TPD (Temperature Programmed Desorption) measurements, which indicated that two distinct surface species adsorb to the ice. Potential reactions between the formic acid/formate ion surface and nitrogen dioxide were subsequently investigated by FT-RAIRS. Co-deposition experiments showed that N2O3 and the NO+ ion (associated with water) were formed as products. A mechanism is proposed to explain these results, which involves direct reaction between the organic acid and nitrogen dioxide. Similar experiments involving acetic acid also indicate ionization on a water-ice surface. The results are put into the context of atmospheric chemistry potentially occuring on cirrus cloud surfaces.

  11. Effect of growth hormone on renal and systemic acid-base homeostasis in humans.

    PubMed

    Sicuro, A; Mahlbacher, K; Hulter, H N; Krapf, R

    1998-04-01

    The effects of recombinant human growth hormone (GH, 0.1 U.kg body wt-1.12 h-1) on systemic and renal acid-base homeostasis were investigated in six normal subjects with preexisting sustained chronic metabolic acidosis, induced by NH4Cl administration (4.2 mmol.kg body wt-1.day-1). GH administration increased and maintained plasma bicarbonate concentration from 14.1 +/- 1.4 to 18.6 +/- 1.1 mmol/l (P < 0.001). The GH-induced increase in plasma bicarbonate concentration was the consequence of a significant increase in net acid excretion that was accounted for largely by an increase in renal NH+4 excretion sufficient in magnitude to override a decrease in urinary titratable acid excretion. During GH administration, urinary pH increased and correlated directly and significantly with urinary NH4+ concentration. Urinary net acid excretion rates were not different during the steady-state periods of acidosis and acidosis with GH administration. Glucocorticoid and mineralocorticoid activities increased significantly in response to acidosis and were suppressed (glucocorticoid) or decreased to control levels (mineralocorticoid) by GH. The partial correction of metabolic acidosis occurred despite GH-induced renal sodium retention (180 mmol; gain in weight of 1.8 +/- 0.2 kg, P < 0.005) and decreased glucocorticoid and mineralocorticoid activities. Thus GH (and/or insulin-like growth factor I) increased plasma bicarbonate concentration and partially corrected metabolic acidosis. This effect was generated in large part by and maintained fully by a renal mechanism (i.e., increased renal NH3 production and NH+4/net acid excretion).

  12. A Regulatory Mechanism Involving TBP-1/Tat-Binding Protein 1 and Akt/PKB in the Control of Cell Proliferation

    PubMed Central

    Tolino, Fabio; Bellucci, Luca; Sisto, Luca; Alfano, Daniela; Ragno, Pia; Calabrò, Viola; de Franciscis, Vittorio; La Mantia, Girolama; Pollice, Alessandra

    2011-01-01

    TBP-1 /Tat-Binding Protein 1 (also named Rpt-5, S6a or PSMC3) is a multifunctional protein, originally identified as a regulator of HIV-1-Tat mediated transcription. It is an AAA-ATPase component of the 19S regulative subunit of the proteasome and, as other members of this protein family, fulfils different cellular functions including proteolysis and transcriptional regulation. We and others reported that over expression of TBP-1 diminishes cell proliferation in different cellular contexts with mechanisms yet to be defined. Accordingly, we demonstrated that TBP-1 binds to and stabilizes the p14ARF oncosuppressor increasing its anti-oncogenic functions. However, TBP-1 restrains cell proliferation also in the absence of ARF, raising the question of what are the molecular pathways involved. Herein we demonstrate that stable knock-down of TBP-1 in human immortalized fibroblasts increases cell proliferation, migration and resistance to apoptosis induced by serum deprivation. We observe that TBP-1 silencing causes activation of the Akt/PKB kinase and that in turn TBP-1, itself, is a downstream target of Akt/PKB. Moreover, MDM2, a known Akt target, plays a major role in this regulation. Altogether, our data suggest the existence of a negative feedback loop involving Akt/PKB that might act as a sensor to modulate TBP-1 levels in proliferating cells. PMID:21991300

  13. Absorption, fluorescence, and acid-base equilibria of rhodamines in micellar media of sodium dodecyl sulfate

    NASA Astrophysics Data System (ADS)

    Obukhova, Elena N.; Mchedlov-Petrossyan, Nikolay O.; Vodolazkaya, Natalya A.; Patsenker, Leonid D.; Doroshenko, Andrey O.; Marynin, Andriy I.; Krasovitskii, Boris M.

    2017-01-01

    Rhodamine dyes are widely used as molecular probes in different fields of science. The aim of this paper was to ascertain to what extent the structural peculiarities of the compounds influence their absorption, emission, and acid-base properties under unified conditions. The acid-base dissociation (HR+ ⇄ R + H+) of a series of rhodamine dyes was studied in sodium n-dodecylsulfate micellar solutions. In this media, the form R exists as a zwitterion R±. The indices of apparent ionization constants of fifteen rhodamine cations HR+ with different substituents in the xanthene moiety vary within the range of pKaapp = 5.04 to 5.53. The distinct dependence of emission of rhodamines bound to micelles on pH of bulk water opens the possibility of using them as fluorescent interfacial acid-base indicators.

  14. A New Regulatory Mechanism for Kv7.2 Protein During Neuropathy: Enhanced Transport from the Soma to Axonal Terminals of Injured Sensory Neurons

    PubMed Central

    Cisneros, Elsa; Roza, Carolina; Jackson, Nieka; López-García, José Antonio

    2015-01-01

    Kv7.2 channel expression has been reported to decrease in dorsal root ganglia (DRG) following the induction of a peripheral neuropathy while other experiments show that Kv7.2 accumulates in peripheral neuromas. The mechanisms underlying these novel expression patterns are poorly understood. Here we use immunofluorescence methods to analyze Kv7.2 protein expression changes in sensory neurons following peripheral axotomy and the potential role of axonal transport. Results indicate that DRG neurons express Kv7.2 in ~16% of neurons and that this number decreases by about 65% after axotomy. Damaged neurons were identified in DRG by application of the tracer Fluoro-ruby at the site of injury during surgery. Reduction of Kv7.2 expression was particularly strong in damaged neurons although some loss was also found in putative uninjured neurons. In parallel to the decrease in the soma of axotomized sensory neurons, Kv7.2 accumulated at neuromatose fiber endings. Blockade of axonal transport with either vinblastine (VLB) or colchicine (COL) abolished Kv7.2 redistribution in neuropathic animals. Channel distribution rearrangements did not occur following induction of inflammation in the hind paw. Behavioral tests indicate that protein rearrangements within sensory afferents are essential to the development of allodynia under neuropathic conditions. These results suggest that axotomy enhances axonal transport in injured sensory neurons, leading to a decrease of somatic expression of Kv7.2 protein and a concomitant accumulation in damaged fiber endings. Localized changes in channel expression patterns under pathological conditions may create novel opportunities for Kv7.2 channel openers to act as analgesics. PMID:26696829

  15. Multiple regulatory mechanisms of hepatocyte growth factor expression in malignant cells with a short poly(dA) sequence in the HGF gene promoter.

