Science.gov

Sample records for acid-base regulatory mechanisms

  1. Recent advances in understanding trans-epithelial acid-base regulation and excretion mechanisms in cephalopods

    PubMed Central

    Hu, Marian Y; Hwang, Pung-Pung; Tseng, Yung-Che

    2015-01-01

    Cephalopods have evolved complex sensory systems and an active lifestyle to compete with fish for similar resources in the marine environment. Their highly active lifestyle and their extensive protein metabolism has led to substantial acid-base regulatory abilities enabling these organisms to cope with CO2 induced acid-base disturbances. In convergence to teleost, cephalopods possess an ontogeny-dependent shift in ion-regulatory epithelia with epidermal ionocytes being the major site of embryonic acid-base regulation and ammonia excretion, while gill epithelia take these functions in adults. Although the basic morphology and excretory function of gill epithelia in cephalopods were outlined almost half a century ago, modern immunohistological and molecular techniques are bringing new insights to the mechanistic basis of acid-base regulation and excretion of nitrogenous waste products (e.g. NH3/NH4+) across ion regulatory epithelia of cephalopods. Using cephalopods as an invertebrate model, recent findings reveal partly conserved mechanisms but also novel aspects of acid-base regulation and nitrogen excretion in these exclusively marine animals. Comparative studies using a range of marine invertebrates will create a novel and exciting research direction addressing the evolution of pH regulatory and excretory systems. PMID:26716070

  2. Recent advances in understanding trans-epithelial acid-base regulation and excretion mechanisms in cephalopods.

    PubMed

    Hu, Marian Y; Hwang, Pung-Pung; Tseng, Yung-Che

    2015-01-01

    Cephalopods have evolved complex sensory systems and an active lifestyle to compete with fish for similar resources in the marine environment. Their highly active lifestyle and their extensive protein metabolism has led to substantial acid-base regulatory abilities enabling these organisms to cope with CO2 induced acid-base disturbances. In convergence to teleost, cephalopods possess an ontogeny-dependent shift in ion-regulatory epithelia with epidermal ionocytes being the major site of embryonic acid-base regulation and ammonia excretion, while gill epithelia take these functions in adults. Although the basic morphology and excretory function of gill epithelia in cephalopods were outlined almost half a century ago, modern immunohistological and molecular techniques are bringing new insights to the mechanistic basis of acid-base regulation and excretion of nitrogenous waste products (e.g. NH3/NH4 (+)) across ion regulatory epithelia of cephalopods. Using cephalopods as an invertebrate model, recent findings reveal partly conserved mechanisms but also novel aspects of acid-base regulation and nitrogen excretion in these exclusively marine animals. Comparative studies using a range of marine invertebrates will create a novel and exciting research direction addressing the evolution of pH regulatory and excretory systems.

  3. Acid-base chemical mechanism of aspartase from Hafnia alvei.

    PubMed

    Yoon, M Y; Thayer-Cook, K A; Berdis, A J; Karsten, W E; Schnackerz, K D; Cook, P F

    1995-06-20

    An acid-base chemical mechanism is proposed for Hafnia alvei aspartase in which a proton is abstracted from C-3 of the monoanionic form of L-aspartate by an enzyme general base with a pK of 6.3-6.6 in the absence and presence of Mg2+. The resulting carbanion is presumably stabilized by delocalization of electrons into the beta-carboxyl with the assistance of a protonated enzyme group in the vicinity of the beta-carboxyl. Ammonia is then expelled with the assistance of a general acid group that traps an initially expelled NH3 as the final NH4+ product. In agreement with the function of the general acid group, potassium, an analog of NH4+, binds optimally when the group is unprotonated. The pK for the general acid is about 7 in the absence of Mg2+, but is increased by about a pH unit in the presence of Mg2+. Since the same pK values are observed in the pKi(succinate) and V/K pH profile, both enzyme groups must be in their optimum protonation state for efficient binding of reactant in the presence of Mg2+. At the end of a catalytic cycle, both the general base and general acid groups are in a protonation state opposite that in which they started when aspartate was bound. The presence of Mg2+ causes a pH-dependent activation of aspartase exhibited as a partial change in the V and V/Kasp pH profiles. When the aspartase reaction is run in D2O to greater than 50% completion no deuterium is found in the remaining aspartate, indicating that the site is inaccessible to solvent during the catalytic cycle.

  4. Causes and mechanisms of acid-base and electrolyte abnormalities in cancer patients.

    PubMed

    Miltiadous, George; Christidis, Dimitrios; Kalogirou, Michalis; Elisaf, Moses

    2008-01-01

    Patients with cancer frequently exhibit acid-base and electrolyte disturbances that complicate their management and prolong their hospitalization. The mechanisms encountered for these abnormalities are multifactorial in origin. Both the underlying disease and the therapeutic interventions can contribute to the development of these disturbances. An understanding of the mechanisms involved in their pathogenesis is of paramount importance for their prevention and treatment in cancer patients. This article briefly reviews the causes and the pathophysiology of acid-base and electrolyte abnormalities observed in cancer patients. PMID:18206594

  5. Stearic acid based oleogels: a study on the molecular, thermal and mechanical properties.

    PubMed

    Sagiri, S S; Singh, Vinay K; Pal, K; Banerjee, I; Basak, Piyali

    2015-03-01

    Stearic acid and its derivatives have been used as gelators in food and pharmaceutical gel formulations. However, the mechanism pertaining to the stearic acid based gelation has not been deciphered yet. Keeping that in mind, we investigated the role of stearic acid on physic-chemical properties of oleogel. For this purpose, two different oil (sesame oil and soy bean oil) formulations/oleogels were prepared. In depth analysis of gel kinetics, gel microstructure, molecular interactions, thermal and mechanical behaviors of the oleogels were done. The properties of the oleogels were dependent on the type of the vegetable oil used and the concentration of the stearic acid. Avrami analysis of DSC thermograms indicated that heterogeneous nucleation was coupled with the one-dimensional growth of gelator fibers as the key phenomenon in the formation of oleogels. Viscoelastic and pseudoplastic nature of the oleogels was analyzed in-depth by fitting the stress relaxation data in modified Peleg's model and rheological studies, respectively. Textural studies have revealed that the coexistence of hydrogen bond dissipation and formation of new bonds is possible under stress conditions in the physical oleogels.

  6. What is the Ultimate Goal in Acid-Base Regulation?

    ERIC Educational Resources Information Center

    Balakrishnan, Selvakumar; Gopalakrishnan, Maya; Alagesan, Murali; Prakash, E. Sankaranarayanan

    2007-01-01

    It is common to see chapters on acid-base physiology state that the goal of acid-base regulatory mechanisms is to maintain the pH of arterial plasma and not arterial PCO [subscript 2] (Pa[subscript CO[subscript 2

  7. Advances in Autophagy Regulatory Mechanisms

    PubMed Central

    Gallagher, Laura E.; Williamson, Leon E.; Chan, Edmond Y. W.

    2016-01-01

    Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK) complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1). Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1. PMID:27187479

  8. [Proposals for economic regulatory mechanisms].

    PubMed

    Bruppacher, R

    1978-12-01

    Economic mechanisms are needed to guarantee that longterm needs are not forgotten over short term benefits and desires. In traffic, variable costs (cost per mile) should be increased relative to fixed costs, traffic education should be supported and--where needed--fines for undesirable behavior should be introduced. Toxic substances should be taxed. As far as tobacco and alcohol consumption is concerned, abstinence or temperance should be rewarded. In medical care and medical education, prevention should be promoted by increased financial support.

  9. α-Ketoglutarate regulates acid-base balance through an intrarenal paracrine mechanism

    PubMed Central

    Tokonami, Natsuko; Morla, Luciana; Centeno, Gabriel; Mordasini, David; Ramakrishnan, Suresh Krishna; Nikolaeva, Svetlana; Wagner, Carsten A.; Bonny, Olivier; Houillier, Pascal; Doucet, Alain; Firsov, Dmitri

    2013-01-01

    Paracrine communication between different parts of the renal tubule is increasingly recognized as an important determinant of renal function. Previous studies have shown that changes in dietary acid-base load can reverse the direction of apical α-ketoglutarate (αKG) transport in the proximal tubule and Henle’s loop from reabsorption (acid load) to secretion (base load). Here we show that the resulting changes in the luminal concentrations of αKG are sensed by the αKG receptor OXGR1 expressed in the type B and non-A–non-B intercalated cells of the connecting tubule (CNT) and the cortical collecting duct (CCD). The addition of 1 mM αKG to the tubular lumen strongly stimulated Cl–-dependent HCO3– secretion and electroneutral transepithelial NaCl reabsorption in microperfused CCDs of wild-type mice but not Oxgr1–/– mice. Analysis of alkali-loaded mice revealed a significantly reduced ability of Oxgr1–/– mice to maintain acid-base balance. Collectively, these results demonstrate that OXGR1 is involved in the adaptive regulation of HCO3– secretion and NaCl reabsorption in the CNT/CCD under acid-base stress and establish αKG as a paracrine mediator involved in the functional coordination of the proximal and the distal parts of the renal tubule. PMID:23934124

  10. Hyaluronic acid-based hydrogels crosslinked by copper-catalyzed azide-alkyne cycloaddition with tailorable mechanical properties.

    PubMed

    Piluso, Susanna; Hiebl, Bernhard; Gorb, Stanislav N; Kovalev, Alexander; Lendlein, Andreas; Neffe, Axel T

    2011-02-01

    Biopolymers of the extracellular matrix are attractive starting materials for providing degradable and biocompatible biomaterials. In this study, hyaluronic acid-based hydrogels with tunable mechanical properties were prepared by the use of copper- catalyzed azide-alkyne cycloaddition (known as "click chemistry"). Alkyne-functionalized hyaluronic acid was crosslinked with linkers having two terminal azide functionalities, varying crosslinker density as well as the lengths and rigidity of the linker molecules. By variation of the crosslinker density and crosslinker type, hydrogels with elastic moduli in the range of 0.5-4 kPa were prepared. The washed materials contained a maximum of 6.8 mg copper per kg dry weight and the eluate of the gel crosslinked with diazidostilbene did not show toxic effects on L929 cells. The hyaluronic acid-based hydrogels have potential as biomaterials for cell culture or soft tissue regeneration applications. PMID:21374560

  11. Contribution of net ion transfer mechanisms to acid-base regulation after exhausting activity in the larger spotted dogfish (Scyliorhinus stellaris).

    PubMed

    Holeton, G F; Heisler, N

    1983-03-01

    Specimens of the larger spotted dogfish (Scyliorhinus stellaris) were electrically stimulated to exhaustion in a closed seawater recirculation system. The production of large quantities of lactic acid by anaerobic metabolism and the resultant efflux of the dissociation products, H+ and lactate, from the white musculature resulted in severe acid-base disturbances and in increases in plasma lactate concentration, the two effects having extremely different time courses. Plasma pH and bicarbonate were maximally depressed 15-30 min after exercise, whereas peak lactate concentrations of up to 30 mM were not attained before 4-8 h after exercise. The acid-base status were restored to normal 10-14 h after exercise, long before the aerobic processing of surplus lactic acid was complete 22-30 h after exercise. This behaviour can be explained on the basis of an interaction of transfer rates, buffer values and equilibria between intracellular and extracellular compartments with the transient net transfer of surplus H+ ions to the environmental water. About half of the original quantity of H+ was transferred net to the environment via the branchial epithelium during the first 8-10 h, and it was later taken up again at the rate of aerobic lactic acid processing in the metabolism of the fish, whereas a transfer of lactate was not observed at any time during the experiment. As a result, the distribution patterns of H+ and lactate differed from each other and varied with time elapsed after anaerobic exercise, leading to the apparent 'H+ ion deficit' which has been observed in the blood of several fish species during lactacidosis. Net transfer of H+ ions to the environment facilitates rapid normalization of the acid-base status long before the original stress, lactic acid, is removed from the organism and thus represents an effective regulatory mechanism for the defence of the internal milieu in fish.

  12. Regulatory mechanisms link phenotypic plasticity to evolvability

    PubMed Central

    van Gestel, Jordi; Weissing, Franz J.

    2016-01-01

    Organisms have a remarkable capacity to respond to environmental change. They can either respond directly, by means of phenotypic plasticity, or they can slowly adapt through evolution. Yet, how phenotypic plasticity links to evolutionary adaptability is largely unknown. Current studies of plasticity tend to adopt a phenomenological reaction norm (RN) approach, which neglects the mechanisms underlying plasticity. Focusing on a concrete question – the optimal timing of bacterial sporulation – we here also consider a mechanistic approach, the evolution of a gene regulatory network (GRN) underlying plasticity. Using individual-based simulations, we compare the RN and GRN approach and find a number of striking differences. Most importantly, the GRN model results in a much higher diversity of responsive strategies than the RN model. We show that each of the evolved strategies is pre-adapted to a unique set of unseen environmental conditions. The regulatory mechanisms that control plasticity therefore critically link phenotypic plasticity to the adaptive potential of biological populations. PMID:27087393

  13. Kinetics and Mechanisms of the Acid-base Reaction Between NH3 and HCOOH in Interstellar Ice Analogs

    NASA Astrophysics Data System (ADS)

    Bergner, Jennifer B.; Öberg, Karin I.; Rajappan, Mahesh; Fayolle, Edith C.

    2016-10-01

    Interstellar complex organic molecules are commonly observed during star formation, and are proposed to form through radical chemistry in icy grain mantles. Reactions between ions and neutral molecules in ices may provide an alternative cold channel to complexity, as ion-neutral reactions are thought to have low or even no-energy barriers. Here we present a study of the kinetics and mechanisms of a potential ion-generating, acid-base reaction between NH3 and HCOOH to form the salt NH{}4+HCOO-. We observe salt growth at temperatures as low as 15 K, indicating that this reaction is feasible in cold environments. The kinetics of salt growth are best fit by a two-step model involving a slow “pre-reaction” step followed by a fast reaction step. The reaction energy barrier is determined to be 70 ± 30 K with a pre-exponential factor 1.4 ± 0.4 × 10-3 s-1. The pre-reaction rate varies under different experimental conditions and likely represents a combination of diffusion and orientation of reactant molecules. For a diffusion-limited case, the pre-reaction barrier is 770 ± 110 K with a pre-exponential factor of ˜7.6 × 10-3 s-1. Acid-base chemistry of common ice constituents is thus a potential cold pathway to generating ions in interstellar ices.

  14. Physical and mechanical properties of extruded poly(lactic acid)-based Paulownia elongata biocomposites

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Paulownia wood flour (PWF), a byproduct of milling lumber, was tested as bio-filler with polylactic acid (PLA). Paulownia wood (PW) shavings were milled and separated into particle fractions and then blended with PLA with a single screw extruder. Mechanical and thermal properties were tested. Dif...

  15. The phosphate of pyridoxal-5'-phosphate is an acid/base catalyst in the mechanism of Pseudomonas fluorescens kynureninase.

    PubMed

    Phillips, Robert S; Scott, Israel; Paulose, Riya; Patel, Akshay; Barron, Taylor Colt

    2014-02-01

    Kynureninase (L-kynurenine hydrolase, EC 3.7.1.3) catalyzes the hydrolytic cleavage of L-kynurenine to L-alanine and anthranilic acid. The proposed mechanism of the retro-Claisen reaction requires extensive acid/base catalysis. Previous crystal structures showed that Tyr226 in the Pseudomonas fluorescens enzyme (Tyr275 in the human enzyme) hydrogen bonds to the phosphate of the pyridoxal-5'-phosphate (PLP) cofactor. This Tyr residue is strictly conserved in all sequences of kynureninase. The human enzyme complexed with a competitive inhibitor, 3-hydroxyhippuric acid, showed that the ligand carbonyl O is located 3.7 Å from the phenol of Tyr275 (Lima, S., Kumar, S., Gawandi, V., Momany, C. & Phillips, R. S. (2009) J. Med. Chem. 52, 389-396). We prepared a Y226F mutant of P. fluorescens kynureninase to probe the role of this residue in catalysis. The Y226F mutant has approximately 3000-fold lower activity than wild-type, and does not show the pKa values of 6.8 on kcat and 6.5 and 8.8 on k(cat)/K(m) seen for the wild-type enzyme (Koushik, S. V., Moore, J. A. III, Sundararaju, B. & Phillips, R. S. (1998) Biochemistry 37, 1376-1382). Wild-type kynureninase shows a resonance at 4.5 ppm in (31)P-NMR, which is shifted to 5.0, 3.3 and 2.0 ppm when the potent inhibitor 5-bromodihydrokynurenine is added. However, Y226F kynureninase shows resonances at 3.6 and 2.5 ppm, and no change in the peak position is seen when 5-bromodihydrokynurenine is added. Taken together, these results suggest that Tyr226 mediates proton transfer between the substrate and the phosphate, which accelerates formation of external aldimine and gem-diol intermediates. Thus, the phosphate of PLP acts as an acid/base catalyst in the mechanism of kynureninase.

  16. Distribution of sea urchins living near shallow water CO2 vents is dependent upon species acid-base and ion-regulatory abilities.

    PubMed

    Calosi, P; Rastrick, S P S; Graziano, M; Thomas, S C; Baggini, C; Carter, H A; Hall-Spencer, J M; Milazzo, M; Spicer, J I

    2013-08-30

    To reduce the negative effect of climate change on Biodiversity, the use of geological CO2 sequestration has been proposed; however leakage from underwater storages may represent a risk to marine life. As extracellular homeostasis is important in determining species' ability to cope with elevated CO2, we investigated the acid-base and ion regulatory responses, as well as the density, of sea urchins living around CO2 vents at Vulcano, Italy. We conducted in situ transplantation and field-based laboratory exposures to different pCO2/pH regimes. Our results confirm that sea urchins have some ability to regulate their extracellular fluid under elevated pCO2. Furthermore, we show that even in closely-related taxa divergent physiological capabilities underlie differences in taxa distribution around the CO2 vent. It is concluded that species distribution under the sort of elevated CO2 conditions occurring with leakages from geological storages and future ocean acidification scenarios, may partly be determined by quite subtle physiological differentiation. PMID:23428288

  17. Aminolevulinic Acid-Based Tumor Detection and Therapy: Molecular Mechanisms and Strategies for Enhancement

    PubMed Central

    Yang, Xue; Palasuberniam, Pratheeba; Kraus, Daniel; Chen, Bin

    2015-01-01

    Aminolevulinic acid (ALA) is the first metabolite in the heme biosynthesis pathway in humans. In addition to the end product heme, this pathway also produces other porphyrin metabolites. Protoporphyrin (PpIX) is one heme precursor porphyrin with good fluorescence and photosensitizing activity. Because tumors and other proliferating cells tend to exhibit a higher level of PpIX than normal cells after ALA incubation, ALA has been used as a prodrug to enable PpIX fluorescence detection and photodynamic therapy (PDT) of lesion tissues. Extensive studies have been carried out in the past twenty years to explore why some tumors exhibit elevated ALA-mediated PpIX and how to enhance PpIX levels to achieve better tumor detection and treatment. Here we would like to summarize previous research in order to stimulate future studies on these important topics. In this review, we focus on summarizing tumor-associated alterations in heme biosynthesis enzymes, mitochondrial functions and porphyrin transporters that contribute to ALA-PpIX increase in tumors. Mechanism-based therapeutic strategies for enhancing ALA-based modalities including iron chelators, differentiation agents and PpIX transporter inhibitors are also discussed. PMID:26516850

  18. Structural Analysis and Mechanical Characterization of Hyaluronic Acid-Based Doubly Cross-Linked Networks

    PubMed Central

    Jha, Amit K.; Hule, Rohan A.; Jiao, Tong; Teller, Sean S.; Clifton, Rodney J.; Duncan, Randall L.; Pochan, Darrin J.; Jia, Xinqiao

    2009-01-01

    We have created a new class of hyaluronic acid (HA)-based hydrogel materials with HA hydrogel particles (HGPs) embedded in and covalently cross-linked to a secondary network. HA HGPs with an average diameter of ∼900 nm and narrow particle size distribution were synthesized using a refined reverse micelle polymerization technique. The average mesh size of the HGPs was estimated to be approximately 5.5 to 7.0 nm by a protein uptake experiment. Sodium periodate oxidation not only introduced aldehyde groups to the particles but also reduced the average particle size. The aldehyde groups generated were used as reactive handles for subsequent cross-linking with an HA derivative containing hydrazide groups. The resulting macroscopic gels contain two distinct hierarchical networks (doubly cross-linked networks, DXNs): one within individual particles and another among different particles. Bulk gels (BGs) formed by direct mixing of HA derivatives with mutually reactive groups were included for comparison. The hydrogel microstructures were collectively characterized by microscopy and neutron scattering techniques. Their viscoelasticity was quantified at low frequencies (0.1−10 Hz) using a controlled stress rheometer and at high frequencies (up to 200 Hz) with a home-built torsional wave apparatus. Both BGs and DXNs are stable elastic gels that become stiffer at higher frequencies. The HA-based DXN offers unique structural hierarchy and mechanical properties that are suitable for soft tissue regeneration. PMID:20046226

  19. Acid-base catalysis in the chemical mechanism of inosine monophosphate dehydrogenase.

    PubMed

    Markham, G D; Bock, C L; Schalk-Hihi, C

    1999-04-01

    Inosine-5'-monophosphate dehydrogenase (IMPDH) catalyzes the K+-dependent reaction IMP + NAD + H2O --> XMP + NADH + H+ which is the rate-limiting step in guanine nucleotide biosynthesis. The catalytic mechanism of the human type-II IMPDH isozyme has been studied by measurement of the pH dependencies of the normal reaction, of the hydrolysis of 2-chloro-IMP (which yields XMP and Cl- in the absence of NAD), and of inactivation by the affinity label 6-chloro-purine-ribotide (6-Cl-PRT). The pH dependence of the IMPDH reaction shows bell-shaped profiles for kcat and the kcat/Km values for both IMP and NAD, illustrating the involvement of both acidic and basic groups in catalysis. Half-maximal kcat values occur at pH values of 7.2 and 9.8; similar pK values of 6.9 and 9.4 are seen in the kcat/Km profile for NAD. The kcat/Km profile for IMP, which binds first in the predominantly ordered kinetic mechanism, shows pK values of 8.1 and 7.3 for acidic and basic groups, respectively. None of the kinetic pK values correspond to ionizations of the free substrates and thus reflect ionization of the enzyme or enzyme-substrate complexes. The rate of inactivation by 6-Cl-PRT, which modifies the active site sulfhydryl of cysteine-331, increases with pH; the pK of 7.5 reflects the ionization of the sulfhydryl in the E.6-Cl-PRT complex. The pKs of the acids observed in the IMPDH reaction likely also reflect ionization of the cysteine-331 sulfhydryl which adds to C-2 of IMP prior to NAD reduction. The kcat and kcat/Km values for hydrolysis of 2-Cl-IMP show a pK value of 9.9 for a basic group, similar to that seen in the overall reaction, but do not exhibit the ionization of an acidic group. Surprisingly, the rates of 2-Cl-IMP hydrolysis and of inactivation by 6-Cl-PRT are not stimulated by K+, in contrast to the >100-fold K+ activation of the IMPDH reaction. Apparently the enigmatic role of K+ lies in the NAD(H)-dependent segment of the IMPDH reaction. To evaluate the importance of

  20. Preparation of a multifunctional material with superhydrophobicity, superparamagnetism, mechanical stability and acids-bases resistance by electrospinning

    NASA Astrophysics Data System (ADS)

    Wang, Shuai; Liu, Qingwen; Zhang, Yang; Wang, Shaodan; Li, Yaoxian; Yang, Qingbiao; Song, Yan

    2013-08-01

    A multifunctional material with superhydrophobicity, superparamagnetism, mechanical stability and acids-bases resistance was developed from the bead-on-string PVDF and Fe3O4@SiO2@POTS nanoparticles by electrospinning in this work. The Fe3O4@SiO2@POTS nanoparticles which have excellent superparamagnetism were successfully prepared and subsequently introduced into PVDF precursor solution. Through electrospinning, Fe3O4@SiO2@POTS nanoparticles irregularly distributed in the membrane to not only make a dual-scale roughness which is beneficial to obtain a superhydrophobic surface but also stimulate the material turns to superparamagnetic for wider use in different fields. More importantly, the film shows stable superhydrophobicity even for many corrosive solutions, such as acidic or basic solutions over a wide pH range and remarkable mechanical stability. The composition and surface structure of the film are the two critical factors that induce such unusual properties. The weight ratio of Fe3O4@SiO2@POTS/PVDF can strongly influence the superhydrophobicity and mechanical properties of the composite films.

  1. Regulatory mechanisms of cardiac development and repair.

    PubMed

    Chinchilla, Ana; Franco, Diego

    2006-06-01

    The heart originates from bilateral primordia that eventually fuse in the embryonic midline leading to a linear tube. Soon after, the heart bends to the right and atrial and ventricular chambers are formed. Progressively each embryonic compartment initiates a process of septation that eventually leads to a four chambered heart with a double circuitry and synchronous contraction. During these developmental events, the growth of the heart and in particular of its myocardial component gradually increases. However, as the heart gets into its mature stage, myocardial growth ceases and concomitantly the myocardium looses its proliferative capacity. In the adult human population, the most frequent cardiac pathologies emanate from a decompensated lost of myocardial function. Therapeutical approaches aiming to add or replace new myocytes to the failing heart are thus highly desired. Embryonic stem cells have a high capacity to give rise to multiple cell types, including myocardial cells, opening new therapeutical possibilities. Unexpectedly discrete adult cell populations have also shown a greater cell plasticity than previously thought, earning therefore much attention as therapeutic targets. These observations have launched initial clinical trials with great hope of clinical benefit. However, it is essential in this respect to initially understand, and eventually control myogenic cell fate determination. Developmental biology of the heart provides a very suitable model for this end. Over the last decade there has been a considerable advance in the understanding of the molecular mechanisms that lead to the determination of the cardiomyocyte lineage and the regulatory mechanisms by which morphogenesis of the heart takes place. Growth factor signalling and transcriptional events controlling cardiac myogenesis have been progressively unravelled. In this review we aim to summarise current data concerning the cardiomyogenic cell fate determination pathways occurring during the

  2. Mechanical Behavior and Thermal Stability of Acid-Base Phosphate Cements and Composites Fabricated at Ambient Temperature

    NASA Astrophysics Data System (ADS)

    Colorado Lopera, Henry Alonso

    This dissertation presents the study of the mechanical behavior and thermal stability of acid-base phosphate cements (PCs) and composites fabricated at ambient temperature. These materials are also known as chemically bonded phosphate ceramics (CBPCs). Among other advantages of using PCs when compared with traditional cements are the better mechanical properties (compressive and flexural strength), lower density, ultra-fast (controllable) setting time, controllable pH, and an environmentally benign process. Several PCs based on wollastonite and calcium and alumino phosphates after thermal exposure up to 1000°C have been investigated. First, the thermo-mechanical and chemical stability of wollastonite-based PC (Wo-PC) exposed to temperatures up to 1000°C in air environment were studied. The effects of processing conditions on the curing and shrinkage of the wollastonite-based PC were studied. The chemical reactions and phase transformations during the fabrication and during the thermal exposure are analyzed in detail using scanning electron microscopy (SEM), X-ray diffraction (XRD), and thermo-gravimetric analysis (TGA Then, the thermo-mechanical and chemical stability of glass, carbon and basalt fiber reinforced Wo-PC composites, were studied using SEM, XRD, TGA. The flexural strength and Weibull statistics were analyzed. A significant strength degradation in the composites were found after the thermal exposure at elevated temperatures due to the interdifusion and chemical reactions across the fibers and the matrix at temperatures over 600°C. To overcome this barrier, we have developed a new PC based on calcium and alumino-phosphates (Ca-Al PCs). The Ca-Al PCs were studied in detail using SEM, XRD, TGA, curing, shrinkage, Weibull statistics, and compression tests. Our study has confirmed that this new composite material is chemically and mechanically stable at temperatures up to 1000°C. Moreover, the compression strength increases after exposure to 1000

  3. Modeling Transport and Flow Regulatory Mechanisms of the Kidney

    PubMed Central

    Layton, Anita T.

    2013-01-01

    The kidney plays an indispensable role in the regulation of whole-organism water balance, electrolyte balance, and acid-base balance, and in the excretion of metabolic wastes and toxins. In this paper, we review representative mathematical models that have been developed to better understand kidney physiology and pathophysiology, including the regulation of glomerular filtration, the regulation of renal blood flow by means of the tubuloglomerular feedback mechanisms and of the myogenic mechanism, the urine concentrating mechanism, and regulation of renal oxygen transport. We discuss how such modeling efforts have significantly expanded our understanding of renal function in both health and disease. PMID:23914303

  4. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    NASA Astrophysics Data System (ADS)

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine

    2015-07-01

    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution.

  5. Mathematical models of regulatory mechanisms of sleep-wake rhythms.

    PubMed

    Nakao, M; Karashima, A; Katayama, N

    2007-05-01

    Studies of regulatory mechanisms of sleep-wake rhythms have benefited greatly from mathematical modeling. There are two major frameworks of modeling: one integrates homeostatic and circadian regulations and the other consists of multiple interacting oscillators. In this article, model constructions based on these respective frameworks and their characteristics are reviewed. The two-process model and the multioscillator model are explained in detail. An appropriate mathematical abstraction is also shown to provide a viewpoint unifying the model structures, which might seem to be distinct. Recently acquired knowledge of neural regulatory mechanisms of sleep-wake rhythm has prompted modeling at the neural network level. Such a detailed model is also reviewed, and could be used to explore a possible neural mechanism underlying a pathological state of sleep-wake rhythm. PMID:17364138

  6. Regulatory mechanisms related to biofuel tolerance in producing microbes.

    PubMed

    Fu, Y; Chen, L; Zhang, W

    2016-08-01

    Production of renewable biofuels through either native or engineered microbes has drawn significant attention in recent years, mostly due to the increasing concerns on the energy crisis and the environmental consequences of the overutilization of petroleum-based fuels. Although significant progress has been achieved thus far, further advances are still necessary in order to decrease the manufacturing cost so that the producing processes can be more competitive to petroleum fuels. Among various possible approaches, the increase in biofuel tolerance in microbes has been suggested as one aspect which is important for the success of biofuel production at industry-scale. In this article, we critically summarize recent advances in deciphering regulatory mechanisms for enhancing biofuel tolerance in various micro-organisms, focusing on functions and utilization of several well-studied regulatory mechanisms in microbes, such as two-component signal transduction systems, sigma factors, transcription factors, noncoding RNA and other regulators. PMID:27123568

  7. Use of a quantitative strong ion approach to determine the mechanism for acid-base abnormalities in sick calves with or without diarrhea.

    PubMed

    Constable, Peter D; Stämpfli, Henry R; Navetat, Hérve; Berchtold, Joachim; Schelcher, François

    2005-01-01

    Acid-base abnormalities are frequently present in sick calves. The mechanism for an acid-base disturbance can be characterized using the strong ion approach, which requires accurate values for the total concentration of plasma nonvolatile buffers (A(tot)) and the effective dissociation constant for plasma weak acids (K(a)). The aims of this study were to experimentally determine A(tot), K(a), and net protein charge values for calf plasma and to apply these values quantitatively to data from sick calves to determine underlying mechanisms for the observed acid-base disturbance. Plasma was harvested from 9 healthy Holstein-Friesian calves and concentrations of quantitatively important strong ions (Na+, K+, Ca2+, Mg2+, Cl-, L-lactate) and nonvolatile buffer ions (total protein, albumin, phosphate) were determined. Plasma was tonometered with CO2 at 37 degrees C, and plasma P(CO2) and pH measured over a range of 15-159 mm Hg and 6.93-7.79, respectively. Strong ion difference (SID) was calculated from the measured strong ion concentrations, and nonlinear regression was used to estimate values for A(tot) and K(a) from the measured pH and P(CO2) and calculated SID. The estimated A(tot) and K(a) values were then validated using data from 2 in vivo studies. Mean (+/- SD) values for calf plasma were A(tot) = 0.343 mmol/g of total protein or 0.622 mmol/g of albumin; K(a) = (0.84 +/- 0.41) x 10(-7); pK(a) = 7.08. The net protein charge of calf plasma was 10.5 mEq/L, equivalent to 0.19 mEq/g of total protein or 0.34 mEq/g of albumin. Application of the strong ion approach to acid-base disturbances in 231 sick calves with or without diarrhea indicated that acidemia was due predominantly to a strong ion acidosis in response to hyponatremia accompanied by normochloremia or hyperchloremia and the presence of unidentified strong anions. These results confirm current recommendations that treatment of acidemia in sick calves with or without diarrhea should focus on intravenous or PO

  8. Secretory pattern and regulatory mechanism of growth hormone in cattle

    PubMed Central

    2016-01-01

    Abstract The ultradian rhythm of growth hormone (GH) secretion has been known in several animal species for years and has recently been observed in cattle. Although the physiological significance of the rhythm is not yet fully understood, it appears essential for normal growth. In this review, previous studies concerning the GH secretory pattern in cattle, including its ultradian rhythm, are introduced and the regulatory mechanism is discussed on the basis of recent findings. PMID:26260675

  9. Mechanism of action of regulatory proteins encoded by complex retroviruses.

    PubMed Central

    Cullen, B R

    1992-01-01

    Complex retroviruses are distinguished by their ability to control the expression of their gene products through the action of virally encoded regulatory proteins. These viral gene products modulate both the quantity and the quality of viral gene expression through regulation at both the transcriptional and posttranscriptional levels. The most intensely studied retroviral regulatory proteins, termed Tat and Rev, are encoded by the prototypic complex retrovirus human immunodeficiency virus type 1. However, considerable information also exists on regulatory proteins encoded by human T-cell leukemia virus type I, as well as several other human and animal complex retroviruses. In general, these data demonstrate that retrovirally encoded transcriptional trans-activators can exert a similar effect by several very different mechanisms. In contrast, posttranscriptional regulation of retroviral gene expression appears to occur via a single pathway that is probably dependent on the recruitment of a highly conserved cellular cofactor. These two shared regulatory pathways are proposed to be critical to the ability of complex retroviruses to establish chronic infections in the face of an ongoing host immune response. Images PMID:1406488

  10. Molecular regulatory mechanisms of osteoclastogenesis through cytoprotective enzymes

    PubMed Central

    Kanzaki, Hiroyuki; Shinohara, Fumiaki; Kanako, Itohiya; Yamaguchi, Yuuki; Fukaya, Sari; Miyamoto, Yutaka; Wada, Satoshi; Nakamura, Yoshiki

    2016-01-01

    It has been reported that reactive oxygen species (ROS), such as hydrogen peroxide and superoxide, take part in osteoclast differentiation as intra-cellular signaling molecules. The current assumed signaling cascade from RANK to ROS production is RANK, TRAF6, Rac1, and then Nox. The target molecules of ROS in RANKL signaling remain unclear; however, several reports support the theory that NF-κB signaling could be the crucial downstream signaling molecule of RANKL-mediated ROS signaling. Furthermore, ROS exert cytotoxic effects such as peroxidation of lipids and phospholipids and oxidative damage to proteins and DNA. Therefore, cells have several protective mechanisms against oxidative stressors that mainly induce cytoprotective enzymes and ROS scavenging. Three well-known mechanisms regulate cytoprotective enzymes including Nrf2-, FOXO-, and sirtuin-dependent mechanisms. Several reports have indicated a crosslink between FOXO- and sirtuin-dependent regulatory mechanisms. The agonists against the regulatory mechanisms are reported to induce these cytoprotective enzymes successfully. Some of them inhibit osteoclast differentiation and bone destruction via attenuation of intracellular ROS signaling. In this review article, we discuss the above topics and summarize the current information available on the relationship between cytoprotective enzymes and osteoclastogenesis. PMID:26795736

  11. Structural and catalytic effects of an invariant purine substitution in the hammerhead ribozyme: implications for the mechanism of acid-base catalysis.

    PubMed

    Schultz, Eric P; Vasquez, Ernesto E; Scott, William G

    2014-09-01

    The hammerhead ribozyme catalyzes RNA cleavage via acid-base catalysis. Whether it does so by general acid-base catalysis, in which the RNA itself donates and abstracts protons in the transition state, as is typically assumed, or by specific acid-base catalysis, in which the RNA plays a structural role and proton transfer is mediated by active-site water molecules, is unknown. Previous biochemical and crystallographic experiments implicate an invariant purine in the active site, G12, as the general base. However, G12 may play a structural role consistent with specific base catalysis. To better understand the role of G12 in the mechanism of hammerhead catalysis, a 2.2 Å resolution crystal structure of a hammerhead ribozyme from Schistosoma mansoni with a purine substituted for G12 in the active site of the ribozyme was obtained. Comparison of this structure (PDB entry 3zd4), in which A12 is substituted for G, with three previously determined structures that now serve as important experimental controls, allows the identification of structural perturbations that are owing to the purine substitution itself. Kinetic measurements for G12 purine-substituted schistosomal hammerheads confirm a previously observed dependence of rate on the pK(a) of the substituted purine; in both cases inosine, which is similar to G in pK(a) and hydrogen-bonding properties, is unexpectedly inactive. Structural comparisons indicate that this may primarily be owing to the lack of the exocyclic 2-amino group in the G12A and G12I substitutions and its structural effect upon both the nucleotide base and phosphate of A9. The latter involves the perturbation of a previously identified and well characterized metal ion-binding site known to be catalytically important in both minimal and full-length hammerhead ribozyme sequences. The results permit it to be suggested that G12 plays an important role in stabilizing the active-site structure. This result, although not inconsistent with the potential

  12. Regulatory mechanisms of EGFR signalling during Drosophila eye development.

    PubMed

    Malartre, Marianne

    2016-05-01

    EGFR signalling is a well-conserved signalling pathway playing major roles during development and cancers. This review explores what studying the EGFR pathway during Drosophila eye development has taught us in terms of the diversity of its regulatory mechanisms. This model system has allowed the identification of numerous positive and negative regulators acting at specific time and place, thus participating to the tight control of signalling. EGFR signalling regulation is achieved by a variety of mechanisms, including the control of ligand processing, the availability of the receptor itself and the transduction of the cascade in the cytoplasm. Ultimately, the transcriptional responses contribute to the establishment of positive and negative feedback loops. The combination of these multiple mechanisms employed to regulate the EGFR pathway leads to specific cellular outcomes involved in functions as diverse as the acquisition of cell fate, proliferation, survival, adherens junction remodelling and morphogenesis. PMID:26935860

  13. Regulatory mechanisms of EGFR signalling during Drosophila eye development.

    PubMed

    Malartre, Marianne

    2016-05-01

    EGFR signalling is a well-conserved signalling pathway playing major roles during development and cancers. This review explores what studying the EGFR pathway during Drosophila eye development has taught us in terms of the diversity of its regulatory mechanisms. This model system has allowed the identification of numerous positive and negative regulators acting at specific time and place, thus participating to the tight control of signalling. EGFR signalling regulation is achieved by a variety of mechanisms, including the control of ligand processing, the availability of the receptor itself and the transduction of the cascade in the cytoplasm. Ultimately, the transcriptional responses contribute to the establishment of positive and negative feedback loops. The combination of these multiple mechanisms employed to regulate the EGFR pathway leads to specific cellular outcomes involved in functions as diverse as the acquisition of cell fate, proliferation, survival, adherens junction remodelling and morphogenesis.

  14. Hyaluronic Acid-Based Hydrogels Containing Covalently Integrated Drug Depots: Implication for Controlling Inflammation in Mechanically Stressed Tissues

    PubMed Central

    Xiao, Longxi; Tong, Zhixiang; Chen, Yingchao; Pochan, Darrin J.; Sabanayagam, Chandran R.; Jia, Xinqiao

    2013-01-01

    Synthetic hydrogels containing covalently-integrated soft and deformable drug depots capable of releasing therapeutic molecules in response to mechanical forces are attractive candidates for the treatment of degenerated tissues that are normally load bearing. Herein, radically crosslinkable block copolymer micelles (xBCM) assembled from an amphiphilic block copolymer consisting of hydrophilic poly(acrylic acid) (PAA) partially modified with 2-hydroxyethyl acrylate, and hydrophobic poly(n-butyl acryclate) (PnBA) were employed as the drug depots and the microscopic crosslinkers for the preparation of hyaluronic acid (HA)-based, hydrogels. HA hydrogels containing covalently integrated micelles (HAxBCM) were prepared by radical polymerization of glycidyl methacrylate (GMA)-modified HA (HAGMA) in the presence of xBCMs. When micelles prepared from the parent PAA-b-PnBA without any polymerizable double bonds were used, hydrogels containing physically entrapped micelles (HApBCM) were obtained. The addition of xBCMs to a HAGMA precursor solution accelerated the gelation kinetics and altered the hydrogel mechanical properties. The resultant HAxBCM gels exhibit an elastic modulus of 847 ± 43 Pa and a compressive modulus of 9.2 ± 0.7 kPa. Diffusion analysis of Nile Red (NR)-labeled xBCMs employing fluorescence correlation spectroscopy confirmed the covalent immobilization of xBCMs in HA networks. Covalent integration of dexamethasone (DEX)-loaded xBCMs in HA gels significantly reduced the initial burst release and provided sustained release over a prolonged period. Importantly, DEX release from HAxBCM gels was accelerated by intermittently-applied external compression in a strain-dependent manner. Culturing macrophages in the presence of DEX-releasing HAxBCM gels significantly reduced cellular production of inflammatory cytokines. Incorporating mechano-responsive modules in synthetic matrices offers a novel strategy to harvest mechanical stress present in the healing wounds

  15. Hyaluronic acid-based hydrogels containing covalently integrated drug depots: implication for controlling inflammation in mechanically stressed tissues.

    PubMed

    Xiao, Longxi; Tong, Zhixiang; Chen, Yingchao; Pochan, Darrin J; Sabanayagam, Chandran R; Jia, Xinqiao

    2013-11-11

    Synthetic hydrogels containing covalently integrated soft and deformable drug depots capable of releasing therapeutic molecules in response to mechanical forces are attractive candidates for the treatment of degenerated tissues that are normally load bearing. Herein, radically cross-linkable block copolymer micelles (xBCM) assembled from an amphiphilic block copolymer consisting of hydrophilic poly(acrylic acid) (PAA) partially modified with 2-hydroxyethyl acrylate, and hydrophobic poly(n-butyl acryclate) (PnBA) were employed as the drug depots and the microscopic cross-linkers for the preparation of hyaluronic acid (HA)-based, hydrogels. HA hydrogels containing covalently integrated micelles (HAxBCM) were prepared by radical polymerization of glycidyl methacrylate (GMA)-modified HA (HAGMA) in the presence of xBCMs. When micelles prepared from the parent PAA-b-PnBA without any polymerizable double bonds were used, hydrogels containing physically entrapped micelles (HApBCM) were obtained. The addition of xBCMs to a HAGMA precursor solution accelerated the gelation kinetics and altered the hydrogel mechanical properties. The resultant HAxBCM gels exhibit an elastic modulus of 847 ± 43 Pa and a compressive modulus of 9.2 ± 0.7 kPa. Diffusion analysis of Nile Red (NR)-labeled xBCMs employing fluorescence correlation spectroscopy confirmed the covalent immobilization of xBCMs in HA networks. Covalent integration of dexamethasone (DEX)-loaded xBCMs in HA gels significantly reduced the initial burst release and provided sustained release over a prolonged period. Importantly, DEX release from HAxBCM gels was accelerated by intermittently applied external compression in a strain-dependent manner. Culturing macrophages in the presence of DEX-releasing HAxBCM gels significantly reduced cellular production of inflammatory cytokines. Incorporating mechano-responsive modules in synthetic matrices offers a novel strategy to harvest mechanical stress present in the healing

  16. Chemical Feasibility of the General Acid/Base Mechanism of glmS Ribozyme Self-Cleavage

    PubMed Central

    Dubecký, Matúš; Walter, Nils G.; Šponer, Jiří; Otyepka, Michal; Banáš, Pavel

    2015-01-01

    In numerous Gram-positive bacteria, the glmS ribozyme or catalytic riboswitch regulates the expression of glucosamine-6-phosphate (GlcN6P) synthase via site-specific cleavage of its sugar-phosphate backbone in response to GlcN6P ligand binding. Biochemical data have suggested a crucial catalytic role for an active site guanine (G40 in Thermoanaerobacter tengcongensis, G33 in Bacillus anthracis). We used hybrid quantum chemical/molecular mechanical (QM/MM) calculations to probe the mechanism where G40 is deprotonated and acts as a general base. The calculations suggest that the deprotonated guanine G40− is sufficiently reactive to overcome the thermodynamic penalty arising from its rare protonation state, and thus is able to activate the A-1(2’-OH) group toward nucleophilic attack on the adjacent backbone. Furthermore, deprotonation of A-1(2’-OH) and nucleophilic attack are predicted to occur as separate steps, where activation of A-1(2’-OH) precedes nucleophilic attack. Conversely, the transition state associated with the rate-determining step corresponds to concurrent nucleophilic attack and protonation of the G1(O5’) leaving group by the ammonium moiety of the GlcN6P cofactor. Overall, our calculations help to explain the crucial roles of G40 (as a general base) and GlcN6P (as a general acid) during glmS ribozyme self-cleavage. In addition, we show that the QM/MM description of the glmS ribozyme self-cleavage reaction is significantly more sensitive to the size of the QM region and the quality of the QM-MM coupling than that of other small ribozymes. PMID:25858644

  17. Chemical feasibility of the general acid/base mechanism of glmS ribozyme self-cleavage.

    PubMed

    Dubecký, Matúš; Walter, Nils G; Šponer, Jiří; Otyepka, Michal; Banáš, Pavel

    2015-10-01

    In numerous Gram-positive bacteria, the glmS ribozyme or catalytic riboswitch regulates the expression of glucosamine-6-phosphate (GlcN6P) synthase via site-specific cleavage of its sugar-phosphate backbone in response to GlcN6P ligand binding. Biochemical data have suggested a crucial catalytic role for an active site guanine (G40 in Thermoanaerobacter tengcongensis, G33 in Bacillus anthracis). We used hybrid quantum chemical/molecular mechanical (QM/MM) calculations to probe the mechanism where G40 is deprotonated and acts as a general base. The calculations suggest that the deprotonated guanine G40(-) is sufficiently reactive to overcome the thermodynamic penalty arising from its rare protonation state, and thus is able to activate the A-1(2'-OH) group toward nucleophilic attack on the adjacent backbone. Furthermore, deprotonation of A-1(2'-OH) and nucleophilic attack are predicted to occur as separate steps, where activation of A-1(2'-OH) precedes nucleophilic attack. Conversely, the transition state associated with the rate-determining step corresponds to concurrent nucleophilic attack and protonation of the G1(O5') leaving group by the ammonium moiety of the GlcN6P cofactor. Overall, our calculations help to explain the crucial roles of G40 (as a general base) and GlcN6P (as a general acid) during glmS ribozyme self-cleavage. In addition, we show that the QM/MM description of the glmS ribozyme self-cleavage reaction is significantly more sensitive to the size of the QM region and the quality of the QM-MM coupling than that of other small ribozymes.

  18. Lewis pair polymerization by classical and frustrated Lewis pairs: acid, base and monomer scope and polymerization mechanism.

    PubMed

    Zhang, Yuetao; Miyake, Garret M; John, Mallory G; Falivene, Laura; Caporaso, Lucia; Cavallo, Luigi; Chen, Eugene Y-X

    2012-08-14

    induction period, and the polymerization is significantly catalyzed by the LA, thus pointing to a bimetallic, activated monomer propagation mechanism. Computational study on the active species formation as well as the chain initiation and propagation events involved in the LPP of MMA with some of the most representative LPs has added our understanding of fundamental steps of LPP. The main difference between NHC and PR(3) bases is in the energetics of zwitterion formation, with the NHC-based zwitterions being remarkably more stable than the PR(3)-based zwitterions. Comparison of the monometallic and bimetallic mechanisms for MMA addition shows a clear preference for the bimetallic mechanism. PMID:22614678

  19. Lewis pair polymerization by classical and frustrated Lewis pairs: acid, base and monomer scope and polymerization mechanism.

    PubMed

    Zhang, Yuetao; Miyake, Garret M; John, Mallory G; Falivene, Laura; Caporaso, Lucia; Cavallo, Luigi; Chen, Eugene Y-X

    2012-08-14

    induction period, and the polymerization is significantly catalyzed by the LA, thus pointing to a bimetallic, activated monomer propagation mechanism. Computational study on the active species formation as well as the chain initiation and propagation events involved in the LPP of MMA with some of the most representative LPs has added our understanding of fundamental steps of LPP. The main difference between NHC and PR(3) bases is in the energetics of zwitterion formation, with the NHC-based zwitterions being remarkably more stable than the PR(3)-based zwitterions. Comparison of the monometallic and bimetallic mechanisms for MMA addition shows a clear preference for the bimetallic mechanism.

  20. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms.

    PubMed

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-03-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  1. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms

    PubMed Central

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-01-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  2. Laminin alters Fyn regulatory mechanisms and promotes oligodendrocyte development

    PubMed Central

    Relucio, Jenne; Tzvetanova, Iva D.; Ao, Wei; Lindquist, Sabine; Colognato, Holly

    2009-01-01

    Mutations in LAMA2, the gene for the extracellular matrix protein laminin-α2, cause a severe muscular dystrophy termed MDC1A. MDC1A patients have accompanying CNS neural dysplasias and white matter abnormalities for which the underlying mechanisms remain unknown. Here we report that in laminin-deficient mice oligodendrocyte development was delayed such that oligodendrocyte progenitors accumulated inappropriately in adult brains. Conversely, laminin substrates were found to promote the transition of oligodendrocyte progenitors to newly-formed oligodendrocytes. Laminin-enhanced differentiation was Src Family Kinase –dependent and resulted in the activation of the Src Family Kinase Fyn. In laminin-deficient brains, however, increased Fyn repression was accompanied by elevated levels of the Src Family Kinase negative regulatory proteins, C-terminal Src kinase (Csk) and its transmembrane adaptor, Csk-binding protein (Cbp). These findings indicate that laminin deficiencies delay oligodendrocyte maturation by causing dysregulation of signaling pathways critical for oligodendrocyte development, and suggest that a normal role for CNS laminin is to promote the development of oligodendrocyte progenitors into myelin-forming oligodendrocytes via modulation of Fyn regulatory molecules. PMID:19776266

  3. Sequence-Specific Peptide Nucleic Acid-Based Antisense Inhibitors of TEM-1 β-Lactamase and Mechanism of Adaptive Resistance.

    PubMed

    Courtney, Colleen M; Chatterjee, Anushree

    2015-06-12

    The recent surge of drug-resistant superbugs and shrinking antibiotic pipeline are serious challenges to global health. In particular, the emergence of β-lactamases has caused extensive resistance against the most frequently prescribed class of β-lactam antibiotics. Here, we develop novel synthetic peptide nucleic acid-based antisense inhibitors that target the start codon and ribosomal binding site of the TEM-1 β-lactamase transcript and act via translation inhibition mechanism. We show that these antisense inhibitors are capable of resensitizing drug-resistant Escherichia coli to β-lactam antibiotics exhibiting 10-fold reduction in the minimum inhibitory concentration (MIC). To study the mechanism of resistance, we adapted E. coli at MIC levels of the β-lactam/antisense inhibitor combination and observed a nonmutational, bet-hedging based adaptive antibiotic resistance response as evidenced by phenotypic heterogeneity as well as heterogeneous expression of key stress response genes. Our data show that both the development of new antimicrobials and an understanding of cellular response during the development of tolerance could aid in mitigating the impending antibiotic crisis. PMID:27622741

  4. Glucose- and nitrogen sensing and regulatory mechanisms in Saccharomyces cerevisiae.

    PubMed

    Rødkaer, Steven V; Faergeman, Nils J

    2014-08-01

    Pro- and eukaryotic cells are constantly challenged by varying concentrations of nutrients in their environment. Perceiving and adapting to such changes are therefore crucial for cellular viability. Thus, numerous specialized cellular receptors continuously sense and react to the availability of nutrients such as glucose and nitrogen. When stimulated, these receptors initiate various cellular signaling pathways, which in concert constitute a complex regulatory network. To ensure a highly specific response, these pathways and networks cross-communicate with each other and are regulated at several steps and by numerous different regulators. As numerous of these regulating proteins, biochemical mechanisms, and cellular pathways are evolutionary conserved, complex biochemical information relevant to humans can be obtained by studying simple organisms. Thus, the yeast Saccharomyces cerevisiae has been recognized as a powerful model system to study fundamental biochemical processes. In the present review, we highlight central signaling pathways and molecular circuits conferring nitrogen- and glucose sensing in S. cerevisiae.

  5. Regulatory mechanisms of microRNAs involvement in cancer.

    PubMed

    Fabbri, Muller; Ivan, Mircea; Cimmino, Amelia; Negrini, Massimo; Calin, George A

    2007-07-01

    MicroRNAs (miRNAs) are 19-24 nucleotide noncoding RNAs that regulate the translation and degradation of target mRNAs and are extensively involved in human cancers. One unexpected conclusion of the profiling and functional studies in tumourigenesis is that some miRNAs behave in cancer cells in a dual mode, resembling the 'Dr Jekyll and Mr Hyde' story, which centers on a conception of humanity as dual in nature. The authors and others have found that onco-miRNAs and suppressor-miRNAs can represent two different looks of the same gene, behaving as oncogenes or tumour suppressors depending on tissue type and specific targets. In this review, the authors analyse the regulatory mechanisms of the main miRNA genes involved in human tumourigenesis. PMID:17665990

  6. Understanding Acid Base Disorders.

    PubMed

    Gomez, Hernando; Kellum, John A

    2015-10-01

    The concentration of hydrogen ions is regulated in biologic solutions. There are currently 3 recognized approaches to assess changes in acid base status. First is the traditional Henderson-Hasselbalch approach, also called the physiologic approach, which uses the relationship between HCO3(-) and Pco2; the second is the standard base excess approach based on the Van Slyke equation. The third approach is the quantitative or Stewart approach, which uses the strong ion difference and the total weak acids. This article explores the origins of the current concepts framing the existing methods to analyze acid base balance.

  7. Acid-Base Homeostasis.

    PubMed

    Hamm, L Lee; Nakhoul, Nazih; Hering-Smith, Kathleen S

    2015-12-01

    Acid-base homeostasis and pH regulation are critical for both normal physiology and cell metabolism and function. The importance of this regulation is evidenced by a variety of physiologic derangements that occur when plasma pH is either high or low. The kidneys have the predominant role in regulating the systemic bicarbonate concentration and hence, the metabolic component of acid-base balance. This function of the kidneys has two components: reabsorption of virtually all of the filtered HCO3(-) and production of new bicarbonate to replace that consumed by normal or pathologic acids. This production or generation of new HCO3(-) is done by net acid excretion. Under normal conditions, approximately one-third to one-half of net acid excretion by the kidneys is in the form of titratable acid. The other one-half to two-thirds is the excretion of ammonium. The capacity to excrete ammonium under conditions of acid loads is quantitatively much greater than the capacity to increase titratable acid. Multiple, often redundant pathways and processes exist to regulate these renal functions. Derangements in acid-base homeostasis, however, are common in clinical medicine and can often be related to the systems involved in acid-base transport in the kidneys.