    PubMed

    Sakai, Kazuko; Takeda, Masayuki; Okamoto, Isamu; Nakagawa, Kazuhiko; Nishio, Kazuto

    2015-01-01

    Hepatocyte growth factor (HGF) expression is a poor prognostic factor in various types of cancer. Expression levels of HGF have been reported to be regulated by shorter poly(dA) sequences in the promoter region. In the present study, the poly(dA) mononucleotide tract in various types of human cancer cell lines was examined and compared with the HGF expression levels in those cells. Short deoxyadenosine repeat sequences were detected in five of the 55 cell lines used in the present study. The H69, IM95, CCK-81, Sui73 and H28 cells exhibited a truncated poly(dA) sequence in which the number of poly(dA) repeats was reduced by ≥5 bp. Two of the cell lines exhibited high HGF expression, determined by reverse transcription quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. The CCK-81, Sui73 and H28 cells with shorter poly(dA) sequences exhibited low HGF expression. The cause of the suppression of HGF expression in the CCK-81, Sui73 and H28 cells was clarified by two approaches, suppression by methylation and single nucleotide polymorphisms in the HGF gene. Exposure to 5-Aza-dC, an inhibitor of DNA methyltransferase 1, induced an increased expression of HGF in the CCK-81 cells, but not in the other cells. Single-nucleotide polymorphism (SNP) rs72525097 in intron 1 was detected in the Sui73 and H28 cells. Taken together, it was found that the defect of poly(dA) in the HGF promoter was present in various types of cancer, including lung, stomach, colorectal, pancreas and mesothelioma. The present study proposes the negative regulation mechanisms by methylation and SNP in intron 1 of HGF for HGF expression in cancer cells with short poly(dA).

  16. Whirlin interacts with espin and modulates its actin-regulatory function: an insight into the mechanism of Usher syndrome type II.

    PubMed

    Wang, Le; Zou, Junhuang; Shen, Zuolian; Song, E; Yang, Jun

    2012-02-01

    Whirlin mutations cause retinal degeneration and hearing loss in Usher syndrome type II (USH2) and non-syndromic deafness, DFNB31. Its protein recruits other USH2 causative proteins to form a complex at the periciliary membrane complex in photoreceptors and the ankle link of the stereocilia in hair cells. However, the biological function of this USH2 protein complex is largely unknown. Using a yeast two-hybrid screen, we identified espin, an actin-binding/bundling protein involved in human deafness when defective, as a whirlin-interacting protein. The interaction between these two proteins was confirmed by their coimmunoprecipitation and colocalization in cultured cells. This interaction involves multiple domains of both proteins and only occurs when espin does not bind to actin. Espin was partially colocalized with whirlin in the retina and the inner ear. In whirlin knockout mice, espin expression changed significantly in these two tissues. Further studies found that whirlin increased the mobility of espin and actin at the actin bundles cross-linked by espin and, eventually, affected the dimension of these actin bundles. In whirlin knockout mice, the stereocilia were thickened in inner hair cells. We conclude that the interaction between whirlin and espin and the balance between their expressions are required to maintain the actin bundle network in photoreceptors and hair cells. Disruption of this actin bundle network contributes to the pathogenic mechanism of hearing loss and retinal degeneration caused by whirlin and espin mutations. Espin is a component of the USH2 protein complex and could be a candidate gene for Usher syndrome.

  17. Association between dietary acid-base load and cardiometabolic risk factors in young Japanese women.

    PubMed

    Murakami, Kentaro; Sasaki, Satoshi; Takahashi, Yoshiko; Uenishi, Kazuhiro

    2008-09-01

    Mild metabolic acidosis, which can be caused by diet, may adversely affect cardiometabolic risk factors, possibly by increasing cortisol production. Methodologies for estimating diet-induced acid-base load using dietary-intake information have been established. To our knowledge, however, the possible association between dietary acid-base load and cardiometabolic risk factors has not been investigated. We cross-sectionally examined associations between dietary acid-base load and cardiometabolic risk factors in a free-living population. The subjects were 1136 female Japanese dietetic students aged 18-22 years. Dietary acid-base load was characterized as the potential renal acid load (PRAL), which was determined using an algorithm including dietary protein, P, K, Ca and Mg, as well as the ratio of dietary protein to K (Pro:K). Estimates of each nutrient were obtained from a validated comprehensive self-administered diet history questionnaire. Body height and weight, waist circumference and blood pressure were measured. Fasting blood samples were collected. After adjustment for potential confounding factors, higher PRAL and Pro:K (more acidic dietary acid-base loads) were associated with higher systolic and diastolic blood pressure (P for trend = 0.028 and 0.035 for PRAL and 0.012 and 0.009 for Pro:K, respectively). PRAL was also independently positively associated with total and LDL-cholesterol (n 1121; P for trend = 0.042 and 0.021, respectively). Additionally, Pro:K showed an independent positive association with BMI and waist circumference (P for trend = 0.024 and 0.012, respectively). In conclusion, more acidic dietary acid-base load was independently associated with adverse profile of several cardiometabolic risk factors in free-living young Japanese women.

  18. The Comparative Studies of Binding Activity of Curcumin and Didemethylated Curcumin with Selenite: Hydrogen Bonding vs Acid-Base Interactions

    NASA Astrophysics Data System (ADS)

    Liao, Jiahn-Haur; Wu, Tzu-Hua; Chen, Ming-Yi; Chen, Wei-Ting; Lu, Shou-Yun; Wang, Yi-Hsuan; Wang, Shao-Pin; Hsu, Yen-Min; Huang, Yi-Shiang; Huang, Zih-You; Lin, Yu-Ching; Chang, Ching-Ming; Huang, Fu-Yung; Wu, Shih-Hsiung

    2015-12-01

    In this report, the in vitro relative capabilities of curcumin (CCM) and didemethylated curcumin (DCCM) in preventing the selenite-induced crystallin aggregation were investigated by turbidity tests and isothermal titration calorimetry (ITC). DCCM showed better activity than CCM. The conformers of CCM/SeO32- and DCCM/SeO32- complexes were optimized by molecular orbital calculations. Results reveal that the selenite anion surrounded by CCM through the H-bonding between CCM and selenite, which is also observed via IR and NMR studied. For DCCM, the primary driving force is the formation of an acid-base adduct with selenite showing that the phenolic OH group of DCCM was responsible for forming major conformer of DCCM. The formation mechanisms of selenite complexes with CCM or DCCM explain why DCCM has greater activity than CCM in extenuating the toxicity of selenite as to prevent selenite-induced lens protein aggregation.