  8. Homopolymeric tracts represent a general regulatory mechanism in prokaryotes

    PubMed Central

    2010-01-01

    Background While, traditionally, regulation of gene expression can be grouped into transcriptional, translational, and post-translational mechanisms, some mechanisms of rapid genetic variation can also contribute to regulation of gene expression, e.g., phase variation. Results We show here that prokaryotes evolved to include homopolymeric tracts (HTs) within coding genes as a system that allows for efficient gene inactivation. Analyses of 81 bacterial and 18 archaeal genomes showed that poly(A) and poly(T) HTs are overrepresented in these genomes and preferentially located at the 5' end of coding genes. Location of HTs at the 5' end is not driven by a preferential placement of aminoacids encoded by the AAA and TTT codons at the N-terminal of proteins. The inlA gene of the pathogen L. monocytogenes was used as a model to further study the role of HTs in reversible gene inactivation. In a number of L. monocytogenes strains, inlA harbors a 5' poly(A) HT, which regularly shows frameshift mutation leading to expression of a truncated 8 aa InlA protein. Translational fusions of the inlA 5' end allowed us to estimate that the frequency of variation in this HT is about 1,000 fold higher than the estimated average point mutation frequency. Conclusions As frameshift mutations in HTs can occur at high frequencies and enable efficient gene inactivation, hypermutable HTs appear to represent a universal system for regulation of gene expression in prokaryotes. Combined with other studies indicating that HTs also enable rapid diversification of both coding and regulatory genetic sequences in eukaryotes, our data suggest that hypermutable HTs represent a general and rapid evolutionary mechanism facilitating adaptation and gene regulation across diverse organisms. PMID:20144225

  9. Redox-switch regulatory mechanism of thiolase from Clostridium acetobutylicum

    PubMed Central

    Kim, Sangwoo; Jang, Yu-Sin; Ha, Sung-Chul; Ahn, Jae-Woo; Kim, Eun-Jung; Hong Lim, Jae; Cho, Changhee; Shin Ryu, Yong; Kuk Lee, Sung; Lee, Sang Yup; Kim, Kyung-Jin

    2015-01-01

    Thiolase is the first enzyme catalysing the condensation of two acetyl-coenzyme A (CoA) molecules to form acetoacetyl-CoA in a dedicated pathway towards the biosynthesis of n-butanol, an important solvent and biofuel. Here we elucidate the crystal structure of Clostridium acetobutylicum thiolase (CaTHL) in its reduced/oxidized states. CaTHL, unlike those from other aerobic bacteria such as Escherichia coli and Zoogloea ramegera, is regulated by the redox-switch modulation through reversible disulfide bond formation between two catalytic cysteine residues, Cys88 and Cys378. When CaTHL is overexpressed in wild-type C. acetobutylicum, butanol production is reduced due to the disturbance of acidogenic to solventogenic shift. The CaTHLV77Q/N153Y/A286K mutant, which is not able to form disulfide bonds, exhibits higher activity than wild-type CaTHL, and enhances butanol production upon overexpression. On the basis of these results, we suggest that CaTHL functions as a key enzyme in the regulation of the main metabolism of C. acetobutylicum through a redox-switch regulatory mechanism. PMID:26391388

  10. Acid-base homeostasis in the human system

    NASA Technical Reports Server (NTRS)

    White, R. J.

    1974-01-01

    Acid-base regulation is a cooperative phenomena in vivo with body fluids, extracellular and intracellular buffers, lungs, and kidneys all playing important roles. The present account is much too brief to be considered a review of present knowledge of these regulatory systems, and should be viewed, instead, as a guide to the elements necessary to construct a simple model of the mutual interactions of the acid-base regulatory systems of the body.

  11. The Cellular and Molecular Mechanisms of Immuno-Suppression by Human Type 1 Regulatory T Cells

    PubMed Central

    Gregori, Silvia; Goudy, Kevin S.; Roncarolo, Maria Grazia

    2011-01-01

    The immuno-regulatory mechanisms of IL-10-producing type 1 regulatory T (Tr1) cells have been widely studied over the years. However, several recent discoveries have shed new light on the cellular and molecular mechanisms that human Tr1 cells use to control immune responses and induce tolerance. In this review we outline the well known and newly discovered regulatory properties of human Tr1 cells and provide an in-depth comparison of the known suppressor mechanisms of Tr1 cells with FOXP3+ Treg. We also highlight the role that Tr1 cells play in promoting and maintaining tolerance in autoimmunity, allergy, and transplantation. PMID:22566914

  12. A fundamental approach to adhesion: Synthesis, surface analysis, thermodynamics and mechanics. [acid-base properties of titanium 6-4 surfaces

    NASA Technical Reports Server (NTRS)

    Siriwardane, R.; Wightman, J. P.

    1980-01-01

    The acid-base properties of titanium 6-4 plates (low surface area) were investigated after three different pretreatments, namely Turco, phosphate-fluoride and Pasa-Jell. A series of indicators was used and color changes were detected using diffuse reflectance visible spectroscopy. Electron spectroscopy for chemical analysis was used to examine the indicator on the Ti 6-4 surface. Specular reflectance infra-red spectroscopy was used to study the adsorption of stearic acid from cyclohexane solutions on the Ti 6-4 surface.

  13. Morphological and mechanical characterization of the acid-base resistant zone at the adhesive-dentin interface of intact and caries-affected dentin.

    PubMed

    Inoue, Go; Tsuchiya, Satoko; Nikaido, Toru; Foxton, Richard M; Tagami, Junji

    2006-01-01

    This study examined the ultrastructure of both intact and caries affected dentin-adhesive interface after artificial secondary caries formation, using scanning electron microscopy and nanoindentation testing. Half of the prepared specimens were bonded with Clearfil SE Bond (Kuraray Medical, Japan) and a resin composite (Metafil Flo, Sun Medical, Japan) for the nanoindentation test. The other specimens were stored in a buffered demineralizing solution for 90 minutes, then observed using SEM. An acid-base resistant zone (ABRZ) was observed beneath the hybrid layer, distinguished by argon-ion etching. The ABRZ of caries-affected dentin was thicker than that of normal dentin, while its nanohardess was lower than normal dentin (p<0.05). It is suggested that the monomer of Clearfil SE Bond penetrated deeper than previously reported, creating a so-called "hybrid layer." However, its physical properties depended on the condition of the dentin.

  14. Structural imprints in vivo decode RNA regulatory mechanisms

    NASA Astrophysics Data System (ADS)

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-03-01

    Visualizing the physical basis for molecular behaviour inside living cells is a great challenge for biology. RNAs are central to biological regulation, and the ability of RNA to adopt specific structures intimately controls every step of the gene expression program. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles include only two of the four nucleotides that make up RNA. Here we present a novel biochemical approach, in vivo click selective 2'-hydroxyl acylation and profiling experiment (icSHAPE), which enables the first global view, to our knowledge, of RNA secondary structures in living cells for all four bases. icSHAPE of the mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguish different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro conditions, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA-binding proteins or RNA-modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression.

  15. Structural imprints in vivo decode RNA regulatory mechanisms

    PubMed Central

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-01-01

    Visualizing the physical basis for molecular behavior inside living cells is a grand challenge in biology. RNAs are central to biological regulation, and RNA’s ability to adopt specific structures intimately controls every step of the gene expression program1. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles view only two of four nucleotides that make up RNA2,3. Here we present a novel biochemical approach, In Vivo Click SHAPE (icSHAPE), that enables the first global view of RNA secondary structures of all four bases in living cells. icSHAPE of mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguishes different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA binding proteins or RNA modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome-wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression. PMID:25799993

  16. Potential self-regulatory mechanisms of yoga for psychological health

    PubMed Central

    Gard, Tim; Noggle, Jessica J.; Park, Crystal L.; Vago, David R.; Wilson, Angela

    2014-01-01

    Research suggesting the beneficial effects of yoga on myriad aspects of psychological health has proliferated in recent years, yet there is currently no overarching framework by which to understand yoga’s potential beneficial effects. Here we provide a theoretical framework and systems-based network model of yoga that focuses on integration of top-down and bottom-up forms of self-regulation. We begin by contextualizing yoga in historical and contemporary settings, and then detail how specific components of yoga practice may affect cognitive, emotional, behavioral, and autonomic output under stress through an emphasis on interoception and bottom-up input, resulting in physical and psychological health. The model describes yoga practice as a comprehensive skillset of synergistic process tools that facilitate bidirectional feedback and integration between high- and low-level brain networks, and afferent and re-afferent input from interoceptive processes (somatosensory, viscerosensory, chemosensory). From a predictive coding perspective we propose a shift to perceptual inference for stress modulation and optimal self-regulation. We describe how the processes that sub-serve self-regulation become more automatized and efficient over time and practice, requiring less effort to initiate when necessary and terminate more rapidly when no longer needed. To support our proposed model, we present the available evidence for yoga affecting self-regulatory pathways, integrating existing constructs from behavior theory and cognitive neuroscience with emerging yoga and meditation research. This paper is intended to guide future basic and clinical research, specifically targeting areas of development in the treatment of stress-mediated psychological disorders. PMID:25368562

  17. Translational regulatory mechanisms in persistent forms of synaptic plasticity.

    PubMed

    Kelleher, Raymond J; Govindarajan, Arvind; Tonegawa, Susumu

    2004-09-30

    Memory and synaptic plasticity exhibit distinct temporal phases, with long-lasting forms distinguished by their dependence on macromolecular synthesis. Prevailing models for the molecular mechanisms underlying long-lasting synaptic plasticity have largely focused on transcriptional regulation. However, a growing body of evidence now supports a crucial role for neuronal activity-dependent mRNA translation, which may occur in dendrites for a subset of neuronal mRNAs. Recent work has begun to define the signaling mechanisms coupling synaptic activation to the protein synthesis machinery. The ERK and mTOR signaling pathways have been shown to regulate the activity of the general translational machinery, while the translation of particular classes of mRNAs is additionally controlled by gene-specific mechanisms. Rapid enhancement of the synthesis of a diverse array of neuronal proteins through such mechanisms provides the components necessary for persistent forms of LTP and LTD. These findings have important implications for the synapse specificity and associativity of protein synthesis-dependent changes in synaptic strength. PMID:15450160

  18. Regulatory mechanisms for specification and patterning of plant vascular tissues.

    PubMed

    Caño-Delgado, Ana; Lee, Ji-Young; Demura, Taku

    2010-01-01

    Plant vascular tissues, the conduits of water, nutrients, and small molecules, play important roles in plant growth and development. Vascular tissues have allowed plants to successfully adapt to various environmental conditions since they evolved 450 Mya. The majority of plant biomass, an important source of renewable energy, comes from the xylem of the vascular tissues. Efforts have been made to identify the underlying mechanisms of cell specification and patterning of plant vascular tissues and their proliferation. The formation of the plant vascular system is a complex process that integrates signaling and gene regulation at transcriptional and posttranscriptional levels. Recently, a wealth of molecular genetic studies and the advent of cell biology and genomic tools have enabled important progress toward understanding its underlying mechanisms. Here, we provide a comprehensive review of the cell and developmental processes of plant vascular tissue and resources recently available for studying them that will enable the discovery of new ways to develop sustainable energy using plant biomass.

  19. 'Cold cuts' added to the circadian smorgasbord of regulatory mechanisms.

    PubMed

    Green, Carla B

    2016-09-01

    In mammals, rhythms in body temperature help to entrain and synchronize circadian rhythms throughout the organism, and the cold-inducible RNA-binding protein (CIRBP) is one of the mediators of these daily temperature changes. Cirbp mRNA expression is regulated by the daily subtle rhythms in body temperature, and a new study by Gotic and colleagues (pp. 2005-2017) reveals a surprising and novel mechanism that involves temperature-dependent enhancement of splicing efficiency. PMID:27664233

  20. The beginning of a seed: regulatory mechanisms of double fertilization

    PubMed Central

    Bleckmann, Andrea; Alter, Svenja; Dresselhaus, Thomas

    2014-01-01

    The launch of seed development in flowering plants (angiosperms) is initiated by the process of double fertilization: two male gametes (sperm cells) fuse with two female gametes (egg and central cell) to form the precursor cells of the two major seed components, the embryo and endosperm, respectively. The immobile sperm cells are delivered by the pollen tube toward the ovule harboring the female gametophyte by species-specific pollen tube guidance and attraction mechanisms. After pollen tube burst inside the female gametophyte, the two sperm cells fuse with the egg and central cell initiating seed development. The fertilized central cell forms the endosperm while the fertilized egg cell, the zygote, will form the actual embryo and suspensor. The latter structure connects the embryo with the sporophytic maternal tissues of the developing seed. The underlying mechanisms of double fertilization are tightly regulated to ensure delivery of functional sperm cells and the formation of both, a functional zygote and endosperm. In this review we will discuss the current state of knowledge about the processes of directed pollen tube growth and its communication with the synergid cells resulting in pollen tube burst, the interaction of the four gametes leading to cell fusion and finally discuss mechanisms how flowering plants prevent multiple sperm cell entry (polyspermy) to maximize their reproductive success. PMID:25309552

  1. Genetic control and regulatory mechanisms of succinoglycan and curdlan biosynthesis in genus Agrobacterium.

    PubMed

    Wu, Dan; Li, Ang; Ma, Fang; Yang, Jixian; Xie, Yutong

    2016-07-01

    Agrobacterium is a genus of gram-negative bacteria that can produce several typical exopolysaccharides with commercial uses in the food and pharmaceutical fields. In particular, succinoglycan and curdlan, due to their good quality in high yield, have been employed on an industrial scale comparatively early. Exopolysaccharide biosynthesis is a multiple-step process controlled by different functional genes, and various environmental factors cause changes in exopolysaccharide biosynthesis through regulatory mechanisms. In this mini-review, we focus on the genetic control and regulatory mechanisms of succinoglycan and curdlan produced by Agrobacterium. Some key functional genes and regulatory mechanisms for exopolysaccharide biosynthesis are described, possessing a high potential for application in metabolic engineering to modify exopolysaccharide production and physicochemical properties. This review may contribute to the understanding of exopolysaccharide biosynthesis and exopolysaccharide modification by metabolic engineering methods in Agrobacterium. PMID:27255488

  2. Structure of the TRPA1 ion channel suggests regulatory mechanisms

    PubMed Central

    Paulsen, Candice E.; Armache, Jean-Paul; Gao, Yuan; Cheng, Yifan; Julius, David

    2015-01-01

    The TRPA1 ion channel (a.k.a the ‘wasabi receptor’) is a detector of noxious chemical agents encountered in our environment or produced endogenously during tissue injury or drug metabolism. These include a broad class of electrophiles that activate the channel through covalent protein modification. TRPA1 antagonists hold potential for treating neurogenic inflammatory conditions provoked or exacerbated by irritant exposure. Despite compelling reasons to understand TRPA1 function, structural mechanisms underlying channel regulation remain obscure. Here, we use single-particle electron cryo-microscopy to determine the structure of full-length human TRPA1 to ~4Å resolution in the presence of pharmacophores, including a potent antagonist. A number of unexpected features are revealed, including an extensive coiled-coil assembly domain stabilized by polyphosphate co-factors and a highly integrated nexus that converges on an unpredicted TRP-like allosteric domain. These findings provide novel insights into mechanisms of TRPA1 regulation, and establish a blueprint for structure-based design of analgesic and anti-inflammatory agents. PMID:25855297

  3. Sociocognitive self-regulatory mechanisms governing judgments of the acceptability and likelihood of sport cheating.

    PubMed

    d'Arripe-Longueville, Fabienne; Corrion, Karine; Scoffier, Stéphanie; Roussel, Peggy; Chalabaev, Aïna

    2010-10-01

    This study extends previous psychosocial literature (Bandura et al., 2001, 2003) by examining a structural model of the self-regulatory mechanisms governing the acceptability and likelihood of cheating in a sport context. Male and female adolescents (N = 804), aged 15-20 years, took part in this study. Negative affective self-regulatory efficacy influenced the acceptability and likelihood of cheating through the mediating role of moral disengagement, in females and males. Affective efficacy positively influenced prosocial behavior through moral disengagement or through resistive self-regulatory efficacy and social efficacy, in both groups. The direct effects of affective efficacy on beliefs about cheating were only evident in females. These results extend the findings of Bandura et al. (2001, 2003) to the sport context and suggest that affective and resistive self-regulatory efficacy operate in concert in governing adolescents' moral disengagement and transgressive behaviors in sport.

  4. Gap junction-mediated electrical transmission: regulatory mechanisms and plasticity

    PubMed Central

    Pereda, Alberto E.; Curti, Sebastian; Hoge, Gregory; Cachope, Roger; Flores, Carmen E.; Rash, John E.

    2012-01-01

    The term synapse applies to cellular specializations that articulate the processing of information within neural circuits by providing a mechanism for the transfer of information between two different neurons. There are two main modalities of synaptic transmission: chemical and electrical. While most efforts have been dedicated to the understanding of the properties and modifiability of chemical transmission, less is still known regarding the plastic properties of electrical synapses, whose structural correlate is the gap junction. A wealth of data indicates that, rather than passive intercellular channels, electrical synapses are more dynamic and modifiable than was generally perceived. This article will discuss the factors determining the strength of electrical transmission and review current evidence demonstrating its dynamic properties. Like their chemical counterparts, electrical synapses can also be plastic and modifiable. PMID:22659675

  5. The molecular mechanism of the neutral-to-base transition of human serum albumin. Acid/base titration and proton nuclear magnetic resonance studies on a large peptic and a large tryptic fragment of albumin.

    PubMed

    Bos, O J; Labro, J F; Fischer, M J; Wilting, J; Janssen, L H

    1989-01-15

    In order to obtain a better understanding of the neutral-to-base (N-B) transition of human serum albumin, we performed acid/base titration experiments and 500-MHz 1H NMR experiments on albumin and on a large peptic (residues 1-387) and large tryptic (residues 198-585) fragment of albumin. The acid/base titration experiments revealed that Ca2+ ions induce a downward pK shift of several histidine residues of the peptic (P46) fragment and of albumin. By contrast, Ca2+ has very little influence on the pK of histidine residues of the tryptic (T45) fragment. In albumin, the pH-dependent His C-2 proton resonances, observed with 1H NMR experiments, have been allotted the numbers 1-17. It proved possible to locate these resonances in the P46 and the T45 fragments. A correspondence was found between the number of histidines detected by the acid/base titration and by the 1H NMR experiments. The results of the experiments lead us to conclude that in domain 1 at least the histidines corresponding to the His C-2 proton resonances 1-5 play a dominant role in the N-B transition. The Cu2+-binding histidine residue 3 (resonance 8) of the albumin molecule is not involved in the N-B transition. In addition, we were able to assign His C-2 proton resonance 9 to histidine 464 of the albumin molecule. The role of the N-B transition in the transport and cellular uptake mechanisms of endogenous and exogenous compounds is discussed.

  6. Cis-regulatory mechanisms governing stem and progenitor cell transitions

    PubMed Central

    Johnson, Kirby D.; Kong, Guangyao; Gao, Xin; Chang, Yuan-I; Hewitt, Kyle J.; Sanalkumar, Rajendran; Prathibha, Rajalekshmi; Ranheim, Erik A.; Dewey, Colin N.; Zhang, Jing; Bresnick, Emery H.

    2015-01-01

    Cis-element encyclopedias provide information on phenotypic diversity and disease mechanisms. Although cis-element polymorphisms and mutations are instructive, deciphering function remains challenging. Mutation of an intronic GATA motif (+9.5) in GATA2, encoding a master regulator of hematopoiesis, underlies an immunodeficiency associated with myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). Whereas an inversion relocalizes another GATA2 cis-element (−77) to the proto-oncogene EVI1, inducing EVI1 expression and AML, whether this reflects ectopic or physiological activity is unknown. We describe a mouse strain that decouples −77 function from proto-oncogene deregulation. The −77−/− mice exhibited a novel phenotypic constellation including late embryonic lethality and anemia. The −77 established a vital sector of the myeloid progenitor transcriptome, conferring multipotentiality. Unlike the +9.5−/− embryos, hematopoietic stem cell genesis was unaffected in −77−/− embryos. These results illustrate a paradigm in which cis-elements in a locus differentially control stem and progenitor cell transitions, and therefore the individual cis-element alterations cause unique and overlapping disease phenotypes. PMID:26601269

  7. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    PubMed Central

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  8. Novel RNA regulatory mechanisms revealed in the epitranscriptome.

    PubMed

    Saletore, Yogesh; Chen-Kiang, Selina; Mason, Christopher E

    2013-03-01

    Methyl-6-adenosine (m (6)A) has been hypothesized to exist since the 1970s, (1) but little has been known about the specific RNAs, or sites within them, that are affected by this RNA modification. Here, we report that recent work has shown RNA modifications like m (6)A, collectively called the "epitranscriptome," are a pervasive feature of mammalian cells and likely play a role in development and disease. An enrichment of m (6)A near the last CDS of thousands of genes has implicated m (6)A in transcript processing, translational regulation and potentially a mechanism for regulating miRNA maturation. Also, because the sites of m (6)A show strong evolutionary conservation and have been replicated in nearly identical sites between mouse and human, strong evolutionary pressures are likely being maintained for this mark. (2)(,) (3) Finally, we note that m (6)A is one of over 100 modifications of RNA that have been reported, (4) and with the combination of high-throughput, next-generation sequencing (NGS) techniques, immunoprecipitation with appropriate antibodies and splicing-aware peak-finding, the dynamics of the epitranscriptome can now be mapped and characterized to discern their specific cellular roles. PMID:23434792

  9. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus.

    PubMed

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  10. [Labor pain--physiologal basis and regulatory mechanisms].

    PubMed

    Kojić, Zvezdana; Arsenijević, Ljubica; Sćepanović, Ljiljana; Popović, Nada

    2007-01-01

    Clinically, labor (visceral) pain is extremely prevalent in general population, yet its mechanisms have been poorly understood. With development of new electrophysiological techniques and molecular biology technologies, our understanding of physiological bases of labor pain has been markedly improved; in that way possibilities for therapeutic modulation of labor pain are expanded. The aim of this study was to describe the new insight into this topic. In this paper, the theory was exposed that the reason for labor pain had been found in sensitization at the levels of the uterus, dorsal root neurones and phychologic factors. Peripheral sensitization occurs due to cervical inflammatory reaction, associated with cervical ripening and remodeling. Chemical inflammatory mediators (notably prostaglandins, cytokines, granulocytes, enzymes such as metalloproteinases, integrines) activate nociceptive nerve fibers. Nociceptive threshold is reduced (resulting in primary hyperalgesia) and because of that there occurs the total number of action potentials generated and propagated by nociceptive peripheral nerves (visceral hypersensitivity). Central sensitization arises due to phosphorylation of N-methyl-D-aspartate (NMDA) receptors of dorsal root neurones. Numerous receptors, ion channels and signaling molecules, which, together with opioid peptides participate in spinal pain control, represent, at the level of central sensitization, possible therapeutic goals for labor pain modulation. Some of them are: DREAM which constitututively suppresses transcription of mRNA for opioid peptides, oncostatin M, COX-2 inhibitors, cFOS protein, tachykinins, gamma-butyric acid agonist, L-type Ca++ channels. Fear, as one of the most frequent phychologic factors, does (not) provide good control in transmision of pain sensitization by descendent nerve fibers. Some of the candidates for objective pain marker are also described. This article outlines the factors that, based on the contemporary

  11. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  12. Hospital closures and survivals: an analysis of operating characteristics and regulatory mechanisms in three states.

    PubMed Central

    Kennedy, L; Dumas, M B

    1983-01-01

    This article examines factors related to hospital closures, using a longitudinal sample of surviving and closed hospitals. The hospitals are drawn from three states with different regulatory programs. Size of hospital and occupancy rate are shown to be related to likelihood of closure, while ownership, length of stay, and expenditures are not. These findings are observed both in the aggregate and within the individual states between 1960 and 1980. The three states--Arizona, Pennsylvania, and Maryland--represent different population trends and regulatory mechanisms and goals. The findings indicate that some programs appear to guarantee survival, whereas others are more neutral. PMID:6668180

  13. Multiple regulatory mechanisms in the chloroplast of green algae: relation to hydrogen production.

    PubMed

    Antal, Taras K; Krendeleva, Tatyana E; Tyystjärvi, Esa

    2015-09-01

    A complex regulatory network in the chloroplast of green algae provides an efficient tool for maintenance of energy and redox balance in the cell under aerobic and anaerobic conditions. In this review, we discuss the structural and functional organizations of electron transport pathways in the chloroplast, and regulation of photosynthesis in the green microalga Chlamydomonas reinhardtii. The focus is on the regulatory mechanisms induced in response to nutrient deficiency stress and anoxia and especially on the role of a hydrogenase-mediated reaction in adaptation to highly reducing conditions and ATP deficiency in the cell. PMID:25986411

  14. Control and regulatory mechanisms associated with thermogenesis in flying insects and birds.

    PubMed

    Loli, Denise; Bicudo, José Eduardo P W

    2005-01-01

    Most insects and birds are able to fly. The chitin made exoskeleton of insects poses them several constraints, and this is one the reasons they are in general small sized animals. On the other hand, because birds possess an endoskeleton made of bones they may grow much larger when compared to insects. The two taxa are quite different with regards to their general "design" platform, in particular with respect to their respiratory and circulatory systems. However, because they fly, they may share in common several traits, namely those associated with the control and regulatory mechanisms governing thermogenesis. High core temperatures are essential for animal flight irrespective of the taxa they belong to. Birds and insects have thus evolved mechanisms which allowed them to control and regulate high rates of heat fluxes. This article discusses possible convergent thermogenic control and regulatory mechanisms associated with flight in insects and birds. PMID:16283551

  15. Control and regulatory mechanisms associated with thermogenesis in flying insects and birds.

    PubMed

    Loli, Denise; Bicudo, José Eduardo P W

    2005-01-01

    Most insects and birds are able to fly. The chitin made exoskeleton of insects poses them several constraints, and this is one the reasons they are in general small sized animals. On the other hand, because birds possess an endoskeleton made of bones they may grow much larger when compared to insects. The two taxa are quite different with regards to their general "design" platform, in particular with respect to their respiratory and circulatory systems. However, because they fly, they may share in common several traits, namely those associated with the control and regulatory mechanisms governing thermogenesis. High core temperatures are essential for animal flight irrespective of the taxa they belong to. Birds and insects have thus evolved mechanisms which allowed them to control and regulate high rates of heat fluxes. This article discusses possible convergent thermogenic control and regulatory mechanisms associated with flight in insects and birds.

  16. Salt secretion is linked to acid-base regulation of ionocytes in seawater-acclimated medaka: new insights into the salt-secreting mechanism.

    PubMed

    Liu, Sian-Tai; Horng, Jiun-Lin; Chen, Po-Yen; Hwang, Pung-Pung; Lin, Li-Yih

    2016-01-01

    Ionocytes in the skin and gills of seawater (SW) teleosts are responsible for both salt and acid secretion. However, the mechanism through which ionocytes secrete acid is still unclear. Here, we hypothesized that apical Na(+)/H(+) exchangers (NHE2/3), carbonic anhydrase (CA2-like), and basolateral HCO3(-)/Cl(-) exchanger (AE1) are involved in acid secretion. In addition, the hypothesized involvement of basolateral AE1 suggested that acid secretion may be linked to Cl(-) secretion by ionocytes. The scanning ion-selective electrode technique (SIET) was used to measure H(+) and Cl(-) secretion by ionocytes in the skin of medaka larvae acclimated to SW. Treatment with inhibitors of NHE, CA, and AE suppressed both H(+) and Cl(-) secretion by ionocytes. Short-term exposure to hypercapnic SW stimulated both H(+) and Cl(-) secretion. mRNA of CA2-like and AE1 were localized to ionocytes in the skin. Branchial mRNA levels of NKCC1a, CA2-like, and AE1a increased together with the salinity to which fish were acclimated. In addition, both AE1a and AE1b mRNA increased in fish acclimated to acidified (pH 7) SW; NKCC1a mRNA increased in fish acclimated to pH 9 SW. This study reveals the mechanism of H(+) secretion by ionocytes, and refines our understanding of the well-established mechanism of Cl(-) secretion by ionocytes of SW fish. PMID:27511107

  17. Salt secretion is linked to acid-base regulation of ionocytes in seawater-acclimated medaka: new insights into the salt-secreting mechanism

    PubMed Central

    Liu, Sian-Tai; Horng, Jiun-Lin; Chen, Po-Yen; Hwang, Pung-Pung; Lin, Li-Yih

    2016-01-01

    Ionocytes in the skin and gills of seawater (SW) teleosts are responsible for both salt and acid secretion. However, the mechanism through which ionocytes secrete acid is still unclear. Here, we hypothesized that apical Na+/H+ exchangers (NHE2/3), carbonic anhydrase (CA2-like), and basolateral HCO3−/Cl− exchanger (AE1) are involved in acid secretion. In addition, the hypothesized involvement of basolateral AE1 suggested that acid secretion may be linked to Cl− secretion by ionocytes. The scanning ion-selective electrode technique (SIET) was used to measure H+ and Cl− secretion by ionocytes in the skin of medaka larvae acclimated to SW. Treatment with inhibitors of NHE, CA, and AE suppressed both H+ and Cl− secretion by ionocytes. Short-term exposure to hypercapnic SW stimulated both H+ and Cl− secretion. mRNA of CA2-like and AE1 were localized to ionocytes in the skin. Branchial mRNA levels of NKCC1a, CA2-like, and AE1a increased together with the salinity to which fish were acclimated. In addition, both AE1a and AE1b mRNA increased in fish acclimated to acidified (pH 7) SW; NKCC1a mRNA increased in fish acclimated to pH 9 SW. This study reveals the mechanism of H+ secretion by ionocytes, and refines our understanding of the well-established mechanism of Cl− secretion by ionocytes of SW fish. PMID:27511107

  18. Regulatory mechanisms of immune tolerance in type 1 diabetes and their failures.

    PubMed

    Kuhn, Chantal; Besançon, Alix; Lemoine, Sébastien; You, Sylvaine; Marquet, Cindy; Candon, Sophie; Chatenoud, Lucienne

    2016-07-01

    In this brief review we propose to discuss salient data showing the importance of immune regulatory mechanisms, and in particular of Treg, for the control of pathogenic anti-β-cell response in autoimmune diabetes. Disease progression that culminates with the massive destruction of insulin-secreting β-cells and advent of hyperglycemia and glycosuria tightly correlates with a functional deficit in immune regulation. Better dissection of the cellular and molecular mechanisms through which the immune system normally sustains tolerance to "self", and which become defective when autoimmune aggression is overt, is the only direct and robust way to learn how to harness these effectively, so as to restore immune tolerance in patients with insulin-dependent type 1 diabetes. No doubt that regulatory T cells are a privileged mechanism underlying this self-tolerance in the periphery. The discovery of the key role of the transcription factor FoxP3, represented the cornerstone leading to the great advances in the field we are witnessing today. Type 1 diabetes is certainly one of the prototypic T cell-mediated autoimmune diseases where immune regulatory mechanisms relying on specialized subsets of T cells have been the most thoroughly analyzed from the fundamental point of view and also largely exploited in a translational therapeutic perspective. PMID:27216249

  19. Identification of genes involved in regulatory mechanism of pigments in broiler chickens.

    PubMed

    Tarique, T M; Yang, S; Mohsina, Z; Qiu, J; Yan, Z; Chen, G; Chen, A

    2014-01-01

    Chicken is an important model organism that unites the evolutionary gap between mammals and other vertebrates and provide major source of protein from meat and eggs for all over the world population. However, specific genes underlying the regulatory mechanism of broiler pigmentation have not yet been determined. In order to better understand the genes involved in the mechanism of pigmentation in the muscle tissues of broilers, the Affymetrix microarray hybridization experiment platform was used to identify gene expression profiles at 7 weeks of age. Broilers fed canthaxanthin, natural lutein, and orangeII pigments (100 mg/kg) were used to explore gene expression profiles). Our data showed that the 7th week of age was a very important phase with regard to gene expression profiles. We identified a number of differentially expressed genes; in canthaxanthin, natural lutein, and orangeII, there were 54 (32 upregulated and 22 downregulated), 23 (15 upregulated and 8 downregulated), and 7 (5 upregulated and 2 downregulated) known genes, respectively. Our data indicate that the numbers of differentially expressed genes were more upregulated than downregulated, and several genes showed conserved signaling to previously known functions. Thus, functional characterization of differentially expressed genes revealed several categories that are involved in important biological processes, including pigmentation, growth, molecular mechanisms, fat metabolism, cell proliferation, immune response, lipid metabolism, and protein synthesis and degradation. The results of the present study demonstrate that the genes associated with canthaxanthin, natural lutein, and orangeII are key regulatory genes that control the regulatory mechanisms of pigmentation.

  20. Regulatory mechanisms of immune tolerance in type 1 diabetes and their failures.

    PubMed

    Kuhn, Chantal; Besançon, Alix; Lemoine, Sébastien; You, Sylvaine; Marquet, Cindy; Candon, Sophie; Chatenoud, Lucienne

    2016-07-01

    In this brief review we propose to discuss salient data showing the importance of immune regulatory mechanisms, and in particular of Treg, for the control of pathogenic anti-β-cell response in autoimmune diabetes. Disease progression that culminates with the massive destruction of insulin-secreting β-cells and advent of hyperglycemia and glycosuria tightly correlates with a functional deficit in immune regulation. Better dissection of the cellular and molecular mechanisms through which the immune system normally sustains tolerance to "self", and which become defective when autoimmune aggression is overt, is the only direct and robust way to learn how to harness these effectively, so as to restore immune tolerance in patients with insulin-dependent type 1 diabetes. No doubt that regulatory T cells are a privileged mechanism underlying this self-tolerance in the periphery. The discovery of the key role of the transcription factor FoxP3, represented the cornerstone leading to the great advances in the field we are witnessing today. Type 1 diabetes is certainly one of the prototypic T cell-mediated autoimmune diseases where immune regulatory mechanisms relying on specialized subsets of T cells have been the most thoroughly analyzed from the fundamental point of view and also largely exploited in a translational therapeutic perspective.

  1. Poly(lactic acid)-Based in Situ Microfibrillar Composites with Enhanced Crystallization Kinetics, Mechanical Properties, Rheological Behavior, and Foaming Ability.

    PubMed

    Kakroodi, Adel Ramezani; Kazemi, Yasamin; Ding, WeiDan; Ameli, Aboutaleb; Park, Chul B

    2015-12-14

    Melt blending is one of the most promising techniques for eliminating poly(lactic acid)'s (PLA) numerous drawbacks. However, success in a typical melt blending process is usually achieved through the inclusion of high concentrations of a second polymeric phase which can compromise PLA's green nature. In a pioneering study, we introduce the production of in situ microfibrillar PLA/polyamide-6 (PA6) blends as a cost-effective and efficient technique for improving PLA's properties while minimizing the required PA6 content. Predominantly biobased products, with only 3 wt % of in situ generated PA6 microfibrils (diameter ≈200 nm), were shown to have dramatically improved crystallization kinetics, mechanical properties, melt elasticity and strength, and foaming-ability compared with PLA. Crucially, the microfibrillar blends were produced using an environmentally friendly and cost-effective process. Both of these qualities are essential in guarantying the viability of the proposed technique for overcoming the obstacles associated with the vast commercialization of PLA.

  2. Structural Instability Tuning as a Regulatory Mechanism in Protein-Protein Interactions

    PubMed Central

    Chen, Li; Balabanidou, Vassilia; Remeta, David P.; Minetti, Conceição A.S.A.; Portaliou, Athina G.; Economou, Anastassios; Kalodimos, Charalampos G.

    2011-01-01

    SUMMARY Protein-protein interactions mediate a vast number of cellular processes. Here we present a regulatory mechanism in protein-protein interactions mediated by finely-tuned structural instability coupled with molecular mimicry. We show that a set of type III secretion (TTS) autoinhibited homodimeric chaperones adopt a molten-globule-like state that transiently exposes the substrate binding site as a means to become rapidly poised for binding to their cognate protein substrates. Packing defects at the homodimeric interface stimulate binding whereas correction of these defects results in less labile chaperones that give rise to non-functional biological systems. The protein substrates use structural mimicry to offset the “weak spots” in the chaperones and to counteract their autoinhibitory conformation. This regulatory mechanism of protein activity is evolutionary conserved among several TSS systems and presents a lucid example of functional advantage conferred upon a biological system by finely-tuned structural instability. PMID:22152477

  3. Diversity of regulatory mechanisms of photosynthetic carbon metabolism in plants and algae.

    PubMed

    Tamoi, Masahiro; Shigeoka, Shigeru

    2015-01-01

    To clarify the regulatory mechanisms of the Calvin cycle in algae, we analyzed the molecular properties of the enzymes involved in this cycle. We demonstrated that these enzymes were not regulated by redox modulation through the ferredoxin/thioredoxin system under light/dark conditions and were not sensitive to treatments with hydrogen peroxide in vitro, unlike the chloroplastic thiol-modulated enzymes of plants. On the other hand, we found that cyanobacteria possessed a unique enzyme involved in the Calvin cycle. The CP12 protein played an important role in regulating carbon metabolism in the Calvin cycle in cyanobacteria and eukaryotic algae. This review described the regulatory mechanisms of the Calvin cycle in algae and also the effects of alterations to photosynthetic carbon metabolism on plant productivity, carbon partitioning, and the carbon/nitrogen balance using transgenic plants expressing algal genes.

  4. A qrr noncoding RNA deploys four different regulatory mechanisms to optimize quorum-sensing dynamics.

    PubMed

    Feng, Lihui; Rutherford, Steven T; Papenfort, Kai; Bagert, John D; van Kessel, Julia C; Tirrell, David A; Wingreen, Ned S; Bassler, Bonnie L

    2015-01-15

    Quorum sensing is a cell-cell communication process that bacteria use to transition between individual and social lifestyles. In vibrios, homologous small RNAs called the Qrr sRNAs function at the center of quorum-sensing pathways. The Qrr sRNAs regulate multiple mRNA targets including those encoding the quorum-sensing regulatory components luxR, luxO, luxM, and aphA. We show that a representative Qrr, Qrr3, uses four distinct mechanisms to control its particular targets: the Qrr3 sRNA represses luxR through catalytic degradation, represses luxM through coupled degradation, represses luxO through sequestration, and activates aphA by revealing the ribosome binding site while the sRNA itself is degraded. Qrr3 forms different base-pairing interactions with each mRNA target, and the particular pairing strategy determines which regulatory mechanism occurs. Combined mathematical modeling and experiments show that the specific Qrr regulatory mechanism employed governs the potency, dynamics, and competition of target mRNA regulation, which in turn, defines the overall quorum-sensing response.

  5. Radiometric acid-base titrations.

    PubMed

    Erdey, L; Gimesi, O; Szabadváry, F

    1969-03-01

    Acid-base titrations can be performed with radiometric end-point detection by use of labelled metal salts (e.g., ZnCl(2), HgCl(2)). Owing to the formation or dissolution of the corresponding hydroxide after the equivalence point, the activity of the titrated solution linearly increases or decreases as excess of standard solution is added. The end-point of the titration is determined graphically.

  6. Regulatory T Cells in Autoimmune Diabetes: Mechanisms of Action and Translational Potential.

    PubMed

    Ovcinnikovs, Vitalijs; Walker, Lucy S K

    2015-01-01

    Since the discovery of specialized T cells with regulatory function, harnessing the power of these cells to ameliorate autoimmunity has been a major goal. Here we collate the evidence that regulatory T cells (Treg) can inhibit Type 1 diabetes in animal models and humans. We discuss the anatomical sites and molecular mechanisms of Treg suppressive function in the Type 1 diabetes setting, citing evidence that Treg can function in both the pancreatic lymph nodes and within the pancreatic lesion. Involvement of the CTLA-4 pathway, as well as TGF-β and IL-2 deprivation will be considered. Finally, we summarize current efforts to manipulate Treg therapeutically in individuals with Type 1 diabetes. The translation of this research area from bench to bedside is still in its infancy, but the remarkable therapeutic potential of successfully manipulating Treg populations is clear to see. PMID:26615100

  7. Latent Tuberculosis: Models, Computational Efforts and the Pathogen’s Regulatory Mechanisms during Dormancy

    PubMed Central

    Magombedze, Gesham; Dowdy, David; Mulder, Nicola

    2013-01-01

    Latent tuberculosis is a clinical syndrome that occurs after an individual has been exposed to the Mycobacterium tuberculosis (Mtb) Bacillus, the infection has been established and an immune response has been generated to control the pathogen and force it into a quiescent state. Mtb can exit this quiescent state where it is unresponsive to treatment and elusive to the immune response, and enter a rapid replicating state, hence causing infection reactivation. It remains a gray area to understand how the pathogen causes a persistent infection and it is unclear whether the organism will be in a slow replicating state or a dormant non-replicating state. The ability of the pathogen to adapt to changing host immune response mechanisms, in which it is exposed to hypoxia, low pH, nitric oxide (NO), nutrient starvation, and several other anti-microbial effectors, is associated with a high metabolic plasticity that enables it to metabolize under these different conditions. Adaptive gene regulatory mechanisms are thought to coordinate how the pathogen changes their metabolic pathways through mechanisms that sense changes in oxygen tension and other stress factors, hence stimulating the pathogen to make necessary adjustments to ensure survival. Here, we review studies that give insights into latency/dormancy regulatory mechanisms that enable infection persistence and pathogen adaptation to different stress conditions. We highlight what mathematical and computational models can do and what they should do to enhance our current understanding of TB latency. PMID:25023946

  8. Functional Genomic Insights into Regulatory Mechanisms of High-Altitude Adaptation.

    PubMed

    Storz, Jay F; Cheviron, Zachary A

    2016-01-01

    Recent studies of indigenous human populations at high altitude have provided proof-of-principle that genome scans of DNA polymorphism can be used to identify candidate loci for hypoxia adaptation. When integrated with experimental analyses of physiological phenotypes, genome-wide surveys of DNA polymorphism and tissue-specific transcriptional profiles can provide insights into actual mechanisms of adaptation. It has been suggested that adaptive phenotypic evolution is largely mediated by cis-regulatory changes in genes that are located at integrative control points in regulatory networks. This hypothesis can be tested by conducting transcriptomic analyses of hypoxic signaling pathways in conjunction with experimental measures of vascular oxygen supply and metabolic pathway flux. Such studies may reveal whether the architecture of gene regulatory networks can be used to predict which loci (and which types of loci) are likely to be "hot spots" for adaptive physiological evolution. Functional genomic studies of deer mice (Peromyscus maniculatus) demonstrate how the integrated analysis of variation in tissue-specific transcriptomes, whole-animal physiological performance, and various subordinate traits can yield insights into the mechanistic underpinnings of high-altitude adaptation. PMID:27343092

  9. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci

    PubMed Central

    Miller, Clint L.; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D.; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K.; Majmudar, Deshna; Kim, Juyong B.; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L.; Montgomery, Stephen B.; Schadt, Eric E.; Björkegren, Johan L.M.; Quertermous, Thomas

    2016-01-01

    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  10. Using Xenopus Embryos to Study Transcriptional and Posttranscriptional Gene Regulatory Mechanisms of Intermediate Filaments.

    PubMed

    Wang, Chen; Szaro, Ben G

    2016-01-01

    Intermediate filament genes exhibit highly regulated, tissue-specific patterns of expression during development and in response to injury. Identifying the responsible cis-regulatory gene elements thus holds great promise for revealing insights into fundamental gene regulatory mechanisms controlling tissue differentiation and repair. Because much of this regulation occurs in response to signals from surrounding cells, characterizing them requires a model system in which their activity can be tested within the context of an intact organism conveniently. We describe methods for doing so by injecting plasmid DNAs into fertilized Xenopus embryos. A prokaryotic element for site-specific recombination and two dual HS4 insulator elements flanking the reporter gene promote penetrant, promoter-typic expression that persists through early swimming tadpole stages, permitting the observation of fluorescent reporter protein expression in live embryos. In addition to describing cloning strategies for generating these plasmids, we present methods for coinjecting test and reference plasmids to identify the best embryos for analysis, for analyzing reporter protein and RNA expression, and for characterizing the trafficking of expressed reporter RNAs from the nucleus to polysomes. Thus, this system can be used to study the activities of cis-regulatory elements of intermediate filament genes at multiple levels of transcriptional and posttranscriptional control within an intact vertebrate embryo, from early stages of embryogenesis through later stages of organogenesis and tissue differentiation.

  11. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci.

    PubMed

    Miller, Clint L; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K; Majmudar, Deshna; Kim, Juyong B; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L; Montgomery, Stephen B; Schadt, Eric E; Björkegren, Johan L M; Quertermous, Thomas

    2016-01-01

    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  12. Regulatory role of collagen V in establishing mechanical properties of tendons and ligaments is tissue dependent.

    PubMed

    Connizzo, Brianne K; Freedman, Benjamin R; Fried, Joanna H; Sun, Mei; Birk, David E; Soslowsky, Louis J

    2015-06-01

    Patients with classic (type I) Ehlers-Danlos syndrome (EDS), characterized by heterozygous mutations in the Col5a1 and Col5a2 genes, exhibit connective tissue hyperelasticity and recurrent joint dislocations, indicating a potential regulatory role for collagen V in joint stabilizing soft tissues. This study asked whether the contribution of collagen V to the establishment of mechanical properties is tissue dependent. We mechanically tested four different tissues from wild type and targeted collagen V-null mice: the flexor digitorum longus (FDL) tendon, Achilles tendon (ACH), the anterior cruciate ligament (ACL), and the supraspinatus tendon (SST). Area was significantly reduced in the Col5a1(ΔTen/ΔTen) group in the FDL, ACH, and SST. Maximum load and stiffness were reduced in the Col5a1(ΔTen/ΔTen) group for all tissues. However, insertion site and midsubstance modulus were reduced only for the ACL and SST. This study provides evidence that the regulatory role of collagen V in extracellular matrix assembly is tissue dependent and that joint instability in classic EDS may be caused in part by insufficient mechanical properties of the tendons and ligaments surrounding each joint. PMID:25876927

  13. Recent Topics on the Regulatory Mechanism of Ecdysteroidogenesis by the Prothoracic Glands in Insects

    PubMed Central

    Tanaka, Yoshiaki

    2011-01-01

    Molting and metamorphosis are strictly regulated by steroid hormones known as ecdysteroids. It is now widely recognized that ecdysteroid biosynthesis (ecdysteroidogenesis) in the prothoracic gland (PG) is regulated by the tropic factor prothoracicotropic hormone (PTTH). However, the importance of PTTH in the induction of molting and metamorphosis remains unclear, and other mechanisms are thought to be involved in the regulation of ecdysteroidogenesis by the PG. Recently, new regulatory mechanisms, prothoracicostatic factors, and neural regulation have been explored using the silkworm, Bombyx mori, and two circulating prothoracicostatic factors, prothoracicostatic peptide (PTSP) and Bommo-myosuppressin (BMS), have been identified. Whereas PTTH and BMS are secreted from the brain, PTSP is secreted from the peripheral neurosecretory system – the epiproctodeal gland – during the molting stage. The molecular basis of neural regulation of ecdysteroidogenesis has been revealed for the first time in B. mori. The innervating neurons supply both Bommo-FMRF related peptide (BRFa) and orcokinin to maintain low levels of ecdysteroids during the feeding stage. These complex regulatory mechanisms – involving tropic and static factors, peripheral neurosecretory cells as well as the central neuroendocrine system, and neural regulation in addition to circulating factors collaborate to regulate ecdysteroidogenesis. Thus, together they create the finely tuned fluctuations in ecdysteroid titers needed in the hemolymph during insect development. PMID:22645515

  14. Biosafety, biosecurity and internationally mandated regulatory regimes: compliance mechanisms for education and global health security

    PubMed Central

    Sture, Judi; Whitby, Simon; Perkins, Dana

    2015-01-01

    This paper highlights the biosafety and biosecurity training obligations that three international regulatory regimes place upon states parties. The duty to report upon the existence of such provisions as evidence of compliance is discussed in relation to each regime. We argue that such mechanisms can be regarded as building blocks for the development and delivery of complementary biosafety and biosecurity teaching and training materials. We show that such building blocks represent foundations upon which life and associated scientists – through greater awareness of biosecurity concerns – can better fulfil their responsibilities to guard their work from misuse in the future. PMID:24494580

  15. Distinct regulatory mechanisms act to establish and maintain Pax3 expression in the developing neural tube.

    PubMed

    Moore, Steven; Ribes, Vanessa; Terriente, Javier; Wilkinson, David; Relaix, Frédéric; Briscoe, James

    2013-01-01

    Pattern formation in developing tissues is driven by the interaction of extrinsic signals with intrinsic transcriptional networks that together establish spatially and temporally restricted profiles of gene expression. How this process is orchestrated at the molecular level by genomic cis-regulatory modules is one of the central questions in developmental biology. Here we have addressed this by analysing the regulation of Pax3 expression in the context of the developing spinal cord. Pax3 is induced early during neural development in progenitors of the dorsal spinal cord and is maintained as pattern is subsequently elaborated, resulting in the segregation of the tissue into dorsal and ventral subdivisions. We used a combination of comparative genomics and transgenic assays to define and dissect several functional cis-regulatory modules associated with the Pax3 locus. We provide evidence that the coordinated activity of two modules establishes and refines Pax3 expression during neural tube development. Mutational analyses of the initiating element revealed that in addition to Wnt signaling, Nkx family homeodomain repressors restrict Pax3 transcription to the presumptive dorsal neural tube. Subsequently, a second module mediates direct positive autoregulation and feedback to maintain Pax3 expression. Together, these data indicate a mechanism by which transient external signals are converted into a sustained expression domain by the activities of distinct regulatory elements. This transcriptional logic differs from the cross-repression that is responsible for the spatiotemporal patterns of gene expression in the ventral neural tube, suggesting that a variety of circuits are deployed within the neural tube regulatory network to establish and elaborate pattern formation.

  16. Anti-Sigma Factors in E. coli: Common Regulatory Mechanisms Controlling Sigma Factors Availability

    PubMed Central

    Treviño-Quintanilla, Luis Gerardo; Freyre-González, Julio Augusto; Martínez-Flores, Irma

    2013-01-01

    In bacteria, transcriptional regulation is a key step in cellular gene expression. All bacteria contain a core RNA polymerase that is catalytically competent but requires an additional σ factor for specific promoter recognition and correct transcriptional initiation. The RNAP core is not able to selectively bind to a given σ factor. In contrast, different σ factors have different affinities for the RNAP core. As a consequence, the concentration of alternate σ factors requires strict regulation in order to properly control the delicate interplay among them, which favors the competence for the RNAP core. This control is archived by different σ/anti-σ controlling mechanisms that shape complex regulatory networks and cascades, and enable the response to sudden environmental cues, whose global understanding is a current challenge for systems biology. Although there have been a number of excellent studies on each of these σ/anti-σ post-transcriptional regulatory systems, no comprehensive comparison of these mechanisms in a single model organism has been conducted. Here, we survey all these systems in E. coli dissecting and analyzing their inner workings and highlightin their differences. Then, following an integral approach, we identify their commonalities and outline some of the principles exploited by the cell to effectively and globally reprogram the transcriptional machinery. These principles provide guidelines for developing biological synthetic circuits enabling an efficient and robust response to sudden stimuli. PMID:24396271

  17. Transancestral fine-mapping of four type 2 diabetes susceptibility loci highlights potential causal regulatory mechanisms

    PubMed Central

    Horikoshi, Momoko; Pasquali, Lorenzo; Wiltshire, Steven; Huyghe, Jeroen R.; Mahajan, Anubha; Asimit, Jennifer L.; Ferreira, Teresa; Locke, Adam E.; Robertson, Neil R.; Wang, Xu; Sim, Xueling; Fujita, Hayato; Hara, Kazuo; Young, Robin; Zhang, Weihua; Choi, Sungkyoung; Chen, Han; Kaur, Ismeet; Takeuchi, Fumihiko; Fontanillas, Pierre; Thuillier, Dorothée; Yengo, Loic; Below, Jennifer E.; Tam, Claudia H.T.; Wu, Ying; Abecasis, Gonçalo; Altshuler, David; Bell, Graeme I.; Blangero, John; Burtt, Noél P.; Duggirala, Ravindranath; Florez, Jose C.; Hanis, Craig L.; Seielstad, Mark; Atzmon, Gil; Chan, Juliana C.N.; Ma, Ronald C.W.; Froguel, Philippe; Wilson, James G.; Bharadwaj, Dwaipayan; Dupuis, Josee; Meigs, James B.; Cho, Yoon Shin; Park, Taesung; Kooner, Jaspal S.; Chambers, John C.; Saleheen, Danish; Kadowaki, Takashi; Tai, E. Shyong; Mohlke, Karen L.; Cox, Nancy J.; Ferrer, Jorge; Zeggini, Eleftheria; Kato, Norihiro; Teo, Yik Ying; Boehnke, Michael; McCarthy, Mark I.; Morris, Andrew P.

    2016-01-01

    To gain insight into potential regulatory mechanisms through which the effects of variants at four established type 2 diabetes (T2D) susceptibility loci (CDKAL1, CDKN2A-B, IGF2BP2 and KCNQ1) are mediated, we undertook transancestral fine-mapping in 22 086 cases and 42 539 controls of East Asian, European, South Asian, African American and Mexican American descent. Through high-density imputation and conditional analyses, we identified seven distinct association signals at these four loci, each with allelic effects on T2D susceptibility that were homogenous across ancestry groups. By leveraging differences in the structure of linkage disequilibrium between diverse populations, and increased sample size, we localised the variants most likely to drive each distinct association signal. We demonstrated that integration of these genetic fine-mapping data with genomic annotation can highlight potential causal regulatory elements in T2D-relevant tissues. These analyses provide insight into the mechanisms through which T2D association signals are mediated, and suggest future routes to understanding the biology of specific disease susceptibility loci. PMID:26911676

  18. Deletional and regulatory mechanisms coalesce to drive transplantation tolerance through mixed chimerism.

    PubMed

    Hock, Karin; Mahr, Benedikt; Schwarz, Christoph; Wekerle, Thomas

    2015-09-01

    Establishing donor-specific immunological tolerance could improve long-term outcome by obviating the need for immunosuppressive drug therapy, which is currently required to control alloreactivity after organ transplantation. Mixed chimerism is defined as the engraftment of donor hematopoietic stem cells in the recipient, leading to viable coexistence of both donor and recipient leukocytes. In numerous experimental models, cotransplantation of donor bone marrow (BM) into preconditioned (e.g., through irradiation or cytotoxic drugs) recipients leads to transplantation tolerance through (mixed) chimerism. Mixed chimerism offers immunological advantages for clinical translation; pilot trials have established proof of concept by deliberately inducing tolerance in humans. Widespread clinical application is prevented, however, by the harsh preconditioning currently necessary for permitting BM engraftment. Recently, the immunological mechanisms inducing and maintaining tolerance in experimental mixed chimerism have been defined, revealing a more prominent role for regulation than historically assumed. The evidence from murine models suggests that both deletional and regulatory mechanisms are critical in promoting complete tolerance, encompassing also the minor histocompatibility antigens. Here, we review the current understanding of tolerance through mixed chimerism and provide an outlook on how to realize widespread clinical translation based on mechanistic insights gained from chimerism protocols, including cell therapy with polyclonal regulatory T cells.

  19. Structure-based elucidation of the regulatory mechanism for aminopeptidase activity.

    PubMed

    Ta, Hai Minh; Bae, Sangsu; Han, Seungsu; Song, Jihyuck; Ahn, Tae Kyu; Hohng, Sungchul; Lee, Sangho; Kim, Kyeong Kyu

    2013-09-01

    The specificity of proteases for the residues in and length of substrates is key to understanding their regulatory mechanism, but little is known about length selectivity. Crystal structure analyses of the bacterial aminopeptidase PepS, combined with functional and single-molecule FRET assays, have elucidated a molecular basis for length selectivity. PepS exists in open and closed conformations. Substrates can access the binding hole in the open conformation, but catalytic competency is only achieved in the closed conformation by formation of the S1 binding pocket and proximal movement of Glu343, a general base, to the cleavage site. Hence, peptides longer than the depth of the binding hole block the transition from the open to the closed conformation, and thus length selection is a prerequisite for catalytic activation. A triple-sieve interlock mechanism is proposed featuring the coupling of length selectivity with residue specificity and active-site positioning.

  20. Transcription factor abundance controlled by an auto-regulatory mechanism involving a transcription start site switch

    PubMed Central

    Ngondo, Richard Patryk; Carbon, Philippe

    2014-01-01

    A transcriptional feedback loop is the simplest and most direct means for a transcription factor to provide an increased stability of gene expression. In this work performed in human cells, we reveal a new negative auto-regulatory mechanism involving an alternative transcription start site (TSS) usage. Using the activating transcription factor ZNF143 as a model, we show that the ZNF143 low-affinity binding sites, located downstream of its canonical TSS, play the role of protein sensors to induce the up- or down-regulation of ZNF143 gene expression. We uncovered that the TSS switch that mediates this regulation implies the differential expression of two transcripts with an opposite protein production ability due to their different 5′ untranslated regions. Moreover, our analysis of the ENCODE data suggests that this mechanism could be used by other transcription factors to rapidly respond to their own aberrant expression level. PMID:24234445

  1. Mechanisms of regulatory T-cell suppression – a diverse arsenal for a moving target

    PubMed Central

    Sojka, Dorothy K; Huang, Yu-Hui; Fowell, Deborah J

    2008-01-01

    Naturally-occurring regulatory T cells (Tregs) are emerging as key regulators of immune responses to self-tissues and infectious agents. Insight has been gained into the cell types and the cellular events that are regulated by Tregs. Indeed, Tregs have been implicated in the control of initial activation events, proliferation, differentiation and effector function. However, the mechanisms by which Tregs disable their cellular targets are not well understood. Here we review recent advances in the identification of distinct mechanisms of Treg action and of signals that enable cellular targets to escape regulation. Roles for inhibitory cytokines, cytotoxic molecules, modulators of cAMP and cytokine competition have all been demonstrated. The growing number of inhibitory mechanisms ascribed to Tregs suggests that Tregs take a multi-pronged approach to immune regulation. It is likely that the relative importance of each inhibitory mechanism is context dependent and modulated by the inflammatory milieu and the magnitude of the immune response. In addition, the target cell may be differentially susceptible or resistant to distinct Treg mechanisms depending on their activation or functional status at the time of the Treg encounter. Understanding when and where each suppressive tool is most effective will help to fine tune therapeutic strategies to promote or constrain specific arms of Treg suppression. PMID:18346152

  2. An atlas of gene regulatory networks reveals multiple three-gene mechanisms for interpreting morphogen gradients

    PubMed Central

    Cotterell, James; Sharpe, James

    2010-01-01

    The interpretation of morphogen gradients is a pivotal concept in developmental biology, and several mechanisms have been proposed to explain how gene regulatory networks (GRNs) achieve concentration-dependent responses. However, the number of different mechanisms that may exist for cells to interpret morphogens, and the importance of design features such as feedback or local cell–cell communication, is unclear. A complete understanding of such systems will require going beyond a case-by-case analysis of real morphogen interpretation mechanisms and mapping out a complete GRN ‘design space.' Here, we generate a first atlas of design space for GRNs capable of patterning a homogeneous field of cells into discrete gene expression domains by interpreting a fixed morphogen gradient. We uncover multiple very distinct mechanisms distributed discretely across the atlas, thereby expanding the repertoire of morphogen interpretation network motifs. Analyzing this diverse collection of mechanisms also allows us to predict that local cell–cell communication will rarely be responsible for the basic dose-dependent response of morphogen interpretation networks. PMID:21045819

  3. Innovation of a Regulatory Mechanism Modulating Semi-determinate Stem Growth through Artificial Selection in Soybean

    PubMed Central

    Ping, Jieqing; Li, Shuai; Chen, Zhixiang; Ma, Jianxin

    2016-01-01

    It has been demonstrated that Terminal Flowering 1 (TFL1) in Arabidopsis and its functional orthologs in other plants specify indeterminate stem growth through their specific expression that represses floral identity genes in shoot apical meristems (SAMs), and that the loss-of-function mutations at these functional counterparts result in the transition of SAMs from the vegetative to reproductive state that is essential for initiation of terminal flowering and thus formation of determinate stems. However, little is known regarding how semi-determinate stems, which produce terminal racemes similar to those observed in determinate plants, are specified in any flowering plants. Here we show that semi-determinacy in soybean is modulated by transcriptional repression of Dt1, the functional ortholog of TFL1, in SAMs. Such repression is fulfilled by recently enabled spatiotemporal expression of Dt2, an ancestral form of the APETALA1/FRUITFULL orthologs, which encodes a MADS-box factor directly binding to the regulatory sequence of Dt1. In addition, Dt2 triggers co-expression of the putative SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (GmSOC1) in SAMs, where GmSOC1 interacts with Dt2, and also directly binds to the Dt1 regulatory sequence. Heterologous expression of Dt2 and Dt1 in determinate (tfl1) Arabidopsis mutants enables creation of semi-determinacy, but the same forms of the two genes in the tfl1 and soc1 background produce indeterminate stems, suggesting that Dt2 and SOC1 both are essential for transcriptional repression of Dt1. Nevertheless, the expression of Dt2 is unable to repress TFL1 in Arabidopsis, further demonstrating the evolutionary novelty of the regulatory mechanism underlying stem growth in soybean. PMID:26807727

  4. Putting theory to the test: which regulatory mechanisms can drive realistic growth of a root?

    PubMed

    De Vos, Dirk; Vissenberg, Kris; Broeckhove, Jan; Beemster, Gerrit T S

    2014-10-01

    In recent years there has been a strong development of computational approaches to mechanistically understand organ growth regulation in plants. In this study, simulation methods were used to explore which regulatory mechanisms can lead to realistic output at the cell and whole organ scale and which other possibilities must be discarded as they result in cellular patterns and kinematic characteristics that are not consistent with experimental observations for the Arabidopsis thaliana primary root. To aid in this analysis, a 'Uniform Longitudinal Strain Rule' (ULSR) was formulated as a necessary condition for stable, unidirectional, symplastic growth. Our simulations indicate that symplastic structures are robust to differences in longitudinal strain rates along the growth axis only if these differences are small and short-lived. Whereas simple cell-autonomous regulatory rules based on counters and timers can produce stable growth, it was found that steady developmental zones and smooth transitions in cell lengths are not feasible. By introducing spatial cues into growth regulation, those inadequacies could be avoided and experimental data could be faithfully reproduced. Nevertheless, a root growth model based on previous polar auxin-transport mechanisms violates the proposed ULSR due to the presence of lateral gradients. Models with layer-specific regulation or layer-driven growth offer potential solutions. Alternatively, a model representing the known cross-talk between auxin, as the cell proliferation promoting factor, and cytokinin, as the cell differentiation promoting factor, predicts the effect of hormone-perturbations on meristem size. By down-regulating PIN-mediated transport through the transcription factor SHY2, cytokinin effectively flattens the lateral auxin gradient, at the basal boundary of the division zone, (thereby imposing the ULSR) to signal the exit of proliferation and start of elongation. This model exploration underlines the value of

  5. Visual- and Vestibular-Autonomic Influence on Short-Term Cardiovascular Regulatory Mechanisms

    NASA Technical Reports Server (NTRS)

    Mullen, Thomas J.; Ramsdell, Craig D.

    1999-01-01

    This synergy project was a one-year effort conducted cooperatively by members of the NSBRI Cardiovascular Alterations and Neurovestibular Adaptation Teams in collaboration with NASA Johnson Space Center (JSC) colleagues. The objective of this study was to evaluate visual autonomic interactions on short-term cardiovascular regulatory mechanisms. Based on established visual-vestibular and vestibular-autonomic shared neural pathways, we hypothesized that visually induced changes in orientation will trigger autonomic cardiovascular reflexes. A second objective was to compare baroreflex changes during postural changes as measured with the new Cardiovascular System Identification (CSI) technique with those measured using a neck barocuff. While the neck barocuff stimulates only the carotid baroreceptors, CSI provides a measure of overall baroreflex responsiveness. This study involved a repeated measures design with 16 healthy human subjects (8 M, 8 F) to examine cardiovascular regulatory responses during actual and virtual head-upright tilts. Baroreflex sensitivity was first evaluated with subjects in supine and upright positions during actual tilt-table testing using both neck barocuff and CSI methods. The responses to actual tilts during this first session were then compared to responses during visually induced tilt and/or rotation obtained during a second session.

  6. A systems biology approach to defining regulatory mechanisms for cartilage and tendon cell phenotypes

    PubMed Central

    Mueller, A. J.; Tew, S. R.; Vasieva, O.; Clegg, P. D.; Canty-Laird, E. G.

    2016-01-01

    Phenotypic plasticity of adult somatic cells has provided emerging avenues for the development of regenerative therapeutics. In musculoskeletal biology the mechanistic regulatory networks of genes governing the phenotypic plasticity of cartilage and tendon cells has not been considered systematically. Additionally, a lack of strategies to effectively reproduce in vitro functional models of cartilage and tendon is retarding progress in this field. De- and redifferentiation represent phenotypic transitions that may contribute to loss of function in ageing musculoskeletal tissues. Applying a systems biology network analysis approach to global gene expression profiles derived from common in vitro culture systems (monolayer and three-dimensional cultures) this study demonstrates common regulatory mechanisms governing de- and redifferentiation transitions in cartilage and tendon cells. Furthermore, evidence of convergence of gene expression profiles during monolayer expansion of cartilage and tendon cells, and the expression of key developmental markers, challenges the physiological relevance of this culture system. The study also suggests that oxidative stress and PI3K signalling pathways are key modulators of in vitro phenotypes for cells of musculoskeletal origin. PMID:27670352

  7. Regulatory motifs on ISWI chromatin remodelers: molecular mechanisms and kinetic proofreading

    NASA Astrophysics Data System (ADS)

    Brysbaert, Guillaume; Lensink, Marc F.; Blossey, Ralf

    2015-02-01

    Recently, kinetic proofreading scenarios have been proposed for the regulation of chromatin remodeling, first on purely theoretical grounds (Blossey and Schiessel 2008 HFSP J. 2 167-70) and deduced from experiments on the ISWI/ACF system (Narlikar 2010 Curr. Opin. Chem. Biol. 14 660). In the kinetic proofreading scenario of chromatin remodeling, the combination of the recognition of a histone tail state and ATP-hydrolysis in the remodeler motor act together to select (i.e. proofread) a nucleosomal substrate. ISWI remodelers have recently been shown to have an additional level of regulation as they contain auto-inhibitory motifs which need to be inactivated through an interaction with the nucleosome. In this paper we show that the auto-regulatory effect enhances substrate recognition in kinetic proofreading. We further report some suggestive additional insights into the molecular mechanism underlying ISWI-autoregulation.

  8. Potential impact of gene regulatory mechanisms on the evolution of multicellularity in the volvocine algae.

    PubMed

    Kianianmomeni, Arash

    2015-01-01

    A fundamental question in biology is how multicellular organisms can arise from their single-celled precursors. The evolution of multicellularity requires the adoption of new traits in unicellular ancestors that allows the generation of form by, for example, increasing the size and developing new cell types. But what are the genetic, cellular and biochemical bases underlying the evolution of multicellularity? Recent advances in evolutionary developmental biology suggest that the regulation of gene expression by cis-regulatory factors, gene duplication and alternative splicing contribute to phenotypic evolution. These mechanisms enable different degrees of phenotypic divergence and complexity with variation in traits from genomes with similar gene contents. In addition, signaling pathways specific to cell types are developed to guarantee the modulation of cellular and developmental processes matched to the cell types as well as the maintenance of multicellularity. PMID:26479715

  9. High commitment of embryonic keratinocytes to terminal differentiation through a Notch1-caspase 3 regulatory mechanism.

    PubMed

    Okuyama, Ryuhei; Nguyen, Bach-Cuc; Talora, Claudio; Ogawa, Eisaku; Tommasi di Vignano, Alice; Lioumi, Maria; Chiorino, Giovanna; Tagami, Hachiro; Woo, Minna; Dotto, G Paolo

    2004-04-01

    Embryonic cells are expected to possess high growth/differentiation potential, required for organ morphogenesis and expansion during development. However, little is known about the intrinsic properties of embryonic epithelial cells due to difficulties in their isolation and cultivation. We report here that pure keratinocyte populations from E15.5 mouse embryos commit irreversibly to differentiation much earlier than newborn cells. Notch signaling, which promotes keratinocyte differentiation, is upregulated in embryonic keratinocyte and epidermis, and elevated caspase 3 expression, which we identify as a transcriptional Notch1 target, accounts in part for the high commitment of embryonic keratinocytes to terminal differentiation. In vivo, lack of caspase 3 results in increased proliferation and decreased differentiation of interfollicular embryonic keratinocytes, together with decreased activation of PKC-delta, a caspase 3 substrate which functions as a positive regulator of keratinocyte differentiation. Thus, a Notch1-caspase 3 regulatory mechanism underlies the intrinsically high commitment of embryonic keratinocytes to terminal differentiation.

  10. Regulatory motifs on ISWI chromatin remodelers: molecular mechanisms and kinetic proofreading.

    PubMed

    Brysbaert, Guillaume; Lensink, Marc F; Blossey, Ralf

    2015-02-18

    Recently, kinetic proofreading scenarios have been proposed for the regulation of chromatin remodeling, first on purely theoretical grounds (Blossey and Schiessel 2008 HFSP J. 2 167-70) and deduced from experiments on the ISWI/ACF system (Narlikar 2010 Curr. Opin. Chem. Biol. 14 660). In the kinetic proofreading scenario of chromatin remodeling, the combination of the recognition of a histone tail state and ATP-hydrolysis in the remodeler motor act together to select (i.e. proofread) a nucleosomal substrate. ISWI remodelers have recently been shown to have an additional level of regulation as they contain auto-inhibitory motifs which need to be inactivated through an interaction with the nucleosome. In this paper we show that the auto-regulatory effect enhances substrate recognition in kinetic proofreading. We further report some suggestive additional insights into the molecular mechanism underlying ISWI-autoregulation. PMID:25563573

  11. Mechanistic Basis for Plant Responses to Drought Stress : Regulatory Mechanism of Abscisic Acid Signaling

    NASA Astrophysics Data System (ADS)

    Miyakawa, Takuya; Tanokura, Masaru

    The phytohormone abscisic acid (ABA) plays a key role in the rapid adaptation of plants to environmental stresses such as drought and high salinity. Accumulated ABA in plant cells promotes stomatal closure in guard cells and transcription of stress-tolerant genes. Our understanding of ABA responses dramatically improved by the discovery of both PYR/PYL/RCAR as a soluble ABA receptor and inhibitory complex of a protein phospatase PP2C and a protein kinase SnRK2. Moreover, several structural analyses of PYR/PYL/RCAR revealed the mechanistic basis for the regulatory mechanism of ABA signaling, which provides a rational framework for the design of alternative agonists in future.

  12. The regulatory mechanisms of myogenin expression in doxorubicin-treated rat cardiomyocytes

    PubMed Central

    Yen, Li-Chen; Huang, Chi-Jung; Lin, Wei-Shiang; Chan, James Yi-Hsin

    2015-01-01

    Doxorubicin, an anthracycline antibiotic, has been used as an anti-neoplastic drug for almost 60 years. However, the mechanism(s) by which anthracyclines cause irreversible myocardial injury remains unclear. In order to delineate possible molecular signals involved in the myocardial toxicity, we assessed candidate genes using mRNA expression profiling in the doxorubicin-treated rat cardiomyocyte H9c2 cell line. In the study, it was confirmed that myogenin, an important transcriptional factor for muscle terminal differentiation, was significantly reduced by doxorubicin in a dose-dependent manner using both RT-PCR and western blot analyses. Also, it was identified that the doxorubicin-reduced myogenin gene level could not be rescued by most cardio-protectants. Furthermore, it was demonstrated how the signaling of the decreased myogenin expression by doxorubicin was altered at the transcriptional, post-transcriptional and translational levels. Based on these findings, a working model was proposed for relieving doxorubicin-associated myocardial toxicity by down-regulating miR-328 expression and increasing voltage-gated calcium channel β1 expression, which is a repressor of myogenin gene regulation. In summary, this study provides several lines of evidence indicating that myogenin is the target for doxorubicin-induced cardio-toxicity and a novel therapeutic strategy for doxorubicin clinical applications based on the regulatory mechanisms of myogenin expression. PMID:26452256

  13. Heritability of symbiont density reveals distinct regulatory mechanisms in a tripartite symbiosis.

    PubMed

    Parkinson, Jasmine F; Gobin, Bruno; Hughes, William O H

    2016-04-01

    Beneficial eukaryotic-bacterial partnerships are integral to animal and plant evolution. Understanding the density regulation mechanisms behind bacterial symbiosis is essential to elucidating the functional balance between hosts and symbionts. Citrus mealybugs, Planococcus citri (Risso), present an excellent model system for investigating the mechanisms of symbiont density regulation. They contain two obligate nutritional symbionts, Moranella endobia, which resides inside Tremblaya princeps, which has been maternally transmitted for 100-200 million years. We investigate whether host genotype may influence symbiont density by crossing mealybugs from two inbred laboratory-reared populations that differ substantially in their symbiont density to create hybrids. The density of the M. endobia symbiont in the hybrid hosts matched that of the maternal parent population, in keeping with density being determined either by the symbiont or the maternal genotype. However, the density of the T. princeps symbiont was influenced by the paternal host genotype. The greater dependency of T. princeps on its host may be due to its highly reduced genome. The decoupling of T. princeps and M. endobia densities, in spite of their intimate association, suggests that distinct regulatory mechanisms can be at work in symbiotic partnerships, even when they are obligate and mutualistic. PMID:27099709

  14. Distinct regulatory mechanisms of eukaryotic transcriptional activation by SAGA and TFIID.

    PubMed

    Bhaumik, Sukesh R

    2011-02-01

    A growing number of human diseases are linked to abnormal gene expression which is largely controlled at the level of transcriptional initiation. The gene-specific activator promotes the initiation of transcription through its interaction with one or more components of the transcriptional initiation machinery, hence leading to stimulated transcriptional initiation or activation. However, all activator proteins do not target the same component(s) of the transcriptional initiation machinery. Rather, they can have different target specificities, and thus, can lead to distinct mechanisms of transcriptional activation. Two such distinct mechanisms of transcriptional activation in yeast are mediated by the SAGA (Spt-Ada-Gcn5-Acetyltransferase) and TFIID (Transcription factor IID) complexes, and are termed as "SAGA-dependent" and "TFIID-dependent" transcriptional activation, respectively. SAGA is the target of the activator in case of SAGA-dependent transcriptional activation, while the targeting of TFIID by the activator leads to TFIID-dependent transcriptional activation. Both the SAGA and TFIID complexes are highly conserved from yeast to human, and play crucial roles in gene activation among eukaryotes. The regulatory mechanisms of eukaryotic transcriptional activation by SAGA and TFIID are discussed here. This article is part of a Special Issue entitled The 26S Proteasome: When degradation is just not enough!

  15. Interaction and Protection Mechanism between Li@C60 and Nucleic Acid Bases (NABs): Performance of PM6-DH2 on Noncovalent Interaction of NABs-Li@C60

    PubMed Central

    Sun, Wenming; Bu, Yuxiang; Wang, Yixuan

    2011-01-01

    To discuss the protection mechanism of DNA from radiation as well as assess the performance of PM6-DH2 on noncovalent interactions, the interaction of four nucleic acid bases (NABs) such as adenine (A), cytosine (C), guanine (G), and thymine (T), with Li@C60 was extensively investigated with the-state-of-art theoretical methods describing non-covalent systems, like M06-2x, PBE-D, and PM6-DH2 methods. In the gas phase, the binding strength of NABs to Li@C60 from M06-2x decreases in the sequence, G>C>A>T. As dispersion was explicitly included, PBE-D relatively enhances the binding of A and T and corrects the sequence to, G>A>C~T. PM6-DH2 predicted similar binding energies to those from PBE-D within 0.5kcal/mol and the same binding sequence, suggesting that the PM6-DH2 method is promising for nano-scale systems. In the aqueous solution, binding of NABs-Li@C60 is considerably decreased, and the M06-2X and PM6-D methods yield a different sequence from the gas phase, G>A>T>C. The encapsulation of Li atom results in a lower IP for Li@C60 than those of NABs, and the dominant localization of single-occupied molecular orbital on Li@C60 moiety of the complexes NABs-Li@C60 further indicates that an electron would be ejected from Li@C60 upon radiation and Li@C60 is therefore able to protect DNA bases from radiation. In addition, it was revealed that Li prefers coordination with the hexagonal ring at Li@C60, which clarifies the existing controversy in this respect. Finally, Yang’s reduced density gradient approach clearly shows that the weak and strong noncovalent interaction regions in the complexes, NABs-Li@C60 and (NABs-Li@C60)+. PMID:22170247

  16. Renal acidification responses to respiratory acid-base disorders.

    PubMed

    Madias, Nicolaos E

    2010-01-01

    Respiratory acid-base disorders are those abnormalities in acid-base equilibrium that are expressed as primary changes in the arterial carbon dioxide tension (PaCO2). An increase in PaCO2 (hypercapnia) acidifies body fluids and initiates the acid-base disturbance known as respiratory acidosis. By contrast, a decrease in PaCO2 (hypocapnia) alkalinizes body fluids and initiates the acid-base disturbance known as respiratory alkalosis. The impact on systemic acidity of these primary changes in PaCO2 is ameliorated by secondary, directional changes in plasma [HCO3¯] that occur in 2 stages. Acutely, hypercapnia or hypocapnia yields relatively small changes in plasma [HCO3¯] that originate virtually exclusively from titration of the body's nonbicarbonate buffers. During sustained hypercapnia or hypocapnia, much larger changes in plasma [HCO3¯] occur that reflect adjustments in renal acidification mechanisms. Consequently, the deviation of systemic acidity from normal is smaller in the chronic forms of these disorders. Here we provide an overview of the renal acidification responses to respiratory acid-base disorders. We also identify gaps in knowledge that require further research.

  17. Molten fatty acid based microemulsions.

    PubMed

    Noirjean, Cecile; Testard, Fabienne; Dejugnat, Christophe; Jestin, Jacques; Carriere, David

    2016-06-21

    We show that ternary mixtures of water (polar phase), myristic acid (MA, apolar phase) and cetyltrimethylammonium bromide (CTAB, cationic surfactant) studied above the melting point of myristic acid allow the preparation of microemulsions without adding a salt or a co-surfactant. The combination of SANS, SAXS/WAXS, DSC, and phase diagram determination allows a complete characterization of the structures and interactions between components in the molten fatty acid based microemulsions. For the different structures characterized (microemulsion, lamellar or hexagonal phases), a similar thermal behaviour is observed for all ternary MA/CTAB/water monophasic samples and for binary MA/CTAB mixtures without water: crystalline myristic acid melts at 52 °C, and a thermal transition at 70 °C is assigned to the breaking of hydrogen bounds inside the mixed myristic acid/CTAB complex (being the surfactant film in the ternary system). Water determines the film curvature, hence the structures observed at high temperature, but does not influence the thermal behaviour of the ternary system. Myristic acid is partitioned in two "species" that behave independently: pure myristic acid and myristic acid associated with CTAB to form an equimolar complex that plays the role of the surfactant film. We therefore show that myristic acid plays the role of a solvent (oil) and a co-surfactant allowing the fine tuning of the structure of oil and water mixtures. This solvosurfactant behaviour of long chain fatty acid opens the way for new formulations with a complex structure without the addition of any extra compound. PMID:27241163

  18. Regulatory mechanisms that modulate signalling by G-protein-coupled receptors.

    PubMed Central

    Böhm, S K; Grady, E F; Bunnett, N W

    1997-01-01

    The large and functionally diverse group of G-protein-coupled receptors includes receptors for many different signalling molecules, including peptide and non-peptide hormones and neuro-transmitters, chemokines, prostanoids and proteinases. Their principal function is to transmit information about the extracellular environment to the interior of the cell by interacting with the heterotrimeric G-proteins, and they thereby participate in many aspects of regulation. Cellular responses to agonists of these receptors are usually rapidly attenuated. Mechanisms of signal attenuation include removal of agonists from the extracellular fluid, receptor desensitization, endocytosis and down-regulation. Agonists are removed by dilution, uptake by transporters and enzymic degradation. Receptor desensitization is mediated by receptor phosphorylation by G-protein receptor kinases and second-messenger kinases, interaction of phosphorylated receptors with arrestins and receptor uncoupling from G-proteins. Agonist-induced receptor endocytosis also contributes to desensitization by depleting the cell surface of high-affinity receptors, and recycling of internalized receptors contributes to resensitization of cellular responses. Receptor down-regulation is a form of desensitization that occurs during continuous, long-term exposure of cells to receptor agonists. Down-regulation, which may occur during the development of drug tolerance, is characterized by depletion of the cellular receptor content, and is probably mediated by alterations in the rates of receptor degradation and synthesis. These regulatory mechanisms are important, as they govern the ability of cells to respond to agonists. A greater understanding of the mechanisms that modulate signalling may lead to the development of new therapies and may help to explain the mechanism of drug tolerance. PMID:9078236

  19. MYCN-driven regulatory mechanisms controlling LIN28B in neuroblastoma

    PubMed Central

    Beckers, Anneleen; Van Peer, Gert; Carter, Daniel R.; Gartlgruber, Moritz; Herrmann, Carl; Agarwal, Saurabh; Helsmoortel, Hetty H.; Althoff, Kristina; Molenaar, Jan J.; Cheung, Belamy B.; Schulte, Johannes H.; Benoit, Yves; Shohet, Jason M.; Westermann, Frank; Marshall, Glenn M.; Vandesompele, Jo; De Preter, Katleen; Speleman, Frank

    2016-01-01

    LIN28B has been identified as an oncogene in various tumor entities, including neuroblastoma, a childhood cancer that originates from neural crest-derived cells, and is characterized by amplification of the MYCN oncogene. Recently, elevated LIN28B expression levels were shown to contribute to neuroblastoma tumorigenesis via let-7 dependent de-repression of MYCN. However, additional insight in the regulation of LIN28B in neuroblastoma is lacking. Therefore, we have performed a comprehensive analysis of the regulation of LIN28B in neuroblastoma, with a specific focus on the contribution of miRNAs. We show that MYCN regulates LIN28B expression in neuroblastoma tumors via two distinct parallel mechanisms. First, through an unbiased LIN28B-3′UTR reporter screen, we found that miR-26a-5p and miR-26b-5p regulate LIN28B expression. Next, we demonstrated that MYCN indirectly affects the expression of miR-26a-5p, and hence regulates LIN28B, therefor establishing a MYCN-miR-26a-5p-LIN28B regulatory axis. Second, we provide evidence that MYCN regulates LIN28B expression via interaction with the LIN28B promotor, establishing a direct MYCN-LIN28B regulatory axis. We believe that these findings mark LIN28B as an important effector of the MYCN oncogenic phenotype and underlines the importance of MYCN-regulated miRNAs in establishing the MYCN-driven oncogenic process. PMID:26123663

  20. Structural insights into the regulatory mechanism of the Pseudomonas aeruginosa YfiBNR system.

    PubMed

    Xu, Min; Yang, Xuan; Yang, Xiu-An; Zhou, Lei; Liu, Tie-Zheng; Fan, Zusen; Jiang, Tao

    2016-06-01

    YfiBNR is a recently identified bis-(3'-5')-cyclic dimeric GMP (c-di-GMP) signaling system in opportunistic pathogens. It is a key regulator of biofilm formation, which is correlated with prolonged persistence of infection and antibiotic drug resistance. In response to cell stress, YfiB in the outer membrane can sequester the periplasmic protein YfiR, releasing its inhibition of YfiN on the inner membrane and thus provoking the diguanylate cyclase activity of YfiN to induce c-di-GMP production. However, the detailed regulatory mechanism remains elusive. Here, we report the crystal structures of YfiB alone and of an active mutant YfiB(L43P) complexed with YfiR with 2:2 stoichiometry. Structural analyses revealed that in contrast to the compact conformation of the dimeric YfiB alone, YfiB(L43P) adopts a stretched conformation allowing activated YfiB to penetrate the peptidoglycan (PG) layer and access YfiR. YfiB(L43P) shows a more compact PG-binding pocket and much higher PG binding affinity than wild-type YfiB, suggesting a tight correlation between PG binding and YfiB activation. In addition, our crystallographic analyses revealed that YfiR binds Vitamin B6 (VB6) or L-Trp at a YfiB-binding site and that both VB6 and L-Trp are able to reduce YfiB(L43P)-induced biofilm formation. Based on the structural and biochemical data, we propose an updated regulatory model of the YfiBNR system. PMID:27113583

  1. A Cell-Regulatory Mechanism Involving Feedback between Contraction and Tissue Formation Guides Wound Healing Progression

    PubMed Central

    Valero, Clara; Javierre, Etelvina; García-Aznar, José Manuel; Gómez-Benito, María José

    2014-01-01

    Wound healing is a process driven by cells. The ability of cells to sense mechanical stimuli from the extracellular matrix that surrounds them is used to regulate the forces that cells exert on the tissue. Stresses exerted by cells play a central role in wound contraction and have been broadly modelled. Traditionally, these stresses are assumed to be dependent on variables such as the extracellular matrix and cell or collagen densities. However, we postulate that cells are able to regulate the healing process through a mechanosensing mechanism regulated by the contraction that they exert. We propose that cells adjust the contraction level to determine the tissue functions regulating all main activities, such as proliferation, differentiation and matrix production. Hence, a closed-regulatory feedback loop is proposed between contraction and tissue formation. The model consists of a system of partial differential equations that simulates the evolution of fibroblasts, myofibroblasts, collagen and a generic growth factor, as well as the deformation of the extracellular matrix. This model is able to predict the wound healing outcome without requiring the addition of phenomenological laws to describe the time-dependent contraction evolution. We have reproduced two in vivo experiments to evaluate the predictive capacity of the model, and we conclude that there is feedback between the level of cell contraction and the tissue regenerated in the wound. PMID:24681636

  2. Core level regulatory network of osteoblast as molecular mechanism for osteoporosis and treatment

    PubMed Central

    Zhu, Xiaomei; Li, Jun; Liang, Yuhong; Liu, Tao; Zhu, Yanxia; Zhang, Bingbing; Tan, Shuang; Guo, Huajie; Guan, Shuguang; Ao, Ping; Zhou, Guangqian

    2016-01-01

    To develop and evaluate the long-term prophylactic treatment for chronic diseases such as osteoporosis requires a clear view of mechanism at the molecular and systems level. While molecular signaling pathway studies for osteoporosis are extensive, a unifying mechanism is missing. In this work, we provide experimental and systems-biology evidences that a tightly connected top-level regulatory network may exist, which governs the normal and osteoporotic phenotypes of osteoblast. Specifically, we constructed a hub-like interaction network from well-documented cross-talks among estrogens, glucocorticoids, retinoic acids, peroxisome proliferator-activated receptor, vitamin D receptor and calcium-signaling pathways. The network was verified with transmission electron microscopy and gene expression profiling for bone tissues of ovariectomized (OVX) rats before and after strontium gluconate (GluSr) treatment. Based on both the network structure and the experimental data, the dynamical modeling predicts calcium and glucocorticoids signaling pathways as targets for GluSr treatment. Modeling results further reveal that in the context of missing estrogen signaling, the GluSr treated state may be an outcome that is closest to the healthy state. PMID:26783964

  3. A LINE-1-encoded reverse transcriptase-dependent regulatory mechanism is active in embryogenesis and tumorigenesis.

    PubMed

    Spadafora, Corrado

    2015-04-01

    LINE-1 (long interspersed nuclear elements) retrotransposons constitute a large family of retrotransposable elements, accounting for 17% of the human genome. They encode proteins required for their own mobilization, including a reverse transcriptase (RT) enzyme highly expressed in mouse embryos and mouse and human cancer cells and repressed in somatic differentiated healthy cells. We have found that reverse transcription takes place in early murine embryos, yielding an increase in LINE-1 copy number during preimplantation development, which also occurs in tumor progression. RT inhibition irreversibly arrests embryo development, reduces cancer cell proliferation, promotes differentiation, antagonizes tumor growth, and causes a global reprogramming of transcription profiles. These results strongly suggest that a previously unrecognized RT-dependent regulatory mechanism operates during preimplantation development, is repressed during differentiation to normal tissues, and, when erroneously reactivated in adult life, promotes cell transformation and cancer progression by "resurrecting" embryonic transcriptional pathways. The RT-dependent mechanism emerges as a major source of genetic and epigenetic changes with physiological, pathological, and evolutionary implications.

  4. Core level regulatory network of osteoblast as molecular mechanism for osteoporosis and treatment.

    PubMed

    Yuan, Ruoshi; Ma, Shengfei; Zhu, Xiaomei; Li, Jun; Liang, Yuhong; Liu, Tao; Zhu, Yanxia; Zhang, Bingbing; Tan, Shuang; Guo, Huajie; Guan, Shuguang; Ao, Ping; Zhou, Guangqian

    2016-01-26

    To develop and evaluate the long-term prophylactic treatment for chronic diseases such as osteoporosis requires a clear view of mechanism at the molecular and systems level. While molecular signaling pathway studies for osteoporosis are extensive, a unifying mechanism is missing. In this work, we provide experimental and systems-biology evidences that a tightly connected top-level regulatory network may exist, which governs the normal and osteoporotic phenotypes of osteoblast. Specifically, we constructed a hub-like interaction network from well-documented cross-talks among estrogens, glucocorticoids, retinoic acids, peroxisome proliferator-activated receptor, vitamin D receptor and calcium-signaling pathways. The network was verified with transmission electron microscopy and gene expression profiling for bone tissues of ovariectomized (OVX) rats before and after strontium gluconate (GluSr) treatment. Based on both the network structure and the experimental data, the dynamical modeling predicts calcium and glucocorticoids signaling pathways as targets for GluSr treatment. Modeling results further reveal that in the context of missing estrogen signaling, the GluSr treated state may be an outcome that is closest to the healthy state. PMID:26783964

  5. Up-regulation of miR-98 and unraveling regulatory mechanisms in gestational diabetes mellitus

    PubMed Central

    Cao, Jing-Li; Zhang, Lu; Li, Jian; Tian, Shi; Lv, Xiao-Dan; Wang, Xue-Qin; Su, Xing; Li, Ying; Hu, Yi; Ma, Xu; Xia, Hong-Fei

    2016-01-01

    MiR-98 expression was up-regulated in kidney in response to early diabetic nephropathy in mouse and down-regulated in muscle in type 2 diabetes in human. However, the expression prolife and functional role of miR-98 in human gestational diabetes mellitus (GDM) remained unclear. Here, we investigated its expression and function in placental tissues from GDM patients and the possible molecular mechanisms. The results showed that miR-98 was up-regulated in placentas from GDM patients compared with normal placentas. MiR-98 over-expression increased global DNA methylational level and miR-98 knockdown reduced global DNA methylational level. Further investigation revealed that miR-98 could inhibit Mecp2 expression by binding the 3′-untranslated region (UTR) of methyl CpG binding protein 2 (Mecp2), and then led to the expression dysregulation of canonical transient receptor potential 3 (Trpc3), a glucose uptake related gene. More importantly, in vivo analysis found that the expression level of Mecp2 and Trpc3 in placental tissues from GDM patients, relative to the increase of miR-98, was diminished, especially for GDM patients over the age of 35 years. Collectively, up-regulation of miR-98 in the placental tissues of human GDM is linked to the global DNA methylation via targeting Mecp2, which may imply a novel regulatory mechanism in GDM. PMID:27573367

  6. Functional role of regulatory T cells in B cell lymphoma and related mechanisms.

    PubMed

    Wu, Wei; Wan, Jun; Xia, Ruixiang; Huang, Zhenqi; Ni, Jing; Yang, Mingzhen

    2015-01-01

    B cell lymphoma (BCL) has a higher degree of malignancy and complicated pathogenic mechanism. Regulatory T cells (Treg cells) are known to exert certain immune suppression functions, in addition to immune mediating effects. Recent studies have revealed the role of Treg cells in pathogenesis and progression of multiple malignant tumors. This study therefore investigated the functional role and related mechanism of Treg cells in BCL. A cohort of thirty patients who were diagnosed with BCL in our hospital between January 2013 and December 2014. Another thirty healthy individuals were recruited. Peripheral blood mononuclear cells (PBMCs) were separated and analyzed for the ratio of CD4+/CD25+ Treg cells. The mRNA expression levels of Foxp3, transforming growth factor (TGF)-β1 and interleukin (IL)-10 genes were quantified by real-time PCR, while their serum levels were determined by enzyme-linked immunosorbent assay (ELISA). Meanwhile all laboratory indexes for patients were monitored during the complete remission (CR) stage. BCL patients significantly elevated ratio of CD4+/CD25+ Treg cells, which were decreased at CR stage. mRNA levels of Foxp3, TGF-β1 and IL-10, in addition to protein levels of TGF-β1 and IL-10 were potentiated in lymphoma patients but decreased in CR patients (P<0.05 in all cases). CD4+/CD25+ Treg cells exert immune suppressing functions in BCL via regulating cytokines, thereby facilitating the pathogenesis and progression of lymphoma. PMID:26464657

  7. The Kidney and Acid-Base Regulation

    ERIC Educational Resources Information Center

    Koeppen, Bruce M.

    2009-01-01

    Since the topic of the role of the kidneys in the regulation of acid base balance was last reviewed from a teaching perspective (Koeppen BM. Renal regulation of acid-base balance. Adv Physiol Educ 20: 132-141, 1998), our understanding of the specific membrane transporters involved in H+, HCO , and NH transport, and especially how these…

  8. The Conjugate Acid-Base Chart.

    ERIC Educational Resources Information Center

    Treptow, Richard S.

    1986-01-01

    Discusses the difficulties that beginning chemistry students have in understanding acid-base chemistry. Describes the use of conjugate acid-base charts in helping students visualize the conjugate relationship. Addresses chart construction, metal ions, buffers and pH titrations, and the organic functional groups and nonaqueous solvents. (TW)

  9. Drug-induced acid-base disorders.

    PubMed

    Kitterer, Daniel; Schwab, Matthias; Alscher, M Dominik; Braun, Niko; Latus, Joerg

    2015-09-01

    The incidence of acid-base disorders (ABDs) is high, especially in hospitalized patients. ABDs are often indicators for severe systemic disorders. In everyday clinical practice, analysis of ABDs must be performed in a standardized manner. Highly sensitive diagnostic tools to distinguish the various ABDs include the anion gap and the serum osmolar gap. Drug-induced ABDs can be classified into five different categories in terms of their pathophysiology: (1) metabolic acidosis caused by acid overload, which may occur through accumulation of acids by endogenous (e.g., lactic acidosis by biguanides, propofol-related syndrome) or exogenous (e.g., glycol-dependant drugs, such as diazepam or salicylates) mechanisms or by decreased renal acid excretion (e.g., distal renal tubular acidosis by amphotericin B, nonsteroidal anti-inflammatory drugs, vitamin D); (2) base loss: proximal renal tubular acidosis by drugs (e.g., ifosfamide, aminoglycosides, carbonic anhydrase inhibitors, antiretrovirals, oxaliplatin or cisplatin) in the context of Fanconi syndrome; (3) alkalosis resulting from acid and/or chloride loss by renal (e.g., diuretics, penicillins, aminoglycosides) or extrarenal (e.g., laxative drugs) mechanisms; (4) exogenous bicarbonate loads: milk-alkali syndrome, overshoot alkalosis after bicarbonate therapy or citrate administration; and (5) respiratory acidosis or alkalosis resulting from drug-induced depression of the respiratory center or neuromuscular impairment (e.g., anesthetics, sedatives) or hyperventilation (e.g., salicylates, epinephrine, nicotine).

  10. Cardiovascular Risk in Systemic Autoimmune Diseases: Epigenetic Mechanisms of Immune Regulatory Functions

    PubMed Central

    López-Pedrera, Chary; Pérez-Sánchez, Carlos; Ramos-Casals, Manuel; Santos-Gonzalez, Monica; Rodriguez-Ariza, Antonio; José Cuadrado, Ma

    2012-01-01

    Autoimmune diseases (AIDs) have been associated with accelerated atherosclerosis (AT) leading to increased cardio- and cerebrovascular disease risk. Traditional risk factors, as well as systemic inflammation mediators, including cytokines, chemokines, proteases, autoantibodies, adhesion receptors, and others, have been implicated in the development of these vascular pathologies. Yet, the characteristics of vasculopathies may significantly differ depending on the underlying disease. In recent years, many new genes and signalling pathways involved in autoimmunity with often overlapping patterns between different disease entities have been further detected. Epigenetics, the control of gene packaging and expression independent of alterations in the DNA sequence, is providing new directions linking genetics and environmental factors. Epigenetic regulatory mechanisms comprise DNA methylation, histone modifications, and microRNA activity, all of which act upon gene and protein expression levels. Recent findings have contributed to our understanding of how epigenetic modifications could influence AID development, not only showing differences between AID patients and healthy controls, but also showing how one disease differs from another and even how the expression of key proteins involved in the development of each disease is regulated. PMID:21941583

  11. Molecular interactions of the Saccharomyces cerevisiae Atg1 complex provide insights into assembly and regulatory mechanisms

    PubMed Central

    Chew, Leon H; Lu, Shan; Liu, Xu; Li, Franco Kk; Yu, Angela Yh; Klionsky, Daniel J; Dong, Meng-Qiu; Yip, Calvin K

    2015-01-01

    The Atg1 complex, which contains 5 major subunits: Atg1, Atg13, Atg17, Atg29, and Atg31, regulates the induction of autophagy and autophagosome formation. To gain a better understanding of the overall architecture and assembly mechanism of this essential autophagy regulatory complex, we have reconstituted a core assembly of the Saccharomyces cerevisiae Atg1 complex composed of full-length Atg17, Atg29, and Atg31, along with the C-terminal domains of Atg1 (Atg1[CTD]) and Atg13 (Atg13[CTD]). Using chemical-crosslinking coupled with mass spectrometry (CXMS) analysis we systematically mapped the intersubunit interaction interfaces within this complex. Our data revealed that the intrinsically unstructured C-terminal domain of Atg29 interacts directly with Atg17, whereas Atg17 interacts with Atg13 in 2 distinct intrinsically unstructured regions, including a previously unknown motif that encompasses several putative phosphorylation sites. The Atg1[CTD] crosslinks exclusively to the Atg13[CTD] and does not appear to make direct contact with the Atg17-Atg31-Atg29 scaffold. Finally, single-particle electron microscopy analysis revealed that both the Atg13[CTD] and Atg1[CTD] localize to the tip regions of Atg17-Atg31-Atg29 and do not alter the distinct curvature of this scaffolding subcomplex. This work provides a comprehensive understanding of the subunit interactions in the fully assembled Atg1 core complex, and uncovers the potential role of intrinsically disordered regions in regulating complex integrity. PMID:25998554

  12. Regulatory mechanism of protein metabolic pathway during the differentiation process of chicken male germ cell.

    PubMed

    Li, Dong; Zuo, Qisheng; Lian, Chao; Zhang, Lei; Shi, Qingqing; Zhang, Zhentao; Wang, Yingjie; Ahmed, Mahmoud F; Tang, Beibei; Xiao, Tianrong; Zhang, Yani; Li, Bichun

    2015-08-01

    We explored the regulatory mechanism of protein metabolism during the differentiation process of chicken male germ cells and provide a basis for improving the induction system of embryonic stem cell differentiation to male germ cells in vitro. We sequenced the transcriptome of embryonic stem cells, primordial germ cells, and spermatogonial stem cells with RNA sequencing (RNA-Seq), bioinformatics analysis methods, and detection of the key genes by quantitative reverse transcription PCR (qRT-PCR). Finally, we found 16 amino acid metabolic pathways enriched in the biological metabolism during the differentiation process of embryonic stem cells to primordial germ cells and 15 amino acid metabolic pathways enriched in the differentiation stage of primordial germ cells to spermatogonial stem cells. We found three pathways, arginine-proline metabolic pathway, tyrosine metabolic pathway, and tryptophan metabolic pathway, significantly enriched in the whole differentiation process of embryonic stem cells to spermatogonial stem cells. Moreover, for these three pathways, we screened key genes such as NOS2, ADC, FAH, and IDO. qRT-PCR results showed that the expression trend of these genes were the same to RNA-Seq. Our findings showed that the three pathways and these key genes play an important role in the differentiation process of embryonic stem cells to male germ cells. These results provide basic information for improving the induction system of embryonic stem cell differentiation to male germ cells in vitro.

  13. Dynamic responsiveness of the vascular bed as a regulatory mechanism in vasomotor control.

    PubMed

    Zamir, Mair; Norton, Katelyn; Fleischhauer, Arlene; Frances, Maria F; Goswami, Ruma; Usselman, Charlotte W; Nolan, Robert P; Shoemaker, J Kevin

    2009-07-01

    The dynamics of blood supply to a vascular bed depend on lumped mechanical properties of that bed, namely the compliance (C), resistance (R), viscoelasticity (K), and inertance (L). While the study of regulatory mechanisms has so far placed the emphasis largely on R, it is not known how the remaining properties contribute collectively to the play of dynamics in vasomotor control. To examine this question and to establish some benchmark values of these properties, simultaneous measurements of pressure and flow waveforms in the vascular bed of the forearm were obtained from three groups: young healthy individuals, older hypertensives with controlled blood pressure, and older hypertensives with uncontrolled blood pressure. The values of R and C were found to vary within a wide range in each of the three groups to the extent that neither R nor C could be used independently as an indicator of health or age of the subjects tested. However, higher level dynamic properties of the bed, such as the time constants and damping index, which depend on combinations of C,K, and L, and which may reflect measures of the dynamic responsiveness or "sluggishness" of the system, were found to be maintained over a wide range of pulse pressures. These findings support a hypothesis that the pulsatile dynamics of blood supply to a vascular bed are adapted to the individual baseline values of R and C in different subjects with the effect of optimizing the level of dynamic responsiveness to changes in pressure or flow, and that this dynamic property of the vascular bed may be a protected and/or regulated property.

  14. Insights into the inhibitory mechanisms of the regulatory protein IIA(Glc) on melibiose permease activity.

    PubMed

    Hariharan, Parameswaran; Guan, Lan

    2014-11-21

    The phosphotransfer protein IIA(Glc) of the bacterial phosphoenolpyruvate:carbohydrate phosphotransferase system plays a key role in the regulation of carbohydrate metabolism. Melibiose permease (MelB) is one among several permeases subject to IIA(Glc) regulation. The regulatory mechanisms are poorly understood; in addition, thermodynamic features of IIA(Glc) binding to other proteins are also unknown. Applying isothermal titration calorimetry and amine-specific cross-linking, we show that IIA(Glc) directly binds to MelB of Salmonella typhimurium (MelB(St)) and Escherichia coli MelB (MelB(Ec)) at a stoichiometry of unity in the absence or presence of melibiose. The dissociation constant values are 3-10 μM for MelB(St) and 25 μM for MelB(Ec). All of the binding is solely driven by favorable enthalpy forces. IIA(Glc) binding to MelB(St) in the absence or presence of melibiose yields a large negative heat capacity change; in addition, the conformational entropy is constrained upon the binding. We further found that the IIA(Glc)-bound MelB(St) exhibits a decreased binding affinity for melibiose or nitrophenyl-α-galactoside. It is believed that sugar binding to the permease is involved in an induced fit mechanism, and the transport process requires conformational cycling between different states. Thus, the thermodynamic data are consistent with the interpretation that IIA(Glc) inhibits the induced fit process and restricts the conformational dynamics of MelB(St). PMID:25296751

  15. An insight into the various regulatory mechanisms modulating human DNA methyltransferase 1 stability and function

    PubMed Central

    Kar, Swayamsiddha; Deb, Moonmoon; Sengupta, Dipta; Shilpi, Arunima; Parbin, Sabnam; Torrisani, Jérôme; Pradhan, Sriharsa; Patra, Samir Kumar

    2012-01-01

    DNA methylation is one of the principal epigenetic signals that participate in cell specific gene expression in vertebrates. DNA methylation plays a quintessential role in the control of gene expression, cellular differentiation and development. It also plays a central role in the preservation of chromatin structure and chromosomal integrity, parental imprinting, X-chromosome inactivation, aging and carcinogenesis. The foremost contributor in the mammalian methylation scheme is DNMT1, a maintenance methyltransferase that faithfully copies the pre-existing methyl marks onto hemimethylated daughter strands during DNA replication to maintain the established methylation patterns across successive cell divisions. The ever-changing cellular physiology and the significant part that DNA methylation plays in genome regulation necessitate rigid management of this enzyme. In mammalian cells, a host of intrinsic and extrinsic mechanisms regulate the expression, activity and stability of DNMT1. Transcriptional regulation, post-transcriptional auto-inhibitory controls and post-translational modifications of the enzyme are responsible for the efficient inheritance of DNA methylation patterns. Also, a large number of intra- and intercellular signaling cascades and numerous interactions with other modulator molecules that affect the catalytic activity of the enzyme at multiple levels function as major checkpoints of the DNMT1 control system. An in-depth understanding of the DNMT1 enzyme, its targeting and function is crucial for comprehending how DNA methylation is coordinated with other critical developmental and physiological processes. This review aims to provide a comprehensive account of the various regulatory mechanisms and interactions of DNMT1 so as to elucidate its function at the molecular level and understand the dynamics of DNA methylation at the cellular level. PMID:22894906

  16. Luteal regression vs. prepartum luteolysis: regulatory mechanisms governing canine corpus luteum function.

    PubMed

    Kowalewski, Mariusz P

    2014-04-01

    Canine reproductive physiology exhibits several unusual features. Among the most interesting of these are the lack of an acute luteolytic mechanism, coinciding with the apparent luteal independency of a uterine luteolysin in absence of pregnancy, contrasting with the acute prepartum luteolysis observed in pregnant animals. These features indicate the existence of mechanisms different from those in other species for regulating the extended luteal regression observed in non-pregnant dogs, and the actively regulated termination of luteal function observed prepartum as a prerequisite for parturition. Nevertheless, the supply of progesterone (P4) depends on corpora lutea (CL) as its primary source in both conditions, resulting in P4 levels that are similar in pregnant and non-pregnant bitches during almost the entire luteal life span prior to the prepartum luteolysis. Consequently, the duration of the prolonged luteal phase in non-pregnant bitches frequently exceeds that of pregnant ones, which is a peculiarity when compared with other domestic animal species. Both LH and prolactin (PRL) are endocrine luteotrophic factors in the dog, the latter being the predominant one. In spite of increased availability of these hormones, luteal regression/luteolysis still takes place. Recently, possible mechanisms regulating the expression and function of PRL receptor have been implicated in the local, i.e., intraluteal regulation of PRL bioavailability and thus its steroidogenic potential. Similar mechanisms may relate to the luteal LH receptor. Most recently, evidence has been provided for an autocrine/paracrine role of prostaglandin E2 (PGE2) as a luteotrophic factor in the canine CL acting at the level of steroidogenic acute regulatory (STAR)-protein mediated supply of steroidogenic substrate, without having a significant impact on the enzymatic activity of the respective steroidogenic enzymes, 3β-hydroxysteroid-dehydrogenase (3βHSD, HSD3B2) and cytochrome P450 side

  17. Mutational analysis of structural elements in a class-I cyclic di-GMP riboswitch to elucidate its regulatory mechanism.

    PubMed

    Inuzuka, Saki; Nishimura, Kei-Ichiro; Kakizawa, Hitoshi; Fujita, Yuki; Furuta, Hiroyuki; Matsumura, Shigeyoshi; Ikawa, Yoshiya

    2016-09-01

    The Vc2 riboswitch possesses an aptamer domain belonging to the class-I c-di-GMP riboswitch family. This domain has been analysed and the molecular mechanism by which it recognizes the c-di-GMP ligand has been elucidated. On the other hand, the regulatory mechanism of the full-length Vc2 riboswitch to control its downstream open reading frame (ORF) remains largely unknown. In this study, we performed in vivo reporter assays and in vitro biochemical analyses of the full-length riboswitch and its aptamer domain. We evaluated the results of in vivo and in vitro analyses to elucidate the regulatory mechanism of the Vc2 riboswitch. The present results suggest that recognition of c-di-GMP ligand by the Vc2 riboswitch aptamer domain downregulates expression of its downstream ORF primarily at the translational level.

  18. Acute inflammation in peritoneal dialysis: experimental studies in rats. Characterization of regulatory mechanisms.

    PubMed

    Bazargani, Farhan

    2005-01-01

    The predominant problems associated with peritoneal dialysis (PD) are ultrafiltration failure and peritonitis. PD maintains a state of intraperitoneal inflammation that affects the structure and function of the peritoneal membrane, potentially impairing ultrafiltration efficiency. Paradoxically, some PD fluids also have anti-inflammatory properties that may compromise the immune defense against peritonitis. This anti-inflammatory feature is mostly due to the glucose degradation products (GDPs), formed during heat-sterilization and storage of PD fluids. The main purpose of the present thesis was to study regulatory mechanisms behind the acute intraperitoneal inflammatory response in PD in the presence and absence of experimental peritonitis. Rats were exposed to a single dose of heat- or filter sterilized PD fluids either as an i.p. injection or as an infusion through an indwelling catheter, with or without supplementations, or pretreatment of the animals. The dwell fluid was analyzed zero, two and four hours later concerning activation of the complement and coagulation cascades, neutrophil recruitment and respiratory burst, ultrafiltration volumes, cytokine-induced neutrophil chemoattractant (CINC-1), rat mast cell protease 2 (RMCP-2), glucose, urea and histamine concentrations and ex vivo/in vitro intraperitoneal chemotactic activity. Exposure to filter sterilized PD fluid alone induced intraperitoneal complement activation and coagulation, neutrophil recruitment and increased the levels of CINC-1 during the dwell. Intraperitoneal concentrations of the mast cell markers histamine and RMCP-2 changed little during the dwells and did not indicate mast cell activation. Low molecular weight heparin (LMWH) and C5 blockade improved ultrafiltration. Pretreatment with cobra venom factor, known decomplementing agent, blocked the CINC-1 release and the neutrophil recruitment and improved ultrafiltration. In combination with experimental peritonitis, heat sterilized PD fluid

  19. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk.