  19. The Comparative Studies of Binding Activity of Curcumin and Didemethylated Curcumin with Selenite: Hydrogen Bonding vs Acid-Base Interactions

    PubMed Central

    Liao, Jiahn-Haur; Wu, Tzu-Hua; Chen, Ming-Yi; Chen, Wei-Ting; Lu, Shou-Yun; Wang, Yi-Hsuan; Wang, Shao-Pin; Hsu, Yen-Min; Huang, Yi-Shiang; Huang, Zih-You; Lin, Yu-Ching; Chang, Ching-Ming; Huang, Fu-Yung; Wu, Shih-Hsiung

    2015-01-01

    In this report, the in vitro relative capabilities of curcumin (CCM) and didemethylated curcumin (DCCM) in preventing the selenite-induced crystallin aggregation were investigated by turbidity tests and isothermal titration calorimetry (ITC). DCCM showed better activity than CCM. The conformers of CCM/SeO32− and DCCM/SeO32− complexes were optimized by molecular orbital calculations. Results reveal that the selenite anion surrounded by CCM through the H-bonding between CCM and selenite, which is also observed via IR and NMR studied. For DCCM, the primary driving force is the formation of an acid-base adduct with selenite showing that the phenolic OH group of DCCM was responsible for forming major conformer of DCCM. The formation mechanisms of selenite complexes with CCM or DCCM explain why DCCM has greater activity than CCM in extenuating the toxicity of selenite as to prevent selenite-induced lens protein aggregation. PMID:26635113

  20. The effect of acid-base clustering and ions on the growth of atmospheric nano-particles

    NASA Astrophysics Data System (ADS)

    Lehtipalo, Katrianne; Rondo, Linda; Kontkanen, Jenni; Schobesberger, Siegfried; Jokinen, Tuija; Sarnela, Nina; Kürten, Andreas; Ehrhart, Sebastian; Franchin, Alessandro; Nieminen, Tuomo; Riccobono, Francesco; Sipilä, Mikko; Yli-Juuti, Taina; Duplissy, Jonathan; Adamov, Alexey; Ahlm, Lars; Almeida, João; Amorim, Antonio; Bianchi, Federico; Breitenlechner, Martin; Dommen, Josef; Downard, Andrew J.; Dunne, Eimear M.; Flagan, Richard C.; Guida, Roberto; Hakala, Jani; Hansel, Armin; Jud, Werner; Kangasluoma, Juha; Kerminen, Veli-Matti; Keskinen, Helmi; Kim, Jaeseok; Kirkby, Jasper; Kupc, Agnieszka; Kupiainen-Määttä, Oona; Laaksonen, Ari; Lawler, Michael J.; Leiminger, Markus; Mathot, Serge; Olenius, Tinja; Ortega, Ismael K.; Onnela, Antti; Petäjä, Tuukka; Praplan, Arnaud; Rissanen, Matti P.; Ruuskanen, Taina; Santos, Filipe D.; Schallhart, Simon; Schnitzhofer, Ralf; Simon, Mario; Smith, James N.; Tröstl, Jasmin; Tsagkogeorgas, Georgios; Tomé, António; Vaattovaara, Petri; Vehkamäki, Hanna; Vrtala, Aron E.; Wagner, Paul E.; Williamson, Christina; Wimmer, Daniela; Winkler, Paul M.; Virtanen, Annele; Donahue, Neil M.; Carslaw, Kenneth S.; Baltensperger, Urs; Riipinen, Ilona; Curtius, Joachim; Worsnop, Douglas R.; Kulmala, Markku

    2016-05-01

    The growth of freshly formed aerosol particles can be the bottleneck in their survival to cloud condensation nuclei. It is therefore crucial to understand how particles grow in the atmosphere. Insufficient experimental data has impeded a profound understanding of nano-particle growth under atmospheric conditions. Here we study nano-particle growth in the CLOUD (Cosmics Leaving OUtdoors Droplets) chamber, starting from the formation of molecular clusters. We present measured growth rates at sub-3 nm sizes with different atmospherically relevant concentrations of sulphuric acid, water, ammonia and dimethylamine. We find that atmospheric ions and small acid-base clusters, which are not generally accounted for in the measurement of sulphuric acid vapour, can participate in the growth process, leading to enhanced growth rates. The availability of compounds capable of stabilizing sulphuric acid clusters governs the magnitude of these effects and thus the exact growth mechanism. We bring these observations into a coherent framework and discuss their significance in the atmosphere.

  1. The Comparative Studies of Binding Activity of Curcumin and Didemethylated Curcumin with Selenite: Hydrogen Bonding vs Acid-Base Interactions.

    PubMed

    Liao, Jiahn-Haur; Wu, Tzu-Hua; Chen, Ming-Yi; Chen, Wei-Ting; Lu, Shou-Yun; Wang, Yi-Hsuan; Wang, Shao-Pin; Hsu, Yen-Min; Huang, Yi-Shiang; Huang, Zih-You; Lin, Yu-Ching; Chang, Ching-Ming; Huang, Fu-Yung; Wu, Shih-Hsiung

    2015-12-04

    In this report, the in vitro relative capabilities of curcumin (CCM) and didemethylated curcumin (DCCM) in preventing the selenite-induced crystallin aggregation were investigated by turbidity tests and isothermal titration calorimetry (ITC). DCCM showed better activity than CCM. The conformers of CCM/SeO3(2-) and DCCM/SeO3(2-) complexes were optimized by molecular orbital calculations. Results reveal that the selenite anion surrounded by CCM through the H-bonding between CCM and selenite, which is also observed via IR and NMR studied. For DCCM, the primary driving force is the formation of an acid-base adduct with selenite showing that the phenolic OH group of DCCM was responsible for forming major conformer of DCCM. The formation mechanisms of selenite complexes with CCM or DCCM explain why DCCM has greater activity than CCM in extenuating the toxicity of selenite as to prevent selenite-induced lens protein aggregation.

  2. Effect of miR-23a on anoxia-induced phenotypic transformation of smooth muscle cells of rat pulmonary arteries and regulatory mechanism

    PubMed Central

    Yan, Li; Gao, Haixiang; Li, Chunzhi; Han, Xiaowen; Qi, Xiaoyong

    2017-01-01

    We investigated the possible implication of miR-23a in anoxia-induced phenotypic transformation of the pulmonary arterial smooth muscle and studied the mechanism of upregulation of miR-23a expression in anoxia. The collagenase digestion method was used for preparing rat primary pulmonary artery smooth muscle cell (PASMC) culture. SM-MHC, SM-α-actin, calponin-1 and SM22α protein expression levels were evaluated using western blot analysis after the ASMCs were subjected to anoxia treatment (3% O2). Transfection with miR-23a mimics were conducted when PASMCs were under normoxia and anoxia conditions. EdU staining was used to detect the proliferative activity of PASMCs. Cells were transfected with HIF-1α specific siRNA under anoxia condition. RT-qPCR was used to detect miR-23a expression in PASMCs. Chromatin immunoprecipitation method was employed to verify the binding sites of HIF-1α. The dual-luciferase reporter gene was used to study the role of HIF-1 and its binding sites. Rat hypoxic pulmonary hypertension models were established to study the expression of miR-23a using RT-qPCR method and to verify the expression of miR-23a in the arteriole of the rat pulmonary. Our results showed that compared with normoxia condition, under anoxia condition (3% O2), the expression levels of the contractile phenotype marker proteins decreased significantly after 24 and 48 h. The positive rate of the EdU staining increased significantly and the expression of miR-23a increased. Transfection with miR-23a-mimic downregulated the expression of contractile marker proteins and improved the positive rate of the EdU staining under normoxia. Anoxia and transfection with HIF-1α enhanced the activity of the wild-type Luc-miR-23a-1 (WT) reporter gene. We concluded that miR-23a participated in the anoxia-induced phenotypic transformation of PASMCs. Increased expression of miR-23a under anoxia may primarily be due to miR-23a-1 and miR-23a-3 upregulation. The anoxia-induced upregulation of

  3. Effect of Annexin A1 gene on the proliferation and invasion of esophageal squamous cell carcinoma cells and its regulatory mechanisms.