    PubMed

    McCraty, Rollin; Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems.

  20. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk

    PubMed Central

    Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems. PMID:25694852

  1. Jammed acid-base reactions at interfaces.

    PubMed

    Gibbs-Davis, Julianne M; Kruk, Jennifer J; Konek, Christopher T; Scheidt, Karl A; Geiger, Franz M

    2008-11-19

    Using nonlinear optics, we show that acid-base chemistry at aqueous/solid interfaces tracks bulk pH changes at low salt concentrations. In the presence of 10 to 100 mM salt concentrations, however, the interfacial acid-base chemistry remains jammed for hours, until it finally occurs within minutes at a rate that follows the kinetic salt effect. For various alkali halide salts, the delay times increase with increasing anion polarizability and extent of cation hydration and lead to massive hysteresis in interfacial acid-base titrations. The resulting implications for pH cycling in these systems are that interfacial systems can spatially and temporally lag bulk acid-base chemistry when the Debye length approaches 1 nm.

  2. Use of an Acid-Base Table.

    ERIC Educational Resources Information Center

    Willis, Grover; And Others

    1986-01-01

    Identifies several ways in which an acid-base table can provide students with information about chemical reactions. Cites examples of the chart's use and includes a table which indicates the strengths of some common acids and bases. (ML)

  3. microRNA regulatory mechanism by which PLLA aligned nanofibers influence PC12 cell differentiation

    NASA Astrophysics Data System (ADS)

    Yu, Yadong; Lü, Xiaoying; Ding, Fei

    2015-08-01

    Objective. Aligned nanofibers (AFs) are regarded as promising biomaterials in nerve tissue engineering. However, a full understanding of the biocompatibility of AFs at the molecular level is still challenging. Therefore, the present study focused on identifying the microRNA (miRNA)-mediated regulatory mechanism by which poly-L-lactic acid (PLLA) AFs influence PC12 cell differentiation. Approach. Firstly, the effects of PLLA random nanofibers (RFs)/AFs and PLLA films (control) on the biological responses of PC12 cells that are associated with neuronal differentiation were examined. Then, SOLiD sequencing and cDNA microarray were employed to profile the expressions of miRNAs and mRNAs. The target genes of the misregulated miRNAs were predicted and compared with the mRNA profile data. Functions of the matched target genes (the intersection between the predicted target genes and the experimentally-determined, misregulated genes) were analyzed. Main results. The results revealed that neurites spread in various directions in control and RF groups. In the AF group, most neurites extended in parallel with each other. The glucose consumption and lactic acid production in the RF and AF groups were higher than those in the control group. Compared with the control group, 42 and 94 miRNAs were significantly dysregulated in the RF and AF groups, respectively. By comparing the predicted target genes with the mRNA profile data, five and 87 matched target genes were found in the RF and AF groups, respectively. Three of the matched target genes in the AF group were found to be associated with neuronal differentiation, whereas none had this association in the RF group. The PLLA AFs induced the dysregulation of miRNAs that regulate many biological functions, including axonal guidance, lipid metabolism and long-term potentiation. In particular, two miRNA-matched target gene-biological function modules associated with neuronal differentiation were identified as follows: (1) miR-23b, mi

  4. Deciphering Transcriptional Regulatory Mechanisms Associated with Hemicellulose Degradation in Neurospora crassa

    PubMed Central

    Sun, Jianping; Tian, Chaoguang; Diamond, Spencer

    2012-01-01

    Hemicellulose, the second most abundant plant biomass fraction after cellulose, is widely viewed as a potential substrate for the production of liquid fuels and other value-added materials. Degradation of hemicellulose by filamentous fungi requires production of many different enzymes, which are induced by biopolymers or its derivatives and regulated mainly at the transcriptional level through transcription factors (TFs). Neurospora crassa, a model filamentous fungus, expresses and secretes enzymes required for plant cell wall deconstruction. To better understand genes specifically associated with degradation of hemicellulose, we applied secretome and transcriptome analysis to N. crassa grown on beechwood xylan. We identified 34 secreted proteins and 353 genes with elevated transcription on xylan. The xylanolytic phenotype of strains with deletions in genes identified from the secretome and transcriptome analysis of the wild type was assessed, revealing functions for known and unknown proteins associated with hemicellulose degradation. By evaluating phenotypes of strains containing deletions of predicted TF genes in N. crassa, we identified a TF (XLR-1; xylan degradation regulator 1) essential for hemicellulose degradation that is an ortholog to XlnR/XYR1 in Aspergillus and Trichoderma species, respectively, a major transcriptional regulator of genes encoding both cellulases and hemicellulases. Deletion of xlr-1 in N. crassa abolished growth on xylan and xylose, but growth on cellulose and cellulolytic activity were only slightly affected. To determine the regulatory mechanisms for hemicellulose degradation, we explored the transcriptional regulon of XLR-1 under xylose, xylanolytic, and cellulolytic conditions. XLR-1 regulated only some predicted hemicellulase genes in N. crassa and was required for a full induction of several cellulase genes. Hemicellulase gene expression was induced by a combination of release from carbon catabolite repression (CCR) and induction

  5. Regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor-α genetic variations

    PubMed Central

    LIU, YANGZHOU; HAN, NING; LI, QINCHUAN; LI, ZENGCHUN

    2016-01-01

    The present study aimed to investigate the regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor (TNF)-α genetic variations. The GSE5760 expression profile data, which was downloaded from the Gene Expression Omnibus database, contained 30 wild-type (WT) and 28 mutation (MUT) samples. Differentially expressed genes (DEGs) between the two types of samples were identified using the Student's t-test, and the corresponding microRNAs (miRNAs) were screened using WebGestalt software. An integrated miRNA-DEG network was constructed using the Cytoscape software, based on the interactions between the DEGs, as identified using the Search Tool for the Retrieval of Interacting Genes/Proteins database, and the correlation between miRNAs and their target genes. Furthermore, Gene Ontology and pathway enrichment analyses were conducted for the DEGs using the Database for Annotation, Visualization and Integrated Discovery and the KEGG Orthology Based Annotation System, respectively. A total of 390 DEGS between the WT and MUT samples, along with 11 -associated miRNAs, were identified. The integrated miRNA-DEG network consisted of 38 DEGs and 11 miRNAs. Within this network, COPS2 was found to be associated with transcriptional functions, while FUS was found to be involved in mRNA metabolic processes. Other DEGs, including FBXW7 and CUL3, were enriched in the ubiquitin-mediated proteolysis pathway. In addition, miR-15 was predicted to target COPS2 and CUL3. The results of the present study suggested that COPS2, FUS, FBXW7 and CUL3 may be associated with sepsis in patients with TNF-α genetic variations. In the progression of sepsis, FBXW7 and CUL3 may participate in the ubiquitin-mediated proteolysis pathway, whereas COPS2 may regulate the phosphorylation and ubiquitination of the FUS protein. Furthermore, COPS2 and CUL3 may be novel targets of miR-15. PMID:27347057

  6. Nitrous Oxide Metabolism in Nitrate-Reducing Bacteria: Physiology and Regulatory Mechanisms.

    PubMed

    Torres, M J; Simon, J; Rowley, G; Bedmar, E J; Richardson, D J; Gates, A J; Delgado, M J

    2016-01-01

    Nitrous oxide (N2O) is an important greenhouse gas (GHG) with substantial global warming potential and also contributes to ozone depletion through photochemical nitric oxide (NO) production in the stratosphere. The negative effects of N2O on climate and stratospheric ozone make N2O mitigation an international challenge. More than 60% of global N2O emissions are emitted from agricultural soils mainly due to the application of synthetic nitrogen-containing fertilizers. Thus, mitigation strategies must be developed which increase (or at least do not negatively impact) on agricultural efficiency whilst decrease the levels of N2O released. This aim is particularly important in the context of the ever expanding population and subsequent increased burden on the food chain. More than two-thirds of N2O emissions from soils can be attributed to bacterial and fungal denitrification and nitrification processes. In ammonia-oxidizing bacteria, N2O is formed through the oxidation of hydroxylamine to nitrite. In denitrifiers, nitrate is reduced to N2 via nitrite, NO and N2O production. In addition to denitrification, respiratory nitrate ammonification (also termed dissimilatory nitrate reduction to ammonium) is another important nitrate-reducing mechanism in soil, responsible for the loss of nitrate and production of N2O from reduction of NO that is formed as a by-product of the reduction process. This review will synthesize our current understanding of the environmental, regulatory and biochemical control of N2O emissions by nitrate-reducing bacteria and point to new solutions for agricultural GHG mitigation. PMID:27134026

  7. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-01-01

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  8. Differential acid-base regulation in various gills of the green crab Carcinus maenas: Effects of elevated environmental pCO2.

    PubMed

    Fehsenfeld, Sandra; Weihrauch, Dirk

    2013-01-01

    Euryhaline decapod crustaceans possess an efficient regulation apparatus located in the gill epithelia, providing a high adaptation potential to varying environmental abiotic conditions. Even though many studies focussed on the osmoregulatory capacity of the gills, acid-base regulatory mechanisms have obtained much less attention. In the present study, underlying principles and effects of elevated pCO(2) on acid-base regulatory patterns were investigated in the green crab Carcinus maenas acclimated to diluted seawater. In gill perfusion experiments, all investigated gills 4-9 were observed to up-regulate the pH of the hemolymph by 0.1-0.2 units. Anterior gills, especially gill 4, were identified to be most efficient in the equivalent proton excretion rate. Ammonia excretion rates mirrored this pattern among gills, indicating a linkage between both processes. In specimen exposed to elevated pCO(2) levels for at least 7 days, mimicking a future ocean scenario as predicted until the year 2300, hemolymph K(+) and ammonia concentrations were significantly elevated, and an increased ammonia excretion rate was observed. A detailed quantitative gene expression analysis revealed that upon elevated pCO(2) exposure, mRNA levels of transcripts hypothesized to be involved in ammonia and acid-base regulation (Rhesus-like protein, membrane-bound carbonic anhydrase, Na(+)/K(+)-ATPase) were affected predominantly in the non-osmoregulating anterior gills. PMID:23022520

  9. 77 FR 16126 - Microbiology Devices; Reclassification of Nucleic Acid-Based Systems for Mycobacterium tuberculosis

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-19

    ... Food and Drug Administration 21 CFR Part 866 Microbiology Devices; Reclassification of Nucleic Acid...: Proposed rule. SUMMARY: The Food and Drug Administration (FDA) is proposing to reclassify nucleic acid... effectiveness of the device for its intended use. II. Regulatory Background of the Device Nucleic acid-based...

  10. The Regulation of Acid-Base Balance--A Microprocessor Simulation.

    ERIC Educational Resources Information Center

    Rasch, Robert W.

    1983-01-01

    Describes a computer program designed to simulate the regulation of acid-base balance, emphasizing regulatory compensations involved in the total process. Includes discussion of equations involved, a sample run of the program, and program listing (MicroSoft Basic). (JN)

  11. Regulatory Mechanisms of the Molecular Pathways in Fibrosis Induced by MicroRNAs

    PubMed Central

    Yang, Cui; Zheng, Si-Dao; Wu, Hong-Jin; Chen, Shao-Jun

    2016-01-01

    Objective: MicroRNAs (miRNAs or miRs) play critical roles in the fibrotic process in different organs. We summarized the latest research progress on the roles and mechanisms of miRNAs in the regulation of the molecular signaling pathways involved in fibrosis. Data Sources: Papers published in English from January 2010 to August 2015 were selected from the PubMed and Web of Science databases using the search terms “microRNA”, “miR”, “transforming growth factor β”, “tgf β”, “mitogen-activated protein kinase”, “mapk”, “integrin”, “p38”, “c-Jun NH2-terminal kinase”, “jnk”, “extracellular signal-regulated kinase”, “erk”, and “fibrosis”. Study Selection: Articles were obtained and reviewed to analyze the regulatory effects of miRNAs on molecular signaling pathways involved in the fibrosis. Results: Recent evidence has shown that miRNAs are involved in regulating fibrosis by targeting different substrates in the molecular processes that drive fibrosis, such as immune cell sensitization, effector cell activation, and extracellular matrix remodeling. Moreover, several important molecular signaling pathways involve in fibrosis, such as the transforming growth factor-beta (TGF-β) pathway, mitogen-activated protein kinase (MAPK) pathways, and the integrin pathway are regulated by miRNAs. Third, regulation of the fibrotic pathways induced by miRNAs is found in many other tissues in addition to the heart, lung, liver, and kidney. Interestingly, the actions of many drugs on the human body are also induced by miRNAs. It is encouraging that the fibrotic process can be blocked or reversed by targeting specific miRNAs and their signaling pathways, thereby protecting the structures and functions of different organs. Conclusions: miRNAs not only regulate molecular signaling pathways in fibrosis but also serve as potential targets of novel therapeutic interventions for fibrosing diseases. PMID:27647197

  12. Identification and characterization of the novel Col10a1 regulatory mechanism during chondrocyte hypertrophic differentiation

    PubMed Central

    Gu, J; Lu, Y; Li, F; Qiao, L; Wang, Q; Li, N; Borgia, J A; Deng, Y; Lei, G; Zheng, Q

    2014-01-01

    hypertrophic MCT cells. Electrophoretic mobility shift assay and chromatin immunoprecipitation assays confirmed the interaction between Cox-2 and Col10a1 cis-enhancer, supporting its role as a candidate Col10a1 regulator. Together, our data support a Cox-2-containing, Runx2-centered Col10a1 regulatory mechanism, during chondrocyte hypertrophic differentiation. PMID:25321476

  13. [Kidney, Fluid, and Acid-Base Balance].

    PubMed

    Shioji, Naohiro; Hayashi, Masao; Morimatsu, Hiroshi

    2016-05-01

    Kidneys play an important role to maintain human homeostasis. They contribute to maintain body fluid, electrolytes, and acid-base balance. Especially in fluid control, we, physicians can intervene body fluid balance using fluid resuscitation and diuretics. In recent years, one type of fluid resuscitation, hydroxyl ethyl starch has been extensively studied in the field of intensive care. Although their effects on fluid resuscitation are reasonable, serious complications such as kidney injury requiring renal replacement therapy occur frequently. Now we have to pay more attention to this important complication. Another topic of fluid management is tolvaptan, a selective vasopressin-2 receptor antagonist Recent randomized trial suggested that tolvaptan has a similar supportive effect for fluid control and more cost effective compared to carperitide. In recent years, Stewart approach is recognized as one important tool to assess acid-base balance in critically ill patients. This approach has great value, especially to understand metabolic components in acid-base balance. Even for assessing the effects of kidneys on acid-base balance, this approach gives us interesting insight. We should appropriately use this new approach to treat acid-base abnormality in critically ill patients. PMID:27319095

  14. Renal acid-base metabolism after ischemia.

    PubMed

    Holloway, J C; Phifer, T; Henderson, R; Welbourne, T C

    1986-05-01

    The response of the kidney to ischemia-induced cellular acidosis was followed over the immediate one hr post-ischemia reflow period. Clearance and extraction experiments as well as measurement of cortical intracellular pH (pHi) were performed on Inactin-anesthetized Sprague-Dawley rats. Arteriovenous concentration differences and para-aminohippurate extraction were obtained by cannulating the left renal vein. Base production was monitored as bicarbonate released into the renal vein and urine; net base production was related to the renal handling of glutamine and ammonia as well as to renal oxygen consumption and pHi. After a 15 min control period, the left renal artery was snared for one-half hr followed by release and four consecutive 15 min reflow periods. During the control period, cortical cell pHi measured by [14C]-5,5-Dimethyl-2,4-Oxazolidinedione distribution was 7.07 +/- 0.08, and Q-O2 was 14.1 +/- 2.2 micromoles/min; neither net glutamine utilization nor net bicarbonate generation occurred. After 30 min of ischemia, renal tissue pH fell to 6.6 +/- 0.15. However, within 45 min of reflow, cortical cell pH returned and exceeded the control value, 7.33 +/- 0.06 vs. 7.15 +/- 0.08. This increase in pHi was associated with a significant rise in cellular metabolic rate, Q-O2 increased to 20.3 +/- 6.4 micromoles/min. Corresponding with cellular alkalosis was a net production of bicarbonate and a net ammonia uptake and glutamine release; urinary acidification was abolished. These results are consistent with a nonexcretory renal metabolic base generating mechanism governing cellular acid base homeostasis following ischemia. PMID:3723929

  15. [Peripheral blood circulation in the skin and the regulatory mechanisms in the course of primary transmural myocardial infarction].

    PubMed

    Khalepo, O V; Molotkov, O V; Eshkina, S L

    2009-01-01

    Laser Doppler flowmetry was used to study the indicators characterizing the peripheral blood circulation in the skin, regulatory mechanisms, and the compensatory capacities of the microcirculatory bed in 32 patients aged 45-60 years in the course of primary transmural myocardial infarction during exercise tests. Significant disturbances of the mechanism responsible for regulating the peripheral blood circulation system and chiefly its active components were detected in the presence of adequate blood filling of microvessels. There was a drastic decrease in the reserves of skin microvascular endothelial activity during ionophoresis of sodium nitroprusside and acetylcholine, the maximum degree of disturbances being observed on day 10 of myocardial infarction development.

  16. Going Beyond, Going Further: The Preparation of Acid-Base Titration Curves.

    ERIC Educational Resources Information Center

    McClendon, Michael

    1984-01-01

    Background information, list of materials needed, and procedures used are provided for a simple technique for generating mechanically plotted acid-base titration curves. The method is suitable for second-year high school chemistry students. (JN)

  17. Regulatory T cells and dendritic cells in transplantation tolerance: molecular markers and mechanisms.

    PubMed

    Cobbold, Stephen P; Nolan, Kathleen F; Graca, Luis; Castejon, Raquel; Le Moine, Alain; Frewin, Mark; Humm, Susan; Adams, Elizabeth; Thompson, Sara; Zelenika, Diana; Paterson, Alison; Yates, Stephen; Fairchild, Paul J; Waldmann, Herman

    2003-12-01

    Transplantation tolerance can be induced in adult rodents using monoclonal antibodies against coreceptor or costimulation molecules on the surface of T cells. There are currently two well-characterized populations of T cells, demonstrating regulatory capacity: the "natural" CD4+CD25+ T cells and the interleukin (IL)-10-producing Tr1 cells. Although both types of regulatory T cells can induce transplantation tolerance under appropriate conditions, it is not clear whether either one plays any role in drug-induced dominant tolerance, primarily due to a lack of clear-cut molecular or functional markers. Similarly, although dendritic cells (DCs) can be pharmacologically manipulated to promote tolerance, the phenotype of such populations remains poorly defined. We have used serial analysis of gene expression (SAGE) with 29 different T-cell and antigen-presenting cell libraries to identify gene-expression signatures associated with immune regulation. We found that independently derived, regulatory Tr1-like clones were highly concordant in their patterns of gene expression but were quite distinct from CD4+CD25+ regulatory T cells from the spleen. DCs that were treated with the tolerance-enhancing agents IL-10 or vitamin D3 expressed a gene signature reflecting a functional specification in common with the most immature DCs derived from embryonic stem cells. PMID:14617201

  18. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms

    PubMed Central

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R

    2014-01-01

    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix. PMID:24988880

  19. Separation of Acids, Bases, and Neutral Compounds

    NASA Astrophysics Data System (ADS)

    Fujita, Megumi; Mah, Helen M.; Sgarbi, Paulo W. M.; Lall, Manjinder S.; Ly, Tai Wei; Browne, Lois M.

    2003-01-01

    Separation of Acids, Bases, and Neutral Compounds requires the following software, which is available for free download from the Internet: Netscape Navigator, version 4.75 or higher, or Microsoft Internet Explorer, version 5.0 or higher; Chime plug-in, version compatible with your OS and browser (available from MDL); and Flash player, version 5 or higher (available from Macromedia).

  20. Jigsaw Cooperative Learning: Acid-Base Theories

    ERIC Educational Resources Information Center

    Tarhan, Leman; Sesen, Burcin Acar

    2012-01-01

    This study focused on investigating the effectiveness of jigsaw cooperative learning instruction on first-year undergraduates' understanding of acid-base theories. Undergraduates' opinions about jigsaw cooperative learning instruction were also investigated. The participants of this study were 38 first-year undergraduates in chemistry education…

  1. The Magic Sign: Acids, Bases, and Indicators.

    ERIC Educational Resources Information Center

    Phillips, Donald B.

    1986-01-01

    Presents an approach that is used to introduce elementary and junior high students to a series of activities that will provide concrete experiences with acids, bases, and indicators. Provides instructions and listings of needed solutions and materials for developing this "magic sign" device. Includes background information and several student…

  2. De Novo Evolution of Complex, Global and Hierarchical Gene Regulatory Mechanisms

    PubMed Central

    Jenkins, Dafyd J.

    2010-01-01

    Gene regulatory networks exhibit complex, hierarchical features such as global regulation and network motifs. There is much debate about whether the evolutionary origins of such features are the results of adaptation, or the by-products of non-adaptive processes of DNA replication. The lack of availability of gene regulatory networks of ancestor species on evolutionary timescales makes this a particularly difficult problem to resolve. Digital organisms, however, can be used to provide a complete evolutionary record of lineages. We use a biologically realistic evolutionary model that includes gene expression, regulation, metabolism and biosynthesis, to investigate the evolution of complex function in gene regulatory networks. We discover that: (i) network architecture and complexity evolve in response to environmental complexity, (ii) global gene regulation is selected for in complex environments, (iii) complex, inter-connected, hierarchical structures evolve in stages, with energy regulation preceding stress responses, and stress responses preceding growth rate adaptations and (iv) robustness of evolved models to mutations depends on hierarchical level: energy regulation and stress responses tend not to be robust to mutations, whereas growth rate adaptations are more robust and non-lethal when mutated. These results highlight the adaptive and incremental evolution of complex biological networks, and the value and potential of studying realistic in silico evolutionary systems as a way of understanding living systems. Electronic supplementary material The online version of this article (doi:10.1007/s00239-010-9369-4) contains supplementary material, which is available to authorized users. PMID:20680619

  3. CHOOSING A CHEMICAL MECHANISM FOR REGULATORY AND RESEARCH AIR QUALITY MODELING APPLICATIONS

    EPA Science Inventory

    There are numerous, different chemical mechanisms currently available for use in air quality models, and new mechanisms and versions of mechanisms are continually being developed. The development of Morphecule-type mechanisms will add a near-infinite number of additional mecha...

  4. Probing the chemical mechanism and critical regulatory amino acid residues of Drosophila melanogaster arylalkylamine N-acyltransferase like 2.

    PubMed

    Dempsey, Daniel R; Carpenter, Anne-Marie; Ospina, Santiago Rodriguez; Merkler, David J

    2015-11-01

    Arylalkylamine N-acyltransferase like 2 (AANATL2) catalyzes the formation of N-acylarylalkylamides from the corresponding acyl-CoA and arylalkylamine. The N-acylation of biogenic amines in Drosophila melanogaster is a critical step for the inactivation of neurotransmitters, cuticle sclerotization, and melatonin biosynthesis. In addition, D. melanogaster has been used as a model system to evaluate the biosynthesis of fatty acid amides: a family of potent cell signaling lipids. We have previously showed that AANATL2 catalyzes the formation of N-acylarylakylamides, including long-chain N-acylserotonins and N-acyldopamines. Herein, we define the kinetic mechanism for AANATL2 as an ordered sequential mechanism with acetyl-CoA binding first followed by tyramine to generate the ternary complex prior to catalysis. Bell shaped kcat,app - acetyl-CoA and (kcat/Km)app - acetyl-CoA pH-rate profiles identified two apparent pKa,app values of ∼7.4 and ∼8.9 that are critical to catalysis, suggesting the AANATL2-catalyzed formation of N-acetyltyramine occurs through an acid/base chemical mechanism. Site-directed mutagenesis of a conserved glutamate that corresponds to the catalytic base for other D. melanogaster AANATL enzymes did not produce a substantial depression in the kcat,app value nor did it abolish the pKa,app value attributed to the general base in catalysis (pKa ∼7.4). These data suggest that AANATL2 catalyzes the formation of N-acylarylalkylamides using either different catalytic residues or a different chemical mechanism relative to other D. melanogaster AANATL enzymes. In addition, we constructed other site-directed mutants of AANATL2 to help define the role of targeted amino acids in substrate binding and/or enzyme catalysis.

  5. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands.

    PubMed

    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo

    2015-01-01

    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1.

  6. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp.

    PubMed

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-01-01

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5'-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism.

  7. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp

    PubMed Central

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-01-01

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5′-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism. PMID:26459861

  8. Identification of a regulatory loop for the synthesis of neurosteroids: a steroidogenic acute regulatory protein-dependent mechanism involving hypothalamic-pituitary-gonadal axis receptors.

    PubMed

    Meethal, Sivan Vadakkadath; Liu, Tianbing; Chan, Hsien W; Ginsburg, Erika; Wilson, Andrea C; Gray, Danielle N; Bowen, Richard L; Vonderhaar, Barbara K; Atwood, Craig S

    2009-08-01

    Brain sex steroids are derived from both peripheral (primarily gonadal) and local (neurosteroids) sources and are crucial for neurogenesis, neural differentiation and neural function. The mechanism(s) regulating the production of neurosteroids is not understood. To determine whether hypothalamic-pituitary-gonadal axis components previously detected in the extra-hypothalamic brain comprise a feedback loop to regulate neuro-sex steroid (NSS) production, we assessed dynamic changes in expression patterns of steroidogenic acute regulatory (StAR) protein, a key regulator of steroidogenesis, and key hypothalamic-pituitary-gonadal endocrine receptors, by modulating peripheral sex hormone levels in female mice. Ovariectomy (OVX; high serum gonadotropins, low serum sex steroids) had a differential effect on StAR protein levels in the extrahypothalamic brain; increasing the 30- and 32-kDa variants but decreasing the 37-kDa variant and is indicative of cholesterol transport into mitochondria for steroidogenesis. Treatment of OVX animals with E(2), P(4), or E(2) + P(4) for 3 days, which decreases OVX-induced increases in GnRH/gonadotropin production, reversed this pattern. Suppression of gonadotropin levels in OVX mice using the GnRH agonist leuprolide acetate inhibited the processing of the 37-kDa StAR protein into the 30-kDa StAR protein, confirming that the differential processing of brain StAR protein is regulated by gonadotropins. OVX dramatically suppressed extra-hypothalamic brain gonadotropin-releasing hormone 1 receptor expression, and was further suppressed in E(2)- or P(4)-treated OVX mice. Together, these data indicate the existence of endocrine and autocrine/paracrine feedback loops that regulate NSS synthesis. Further delineation of these feedback loops that regulate NSS production will aid in developing therapies to maintain brain sex steroid levels and cognition.

  9. Mosaic gene network modelling identified new regulatory mechanisms in HCV infection.

    PubMed

    Popik, Olga V; Petrovskiy, Evgeny D; Mishchenko, Elena L; Lavrik, Inna N; Ivanisenko, Vladimir A

    2016-06-15

    Modelling of gene networks is widely used in systems biology to study the functioning of complex biological systems. Most of the existing mathematical modelling techniques are useful for analysis of well-studied biological processes, for which information on rates of reactions is available. However, complex biological processes such as those determining the phenotypic traits of organisms or pathological disease processes, including pathogen-host interactions, involve complicated cross-talk between interacting networks. Furthermore, the intrinsic details of the interactions between these networks are often missing. In this study, we developed an approach, which we call mosaic network modelling, that allows the combination of independent mathematical models of gene regulatory networks and, thereby, description of complex biological systems. The advantage of this approach is that it allows us to generate the integrated model despite the fact that information on molecular interactions between parts of the model (so-called mosaic fragments) might be missing. To generate a mosaic mathematical model, we used control theory and mathematical models, written in the form of a system of ordinary differential equations (ODEs). In the present study, we investigated the efficiency of this method in modelling the dynamics of more than 10,000 simulated mosaic regulatory networks consisting of two pieces. Analysis revealed that this approach was highly efficient, as the mean deviation of the dynamics of mosaic network elements from the behaviour of the initial parts of the model was less than 10%. It turned out that for construction of the control functional, data on perturbation of one or two vertices of the mosaic piece are sufficient. Further, we used the developed method to construct a mosaic gene regulatory network including hepatitis C virus (HCV) as the first piece and the tumour necrosis factor (TNF)-induced apoptosis and NF-κB induction pathways as the second piece. Thus

  10. Mosaic gene network modelling identified new regulatory mechanisms in HCV infection.

    PubMed

    Popik, Olga V; Petrovskiy, Evgeny D; Mishchenko, Elena L; Lavrik, Inna N; Ivanisenko, Vladimir A

    2016-06-15

    Modelling of gene networks is widely used in systems biology to study the functioning of complex biological systems. Most of the existing mathematical modelling techniques are useful for analysis of well-studied biological processes, for which information on rates of reactions is available. However, complex biological processes such as those determining the phenotypic traits of organisms or pathological disease processes, including pathogen-host interactions, involve complicated cross-talk between interacting networks. Furthermore, the intrinsic details of the interactions between these networks are often missing. In this study, we developed an approach, which we call mosaic network modelling, that allows the combination of independent mathematical models of gene regulatory networks and, thereby, description of complex biological systems. The advantage of this approach is that it allows us to generate the integrated model despite the fact that information on molecular interactions between parts of the model (so-called mosaic fragments) might be missing. To generate a mosaic mathematical model, we used control theory and mathematical models, written in the form of a system of ordinary differential equations (ODEs). In the present study, we investigated the efficiency of this method in modelling the dynamics of more than 10,000 simulated mosaic regulatory networks consisting of two pieces. Analysis revealed that this approach was highly efficient, as the mean deviation of the dynamics of mosaic network elements from the behaviour of the initial parts of the model was less than 10%. It turned out that for construction of the control functional, data on perturbation of one or two vertices of the mosaic piece are sufficient. Further, we used the developed method to construct a mosaic gene regulatory network including hepatitis C virus (HCV) as the first piece and the tumour necrosis factor (TNF)-induced apoptosis and NF-κB induction pathways as the second piece. Thus

  11. Nicotiana tabacum protoplasts secretome can evidence relations among regulatory elements of exocytosis mechanisms.

    PubMed

    Ul-Rehman, Reiaz; Rinalducci, Sara; Zolla, Lello; Dalessandro, Giuseppe; Di Sansebastiano, Gian Pietro

    2011-08-01

    An alternative study involving proteome analysis of the 24 hour Nicotiana tabacum protoplast culture medium was performed with the aim to confirm relations among regulatory elements of exocytotic processes. Protoplasts present many convenient features to study cellular processes during transient over-expression or suppression of specific gene's products. We performed a proteomic analysis of the culture medium fraction of protoplasts transiently expressing transgenes for 24 hours to characterize the effect of various regulatory proteins dominant negative mutants. A total number of 49 spots were found reproducible in the medium. 24 of these spots were identified with nano RP-HPLC-ESI-MS/MS. Only three and six spots were respectively identified as canonical and non-canonical secreted cell wall proteins. The low number of spots present in the culture medium fraction allowed us the ambitious experiment to analyze the influence of various SNAREs (SYP121, SYP122, SNAP33) and Rab (Rab11) dominant negative mutants. Missing a reasonable number of identified proteins the analyses gave rise to a similarity matrix statistically analyzed considering variation within the presence of 24 spots reproducible in presence of transient over-expression of SNAREs (SYP121 and SYP122) and Rab11 native cDNAs. The similarity confirmed the closer relation between the function of SYP122 and Rab11 as evidenced by the secRGUS based analysis. This analysis included the effect of SNAP33 DN mutant and showed that this Qb-c-SNARE influence both SYP121 and SYP122 SNARE complexes.

  12. High-precision, in vitro validation of the sequestration mechanism for generating ultrasensitive dose-response curves in regulatory networks.

    PubMed

    Ricci, Francesco; Vallée-Bélisle, Alexis; Plaxco, Kevin W

    2011-10-01

    Our ability to recreate complex biochemical mechanisms in designed, artificial systems provides a stringent test of our understanding of these mechanisms and opens the door to their exploitation in artificial biotechnologies. Motivated by this philosophy, here we have recapitulated in vitro the "target sequestration" mechanism used by nature to improve the sensitivity (the steepness of the input/output curve) of many regulatory cascades. Specifically, we have employed molecular beacons, a commonly employed optical DNA sensor, to recreate the sequestration mechanism and performed an exhaustive, quantitative study of its key determinants (e.g., the relative concentrations and affinities of probe and depletant). We show that, using sequestration, we can narrow the pseudo-linear range of a traditional molecular beacon from 81-fold (i.e., the transition from 10% to 90% target occupancy spans an 81-fold change in target concentration) to just 1.5-fold. This narrowing of the dynamic range improves the sensitivity of molecular beacons to that equivalent of an oligomeric, allosteric receptor with a Hill coefficient greater than 9. Following this we have adapted the sequestration mechanism to steepen the binding-site occupancy curve of a common transcription factor by an order of magnitude over the sensitivity observed in the absence of sequestration. Given the success with which the sequestration mechanism has been employed by nature, we believe that this strategy could dramatically improve the performance of synthetic biological systems and artificial biosensors.

  13. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  14. Transcriptional regulatory network triggered by oxidative signals configures the early response mechanisms of japonica rice to chilling stress

    PubMed Central

    2010-01-01

    Background The transcriptional regulatory network involved in low temperature response leading to acclimation has been established in Arabidopsis. In japonica rice, which can only withstand transient exposure to milder cold stress (10°C), an oxidative-mediated network has been proposed to play a key role in configuring early responses and short-term defenses. The components, hierarchical organization and physiological consequences of this network were further dissected by a systems-level approach. Results Regulatory clusters responding directly to oxidative signals were prominent during the initial 6 to 12 hours at 10°C. Early events mirrored a typical oxidative response based on striking similarities of the transcriptome to disease, elicitor and wounding induced processes. Targets of oxidative-mediated mechanisms are likely regulated by several classes of bZIP factors acting on as1/ocs/TGA-like element enriched clusters, ERF factors acting on GCC-box/JAre-like element enriched clusters and R2R3-MYB factors acting on MYB2-like element enriched clusters. Temporal induction of several H2O2-induced bZIP, ERF and MYB genes coincided with the transient H2O2 spikes within the initial 6 to 12 hours. Oxidative-independent responses involve DREB/CBF, RAP2 and RAV1 factors acting on DRE/CRT/rav1-like enriched clusters and bZIP factors acting on ABRE-like enriched clusters. Oxidative-mediated clusters were activated earlier than ABA-mediated clusters. Conclusion Genome-wide, physiological and whole-plant level analyses established a holistic view of chilling stress response mechanism of japonica rice. Early response regulatory network triggered by oxidative signals is critical for prolonged survival under sub-optimal temperature. Integration of stress and developmental responses leads to modulated growth and vigor maintenance contributing to a delay of plastic injuries. PMID:20100339

  15. A meta-analysis of caloric restriction gene expression profiles to infer common signatures and regulatory mechanisms.

    PubMed

    Plank, Michael; Wuttke, Daniel; van Dam, Sipko; Clarke, Susan A; de Magalhães, João Pedro

    2012-04-01

    Caloric restriction, a reduction in calorie intake without malnutrition, retards age-related degeneration and extends lifespan in several organisms. CR induces multiple changes, yet its underlying mechanisms remain poorly understood. In this work, we first performed a meta-analysis of microarray CR studies in mammals and identified genes and processes robustly altered due to CR. Our results reveal a complex array of CR-induced changes and we re-identified several genes and processes previously associated with CR, such as growth hormone signalling, lipid metabolism and immune response. Moreover, our results highlight novel associations with CR, such as retinol metabolism and copper ion detoxification, as well as hint of a strong effect of CR on circadian rhythms that in turn may contribute to metabolic changes. Analyses of our signatures by integrating co-expression data, information on genetic mutants, and transcription factor binding site analysis revealed candidate regulators of transcriptional modules in CR. Our results hint at a transcriptional module involved in sterol metabolism regulated by Srebf1. A putative regulatory role of Ppara was also identified. Overall, our conserved molecular signatures of CR provide a comprehensive picture of CR-induced changes and help understand its regulatory mechanisms.

  16. Antigen-specific expansion of human regulatory T cells as a major tolerance mechanism against mucosal fungi.

    PubMed

    Bacher, P; Kniemeyer, O; Schönbrunn, A; Sawitzki, B; Assenmacher, M; Rietschel, E; Steinbach, A; Cornely, O A; Brakhage, A A; Thiel, A; Scheffold, A

    2014-07-01

    Foxp3(+) regulatory T cells (Treg) have a central role for keeping the balance between pro- and anti-inflammatory immune responses against chronically encountered antigens at mucosal sites. However, their antigen specificity especially in humans is largely unknown. Here we used a sensitive enrichment technology for antigen-reactive T cells to directly compare the conventional vs. regulatory CD4(+) T-cell response directed against two ubiquitous mucosal fungi, Aspergillus fumigatus and Candida albicans. In healthy humans, fungus-specific CD4(+)CD25(+)CD127(-)Foxp3(+) Treg are strongly expanded in peripheral blood and possess phenotypic, epigenetic and functional features of thymus-derived Treg. Intriguingly, for A. fumigatus, the strong Treg response contrasts with minimal conventional T-cell memory, indicating selective Treg expansion as an effective mechanism to prevent inappropriate immune activation in healthy individuals. By contrast, in subjects with A. fumigatus allergies, specific Th2 cells were strongly expanded despite the presence of specific Treg. Taken together, we demonstrate a largely expanded Treg population specific for mucosal fungi as part of the physiological human T-cell repertoire and identify a unique capacity of A. fumigatus to selectively generate Treg responses as a potentially important mechanism for the prevention of allergic reactions.

  17. Evolution of chorion structural genes and regulatory mechanisms in two wild silkmoths: a preliminary analysis.

    PubMed

    Moschonas, N K; Thireos, G; Kafatos, F C

    1988-01-01

    We report a preliminary analysis of structural and regulatory evolution of the A and B chorion gene families in two wild silkmoths, Antheraea pernyi and Antheraea polyphemus. Homospecific and heterospecific dot hybridizations were performed between previously characterized A. polyphemus complementary DNA clones and total or stage-specific follicular mRNAs from the two species. The hybridization patterns indicated substantial interspecies changes in the abundance of corresponding mRNA sequences (heteroposic evolution) without substantial changes in their developmental specificities (heterochronic evolution). In addition, the proteins encoded in the two species by corresponding mRNAs were determined by hybrid-selected translation followed by electrophoretic analysis. The results suggested that the proteins evolve in size, presumably through internal deletions and duplications.

  18. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis.

    PubMed

    Jones, Danielle M; Murray, Christian M; Ketelaar, KassaDee J; Thomas, Joseph J; Villalobos, Jose A; Wallace, Ian S

    2016-01-01

    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  19. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis

    PubMed Central

    Jones, Danielle M.; Murray, Christian M.; Ketelaar, KassaDee J.; Thomas, Joseph J.; Villalobos, Jose A.; Wallace, Ian S.

    2016-01-01

    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  20. Acid-base disorders in calves with chronic diarrhea.

    PubMed

    Bednarski, M; Kupczyński, R; Sobiech, P

    2015-01-01

    The aim of this study was to analyze disorders of acid-base balance in calves with chronic diarrhea caused by mixed, viral, bacterial and Cryptosporydium parvum infection. We compared results ob- tained with the classic model (Henderson-Hasselbalch) and strong ion approach (the Steward model). The study included 36 calves aged between 14 and 21 days. The calves were allocated to three groups: I - (control) non-diarrheic calves, group II - animals with compensated acid-base imbalance and group III calves with compensated acid-base disorders and hypoalbuminemia. Plasma concentrations of Na+, K+, Cl-, C12+, Mg2+, P, albumin and lactate were measured. In the classic model, acid-base balance was determined on the basis of blood pH, pCO2, HCO3-, BE and anion gap. In the strong ion model, strong ion difference (SID), effective strong anion difference, total plasma concentration of nonvolatile buffers (A(Tot)) and strong ion gap (SIG) were measured. The control calves and the animals from groups II and III did not differ significantly in terms of their blood pH. The plasma concentration of HCO3-, BE and partial pressure of CO2 in animals from the two groups with chronic diarrhea were significantly higher than those found in the controls. The highest BE (6.03 mmol/l) was documented in calves from group II. The animals from this group presented compensation resulted from activation of metabolic mechanisms. The calves with hypoal- buminemia (group III) showed lower plasma concentrations of albumin (15.37 g/L), Cl (74.94 mmol/L), Mg2+ (0.53 mmol/L), P (1.41 mmol/L) and higher value of anion gap (39.03 mmol/L). This group III presented significantly higher SID3 (71.89 mmol/L), SID7 (72.92 mmol/L) and SIG (43.53 mmol/L) values than animals from the remaining groups (P < 0.01), whereas A(Tot) (6.82 mmol/L) were significantly lower. The main finding of the correlation study was the excellent relationship between the AGcorr and SID3, SID7, SIG. In conclusion, chronic diarrhea leads

  1. Control of hepatic nitrogen metabolism and glutathione release by cell volume regulatory mechanisms.

    PubMed

    Hüssinger, D; Lang, F; Bauers, K; Gerok, W

    1990-11-13

    1. Urea synthesis was studied in isolated perfused rat liver during cell volume regulatory ion fluxes following exposure of the liver to anisotonic perfusion media. Lowering of the osmolarity in influent perfusate from 305 mOsm/l to 225 mOsm/l (by decreasing influent [NaCl] by 40 mmol/l) led to an inhibition of urea synthesis from NH4Cl (0.5 mmol/l) by about 60% and a decrease of hepatic oxygen uptake by 0.43 +/- 0.03 mumol g-1 min-1 [from 3.09 +/- 0.13 mumol g-1 min-1 to 2.66 +/- 0.12 mumol g-1 min-1 (n = 9)]. The effects on urea synthesis and oxygen uptake were observed throughout hypotonic exposure (225 mOsm/l). They persisted although volume regulatory K+ efflux from the liver was complete within 8 min and were fully reversible upon reexposure to normotonic perfusion media (305 mOsm/l). A 42% inhibition of urea synthesis from NH4Cl (0.5 mmol/l) during hypotonicity was also observed when the perfusion medium was supplemented with glucose (5 mmol/l). Urea synthesis was inhibited by only 10-20% in livers from fed rats, and was even stimulated in those from starved rats when an amino acid mixture (twice the physiological concentration) plus NH4Cl (0.2 mmol/l) was infused. 2. The inhibition of urea synthesis from NH4Cl (0.5 mmol/l) during hypotonicity was accompanied by a threefold increase of citrulline tissue levels, a 50-70% decrease of the tissue contents of glutamate, aspartate, citrate and malate, whereas 2-oxoglutarate, ATP and ornithine tissue levels, and the [3H]inulin extracellular space remained almost unaltered. Further, hypotonic exposure stimulated hepatic glutathione (GSH) release with a time course roughly paralleling volume regulatory K+ efflux. NH4Cl stimulated lactate release from the liver during hypotonic but not during normotonic perfusion. In the absence of NH4Cl, hypotonicity did not significantly affect the lactate/pyruvate ratio in effluent perfusate. With NH4Cl (0.5 mmol/l) present, the lactate/pyruvate ratio increased from 4.3 to 8.2 in

  2. Regulatory mechanisms of ethylene biosynthesis in response to various stimuli during maturation and ripening in fig fruit (Ficus carica L.).

    PubMed

    Owino, W O; Manabe, Y; Mathooko, F M; Kubo, Y; Inaba, A

    2006-01-01

    In order to obtain a greater uniformity of maturation, the growth of the fig fruit (Ficus carica L.) can be stimulated by the application of either olive oil, ethrel/ethephon or auxin. The three treatments induce ethylene production in figs. In this study, we investigated the regulatory mechanisms responsible for oil, auxin and ethylene induced ethylene production in figs. The ethylene production in response to olive oil, auxin, and propylene treatments and during ripening were all induced by 1-methylcyclopropene (1-MCP) and inhibited by propylene indicating a negative feedback regulation mechanism. Three 1-aminocyclopropane-1-carboxylic acid (ACC) synthase genes (Fc-ACS1, Fc-ACS2 and Fc-ACS3) and one ACC oxidase gene (Fc-ACO1) were isolated and their expression patterns in response to either oil, propylene or auxin treatment in figs determined. The expression patterns of Fc-ACS1 and Fc-ACO1 were clearly inhibited by 1-MCP and induced by propylene in oil treated and ripe fruits indicating positive regulation by ethylene, whereas Fc-ACS2 gene expression was induced by 1-MCP and inhibited by propylene indicating negative regulation by ethylene. The Fc-ACS3 mRNA showed high level accumulation in the auxin treated fruit. The inhibition of Fc-ACS3 gene by 1-MCP in oil treated and in ripe fruits suggests that auxin and ethylene modulate the expression of this gene by multi-responsive signal transduction pathway mechanisms. We further report that the olive oil-induced ethylene in figs involves the ACC-dependent pathway and that multiple ethylene regulatory pathways are involved during maturation and ripening in figs and each specific pathway depends on the inducer/stimulus. PMID:16889975

  3. The effect of callosotomy on testicular steroidogenesis in hemiorchidectomized rats: a pituitary-independent regulatory mechanism.

    PubMed

    Banczerowski, P; Csaba, Z; Csernus, V; Gerendai, I

    2000-09-15

    In recent years, increasing number of data indicate that cerebral structures exert a direct, pituitary-independent, neural regulatory action on the endocrine glands. In addition, both experimental and clinical observations indicate functional asymmetry of the control system. Therefore, the objective of the present study was to study the effect of callosotomy on testicular steroidogenesis and serum gonadotrop concentrations in rats subjected to left- or right-sided orchidectomy. In animals underwent callosotomy plus left-sided orchidectomy the basal testosterone secretion in vitro of the remaining (right) testis was significantly higher than that of intact controls, and of rats subjected to sham surgery plus left orchidectomy. In contrast, either sham operation or callosotomy plus right-sided orchidectomy did not interfere with testicular steroidogenesis. Sham surgery or callosotomy plus left orchidectomy induced a significant rise in serum follicle-stimulating hormone concentration while right orchidectomy combined either with sham surgery or callosotomy did not alter this parameter. There was no statistically significant difference between experimental groups in serum testosterone and luteinizing hormone concentrations. The results indicate the involvement of the corpus callosum in a pituitary-independent neural control of testicular steroidogenesis. The data further suggest a different response in steroidogenesis of the left and the right testis following hemicastration and callosotomy. PMID:11044600

  4. Transcriptome analysis reveals novel regulatory mechanisms in a genome-reduced bacterium

    PubMed Central

    Mazin, Pavel V.; Fisunov, Gleb Y.; Gorbachev, Alexey Y.; Kapitskaya, Kristina Y.; Altukhov, Ilya A.; Semashko, Tatiana A.; Alexeev, Dmitry G.; Govorun, Vadim M.

    2014-01-01

    The avian bacterial pathogen Mycoplasma gallisepticum is a good model for systems studies due to small genome and simplicity of regulatory pathways. In this study, we used RNA-Seq and MS-based proteomics to accurately map coding sequences, transcription start sites (TSSs) and transcript 3′-ends (T3Es). We used obtained data to investigate roles of TSSs and T3Es in stress-induced transcriptional responses. We identified 1061 TSSs at a false discovery rate of 10% and showed that almost all transcription in M. gallisepticum is initiated from classic TATAAT promoters surrounded by A/T-rich sequences. Our analysis revealed the pronounced operon structure complexity: on average, each coding operon has one internal TSS and T3Es in addition to the primary ones. Our transcriptomic approach based on the intervals between the two nearest transcript ends allowed us to identify two classes of T3Es: strong, unregulated, hairpin-containing T3Es and weak, heat shock-regulated, hairpinless T3Es. Comparing gene expression levels under different conditions revealed widespread and divergent transcription regulation in M. gallisepticum. Modeling suggested that the core promoter structure plays an important role in gene expression regulation. We have shown that the heat stress activation of cryptic promoters combined with the hairpinless T3Es suppression leads to widespread, seemingly non-functional transcription. PMID:25361977

  5. Effects of radiation on T regulatory cells in normal states and cancer: mechanisms and clinical implications.

    PubMed

    Liu, Shu; Sun, Xiangdong; Luo, Jinhua; Zhu, Hongcheng; Yang, Xi; Guo, Qing; Song, Yaqi; Sun, Xinchen

    2015-01-01

    Radiation remains an important component of cancer treatment. In addition to inducing tumor cell death through direct cytotoxic effects, radiation can also promote the regression of tumor via augment of immune response. Regulatory T cells (Tregs) are a unique subpopulation of CD4 positive cells, which are characterized by expression of the forkhead box P3 (Foxp3) transcription factor and high levels of CD25. Mounting evidence has shown that Tregs are implicated in the development and progression of various types of cancer, which makes Tregs an important target in cancer therapeutics. Generally, lymphocytes are regarded as radiosensitive. However, Tregs have been demonstrated to be relatively resistant to radiotherapy, which is partly mediated by downregulation of pro-apoptotic proteins and upregulation of anti-apoptotic proteins. Moreover, radiotherapy can increase the production of Tregs and the recruitment of Tregs to local tumor microenvironment. Tregs can attenuate radiation-induced tumor death, which cause the resistance of tumor to radiotherapy. Recent experimental studies and clinical trails have demonstrated that the combination of radiation with medications that target Tregs is promising in the treatment of several types of neoplasms. In this review, we discussed the effect of radiation on Tregs in physiological states and cancer. Further, we presented an overview of therapies that target Tregs to enhance the efficacy of radiation in cancer therapeutics. PMID:26807310

  6. Pyruvate dehydrogenase kinase regulatory mechanisms and inhibition in treating diabetes, heart ischemia, and cancer.

    PubMed

    Roche, T E; Hiromasa, Y

    2007-04-01

    The fraction of pyruvate dehydrogenase complex (PDC) in the active form is reduced by the activities of dedicated PD kinase isozymes (PDK1, PDK2, PDK3 and PDK4). Via binding to the inner lipoyl domain (L2) of the dihydrolipoyl acetyltransferase (E2 60mer), PDK rapidly access their E2-bound PD substrate. The E2-enhanced activity of the widely distributed PDK2 is limited by dissociation of ADP from its C-terminal catalytic domain, and this is further slowed by pyruvate binding to the N-terminal regulatory (R) domain. Via the reverse of the PDC reaction, NADH and acetyl-CoA reductively acetylate lipoyl group of L2, which binds to the R domain and stimulates PDK2 activity by speeding up ADP dissociation. Activation of PDC by synthetic PDK inhibitors binding at the pyruvate or lipoyl binding sites decreased damage during heart ischemia and lowered blood glucose in insulin-resistant animals. PDC activation also triggers apoptosis in cancer cells that selectively convert glucose to lactate. PMID:17310282

  7. Immunomodulation of mesenchymal stromal cells on regulatory T cells and its possible mechanism.

    PubMed

    Yan, Zhidong; Zhuansun, Yongxun; Chen, Rui; Li, Jianguo; Ran, Pixin

    2014-05-15

    Mesenchymal stromal cells (MSCs) and regulatory T cells (Tregs) have both garnered abundant interests from immunologists worldwide, as both MSCs and Tregs can be considered immunosuppressive in their own right. But a little attention has been paid to the impacts of MSCs on Tregs. To clarify the effects of MSCs on Tregs, we performed the coculture systems within MSCs and Tregs. We confirmed that MSC-exposed Tregs are capable of more immunosuppressive than Tregs without coculturing with MSCs. And this augmenting suppressive capacity was accompanied with an upregulation of programmed cell death 1 receptor (PD-1) on Tregs. Importantly, we found that cell viability of Tregs was excluded from the influences of MSCs. Finally, we showed that PD-1/B7-H1 interactions and IL-10 might be responsible for the enhanced suppressive capability of MSC-exposed Tregs. Further analysis revealed that PD-1/B7-H1 interactions were not responsible for the productions of IL-10 and TGF-β1 in the MSC-Treg coculture systems; in contrast, IL-10 rather than TGF-β1 played a role in the upregualtion of PD-1. Furthermore, this is the first explorative study to evaluate the immunomodulation of MSCs on the suppressive capacity of Tregs in MSC-Treg in vitro coculture setting.

  8. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues

    PubMed Central

    Suzuki, Takashi; Swift, Larry L.

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5′-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5′-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  9. Structure of the Yeast Polarity Protein Sro7 Reveals a SNARE Regulatory Mechanism

    SciTech Connect

    Hattendorf, D.A.; Andreeva, A.; Gangar, A.; Brennwald, P.J.; Weis, W.I.; /Stanford U., Med. School /North Carolina U.

    2007-07-09

    Polarized exocytosis requires coordination between the actin cytoskeleton and the exocytic machinery responsible for fusion of secretory vesicles at specific sites on the plasma membrane. Fusion requires formation of a complex between a vesicle-bound R-SNARE and plasma membrane Qa, Qb and Qc SNARE proteins. Proteins in the lethal giant larvae protein family, including lethal giant larvae and tomosyn in metazoans and Sro7 in yeast, interact with Q-SNAREs and are emerging as key regulators of polarized exocytosis. The crystal structure of Sro7 reveals two seven-bladed WD40 {beta}-propellers followed by a 60-residue-long 'tail', which is bound to the surface of the amino-terminal propeller. Deletion of the Sro7 tail enables binding to the Qbc SNARE region of Sec9 and this interaction inhibits SNARE complex assembly. The N-terminal domain of Sec9 provides a second, high-affinity Sro7 interaction that is unaffected by the tail. The results suggest that Sro7 acts as an allosteric regulator of exocytosis through interactions with factors that control the tail. Sequence alignments indicate that lethal giant larvae and tomosyn have a two-{beta}-propeller fold similar to that of Sro7, but only tomosyn appears to retain the regulatory tail.

  10. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues.

    PubMed

    Suzuki, Takashi; Swift, Larry L

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5'-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5'-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  11. Regulatory Light Chain Mutations Associated with Cardiomyopathy Affect Myosin Mechanics and Kinetics

    PubMed Central

    Greenberg, Michael J.; Watt, James D.; Jones, Michelle; Kazmierczak, Katarzyna; Szczesna-Cordary, Danuta; Moore, Jeffrey R.

    2009-01-01

    The myosin regulatory light chain (RLC) wraps around the alpha helical neck region of myosin. This neck region has been proposed to act as a lever arm, amplifying small conformational changes in the myosin head to generate motion. The RLC serves an important structural role, supporting the myosin neck region and a modulatory role, tuning the kinetics of the actin myosin interaction. Given the importance of the RLC, it is not surprising that mutations of the RLC can lead to familial hypertrophic cardiomyopathy (FHC), the leading cause of sudden cardiac death in people under 30. Population studies identified two FHC mutations located near the cationic binding site of the RLC, R58Q and N47K. Although these mutations are close in sequence, they differ in clinical presentation and prognosis with R58Q showing a more severe phenotype. We examined the molecular based changes in myosin that are responsible for the disease phenotype by purifying myosin from transgenic mouse hearts expressing mutant myosins and examining actin filament sliding using the in vitro motility assay. We found that both R58Q and N47K showed reductions in force compared to the wild type that could result in compensatory hypertrophy. Furthermore, we observed a higher ATPase rate and an increased activation at submaximal calcium levels for the R58Q myosin that could lead to decreased efficiency and incomplete cardiac relaxation, potentially explaining the more severe phenotype for the R58Q mutation. PMID:18929571

  12. On multiple regulatory mechanisms in the tryptophan operon system in Escherichia coli: in silico study of perturbation dynamics.

    PubMed

    Nguyen, Lan K; Kulasiri, Don

    2008-01-01

    Living organisms often exist in uncertain environments where changes are the norm. Cellular systems therefore require resilient regulatory mechanisms for timely and stable adaptation. Among various regulation motifs, multiple feedback control emerges as a common theme. The tryptophan operon system in Escherichia coli regulates the production ofintracellular tryptophan using an apparatus of three feedback mechanisms: repression, attenuation and enzyme inhibition; each provides essentially the same function but operates in distinctly different ways. Here we aim to understand the roles of each loop by studying transient dynamics of the system to perturbations of different types; to reveal the underlying relationships between individual control mechanisms and macroscopic behaviour. We develop an S-systems approximation of an existing model for the system and characterise transient dynamics by introducing two measurable quantities: maximum disturbance (MD) and recovery time (RT). Our simulation results showed that combined regulation using all three feedback mechanisms significantly increases system stability, broadening the range of kinetic parameters for stable behaviour. Enzyme inhibition was shown to directly control the disturbance level in system variables after perturbations. Attenuation, on the other hand, was found to speed up system recovery whereas repression lengthens recovery time. The method developed in this paper and the defined transient dynamics measurements can be applied to other cellular systems. PMID:19374133

  13. Mathematical modeling of acid-base physiology

    PubMed Central

    Occhipinti, Rossana; Boron, Walter F.

    2015-01-01

    pH is one of the most important parameters in life, influencing virtually every biological process at the cellular, tissue, and whole-body level. Thus, for cells, it is critical to regulate intracellular pH (pHi) and, for multicellular organisms, to regulate extracellular pH (pHo). pHi regulation depends on the opposing actions of plasma-membrane transporters that tend to increase pHi, and others that tend to decrease pHi. In addition, passive fluxes of uncharged species (e.g., CO2, NH3) and charged species (e.g., HCO3− , NH4+) perturb pHi. These movements not only influence one another, but also perturb the equilibria of a multitude of intracellular and extracellular buffers. Thus, even at the level of a single cell, perturbations in acid-base reactions, diffusion, and transport are so complex that it is impossible to understand them without a quantitative model. Here we summarize some mathematical models developed to shed light onto the complex interconnected events triggered by acids-base movements. We then describe a mathematical model of a spherical cell–which to our knowledge is the first one capable of handling a multitude of buffer reaction–that our team has recently developed to simulate changes in pHi and pHo caused by movements of acid-base equivalents across the plasma membrane of a Xenopus oocyte. Finally, we extend our work to a consideration of the effects of simultaneous CO2 and HCO3− influx into a cell, and envision how future models might extend to other cell types (e.g., erythrocytes) or tissues (e.g., renal proximal-tubule epithelium) important for whole-body pH homeostasis. PMID:25617697

  14. Mathematical modeling of acid-base physiology.

    PubMed

    Occhipinti, Rossana; Boron, Walter F

    2015-01-01

    pH is one of the most important parameters in life, influencing virtually every biological process at the cellular, tissue, and whole-body level. Thus, for cells, it is critical to regulate intracellular pH (pHi) and, for multicellular organisms, to regulate extracellular pH (pHo). pHi regulation depends on the opposing actions of plasma-membrane transporters that tend to increase pHi, and others that tend to decrease pHi. In addition, passive fluxes of uncharged species (e.g., CO2, NH3) and charged species (e.g., HCO3(-), [Formula: see text] ) perturb pHi. These movements not only influence one another, but also perturb the equilibria of a multitude of intracellular and extracellular buffers. Thus, even at the level of a single cell, perturbations in acid-base reactions, diffusion, and transport are so complex that it is impossible to understand them without a quantitative model. Here we summarize some mathematical models developed to shed light onto the complex interconnected events triggered by acids-base movements. We then describe a mathematical model of a spherical cells-which to our knowledge is the first one capable of handling a multitude of buffer reactions-that our team has recently developed to simulate changes in pHi and pHo caused by movements of acid-base equivalents across the plasma membrane of a Xenopus oocyte. Finally, we extend our work to a consideration of the effects of simultaneous CO2 and HCO3(-) influx into a cell, and envision how future models might extend to other cell types (e.g., erythrocytes) or tissues (e.g., renal proximal-tubule epithelium) important for whole-body pH homeostasis.

  15. Analysis of microRNA and Gene Expression Profiles in Multiple Sclerosis: Integrating Interaction Data to Uncover Regulatory Mechanisms

    PubMed Central

    Freiesleben, Sherry; Hecker, Michael; Zettl, Uwe Klaus; Fuellen, Georg; Taher, Leila

    2016-01-01

    MicroRNAs (miRNAs) have been reported to contribute to the pathophysiology of multiple sclerosis (MS), an inflammatory disorder of the central nervous system. Here, we propose a new consensus-based strategy to analyse and integrate miRNA and gene expression data in MS as well as other publically available data to gain a deeper understanding of the role of miRNAs in MS and to overcome the challenges posed by studies with limited patient sample sizes. We processed and analysed microarray datasets, and compared the expression of genes and miRNAs in the blood of MS patients and controls. We then used our consensus and integration approach to construct two molecular networks dysregulated in MS: a miRNA- and a gene-based network. We identified 18 differentially expressed (DE) miRNAs and 128 DE genes that may contribute to the regulatory alterations behind MS. The miRNAs were linked to immunological and neurological pathways, and we exposed let-7b-5p and miR-345-5p as promising blood-derived disease biomarkers in MS. The results suggest that DE miRNAs are more informative than DE genes in uncovering pathways potentially involved in MS. Our findings provide novel insights into the regulatory mechanisms and networks underlying MS. PMID:27694855

  16. Catalytic control in the EGF Receptor and its connection to general kinase regulatory mechanisms

    PubMed Central

    Jura, Natalia; Zhang, Xuewu; Endres, Nicholas F.; Seeliger, Markus A.; Schindler, Thomas; Kuriyan, John

    2011-01-01

    Summary In contrast to the active conformations of protein kinases, which are essentially the same for all kinases, inactive kinase conformations are structurally diverse. Some inactive conformations are, however, observed repeatedly in different kinases, perhaps reflecting an important role in catalysis. In this review, we analyze one of these recurring conformations, first identified in CDK and Src kinases, which turned out to be central to understanding of how kinase domain of the EGF receptor is activated. This mechanism, which involves the stabilization of the active conformation of an α helix, has features in common with mechanisms operative in several other kinases. PMID:21474065

  17. Regulatory mechanisms differ in UMP kinases from gram-negative and gram-positive bacteria.

    PubMed

    Evrin, Cécile; Straut, Monica; Slavova-Azmanova, Neli; Bucurenci, Nadia; Onu, Adrian; Assairi, Liliane; Ionescu, Mihaela; Palibroda, Nicolae; Bârzu, Octavian; Gilles, Anne-Marie

    2007-03-01

    In this work, we examined the regulation by GTP and UTP of the UMP kinases from eight bacterial species. The enzyme from Gram-positive organisms exhibited cooperative kinetics with ATP as substrate. GTP decreased this cooperativity and increased the affinity for ATP. UTP had the opposite effect, as it decreased the enzyme affinity for ATP. The nucleotide analogs 5-bromo-UTP and 5-iodo-UTP were 5-10 times stronger inhibitors than the parent compound. On the other hand, UMP kinases from the Gram-negative organisms did not show cooperativity in substrate binding and catalysis. Activation by GTP resulted mainly from the reversal of inhibition caused by excess UMP, and inhibition by UTP was accompanied by a strong increase in the apparent K(m) for UMP. Altogether, these results indicate that, depending on the bacteria considered, GTP and UTP interact with different enzyme recognition sites. In Gram-positive bacteria, GTP and UTP bind to a single site or largely overlapping sites, shifting the T R equilibrium to either the R or T form, a scenario corresponding to almost all regulatory proteins, commonly called K systems. In Gram-negative organisms, the GTP-binding site corresponds to the unique allosteric site of the Gram-positive bacteria. In contrast, UTP interacts cooperatively with a site that overlaps the catalytic center, i.e. the UMP-binding site and part of the ATP-binding site. These characteristics make UTP an original regulator of UMP kinases from Gram-negative organisms, beyond the common scheme of allosteric control.

  18. TGF-β-Induced Regulatory T Cells Directly Suppress B Cell Responses through a Noncytotoxic Mechanism.

    PubMed

    Xu, Anping; Liu, Ya; Chen, Weiqian; Wang, Julie; Xue, Youqiu; Huang, Feng; Rong, Liming; Lin, Jin; Liu, Dahai; Yan, Mei; Li, Quan-Zhen; Li, Bin; Song, Jianxun; Olsen, Nancy; Zheng, Song Guo

    2016-05-01

    Foxp3(+) regulatory T cells (Treg) playing a crucial role in the maintenance of immune tolerance and prevention of autoimmune diseases consist of thymus-derived naturally occurring CD4(+)Foxp3(+) Treg cells (nTreg) and those that can be induced ex vivo with TGF-β (iTreg). Although both Treg subsets share similar phenotypes and functional characteristics, they also have potential biologic differences on their biology. The role of iTreg in regulating B cells remains unclear so far. The suppression assays of Treg subsets on activation, proliferation, and Abs production of B cells were measured using a Treg and B cell coculture system in vitro. Transwell and Ab blockade experiments were performed to assess the roles of cell contact and soluble cytokines. Treg were adoptively transferred to lupus mice to assess in vivo effects on B cells. Like nTreg, iTreg subset also directly suppressed activation and proliferation of B cells. nTreg subset suppressed B cell responses through cytotoxic manner related to expression of granzyme A, granzyme B, and perforin, whereas the role of iTreg subset on B cells did not involve in cytotoxic action but depending on TGF-β signaling. Furthermore, iTreg subset can significantly suppress Ab produced by lupus B cells in vitro. Comparison experiments using autoantibodies microarrays demonstrated that adoptive transfer of iTreg had a superior effect than nTreg subset on suppressing lupus B cell responses in vivo. Our data implicate a role and advantage of iTreg subset in treating B cell-mediated autoimmune diseases, boosting the translational potential of these findings. PMID:27001954

  19. [Regulatory role of mechanical stress response in cellular function: development of new drugs and tissue engineering].

    PubMed

    Momose, Kazutaka; Matsuda, Takehisa; Oike, Masahiro; Obara, Kazuo; Laher, Ismail; Sugiura, Seiryo; Ohata, Hisayuki; Nakayama, Koichi

    2003-02-01

    The investigation of mechanotransduction in the cardiovascular system is essentially important for elucidating the cellular and molecular mechanisms involved in not only the maintenance of hemodynamic homeostasis but also etiology of cardiovascular diseases including arteriosclerosis. The present review summarizes the latest research performed by six academic groups, and presented at the 75th Annual Meeting of the Japanese Pharmacological Society. Technology of cellular biomechanics is also required for research and clinical application of a vascular hybrid tissue responding to pulsatile stress. 1) Vascular tissue engineering: Design of pulsatile stress-responsive scaffold and in vivo vascular wall reconstruction (T. Matsuda); 2) Cellular mechanisms of mechanosensitive calcium transients in vascular endothelium (M. Oike et al.); 3) Cross-talk of stimulation with fluid flow and lysophosphatidic acid in vascular endothelial cells (K. Momose et al.); 4) Mechanotransduction of vascular smooth muscles: Rate-dependent stretch-induced protein phosphorylations and contractile activation (K. Obara et al.); 5) Lipid mediators in vascular myogenic tone (I. Laher et al.); and 6) Caldiomyocyte regulates its mechanical output in response to mechanical load (S. Sugiura et al.).

  20. Reactive oxygen species regulatory mechanisms associated with rapid response of MC3T3-E1 cells for vibration stress.

    PubMed

    Zhang, Ling; Gan, Xueqi; Zhu, Zhuoli; Yang, Yang; He, Yuting; Yu, Haiyang

    2016-02-12

    Although many previous studies have shown that refractory period-dependent memory effect of vibration stress is anabolic for skeletal homeostasis, little is known about the rapid response of osteoblasts simply derived from vibration itself. In view of the potential role of reactive oxygen species (ROS) in mediating differentiated activity of osteoblasts, whether and how ROS regulates the rapid effect of vibration deserve to be demonstrated. Our findings indicated that MC3T3-E1 cells underwent decreased gene expression of Runx2, Col-I and ALP and impaired ALP activity accompanied by increased mitochondrial fission immediately after vibration loading. Moreover, we also revealed the involvement of ERK-Drp1 signal transduction in ROS regulatory mechanisms responsible for the rapid effect of vibration stress.

  1. Reactive oxygen species regulatory mechanisms associated with rapid response of MC3T3-E1 cells for vibration stress.

    PubMed

    Zhang, Ling; Gan, Xueqi; Zhu, Zhuoli; Yang, Yang; He, Yuting; Yu, Haiyang

    2016-02-12

    Although many previous studies have shown that refractory period-dependent memory effect of vibration stress is anabolic for skeletal homeostasis, little is known about the rapid response of osteoblasts simply derived from vibration itself. In view of the potential role of reactive oxygen species (ROS) in mediating differentiated activity of osteoblasts, whether and how ROS regulates the rapid effect of vibration deserve to be demonstrated. Our findings indicated that MC3T3-E1 cells underwent decreased gene expression of Runx2, Col-I and ALP and impaired ALP activity accompanied by increased mitochondrial fission immediately after vibration loading. Moreover, we also revealed the involvement of ERK-Drp1 signal transduction in ROS regulatory mechanisms responsible for the rapid effect of vibration stress. PMID:26802466

  2. Single-Nucleotide Mutations in FMR1 Reveal Novel Functions and Regulatory Mechanisms of the Fragile X Syndrome Protein FMRP

    PubMed Central

    Suhl, Joshua A.; Warren, Stephen T.

    2015-01-01

    Fragile X syndrome is a monogenic disorder and a common cause of intellectual disability. Despite nearly 25 years of research on FMR1, the gene underlying the syndrome, very few pathological mutations other than the typical CGG-repeat expansion have been reported. This is in contrast to other X-linked, monogenic, intellectual disability disorders, such as Rett syndrome, where many point mutations have been validated as causative of the disorder. As technology has improved and significantly driven down the cost of sequencing, allowing for whole genes to be sequenced with relative ease, in-depth sequencing studies on FMR1 have recently been performed. These studies have led to the identification of novel variants in FMR1, where some of which have been functionally evaluated and are likely pathogenic. In this review, we discuss recently identified FMR1 variants, the ways these novel variants cause dysfunction, and how they reveal new regulatory mechanisms and functionalities of the gene. PMID:26819560

  3. Reversible oxidation of vicinal-thiols motif in sarcoplasmic reticulum calcium regulatory proteins is involved in muscle fatigue mechanism.

    PubMed

    Vázquez, Pável; Tirado-Cortés, Aldo; Álvarez, Rocío; Ronjat, Michel; Amaya, Araceli; Ortega, Alicia

    2016-10-01

    The mechanism underlying fatigue in skeletal muscle (SM) related to the redox-potential hypothesis, ranges from a direct effect of oxygen reactive species, to a number of other free radical intermediates targeting specific amino acids in the Ca(2+)-regulatory proteins of the sarcoplasmic reticulum (SR). In the present study, we investigate the selective oxidation/reduction of the protein motif Cys-(Xn=2-6)-Cys, known as a vicinal thiol group (VTG), present in the SR Ca(2+)-ATPase (SERCA) and in the Ca(2+)-channel ryanodine receptor (RyR) which are modified during muscle fatigue in SM. Selective oxidation of VTG with phenyl arsine oxide (PAO) increases fatigue in rat isolated SM and fatigue is prevented when muscle is previously incubated with a VTG selective reducing agent, 2,3-dimercaptopropanol (British anti-Lewisite (BAL)). In isolated SR membranes, PAO [<0.1mM] modifies SERCA conformation and inhibits ATPase activity but does not affect Ca(2+)-release. However, PAO at [>0.1mM] inhibits SERCA and RyR activities in a reversible manner by selectively reducing them. Interestingly, as observed by differential scanning calorimetry, the conformation of SERCA from fatigued muscle changed in a similar manner as when SERCA VTG where oxidized. The addition of BAL to fatigued muscle restored the structural conformation and activity of SERCA with full recovery of muscle force production after fatigue. We conclude that VTG reversible oxidation of SR Ca(2+) regulatory proteins are involved in muscle contraction/relaxation and are a molecular mechanism to be considered for muscle fatigue.

  4. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods

    NASA Astrophysics Data System (ADS)

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay; Chatterjee, Suvro; Patra, Chitta Ranjan

    2015-05-01

    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role.Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular

  5. Modern quantitative acid-base chemistry.

    PubMed

    Stewart, P A

    1983-12-01

    Quantitative analysis of ionic solutions in terms of physical and chemical principles has been effectively prohibited in the past by the overwhelming amount of calculation it required, but computers have suddenly eliminated that prohibition. The result is an approach to acid-base which revolutionizes our ability to understand, predict, and control what happens to hydrogen ions in living systems. This review outlines that approach and suggests some of its most useful implications. Quantitative understanding requires distinctions between independent variables (in body fluids: pCO2, net strong ion charge, and total weak acid, usually protein), and dependent variables [( HCO-3], [HA], [A-], [CO(2-)3], [OH-], and [H+] (or pH]. Dependent variables are determined by independent variables, and can be calculated from the defining equations for the specific system. Hydrogen ion movements between solutions can not affect hydrogen ion concentration; only changes in independent variables can. Many current models for ion movements through membranes will require modification on the basis of this quantitative analysis. Whole body acid-base balance can be understood quantitatively in terms of the three independent variables and their physiological regulation by the lungs, kidneys, gut, and liver. Quantitative analysis also shows that body fluids interact mainly by strong ion movements through the membranes separating them.

  6. Bipolar Membranes for Acid Base Flow Batteries

    NASA Astrophysics Data System (ADS)

    Anthamatten, Mitchell; Roddecha, Supacharee; Jorne, Jacob; Coughlan, Anna

    2011-03-01

    Rechargeable batteries can provide grid-scale electricity storage to match power generation with consumption and promote renewable energy sources. Flow batteries offer modular and flexible design, low cost per kWh and high efficiencies. A novel flow battery concept will be presented based on acid-base neutralization where protons (H+) and hydroxyl (OH-) ions react electrochemically to produce water. The large free energy of this highly reversible reaction can be stored chemically, and, upon discharge, can be harvested as usable electricity. The acid-base flow battery concept avoids the use of a sluggish oxygen electrode and utilizes the highly reversible hydrogen electrode, thus eliminating the need for expensive noble metal catalysts. The proposed flow battery is a hybrid of a battery and a fuel cell---hydrogen gas storing chemical energy is produced at one electrode and is immediately consumed at the other electrode. The two electrodes are exposed to low and high pH solutions, and these solutions are separated by a hybrid membrane containing a hybrid cation and anion exchange membrane (CEM/AEM). Membrane design will be discussed, along with ion-transport data for synthesized membranes.

  7. Teaching Acid/Base Physiology in the Laboratory

    ERIC Educational Resources Information Center

    Friis, Ulla G.; Plovsing, Ronni; Hansen, Klaus; Laursen, Bent G.; Wallstedt, Birgitta

    2010-01-01

    Acid/base homeostasis is one of the most difficult subdisciplines of physiology for medical students to master. A different approach, where theory and practice are linked, might help students develop a deeper understanding of acid/base homeostasis. We therefore set out to develop a laboratory exercise in acid/base physiology that would provide…

  8. A General Simulator for Acid-Base Titrations

    NASA Astrophysics Data System (ADS)

    de Levie, Robert

    1999-07-01

    General formal expressions are provided to facilitate the automatic computer calculation of acid-base titration curves of arbitrary mixtures of acids, bases, and salts, without and with activity corrections based on the Davies equation. Explicit relations are also given for the buffer strength of mixtures of acids, bases, and salts.

  9. Using Willie's Acid-Base Box for Blood Gas Analysis

    ERIC Educational Resources Information Center

    Dietz, John R.

    2011-01-01

    In this article, the author describes a method developed by Dr. William T. Lipscomb for teaching blood gas analysis of acid-base status and provides three examples using Willie's acid-base box. Willie's acid-base box is constructed using three of the parameters of standard arterial blood gas analysis: (1) pH; (2) bicarbonate; and (3) CO[subscript…

  10. [Research Progress of NOS3 Participation in Regulatory Mechanisms of Cardiovascular Diseases].

    PubMed

    Sun, Ting; Chi, Qingjia; Wang, Guixue

    2016-02-01

    Cardiovascular disease has been a major threat to human's health and lives for many years. It is of great importance to explore the mechanisms and develop strategies to prevent the pathogenesis. Generally, cardiovascular disease is associated with endothelial dysfunction, which is closely related to the nitric oxide (NO)-mediated vasodilatation. The release of NO is regulated by NOS3 gene in mammals' vascular system. A great deal of evidences have shown that the polymorphism and epigenetic of NOS3 gene play vital roles in the pathological process of cardiovascular disease. To gain insights into the role of NOS3 in the cardiovascular diseases, we reviewed the molecular mechanisms underlying the development of cardiovascular diseases in this paper, including the uncoupling of NOS3 protein, epigenetic and polymorphism of NOS3 gene. The review can also offer possible strategies to prevent and treat cardiovascular diseases. PMID:27382763

  11. Transport mechanism and regulatory properties of the human amino acid transporter ASCT2 (SLC1A5).

    PubMed

    Scalise, Mariafrancesca; Pochini, Lorena; Panni, Simona; Pingitore, Piero; Hedfalk, Kristina; Indiveri, Cesare

    2014-11-01

    The kinetic mechanism of the transport catalyzed by the human glutamine/neutral amino acid transporter hASCT2 over-expressed in P. pastoris was determined in proteoliposomes by pseudo-bi-substrate kinetic analysis of the Na(+)-glutamineex/glutaminein transport reaction. A random simultaneous mechanism resulted from the experimental analysis. Purified functional hASCT2 was chemically cross-linked to a stable dimeric form. The oligomeric structure correlated well with the kinetic mechanism of transport. Half-saturation constants (Km) of the transporter for the other substrates Ala, Ser, Asn and Thr were measured both on the external and internal side. External Km were much lower than the internal ones confirming the asymmetry of the transporter. The electric nature of the transport reaction was determined imposing a negative inside membrane potential generated by K(+) gradients in the presence of valinomycin. The transport reaction resulted to be electrogenic and the electrogenicity originated from external Na(+). Internal Na(+) exerted a stimulatory effect on the transport activity which could be explained by a regulatory, not a counter-transport, effect. Native and deglycosylated hASCT2 extracted from HeLa showed the same transport features demonstrating that the glycosyl moiety has no role in transport function. Both in vitro and in vivo interactions of hASCT2 with the scaffold protein PDZK1 were revealed.

  12. Regulatory mechanisms of RNA function: emerging roles of DNA repair enzymes.

    PubMed

    Jobert, Laure; Nilsen, Hilde

    2014-07-01

    The acquisition of an appropriate set of chemical modifications is required in order to establish correct structure of RNA molecules, and essential for their function. Modification of RNA bases affects RNA maturation, RNA processing, RNA quality control, and protein translation. Some RNA modifications are directly involved in the regulation of these processes. RNA epigenetics is emerging as a mechanism to achieve dynamic regulation of RNA function. Other modifications may prevent or be a signal for degradation. All types of RNA species are subject to processing or degradation, and numerous cellular mechanisms are involved. Unexpectedly, several studies during the last decade have established a connection between DNA and RNA surveillance mechanisms in eukaryotes. Several proteins that respond to DNA damage, either to process or to signal the presence of damaged DNA, have been shown to participate in RNA quality control, turnover or processing. Some enzymes that repair DNA damage may also process modified RNA substrates. In this review, we give an overview of the DNA repair proteins that function in RNA metabolism. We also discuss the roles of two base excision repair enzymes, SMUG1 and APE1, in RNA quality control.

  13. [Research progress in biofilm formation and regulatory mechanism of Campylobacter jejuni].

    PubMed

    Wu, Qingping; Zhong, Xian; Zhang, Jumei

    2016-02-01

    Biofilm of Campylobacter jejuni was formed by cross-linking its extracellular secretion, polysaccharides, various extracellular proteins, nucleic acids etc to enhance its survival in hostile environments, especially for detergents, antibiotics and disinfectants. This paper elaborated C. jejuni biofilm formation and regulation mechanisms in the surface properties of the media, temperatures, gas environment, the regulation of gene etc, also analysed and discussed a variety of biofilm removal practical applications. We hope it can provide a reference for studies on biofilm control of C. jejuni. PMID:27373066

  14. A global regulatory mechanism for activating an exon network required for neurogenesis.

    PubMed

    Raj, Bushra; Irimia, Manuel; Braunschweig, Ulrich; Sterne-Weiler, Timothy; O'Hanlon, Dave; Lin, Zhen-Yuan; Chen, Ginny I; Easton, Laura E; Ule, Jernej; Gingras, Anne-Claude; Eyras, Eduardo; Blencowe, Benjamin J

    2014-10-01

    The vertebrate and neural-specific Ser/Arg (SR)-related protein nSR100/SRRM4 regulates an extensive program of alternative splicing with critical roles in nervous system development. However, the mechanism by which nSR100 controls its target exons is poorly understood. We demonstrate that nSR100-dependent neural exons are associated with a unique configuration of intronic cis-elements that promote rapid switch-like regulation during neurogenesis. A key feature of this configuration is the insertion of specialized intronic enhancers between polypyrimidine tracts and acceptor sites that bind nSR100 to potently activate exon inclusion in neural cells while weakening 3' splice site recognition and contributing to exon skipping in nonneural cells. nSR100 further operates by forming multiple interactions with early spliceosome components bound proximal to 3' splice sites. These multifaceted interactions achieve dominance over neural exon silencing mediated by the splicing regulator PTBP1. The results thus illuminate a widespread mechanism by which a critical neural exon network is activated during neurogenesis. PMID:25219497

  15. The Influence of Early Life Nutrition on Epigenetic Regulatory Mechanisms of the Immune System

    PubMed Central

    Paparo, Lorella; di Costanzo, Margherita; di Scala, Carmen; Cosenza, Linda; Leone, Ludovica; Nocerino, Rita; Berni Canani, Roberto

    2014-01-01

    The immune system is exquisitely sensitive to environmental changes. Diet constitutes one of the major environmental factors that exerts a profound effect on immune system development and function. Epigenetics is the study of mitotically heritable, yet potentially reversible, molecular modifications to DNA and chromatin without alteration to the underlying DNA sequence. Nutriepigenomics is an emerging discipline examining the role of dietary influences on gene expression. There is increasing evidence that the epigenetic mechanisms that regulate gene expression during immune differentiation are directly affected by dietary factors or indirectly through modifications in gut microbiota induced by different dietary habits. Short-chain fatty acids, in particular butyrate, produced by selected bacteria stains within gut microbiota, are crucial players in this network. PMID:25353665

  16. The T box mechanism: tRNA as a regulatory molecule

    PubMed Central

    Green, Nicholas J.; Grundy, Frank J.; Henkin, Tina M.

    2009-01-01

    The T box mechanism is widely used in Gram-positive bacteria to regulate expression of aminoacyl-tRNA synthetase genes and genes involved in amino acid biosynthesis and uptake. Binding of a specific uncharged tRNA to a riboswitch element in the nascent transcript causes a structural change in the transcript that promotes expression of the downstream coding sequence. In most cases, this occurs by stabilization of an antiterminator element that competes with formation of a terminator helix. Specific tRNA recognition by the nascent transcript results in increased expression of genes important for tRNA aminoacylation in response to decreased pools of charged tRNA. PMID:19932103

  17. [The defense and regulatory mechanisms during development of legume-Rhizobium symbiosis].

    PubMed

    Glian'ko, A K; Akimova, G P; Sokolova, M G; Makarova, L E; Vasil'eva, G G

    2007-01-01

    The roles of indolylacetic acid, the peroxidase system, catalase, active oxygen species, and phenolic compounds in the physiological and biochemical mechanisms involved in the autoregulation of nodulation in the developing legume-Rhizobium symbiosis were studied. It was inferred that the concentration of indolylacetic acid in the roots of inoculated plants, controlled by the enzymes of the peroxidase complex, is the signal permitting or limiting nodulation at the initial stages of symbiotic interaction. Presumably, the change in the level of active oxygen species is determined by an antioxidant activity of phenolic compounds. During the development of symbiosis, phytohormones, antioxidant enzymes, and active oxygen species may be involved in the regulation of infection via both a direct antibacterial action and regulation of functional activity of the host plant defense systems. PMID:17619575

  18. New effector functions and regulatory mechanisms of BCL6 in normal and malignant lymphocytes

    PubMed Central

    Bunting, Karen L.; Melnick, Ari M.

    2014-01-01

    The BCL6 oncogenic repressor is a master regulator of humoral immunity and B-cell lymphoma survival. Whereas much research has focused on its regulation and function in germinal center B-cells, its role in other mature lymphoid cell compartments is less clear. A novel role for BCL6 in follicular T helper cell development was recently uncovered. The latest discoveries reveal that BCL6 is also an important regulator of other specialized helper T-cell subsets within germinal centers, pre-germinal center events, and peripheral T-cells effector functions. Here, we review newly discovered roles for BCL6 in lymphocyte subsets residing within and outside of germinal centers, and discuss their implications with respect to the molecular mechanisms of BCL6 regulation and potential links to B and T-cell lymphomas. PMID:23725655

  19. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons.

    PubMed

    Berndt, Anthony J E; Tang, Jonathan C Y; Ridyard, Marc S; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W

    2015-12-01

    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  20. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons

    PubMed Central

    Ridyard, Marc S.; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W.

    2015-01-01

    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  1. Ocean warming and acidification modulate energy budget and gill ion regulatory mechanisms in Atlantic cod (Gadus morhua).

    PubMed

    Kreiss, C M; Michael, K; Lucassen, M; Jutfelt, F; Motyka, R; Dupont, S; Pörtner, H-O

    2015-10-01

    Ocean warming and acidification are threatening marine ecosystems. In marine animals, acidification is thought to enhance ion regulatory costs and thereby baseline energy demand, while elevated temperature also increases baseline metabolic rate. Here we investigated standard metabolic rates (SMR) and plasma parameters of Atlantic cod (Gadus morhua) after 3-4 weeks of exposure to ambient and future PCO2 levels (550, 1200 and 2200 µatm) and at two temperatures (10, 18 °C). In vivo branchial ion regulatory costs were studied in isolated, perfused gill preparations. Animals reared at 18 °C responded to increasing CO2 by elevating SMR, in contrast to specimens at 10 °C. Isolated gills at 10 °C and elevated PCO2 (≥1200 µatm) displayed increased soft tissue mass, in parallel to increased gill oxygen demand, indicating an increased fraction of gill in whole animal energy budget. Altered gill size was not found at 18 °C, where a shift in the use of ion regulation mechanisms occurred towards enhanced Na(+)/H(+)-exchange and HCO3 (-) transport at high PCO2 (2200 µatm), paralleled by higher Na(+)/K(+)-ATPase activities. This shift did not affect total gill energy consumption leaving whole animal energy budget unaffected. Higher Na(+)/K(+)-ATPase activities in the warmth might have compensated for enhanced branchial permeability and led to reduced plasma Na(+) and/or Cl(-) concentrations and slightly lowered osmolalities seen at 18 °C and 550 or 2200 µatm PCO2 in vivo. Overall, the gill as a key ion regulation organ seems to be highly effective in supporting the resilience of cod to effects of ocean warming and acidification. PMID:26219611

  2. Glucocorticoid receptor-mediated cell cycle arrest is achieved through distinct cell-specific transcriptional regulatory mechanisms.

    PubMed Central

    Rogatsky, I; Trowbridge, J M; Garabedian, M J

    1997-01-01

    Glucocorticoids inhibit proliferation of many cell types, but the events leading from the activated glucocorticoid receptor (GR) to growth arrest are not understood. Ectopic expression and activation of GR in human osteosarcoma cell lines U2OS and SAOS2, which lack endogenous receptors, result in a G1 cell cycle arrest. GR activation in U2OS cells represses expression of the cyclin-dependent kinases (CDKs) CDK4 and CDK6 as well as their regulatory partner, cyclin D3, leading to hypophosphorylation of the retinoblastoma protein (Rb). We also demonstrate a ligand-dependent reduction in the expression of E2F-1 and c-Myc, transcription factors involved in the G1-to-S-phase transition. Mitogen-activated protein kinase, CDK2, cyclin E, and the CDK inhibitors (CDIs) p27 and p21 are unaffected by receptor activation in U2OS cells. The receptor's N-terminal transcriptional activation domain is not required for growth arrest in U2OS cells. In Rb-deficient SAOS2 cells, however, the expression of p27 and p21 is induced upon receptor activation. Remarkably, in SAOS2 cells that express a GR deletion derivative lacking the N-terminal transcriptional activation domain, induction of CDI expression is abolished and the cells fail to undergo ligand-dependent cell cycle arrest. Similarly, murine S49 lymphoma cells, which, like SAOS2 cells, lack Rb, require the N-terminal activation domain for growth arrest and induce CDI expression upon GR activation. These cell-type-specific differences in receptor domains and cellular targets linking GR activation to cell cycle machinery suggest two distinct regulatory mechanisms of GR-mediated cell cycle arrest: one involving transcriptional repression of G1 cyclins and CDKs and the other involving enhanced transcription of CDIs by the activated receptor. PMID:9154817

  3. Ocean warming and acidification modulate energy budget and gill ion regulatory mechanisms in Atlantic cod (Gadus morhua).

    PubMed

    Kreiss, C M; Michael, K; Lucassen, M; Jutfelt, F; Motyka, R; Dupont, S; Pörtner, H-O

    2015-10-01

    Ocean warming and acidification are threatening marine ecosystems. In marine animals, acidification is thought to enhance ion regulatory costs and thereby baseline energy demand, while elevated temperature also increases baseline metabolic rate. Here we investigated standard metabolic rates (SMR) and plasma parameters of Atlantic cod (Gadus morhua) after 3-4 weeks of exposure to ambient and future PCO2 levels (550, 1200 and 2200 µatm) and at two temperatures (10, 18 °C). In vivo branchial ion regulatory costs were studied in isolated, perfused gill preparations. Animals reared at 18 °C responded to increasing CO2 by elevating SMR, in contrast to specimens at 10 °C. Isolated gills at 10 °C and elevated PCO2 (≥1200 µatm) displayed increased soft tissue mass, in parallel to increased gill oxygen demand, indicating an increased fraction of gill in whole animal energy budget. Altered gill size was not found at 18 °C, where a shift in the use of ion regulation mechanisms occurred towards enhanced Na(+)/H(+)-exchange and HCO3 (-) transport at high PCO2 (2200 µatm), paralleled by higher Na(+)/K(+)-ATPase activities. This shift did not affect total gill energy consumption leaving whole animal energy budget unaffected. Higher Na(+)/K(+)-ATPase activities in the warmth might have compensated for enhanced branchial permeability and led to reduced plasma Na(+) and/or Cl(-) concentrations and slightly lowered osmolalities seen at 18 °C and 550 or 2200 µatm PCO2 in vivo. Overall, the gill as a key ion regulation organ seems to be highly effective in supporting the resilience of cod to effects of ocean warming and acidification.

  4. Targeted mutagenesis of intergenic regions in the Neisseria gonorrhoeae gonococcal genetic island reveals multiple regulatory mechanisms controlling type IV secretion

    PubMed Central

    Ramsey, Meghan E.; Bender, Tobias; Klimowicz, Amy K.; Hackett, Kathleen T.; Yamamoto, Ami; Jolicoeur, Adrienne; Callaghan, Melanie M.; Wassarman, Karen M.; van der Does, Chris; Dillard, Joseph P.

    2015-01-01

    Summary Gonococci secrete chromosomal DNA into the extracellular environment using a type IV secretion system (T4SS). The secreted DNA acts in natural transformation and initiates biofilm development. Although the DNA and its effects are detectable, structural components of the T4SS are present at very low levels, suggestive of uncharacterized regulatory control. We sought to better characterize the expression and regulation of T4SS genes and found that the four operons containing T4SS genes are transcribed at very different levels. Increasing transcription of two of the operons through targeted promoter mutagenesis did not increase DNA secretion. The stability and steady-state levels of two T4SS structural proteins were affected by a homolog of tail-specific protease. An RNA switch was also identified that regulates translation of a third T4SS operon. The switch mechanism relies on two putative stem-loop structures contained within the 5’ untranslated region of the transcript, one of which occludes the ribosome binding site and start codon. Mutational analysis of these stem-loops supports a model in which induction of an alternative structure relieves repression. Taken together, these results identify multiple layers of regulation, including transcriptional, translational, and post-translational mechanisms controlling T4SS gene expression and DNA secretion. PMID:26076069

  5. Targeted mutagenesis of intergenic regions in the Neisseria gonorrhoeae gonococcal genetic island reveals multiple regulatory mechanisms controlling type IV secretion.

    PubMed

    Ramsey, Meghan E; Bender, Tobias; Klimowicz, Amy K; Hackett, Kathleen T; Yamamoto, Ami; Jolicoeur, Adrienne; Callaghan, Melanie M; Wassarman, Karen M; van der Does, Chris; Dillard, Joseph P

    2015-09-01

    Gonococci secrete chromosomal DNA into the extracellular environment using a type IV secretion system (T4SS). The secreted DNA acts in natural transformation and initiates biofilm development. Although the DNA and its effects are detectable, structural components of the T4SS are present at very low levels, suggestive of uncharacterized regulatory control. We sought to better characterize the expression and regulation of T4SS genes and found that the four operons containing T4SS genes are transcribed at very different levels. Increasing transcription of two of the operons through targeted promoter mutagenesis did not increase DNA secretion. The stability and steady-state levels of two T4SS structural proteins were affected by a homolog of tail-specific protease. An RNA switch was also identified that regulates translation of a third T4SS operon. The switch mechanism relies on two putative stem-loop structures contained within the 5' untranslated region of the transcript, one of which occludes the ribosome binding site and start codon. Mutational analysis of these stem loops supports a model in which induction of an alternative structure relieves repression. Taken together, these results identify multiple layers of regulation, including transcriptional, translational and post-translational mechanisms controlling T4SS gene expression and DNA secretion.

  6. Targeted mutagenesis of intergenic regions in the Neisseria gonorrhoeae gonococcal genetic island reveals multiple regulatory mechanisms controlling type IV secretion.

    PubMed

    Ramsey, Meghan E; Bender, Tobias; Klimowicz, Amy K; Hackett, Kathleen T; Yamamoto, Ami; Jolicoeur, Adrienne; Callaghan, Melanie M; Wassarman, Karen M; van der Does, Chris; Dillard, Joseph P

    2015-09-01

    Gonococci secrete chromosomal DNA into the extracellular environment using a type IV secretion system (T4SS). The secreted DNA acts in natural transformation and initiates biofilm development. Although the DNA and its effects are detectable, structural components of the T4SS are present at very low levels, suggestive of uncharacterized regulatory control. We sought to better characterize the expression and regulation of T4SS genes and found that the four operons containing T4SS genes are transcribed at very different levels. Increasing transcription of two of the operons through targeted promoter mutagenesis did not increase DNA secretion. The stability and steady-state levels of two T4SS structural proteins were affected by a homolog of tail-specific protease. An RNA switch was also identified that regulates translation of a third T4SS operon. The switch mechanism relies on two putative stem-loop structures contained within the 5' untranslated region of the transcript, one of which occludes the ribosome binding site and start codon. Mutational analysis of these stem loops supports a model in which induction of an alternative structure relieves repression. Taken together, these results identify multiple layers of regulation, including transcriptional, translational and post-translational mechanisms controlling T4SS gene expression and DNA secretion. PMID:26076069

  7. TRIENNIAL LACTATION SYMPOSIUM: Systems biology of regulatory mechanisms of nutrient metabolism in lactation.

    PubMed

    McNamara, J P

    2015-12-01

    A major role of the dairy cow is to convert low-quality plant materials into high-quality protein and other nutrients for humans. We must select and manage cows with the goal of having animals of the greatest efficiency matched to their environment. We have increased efficiency tremendously over the years, yet the variation in productive and reproductive efficiency among animals is still large. In part, this is because of a lack of full integration of genetic, nutritional, and reproductive biology into management decisions. However, integration across these disciplines is increasing as the biological research findings show specific control points at which genetics, nutrition, and reproduction interact. An ordered systems biology approach that focuses on why and how cells regulate energy and N use and on how and why organs interact through endocrine and neurocrine mechanisms will speed improvements in efficiency. More sophisticated dairy managers will demand better information to improve the efficiency of their animals. Using genetic improvement and animal management to improve milk productive and reproductive efficiency requires a deeper understanding of metabolic processes throughout the life cycle. Using existing metabolic models, we can design experiments specifically to integrate data from global transcriptional profiling into models that describe nutrient use in farm animals. A systems modeling approach can help focus our research to make faster and larger advances in efficiency and determine how this knowledge can be applied on the farms.

  8. TRIENNIAL LACTATION SYMPOSIUM: Systems biology of regulatory mechanisms of nutrient metabolism in lactation.

    PubMed

    McNamara, J P

    2015-12-01

    A major role of the dairy cow is to convert low-quality plant materials into high-quality protein and other nutrients for humans. We must select and manage cows with the goal of having animals of the greatest efficiency matched to their environment. We have increased efficiency tremendously over the years, yet the variation in productive and reproductive efficiency among animals is still large. In part, this is because of a lack of full integration of genetic, nutritional, and reproductive biology into management decisions. However, integration across these disciplines is increasing as the biological research findings show specific control points at which genetics, nutrition, and reproduction interact. An ordered systems biology approach that focuses on why and how cells regulate energy and N use and on how and why organs interact through endocrine and neurocrine mechanisms will speed improvements in efficiency. More sophisticated dairy managers will demand better information to improve the efficiency of their animals. Using genetic improvement and animal management to improve milk productive and reproductive efficiency requires a deeper understanding of metabolic processes throughout the life cycle. Using existing metabolic models, we can design experiments specifically to integrate data from global transcriptional profiling into models that describe nutrient use in farm animals. A systems modeling approach can help focus our research to make faster and larger advances in efficiency and determine how this knowledge can be applied on the farms. PMID:26641166

  9. Inducible nitric oxide synthase (NOS-2) in subarachnoid hemorrhage: Regulatory mechanisms and therapeutic implications

    PubMed Central

    Iqbal, Sana; Hayman, Erik G; Hong, Caron; Stokum, Jesse A; Kurland, David B; Gerzanich, Volodymyr; Simard, J Marc

    2016-01-01

    Aneurysmal subarachnoid hemorrhage (SAH) typically carries a poor prognosis. Growing evidence indicates that overabundant production of nitric oxide (NO) may be responsible for a large part of the secondary injury that follows SAH. Although SAH modulates the activity of all three isoforms of nitric oxide synthase (NOS), the inducible isoform, NOS-2, accounts for a majority of NO-mediated secondary injuries after SAH. Here, we review the indispensable physiological roles of NO that must be preserved, even while attempting to downmodulate the pathophysiologic effects of NO that are induced by SAH. We examine the effects of SAH on the function of the various NOS isoforms, with a particular focus on the pathological effects of NOS-2 and on the mechanisms responsible for its transcriptional upregulation. Finally, we review interventions to block NOS-2 upregulation or to counteract its effects, with an emphasis on the potential therapeutic strategies to improve outcomes in patients afflicted with SAH. There is still much to be learned regarding the apparently maladaptive response of NOS-2 and its harmful product NO in SAH. However, the available evidence points to crucial effects that, on balance, are adverse, making the NOS-2/NO/peroxynitrite axis an attractive therapeutic target in SAH. PMID:27774520

  10. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress.

    PubMed

    Hossain, M Sazzad; Dietz, Karl-Josef

    2016-01-01

    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  11. Social dominance-related major urinary proteins and the regulatory mechanism in mice.

    PubMed

    Guo, Huifen; Fang, Qi; Huo, Ying; Zhang, Yaohua; Zhang, Jianxu

    2015-11-01

    Major urinary proteins (MUPs) have been proven to be non-volatile male pheromones in mice. Here, we aimed to elucidate the relationship between MUPs and dominance hierarchy, and the underlying molecular mechanisms. Dominance-submission relationship was established by chronic dyadic encountering. We found that at the urinary protein level and hepatic mRNA level, the expression of major MUPs, including Mup20, was enhanced in dominant males compared with subordinate males, indicating that MUPs might signal the social status of male mice. Meanwhile, the mRNA level of hepatic corticotropin releasing hormone receptor 2 (CRHR2) was higher in subordinate male mice than in dominant male mice. Castration also enhanced the expression of CRHR2, but suppressed that of MUPs. CRHR2 agonist treatment reduced the expression of MUPs in liver. However, male social status failed to exert significant influence on serum testosterone and corticosterone as well as the mRNA expression of their receptors. These findings reveal that some MUPs, especially Mup20, might constitute potential dominance pheromones and could be downregulated by hepatic CRHR2, which is possibly independent of androgen or corticosterone systems.

  12. Familial autoinflammation with neutrophilic dermatosis reveals a regulatory mechanism of pyrin activation.

    PubMed

    Masters, Seth L; Lagou, Vasiliki; Jéru, Isabelle; Baker, Paul J; Van Eyck, Lien; Parry, David A; Lawless, Dylan; De Nardo, Dominic; Garcia-Perez, Josselyn E; Dagley, Laura F; Holley, Caroline L; Dooley, James; Moghaddas, Fiona; Pasciuto, Emanuela; Jeandel, Pierre-Yves; Sciot, Raf; Lyras, Dena; Webb, Andrew I; Nicholson, Sandra E; De Somer, Lien; van Nieuwenhove, Erika; Ruuth-Praz, Julia; Copin, Bruno; Cochet, Emmanuelle; Medlej-Hashim, Myrna; Megarbane, Andre; Schroder, Kate; Savic, Sinisa; Goris, An; Amselem, Serge; Wouters, Carine; Liston, Adrian

    2016-03-30

    Pyrin responds to pathogen signals and loss of cellular homeostasis by forming an inflammasome complex that drives the cleavage and secretion of interleukin-1β (IL-1β). Mutations in the B30.2/SPRY domain cause pathogen-independent activation of pyrin and are responsible for the autoinflammatory disease familial Mediterranean fever (FMF). We studied a family with a dominantly inherited autoinflammatory disease, distinct from FMF, characterized by childhood-onset recurrent episodes of neutrophilic dermatosis, fever, elevated acute-phase reactants, arthralgia, and myalgia/myositis. The disease was caused by a mutation in MEFV, the gene encoding pyrin (S242R). The mutation results in the loss of a 14-3-3 binding motif at phosphorylated S242, which was not perturbed by FMF mutations in the B30.2/SPRY domain. However, loss of both S242 phosphorylation and 14-3-3 binding was observed for bacterial effectors that activate the pyrin inflammasome, such as Clostridium difficile toxin B (TcdB). The S242R mutation thus recapitulated the effect of pathogen sensing, triggering inflammasome activation and IL-1β production. Successful therapy targeting IL-1β has been initiated in one patient, resolving pyrin-associated autoinflammation with neutrophilic dermatosis. This disease provides evidence that a guard-like mechanism of pyrin regulation, originally identified for Nod-like receptors in plant innate immunity, also exists in humans.

  13. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress

    PubMed Central

    Hossain, M. Sazzad; Dietz, Karl-Josef

    2016-01-01

    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  14. Fluorescence single-molecule imaging of actin turnover and regulatory mechanisms.

    PubMed

    Watanabe, Naoki

    2012-01-01

    Cells must rapidly remodel the actin filament network to achieve various cellular functions. Actin filament turnover is a dynamic process that plays crucial roles in cell adhesion, locomotion, cytokinesis, endocytosis, phagocytosis, tissue remodeling, etc., and is regulated by cell signaling cascades. Success in elucidating dynamic biological processes such as actin-based motility relies on the means enabling real time monitoring of the process. The invention of live-cell fluorescence single-molecule imaging has opened a window for direct viewing of various actin remodeling processes. In general, assembly and dissociation of actin and its regulators turned out to occur at the faster rates than previously estimated by biochemical and structural analyses. Cells undergo such fast continuous exchange of the components perhaps not only to drive actin remodeling but also to facilitate rapid response in many other cell mechanics and signaling cascades. This chapter describes how epifluorescence single-molecule imaging which visualizes deeper area than the TIRF microscopy is achieved in XTC cells, the currently best platform for this approach.

  15. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps

    PubMed Central

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low. PMID:26751076

  16. Phosphorylation regulates myo-inositol-3-phosphate synthase: a novel regulatory mechanism of inositol biosynthesis.

    PubMed

    Deranieh, Rania M; He, Quan; Caruso, Joseph A; Greenberg, Miriam L

    2013-09-13

    myo-Inositol-3-phosphate synthase (MIPS) plays a crucial role in inositol homeostasis. Transcription of the coding gene INO1 is highly regulated. However, regulation of the enzyme is not well defined. We previously showed that MIPS is indirectly inhibited by valproate, suggesting that the enzyme is post-translationally regulated. Using (32)Pi labeling and phosphoamino acid analysis, we show that yeast MIPS is a phosphoprotein. Mass spectrometry analysis identified five phosphosites, three of which are conserved in the human MIPS. Analysis of phosphorylation-deficient and phosphomimetic site mutants indicated that the three conserved sites in yeast (Ser-184, Ser-296, and Ser-374) and humans (Ser-177, Ser-279, and Ser-357) affect MIPS activity. Both S296A and S296D yeast mutants and S177A and S177D human mutants exhibited decreased enzymatic activity, suggesting that a serine residue is critical at that location. The phosphomimetic mutations S184D (human S279D) and S374D (human S357D) but not the phosphodeficient mutations decreased activity, suggesting that phosphorylation of these two sites is inhibitory. The double mutation S184A/S374A caused an increase in MIPS activity, conferred a growth advantage, and partially rescued sensitivity to valproate. Our findings identify a novel mechanism of regulation of inositol synthesis by phosphorylation of MIPS.

  17. Seasonality of reproduction in mammals: intimate regulatory mechanisms and practical implications.

    PubMed

    Chemineau, P; Guillaume, D; Migaud, M; Thiéry, J C; Pellicer-Rubio, M T; Malpaux, B

    2008-07-01

    Farm mammals generally express seasonal variations in their production traits, thus inducing changing availability of fresh derived animal products (meat, milk and cheese) or performances (horses). This is due to a more or less marked seasonal birth distribution in sheep and goats, in horses but not cattle. Birth peak occurs at the end of winter-early spring, the most favourable period for the progeny to survive. Most species show seasonal variations in their ovulation frequency (presence or absence of ovulation), spermatogenic activity (from moderate decrease to complete absence of sperm production), gamete quality (variations in fertilization rates and embryo survival), and also sexual behaviour. The intimate mechanism involved is a complex combination of endogenous circannual rhythm driven and synchronized by light and melatonin. Profound and long-term neuroendocrine changes involving different neuromediator systems were described to play a role in these processes. In most species artificial photoperiodic treatments consisting of extra-light during natural short days (in sheep and goats and mares) or melatonin during long days (in sheep and goats) are extensively used to either adjust the breeding season to animal producer needs and/or to completely overcome seasonal variations of sperm production in artificial insemination centres. Pure light treatments (without melatonin), especially when applied in open barns, could be considered as non-invasive ones which fully respect animal welfare. Genetic selection could be one of the future ways to decrease seasonality in sheep and goats. PMID:18638103

  18. Sweat, the driving force behind normal skin: an emerging perspective on functional biology and regulatory mechanisms.

    PubMed

    Murota, Hiroyuki; Matsui, Saki; Ono, Emi; Kijima, Akiko; Kikuta, Junichi; Ishii, Masaru; Katayama, Ichiro

    2015-01-01

    The various symptoms associated with excessive or insufficient perspiration can significantly reduce a patient's quality of life. If a versatile and minimally invasive method could be established for returning sweat activity to normalcy, there is no question that it could be used in the treatment of many diseases that are believed to involve perspiration. For this reason, based on an understanding of the sweat-gland control function and sweat activity, it was necessary to conduct a comprehensive search for the factors that control sweating, such as the central and peripheral nerves that control sweat-gland function, the microenvironment surrounding the sweat glands, and lifestyle. We focused on the mechanism by which atopic dermatitis leads to hypohidrosis and confirmed that histamine inhibits acetylcholinergic sweating. Acetylcholine promotes the phosphorylation of glycogen synthesis kinase 3β (GSK3β) in the sweat-gland secretory cells and leads to sensible perspiration. By suppressing the phosphorylation of GSK3β, histamine inhibits the movement of sweat from the sweat-gland secretory cells through the sweat ducts, which could presumably be demonstrated by dynamic observations of the sweat glands using two-photon microscopy. It is expected that the discovery of new factors that control sweat-gland function can contribute to the treatment of diseases associated with dyshidrosis.

  19. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps.

    PubMed

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low.

  20. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps.