    PubMed

    Han, Gaohua; Lu, Kaijin; Huang, Junxing; Ye, Jun; Dai, Shengbin; Ye, Yunyao; Zhang, Lixin

    2017-02-01

    The aim of this study was to examine the effect of Annexin A1 (ANXA1) on the proliferation, migration and invasion of esophageal squamous cell carcinoma (ESCC) cells and its possible mechanisms of action. After constructing the ANXA1 overexpression plasmid, we transfected this plasmid and/or microRNA (miRNA)‑196a mimic into ESCC cells (Eca109 cell line). Methyl thiazolyl tetrazolium (MTT) assay and Transwell chamber assay were performed to determine cell proliferation, migration and invasion, respectively. Western blot analysis was used to examine the protein expression levels of ANXA1, Snail and E-cadherin. RT-PCR was used to detect the expression of miRNA-196a. Our results revealed that ANXA1 expression was upregulated in the cells transfected with the ANXA1 overexpression plasmid, and cell proliferation, migration and invasion were significantly increased (p=0.004, p<0.001 and p=0.011, respectively). In the cells transfected with the miRNA‑196a mimic, miRNA‑196a expression was significantly upregulated (p<0.001). However, miRNA-196a expression was downregulated in the cells transfected with the ANXA1 overexpression plasmid. In addition, in the cells transfected with the miRNA‑196a mimic, cell proliferation, migration and invasion were significantly decreased (p=0.027, p=0.009 and p=0.021, respectively). In the cells transfected with the ANXA1 overexpression plasmid, the expression of Snail was upregulated and that of E-cadherin was downregulated. However, the opposite was observed in the cells transfected with the miRNA‑196a mimic. Our findings thus demonstrate that ANXA1 promotes the proliferation of Eca109 cells, and increases the expression of Snail, whereas it inhibits that of E-cadherin, thus enhancing the migration and invasion of ESCC cells. miRNA-196a negatively regulates the expression of ANXA1, thereby inhibiting the proliferation, invasion and metastasis of ESCC cells.

  4. Effect of Annexin A1 gene on the proliferation and invasion of esophageal squamous cell carcinoma cells and its regulatory mechanisms

    PubMed Central

    Han, Gaohua; Lu, Kaijin; Huang, Junxing; Ye, Jun; Dai, Shengbin; Ye, Yunyao; Zhang, Lixin

    2017-01-01

    The aim of this study was to examine the effect of Annexin A1 (ANXA1) on the proliferation, migration and invasion of esophageal squamous cell carcinoma (ESCC) cells and its possible mechanisms of action. After constructing the ANXA1 overexpression plasmid, we transfected this plasmid and/or microRNA (miRNA)-196a mimic into ESCC cells (Eca109 cell line). Methyl thiazolyl tetrazolium (MTT) assay and Transwell chamber assay were performed to determine cell proliferation, migration and invasion, respectively. Western blot analysis was used to examine the protein expression levels of ANXA1, Snail and E-cadherin. RT-PCR was used to detect the expression of miRNA-196a. Our results revealed that ANXA1 expression was upregulated in the cells transfected with the ANXA1 overexpression plasmid, and cell proliferation, migration and invasion were significantly increased (p=0.004, p<0.001 and p=0.011, respectively). In the cells transfected with the miRNA-196a mimic, miRNA-196a expression was significantly upregulated (p<0.001). However, miRNA-196a expression was downregulated in the cells transfected with the ANXA1 overexpression plasmid. In addition, in the cells transfected with the miRNA-196a mimic, cell proliferation, migration and invasion were significantly decreased (p=0.027, p=0.009 and p=0.021, respectively). In the cells transfected with the ANXA1 overexpression plasmid, the expression of Snail was upregulated and that of E-cadherin was downregulated. However, the opposite was observed in the cells transfected with the miRNA-196a mimic. Our findings thus demonstrate that ANXA1 promotes the proliferation of Eca109 cells, and increases the expression of Snail, whereas it inhibits that of E-cadherin, thus enhancing the migration and invasion of ESCC cells. miRNA-196a negatively regulates the expression of ANXA1, thereby inhibiting the proliferation, invasion and metastasis of ESCC cells. PMID:28035369

  5. Teaching Brønsted-Lowry Acid-Base Theory in a Direct Comprehensive Way

    NASA Astrophysics Data System (ADS)

    Adcock, Jamie L.

    2001-11-01

    A figure is presented which shows in a comprehensive way the relationships between Brønsted-Lowry acids and their conjugate bases. It shows their interactions with water and quantifies the terms strong, weak, and very weak, showing precisely how these modifiers can be effectively used to indicate the nature of the reaction between any conjugate acid/base and water. It shows that ion hydrolysis is simple acid/base behavior, and it clearly suggests the leveling effect of water on strong acids and bases.

  6. Closed cycle ion exchange method for regenerating acids, bases and salts

    DOEpatents

    Dreyfuss, Robert M.

    1976-01-01

    A method for conducting a chemical reaction in acidic, basic, or neutral solution as required and then regenerating the acid, base, or salt by means of ion exchange in a closed cycle reaction sequence which comprises contacting the spent acid, base, or salt with an ion exchanger, preferably a synthetic organic ion-exchange resin, so selected that the counter ions thereof are ions also produced as a by-product in the closed reaction cycle, and then regenerating the spent ion exchanger by contact with the by-product counter ions. The method is particularly applicable to closed cycle processes for the thermochemical production of hydrogen.

  7. Essentials in the diagnosis of acid-base disorders and their high altitude application.

    PubMed

    Paulev, P E; Zubieta-Calleja, G R

    2005-09-01

    This report describes the historical development in the clinical application of chemical variables for the interpretation of acid-base disturbances. The pH concept was already introduced in 1909. Following World War II, disagreements concerning the definition of acids and bases occurred, and since then two strategies have been competing. Danish scientists in 1923 defined an acid as a substance able to give off a proton at a given pH, and a base as a substance that could bind a proton, whereas the North American Singer-Hasting school in 1948 defined acids as strong non-buffer anions and bases as non-buffer cations. As a consequence of this last definition, electrolyte disturbances were mixed up with real acid-base disorders and the variable, strong ion difference (SID), was introduced as a measure of non-respiratory acid-base disturbances. However, the SID concept is only an empirical approximation. In contrast, the Astrup/Siggaard-Andersen school of scientists, using computer strategies and the Acid-base Chart, has made diagnosis of acid-base disorders possible at a glance on the Chart, when the data are considered in context with the clinical development. Siggaard-Andersen introduced Base Excess (BE) or Standard Base Excess (SBE) in the extracellular fluid volume (ECF), extended to include the red cell volume (eECF), as a measure of metabolic acid-base disturbances and recently replaced it by the term Concentration of Titratable Hydrogen Ion (ctH). These two concepts (SBE and ctH) represent the same concentration difference, but with opposite signs. Three charts modified from the Siggaard-Andersen Acid-Base Chart are presented for use at low, medium and high altitudes of 2500 m, 3500 m, and 4000 m, respectively. In this context, the authors suggest the use of Titratable Hydrogen Ion concentration Difference (THID) in the extended extracellular fluid volume, finding it efficient and better than any other determination of the metabolic component in acid-base

  8. Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems

    PubMed Central

    Lui, Clarissa; Cady, Nathaniel C.; Batt, Carl A.

    2009-01-01

    The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform. PMID:22412335

  9. Bifunctional Organic Polymeric Catalysts with a Tunable Acid-Base Distance and Framework Flexibility

    PubMed Central

    Chen, Huanhui; Wang, Yanan; Wang, Qunlong; Li, Junhui; Yang, Shiqi; Zhu, Zhirong

    2014-01-01

    Acid-base bifunctional organic polymeric catalysts were synthesized with tunable structures. we demonstrated two synthesis approaches for structural fine-tune. In the first case, the framework flexibility was tuned by changing the ratio of rigid blocks to flexible blocks within the polymer framework. In the second case, we precisely adjusted the acid-base distance by distributing basic monomers to be adjacent to acidic monomers, and by changing the chain length of acidic monomers. In a standard test reaction for the aldol condensation of 4-nitrobenzaldehyde with acetone, the catalysts showed good reusability upon recycling and maintained relatively high conversion percentage. PMID:25267260

  10. 78 FR 44279 - Regulatory Agenda

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-23

    ... Regulatory Flexibility Act, 5 U.S.C. sections 601 to 612 (1988). FOR FURTHER INFORMATION CONTACT: Robert... mandated for the regulatory flexibility agendas required by the Regulatory Flexibility Act (5 U.S.C. 602... regulatory flexibility agenda, in accordance with the Regulatory Flexibility Act, because they are likely...

  11. A sensitive gel-based method combining distinct cyclophellitol-based probes for the identification of acid/base residues in human retaining β-glucosidases.

    PubMed

    Kallemeijn, Wouter W; Witte, Martin D; Voorn-Brouwer, Tineke M; Walvoort, Marthe T C; Li, Kah-Yee; Codée, Jeroen D C; van der Marel, Gijsbert A; Boot, Rolf G; Overkleeft, Herman S; Aerts, Johannes M F G

    2014-12-19

    Retaining β-exoglucosidases operate by a mechanism in which the key amino acids driving the glycosidic bond hydrolysis act as catalytic acid/base and nucleophile. Recently we designed two distinct classes of fluorescent cyclophellitol-type activity-based probes (ABPs) that exploit this mechanism to covalently modify the nucleophile of retaining β-glucosidases. Whereas β-epoxide ABPs require a protonated acid/base for irreversible inhibition of retaining β-glucosidases, β-aziridine ABPs do not. Here we describe a novel sensitive method to identify both catalytic residues of retaining β-glucosidases by the combined use of cyclophellitol β-epoxide- and β-aziridine ABPs. In this approach putative catalytic residues are first substituted to noncarboxylic amino acids such as glycine or glutamine through site-directed mutagenesis. Next, the acid/base and nucleophile can be identified via classical sodium azide-mediated rescue of mutants thereof. Selective labeling with fluorescent β-aziridine but not β-epoxide ABPs identifies the acid/base residue in mutagenized enzyme, as only the β-aziridine ABP can bind in its absence. The Absence of the nucleophile abolishes any ABP labeling. We validated the method by using the retaining β-glucosidase GBA (CAZy glycosylhydrolase family GH30) and then applied it to non-homologous (putative) retaining β-glucosidases categorized in GH1 and GH116: GBA2, GBA3, and LPH. The described method is highly sensitive, requiring only femtomoles (nanograms) of ABP-labeled enzymes.

  12. Modeling of hysteresis in gene regulatory networks.

    PubMed

    Hu, J; Qin, K R; Xiang, C; Lee, T H

    2012-08-01

    Hysteresis, observed in many gene regulatory networks, has a pivotal impact on biological systems, which enhances the robustness of cell functions. In this paper, a general model is proposed to describe the hysteretic gene regulatory network by combining the hysteresis component and the transient dynamics. The Bouc-Wen hysteresis model is modified to describe the hysteresis component in the mammalian gene regulatory networks. Rigorous mathematical analysis on the dynamical properties of the model is presented to ensure the bounded-input-bounded-output (BIBO) stability and demonstrates that the original Bouc-Wen model can only generate a clockwise hysteresis loop while the modified model can describe both clockwise and counter clockwise hysteresis loops. Simulation studies have shown that the hysteresis loops from our model are consistent with the experimental observations in three mammalian gene regulatory networks and two E.coli gene regulatory networks, which demonstrate the ability and accuracy of the mathematical model to emulate natural gene expression behavior with hysteresis. A comparison study has also been conducted to show that this model fits the experiment data significantly better than previous ones in the literature. The successful modeling of the hysteresis in all the five hysteretic gene regulatory networks suggests that the new model has the potential to be a unified framework for modeling hysteresis in gene regulatory networks and provide better understanding of the general mechanism that drives the hysteretic function.

  13. Effects of Sodium Butyrate Treatment on Histone Modifications and the Expression of Genes Related to Epigenetic Regulatory Mechanisms and Immune Response in European Sea Bass (Dicentrarchus Labrax) Fed a Plant-Based Diet

    PubMed Central

    Díaz, Noelia; Rimoldi, Simona; Ceccotti, Chiara; Gliozheni, Emi; Piferrer, Francesc

    2016-01-01

    Bacteria that inhabit the epithelium of the animals’ digestive tract provide the essential biochemical pathways for fermenting otherwise indigestible dietary fibers, leading to the production of short-chain fatty acids (SCFAs). Of the major SCFAs, butyrate has received particular attention due to its numerous positive effects on the health of the intestinal tract and peripheral tissues. The mechanisms of action of this four-carbon chain organic acid are different; many of these are related to its potent regulatory effect on gene expression since butyrate is a histone deacetylase inhibitor that play a predominant role in the epigenetic regulation of gene expression and cell function. In the present work, we investigated in the European sea bass (Dicentrarchus labrax) the effects of butyrate used as a feed additive on fish epigenetics as well as its regulatory role in mucosal protection and immune homeostasis through impact on gene expression. Seven target genes related to inflammatory response and reinforcement of the epithelial defense barrier [tnfα (tumor necrosis factor alpha) il1β, (interleukin 1beta), il-6, il-8, il-10, and muc2 (mucin 2)] and five target genes related to epigenetic modifications [dicer1(double-stranded RNA-specific endoribonuclease), ehmt2 (euchromatic histone-lysine-N-methyltransferase 2), pcgf2 (polycomb group ring finger 2), hdac11 (histone deacetylase-11), and jarid2a (jumonji)] were analyzed in fish intestine and liver. We also investigated the effect of dietary butyrate supplementation on histone acetylation, by performing an immunoblotting analysis on liver core histone extracts. Results of the eight-week-long feeding trial showed no significant differences in weight gain or SGR (specific growth rate) of sea bass that received 0.2% sodium butyrate supplementation in the diet in comparison to control fish that received a diet without Na-butyrate. Dietary butyrate led to a twofold increase in the acetylation level of histone H4 at

  14. Changes of prolactin regulatory mechanisms in aging: 24-h rhythms of serum prolactin and median eminence and adenohypophysial concentration of dopamine, serotonin, (gamma-aminobutyric acid, taurine and somatostatin in young and aged rats.