    PubMed

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low. PMID:26751076

  1. Endocannabinoids are Involved in Male Vertebrate Reproduction: Regulatory Mechanisms at Central and Gonadal Level.

    PubMed

    Bovolin, Patrizia; Cottone, Erika; Pomatto, Valentina; Fasano, Silvia; Pierantoni, Riccardo; Cobellis, Gilda; Meccariello, Rosaria

    2014-01-01

    Endocannabinoids (eCBs) are natural lipids regulating a large array of physiological functions and behaviors in vertebrates. The eCB system is highly conserved in evolution and comprises several specific receptors (type-1 and type-2 cannabinoid receptors), their endogenous ligands (e.g., anandamide and 2-arachidonoylglycerol), and a number of biosynthetic and degradative enzymes. In the last few years, eCBs have been described as critical signals in the control of male and female reproduction at multiple levels: centrally, by targeting hypothalamic gonadotropin-releasing-hormone-secreting neurons and pituitary, and locally, with direct effects on the gonads. These functions are supported by the extensive localization of cannabinoid receptors and eCB metabolic enzymes at different levels of the hypothalamic-pituitary-gonadal axis in mammals, as well as bonyfish and amphibians. In vivo and in vitro studies indicate that eCBs centrally regulate gonadal functions by modulating the gonadotropin-releasing hormone-gonadotropin-steroid network through direct and indirect mechanisms. Several proofs of local eCB regulation have been found in the testis and male genital tracts, since eCBs control Sertoli and Leydig cells activity, germ cell progression, as well as the acquisition of sperm functions. A comparative approach usually is a key step in the study of physiological events leading to the building of a general model. Thus, in this review, we summarize the action of eCBs at different levels of the male reproductive axis, with special emphasis, where appropriate, on data from non-mammalian vertebrates.

  2. Regulatory mechanisms of the acrosome reaction revealed by multiview microscopy of single starfish sperm

    PubMed Central

    1995-01-01

    The acrosome reaction in many animals is a coupled reaction involving an exocytotic step and a dramatic change in cell shape. It has been proposed that these morphological changes are regulated by intracellular ions such as Ca2+ and H+. We report here simultaneous visualization, under a multiview microscope, of intracellular free Ca2+ concentration ([Ca2+]i), intracellular pH (pHi), and morphological changes in a single starfish sperm (Asterina pectinifera). [Ca2+]i and pHi were monitored with the fluorescent probes indo-1 and SNARF-1, respectively. The acrosome reaction was induced with ionomycin. After the introduction of ionomycin in the medium, [Ca2+]i increased gradually and reached a plateau in approximately 30 s. The fusion of the acrosomal vacuole took place abruptly before the plateau, during the rising phase. Although the speed of the [Ca2+]i increase varied among the many sperm tested, exocytosis in all cases occurred at the same [Ca2+]i of approximately 2 microM (estimated using the dissociation constant of indo-1 for Ca2+ of 1.1 microM). This result suggests that the exocytotic mechanism in starfish sperm responds to [Ca2+]i rapidly, with a reaction time of the order of one second or less. Unlike the change in [Ca2+]i, an abrupt increase in pHi was observed immediately after exocytosis, suggesting the presence of a proton mobilizing system that is triggered by exocytosis. The rapid increase in pHi coincided with the formation of the acrosomal rod and the beginning of vigorous movement of the flagellum, both of which have been proposed to be pHi dependent. The exocytotic event itself was visualized with the fluorescent membrane probe RH292. The membrane of the acrosomal vacuole, concealed from the external medium in an unreacted sperm, was seen to fuse with the plasma membrane. PMID:7490297

  3. Endocannabinoids are Involved in Male Vertebrate Reproduction: Regulatory Mechanisms at Central and Gonadal Level

    PubMed Central

    Bovolin, Patrizia; Cottone, Erika; Pomatto, Valentina; Fasano, Silvia; Pierantoni, Riccardo; Cobellis, Gilda; Meccariello, Rosaria

    2014-01-01

    Endocannabinoids (eCBs) are natural lipids regulating a large array of physiological functions and behaviors in vertebrates. The eCB system is highly conserved in evolution and comprises several specific receptors (type-1 and type-2 cannabinoid receptors), their endogenous ligands (e.g., anandamide and 2-arachidonoylglycerol), and a number of biosynthetic and degradative enzymes. In the last few years, eCBs have been described as critical signals in the control of male and female reproduction at multiple levels: centrally, by targeting hypothalamic gonadotropin-releasing-hormone-secreting neurons and pituitary, and locally, with direct effects on the gonads. These functions are supported by the extensive localization of cannabinoid receptors and eCB metabolic enzymes at different levels of the hypothalamic–pituitary–gonadal axis in mammals, as well as bonyfish and amphibians. In vivo and in vitro studies indicate that eCBs centrally regulate gonadal functions by modulating the gonadotropin-releasing hormone–gonadotropin–steroid network through direct and indirect mechanisms. Several proofs of local eCB regulation have been found in the testis and male genital tracts, since eCBs control Sertoli and Leydig cells activity, germ cell progression, as well as the acquisition of sperm functions. A comparative approach usually is a key step in the study of physiological events leading to the building of a general model. Thus, in this review, we summarize the action of eCBs at different levels of the male reproductive axis, with special emphasis, where appropriate, on data from non-mammalian vertebrates. PMID:24782832

  4. Anaerobic transcription activation in Bacillus subtilis: identification of distinct FNR-dependent and -independent regulatory mechanisms.

    PubMed Central

    Cruz Ramos, H; Boursier, L; Moszer, I; Kunst, F; Danchin, A; Glaser, P

    1995-01-01

    Bacillus subtilis is able to grow anaerobically using alternative electron acceptors, including nitrate or fumarate. We characterized an operon encoding the dissimilatory nitrate reductase subunits homologous to the Escherichia coli narGHJI operon and the narK gene encoding a protein with nitrite extrusion activity. Downstream from narK and co-transcribed with it a gene (fnr) encoding a protein homologous to E.coli FNR was found. Disruption of fnr abolished both nitrate and fumarate utilization as electron acceptors and anaerobic induction of narK. Four putative FNR binding sites were found in B.subtilis sequences. The consensus sequence, centred at position -41.5, is identical to the consensus for the DNA site for E.coli CAP. Bs-FNR contained a four cysteine residue cluster at its C-terminal end. This is in contrast to Ec-FNR, where a similar cluster is present at the N-terminal end. It is possible that oxygen modulates the activity of both activators by a similar mechanism involving iron. Unlike in E.coli, where fnr expression is weakly repressed by anaerobiosis, fnr gene expression in B.subtilis is strongly activated by anaerobiosis. We have identified in the narK-fnr intergenic region a promotor activated by anaerobiosis independently of FNR. Thus induction of genes involved in anaerobic respiration requires in B.subtilis at least two levels of regulation: activation of fnr transcription and activation of FNR to induce transcription of FNR-dependent promoters. Images PMID:8846791

  5. Vpu Mediates Depletion of Interferon Regulatory Factor 3 during HIV Infection by a Lysosome-Dependent Mechanism

    PubMed Central

    Doehle, Brian P.; Chang, Kristina; Rustagi, Arjun; McNevin, John; McElrath, M. Juliana

    2012-01-01

    HIV has evolved sophisticated mechanisms to avoid restriction by intracellular innate immune defenses that otherwise serve to control acute viral infection and virus dissemination. Innate defenses are triggered when pattern recognition receptor (PRR) proteins of the host cell engage pathogen-associated molecule patterns (PAMPs) present in viral products. Interferon regulatory factor 3 (IRF3) plays a central role in PRR signaling of innate immunity to drive the expression of type I interferon (IFN) and interferon-stimulated genes (ISGs), including a variety of HIV restriction factors, that serve to limit viral replication directly and/or program adaptive immunity. Productive infection of T cells by HIV is dependent upon the targeted proteolysis of IRF3 that occurs through a virus-directed mechanism that results in suppression of innate immune defenses. However, the mechanisms by which HIV controls innate immune signaling and IRF3 function are not defined. Here, we examined the innate immune response induced by HIV strains identified through their differential control of PRR signaling. We identified viruses that, unlike typical circulating HIV strains, lack the ability to degrade IRF3. Our studies show that IRF3 regulation maps specifically to the HIV accessory protein Vpu. We define a molecular interaction between Vpu and IRF3 that redirects IRF3 to the endolysosome for proteolytic degradation, thus allowing HIV to avoid the innate antiviral immune response. Our studies reveal that Vpu is an important IRF3 regulator that supports acute HIV infection through innate immune suppression. These observations define the Vpu-IRF3 interface as a novel target for therapeutic strategies aimed at enhancing the immune response to HIV. PMID:22593165

  6. Vpu mediates depletion of interferon regulatory factor 3 during HIV infection by a lysosome-dependent mechanism.

    PubMed

    Doehle, Brian P; Chang, Kristina; Rustagi, Arjun; McNevin, John; McElrath, M Juliana; Gale, Michael

    2012-08-01

    HIV has evolved sophisticated mechanisms to avoid restriction by intracellular innate immune defenses that otherwise serve to control acute viral infection and virus dissemination. Innate defenses are triggered when pattern recognition receptor (PRR) proteins of the host cell engage pathogen-associated molecule patterns (PAMPs) present in viral products. Interferon regulatory factor 3 (IRF3) plays a central role in PRR signaling of innate immunity to drive the expression of type I interferon (IFN) and interferon-stimulated genes (ISGs), including a variety of HIV restriction factors, that serve to limit viral replication directly and/or program adaptive immunity. Productive infection of T cells by HIV is dependent upon the targeted proteolysis of IRF3 that occurs through a virus-directed mechanism that results in suppression of innate immune defenses. However, the mechanisms by which HIV controls innate immune signaling and IRF3 function are not defined. Here, we examined the innate immune response induced by HIV strains identified through their differential control of PRR signaling. We identified viruses that, unlike typical circulating HIV strains, lack the ability to degrade IRF3. Our studies show that IRF3 regulation maps specifically to the HIV accessory protein Vpu. We define a molecular interaction between Vpu and IRF3 that redirects IRF3 to the endolysosome for proteolytic degradation, thus allowing HIV to avoid the innate antiviral immune response. Our studies reveal that Vpu is an important IRF3 regulator that supports acute HIV infection through innate immune suppression. These observations define the Vpu-IRF3 interface as a novel target for therapeutic strategies aimed at enhancing the immune response to HIV.

  7. Frequency, Suppressive Capacity, Recruitment and Induction Mechanisms of Regulatory T Cells in Sinonasal Squamous Cell Carcinoma and Nasal Inverted Papilloma

    PubMed Central

    Li, Pingdong; Zhou, Weiguo; Wang, Yang; Fan, Erzhong; Li, Ying; Wang, Hong; Liu, Zhongyan; Xiao, Lei; Wang, Chengshuo; Zhang, Luo

    2015-01-01

    Background Sinonasal squamous cell carcinoma (SSCC) and nasal inverted papilloma (NIP) represent the predominant type of malignant and benign tumors in sinonasal tract, respectively. CD4+CD25+Foxp3+ natural regulatory T (Treg) cells might play critical role(s) in the suppression of anti-tumor immune response and thus shed light on tumor progression from benign to malignant. Objective This study aimed to evaluate the frequency and suppressive capacity of Treg cells in SSCC compared to NIP and further to explore the underlying mechanisms. Patients and Methods Frequencies of Treg, Th1 and Th2 cells were evaluated by flow cytometry in tissue homogenate and peripheral blood from 31 SSCC patients, 32 NIP patients and 35 normal controls. Treg cells were tested for regulatory function by co-culture with effector T cells. CCR4 and its ligands, CCL22 and CCL17, were analyzed by flow cytometry and Luminex, respectively. The chemoattractant properties of CCR4/CCL22 and CCR4/CCL17 for Treg cells were assessed using the Boyden chamber technique, to elucidate the potential mechanisms of Treg recruitment in tumor microenvironment. Treg cells induction via TGF-β was assessed with transwells after local CD4+Foxp3+ T cells were assessed by immunohistochemistry and TGF-β concentration was measured by Luminex. Results Tumor-infiltrating Treg cells increased significantly from normal to NIP to SSCC (P ≤ 0.001 for normal vs. NIP and P = 0.004 for NIP vs. SSCC). Significantly elevated frequency and enhanced suppression capacity of circulating Treg cells in SSCC were detected compared to NIP and healthy controls, concomitant with Th1 decrease and Th2 increase. Apparently increased CCL22 attracted CCR4-expressing Treg cells to tumor microenvironment in SSCC, compared to NIP. SSCC produced significantly more TGF-β than NIP and thus possessed greater potential for Treg cell induction. Conclusion Frequency and suppressive capacity of Treg cells enhanced with progression of malignancy from

  8. The central role of chloride in the metabolic acid-base changes in canine parvoviral enteritis.

    PubMed

    Burchell, Richard K; Schoeman, Johan P; Leisewitz, Andrew L

    2014-04-01

    The acid-base disturbances in canine parvoviral (CPV) enteritis are not well described. In addition, the mechanisms causing these perturbations have not been fully elucidated. The purpose of the present study was to assess acid-base changes in puppies suffering from CPV enteritis, using a modified strong ion model (SIM). The hypothesis of the study was that severe acid-base disturbances would be present and that the SIM would provide insights into pathological mechanisms, which have not been fully appreciated by the Henderson-Hasselbalch model. The study analysed retrospective data, obtained from 42 puppies with confirmed CPV enteritis and 10 healthy control dogs. The CPV-enteritis group had been allocated a clinical score, to allow classification of the data according to clinical severity. The effects of changes in free water, chloride, l-lactate, albumin and phosphate were calculated, using a modification of the base excess algorithm. When the data were summated for each patient, and correlated to each individual component, the most important contributor to the metabolic acid-base changes, according to the SIM, was chloride (P<0.001). Severely-affected animals tended to demonstrate hypochloraemic alkalosis, whereas mildly-affected puppies had a hyperchloraemic acidosis (P=0.007). In conclusion, the acid-base disturbances in CPV enteritis are multifactorial and complex, with the SIM providing information in terms of the origin of these changes.

  9. Fatty acid-based polyurethane films for wound dressing applications.

    PubMed

    Gultekin, Guncem; Atalay-Oral, Cigdem; Erkal, Sibel; Sahin, Fikret; Karastova, Djursun; Tantekin-Ersolmaz, S Birgul; Guner, F Seniha

    2009-01-01

    Fatty acid-based polyurethane films were prepared for use as potential wound dressing material. The polymerization reaction was carried out with or without catalyst. Polymer films were prepared by casting-evaporation technique with or without crosslink-catalyst. The film prepared from uncatalyzed reaction product with crosslink-catalyst gave slightly higher crosslink density. The mechanical tests showed that, the increase in the tensile strength and decrease in the elongation at break is due to the increase in the degree of crosslinking. All films were flexible, and resisted to acid solution. The films prepared without crosslink-catalyst were more hydrophilic, absorbed more water. The highest permeability values were generally obtained for the films prepared without crosslink catalyst. Both the direct contact method and the MMT test were applied for determination of cytotoxicity of polymer films and the polyurethane film prepared from uncatalyzed reaction product without crosslink-catalyst showed better biocompatibility property, closest to the commercial product, Opsite.

  10. Fatty acid-based polyurethane films for wound dressing applications.

    PubMed

    Gultekin, Guncem; Atalay-Oral, Cigdem; Erkal, Sibel; Sahin, Fikret; Karastova, Djursun; Tantekin-Ersolmaz, S Birgul; Guner, F Seniha

    2009-01-01

    Fatty acid-based polyurethane films were prepared for use as potential wound dressing material. The polymerization reaction was carried out with or without catalyst. Polymer films were prepared by casting-evaporation technique with or without crosslink-catalyst. The film prepared from uncatalyzed reaction product with crosslink-catalyst gave slightly higher crosslink density. The mechanical tests showed that, the increase in the tensile strength and decrease in the elongation at break is due to the increase in the degree of crosslinking. All films were flexible, and resisted to acid solution. The films prepared without crosslink-catalyst were more hydrophilic, absorbed more water. The highest permeability values were generally obtained for the films prepared without crosslink catalyst. Both the direct contact method and the MMT test were applied for determination of cytotoxicity of polymer films and the polyurethane film prepared from uncatalyzed reaction product without crosslink-catalyst showed better biocompatibility property, closest to the commercial product, Opsite. PMID:18839285

  11. Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis Campylobacter jejuni is a leading cause of food- and waterbourne bacterial gastroenteritis in the developed world. Although il...

  12. Myosin light chain kinase (MLCK) regulates cell migration in a myosin regulatory light chain phosphorylation-independent mechanism.

    PubMed

    Chen, Chen; Tao, Tao; Wen, Cheng; He, Wei-Qi; Qiao, Yan-Ning; Gao, Yun-Qian; Chen, Xin; Wang, Pei; Chen, Cai-Ping; Zhao, Wei; Chen, Hua-Qun; Ye, An-Pei; Peng, Ya-Jing; Zhu, Min-Sheng

    2014-10-10

    Myosin light chain kinase (MLCK) has long been implicated in the myosin phosphorylation and force generation required for cell migration. Here, we surprisingly found that the deletion of MLCK resulted in fast cell migration, enhanced protrusion formation, and no alteration of myosin light chain phosphorylation. The mutant cells showed reduced membrane tether force and fewer membrane F-actin filaments. This phenotype was rescued by either kinase-dead MLCK or five-DFRXXL motif, a MLCK fragment with potent F-actin-binding activity. Pull-down and co-immunoprecipitation assays showed that the absence of MLCK led to attenuated formation of transmembrane complexes, including myosin II, integrins and fibronectin. We suggest that MLCK is not required for myosin phosphorylation in a migrating cell. A critical role of MLCK in cell migration involves regulating the cell membrane tension and protrusion necessary for migration, thereby stabilizing the membrane skeleton through F-actin-binding activity. This finding sheds light on a novel regulatory mechanism of protrusion during cell migration.

  13. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato.

    PubMed

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-12-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  14. Transcriptome Profiling Reveals the Regulatory Mechanism Underlying Pollination Dependent and Parthenocarpic Fruit Set Mainly Mediated by Auxin and Gibberellin

    PubMed Central

    Tang, Ning; Deng, Wei; Hu, Guojian; Hu, Nan; Li, Zhengguo

    2015-01-01

    Background Fruit set is a key process for crop production in tomato which occurs after successful pollination and fertilization naturally. However, parthenocarpic fruit development can be uncoupled from fertilization triggered by exogenous auxin or gibberellins (GAs). Global transcriptome knowledge during fruit initiation would help to characterize the molecular mechanisms by which these two hormones regulate pollination-dependent and -independent fruit set. Principal Findings In this work, digital gene expression tag profiling (DGE) technology was applied to compare the transcriptomes from pollinated and 2, 4-D/GA3-treated ovaries. Activation of carbohydrate metabolism, cell division and expansion as well as the down-regulation of MADS-box is a comprehensive regulatory pathway during pollination-dependent and parthenocarpic fruit set. The signaling cascades of auxin and GA are significantly modulated. The feedback regulations of Aux/IAAs and DELLA genes which functioned to fine-tune auxin and GA response respectively play fundamental roles in triggering fruit initiation. In addition, auxin regulates GA synthesis via up-regulation of GA20ox1 and down-regulation of KNOX. Accordingly, the effect of auxin on fruit set is mediated by GA via ARF2 and IAA9 down-regulation, suggesting that both pollination-dependent and parthenocarpic fruit set depend on the crosstalk between auxin and GA. Significance This study characterizes the transcriptomic features of ovary development and more importantly unravels the integral roles of auxin and GA on pollination-dependent and parthenocarpic fruit set. PMID:25909657

  15. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato

    PubMed Central

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-01-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  16. Inhibition of protein synthesis by TOR inactivation revealed a conserved regulatory mechanism of the BiP chaperone in Chlamydomonas.

    PubMed

    Díaz-Troya, Sandra; Pérez-Pérez, María Esther; Pérez-Martín, Marta; Moes, Suzette; Jeno, Paul; Florencio, Francisco J; Crespo, José L

    2011-10-01

    The target of rapamycin (TOR) kinase integrates nutritional and stress signals to coordinately control cell growth in all eukaryotes. TOR associates with highly conserved proteins to constitute two distinct signaling complexes termed TORC1 and TORC2. Inactivation of TORC1 by rapamycin negatively regulates protein synthesis in most eukaryotes. Here, we report that down-regulation of TOR signaling by rapamycin in the model green alga Chlamydomonas reinhardtii resulted in pronounced phosphorylation of the endoplasmic reticulum chaperone BiP. Our results indicated that Chlamydomonas TOR regulates BiP phosphorylation through the control of protein synthesis, since rapamycin and cycloheximide have similar effects on BiP modification and protein synthesis inhibition. Modification of BiP by phosphorylation was suppressed under conditions that require the chaperone activity of BiP, such as heat shock stress or tunicamycin treatment, which inhibits N-linked glycosylation of nascent proteins in the endoplasmic reticulum. A phosphopeptide localized in the substrate-binding domain of BiP was identified in Chlamydomonas cells treated with rapamycin. This peptide contains a highly conserved threonine residue that might regulate BiP function, as demonstrated by yeast functional assays. Thus, our study has revealed a regulatory mechanism of BiP in Chlamydomonas by phosphorylation/dephosphorylation events and assigns a role to the TOR pathway in the control of BiP modification.

  17. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato.

    PubMed

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-12-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato.

  18. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    DOE PAGES

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-29

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations tomore » the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal mol-1. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called 'finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive

  19. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    PubMed Central

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-01

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal/mol. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called `finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle and

  20. Mechanisms of immune suppression by interleukin-10 and transforming growth factor-β: the role of T regulatory cells

    PubMed Central

    Taylor, Alison; Verhagen, Johan; Blaser, Kurt; Akdis, Mübeccel; Akdis, Cezmi A

    2006-01-01

    Specific immune suppression and induction of tolerance are essential processes in the regulation and circumvention of immune defence. The balance between allergen-specific type 1 regulatory (Tr1) cells and T helper (Th) 2 cells appears to be decisive in the development of allergy. Tr1 cells consistently represent the dominant subset specific for common environmental allergens in healthy individuals. In contrast, there is a high frequency of allergen-specific interleukin-4 (IL-4)-secreting T cells in allergic individuals. Allergen-specific immunotherapy can induce specific Tr1 cells that abolish allergen-induced proliferation of Th1 and Th2 cells, as well as their cytokine production. Tr1 cells utilize multiple suppressor mechanisms, such as IL-10 and transforming growth factor-β (TGF-β) as secreted cytokines and various surface molecules, such as cytotoxic T-lymphocyte antigen 4 and programmed death-1. IL-10 only inhibits T cells stimulated by low numbers of triggered T-cell receptors, which depend on CD28 costimulation. IL-10 inhibits CD28 tyrosine phosphorylation, preventing the binding of phosphatidylinositol 3-kinase p85 and consequently inhibiting the CD28 signalling pathway. In addition, IL-10 and TGF-β secreted by Tr1 cells skew the antibody production from immunoglobulin E (IgE) towards the non-inflammatory isotypes IgG4 and IgA, respectively. Induction of antigen-specific Tr1 cells can thus re-direct an inappropriate immune response against allergens or auto-antigens using a broad range of suppressor mechanisms. PMID:16556256

  1. The function of the RNA-binding protein TEL1 in moss reveals ancient regulatory mechanisms of shoot development.

    PubMed

    Vivancos, Julien; Spinner, Lara; Mazubert, Christelle; Charlot, Florence; Paquet, Nicolas; Thareau, Vincent; Dron, Michel; Nogué, Fabien; Charon, Céline

    2012-03-01

    The shoot represents the basic body plan in land plants. It consists of a repeated structure composed of stems and leaves. Whereas vascular plants generate a shoot in their diploid phase, non-vascular plants such as mosses form a shoot (called the gametophore) in their haploid generation. The evolution of regulatory mechanisms or genetic networks used in the development of these two kinds of shoots is unclear. TERMINAL EAR1-like genes have been involved in diploid shoot development in vascular plants. Here, we show that disruption of PpTEL1 from the moss Physcomitrella patens, causes reduced protonema growth and gametophore initiation, as well as defects in gametophore development. Leafy shoots formed on ΔTEL1 mutants exhibit shorter stems with more leaves per shoot, suggesting an accelerated leaf initiation (shortened plastochron), a phenotype shared with the Poaceae vascular plants TE1 and PLA2/LHD2 mutants. Moreover, the positive correlation between plastochron length and leaf size observed in ΔTEL1 mutants suggests a conserved compensatory mechanism correlating leaf growth and leaf initiation rate that would minimize overall changes in plant biomass. The RNA-binding protein encoded by PpTEL1 contains two N-terminus RNA-recognition motifs, and a third C-terminus non-canonical RRM, specific to TEL proteins. Removal of the PpTEL1 C-terminus (including this third RRM) or only 16-18 amino acids within it seriously impairs PpTEL1 function, suggesting a critical role for this third RRM. These results show a conserved function of the RNA-binding PpTEL1 protein in the regulation of shoot development, from early ancestors to vascular plants, that depends on the third TEL-specific RRM.

  2. Using quantitative acid-base analysis in the ICU.

    PubMed

    Lloyd, P; Freebairn, R

    2006-03-01

    The quantitative acid-base 'Strong Ion' calculator is a practical application of quantitative acid-base chemistry, as developed by Peter Stewart and Peter Constable. It quantifies the three independent factors that control acidity, calculates the concentration and charge of unmeasured ions, produces a report based on these calculations and displays a Gamblegram depicting measured ionic species. Used together with the medical history, quantitative acid-base analysis has advantages over traditional approaches.

  3. Regulatory Mechanisms That Prevent Re-initiation of DNA Replication Can Be Locally Modulated at Origins by Nearby Sequence Elements

    PubMed Central

    Richardson, Christopher D.; Li, Joachim J.

    2014-01-01

    Eukaryotic cells must inhibit re-initiation of DNA replication at each of the thousands of origins in their genome because re-initiation can generate genomic alterations with extraordinary frequency. To minimize the probability of re-initiation from so many origins, cells use a battery of regulatory mechanisms that reduce the activity of replication initiation proteins. Given the global nature of these mechanisms, it has been presumed that all origins are inhibited identically. However, origins re-initiate with diverse efficiencies when these mechanisms are disabled, and this diversity cannot be explained by differences in the efficiency or timing of origin initiation during normal S phase replication. This observation raises the possibility of an additional layer of replication control that can differentially regulate re-initiation at distinct origins. We have identified novel genetic elements that are necessary for preferential re-initiation of two origins and sufficient to confer preferential re-initiation on heterologous origins when the control of re-initiation is partially deregulated. The elements do not enhance the S phase timing or efficiency of adjacent origins and thus are specifically acting as re-initiation promoters (RIPs). We have mapped the two RIPs to ∼60 bp AT rich sequences that act in a distance- and sequence-dependent manner. During the induction of re-replication, Mcm2-7 reassociates both with origins that preferentially re-initiate and origins that do not, suggesting that the RIP elements can overcome a block to re-initiation imposed after Mcm2-7 associates with origins. Our findings identify a local level of control in the block to re-initiation. This local control creates a complex genomic landscape of re-replication potential that is revealed when global mechanisms preventing re-replication are compromised. Hence, if re-replication does contribute to genomic alterations, as has been speculated for cancer cells, some regions of the genome

  4. Photochemistry of nucleic acid bases and their thio- and aza-analogues in solution.

    PubMed

    Pollum, Marvin; Martínez-Fernández, Lara; Crespo-Hernández, Carlos E

    2015-01-01

    The steady-state and time-resolved photochemistry of the natural nucleic acid bases and their sulfur- and nitrogen-substituted analogues in solution is reviewed. Emphasis is given to the experimental studies performed over the last 3-5 years that showcase topical areas of scientific inquiry and those that require further scrutiny. Significant progress has been made toward mapping the radiative and nonradiative decay pathways of nucleic acid bases. There is a consensus that ultrafast internal conversion to the ground state is the primary relaxation pathway in the nucleic acid bases, whereas the mechanism of this relaxation and the level of participation of the (1)πσ*, (1) nπ*, and (3)ππ* states are still matters of debate. Although impressive research has been performed in recent years, the microscopic mechanism(s) by which the nucleic acid bases dissipate excess vibrational energy to their environment, and the role of the N-glycosidic group in this and in other nonradiative decay pathways, are still poorly understood. The simple replacement of a single atom in a nucleobase with a sulfur or nitrogen atom severely restricts access to the conical intersections responsible for the intrinsic internal conversion pathways to the ground state in the nucleic acid bases. It also enhances access to ultrafast and efficient inter-system crossing pathways that populate the triplet manifold in yields close to unity. Determining the coupled nuclear and electronic pathways responsible for the significantly different photochemistry in these nucleic acid base analogues serves as a convenient platform to examine the current state of knowledge regarding the photodynamic properties of the DNA and RNA bases from both experimental and computational perspectives. Further investigations should also aid in forecasting the prospective use of sulfur- and nitrogen-substituted base analogues in photochemotherapeutic applications. PMID:25238718

  5. Strong Ion Regulatory Abilities Enable the Crab Xenograpsus testudinatus to Inhabit Highly Acidified Marine Vent Systems

    PubMed Central

    Hu, Marian Y.; Guh, Ying-Jey; Shao, Yi-Ta; Kuan, Pou-Long; Chen, Guan-Lin; Lee, Jay-Ron; Jeng, Ming-Shiou; Tseng, Yung-Che

    2016-01-01

    Hydrothermal vent organisms have evolved physiological adaptations to cope with extreme abiotic conditions including temperature and pH. To date, acid-base regulatory abilities of vent organisms are poorly investigated, although this physiological feature is essential for survival in low pH environments. We report the acid-base regulatory mechanisms of a hydrothermal vent crab, Xenograpsus testudinatus, endemic to highly acidic shallow-water vent habitats with average environment pH-values ranging between 5.4 and 6.6. Within a few hours, X. testudinatus restores extracellular pH (pHe) in response to environmental acidification of pH 6.5 (1.78 kPa pCO2) accompanied by an increase in blood HCO3- levels from 8.8 ± 0.3 to 31 ± 6 mM. Branchial Na+/K+-ATPase (NKA) and V-type H+-ATPase (VHA), the major ion pumps involved in branchial acid-base regulation, showed dynamic increases in response to acidified conditions on the mRNA, protein and activity level. Immunohistochemical analyses demonstrate the presence of NKA in basolateral membranes, whereas the VHA is predominantly localized in cytoplasmic vesicles of branchial epithelial- and pillar-cells. X. testudinatus is closely related to other strong osmo-regulating brachyurans, which is also reflected in the phylogeny of the NKA. Accordingly, our results suggest that the evolution of strong ion regulatory abilities in brachyuran crabs that allowed the occupation of ecological niches in euryhaline, freshwater, and terrestrial habitats are probably also linked to substantial acid-base regulatory abilities. This physiological trait allowed X. testudinatus to successfully inhabit one of the world's most acidic marine environments. PMID:26869933

  6. The in Silico Insight into Carbon Nanotube and Nucleic Acid Bases Interaction

    PubMed Central

    Karimi, Ali Asghar; Ghalandari, Behafarid; Tabatabaie, Seyed Saleh; Farhadi, Mohammad

    2016-01-01

    Background To explore practical applications of carbon nanotubes (CNTs) in biomedical fields the properties of their interaction with biomolecules must be revealed. Recent years, the interaction of CNTs with biomolecules is a subject of research interest for practical applications so that previous research explored that CNTs have complementary structure properties with single strand DNA (ssDNA). Objectives Hence, the quantum mechanics (QM) method based on ab initio was used for this purpose. Therefore values of binding energy, charge distribution, electronic energy and other physical properties of interaction were studied for interaction of nucleic acid bases and SCNT. Materials and Methods In this study, the interaction between nucleic acid bases and a (4, 4) single-walled carbon nanotube (SCNT) were investigated through calculations within quantum mechanics (QM) method at theoretical level of Hartree-Fock (HF) method using 6-31G basis set. Hence, the physical properties such as electronic energy, total dipole moment, charge distributions and binding energy of nucleic acid bases interaction with SCNT were investigated based on HF method. Results It has been found that the guanine base adsorption is bound stronger to the outer surface of nanotube in comparison to the other bases, consistent with the recent theoretical studies. In the other words, the results explored that guanine interaction with SCNT has optimum level of electronic energy so that their interaction is stable. Also, the calculations illustrated that SCNT interact to nucleic acid bases by noncovalent interaction because of charge distribution an electrostatic area is created in place of interaction. Conclusions Consequently, small diameter SCNT interaction with nucleic acid bases is noncovalent. Also, the results revealed that small diameter SCNT interaction especially SCNT (4, 4) with nucleic acid bases can be useful in practical application area of biomedical fields such detection and drug delivery

  7. Review: regulatory mechanisms of gonadotropin-inhibitory hormone (GnIH) synthesis and release in photoperiodic animals

    PubMed Central

    Tsutsui, Kazuyoshi; Ubuka, Takayoshi; Bentley, George E.; Kriegsfeld, Lance J.

    2013-01-01

    Gonadotropin-inhibitory hormone (GnIH) is a novel hypothalamic neuropeptide that was discovered in quail as an inhibitory factor for gonadotropin release. GnIH inhibits gonadotropin synthesis and release in birds through actions on gonadotropin-releasing hormone (GnRH) neurons and gonadotropes, mediated via the GnIH receptor (GnIH-R), GPR147. Subsequently, GnIH was identified in mammals and other vertebrates. As in birds, mammalian GnIH inhibits gonadotropin secretion, indicating a conserved role for this neuropeptide in the control of the hypothalamic-pituitary-gonadal (HPG) axis across species. Identification of the regulatory mechanisms governing GnIH expression and release is important in understanding the physiological role of the GnIH system. A nocturnal hormone, melatonin, appears to act directly on GnIH neurons through its receptor to induce expression and release of GnIH in quail, a photoperiodic bird. Recently, a similar, but opposite, action of melatonin on the inhibition of expression of mammalian GnIH was shown in hamsters and sheep, photoperiodic mammals. These results in photoperiodic animals demonstrate that GnIH expression is photoperiodically modulated via a melatonin-dependent process. Recent findings indicate that GnIH may be a mediator of stress-induced reproductive disruption in birds and mammals, pointing to a broad role for this neuropeptide in assessing physiological state and modifying reproductive effort accordingly. This paper summarizes the advances made in our knowledge regarding the regulation of GnIH synthesis and release in photoperiodic birds and mammals. This paper also discusses the neuroendocrine integration of environmental signals, such as photoperiods and stress, and internal signals, such as GnIH, melatonin, and glucocorticoids, to control avian and mammalian reproduction. PMID:23596387

  8. Review: regulatory mechanisms of gonadotropin-inhibitory hormone (GnIH) synthesis and release in photoperiodic animals.

    PubMed

    Tsutsui, Kazuyoshi; Ubuka, Takayoshi; Bentley, George E; Kriegsfeld, Lance J

    2013-01-01

    Gonadotropin-inhibitory hormone (GnIH) is a novel hypothalamic neuropeptide that was discovered in quail as an inhibitory factor for gonadotropin release. GnIH inhibits gonadotropin synthesis and release in birds through actions on gonadotropin-releasing hormone (GnRH) neurons and gonadotropes, mediated via the GnIH receptor (GnIH-R), GPR147. Subsequently, GnIH was identified in mammals and other vertebrates. As in birds, mammalian GnIH inhibits gonadotropin secretion, indicating a conserved role for this neuropeptide in the control of the hypothalamic-pituitary-gonadal (HPG) axis across species. Identification of the regulatory mechanisms governing GnIH expression and release is important in understanding the physiological role of the GnIH system. A nocturnal hormone, melatonin, appears to act directly on GnIH neurons through its receptor to induce expression and release of GnIH in quail, a photoperiodic bird. Recently, a similar, but opposite, action of melatonin on the inhibition of expression of mammalian GnIH was shown in hamsters and sheep, photoperiodic mammals. These results in photoperiodic animals demonstrate that GnIH expression is photoperiodically modulated via a melatonin-dependent process. Recent findings indicate that GnIH may be a mediator of stress-induced reproductive disruption in birds and mammals, pointing to a broad role for this neuropeptide in assessing physiological state and modifying reproductive effort accordingly. This paper summarizes the advances made in our knowledge regarding the regulation of GnIH synthesis and release in photoperiodic birds and mammals. This paper also discusses the neuroendocrine integration of environmental signals, such as photoperiods and stress, and internal signals, such as GnIH, melatonin, and glucocorticoids, to control avian and mammalian reproduction.

  9. Bacillus subtilis as a platform for molecular characterisation of regulatory mechanisms of Enterococcus faecalis resistance against cell wall antibiotics.

    PubMed

    Fang, Chong; Stiegeler, Emanuel; Cook, Gregory M; Mascher, Thorsten; Gebhard, Susanne

    2014-01-01

    To combat antibiotic resistance of Enterococcus faecalis, a better understanding of the molecular mechanisms, particularly of antibiotic detection, signal transduction and gene regulation is needed. Because molecular studies in this bacterium can be challenging, we aimed at exploiting the genetically highly tractable Gram-positive model organism Bacillus subtilis as a heterologous host. Two fundamentally different regulators of E. faecalis resistance against cell wall antibiotics, the bacitracin sensor BcrR and the vancomycin-sensing two-component system VanSB-VanRB, were produced in B. subtilis and their functions were monitored using target promoters fused to reporter genes (lacZ and luxABCDE). The bacitracin resistance system BcrR-BcrAB of E. faecalis was fully functional in B. subtilis, both regarding regulation of bcrAB expression and resistance mediated by the transporter BcrAB. Removal of intrinsic bacitracin resistance of B. subtilis increased the sensitivity of the system. The lacZ and luxABCDE reporters were found to both offer sensitive detection of promoter induction on solid media, which is useful for screening of large mutant libraries. The VanSB-VanRB system displayed a gradual dose-response behaviour to vancomycin, but only when produced at low levels in the cell. Taken together, our data show that B. subtilis is a well-suited host for the molecular characterization of regulatory systems controlling resistance against cell wall active compounds in E. faecalis. Importantly, B. subtilis facilitates the careful adjustment of expression levels and genetic background required for full functionality of the introduced regulators.

  10. Spectral changes of near-infrared spectroscopy signals in migraineurs with aura reveal an impaired carbon dioxide-regulatory mechanism.

    PubMed

    Liboni, William; Molinari, Filippo; Allais, Gianni; Mana, Ornella; Negri, Emanuela; Bussone, Gennaro; D'Andrea, Giovanni; Benedetto, Chiara

    2009-05-01

    Subjects suffering from migraine with aura (MwA) present an altered cerebral autoregulation during migraine attacks. It is still unclear whether MwA sufferers present a normal autoregulation during attack-free periods. In this study, we characterized cerebral autoregulation in the frequency domain by analyzing the spontaneous oscillations superimposed on the cerebral hemodynamic signals, as detected by near-infrared spectroscopy (NIRS). Ten healthy women (age: 38.4 +/- 9.5 years) and ten women suffering from MwA (age: 35.2 +/- 10.5 years) underwent NIRS recording in resting conditions and during breath-holding (BH). Being the NIRS signals during BH nonstationary, we used the Choi-Williams time-frequency distribution to perform spectral analysis. We considered 256 s of signals and quantified the variation in the power of the very-low frequencies (VLF: 20-40 mHz) and of the low frequencies (LF: 40-140 mHz) as response to BH. Results showed that BH increases the power in the LF band both in healthy and MwA subjects. Considering the signal of the deoxygenated hemoglobin, the average power increase in the LF band was equal to 20% +/- 15.4% for the healthy group and significantly lower, 4.8% +/- 8.3%, in the MwA group (Student's t test, P < 0.02). No significant difference was observed in the VLF band or in the oxygenated hemoglobin signal power variations of the LF and VLF bands. The resulting data reveal a possible impairment in the carbon dioxide-regulatory mechanism in MwA subjects.

  11. Regulatory mechanisms and the role of calcium and potassium channels controlling supercontractile crop muscles in adult Phormia regina.

    PubMed

    Solari, Paolo; Stoffolano, John G; Fitzpatrick, Joanna; Gelperin, Alan; Thomson, Alan; Talani, Giuseppe; Sanna, Enrico; Liscia, Anna

    2013-09-01

    Bioassays and electrophysiological recordings were conducted in the adult blowfly Phormia regina to provide new insights into the regulatory mechanisms governing the crop filling and emptying processes of the supercontractile crop muscles. The cibarial pump drives ingestion. Simultaneous multisite extracellular recordings show that crop lobe (P5) distension during ingestion of a 4.7 μl sugar meal does not require muscle activity by any of the other pumps of the system. Conversely, pumping of fluids toward the anterior of the crop system during crop emptying is brought about by active muscle contraction, in the form of a highly coordinated peristaltic wave starting from P5 and progressively propagating to P6, P4 and P3 pumps, with P5 contracting with a frequency about 3.4 times higher than the other pumps. The crop contraction rate is also modulated by hemolymph-borne factors such as sugars, through ligand recognition at a presumptive receptor site rather than by an osmotic effect, as assessed by both behavioural and electrophysiological experiments. In this respect, sugars of equal osmolarity produce different effects, glucose being inhibitory and mannose ineffective for crop muscles, while trehalose enhances crop activity. Finally, voltage and current clamp experiments show that the muscle action potentials (mAPs) at the P4 pump are sustained by a serotonin-sensitive calcium conductance. Serotonin enhances calcium entry into the muscle cells and this could lead, as an indirect modulatory effect, to activation of a Ca(2+)-activated K(+) conductance (IK(Ca)), which sustains the following mAP repolarization phase in such a way that further mAPs can be generated early and the frequency consequently increased. PMID:23834826

  12. A Closer Look at Acid-Base Olfactory Titrations

    ERIC Educational Resources Information Center

    Neppel, Kerry; Oliver-Hoyo, Maria T.; Queen, Connie; Reed, Nicole

    2005-01-01

    Olfactory titrations using raw onions and eugenol as acid-base indicators are reported. An in-depth investigation on olfactory titrations is presented to include requirements for potential olfactory indicators and protocols for using garlic, onions, and vanillin as acid-base olfactory indicators are tested.

  13. A Modern Approach to Acid-Base Chemistry

    ERIC Educational Resources Information Center

    Drago, Russell S.

    1974-01-01

    Summarizes current status of our knowledge about acid-base interactions, including Lewis considerations, experimental design, data about donor-acceptor systems, common misconceptions, and hard-soft acid-base model. Indicates that there is the possibility of developing unifying concepts for chemical reactions of inorganic compounds. (CC)

  14. Assessment of acid-base balance. Stewart's approach.

    PubMed

    Fores-Novales, B; Diez-Fores, P; Aguilera-Celorrio, L J

    2016-04-01

    The study of acid-base equilibrium, its regulation and its interpretation have been a source of debate since the beginning of 20th century. Most accepted and commonly used analyses are based on pH, a notion first introduced by Sorensen in 1909, and on the Henderson-Hasselbalch equation (1916). Since then new concepts have been development in order to complete and make easier the understanding of acid-base disorders. In the early 1980's Peter Stewart brought the traditional interpretation of acid-base disturbances into question and proposed a new method. This innovative approach seems more suitable for studying acid-base abnormalities in critically ill patients. The aim of this paper is to update acid-base concepts, methods, limitations and applications.

  15. Awareness of federal regulatory mechanisms relevant to community-engaged research: survey of health disparities-oriented NIH-funded investigators

    PubMed Central

    Fullerton, Stephanie M.; Anderson, Emily E.; Cowan, Ketch; Malen, Rachel C.; Brugge, Doug

    2015-01-01

    Few studies or investigators involved in community engaged research or community-based participatory research have examined awareness and adoption of federal regulatory mechanisms. We conducted a survey of investigators affiliated with the ten National Institutes of Health (NIH) Centers for Population Health and Health Disparities. A questionnaire designed to capture experience with the conduct and oversight of community engaged research, and awareness of pertinent regulatory mechanisms, including Federalwide Assurances (FWAs), Individual Investigator Agreements (IIAs), and Institutional Review Board Authorization Agreements (IAAs), was completed by 101 respondents (68% response rate). Although most were aware of FWAs, only a minority of those surveyed reported knowledge of IAAs and IIAs and even fewer had used them in their research with community partners. Implications for future training and oversight are discussed. PMID:25742662

  16. Poly (ricinoleic acid) based novel thermosetting elastomer.

    PubMed

    Ebata, Hiroki; Yasuda, Mayumi; Toshima, Kazunobu; Matsumura, Shuichi

    2008-01-01

    A novel bio-based thermosetting elastomer was prepared by the lipase-catalyzed polymerization of methyl ricinoleate with subsequent vulcanization. Some mechanical properties of the cured carbon black-filled polyricinoleate compounds were evaluated as a thermosetting elastomer. It was found that the carbon black-filled polyricinoleate compounds were readily cured by sulfur curatives to produce a thermosetting elastomer that formed a rubber-like sheet with a smooth and non-sticky surface. The curing behaviors and mechanical properties were dependent on both the molecular weight of the polyricinoleate and the amount of the sulfur curatives. Cured compounds consisting of polyricinoleate with a molecular weight of 100,800 showed good mechanical properties, such as a hardness of 48 A based on the durometer A measurements, a tensile strength at break of 6.91 MPa and an elongation at break of 350%. PMID:18469493

  17. Contrasting Evolutionary Dynamics of the Developmental Regulator PAX9, among Bats, with Evidence for a Novel Post-Transcriptional Regulatory Mechanism

    PubMed Central

    Phillips, Caleb D.; Butler, Boyd; Fondon, John W.; Mantilla-Meluk, Hugo; Baker, Robert J.

    2013-01-01

    Morphological evolution can be the result of natural selection favoring modification of developmental signaling pathways. However, little is known about the genetic basis of such phenotypic diversity. Understanding these mechanisms is difficult for numerous reasons, yet studies in model organisms often provide clues about the major developmental pathways involved. The paired-domain gene, PAX9, is known to be a key regulator of development, particularly of the face and teeth. In this study, using a comparative genetics approach, we investigate PAX9 molecular evolution among mammals, focusing on craniofacially diversified (Phyllostomidae) and conserved (Vespertilionidae) bat families, and extend our comparison to other orders of mammal. Open-reading frame analysis disclosed signatures of selection, in which a small percentage of residues vary, and lineages acquire different combinations of variation through recurrent substitution and lineage specific changes. A few instances of convergence for specific residues were observed between morphologically convergent bat lineages. Bioinformatic analysis for unknown PAX9 regulatory motifs indicated a novel post-transcriptional regulatory mechanism involving a Musashi protein. This regulation was assessed through fluorescent reporter assays and gene knockdowns. Results are compatible with the hypothesis that the number of Musashi binding-elements in PAX9 mRNA proportionally regulates protein translation rate. Although a connection between morphology and binding element frequency was not apparent, results indicate this regulation would vary among craniofacially divergent bat species, but be static among conserved species. Under this model, Musashi’s regulatory control of alternative human PAX9 isoforms would also vary. The presence of Musashi-binding elements within PAX9 of all mammals examined, chicken, zebrafish, and the fly homolog of PAX9, indicates this regulatory mechanism is ancient, originating basal to much of the

  18. Acid-base transport by the renal proximal tubule

    PubMed Central

    Skelton, Lara A.; Boron, Walter F.; Zhou, Yuehan

    2015-01-01

    Each day, the kidneys filter 180 L of blood plasma, equating to some 4,300 mmol of the major blood buffer, bicarbonate (HCO3−). The glomerular filtrate enters the lumen of the proximal tubule (PT), and the majority of filtered HCO3− is reclaimed along the early (S1) and convoluted (S2) portions of the PT in a manner coupled to the secretion of H+ into the lumen. The PT also uses the secreted H+ to titrate non-HCO3− buffers in the lumen, in the process creating “new HCO3−” for transport into the blood. Thus, the PT – along with more distal renal segments – is largely responsible for regulating plasma [HCO3−]. In this review we first focus on the milestone discoveries over the past 50+ years that define the mechanism and regulation of acid-base transport by the proximal tubule. Further on in the review, we will summarize research still in progress from our laboratory, work that addresses the problem of how the PT is able to finely adapt to acid–base disturbances by rapidly sensing changes in basolateral levels of HCO3− and CO2 (but not pH), and thereby to exert tight control over the acid–base composition of the blood plasma. PMID:21170887

  19. [Development of Nucleic Acid-Based Adjuvant for Cancer Immunotherapy].

    PubMed

    Kobiyama, Kouji; Ishii, Ken J

    2015-09-01

    Since the discovery of the human T cell-defined tumor antigen, the cancer immunotherapy field has rapidly progressed, with the research and development of cancer immunotherapy, including cancer vaccines, being conducted actively. However, the disadvantages of most cancer vaccines include relatively weak immunogenicity and immune escape or exhaustion. Adjuvants with innate immunostimulatory activities have been used to overcome these issues, and these agents have been shown to enhance the immunogenicity of cancer vaccines and to act as mono-therapeutic anti-tumor agents. CpG ODN, an agonist for TLR9, is one of the promising nucleic acid-based adjuvants, and it is a potent inducer of innate immune effector functions. CpG ODN suppresses tumor growth in the absence of tumor antigens and peptide administration. Therefore, CpG ODN is expected to be useful as a cancer vaccine adjuvant as well as a cancer immunotherapy agent. In this review, we discuss the potential therapeutic applications and mechanisms of CpG ODN for cancer immunotherapy.

  20. Acid-base transport in pancreas—new challenges

    PubMed Central

    Novak, Ivana; Haanes, Kristian A.; Wang, Jing

    2013-01-01

    Along the gastrointestinal tract a number of epithelia contribute with acid or basic secretions in order to aid digestive processes. The stomach and pancreas are the most extreme examples of acid (H+) and base (HCO−3) transporters, respectively. Nevertheless, they share the same challenges of transporting acid and bases across epithelia and effectively regulating their intracellular pH. In this review, we will make use of comparative physiology to enlighten the cellular mechanisms of pancreatic HCO−3 and fluid secretion, which is still challenging physiologists. Some of the novel transporters to consider in pancreas are the proton pumps (H+-K+-ATPases), as well as the calcium-activated K+ and Cl− channels, such as KCa3.1 and TMEM16A/ANO1. Local regulators, such as purinergic signaling, fine-tune, and coordinate pancreatic secretion. Lastly, we speculate whether dys-regulation of acid-base transport contributes to pancreatic diseases including cystic fibrosis, pancreatitis, and cancer. PMID:24391597

  1. [Development of Nucleic Acid-Based Adjuvant for Cancer Immunotherapy].

    PubMed

    Kobiyama, Kouji; Ishii, Ken J

    2015-09-01

    Since the discovery of the human T cell-defined tumor antigen, the cancer immunotherapy field has rapidly progressed, with the research and development of cancer immunotherapy, including cancer vaccines, being conducted actively. However, the disadvantages of most cancer vaccines include relatively weak immunogenicity and immune escape or exhaustion. Adjuvants with innate immunostimulatory activities have been used to overcome these issues, and these agents have been shown to enhance the immunogenicity of cancer vaccines and to act as mono-therapeutic anti-tumor agents. CpG ODN, an agonist for TLR9, is one of the promising nucleic acid-based adjuvants, and it is a potent inducer of innate immune effector functions. CpG ODN suppresses tumor growth in the absence of tumor antigens and peptide administration. Therefore, CpG ODN is expected to be useful as a cancer vaccine adjuvant as well as a cancer immunotherapy agent. In this review, we discuss the potential therapeutic applications and mechanisms of CpG ODN for cancer immunotherapy. PMID:26469159

  2. Distinct regulatory mechanisms of the human ferritin gene by hypoxia and hypoxia mimetic cobalt chloride at the transcriptional and post-transcriptional levels.

    PubMed

    Huang, Bo-Wen; Miyazawa, Masaki; Tsuji, Yoshiaki

    2014-12-01

    Cobalt chloride has been used as a hypoxia mimetic because it stabilizes hypoxia inducible factor-1α (HIF1-α) and activates gene transcription through a hypoxia responsive element (HRE). However, differences between hypoxia and hypoxia mimetic cobalt chloride in gene regulation remain elusive. Expression of ferritin, the major iron storage protein, is regulated at the transcriptional and posttranscriptional levels through DNA and RNA regulatory elements. Here we demonstrate that hypoxia and cobalt chloride regulate ferritin heavy chain (ferritin H) expression by two distinct mechanisms. Both hypoxia and cobalt chloride increased HIF1-α but a putative HRE in the human ferritin H gene was not activated. Instead, cobalt chloride but not hypoxia activated ferritin H transcription through an antioxidant responsive element (ARE), to which Nrf2 was recruited. Intriguingly, cobalt chloride downregulated ferritin H protein expression while it upregulated other ARE-regulated antioxidant genes in K562 cells. Further characterization demonstrated that cobalt chloride increased interaction between iron regulatory proteins (IRP1 and IRP2) and iron responsive element (IRE) in the 5'UTR of ferritin H mRNA, resulting in translational block of the accumulated ferritin H mRNA. In contrast, hypoxia had marginal effect on ferritin H transcription but increased its translation through decreased IRP1-IRE interaction. These results suggest that hypoxia and hypoxia mimetic cobalt chloride employ distinct regulatory mechanisms through the interplay between DNA and mRNA elements at the transcriptional and post-transcriptional levels.

  3. Effect of acid-base alterations on hepatic lactate utilization

    PubMed Central

    Goldstein, Philip J.; Simmons, Daniel H.; Tashkin, Donald P.

    1972-01-01

    1. The effect of acid-base changes on hepatic lactate utilization was investigated in anaesthetized, mechanically ventilated dogs. 2. Portal vein flow and hepatic artery flow were measured with electromagnetic flowmeters, lactate concentration of portal vein, arterial and mixed hepatic venous blood was determined by an enzymatic technique, and hepatic lactate uptake was calculated using the Fick principle. 3. Respiratory alkalosis (Δ pH 0·25 ± 0·02) in four dogs resulted in a significant fall in total hepatic blood flow (-22 ± 4%) and a significant rise in both arterial lactate concentration (2·18 ± 0·32 m-mole/l.) and hepatic lactate utilization (3·9 ± 1·2 μmole/min.kg). 4. 0·6 M-Tris buffer infusion (Δ pH 0·21 ± 0·02) in four dogs produced no significant changes in liver blood flow, arterial lactate concentration or hepatic lactate uptake. 5. Respiratory acidosis (Δ pH -0·20 ± 0·03) in six dogs and metabolic acidosis (Δ pH -0·20 ± 0·02) in four dogs produced no significant changes in liver blood flow, decreases in arterial lactate concentration of 0·38 ± 0·09 m-mole/l. (P < 0·05) and 0·13 ± 0·13 m-mole/l., respectively, and no significant changes in hepatic lactate uptake. 6. A significant correlation (r = 0·63; P < 0·01) was found between hepatic lactate utilization and arterial lactate concentration during the hyperlactataemia associated with respiratory alkalosis. 7. Hyperlactataemia induced in four dogs by infusion of buffered sodium lactate (Δ pH 0·05 ± 0·01;% Δ liver blood flow 29 ± 7%) was also significantly correlated with hepatic lactate utilization (r = 0·70; P < 0·01) and the slope of the regression was similar to that during respiratory alkalosis. 8. These data suggest that the hyperlactataemia of alkalosis is not due to impaired hepatic utilization of lactate and that the principal determinant of hepatic lactate uptake during alkalosis or lactate infusion is blood lactate concentration, rather than liver

  4. Model for acid-base chemistry in nanoparticle growth (MABNAG)

    NASA Astrophysics Data System (ADS)

    Yli-Juuti, T.; Barsanti, K.; Hildebrandt Ruiz, L.; Kieloaho, A.-J.; Makkonen, U.; Petäjä, T.; Ruuskanen, T.; Kulmala, M.; Riipinen, I.