    PubMed

    Esquifino, A I; Cano, P; Jimenez, V; Reyes Toso, C F; Cardinali, D P

    2004-01-01

    Twenty-four hour rhythmicity of serum prolactin and median eminence and anterior pituitary content of dopamine (DA), serotonin (5HT), gamma-aminobutyric acid (GABA), taurine and somatostatin were examined in 2 months-old and 18-20 months-old Wistar male rats. The concentration of prolactin was higher in aged rats, with peaks in both groups of rats at the early phase of the activity span. Median eminence DA content of young rats attained its maximum at the middle of rest span and decreased as prolactin levels augmented while the lowest values of adenohypophysial DA were observed at the time of prolactin peak. DA rhythmicity disappeared in aged rats. GABA content of median eminence and adenohypophysis was lower in aged rats, with maximal values of median eminence GABA at light-dark transition in young rats and at the second half of activity span in aged rats. Serum prolactin correlated positively with median eminence GABA in young rats and negatively with pituitary GABA in young and aged rats. Median eminence somatostatin peaked at the beginning of the activity phase (young rats) or at the end of the rest phase (aged rats). Prolactin levels and somatostatin content correlated significantly in young rats only. Median eminence and pituitary 5HT and taurine content did not change with age. The results indicate disruption of prolactin regulatory mechanisms with aging in rats.

  15. Aortic endothelial cells regulate proliferation of human monocytes in vitro via a mechanism synergistic with macrophage colony-stimulating factor. Convergence at the cyclin E/p27(Kip1) regulatory checkpoint.

    PubMed

    Antonov, A S; Munn, D H; Kolodgie, F D; Virmani, R; Gerrity, R G

    1997-06-15

    Monocyte-derived macrophages (Mphis) are pivotal participants in the pathogenesis of atherosclerosis. Evidence from both animal and human plaques indicates that local proliferation may contribute to accumulation of lesion Mphis, and the major Mphi growth factor, macrophage colony stimulating factor (MCSF), is present in atherosclerotic plaques. However, most in vitro studies have failed to demonstrate that human monocytes/Mphis possess significant proliferative capacity. We now report that, although human monocytes cultured in isolation showed only limited MCSF-induced proliferation, monocytes cocultured with aortic endothelial cells at identical MCSF concentrations underwent enhanced (up to 40-fold) and prolonged (21 d) proliferation. In contrast with monocytes in isolation, this was optimal at low seeding densities, required endothelial cell contact, and could not be reproduced by coculture with smooth muscle cells. Intimal Mphi isolated from human aortas likewise showed endothelial cell contact-dependent, MCSF-induced proliferation. Consistent with a two-signal mechanism governing Mphi proliferation, the cell cycle regulatory protein, cyclin E, was rapidly upregulated by endothelial cell contact in an MCSFindependent fashion, but MCSF was required for successful downregulation of the cell cycle inhibitory protein p27(Kip1) before cell cycling. Thus endothelial cells and MCSF differentially and synergistically regulate two Mphi genes critical for progression through the cell cycle.

  16. EVOLUTIONARY BIOSCIENCE AS REGULATORY SYSTEMS BIOLOGY

    PubMed Central

    Davidson, Eric H.

    2011-01-01

    At present several entirely different explanatory approaches compete to illuminate the mechanisms by which animal body plans have evolved. Their respective relevance is briefly considered here in the light of modern knowledge of genomes and the regulatory processes by which development is controlled. Just as development is a system property of the regulatory genome, so causal explanation of evolutionary change in developmental process must be considered at a system level. Here I enumerate some mechanistic consequences that follow from the conclusion that evolution of the body plan has occurred by alteration of the structure of developmental gene regulatory networks. The hierarchy and multiple additional design features of these networks act to produce Boolean regulatory state specification functions at upstream phases of development of the body plan. These are created by the logic outputs of network subcircuits, and in modern animals these outputs are impervious to continuous adaptive variation unlike genes operating more peripherally in the network. PMID:21320483

  17. Evolutionary bioscience as regulatory systems biology.

    PubMed

    Davidson, Eric H

    2011-09-01

    At present several entirely different explanatory approaches compete to illuminate the mechanisms by which animal body plans have evolved. Their respective relevance is briefly considered here in the light of modern knowledge of genomes and the regulatory processes by which development is controlled. Just as development is a system property of the regulatory genome, causal explanation of evolutionary change in developmental process must be considered at a system level. Here I enumerate some mechanistic consequences that follow from the conclusion that evolution of the body plan has occurred by alteration of the structure of developmental gene regulatory networks. The hierarchy and multiple additional design features of these networks act to produce Boolean regulatory state specification functions at upstream phases of development of the body plan. These are created by the logic outputs of network subcircuits, and in modern animals these outputs are impervious to continuous adaptive variation unlike genes operating more peripherally in the network.

  18. Regulatory guidance document

    SciTech Connect

    1994-05-01

    The Office of Civilian Radioactive Waste Management (OCRWM) Program Management System Manual requires preparation of the OCRWM Regulatory Guidance Document (RGD) that addresses licensing, environmental compliance, and safety and health compliance. The document provides: regulatory compliance policy; guidance to OCRWM organizational elements to ensure a consistent approach when complying with regulatory requirements; strategies to achieve policy objectives; organizational responsibilities for regulatory compliance; guidance with regard to Program compliance oversight; and guidance on the contents of a project-level Regulatory Compliance Plan. The scope of the RGD includes site suitability evaluation, licensing, environmental compliance, and safety and health compliance, in accordance with the direction provided by Section 4.6.3 of the PMS Manual. Site suitability evaluation and regulatory compliance during site characterization are significant activities, particularly with regard to the YW MSA. OCRWM`s evaluation of whether the Yucca Mountain site is suitable for repository development must precede its submittal of a license application to the Nuclear Regulatory Commission (NRC). Accordingly, site suitability evaluation is discussed in Chapter 4, and the general statements of policy regarding site suitability evaluation are discussed in Section 2.1. Although much of the data and analyses may initially be similar, the licensing process is discussed separately in Chapter 5. Environmental compliance is discussed in Chapter 6. Safety and Health compliance is discussed in Chapter 7.

  19. Students' Understanding of Acid, Base and Salt Reactions in Qualitative Analysis.

    ERIC Educational Resources Information Center

    Tan, Kim-Chwee Daniel; Goh, Ngoh-Khang; Chia, Lian-Sai; Treagust, David F.

    2003-01-01

    Uses a two-tier, multiple-choice diagnostic instrument to determine (n=915) grade 10 students' understanding of the acid, base, and salt reactions involved in basic qualitative analysis. Reports that many students did not understand the formation of precipitates and the complex salts, acid/salt-base reactions, and thermal decomposition involved in…

  20. The Effect of Voluntary Ventilation on Acid-base Responses to a Moo Duk Tkow Form.

    ERIC Educational Resources Information Center

    Hetzler, Ronald K.; And Others

    1989-01-01

    Results are reported from a study that investigated the acid-base and lactate reponses to voluntary integration of breathing and exercise movements during beginning level form Ki Cho I, performed at competitive intensities. Findings suggest that respiratory compensation does not occur and that respiratory acidosis may contribute to metabolic…

  1. Analysis and Identification of Acid-Base Indicator Dyes by Thin-Layer Chromatography

    ERIC Educational Resources Information Center

    Clark, Daniel D.

    2007-01-01

    Thin-layer chromatography (TLC) is a very simple and effective technique that is used by chemists by different purposes, including the monitoring of the progress of a reaction. TLC can also be easily used for the analysis and identification of various acid-base indicator dyes.

  2. Surveying Students' Conceptual and Procedural Knowledge of Acid-Base Behavior of Substances

    ERIC Educational Resources Information Center

    Furio-Mas, Carles; Calatayud, Maria-Luisa; Barcenas, Sergio L.

    2007-01-01

    By the end of their high school studies, students should be able to understand macroscopic and sub-microscopic conceptualization of acid-base behavior and the relationship between these conceptual models. The aim of this article is to ascertain whether grade-12 students have sufficient background knowledge to explain the properties of acids,…

  3. Examining the Mismatch between Pupil and Teacher Knowledge in Acid-Base Chemistry.

    ERIC Educational Resources Information Center

    Erduran, Sibel

    2003-01-01

    Reports a mismatch between teacher and pupil knowledge of acid-base chemistry as a result of controversial episodes from three science lessons. Suggests that the teacher's knowledge is guided by textbook information while the pupil's knowledge is based on direct experimental experience. Proposes that classroom activities should support the…

  4. Acid-Base Chemistry According to Robert Boyle: Chemical Reactions in Words as well as Symbols

    ERIC Educational Resources Information Center

    Goodney, David E.

    2006-01-01

    Examples of acid-base reactions from Robert Boyle's "The Sceptical Chemist" are used to illustrate the rich information content of chemical equations. Boyle required lengthy passages of florid language to describe the same reaction that can be done quite simply with a chemical equation. Reading or hearing the words, however, enriches the student's…

  5. Interactive Computer-Assisted Instruction in Acid-Base Physiology for Mobile Computer Platforms

    ERIC Educational Resources Information Center

    Longmuir, Kenneth J.

    2014-01-01

    In this project, the traditional lecture hall presentation of acid-base physiology in the first-year medical school curriculum was replaced by interactive, computer-assisted instruction designed primarily for the iPad and other mobile computer platforms. Three learning modules were developed, each with ~20 screens of information, on the subjects…

  6. Kinetic Classroom: Acid-Base and Redox Demonstrations with Student Movement.

    ERIC Educational Resources Information Center

    Lomax, Joseph F.

    1994-01-01

    Describes classroom activities that involve student movement to demonstrate principles of kinetics. This classroom method can be used for any topic related to dynamic processes. The method used in this activity illustrates Brxnsted-Lowry acid-base theory and redox reactions. Takes advantage of analogies between proton and electron transfers. Use…

  7. Experienced Teachers' Pedagogical Content Knowledge of Teaching Acid-Base Chemistry

    ERIC Educational Resources Information Center

    Drechsler, Michal; Van Driel, Jan

    2008-01-01

    We investigated the pedagogical content knowledge (PCK) of nine experienced chemistry teachers. The teachers took part in a teacher training course on students' difficulties and the use of models in teaching acid-base chemistry, electrochemistry, and redox reactions. Two years after the course, the teachers were interviewed about their PCK of (1)…

  8. Isoelectric Point, Electric Charge, and Nomenclature of the Acid-Base Residues of Proteins

    ERIC Educational Resources Information Center

    Maldonado, Andres A.; Ribeiro, Joao M.; Sillero, Antonio

    2010-01-01

    The main object of this work is to present the pedagogical usefulness of the theoretical methods, developed in this laboratory, for the determination of the isoelectric point (pI) and the net electric charge of proteins together with some comments on the naming of the acid-base residues of proteins. (Contains 8 figures and 4 tables.)

  9. Prospects for nucleic acid-based therapeutics against hepatitis C virus.

    PubMed

    Lee, Chang Ho; Kim, Ji Hyun; Lee, Seong-Wook

    2013-12-21

    In this review, we discuss recent advances in nucleic acid-based therapeutic technologies that target hepatitis C virus (HCV) infection. Because the HCV genome is present exclusively in RNA form during replication, various nucleic acid-based therapeutic approaches targeting the HCV genome, such as ribozymes, aptamers, siRNAs, and antisense oligonucleotides, have been suggested as potential tools against HCV. Nucleic acids are potentially immunogenic and typically require a delivery tool to be utilized as therapeutics. These limitations have hampered the clinical development of nucleic acid-based therapeutics. However, despite these limitations, nucleic acid-based therapeutics has clinical value due to their great specificity, easy and large-scale synthesis with chemical methods, and pharmaceutical flexibility. Moreover, nucleic acid therapeutics are expected to broaden the range of targetable molecules essential for the HCV replication cycle, and therefore they may prove to be more effective than existing therapeutics, such as interferon-α and ribavirin combination therapy. This review focuses on the current status and future prospects of ribozymes, aptamers, siRNAs, and antisense oligonucleotides as therapeutic reagents against HCV.

  10. Barbituric acid-based magnetic N-halamine nanoparticles as recyclable antibacterial agents.

    PubMed

    Dong, Alideertu; Sun, Yue; Lan, Shi; Wang, Qin; Cai, Qian; Qi, Xiuzhen; Zhang, Yanling; Gao, Ge; Liu, Fengqi; Harnoode, Chokto

    2013-08-28

    Novel recyclable bactericidal materials, barbituric acid-based magnetic N-halamine nanoparticles (BAMNH NPs), were fabricated by coating of magnetic silica nanoparticles (MS NPs) with barbituric acid-based N-halamine by the aid of the radical polymerization. The sterilizing effect on the bacterial strain is investigated by incubating Gram-negative bacteria (Escherichia coli and Pseudomonas aeruginosa) and Gram-positive bacteria (Staphylococcus aureus and Bacillus subtilis). The as-prepared BAMNH NPs exhibit higher biocidal activity than the bulk powder barbituric acid-based N-halamine due to the high activated surface area. The structural effect of N-halamine on antimicrobial performance was fully clarified through the comparison between BAMNH NPs and hydantoin-based magnetic N-halamine nanoparticles (HMNH NPs). BAMNH NPs exhibited promising stability toward repeated washing and long-term storage. BAMNH NPs with different chlorine content were comparatively chosen to investigate the influence of chlorine content on the antimicrobial activity. An antibacterial recycle experiment revealed that no significant change occurred in the structure and antibacterial efficiency of BAMNH NPs after five recycle experiments. The combination of barbituric acid-based N-halamine with magnetic component results in an obvious synergistic effect and facilitates the repeated antibacterial applications, providing potential and ideal candidates for sterilization or even for the control of disease.