    2013-12-01

    Climatic effects of newly-formed atmospheric secondary aerosol particles are to a large extent determined by their condensational growth rates. However, all the vapours condensing on atmospheric nanoparticles and growing them to climatically relevant sizes are not identified yet and the effects of particle phase processes on particle growth rates are poorly known. Besides sulfuric acid, organic compounds are known to contribute significantly to atmospheric nanoparticle growth. In this study a particle growth model MABNAG (Model for Acid-Base chemistry in NAnoparticle Growth) was developed to study the effect of salt formation on nanoparticle growth, which has been proposed as a potential mechanism lowering the equilibrium vapour pressures of organic compounds through dissociation in the particle phase and thus preventing their evaporation. MABNAG is a model for monodisperse aqueous particles and it couples dynamics of condensation to particle phase chemistry. Non-zero equilibrium vapour pressures, with both size and composition dependence, are considered for condensation. The model was applied for atmospherically relevant systems with sulfuric acid, one organic acid, ammonia, one amine and water in the gas phase allowed to condense on 3-20 nm particles. The effect of dissociation of the organic acid was found to be small under ambient conditions typical for a boreal forest site, but considerable for base-rich environments (gas phase concentrations of about 1010 cm-3 for the sum of the bases). The contribution of the bases to particle mass decreased as particle size increased, except at very high gas phase concentrations of the bases. The relative importance of amine versus ammonia did not change significantly as a function of particle size. While our results give a reasonable first estimate on the maximum contribution of salt formation to nanoparticle growth, further studies on, e.g. the thermodynamic properties of the atmospheric organics, concentrations of low

  5. Model for acid-base chemistry in nanoparticle growth (MABNAG)

    NASA Astrophysics Data System (ADS)

    Yli-Juuti, T.; Barsanti, K.; Hildebrandt Ruiz, L.; Kieloaho, A.-J.; Makkonen, U.; Petäjä, T.; Ruuskanen, T.; Kulmala, M.; Riipinen, I.

    2013-03-01

    Climatic effects of newly-formed atmospheric secondary aerosol particles are to a large extent determined by their condensational growth rates. However, all the vapors condensing on atmospheric nanoparticles and growing them to climatically relevant sizes are not identified yet and the effects of particle phase processes on particle growth rates are poorly known. Besides sulfuric acid, organic compounds are known to contribute significantly to atmospheric nanoparticle growth. In this study a particle growth model MABNAG (Model for Acid-Base chemistry in NAnoparticle Growth) was developed to study the effect of salt formation on nanoparticle growth, which has been proposed as a potential mechanism lowering the equilibrium vapor pressures of organic compounds through dissociation in the particle phase and thus preventing their evaporation. MABNAG is a model for monodisperse aqueous particles and it couples dynamics of condensation to particle phase chemistry. Non-zero equilibrium vapor pressures, with both size and composition dependence, are considered for condensation. The model was applied for atmospherically relevant systems with sulfuric acid, one organic acid, ammonia, one amine and water in the gas phase allowed to condense on 3-20 nm particles. The effect of dissociation of the organic acid was found to be small under ambient conditions typical for a boreal forest site, but considerable for base-rich environments (gas phase concentrations of about 1010 cm-3 for the sum of the bases). The contribution of the bases to particle mass decreased as particle size increased, except at very high gas phase concentrations of the bases. The relative importance of amine versus ammonia did not change significantly as a function of particle size. While our results give a reasonable first estimate on the maximum contribution of salt formation to nanoparticle growth, further studies on, e.g. the thermodynamic properties of the atmospheric organics, concentrations of low

  6. An Olfactory Indicator for Acid-Base Titrations.

    ERIC Educational Resources Information Center

    Flair, Mark N.; Setzer, William N.

    1990-01-01

    The use of an olfactory acid-base indicator in titrations for visually impaired students is discussed. Potential olfactory indicators include eugenol, thymol, vanillin, and thiophenol. Titrations performed with each indicator with eugenol proved to be successful. (KR)

  7. Biologist's Toolbox. Acid-base Balance: An Educational Computer Game.

    ERIC Educational Resources Information Center

    Boyle, Joseph, III; Robinson, Gloria

    1987-01-01

    Describes a microcomputer program that can be used in teaching the basic physiological aspects of acid-base (AB) balance. Explains how its game format and graphic approach can be applied in diagnostic and therapeutic exercises. (ML)

  8. The Bronsted-Lowery Acid-Base Concept.

    ERIC Educational Resources Information Center

    Kauffman, George B.

    1988-01-01

    Gives the background history of the simultaneous discovery of acid-base relationships by Johannes Bronsted and Thomas Lowry. Provides a brief biographical sketch of each. Discusses their concept of acids and bases in some detail. (CW)

  9. Identification of acid-base catalytic residues of high-Mr thioredoxin reductase from Plasmodium falciparum.

    PubMed

    McMillan, Paul J; Arscott, L David; Ballou, David P; Becker, Katja; Williams, Charles H; Müller, Sylke

    2006-11-01

    High-M(r) thioredoxin reductase from the malaria parasite Plasmodium falciparum (PfTrxR) contains three redox active centers (FAD, Cys-88/Cys-93, and Cys-535/Cys-540) that are in redox communication. The catalytic mechanism of PfTrxR, which involves dithiol-disulfide interchanges requiring acid-base catalysis, was studied by steady-state kinetics, spectral analyses of anaerobic static titrations, and rapid kinetics analysis of wild-type enzyme and variants involving the His-509-Glu-514 dyad as the presumed acid-base catalyst. The dyad is conserved in all members of the enzyme family. Substitution of His-509 with glutamine and Glu-514 with alanine led to TrxR with only 0.5 and 7% of wild type activity, respectively, thus demonstrating the crucial roles of these residues for enzymatic activity. The H509Q variant had rate constants in both the reductive and oxidative half-reactions that were dramatically less than those of wild-type enzyme, and no thiolateflavin charge-transfer complex was observed. Glu-514 was shown to be involved in dithiol-disulfide interchange between the Cys-88/Cys-93 and Cys-535/Cys-540 pairs. In addition, Glu-514 appears to greatly enhance the role of His-509 in acid-base catalysis. It can be concluded that the His-509-Glu-514 dyad, in analogy to those in related oxidoreductases, acts as the acid-base catalyst in PfTrxR.

  10. Practical approach to physical-chemical acid-base management. Stewart at the bedside.

    PubMed

    Magder, Sheldon; Emami, Ali

    2015-01-01

    The late Peter Stewart developed an approach to the analysis of acid-base disturbances in biological systems based on basic physical-chemical principles. His key argument was that the traditional carbon dioxide/bicarbonate analysis with just the use of the Henderson-Hasselbalch equation does not account for the important role in the regulation of H(+) concentration played by strong ions, weak acids and water itself. Acceptance of his analysis has been limited because it requires a complicated set of calculations to account for all the variables and it does not provide simple clinical guidance. However, the analysis can be made more pragmatic by using a series of simple equations to quantify the major processes in acid-base disturbances. These include the traditional PCO2 component and the addition of four metabolic processes, which we classify as "water-effects," "chloride-effects," "albumin effects," and "others." Six values are required for the analysis: [Na(+)], [Cl(-)], pH, Pco2, albumin concentration, and base excess. The advantage of this approach is that it gives a better understanding of the mechanisms behind acid-base abnormalities and more readily leads to clinical actions that can prevent or correct the abnormalities. We have developed a simple free mobile app that can be used to input the necessary values to use this approach at the bedside (Physical/Chemical Acid Base Calculator).

  11. Carbonic anhydrase and acid-base regulation in fish.

    PubMed

    Gilmour, K M; Perry, S F

    2009-06-01

    Carbonic anhydrase (CA) is the zinc metalloenzyme that catalyses the reversible reactions of CO(2) with water. CA plays a crucial role in systemic acid-base regulation in fish by providing acid-base equivalents for exchange with the environment. Unlike air-breathing vertebrates, which frequently utilize alterations of breathing (respiratory compensation) to regulate acid-base status, acid-base balance in fish relies almost entirely upon the direct exchange of acid-base equivalents with the environment (metabolic compensation). The gill is the critical site of metabolic compensation, with the kidney playing a supporting role. At the gill, cytosolic CA catalyses the hydration of CO(2) to H(+) and HCO(3)(-) for export to the water. In the kidney, cytosolic and membrane-bound CA isoforms have been implicated in HCO(3)(-) reabsorption and urine acidification. In this review, the CA isoforms that have been identified to date in fish will be discussed together with their tissue localizations and roles in systemic acid-base regulation.

  12. Comprehensive analysis of microRNA-Seq and target mRNAs of rice sheath blight pathogen provides new insights into pathogenic regulatory mechanisms

    PubMed Central

    Lin, Runmao; He, Liye; He, Jiayu; Qin, Peigang; Wang, Yanran; Deng, Qiming; Yang, Xiaoting; Li, Shuangcheng; Wang, Shiquan; Wang, Wenming; Liu, Huainian; Li, Ping; Zheng, Aiping

    2016-01-01

    MicroRNAs (miRNAs) are ∼22 nucleotide non-coding RNAs that regulate gene expression by targeting mRNAs for degradation or inhibiting protein translation. To investigate whether miRNAs regulate the pathogenesis in necrotrophic fungus Rhizoctonia solani AG1 IA, which causes significant yield loss in main economically important crops, and to determine the regulatory mechanism occurring during pathogenesis, we constructed hyphal small RNA libraries from six different infection periods of the rice leaf. Through sequencing and analysis, 177 miRNA-like small RNAs (milRNAs) were identified, including 15 candidate pathogenic novel milRNAs predicted by functional annotations of their target mRNAs and expression patterns of milRNAs and mRNAs during infection. Reverse transcription-quantitative polymerase chain reaction results for randomly selected milRNAs demonstrated that our novel comprehensive predictions had a high level of accuracy. In our predicted pathogenic protein-protein interaction network of R. solani, we added the related regulatory milRNAs of these core coding genes into the network, and could understand the relationships among these regulatory factors more clearly at the systems level. Furthermore, the putative pathogenic Rhi-milR-16, which negatively regulates target gene expression, was experimentally validated to have regulatory functions by a dual-luciferase reporter assay. Additionally, 23 candidate rice miRNAs that may involve in plant immunity against R. solani were discovered. This first study on novel pathogenic milRNAs of R. solani AG1 IA and the recognition of target genes involved in pathogenicity, as well as rice miRNAs, participated in defence against R. solani could provide new insights into revealing the pathogenic mechanisms of the severe rice sheath blight disease. PMID:27374612

  13. α -Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism.

    PubMed

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system. PMID:24719864

  14. α -Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism.

    PubMed

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system.

  15. α-Actinin TvACTN3 of Trichomonas vaginalis Is an RNA-Binding Protein That Could Participate in Its Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system. PMID:24719864

  16. Hydrogen bonding: a channel for protons to transfer through acid-base pairs.

    PubMed

    Wu, Liang; Huang, Chuanhui; Woo, Jung-Je; Wu, Dan; Yun, Sung-Hyun; Seo, Seok-Jun; Xu, Tongwen; Moon, Seung-Hyeon

    2009-09-10

    Different from H(3)O(+) transport as in the vehicle mechanism, protons find another channel to transfer through the poorly hydrophilic interlayers in a hydrated multiphase membrane. This membrane was prepared from poly(phthalazinone ether sulfone kentone) (SPPESK) and H(+)-form perfluorosulfonic resin (FSP), and poorly hydrophilic electrostatically interacted acid-base pairs constitute the interlayer between two hydrophilic phases (FSP and SPPESK). By hydrogen bonds forming and breaking between acid-base pairs and water molecules, protons transport directly through these poorly hydrophilic zones. The multiphase membrane, due to this unique transfer mechanism, exhibits better electrochemical performances during fuel cell tests than those of pure FSP and Nafion-112 membranes: 0.09-0.12 S cm(-1) of proton conductivity at 25 degrees C and 990 mW cm(-2) of the maximum power density at a current density of 2600 mA cm(-2) and a cell voltage of 0.38 V.

  17. Genome-Wide Analysis of Wilms’ Tumor 1-Controlled Gene Expression in Podocytes Reveals Key Regulatory Mechanisms

    PubMed Central

    Kann, Martin; Ettou, Sandrine; Jung, Youngsook L.; Lenz, Maximilian O.; Taglienti, Mary E.; Park, Peter J.; Schermer, Bernhard

    2015-01-01

    The transcription factor Wilms’ tumor suppressor 1 (WT1) is key to podocyte development and viability; however, WT1 transcriptional networks in podocytes remain elusive. We provide a comprehensive analysis of the genome-wide WT1 transcriptional network in podocytes in vivo using chromatin immunoprecipitation followed by sequencing (ChIPseq) and RNA sequencing techniques. Our data show a specific role for WT1 in regulating the podocyte-specific transcriptome through binding to both promoters and enhancers of target genes. Furthermore, we inferred a podocyte transcription factor network consisting of WT1, LMX1B, TCF21, Fox-class and TEAD family transcription factors, and MAFB that uses tissue-specific enhancers to control podocyte gene expression. In addition to previously described WT1-dependent target genes, ChIPseq identified novel WT1-dependent signaling systems. These targets included components of the Hippo signaling system, underscoring the power of genome-wide transcriptional-network analyses. Together, our data elucidate a comprehensive gene regulatory network in podocytes suggesting that WT1 gene regulatory function and podocyte cell-type specification can best be understood in the context of transcription factor-regulatory element network interplay. PMID:25636411

  18. Cis- and Trans-Regulatory Mechanisms of Gene Expression in the ASJ Sensory Neuron of Caenorhabditis elegans

    PubMed Central

    González-Barrios, María; Fierro-González, Juan Carlos; Krpelanova, Eva; Mora-Lorca, José Antonio; Pedrajas, José Rafael; Peñate, Xenia; Chavez, Sebastián; Swoboda, Peter; Jansen, Gert; Miranda-Vizuete, Antonio

    2015-01-01

    The identity of a given cell type is determined by the expression of a set of genes sharing common cis-regulatory motifs and being regulated by shared transcription factors. Here, we identify cis and trans regulatory elements that drive gene expression in the bilateral sensory neuron ASJ, located in the head of the nematode Caenorhabditis elegans. For this purpose, we have dissected the promoters of the only two genes so far reported to be exclusively expressed in ASJ, trx-1 and ssu-1. We hereby identify the ASJ motif, a functional cis-regulatory bipartite promoter region composed of two individual 6 bp elements separated by a 3 bp linker. The first element is a 6 bp CG-rich sequence that presumably binds the Sp family member zinc-finger transcription factor SPTF-1. Interestingly, within the C. elegans nervous system SPTF-1 is also found to be expressed only in ASJ neurons where it regulates expression of other genes in these neurons and ASJ cell fate. The second element of the bipartite motif is a 6 bp AT-rich sequence that is predicted to potentially bind a transcription factor of the homeobox family. Together, our findings identify a specific promoter signature and SPTF-1 as a transcription factor that functions as a terminal selector gene to regulate gene expression in C. elegans ASJ sensory neurons. PMID:25769980

  19. The acid-base titration of montmorillonite

    NASA Astrophysics Data System (ADS)

    Bourg, I. C.; Sposito, G.; Bourg, A. C.

    2003-12-01

    Proton binding to clay minerals plays an important role in the chemical reactivity of soils (e.g., acidification, retention of nutrients or pollutants). If should also affect the performance of clay barriers for waste disposal. The surface acidity of clay minerals is commonly modelled empirically by assuming generic amphoteric surface sites (>SOH) on a flat surface, with fitted site densities and acidity constant. Current advances in experimental methods (notably spectroscopy) are rapidly improving our understanding of the structure and reactivity of the surface of clay minerals (arrangement of the particles, nature of the reactive surface sites, adsorption mechanisms). These developments are motivated by the difficulty of modelling the surface chemistry of mineral surfaces at the macro-scale (e.g., adsorption or titration) without a detailed (molecular-scale) picture of the mechanisms, and should be progressively incorporated into surface complexation models. In this view, we have combined recent estimates of montmorillonite surface properties (surface site density and structure, edge surface area, surface electrostatic potential) with surface site acidities obtained from the titration of alpha-Al2O3 and SiO2, and a novel method of accounting for the unknown initial net proton surface charge of the solid. The model predictions were compared to experimental titrations of SWy-1 montmorillonite and purified MX-80 bentonite in 0.1-0.5 mol/L NaClO4 and 0.005-0.5 mol/L NaNO3 background electrolytes, respectively. Most of the experimental data were appropriately described by the model after we adjusted a single parameter (silanol sites on the surface of montmorillonite were made to be slightly more acidic than those of silica). At low ionic strength and acidic pH the model underestimated the buffering capacity of the montmorillonite, perhaps due to clay swelling or to the interlayer adsorption of dissolved aluminum. The agreement between our model and the experimental

  20. The Regulatory T Cell Lineage Factor Foxp3 Regulates Gene Expression through Several Distinct Mechanisms Mostly Independent of Direct DNA Binding

    PubMed Central

    Andersen, Kristian G.; Hebenstreit, Daniel; Teichmann, Sarah A.; Betz, Alexander G.

    2015-01-01

    The lineage factor Foxp3 is essential for the development and maintenance of regulatory T cells, but little is known about the mechanisms involved. Here, we demonstrate that an N-terminal proline-rich interaction region is crucial for Foxp3’s function. Subdomains within this key region link Foxp3 to several independent mechanisms of transcriptional regulation. Our study suggests that Foxp3, even in the absence of its DNA-binding forkhead domain, acts as a bridge between DNA-binding interaction partners and proteins with effector function permitting it to regulate a large number of genes. We show that, in one such mechanism, Foxp3 recruits class I histone deacetylases to the promoters of target genes, counteracting activation-induced histone acetylation and thereby suppressing their expression. PMID:26107960

  1. Acid-Base and the Skeleton

    NASA Astrophysics Data System (ADS)

    Bushinsky, David A.

    2008-09-01

    Chronic metabolic acidosis increases urine calcium (Ca) excretion in the absence of a concomitant increase in intestinal Ca absorption resulting in a net loss of total body. The source of this additional urine Ca is almost certainly the skeleton, the primary reservoir of body Ca. In vitro metabolic acidosis, modeled as a primary reduction in medium bicarbonate concentration, acutely (<24 h) stimulates Ca efflux primarily through physicochemical mineral dissolution while at later time periods (>24 h) cell-mediated mechanisms predominate. In cultured neonatal mouse calvariae, acidosis-induced, cell-mediated Ca efflux is mediated by effects on both osteoblasts and osteoclasts. Metabolic acidosis inhibits extracellular matrix production by osteoblasts, as determined by measurement of collagen levels and levels for the non-collagenous matrix proteins osteopontin and matrix gla protein. Metabolic acidosis upregulates osteoblastic expression of RANKL (Receptor Activator of NFκB Ligand), an important osteoclastogenic and osteoclast-activating factor. Acidosis also increases osteoclastic activity as measured by release of β-glucuronidase, an enzyme whose secretion correlates with osteoclast-mediated bone resorption.

  2. Thioarsenides: A case for long-range Lewis acid-base-directed van der Waals interactions

    SciTech Connect

    Gibbs, Gerald V.; Wallace, Adam F.; Downs, R. T.; Ross, Nancy L.; Cox, David F.; Rosso, Kevin M.

    2011-04-01

    Electron density distributions, bond paths, Laplacian and local energy density properties have been calculated for a number of As4Sn (n = 3,4,5) thioarsenide molecular crystals. On the basis of the distributions, the intramolecular As-S and As-As interactions classify as shared bonded interactions and the intermolecular As-S, As-As and S-S interactions classify as closed-shell van der Waals bonded interactions. The bulk of the intermolecular As-S bond paths link regions of locally concentrated electron density (Lewis base regions) with aligned regions of locally depleted electron density (Lewis acid regions) on adjacent molecules. The paths are comparable with intermolecular paths reported for several other molecular crystals that link aligned Lewis base and acid regions in a key-lock fashion, interactions that classified as long range Lewis acid-base directed van der Waals interactions. As the bulk of the intermolecular As-S bond paths (~70%) link Lewis acid-base regions on adjacent molecules, it appears that molecules adopt an arrangement that maximizes the number of As-S Lewis acid-base intermolecular bonded interactions. The maximization of the number of Lewis acid-base interactions appears to be connected with the close-packed array adopted by molecules: distorted cubic close-packed arrays are adopted for alacránite, pararealgar, uzonite, realgar and β-AsS and the distorted hexagonal close-packed arrays adopted by α- and β-dimorphite. A growth mechanism is proposed for thioarsenide molecular crystals from aqueous species that maximizes the number of long range Lewis acid-base vdW As-S bonded interactions with the resulting directed bond paths structuralizing the molecules as a molecular crystal.

  3. PARP-2 and PARP-3 are selectively activated by 5' phosphorylated DNA breaks through an allosteric regulatory mechanism shared with PARP-1.

    PubMed

    Langelier, Marie-France; Riccio, Amanda A; Pascal, John M

    2014-07-01

    PARP-1, PARP-2 and PARP-3 are DNA-dependent PARPs that localize to DNA damage, synthesize poly(ADP-ribose) (PAR) covalently attached to target proteins including themselves, and thereby recruit repair factors to DNA breaks to increase repair efficiency. PARP-1, PARP-2 and PARP-3 have in common two C-terminal domains-Trp-Gly-Arg (WGR) and catalytic (CAT). In contrast, the N-terminal region (NTR) of PARP-1 is over 500 residues and includes four regulatory domains, whereas PARP-2 and PARP-3 have smaller NTRs (70 and 40 residues, respectively) of unknown structural composition and function. Here, we show that PARP-2 and PARP-3 are preferentially activated by DNA breaks harboring a 5' phosphate (5'P), suggesting selective activation in response to specific DNA repair intermediates, in particular structures that are competent for DNA ligation. In contrast to PARP-1, the NTRs of PARP-2 and PARP-3 are not strictly required for DNA binding or for DNA-dependent activation. Rather, the WGR domain is the central regulatory domain of PARP-2 and PARP-3. Finally, PARP-1, PARP-2 and PARP-3 share an allosteric regulatory mechanism of DNA-dependent catalytic activation through a local destabilization of the CAT. Collectively, our study provides new insights into the specialization of the DNA-dependent PARPs and their specific roles in DNA repair pathways.

  4. Regulatory RNAs

    PubMed Central

    Vazquez-Anderson, Jorge; Contreras, Lydia M

    2013-01-01

    RNAs have many important functional properties, including that they are independently controllable and highly tunable. As a result of these advantageous properties, their use in a myriad of sophisticated devices has been widely explored. Yet, the exploitation of RNAs for synthetic applications is highly dependent on the ability to characterize the many new molecules that continue to be discovered by large-scale sequencing and high-throughput screening techniques. In this review, we present an exhaustive survey of the most recent synthetic bacterial riboswitches and small RNAs while emphasizing their virtues in gene expression management. We also explore the use of these RNA components as building blocks in the RNA synthetic biology toolbox and discuss examples of synthetic RNA components used to rewire bacterial regulatory circuitry. We anticipate that this field will expand its catalog of smart devices by mimicking and manipulating natural RNA mechanisms and functions. PMID:24356572

  5. Positive and Negative Regulatory Mechanisms for Fine-Tuning Cellularity and Functions of Medullary Thymic Epithelial Cells

    PubMed Central

    Akiyama, Taishin; Tateishi, Ryosuke; Akiyama, Nobuko; Yoshinaga, Riko; Kobayashi, Tetsuya J.

    2015-01-01

    Self-tolerant T cells and regulatory T cells develop in the thymus. A wide variety of cell–cell interactions in the thymus is required for the differentiation, proliferation, and repertoire selection of T cells. Various secreted and cell surface molecules expressed in thymic epithelial cells (TECs) mediate these processes. Moreover, cytokines expressed by cells of hematopoietic origin regulate the cellularity of TECs. Tumor necrosis factor (TNF) family RANK ligand, lymphotoxin, and CD40 ligand, expressed in T cells and innate lymphoid cells (ILCs), promote the differentiation and proliferation of medullary TECs (mTECs) that play critical roles in the induction of immune tolerance. A recent study suggests that interleukin-22 (IL-22) produced by ILCs promotes regeneration of TECs after irradiation. Intriguingly, tumor growth factor-β and osteoprotegerin limit cellularity of mTECs, thereby attenuating regulatory T cell generation. We will review recent insights into the molecular basis for cell–cell interactions regulating differentiation and proliferation of mTECs and also discuss about a perspective on use of mathematical models for understanding this complicated system. PMID:26441966

  6. Analysis of the low-pressure plasma pretreated polymer surface in terms of acid-base approach

    NASA Astrophysics Data System (ADS)

    Kraus, Eduard; Orf, Lukas; Baudrit, Benjamin; Heidemeyer, Peter; Bastian, Martin; Bonenberger, Ramona; Starostina, Irina; Stoyanov, Oleg

    2016-05-01

    We demonstrate the use of a modern wetting method for determining the acid-base properties of treated polymer surfaces for different plastics and adhesives. The effect of the surface treatment with low pressure plasma was evaluated from the viewpoint of acid-base approach with plastics polyoxymethylene (POM) and polyetheretherketone (PEEK). The correlations between the acid-base properties and the identified mechanical tensile strengths of adhesive bonded joints were evaluated and discussed. In the investigated range the determination coefficients for POM and PEEK were calculated to R2 = 0.93 and R2 = 0.97, respectively. These relatively high determination coefficients showed a good correlation between the mechanical strength and the acidity parameter ΔDshort for use in bonding technology for surface pretreatment of polymers with LPP.

  7. Effect of acid/base on the third-order optical nonlinearity of polypyrrole

    NASA Astrophysics Data System (ADS)

    Wang, Aijian; Zhao, Wei; Yu, Wang

    2015-11-01

    Polypyrrole (PPy) and its acid/base composites (PPy·H2SO4, PPy·HCl and PPy·NH3·H2O) were successfully synthesized and were characterized respectively by using fourier transform infrared, ultraviolet/visible absorption, X-ray diffraction, transmission electron microscopy and Raman spectroscopic techniques. The nonlinear optical properties of PPy and its acid/base composites were investigated using nanosecond Z-scan measurements at 532 nm. At the identical linear transmittance, the saturable absorption of pure PPy was changed to reverse saturable absorption by doping with acid (HCl and H2SO4) and base (NH3·H2O). The possible mechanisms for the different nonlinear properties were also discussed.

  8. Acid-base equilibrium dynamics in methanol and dimethyl sulfoxide probed by two-dimensional infrared spectroscopy.

    PubMed

    Lee, Chiho; Son, Hyewon; Park, Sungnam

    2015-07-21

    Two-dimensional infrared (2DIR) spectroscopy, which has been proven to be an excellent experimental method for studying thermally-driven chemical processes, was successfully used to investigate the acid dissociation equilibrium of HN3 in methanol (CH3OH) and dimethyl sulfoxide (DMSO) for the first time. Our 2DIR experimental results indicate that the acid-base equilibrium occurs on picosecond timescales in CH3OH but that it occurs on much longer timescales in DMSO. Our results imply that the different timescales of the acid-base equilibrium originate from different proton transfer mechanisms between the acidic (HN3) and basic (N3(-)) species in CH3OH and DMSO. In CH3OH, the acid-base equilibrium is assisted by the surrounding CH3OH molecules which can directly donate H(+) to N3(-) and accept H(+) from HN3 and the proton migrates through the hydrogen-bonded chain of CH3OH. On the other hand, the acid-base equilibrium in DMSO occurs through the mutual diffusion of HN3 and N3(-) or direct proton transfer. Our 2DIR experimental results corroborate different proton transfer mechanisms in the acid-base equilibrium in protic (CH3OH) and aprotic (DMSO) solvents.

  9. Acid Base Titrations in Nonaqueous Solvents and Solvent Mixtures

    NASA Astrophysics Data System (ADS)

    Barcza, Lajos; Buvári-Barcza, Ágnes

    2003-07-01

    The acid base determination of different substances by nonaqueous titrations is highly preferred in pharmaceutical analyses since the method is quantitative, exact, and reproducible. The modern interpretation of the reactions in nonaqueous solvents started in the last century, but several inconsistencies and unsolved problems can be found in the literature. The acid base theories of Brønsted Lowry and Lewis as well as the so-called solvent theory are outlined first, then the promoting (and leveling) and the differentiating effects are discussed on the basis of the hydrogen-bond concept. Emphasis is put on the properties of formic acid and acetic anhydride since their importance is increasing.

  10. An Acid-Base Chemistry Example: Conversion of Nicotine

    NASA Astrophysics Data System (ADS)

    Summerfield, John H.

    1999-10-01

    The current government interest in nicotine conversion by cigarette companies provides an example of acid-base chemistry that can be explained to students in the second semester of general chemistry. In particular, the conversion by ammonia of the +1 form of nicotine to the easier-to-assimilate free-base form illustrates the effect of pH on acid-base equilibrium. The part played by ammonia in tobacco smoke is analogous to what takes place when cocaine is "free-based".

  11. Acid-base and ion balance in fishes with bimodal respiration.

    PubMed

    Shartau, R B; Brauner, C J

    2014-03-01

    The evolution of air breathing during the Devonian provided early fishes with bimodal respiration with a stable O2 supply from air. This was, however, probably associated with challenges and trade-offs in terms of acid-base balance and ionoregulation due to reduced gill:water interaction and changes in gill morphology associated with air breathing. While many aspects of acid-base and ionoregulation in air-breathing fishes are similar to water breathers, the specific cellular and molecular mechanisms involved remain largely unstudied. In general, reduced ionic permeability appears to be an important adaptation in the few bimodal fishes investigated but it is not known if this is a general characteristic. The kidney appears to play an important role in minimizing ion loss to the freshwater environment in the few species investigated, and while ion uptake across the gut is probably important, it has been largely unexplored. In general, air breathing in facultative air-breathing fishes is associated with an acid-base disturbance, resulting in an increased partial pressure of arterial CO2 and a reduction in extracellular pH (pHE ); however, several fishes appear to be capable of tightly regulating tissue intracellular pH (pHI ), despite a large sustained reduction in pHE , a trait termed preferential pHI regulation. Further studies are needed to determine whether preferential pHI regulation is a general trait among bimodal fishes and if this confers reduced sensitivity to acid-base disturbances, including those induced by hypercarbia, exhaustive exercise and hypoxia or anoxia. Additionally, elucidating the cellular and molecular mechanisms may yield insight into whether preferential pHI regulation is a trait ultimately associated with the early evolution of air breathing in vertebrates.

  12. Acid-base status in dietary treatment of phenylketonuria.

    PubMed

    Manz, F; Schmidt, H; Schärer, K; Bickel, H

    1977-10-01

    Blood acid-base status, serum electrolytes, and urine pH were examined in 64 infants and children with phenylketonuria (PKU) treated with three different low phenylalanine protein hydrolyzates (Aponti, Cymogran, AlbumaidXP) and two synthetic amino acid mixtures (Aminogran, PAM). The formulas caused significant differences in acid-base status, serum potassium, and chloride, and in urine pH. In acid-base balance studies in two patients with PKU, Aponti, PAM, and two modifications of PAM (P2 + P3) were given. We observed a change from mild alkalosis to increasing metabolic acidosis from Aponti (serum bicarbonate 25,8 mval/liter) to P3 (24,0Y, P2 (19, 3) and PAM (17,0). Urine pH decreased and renal net acid excretion increased. In the formulas PAM, P2 and P3 differences in renal net acid excretion correlated with differences in chloride and sulfur contents of the diets and of the urines. New modifications of AlbumaidXP and of PAM, prepared according to our recommendations, showed normal renal net acid excretion (1 mEq/kg/24 hr) in a balance study performed in one patient with PKU and normal acid base status in 20 further patients.

  13. Students' Understanding of Acids/Bases in Organic Chemistry Contexts

    ERIC Educational Resources Information Center

    Cartrette, David P.; Mayo, Provi M.

    2011-01-01

    Understanding key foundational principles is vital to learning chemistry across different contexts. One such foundational principle is the acid/base behavior of molecules. In the general chemistry sequence, the Bronsted-Lowry theory is stressed, because it lends itself well to studying equilibrium and kinetics. However, the Lewis theory of…

  14. Potentiometric Acid-Base Titrations with Activated Graphite Electrodes

    NASA Astrophysics Data System (ADS)

    Riyazuddin, P.; Devika, D.

    1997-10-01

    Dry cell graphite (DCG) electrodes activated with potassium permanganate are employed as potentiometric indicator electrodes for acid-base titrations. Special attention is given to an indicator probe comprising activated DCG-non-activiated DCG electrode couple. This combination also proves suitable for the titration of strong or weak acids.

  15. Thymine, adenine and lipoamino acid based gene delivery systems.

    PubMed

    Skwarczynski, Mariusz; Ziora, Zyta M; Coles, Daniel J; Lin, I-Chun; Toth, Istvan

    2010-05-14

    A novel class of thymine, adenine and lipoamino acid based non-viral carriers for gene delivery has been developed. Their ability to bind to DNA by hydrogen bonding was confirmed by NMR diffusion, isothermal titration calorimetry and transmission electron microscopy experiments.

  16. Soil Studies: Applying Acid-Base Chemistry to Environmental Analysis.

    ERIC Educational Resources Information Center

    West, Donna M.; Sterling, Donna R.

    2001-01-01

    Laboratory activities for chemistry students focus attention on the use of acid-base chemistry to examine environmental conditions. After using standard laboratory procedures to analyze soil and rainwater samples, students use web-based resources to interpret their findings. Uses CBL probes and graphing calculators to gather and analyze data and…

  17. Acid-Base Disorders--A Computer Simulation.

    ERIC Educational Resources Information Center

    Maude, David L.

    1985-01-01

    Describes and lists a program for Apple Pascal Version 1.1 which investigates the behavior of the bicarbonate-carbon dioxide buffer system in acid-base disorders. Designed specifically for the preclinical medical student, the program has proven easy to use and enables students to use blood gas parameters to arrive at diagnoses. (DH)

  18. Using Spreadsheets to Produce Acid-Base Titration Curves.

    ERIC Educational Resources Information Center

    Cawley, Martin James; Parkinson, John

    1995-01-01

    Describes two spreadsheets for producing acid-base titration curves, one uses relatively simple cell formulae that can be written into the spreadsheet by inexperienced students and the second uses more complex formulae that are best written by the teacher. (JRH)

  19. FarR regulates the farAB-encoded efflux pump of Neisseria gonorrhoeae via an MtrR regulatory mechanism.

    PubMed

    Lee, E-H; Rouquette-Loughlin, C; Folster, J P; Shafer, W M

    2003-12-01

    The farAB operon of Neisseria gonorrhoeae encodes an efflux pump which mediates gonococcal resistance to antibacterial fatty acids. It was previously observed that expression of the farAB operon was positively regulated by MtrR, which is a repressor of the mtrCDE-encoded efflux pump system (E.-H. Lee and W. M. Shafer, Mol. Microbiol. 33:839-845, 1999). This regulation was believed to be indirect since MtrR did not bind to the farAB promoter. In this study, computer analysis of the gonococcal genome sequence database, lacZ reporter fusions, and gel mobility shift assays were used to elucidate the regulatory mechanism by which expression of the farAB operon is modulated by MtrR in gonococci. We identified a regulatory protein belonging to the MarR family of transcriptional repressors and found that it negatively controls expression of farAB by directly binding to the farAB promoter. We designated this regulator FarR to signify its role in regulating the farAB operon. We found that MtrR binds to the farR promoter, thereby repressing farR expression. Hence, MtrR regulates farAB in a positive fashion by modulating farR expression. This MtrR regulatory cascade seems to play an important role in adjusting levels of the FarAB and MtrCDE efflux pumps to prevent their excess expression in gonococci. PMID:14645274

  20. Characterization of microRNA expression in bovine adipose tissues: a potential regulatory mechanism of subcutaneous adipose tissue development

    PubMed Central

    2010-01-01

    Background MicroRNAs (miRNAs), a family of small non-coding RNA molecules, appear to regulate animal lipid metabolism and preadipocyte conversion to form lipid-assimilating adipocytes (i.e. adipogenesis). However, no miRNA to date has been reported to modulate adipogenesis and lipid deposition in beef cattle. Results The expression patterns of 89 miRNAs including four bovine specific miRNAs in subcutaneous adipose tissues from three groups of crossbred steers differing in backfat thickness were compared using qRT-PCR analysis. Eighty-six miRNAs were detectable in all samples, with 42 miRNAs differing among crossbreds (P < 0.05) and 15 miRNAs differentially expressed between tissues with high and low backfat thickness (P < 0.05). The expression levels of 18 miRNAs were correlated with backfat thickness (P < 0.05). The miRNA most differentially expressed and the most strongly associated with backfat thickness was miR-378, with a 1.99-fold increase in high backfat thickness tissues (r = 0.72). Conclusions MiRNA expression patterns differed significantly in response to host genetic components. Approximately 20% of the miRNAs in this study were identified as being correlated with backfat thickness. This result suggests that miRNAs may play a regulatory role in white adipose tissue development in beef animals. PMID:20423511

  1. Digestive cells from Mytilus galloprovincialis show a partial regulatory volume decrease following acute hypotonic stress through mechanisms involving inorganic ions.

    PubMed

    Torre, Agata; Trischitta, Francesca; Corsaro, Carmelo; Mallamace, Domenico; Faggio, Caterina

    2013-08-01

    The response of isolated digestive cells of the digestive gland of Mytilus galloprovincialis to hypotonic shock was studied using videometric methods. The isolated cells exposed to a rapid change (from 1100 to 800 mosmol kg(-1) ) of the bathing solution osmolality swelled but thereafter underwent a regulatory volume decrease (RVD), tending to recover the original size. When the hypotonic stress was applied in the presence of quinine and glibenclamide, known inhibitors of swelling activated ion channels, the cells did not exhibit an RVD response; in addition, they showed a larger increase in size in respect to control cells. These observations suggest that the digestive cells of the digestive gland have the machinery to cope with the hyposmotic shock allowing them to exhibit a small but significant RVD preventing an excessive increase in cell size. The pharmacological treatment of digestive cells during the RVD experiments suggests that cell volume is regulated by K(+) and Cl(-) efflux followed by an obliged water efflux from the cell. The involvement of organic osmolytes such as taurine and betaine seems to be excluded by NMR measurement on digestive cells.

  2. Temperature controls on the basal emission rate of isoprene in a tropical tree Ficus septica: exploring molecular regulatory mechanisms.

    PubMed

    Mutanda, Ishmael; Inafuku, Masashi; Saitoh, Seikoh; Iwasaki, Hironori; Fukuta, Masakazu; Watanabe, Keiichi; Oku, Hirosuke

    2016-10-01

    Isoprene emission from plants is very sensitive to environmental temperature both at short-term and long-term scales. Our previous study demonstrated suppression of isoprene emission by cold temperatures in a high emitting tropical tree Ficus septica and revealed a strong correlation of emission to isoprene synthase (IspS) protein levels. When challenged with decreasing daily temperatures from 30 to 12 °C, F. septica completely stopped isoprene emission at 12 °C, only to recover on the second day after re-exposure to 30 °C. Here, we explored this regulation of isoprene emission in response to environmental temperature by a comprehensive analysis of transcriptome data, gene expressions and metabolite pools of the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. MEP pathway genes and metabolites dynamics did not support substrate-level limitations as major control over observed basal emission, but transcriptome data, network inferences and putative regulatory elements on IspS promoter suggested transcriptional regulation of IspS gene through circadian rhythm and phytohormone signalling processes. Expression levels of 29 genes involved in these pathways were examined by quantitative real-time PCR. We propose that temperature controls over basal isoprene emission at a time-scale of hours to few days are regulated by phytohormone-mediated transcriptional modulation of IspS gene under synchronization by the circadian clock. PMID:27425779

  3. Inference of the Arabidopsis Lateral Root Gene Regulatory Network Suggests a Bifurcation Mechanism That Defines Primordia Flanking and Central Zones[OPEN

    PubMed Central

    Lavenus, Julien; Goh, Tatsuaki; Guyomarc’h, Soazig; Hill, Kristine; Lucas, Mikael; Voß, Ute; Kenobi, Kim; Wilson, Michael H.; Farcot, Etienne; Hagen, Gretchen; Guilfoyle, Thomas J.; Fukaki, Hidehiro; Laplaze, Laurent; Bennett, Malcolm J.

    2015-01-01

    A large number of genes involved in lateral root (LR) organogenesis have been identified over the last decade using forward and reverse genetic approaches in Arabidopsis thaliana. Nevertheless, how these genes interact to form a LR regulatory network largely remains to be elucidated. In this study, we developed a time-delay correlation algorithm (TDCor) to infer the gene regulatory network (GRN) controlling LR primordium initiation and patterning in Arabidopsis from a time-series transcriptomic data set. The predicted network topology links the very early-activated genes involved in LR initiation to later expressed cell identity markers through a multistep genetic cascade exhibiting both positive and negative feedback loops. The predictions were tested for the key transcriptional regulator AUXIN RESPONSE FACTOR7 node, and over 70% of its targets were validated experimentally. Intriguingly, the predicted GRN revealed a mutual inhibition between the ARF7 and ARF5 modules that would control an early bifurcation between two cell fates. Analyses of the expression pattern of ARF7 and ARF5 targets suggest that this patterning mechanism controls flanking and central zone specification in Arabidopsis LR primordia. PMID:25944102

  4. [Triggering and regulatory mechanisms of ciliary motion in the ctenophore Bolinopsis. III. Electric excitability and inherent contractility of ciliated cells].

    PubMed

    Labas, Iu A; Mashanskiĭ, V F

    1977-01-01

    Rhythmical electrostimulation is able to produce in a tissue strip of Bolinopsis series of beats of combs-plates. However, the beat frequency, within one series, is only poorly controlled by electrical stimuli. Isolated comb-plate cells with a cilium cut off maintain rhythmical contractions stimulated both mechanically and electrically. A lot of microtubules has been found in the apical region of these cells. It is supposed that it is these microtubules, probably together with the associated root filaments, that are responsible for cell motility. Mutual mechanical stimulation of ciliary cells in these motions is, presumably, a signal providing intratissue propagation of metachronal wave.

  5. Autophagy Regulatory Network - a systems-level bioinformatics resource for studying the mechanism and regulation of autophagy.

    PubMed

    Türei, Dénes; Földvári-Nagy, László; Fazekas, Dávid; Módos, Dezső; Kubisch, János; Kadlecsik, Tamás; Demeter, Amanda; Lenti, Katalin; Csermely, Péter; Vellai, Tibor; Korcsmáros, Tamás

    2015-01-01

    Autophagy is a complex cellular process having multiple roles, depending on tissue, physiological, or pathological conditions. Major post-translational regulators of autophagy are well known, however, they have not yet been collected comprehensively. The precise and context-dependent regulation of autophagy necessitates additional regulators, including transcriptional and post-transcriptional components that are listed in various datasets. Prompted by the lack of systems-level autophagy-related information, we manually collected the literature and integrated external resources to gain a high coverage autophagy database. We developed an online resource, Autophagy Regulatory Network (ARN; http://autophagy-regulation.org), to provide an integrated and systems-level database for autophagy research. ARN contains manually curated, imported, and predicted interactions of autophagy components (1,485 proteins with 4,013 interactions) in humans. We listed 413 transcription factors and 386 miRNAs that could regulate autophagy components or their protein regulators. We also connected the above-mentioned autophagy components and regulators with signaling pathways from the SignaLink 2 resource. The user-friendly website of ARN allows researchers without computational background to search, browse, and download the database. The database can be downloaded in SQL, CSV, BioPAX, SBML, PSI-MI, and in a Cytoscape CYS file formats. ARN has the potential to facilitate the experimental validation of novel autophagy components and regulators. In addition, ARN helps the investigation of transcription factors, miRNAs and signaling pathways implicated in the control of the autophagic pathway. The list of such known and predicted regulators could be important in pharmacological attempts against cancer and neurodegenerative diseases.

  6. Autophagy Regulatory Network - a systems-level bioinformatics resource for studying the mechanism and regulation of autophagy.

    PubMed

    Türei, Dénes; Földvári-Nagy, László; Fazekas, Dávid; Módos, Dezső; Kubisch, János; Kadlecsik, Tamás; Demeter, Amanda; Lenti, Katalin; Csermely, Péter; Vellai, Tibor; Korcsmáros, Tamás

    2015-01-01

    Autophagy is a complex cellular process having multiple roles, depending on tissue, physiological, or pathological conditions. Major post-translational regulators of autophagy are well known, however, they have not yet been collected comprehensively. The precise and context-dependent regulation of autophagy necessitates additional regulators, including transcriptional and post-transcriptional components that are listed in various datasets. Prompted by the lack of systems-level autophagy-related information, we manually collected the literature and integrated external resources to gain a high coverage autophagy database. We developed an online resource, Autophagy Regulatory Network (ARN; http://autophagy-regulation.org), to provide an integrated and systems-level database for autophagy research. ARN contains manually curated, imported, and predicted interactions of autophagy components (1,485 proteins with 4,013 interactions) in humans. We listed 413 transcription factors and 386 miRNAs that could regulate autophagy components or their protein regulators. We also connected the above-mentioned autophagy components and regulators with signaling pathways from the SignaLink 2 resource. The user-friendly website of ARN allows researchers without computational background to search, browse, and download the database. The database can be downloaded in SQL, CSV, BioPAX, SBML, PSI-MI, and in a Cytoscape CYS file formats. ARN has the potential to facilitate the experimental validation of novel autophagy components and regulators. In addition, ARN helps the investigation of transcription factors, miRNAs and signaling pathways implicated in the control of the autophagic pathway. The list of such known and predicted regulators could be important in pharmacological attempts against cancer and neurodegenerative diseases. PMID:25635527

  7. Functional anatomy and ion regulatory mechanisms of the antennal gland in a semi-terrestrial crab, Ocypode stimpsoni

    PubMed Central

    Tsai, Jyuan-Ru; Lin, Hui-Chen

    2014-01-01

    ABSTRACT Brachyuran crabs from diverse habitats show great differences in their osmoregulatory processes, especially in terms of the structural and physiological characteristics of the osmoregulatory organs. In crustaceans, the antennal glands are known to be important in osmoregulation, and they play a functional role analogous to that of the vertebrate kidney. Nevertheless, the detailed structure and function of the antennal glands in different species have rarely been described. The aim of this study is to investigate the role of the antennal gland in ion regulation by examining the ultrastructure of the cells and the distribution of the ion regulatory proteins in each cell type in the antennal gland of a semi-terrestrial crab. The results showed that Na+, K+-ATPase activity significantly increased in the antennal gland after a 4-day acclimation in dilute seawater and returned to its original (day 0) level after 7 days. Three major types of cells were identified in the antennal gland, including coelomic cells (COEs), labyrinthine cells (LBRs) and end-labyrinthine cells (ELBRs). The proximal tubular region (PT) and distal tubular region (DT) of the antennal gland consist of LBRs and COEs, whereas the end tubular region (ET) consists of all three types of cells, with fewer COEs and more ELBRs. We found a non-uniform distribution of NKA immunoreactivity, with increasing intensity from the proximal to the distal regions of the antennal gland. We summarise our study with a proposed model for the urine reprocessing pathway and the role of each cell type or segment of the antennal gland. PMID:24795144

  8. Trypanosoma cruzi Infection Imparts a Regulatory Program in Dendritic Cells and T Cells via Galectin-1-Dependent Mechanisms.

    PubMed

    Poncini, Carolina V; Ilarregui, Juan M; Batalla, Estela I; Engels, Steef; Cerliani, Juan P; Cucher, Marcela A; van Kooyk, Yvette; González-Cappa, Stella M; Rabinovich, Gabriel A

    2015-10-01

    Galectin-1 (Gal-1), an endogenous glycan-binding protein, is widely distributed at sites of inflammation and microbial invasion. Despite considerable progress regarding the immunoregulatory activity of this lectin, the role of endogenous Gal-1 during acute parasite infections is uncertain. In this study, we show that Gal-1 functions as a negative regulator to limit host-protective immunity following intradermal infection with Trypanosoma cruzi. Concomitant with the upregulation of immune inhibitory mediators, including IL-10, TGF-β1, IDO, and programmed death ligand 2, T. cruzi infection induced an early increase of Gal-1 expression in vivo. Compared to their wild-type (WT) counterpart, Gal-1-deficient (Lgals1(-/-)) mice exhibited reduced mortality and lower parasite load in muscle tissue. Resistance of Lgals1(-/-) mice to T. cruzi infection was associated with a failure in the activation of Gal-1-driven tolerogenic circuits, otherwise orchestrated by WT dendritic cells, leading to secondary dysfunction in the induction of CD4(+)CD25(+)Foxp3(+) regulatory T cells. This effect was accompanied by an increased number of CD8(+) T cells and higher frequency of IFN-γ-producing CD4(+) T cells in muscle tissues and draining lymph nodes as well as reduced parasite burden in heart and hindlimb skeletal muscle. Moreover, dendritic cells lacking Gal-1 interrupted the Gal-1-mediated tolerogenic circuit and reinforced T cell-dependent anti-parasite immunity when adoptively transferred into WT mice. Thus, endogenous Gal-1 may influence T. cruzi infection by fueling tolerogenic circuits that hinder anti-parasite immunity.

  9. Potential of acute phase proteins as predictor of postpartum uterine infections during transition period and its regulatory mechanism in dairy cattle

    PubMed Central

    Manimaran, A.; Kumaresan, A.; Jeyakumar, S.; Mohanty, T. K.; Sejian, V.; Kumar, Narender; Sreela, L.; Prakash, M. Arul; Mooventhan, P.; Anantharaj, A.; Das, D. N.

    2016-01-01

    Among the various systemic reactions against infection or injury, the acute phase response is the cascade of reaction and mostly coordinated by cytokines-mediated acute phase proteins (APPs) production. Since APPs are sensitive innate immune molecules, they are useful for early detection of inflammation in bovines and believed to be better discriminators than routine hematological parameters. Therefore, the possibility of using APPs as a diagnostic and prognostic marker of inflammation in major bovine health disorders including postpartum uterine infection has been explored by many workers. In this review, we discussed specifically importance of postpartum uterine infection, the role of energy balance in uterine infections and potential of APPs as a predictor of postpartum uterine infections during the transition period and its regulatory mechanism in dairy cattle. PMID:27051191

  10. Crosstalk between bone marrow-derived mesenchymal stem cells and regulatory T cells through a glucocorticoid-induced leucine zipper/developmental endothelial locus-1-dependent mechanism

    PubMed Central

    Yang, Nianlan; Baban, Babak; Isales, Carlos M.; Shi, Xing-Ming

    2015-01-01

    Bone marrow is a reservoir for regulatory T (Treg) cells, but how Treg cells are regulated in that environment remains poorly understood. We show that expression of glucocorticoid (GC)-induced leucine zipper (GILZ) in bone marrow mesenchymal lineage cells or bone marrow-derived mesenchymal stem cells (BMSCs) increases the production of Treg cells via a mechanism involving the up-regulation of developmental endothelial locus-1 (Del-1), an endogenous leukocyte-endothelial adhesion inhibitor. We found that the expression of Del-1 is increased ∼4-fold in the bone tissues of GILZ transgenic (Tg) mice, and this increase is coupled with a significant increase in the production of IL-10 (2.80 vs. 0.83) and decrease in the production of IL-6 (0.80 vs. 2.33) and IL-12 (0.25 vs. 1.67). We also show that GILZ-expressing BMSCs present antigen in a way that favors Treg cells. These results indicate that GILZ plays a critical role mediating the crosstalk between BMSCs and Treg in the bone marrow microenvironment. These data, together with our previous findings that overexpression of GILZ in BMSCs antagonizes TNF-α-elicited inflammatory responses, suggest that GILZ plays important roles in bone-immune cell communication and BMSC immune suppressive functions.—Yang, N., Baban, B., Isales, C. M., Shi, X.-M. Crosstalk between bone marrow-derived mesenchymal stem cells and regulatory T cells through a glucocorticoid-induced leucine zipper/developmental endothelial locus-1-dependent mechanism. PMID:26038125

  11. Immune-Regulatory Mechanisms of Classical and Experimental Multiple Sclerosis Drugs: A Special Focus on Helminth-Derived Treatments.

    PubMed

    Peón, Alberto N; Terrazas, Luis I

    2016-01-01

    Multiple sclerosis (MS) is the most prevalent autoimmune disease affecting the central nervous system (CNS). Its pathophysiology is centered on neuron myelin sheath destruction in a manner largely dependent upon CD4+/CD8+ T-cell autoreactivity against myelin antigens, inducing Th1/Th17 pathogenic responses with the resulting production of free radicals and soluble mediators that exhibit the effector mechanisms of neurodegeneration. The immune response responsible for this disease is complex and challenges modern medicine. Consequently, many experimental therapies have been proposed in addition to the classical array of immunoregulatory/ immunosuppressive drugs that are normally used to treat MS. In this review, we will describe the effects and mechanisms of action of widely used disease-modifying MS drugs as well as those of select treatments that are currently in the experimental phase. Special emphasis is placed on helminth-derived immunoregulators, as some of them have shown promising results. Additionally, we will compare the mechanisms of action of both the MS drugs and the helminth-derived treatments to discuss the potential importance of some signaling pathways in the control of MS.

  12. To Gate, or Not to Gate: Regulatory Mechanisms for Intercellular Protein Transport and Virus Movement in Plants

    PubMed Central

    Ueki, Shoko; Citovsky, Vitaly

    2011-01-01

    Cell-to-cell signal transduction is vital for orchestrating the whole-body physiology of multi-cellular organisms, and many endogenous macromolecules, proteins, and nucleic acids function as such transported signals. In plants, many of these molecules are transported through plasmodesmata (Pd), the cell wall-spanning channel structures that interconnect plant cells. Furthermore, Pd also act as conduits for cell-to-cell movement of most plant viruses that have evolved to pirate these channels to spread the infection. Pd transport is presumed to be highly selective, and only a limited repertoire of molecules is transported through these channels. Recent studies have begun to unravel mechanisms that actively regulate the opening of the Pd channel to allow traffic. This macromolecular transport between cells comprises two consecutive steps: intracellular targeting to Pd and translocation through the channel to the adjacent cell. Here, we review the current knowledge of molecular species that are transported though Pd and the mechanisms that control this traffic. Generally, Pd traffic can occur by passive diffusion through the trans-Pd cytoplasm or through the membrane/lumen of the trans-Pd ER, or by active transport that includes protein–protein interactions. It is this latter mode of Pd transport that is involved in intercellular traffic of most signal molecules and is regulated by distinct and sometimes interdependent mechanisms, which represent the focus of this article. PMID:21746703

  13. Acid-base properties of bentonite rocks with different origins.

    PubMed

    Nagy, Noémi M; Kónya, József

    2006-03-01

    Five bentonite samples (35-47% montmorillonite) from a Sarmatian sediment series with bentonite sites around Sajóbábony (Hungary) is studied. Some of these samples were tuffogenic bentonite (sedimentary), the others were bentonitized tuff with volcano sedimentary origin. The acid-base properties of the edge sites were studied by potentiometric titrations and surface complexation modeling. It was found that the number and the ratio of silanol and aluminol sites as well as the intrinsic stability constants are different for the sedimentary bentonite and bentonitized tuff. The characteristic properties of the edges sites depend on the origins. The acid-base properties are compared to other commercial and standard bentonites.