  11. Red Shoe-Blue Shoe: An Acid-Base Demonstration with a Fashionable Twist.

    ERIC Educational Resources Information Center

    Breyer, Arthur C.; Uzelmeier, Calvin E.

    1998-01-01

    Illustrates that acid-base indicators come in many forms and the reversible effects that acids and bases have on the colors of such indicators. An object is dyed in an indicator, which causes the object to turn dark blue at pH less than 3.0 to 5.0. Suggests using dyeable fabric shoes and other cotton articles. (PVD)

  12. Evaluation of the number of ionogenic groups of inulinase by acid-base titration.

    PubMed

    Kovaleva, T A; Holyavka, M G; Rezvan, S G; Kozhedub, S V

    2008-06-01

    Acid base titration showed that Aspergillus awamori inulinase includes 178 asparaginic and glutamic acid residues, 20 histidine, 10 serine, and 34 lysine and tyrosine residues. Denaturation temperature for this enzyme was calculated using analysis of the proportion of stabilizing and destabilizing amino acids in the molecule.

  13. Stereoselective assembly of amino acid-based metal-biomolecule nanofibers.

    PubMed

    Wu, Hong; Tian, Chunyong; Zhang, Yufei; Yang, Chen; Zhang, Songping; Jiang, Zhongyi

    2015-04-14

    A series of amino acid-based metal-biomolecule nanofibers are fabricated through a coordination-directed assembly process. The chirality and carbon chain length of the amino acids exert a pronounced influence on the assembly process. This study may be extended to design diverse kinds of 1-D metal-biomolecule frameworks (MBioFs).

  14. The Acid-Base Titration of a Very Weak Acid: Boric Acid

    ERIC Educational Resources Information Center

    Celeste, M.; Azevedo, C.; Cavaleiro, Ana M. V.

    2012-01-01

    A laboratory experiment based on the titration of boric acid with strong base in the presence of d-mannitol is described. Boric acid is a very weak acid and direct titration with NaOH is not possible. An auxiliary reagent that contributes to the release of protons in a known stoichiometry facilitates the acid-base titration. Students obtain the…

  15. Regulatory bioinformatics for food and drug safety.

    PubMed

    Healy, Marion J; Tong, Weida; Ostroff, Stephen; Eichler, Hans-Georg; Patak, Alex; Neuspiel, Margaret; Deluyker, Hubert; Slikker, William

    2016-10-01

    "Regulatory Bioinformatics" strives to develop and implement a standardized and transparent bioinformatic framework to support the implementation of existing and emerging technologies in regulatory decision-making. It has great potential to improve public health through the development and use of clinically important medical products and tools to manage the safety of the food supply. However, the application of regulatory bioinformatics also poses new challenges and requires new knowledge and skill sets. In the latest Global Coalition on Regulatory Science Research (GCRSR) governed conference, Global Summit on Regulatory Science (GSRS2015), regulatory bioinformatics principles were presented with respect to global trends, initiatives and case studies. The discussion revealed that datasets, analytical tools, skills and expertise are rapidly developing, in many cases via large international collaborative consortia. It also revealed that significant research is still required to realize the potential applications of regulatory bioinformatics. While there is significant excitement in the possibilities offered by precision medicine to enhance treatments of serious and/or complex diseases, there is a clear need for further development of mechanisms to securely store, curate and share data, integrate databases, and standardized quality control and data analysis procedures. A greater understanding of the biological significance of the data is also required to fully exploit vast datasets that are becoming available. The application of bioinformatics in the microbiological risk analysis paradigm is delivering clear benefits both for the investigation of food borne pathogens and for decision making on clinically important treatments. It is recognized that regulatory bioinformatics will have many beneficial applications by ensuring high quality data, validated tools and standardized processes, which will help inform the regulatory science community of the requirements

  16. Specific expression of an A-kinase anchoring protein subtype, AKAP-150, and specific regulatory mechanism for Na(+),K(+)-ATPase via protein kinase A in the parotid gland among the three major salivary glands of the rat.

    PubMed

    Kurihara, Kinji; Nakanishi, Nobuo; Amano, Osamu; Yamamoto, Miyuki; Iseki, Shoichi

    2003-07-15

    We have examined the expression of A-kinase anchoring protein (AKAP) in the three major salivary glands, i.e. the parotid gland (PG), submandibular gland (SMG), and sublingual gland (SLG), of the rat to elucidate the functional relevance between saliva secretion and Na(+),K(+)-ATPase regulation by protein kinase A (PKA)-dependent phosphorylation, since an AKAP subtype, AKAP-150, is known to be involved in the regulation of the ATPase in PG. Although AKAP-150 and its mRNA were clearly detected in the PG, they were hardly detectable in either the SMG or SLG. The membrane-bound form of the RII regulatory subunit of PKA, an index for the total amount of AKAP subtypes and therefore of the anchored PKA holoenzyme, was also undetectable in membranes from the SMG and SLG but was found in the PG; though a substantial and comparable amount of Na(+),K(+)-ATPase was present in all of these membrane preparations. Incubation with [gamma-32P]ATP revealed that Na(+),K(+)-ATPase in the PG membranes was quickly phosphorylated upon the addition of cAMP, whereas the ATPases in the membranes from SMG and SLG were not; though they were readily and equally phosphorylated by the exogenously added PKA catalytic subunit. AKAP-150 in the basolateral membranes of PG acinar cells was co-immunoprecipitated with RII by an anti-RII antiserum; and AKAP-150 and Na(+),K(+)-ATPase were immunohistochemically co-localized predominantly on the basolateral membranes, suggesting a possibility that the ATPase might directly interact with the AKAP to form an ATPase/AKAP/PKA complex or associate with the AKAP, such association being mediated via some scaffolding molecule. Expression of AKAP-150 and quick down-regulation of Na(+),K(+)-ATPase by AKAP-anchored PKA in response to cAMP elevation are characteristics specific to PG among the three major salivary glands, suggesting the presence of PG-specific regulatory mechanisms for saliva production/secretion.

  17. Metabolism, gas exchange, and acid-base balance of giant salamanders.

    PubMed

    Ultsch, Gordon R

    2012-08-01

    The giant salamanders are aquatic and paedomorphic urodeles including the genera Andrias and Cryptobranchus (Cryptobranchidae), Amphiuma (Amphiumidae), Siren (Sirenidae), and Necturus (Proteidae, of which only N. maculosus is considered 'a giant'). Species in the genera Cryptobranchus and Necturus are considered aquatic salamanders well adapted for breathing water, poorly adapted for breathing air, and with limited abilities t