  14. [Blood acid-base balance of sportsmen during physical activity].

    PubMed

    Petrushova, O P; Mikulyak, N I

    2014-01-01

    The aim of this study was to investigate the acid-base balance parameters in blood of sportsmen by physical activity. Before exercise lactate concentration in blood was normal. Carbon dioxide pressure (рСО2), bicarbonate concentration (НСО3 -), base excess (BE), were increased immediately after physical activity lactate concentration increased, while pH, BE, НСО3 -, рСО2 decreased in capillary blood of sportsmen. These changes show the development of lactate-acidosis which is partly compensated with bicarbonate buffering system and respiratory alkalosis. During postexercise recovery lactate concentration decreased, while рСО2, НСО3 -, BE increased. The results of this study can be used for diagnostics of acid-base disorders and their medical treatment for preservation of sportsmen physical capacity.

  15. Evolution of the Acid-Base Status in Cardiac Arrest

    PubMed Central

    Carrasco G., Hugo A.; Oletta L., José F.

    1973-01-01

    In a study of the evolution of acid-base status in 26 patients who had cardiopulmonary arrest in the operating room, it appeared that: The determination of acid-base status within the first hour post-cardiac arrest is useful in differentiating final survivors from non-survivors. Respiratory or combined acidosis carries a poor prognosis not evidenced for metabolic acidosis. Late respiratory complications are more frequent in patients with initial combined acidosis. Treatment should be instituted on the basis of frequent determinations of acidbase status, since accurate diagnosis of degree and type of acidosis cannot be done on clinical grounds only. Recovery of consciousness is influenced by the type and severity of acidosis, less so by duration of arrest; and that high pCO2 is associated frequently with unconsciousness after recovery of circulatory function. PMID:4709532

  16. A computational study of ultrafast acid dissociation and acid-base neutralization reactions. I. The model.

    PubMed

    Maurer, Patrick; Thomas, Vibin; Rivard, Ugo; Iftimie, Radu

    2010-07-28

    Ultrafast, time-resolved investigations of acid-base neutralization reactions have recently been performed using systems containing the photoacid 8-hydroxypyrene-1,3,6-trisulfonic acid trisodium salt (HPTS) and various Bronsted bases. Two conflicting neutralization mechanisms have been formulated by Mohammed et al. [Science 310, 83 (2005)] and Siwick et al. [J. Am. Chem. Soc. 129, 13412 (2007)] for the same acid-base system. Herein an ab initio molecular dynamics based computational model is formulated, which is able to investigate the validity of the proposed mechanisms in the general context of ground-state acid-base neutralization reactions. Our approach consists of using 2,4,6-tricyanophenol (exp. pKa congruent with 1) as a model for excited-state HPTS( *) (pKa congruent with 1.4) and carboxylate ions for the accepting base. We employ our recently proposed dipole-field/quantum mechanics (QM) treatment [P. Maurer and R. Iftimie, J. Chem. Phys. 132, 074112 (2010)] of the proton donor and acceptor molecules. This approach allows one to tune the free energy of neutralization to any desired value as well as model initial nonequilibrium hydration effects caused by a sudden increase in acidity, making it possible to achieve a more realistic comparison with experimental data than could be obtained via a full-QM treatment of the entire system. It is demonstrated that the dipole-field/QM model reproduces correctly key properties of the 2,4,6-tricyanophenol acid molecule including gas-phase proton dissociation energies and dipole moments, and condensed-phase hydration structure and pKa values.

  17. A computational study of ultrafast acid dissociation and acid-base neutralization reactions. I. The model

    NASA Astrophysics Data System (ADS)

    Maurer, Patrick; Thomas, Vibin; Rivard, Ugo; Iftimie, Radu

    2010-07-01

    Ultrafast, time-resolved investigations of acid-base neutralization reactions have recently been performed using systems containing the photoacid 8-hydroxypyrene-1,3,6-trisulfonic acid trisodium salt (HPTS) and various Brønsted bases. Two conflicting neutralization mechanisms have been formulated by Mohammed et al. [Science 310, 83 (2005)] and Siwick et al. [J. Am. Chem. Soc. 129, 13412 (2007)] for the same acid-base system. Herein an ab initio molecular dynamics based computational model is formulated, which is able to investigate the validity of the proposed mechanisms in the general context of ground-state acid-base neutralization reactions. Our approach consists of using 2,4,6-tricyanophenol (exp. pKa≅1) as a model for excited-state HPTS∗ (pKa≅1.4) and carboxylate ions for the accepting base. We employ our recently proposed dipole-field/quantum mechanics (QM) treatment [P. Maurer and R. Iftimie, J. Chem. Phys. 132, 074112 (2010)] of the proton donor and acceptor molecules. This approach allows one to tune the free energy of neutralization to any desired value as well as model initial nonequilibrium hydration effects caused by a sudden increase in acidity, making it possible to achieve a more realistic comparison with experimental data than could be obtained via a full-QM treatment of the entire system. It is demonstrated that the dipole-field/QM model reproduces correctly key properties of the 2,4,6-tricyanophenol acid molecule including gas-phase proton dissociation energies and dipole moments, and condensed-phase hydration structure and pKa values.

  18. Acid-base interactions and complex formation while recovering copper(II) ions from aqueous solutions using cellulose adsorbent in the presence of polyvinylpyrrolidone

    NASA Astrophysics Data System (ADS)

    Nikiforova, T. E.; Kozlov, V. A.; Islyaikin, M. K.

    2012-12-01

    The sorption properties of nontreated cotton cellulose and cellulose modified with polyvinylpyrrolidone with respect to copper(II) ions are investigated. It is established that modified cellulose adsorbents have high sorption capability associated with the formation of new sorption centers during treatment with nitrogen-containing polymer. A mechanism is proposed for acid-base interactions in aqueous solutions of acids, bases, and salts during copper(II) cation recovery using cellulose adsorbent with the participation of polyvinylpyrrolidone.

  19. Acid-Base Balance in Uremic Rats with Vascular Calcification

    PubMed Central

    Peralta-Ramírez, Alan; Raya, Ana Isabel; Pineda, Carmen; Rodríguez, Mariano; Aguilera-Tejero, Escolástico; López, Ignacio

    2014-01-01

    Background/Aims Vascular calcification (VC), a major complication in humans and animals with chronic kidney disease (CKD), is influenced by changes in acid-base balance. The purpose of this study was to describe the acid-base balance in uremic rats with VC and to correlate the parameters that define acid-base equilibrium with VC. Methods Twenty-two rats with CKD induced by 5/6 nephrectomy (5/6 Nx) and 10 nonuremic control rats were studied. Results The 5/6 Nx rats showed extensive VC as evidenced by a high aortic calcium (9.2 ± 1.7 mg/g of tissue) and phosphorus (20.6 ± 4.9 mg/g of tissue) content. Uremic rats had an increased pH level (7.57 ± 0.03) as a consequence of both respiratory (PaCO2 = 28.4 ± 2.1 mm Hg) and, to a lesser degree, metabolic (base excess = 4.1 ± 1 mmol/l) derangements. A high positive correlation between both anion gap (AG) and strong ion difference (SID) with aortic calcium (AG: r = 0.604, p = 0.02; SID: r = 0.647, p = 0.01) and with aortic phosphorus (AG: r = 0.684, p = 0.007; SID: r = 0.785, p = 0.01) was detected. Conclusions In an experimental model of uremic rats, VC showed high positive correlation with AG and SID. PMID:25177336

  20. Hydrogen bond removal of pterin derivative whose structure is similar to nucleic acid bases.

    PubMed

    Nonogawa, Mitsuru; Arai, Toshiyuki; Endo, Nobuyuki; Pack, Seung Pil; Kodaki, Tsutomu; Makino, Keisuke

    2005-01-01

    Pterin, an analog of guanine, is an electron transfer compound in biological systems. Among the analogs, 6-formylpterin (6FP) has been demonstrated to have many marked physiological and pharmacological activities and it is, therefore, worthwhile to elucidate whole mechanism of its activities. Unfortunately, however, 6FP is hardly soluble in water and organic solvents. Like nucleic acid bases, 6FP makes intermolecular hydrogen bonds and forms stacking structure causing such drawback nature. This has made mechanistic studies on 6FP activities extremely difficult. In this study, we carried out derivatization for 6FP and succeeded in increasing water solubility with maintaining its physiological activities. PMID:17150758

  1. Disparate Regulatory Mechanisms Control Fat3 and P75NTR Protein Transport through a Conserved Kif5-Interaction Domain

    PubMed Central

    Birkness, Jacqueline E.; Trinidad, Jonathan C.

    2016-01-01

    Directed transport delivers proteins to specific cellular locations and is one mechanism by which cells establish and maintain polarized cellular architectures. The atypical cadherin Fat3 directs the polarized extension of dendrites in retinal amacrine cells by influencing the distribution of cytoskeletal regulators during retinal development, however the mechanisms regulating the distribution of Fat3 remain unclear. We report a novel Kinesin/Kif5 Interaction domain (Kif5-ID) in Fat3 that facilitates Kif5B binding, and determines the distribution of Fat3 cytosolic domain constructs in neurons and MDCK cells. The Kif5-ID sequence is conserved in the neurotrophin receptor P75NTR, which also binds Kif5B, and Kif5-ID mutations similarly result in P75NTR mislocalization. Despite these similarities, Kif5B-mediated protein transport is differentially regulated by these two cargos. For Fat3, the Kif5-ID is regulated by alternative splicing, and the timecourse of splicing suggests that the distribution of Fat3 may switch between early and later stages of retinal development. In contrast, P75NTR binding to Kif5B is enhanced by tyrosine phosphorylation and thus has the potential to be dynamically regulated on a more rapid time scale. PMID:27788242

  2. Transcriptomes reveal the genetic mechanisms underlying ionic regulatory adaptations to salt in the crab-eating frog

    PubMed Central

    Shao, Yong; Wang, Li-Jun; Zhong, Li; Hong, Mei-Ling; Chen, Hong-Man; Murphy, Robert W.; Wu, Dong-Dong; Zhang, Ya-Ping; Che, Jing

    2015-01-01

    The crab-eating frog, Fejervarya cancrivora, is the only frog that lives near seas. It tolerates increased environmental concentrations of sodium, chloride and potassium partly by raising ion and urea levels in its blood plasma. The molecular mechanism of the adaptation remains rarely documented. Herein, we analyze transcriptomes of the crab-eating frog and its closely related saline-intolerant species, F. limnocharis, to explore the molecular basis of adaptations to such extreme environmental conditions. Analyses reveal the potential genetic mechanism underlying the adaptation to salinity for the crab-eating frog. Genes in categories associated with ion transport appear to have evolved rapidly in F. cancrivora. Both positively selected and differentially expressed genes exhibit enrichment in the GO category regulation of renal sodium excretion. In this category, the positively selected sites of ANPEP and AVPR2 encode CD13 and V2 receptors, respectively; they fall precisely on conserved domains. More differentially expressed rapidly evolved genes occur in the kidney of F. cancrivora than in F. limnocharis. Four genes involved in the regulation of body fluid levels show signs of positive selection and increased expression. Significant up-regulation occurs in several genes of F. cancrivora associated with renin-angiotensin system and aldosterone-regulated sodium reabsorption pathways, which relate to osmotic regulation. PMID:26619819

  3. Subchromoplast Sequestration of Carotenoids Affects Regulatory Mechanisms in Tomato Lines Expressing Different Carotenoid Gene Combinations[C][W

    PubMed Central

    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M.A.; Bramley, Peter M.; Fraser, Paul D.

    2013-01-01

    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed. PMID:24249831

  4. The normal acid-base status of mice.

    PubMed

    Iversen, Nina K; Malte, Hans; Baatrup, Erik; Wang, Tobias

    2012-03-15

    Rodent models are commonly used for various physiological studies including acid-base regulation. Despite the widespread use of especially genetic modified mice, little attention have been made to characterise the normal acid-base status in these animals in order to reveal proper control values. Furthermore, several studies report blood gas values obtained in anaesthetised animals. We, therefore, decided to characterise blood CO(2) binding characteristic of mouse blood in vitro and to characterise normal acid-base status in conscious BALBc mice. In vitro CO(2) dissociation curves, performed on whole blood equilibrated to various PCO₂ levels in rotating tonometers, revealed a typical mammalian pK' (pK'=7.816-0.234 × pH (r=0.34)) and a non-bicarbonate buffer capacity (16.1 ± 2.6 slyke). To measure arterial acid-base status, small blood samples were taken from undisturbed mice with indwelling catheters in the carotid artery. In these animals, pH was 7.391 ± 0.026, plasma [HCO(3)(-)] 18.4 ± 0.83 mM, PCO₂ 30.3 ± 2.1 mm Hg and lactate concentration 4.6 ± 0.7 mM. Our study, therefore, shows that mice have an arterial pH that resembles other mammals, although arterial PCO₂ tends to be lower than in larger mammals. However, pH from arterial blood sampled from mice anaesthetised with isoflurane was significantly lower (pH 7.239 ± 0.021), while plasma [HCO(3)(-)] was 18.5 ± 1.4 mM, PCO₂ 41.9 ± 2.9 mm Hg and lactate concentration 4.48 ± 0.67 mM. Furthermore, we measured metabolism and ventilation (V(E)) in order to determine the ventilation requirements (VE/VO₂) to answer whether small mammals tend to hyperventilate. We recommend, therefore, that studies on acid-base regulation in mice should be based on samples taken for indwelling catheters rather than cardiac puncture of terminally anaesthetised mice.

  5. Early tissue response to citric acid-based micro- and nanocomposites

    PubMed Central

    Chung, Eun Ji; Qiu, Hongjin; Kodali, Pradeep; Yang, Scott; Sprague, Stuart M.; Hwong, James; Koh, Jason; Ameer, Guillermo A.

    2010-01-01

    Composites based on calcium phosphates and biodegradable polymers are desirable for orthopaedic applications due to their potential to mimic bone. Herein, we describe the fabrication, characterization, and in vivo response of novel citric acid-based microcomposites and nanocomposites. Poly(1,8-octanediol-co-citrate) (POC) was mixed with increasing amounts of HA nanoparticles or microparticles (up to 60 wt%), and the morphology and mechanical properties of the resulting composites were assessed. To investigate tissue response, nanocomposites, microcomposites, POC, and poly(L-lactide) (PLL) were implanted in osteochondral defects in rabbits and harvested at 6 weeks for histological evaluation. SEM confirmed increased surface roughness of microcomposites relative to nanocomposites. The mechanical properties of both types of composites increased with increasing amounts of HA (8–328 MPa), although nanocomposites with 60 wt.% HA displayed the highest strength and stiffness. Based on tissue-implant interfacial assessments, all implants integrated well with the surrounding bone and cartilage with no evidence of inflammation. Both nanocomposites and microcomposites supported bone remodeling; however, nanocomposites induced more trabecular bone formation at the tissue-implant interface. The mechanical properties of citric acid-based composites are within the range of human trabecular bone (1–1524 MPa, 211±78 MPa mean modulus) and tissue response was dependent on the size and content of HA, providing new perspectives of design and fabrication criteria for orthopaedic devices such as interference screws and fixation pins. PMID:20949482

  6. Control of the Inflammatory Response Mechanisms Mediated by Natural and Induced Regulatory T-Cells in HCV-, HTLV-1-, and EBV-Associated Cancers

    PubMed Central

    Moralès, Olivier; Delhem, Nadira

    2014-01-01

    Virus infections are involved in chronic inflammation and, in some cases, cancer development. Although a viral infection activates the immune system's response that eradicates the pathogen mainly through inflammatory mechanisms, it is now recognized that this inflammatory condition is also favorable to the development of tumors. Indeed, it is well described that viruses, such as hepatitis C virus (HCV), Epstein Barr virus (EBV), human papillomavirus (HPV) or human T-cell lymphotropic virus type-1 (HTLV-1), are important risk factors for tumor malignancies. The inflammatory response is a fundamental immune mechanism which involves several molecular and cellular components consisting of cytokines and chemokines that are released by various proinflammatory cells. In parallel to this process, some endogenous recruited components release anti-inflammatory mediators to restore homeostasis. The development of tools and strategies using viruses to hijack the immune response is mostly linked to the presence of regulatory T-cells (Treg) that can inhibit inflammation and antiviral responses of other effector cells. In this review, we will focus on current understanding of the role of natural and induced Treg in the control and the resolution of inflammatory response in HCV-, HTLV-1-, and EBV-associated cancers. PMID:25525301

  7. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences.

    PubMed

    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M; Puisieux, Alain; Payen, Léa

    2016-06-20

    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

  8. Studies on the regulatory effect of Peony-Glycyrrhiza Decoction on prolactin hyperactivity and underlying mechanism in hyperprolactinemia rat model.

    PubMed

    Wang, Di; Wang, Wei; Zhou, Yulin; Wang, Juan; Jia, Dongxu; Wong, Hei Kiu; Zhang, Zhang-Jin

    2015-10-01

    Clinical trials have demonstrated the beneficial effects of Peony-Glycyrrhiza Decoction (PGD) in alleviating antipsychotic-induced hyperprolactinemia (hyperPRL) in schizophrenic patients. In previous experiment, PGD suppressed prolactin (PRL) level in MMQ cells, involving modulating the expression of D2 receptor (DRD2) and dopamine transporter (DAT). In the present study, hyperPRL female rat model induced by dopamine blocker metoclopramide (MCP) was applied to further confirm the anti-hyperpPRL activity of PGD and underlying mechanism. In MCP-induced hyperPRL rats, the elevated serum PRL level was significantly suppressed by either PGD (2.5-10 g/kg) or bromocriptine (BMT) (0.6 mg/kg) administration for 14 days. However, in MCP-induced rats, only PGD restored the under-expressed serum progesterone (P) to control level. Both PGD and BMT administration restore the under-expression of DRD2, DAT and TH resulted from MCP in pituitary gland and hypothalamus. Compared to untreated group, hyperPRL animals had a marked reduction on DRD2 and DAT expression in the arcuate nucleus. PGD (10 g/kg) and BMT (0.6 mg/kg) treatment significant reversed the expression of DRD2 and DAT. Collectively, the anti-hyperPRL activity of PGD associates with the modulation of dopaminergic neuronal system and the restoration of serum progesterone level. Our finding supports PGD as an effective agent against hyperPRL.

  9. Comparative transcriptome and metabolome provides new insights into the regulatory mechanisms of accelerated senescence in litchi fruit after cold storage

    PubMed Central

    Yun, Ze; Qu, Hongxia; Wang, Hui; Zhu, Feng; Zhang, Zhengke; Duan, Xuewu; Yang, Bao; Cheng, Yunjiang; Jiang, Yueming

    2016-01-01

    Litchi is a non-climacteric subtropical fruit of high commercial value. The shelf life of litchi fruit under ambient conditions (AC) is approximately 4–6 days. Post-harvest cold storage prolongs the life of litchi fruit for up to 30 days with few changes in pericarp browning and total soluble solids. However, the shelf life of litchi fruits at ambient temperatures after pre-cold storage (PCS) is only 1–2 days. To better understand the mechanisms involved in the rapid fruit senescence induced by pre-cold storage, a transcriptome of litchi pericarp was constructed to assemble the reference genes, followed by comparative transcriptomic and metabolomic analyses. Results suggested that the senescence of harvested litchi fruit was likely to be an oxidative process initiated by ABA, including oxidation of lipids, polyphenols and anthocyanins. After cold storage, PCS fruit exhibited energy deficiency, and respiratory burst was elicited through aerobic and anaerobic respiration, which was regulated specifically by an up-regulated calcium signal, G-protein-coupled receptor signalling pathway and small GTPase-mediated signal transduction. The respiratory burst was largely associated with increased production of reactive oxygen species, up-regulated peroxidase activity and initiation of the lipoxygenase pathway, which were closely related to the accelerated senescence of PCS fruit. PMID:26763309

  10. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences

    PubMed Central

    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M.; Puisieux, Alain; Payen, Léa

    2016-01-01

    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

  11. Nek2A phosphorylates and stabilizes SuFu: A new strategy of Gli2/Hedgehog signaling regulatory mechanism.

    PubMed

    Wang, Yao; Li, Yong; Hu, Guanghui; Huang, Xuan; Rao, Hai; Xiong, Xiangyang; Luo, Zhijun; Lu, Quqin; Luo, Shiwen

    2016-09-01

    Suppressor of Fused (SuFu) plays a conservative role in the regulation of the Gli transcription factors within the Hedgehog (Hh) signaling pathway. Despite the central importance of SuFu in the Hh pathway, little is known about its regulation. Here, we performed a GAL4-based yeast two-hybrid screen using human SuFu as bait, and identified NIMA-related expressed kinase 2A (Nek2A) as a new SuFu-interacting protein, which was also confirmed by glutathione-S-transferase pull-down and co-immunoprecipitation assays. Intriguingly, Nek2A is found to stabilize SuFu at least partly depending on its kinase activity, thereby triggering phosphorylation of the SuFu protein. Moreover, the phosphorylated SuFu inhibits the nuclear localization and transcriptional activity of Gli2/Hh signaling. These findings reveal a new mechanism of mammalian SuFu regulation, and offers novel insights into Hh signaling regulation in development and human disease. PMID:27297360

  12. Comparative transcriptome and metabolome provides new insights into the regulatory mechanisms of accelerated senescence in litchi fruit after cold storage.

    PubMed

    Yun, Ze; Qu, Hongxia; Wang, Hui; Zhu, Feng; Zhang, Zhengke; Duan, Xuewu; Yang, Bao; Cheng, Yunjiang; Jiang, Yueming

    2016-01-01

    Litchi is a non-climacteric subtropical fruit of high commercial value. The shelf life of litchi fruit under ambient conditions (AC) is approximately 4-6 days. Post-harvest cold storage prolongs the life of litchi fruit for up to 30 days with few changes in pericarp browning and total soluble solids. However, the shelf life of litchi fruits at ambient temperatures after pre-cold storage (PCS) is only 1-2 days. To better understand the mechanisms involved in the rapid fruit senescence induced by pre-cold storage, a transcriptome of litchi pericarp was constructed to assemble the reference genes, followed by comparative transcriptomic and metabolomic analyses. Results suggested that the senescence of harvested litchi fruit was likely to be an oxidative process initiated by ABA, including oxidation of lipids, polyphenols and anthocyanins. After cold storage, PCS fruit exhibited energy deficiency, and respiratory burst was elicited through aerobic and anaerobic respiration, which was regulated specifically by an up-regulated calcium signal, G-protein-coupled receptor signalling pathway and small GTPase-mediated signal transduction. The respiratory burst was largely associated with increased production of reactive oxygen species, up-regulated peroxidase activity and initiation of the lipoxygenase pathway, which were closely related to the accelerated senescence of PCS fruit. PMID:26763309

  13. Study on the molecular regulatory mechanism of MicroRNA-195 in the invasion and metastasis of colorectal carcinoma

    PubMed Central

    Yang, Bin; Tan, Zhigang; Song, Yan

    2015-01-01

    Objective: This study aims to identify the target gene of hsa-miR-195 and to research the molecular mechanism of hsa-miR-195 which is through its target genes in the colorectal cancer invasion and metastasis. Methods: We used biological informatics (RNAhybrid and Target Scan analysis database) to predict the target genes of hsa-miR-195. Collected colon cancer tissues from clinical colorectal cancer patients by surgical removal of the carcinoma and control tissues, and researched the expression of Bcl-2 in tissues by immunohistochemical. Next, Real-time PCR was used to research the expression of hsa-miR-195 in Caco-2 and NCM460 cell line. hsa -miR-195 Mimics was transient transfered to Caco-2 cells, western blot was used to analysis the expression changes of Bcl-2. To analysis the possibility that hsa-miR-195 can affect the invasive ability of tumor cells by Bcl-2, we transferred hsa-miR-195 Mimics and Bcl-2 expression plasmid, and used the cell invasion experiment to discusses hsa-miR-195 effect on the ability of tumor cell invasion. Results: the immunohistochemical results showed that, the semi-quantitative parameters for the Bcl-2: control by 0.89 ± 0.51, 6 colon cancer by 31 ± 0.79. The expression of has-miR-195 in Caco-2 is 0.39 ± 1.5 while the value in control is2.01 ± 0.2, **P < 0.01. Conclusion: In colorectal cancer, has-miR-195 can promote cell apoptosis and inhibit the invasion and metastasis by inhibiting the expression of Bcl-2. PMID:26064276

  14. S-nitrosation of β-catenin and p120 catenin: a novel regulatory mechanism in endothelial hyperpermeability

    PubMed Central

    Marín, N.; Zamorano, P.; Carrasco, R.; Mujica, P.; González, FG.; Quezada, C.; Meininger, CJ.; Boric, MP.; Durán, WN.; Sánchez, FA.

    2014-01-01

    Rationale Endothelial adherens junction proteins constitute an important element in the control of microvascular permeability. Platelet-activating factor (PAF) increases permeability to macromolecules via translocation of eNOS to cytosol and stimulation of eNOS-derived NO signaling cascade. The mechanisms by which NO signaling regulates permeability at adherens junctions are still incompletely understood. Objective We explored the hypothesis that PAF stimulates hyperpermeability via S-nitrosation (SNO) of adherens junction proteins. Methods and Results We measured PAF-stimulated S-nitrosation of β-catenin and p120-catenin (p120) in three cell lines: ECV-eNOSGFP, EAhy926 (derived from human umbilical vein) and CVEC (derived from bovine heart endothelium) and in the mouse cremaster muscle in vivo. SNO correlated with diminished abundance of β-catenin and p120 at the adherens junction and with hyperpermeability. TNF-α increased NO production and caused similar increase in S-nitrosation as PAF. To ascertain the importance of eNOS subcellular location in this process, we used ECV-304 cells transfected with cytosolic eNOS (GFPeNOSG2A) and plasma membrane eNOS (GFPeNOSCAAX). PAF induced S-nitrosation of β-catenin and p120 and significantly diminished association between these proteins in cells with cytosolic eNOS but not in cells wherein eNOS is anchored to the cell membrane. Inhibitors of NO production and of S-nitrosation blocked PAF-induced S-nitrosation and hyperpermeability whereas inhibition of the cGMP pathway had no effect. Mass spectrometry analysis of purified p120 identified cysteine 579 as the main S-nitrosated residue in the region that putatively interacts with VE-cadherin. Conclusions Our results demonstrate that agonist-induced SNO contributes to junctional membrane protein changes that enhance endothelial permeability. PMID:22777005

  15. Lycopene treatment against loss of bone mass, microarchitecture and strength in relation to regulatory mechanisms in a postmenopausal osteoporosis model.

    PubMed

    Ardawi, Mohammed-Salleh M; Badawoud, Mohammed H; Hassan, Sherif M; Rouzi, Abdulrahim A; Ardawi, Jumanah M S; AlNosani, Nouf M; Qari, Mohammed H; Mousa, Shaker A

    2016-02-01

    Lycopene supplementation decreases oxidative stress and exhibits beneficial effects on bone health, but the mechanisms through which it alters bone metabolism in vivo remain unclear. The present study aims to evaluate the effects of lycopene treatment on postmenopausal osteoporosis. Six-month-old female Wistar rats (n=264) were sham-operated (SHAM) or ovariectomized (OVX). The SHAM group received oral vehicle only and the OVX rats were randomized into five groups receiving oral daily lycopene treatment (mg/kg body weight per day): 0 OVX (control), 15 OVX, 30 OVX, and 45 OVX, and one group receiving alendronate (ALN) (2μg/kg body weight per day), for 12weeks. Bone densitometry measurements, bone turnover markers, biomechanical testing, and histomorphometric analysis were conducted. Micro computed tomography was also used to evaluate changes in microarchitecture. Lycopene treatment suppressed the OVX-induced increase in bone turnover, as indicated by changes in biomarkers of bone metabolism: serum osteocalcin (s-OC), serum N-terminal propeptide of type 1 collagen (s-PINP), serum crosslinked carboxyterminal telopeptides (s-CTX-1), and urinary deoxypyridinoline (u-DPD). Significant improvement in OVX-induced loss of bone mass, bone strength, and microarchitectural deterioration was observed in lycopene-treated OVX animals. These effects were observed mainly at sites rich in trabecular bone, with less effect in cortical bone. Lycopene treatment down-regulated osteoclast differentiation concurrent with up-regulating osteoblast together with glutathione peroxidase (GPx) catalase (CAT) and superoxide dismutase (SOD) activities. These findings demonstrate that lycopene treatment in OVX rats primarily suppressed bone turnover to restore bone strength and microarchitecture.

  16. Regulatory Dendritic Cells Restrain NK Cell IFN-γ Production through Mechanisms Involving NKp46, IL-10, and MHC Class I-Specific Inhibitory Receptors.

    PubMed

    Spallanzani, Raúl G; Torres, Nicolás I; Avila, Damián E; Ziblat, Andrea; Iraolagoitia, Ximena L Raffo; Rossi, Lucas E; Domaica, Carolina I; Fuertes, Mercedes B; Rabinovich, Gabriel A; Zwirner, Norberto W

    2015-09-01

    Cross-talk between mature dendritic cells (mDC) and NK cells through the cell surface receptors NKp30 and DNAM-1 leads to their reciprocal activation. However, the impact of regulatory dendritic cells (regDC) on NK cell function remains unknown. As regDC constrain the immune response in different physiological and pathological conditions, the aim of this work was to investigate the functional outcome of the interaction between regDC and NK cells and the associated underlying mechanisms. RegDC generated from monocyte-derived DC treated either with LPS and dexamethasone, vitamin D3, or vitamin D3 and dexamethasone instructed NK cells to secrete lower amounts of IFN-γ than NK cells exposed to mDC. Although regDC triggered upregulation of the activation markers CD69 and CD25 on NK cells, they did not induce upregulation of CD56 as mDC, and silenced IFN-γ secretion through mechanisms involving insufficient secretion of IL-18, but not IL-12 or IL-15 and/or induction of NK cell apoptosis. Blocking experiments demonstrated that regDC curb IFN-γ secretion by NK cells through a dominant suppressive mechanism involving IL-10, NK cell inhibitory receptors, and, unexpectedly, engagement of the activating receptor NKp46. Our findings unveil a previously unrecognized cross-talk through which regDC shape NK cell function toward an alternative activated phenotype unable to secrete IFN-γ, highlighting the plasticity of NK cells in response to tolerogenic stimuli. In addition, our findings contribute to identify a novel inhibitory role for NKp46 in the control of NK cell function, and have broad implications in the resolution of inflammatory responses and evasion of antitumor responses. PMID:26232426

  17. Integrative Modeling of eQTLs and Cis-Regulatory Elements Suggests Mechanisms Underlying Cell Type Specificity of eQTLs

    PubMed Central

    Brown, Christopher D.; Mangravite, Lara M.; Engelhardt, Barbara E.

    2013-01-01

    Genetic variants in cis-regulatory elements or trans-acting regulators frequently influence the quantity and spatiotemporal distribution of gene transcription. Recent interest in expression quantitative trait locus (eQTL) mapping has paralleled the adoption of genome-wide association studies (GWAS) for the analysis of complex traits and disease in humans. Under the hypothesis that many GWAS associations tag non-coding SNPs with small effects, and that these SNPs exert phenotypic control by modifying gene expression, it has become common to interpret GWAS associations using eQTL data. To fully exploit the mechanistic interpretability of eQTL-GWAS comparisons, an improved understanding of the genetic architecture and causal mechanisms of cell type specificity of eQTLs is required. We address this need by performing an eQTL analysis in three parts: first we identified eQTLs from eleven studies on seven cell types; then we integrated eQTL data with cis-regulatory element (CRE) data from the ENCODE project; finally we built a set of classifiers to predict the cell type specificity of eQTLs. The cell type specificity of eQTLs is associated with eQTL SNP overlap with hundreds of cell type specific CRE classes, including enhancer, promoter, and repressive chromatin marks, regions of open chromatin, and many classes of DNA binding proteins. These associations provide insight into the molecular mechanisms generating the cell type specificity of eQTLs and the mode of regulation of corresponding eQTLs. Using a random forest classifier with cell specific CRE-SNP overlap as features, we demonstrate the feasibility of predicting the cell type specificity of eQTLs. We then demonstrate that CREs from a trait-associated cell type can be used to annotate GWAS associations in the absence of eQTL data for that cell type. We anticipate that such integrative, predictive modeling of cell specificity will improve our ability to understand the mechanistic basis of human complex phenotypic

  18. History of medical understanding and misunderstanding of Acid base balance.

    PubMed

    Aiken, Christopher Geoffrey Alexander

    2013-09-01

    To establish how controversies in understanding acid base balance arose, the literature on acid base balance was reviewed from 1909, when Henderson described how the neutral reaction of blood is determined by carbonic and organic acids being in equilibrium with an excess of mineral bases over mineral acids. From 1914 to 1930, Van Slyke and others established our acid base principles. They recognised that carbonic acid converts into bicarbonate all non-volatile mineral bases not bound by mineral acids and determined therefore that bicarbonate represents the alkaline reserve of the body and should be a physiological constant. They showed that standard bicarbonate is a good measure of acidosis caused by increased production or decreased elimination of organic acids. However, they recognised that bicarbonate improved low plasma bicarbonate but not high urine acid excretion in diabetic ketoacidosis, and that increasing pCO2 caused chloride to shift into cells raising plasma titratable alkali. Both indicate that minerals influence pH. In 1945 Darrow showed that hyperchloraemic metabolic acidosis in preterm infants fed milk with 5.7 mmol of chloride and 2.0 mmol of sodium per 100 kcal was caused by retention of chloride in excess of sodium. Similar findings were made but not recognised in later studies of metabolic acidosis in preterm infants. Shohl in 1921 and Kildeberg in 1978 presented the theory that carbonic and organic acids are neutralised by mineral base, where mineral base is the excess of mineral cations over anions and organic acid is the difference between mineral base, bicarbonate and protein anion. The degree of metabolic acidosis measured as base excess is determined by deviation in both mineral base and organic acid from normal.

  19. Functional nucleic-acid-based sensors for environmental monitoring.

    PubMed

    Sett, Arghya; Das, Suradip; Bora, Utpal

    2014-10-01

    Efforts to replace conventional chromatographic methods for environmental monitoring with cheaper and easy to use biosensors for precise detection and estimation of hazardous environmental toxicants, water or air borne pathogens as well as various other chemicals and biologics are gaining momentum. Out of the various types of biosensors classified according to their bio-recognition principle, nucleic-acid-based sensors have shown high potential in terms of cost, sensitivity, and specificity. The discovery of catalytic activities of RNA (ribozymes) and DNA (DNAzymes) which could be triggered by divalent metallic ions paved the way for their extensive use in detection of heavy metal contaminants in environment. This was followed with the invention of small oligonucleotide sequences called aptamers which can fold into specific 3D conformation under suitable conditions after binding to target molecules. Due to their high affinity, specificity, reusability, stability, and non-immunogenicity to vast array of targets like small and macromolecules from organic, inorganic, and biological origin, they can often be exploited as sensors in industrial waste management, pollution control, and environmental toxicology. Further, rational combination of the catalytic activity of DNAzymes and RNAzymes along with the sequence-specific binding ability of aptamers have given rise to the most advanced form of functional nucleic-acid-based sensors called aptazymes. Functional nucleic-acid-based sensors (FNASs) can be conjugated with fluorescent molecules, metallic nanoparticles, or quantum dots to aid in rapid detection of a variety of target molecules by target-induced structure switch (TISS) mode. Although intensive research is being carried out for further improvements of FNAs as sensors, challenges remain in integrating such bio-recognition element with advanced transduction platform to enable its use as a networked analytical system for tailor made analysis of environmental

  20. 75 FR 61531 - Issuance of Regulatory Guide

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-05

    ... E. Norris, Component Integrity Branch, Division of Engineering, Office of Nuclear Regulatory... acceptable alternatives to requirements in the American Society of Mechanical Engineers (ASME) Boiler and.... Harriet Karagiannis, Acting Chief, Regulatory Guide Development Branch, Division of Engineering, Office...

  1. The oxidative stress, antioxidant profile and acid-base status in preterm and term canine neonates.

    PubMed

    Vannucchi, C I; Kishi, D; Regazzi, F M; Silva, L C G; Veiga, G A L; Angrimani, D S R; Lucio, C F; Nichi, M

    2015-04-01

    During the initiation of neonatal pulmonary respiration, there is an exponential increase in reactive oxygen species that must be scavenged by antioxidant defences. However, neonate and preterm newborns are known to possess immature antioxidant mechanisms to neutralize these toxic effects. The purposes of this study were to compare the development of antioxidant system between preterm and term canine neonates and to evaluate the magnitude of acid-base balance during the initial 4 h of life. A prospective study was conducted involving 18 neonatal puppies assigned to Term Group (63 days of gestation; n = 5), Preterm-57 Group (57 days of gestation; n = 8) and Preterm-55 Group (55 days of gestation; n = 5). Neonates were physically examined through Apgar score and venous haemogasometry within 5 min, 2 and 4 h after birth. No difference on amniotic fluid and serum superoxide dismutase (SOD), glutathione peroxidase (GPx) and the marker of oxidative stress (thiobarbituric acid reactive substances; TBARS) was verified. Irrespective of prematurity, all neonates presented low vitality, hypothermia, acidosis, hypoxaemia and hypercapnia at birth. However, term puppies clinically evolved more rapidly than preterm newborns. During the course of the study, premature neonates presented more severe complications, such as prolonged hypoxaemia and even death. In conclusion, premature puppies have no signs of immature enzymatic mechanisms for controlling oxidative stress, although SOD and GPx may participate in achieving acid-base balance. Aside from initial unremarkable symptoms, premature puppies should be carefully followed up, as they are at high risk of succumbing to odds of prematurity.

  2. The glmS ribozyme cofactor is a general acid-base catalyst.

    PubMed

    Viladoms, Júlia; Fedor, Martha J

    2012-11-21

    The glmS ribozyme is the first natural self-cleaving ribozyme known to require a cofactor. The d-glucosamine-6-phosphate (GlcN6P) cofactor has been proposed to serve as a general acid, but its role in the catalytic mechanism has not been established conclusively. We surveyed GlcN6P-like molecules for their ability to support self-cleavage of the glmS ribozyme and found a strong correlation between the pH dependence of the cleavage reaction and the intrinsic acidity of the cofactors. For cofactors with low binding affinities, the contribution to rate enhancement was proportional to their intrinsic acidity. This linear free-energy relationship between cofactor efficiency and acid dissociation constants is consistent with a mechanism in which the cofactors participate directly in the reaction as general acid-base catalysts. A high value for the Brønsted coefficient (β ~ 0.7) indicates that a significant amount of proton transfer has already occurred in the transition state. The glmS ribozyme is the first self-cleaving RNA to use an exogenous acid-base catalyst.

  3. The glmS Ribozyme Cofactor is a General Acid-Base Catalyst

    PubMed Central

    Viladoms, Julia; Fedor, Martha J.

    2012-01-01

    The glmS ribozyme is the first natural self-cleaving ribozyme known to require a cofactor. The D-glucosamine-6-phosphate (GlcN6P) cofactor has been proposed to serve as a general acid, but its role in the catalytic mechanism has not been established conclusively. We surveyed GlcN6P-like molecules for their ability to support self-cleavage of the glmS ribozyme and found a strong correlation between the pH dependence of the cleavage reaction and the intrinsic acidity of the cofactors. For cofactors with low binding affinities the contribution to rate enhancement was proportional to their intrinsic acidity. This linear free-energy relationship between cofactor efficiency and acid dissociation constants is consistent with a mechanism in which the cofactors participate directly in the reaction as general acid-base catalysts. A high value for the Brønsted coefficient (β ~ 0.7) indicates that a significant amount of proton transfer has already occurred in the transition state. The glmS ribozyme is the first self-cleaving RNA to use an exogenous acid-base catalyst. PMID:23113700

  4. The comprehensive acid-base characterization of glutathione

    NASA Astrophysics Data System (ADS)

    Mirzahosseini, Arash; Somlyay, Máté; Noszál, Béla

    2015-02-01

    Glutathione in its thiol (GSH) and disulfide (GSSG) forms, and 4 related compounds were studied by 1H NMR-pH titrations and a case-tailored evaluation method. The resulting acid-base properties are quantified in terms of 128 microscopic protonation constants; the first complete set of such parameters for this vitally important pair of compounds. The concomitant 12 interactivity parameters were also determined. Since biological redox systems are regularly compared to the GSH-GSSG pair, the eight microscopic thiolate basicities determined this way are exclusive means for assessing subtle redox parameters in a wide pH range.

  5. Gallic acid-based indanone derivatives as anticancer agents.

    PubMed

    Saxena, Hari Om; Faridi, Uzma; Srivastava, Suchita; Kumar, J K; Darokar, M P; Luqman, Suaib; Chanotiya, C S; Krishna, Vinay; Negi, Arvind S; Khanuja, S P S

    2008-07-15

    Gallic acid-based indanone derivatives have been synthesised. Some of the indanones showed very good anticancer activity in MTT assay. Compounds 10, 11, 12 and 14 possessed potent anticancer activity against various human cancer cell lines. The most potent indanone (10, IC(50)=2.2 microM), against MCF-7, that is, hormone-dependent breast cancer cell line, showed no toxicity to human erythrocytes even at higher concentrations (100 microg/ml, 258 microM). While, indanones 11, 12 and 14 showed toxicities to erythrocytes at higher concentrations.

  6. Acid-Base Homeostasis: Overview for Infusion Nurses.

    PubMed

    Masco, Natalie A

    2016-01-01

    Acid-base homeostasis is essential to normal function of the human body. Even slight alterations can significantly alter physiologic processes at the tissue and cellular levels. To optimally care for patients, nurses must be able to recognize signs and symptoms that indicate deviations from normal. Nurses who provide infusions to patients-whether in acute care, home care, or infusion center settings-have a responsibility to be able to recognize the laboratory value changes that occur with the imbalance and appreciate the treatment options, including intravenous infusions. PMID:27598068

  7. A fully automatic system for acid-base coulometric titrations.

    PubMed

    Cladera, A; Caro, A; Estela, J M; Cerdà, V

    1990-01-01

    An automatic system for acid-base titrations by electrogeneration of H(+) and OH(-) ions, with potentiometric end-point detection, was developed. The system includes a PC-compatible computer for instrumental control, data acquisition and processing, which allows up to 13 samples to be analysed sequentially with no human intervention.The system performance was tested on the titration of standard solutions, which it carried out with low errors and RSD. It was subsequently applied to the analysis of various samples of environmental and nutritional interest, specifically waters, soft drinks and wines.

  8. The physiological assessment of acid-base balance.

    PubMed

    Howorth, P J

    1975-04-01

    Acid-base terminology including the sue of SI units is reviewed. The historical reasons why nomograms have been particularly used in acid-base work are discussed. The theoretical basis of the Henderson-Hasselbalch equation is considered. It is emphasized that the solubility of CO2 in plasma and the apparent first dissociation constant of carbonic acid are not chemical constants when applied to media of uncertain and varying composition such as blood plasma. The use of the Henderson-Hasselbalch equation in making hypothermia corrections for PCO2 is discussed. The Astrup system for the in vitro determination of blood gases and derived parameters is described and the theoretical weakness of the base excess concept stressed. A more clinically-oriented approach to the assessment of acid-base problems is presented. Measurement of blood [H+] and PCO2 are considered to be primary data which should be recorded on a chart with in vivo CO2-titration lines (see below). Clinical information and results of other laboratory investigations such as plasma bicarbonate, PO2,P50 are then to be considered together with the primary data. In order to interpret this combined information it is essential to take into account the known ventilatory response to metabolic acidosis and alkalosis, and the renal response to respiratory acidosis and alkalosis. The use is recommended of a chart showing the whole-body CO2-titration points obtained when patients with different initial levels of non-respiratory [H+] are ventilated. A number of examples are given of the use of this [H+] and PCO2 in vivo chart in the interpretation of acid-base data. The aetiology, prognosis and treatment of metabolic alkalosis is briefly reviewed. Treatment with intravenous acid is recommended for established cases. Attention is drawn to the possibility of iatrogenic production of metabolic alkalosis. Caution is expressed over the use of intravenous alkali in all but the severest cases of metabolic acidosis. The role of

  9. [Acid-base equilibrium in sportsmen during physical exercise].

    PubMed

    Brinzak, V P; Kalinskiĭ, M I; Val'tin, A I; Povzhitkova, M S

    1983-01-01

    Acid-base balance in venous blood of basketball players was studied under specific loadings of various intensity by means of the micro-Astrup device. It is established that under acyclic loadings (throwing the ball into the basket) the state of metabolic acidosis is developed in the sportsmen and the more intensive the work, the higher the degree of the state of metabolic acidosis. The efficiency of actions of the persons examined was in inverse dependence on the degree of metabolic disturbances, i.e. the least efficiency was marked under the most profound acidosis.

  10. A Computer-Based Simulation of an Acid-Base Titration

    ERIC Educational Resources Information Center

    Boblick, John M.

    1971-01-01

    Reviews the advantages of computer simulated environments for experiments, referring in particular to acid-base titrations. Includes pre-lab instructions and a sample computer printout of a student's use of an acid-base simulation. Ten references. (PR)

  11. Microhomology-mediated mechanisms underlie non-recurrent disease-causing microdeletions of the FOXL2 gene or its regulatory domain.

    PubMed

    Verdin, Hannah; D'haene, Barbara; Beysen, Diane; Novikova, Yana; Menten, Björn; Sante, Tom; Lapunzina, Pablo; Nevado, Julian; Carvalho, Claudia M B; Lupski, James R; De Baere, Elfride

    2013-01-01

    Genomic disorders are often caused by recurrent copy number variations (CNVs), with nonallelic homologous recombination (NAHR) as the underlying mechanism. Recently, several microhomology-mediated repair mechanisms--such as microhomology-mediated end-joining (MMEJ), fork stalling and template switching (FoSTeS), microhomology-mediated break-induced replication (MMBIR), serial replication slippage (SRS), and break-induced SRS (BISRS)--were described in the etiology of non-recurrent CNVs in human disease. In addition, their formation may be stimulated by genomic architectural features. It is, however, largely unexplored to what extent these mechanisms contribute to rare, locus-specific pathogenic CNVs. Here, fine-mapping of 42 microdeletions of the FOXL2 locus, encompassing FOXL2 (32) or its regulatory domain (10), serves as a model for rare, locus-specific CNVs implicated in genetic disease. These deletions lead to blepharophimosis syndrome (BPES), a developmental condition affecting the eyelids and the ovary. For breakpoint mapping we used targeted array-based comparative genomic hybridization (aCGH), quantitative PCR (qPCR), long-range PCR, and Sanger sequencing of the junction products. Microhomology, ranging from 1 bp to 66 bp, was found in 91.7% of 24 characterized breakpoint junctions, being significantly enriched in comparison with a random control sample. Our results show that microhomology-mediated repair mechanisms underlie at least 50% of these microdeletions. Moreover, genomic architectural features, like sequence motifs, non-B DNA conformations, and repetitive elements, were found in all breakpoint regions. In conclusion, the majority of these microdeletions result from microhomology-mediated mechanisms like MMEJ, FoSTeS, MMBIR, SRS, or BISRS. Moreover, we hypothesize that the genomic architecture might drive their formation by increasing the susceptibility for DNA breakage or promote replication fork stalling. Finally, our locus-centered study

  12. A simplified strong ion model for acid-base equilibria: application to horse plasma.

    PubMed

    Constable, P D

    1997-07-01

    The Henderson-Hasselbalch equation and Stewart's strong ion model are currently used to describe mammalian acid-base equilibria. Anomalies exist when the Henderson-Hasselbalch equation is applied to plasma, whereas the strong ion model does not provide a practical method for determining the total plasma concentration of nonvolatile weak acids ([Atot]) and the effective dissociation constant for plasma weak acids (Ka). A simplified strong ion model, which was developed from the assumption that plasma ions act as strong ions, volatile buffer ions (HCO-3), or nonvolatile buffer ions, indicates that plasma pH is determined by five independent variables: PCO2, strong ion difference, concentration of individual nonvolatile plasma buffers (albumin, globulin, and phosphate), ionic strength, and temperature. The simplified strong ion model conveys on a fundamental level the mechanism for change in acid-base status, explains many of the anomalies when the Henderson-Hasselbalch equation is applied to plasma, is conceptually and algebraically simpler than Stewart's strong ion model, and provides a practical in vitro method for determining [Atot] and Ka of plasma. Application of the simplified strong ion model to CO2-tonometered horse plasma produced values for [Atot] (15.0 +/- 3.1 meq/l) and Ka (2.22 +/- 0.32 x 10(-7) eq/l) that were significantly different from the values commonly assumed for human plasma ([Atot] = 20.0 meq/l, Ka = 3.0 x 10(-7) eq/l). Moreover, application of the experimentally determined values for [Atot] and Ka to published data for the horse (known PCO2, strong ion difference, and plasma protein concentration) predicted plasma pH more accurately than the values for [Atot] and Ka commonly assumed for human plasma. Species-specific values for [Atot] and Ka should be experimentally determined when the simplified strong ion model (or strong ion model) is used to describe acid-base equilibria.

  13. Chemical rescue, multiple ionizable groups, and general acid-base catalysis in the HDV genomic ribozyme.

    PubMed

    Perrotta, Anne T; Wadkins, Timothy S; Been, Michael D

    2006-07-01

    In the ribozyme from the hepatitis delta virus (HDV) genomic strand RNA, a cytosine side chain is proposed to facilitate proton transfer in the transition state of the reaction and, thus, act as a general acid-base catalyst. Mutation of this active-site cytosine (C75) reduced RNA cleavage rates by as much as one million-fold, but addition of exogenous cytosine and certain nucleobase or imidazole analogs can partially rescue activity in these mutants. However, pH-rate profiles for the rescued reactions were bell shaped, and only one leg of the pH-rate curve could be attributed to ionization of the exogenous nucleobase or buffer. When a second potential ionizable nucleobase (C41) was removed, one leg of the bell-shaped curve was eliminated in the chemical-rescue reaction. With this construct, the apparent pK(a) determined from the pH-rate profile correlated with the solution pK(a) of the buffer, and the contribution of the buffer to the rate enhancement could be directly evaluated in a free-energy or Brønsted plot. The free-energy relationship between the acid dissociation constant of the buffer and the rate constant for cleavage (Brønsted value, beta, = approximately 0.5) was consistent with a mechanism in which the buffer acted as a general acid-base catalyst. These data support the hypothesis that cytosine 75, in the intact ribozyme, acts as a general acid-base catalyst.

  14. Genome-wide analysis of the H-NS and Sfh regulatory networks in Salmonella Typhimurium identifies a plasmid-encoded transcription silencing mechanism.

    PubMed

    Dillon, Shane C; Cameron, Andrew D S; Hokamp, Karsten; Lucchini, Sacha; Hinton, Jay C D; Dorman, Charles J

    2010-06-01

    The conjugative IncHI1 plasmid pSfR27 from Shigella flexneri 2a strain 2457T encodes the Sfh protein, a paralogue of the global transcriptional repressor H-NS. Sfh allows pSfR27 to be transmitted to new bacterial hosts with minimal impact on host fitness, providing a 'stealth' function whose molecular mechanism has yet to be determined. The impact of the Sfh protein on the Salmonella enterica serovar Typhimurium transcriptome was assessed and binding sites for Sfh in the Salmonella Typhimurium genome were identified by chromatin immunoprecipitation. Sfh did not bind uniquely to any sites. Instead, it bound to a subset of the larger H-NS regulatory network. Analysis of Sfh binding in the absence of H-NS revealed a greatly expanded population of Sfh binding sites that included the majority of H-NS target genes. Furthermore, the presence of plasmid pSfR27 caused a decrease in H-NS interactions with the S. Typhimurium chromosome, suggesting that the A + T-rich DNA of this large plasmid acts to titrate H-NS, removing it from chromosomal locations. It is proposed that Sfh acts as a molecular backup for H-NS and that it provides its 'stealth' function by replacing H-NS on the chromosome, thus minimizing disturbances to the H-NS-DNA binding pattern in cells that acquire pSfR27.

  15. A multilayered regulatory mechanism for the autoinhibition and activation of a plant CC-NB-LRR resistance protein with an extra N-terminal domain.

    PubMed

    Chen, Xiaojiao; Zhu, Min; Jiang, Lei; Zhao, Wenyang; Li, Jia; Wu, Jianyan; Li, Chun; Bai, Baohui; Lu, Gang; Chen, Hongyu; Moffett, Peter; Tao, Xiaorong

    2016-10-01

    The tomato resistance protein Sw-5b differs from the classical coiled-coil nucleotide-binding leucine-rich repeat (CC-NB-LRR) resistance proteins by having an extra N-terminal domain (NTD). To understand how NTD, CC and NB-LRR regulate autoinhibition and activation of Sw-5b, we dissected the function(s) of each domain. When viral elicitor was absent, Sw-5b LRR suppressed the central NB-ARC to maintain autoinhibition of the NB-LRR segment. The CC and NTD domains independently and additively enhanced the autoinhibition of NB-LRR. When viral elicitor was present, the NB-LRR segment of Sw-5b was specifically activated to trigger a hypersensitive response. Surprisingly, Sw-5b CC suppressed the activation of NB-LRR, whereas the extra NTD of Sw-5b became a positive regulator and fully activated the resistance protein, probably by relieving the inhibitory effects of the CC. In infection assays of transgenic plants, the NB-LRR segment alone was insufficient to confer resistance against Tomato spotted wilt tospovirus; the layers of NTD and CC regulation on NB-LRR were required for Sw-5b to confer resistance. Based on these findings, we propose that, to counter the negative regulation of the CC on NB-LRR, Sw-5b evolved an extra NTD to coordinate with the CC, thus developing a multilayered regulatory mechanism to control autoinhibition and activation.

  16. Dissection of the regulatory mechanism of a heat-shock responsive promoter in Haloarchaea: a new paradigm for general transcription factor directed archaeal gene regulation

    PubMed Central

    Lu, Qiuhe; Han, Jing; Zhou, Ligang; Coker, James A.; DasSarma, Priya; DasSarma, Shiladitya; Xiang, Hua

    2008-01-01

    Multiple general transcription factors (GTFs), TBP and TFB, are present in many haloarchaea, and are deemed to accomplish global gene regulation. However, details and the role of GTF-directed transcriptional regulation in stress response are still not clear. Here, we report a comprehensive investigation of the regulatory mechanism of a heat-induced gene (hsp5) from Halobacterium salinarum. We demonstrated by mutation analysis that the sequences 5′ and 3′ to the core elements (TATA box and BRE) of the hsp5 promoter (Phsp5) did not significantly affect the basal and heat-induced gene expression, as long as the transcription initiation site was not altered. Moreover, the BRE and TATA box of Phsp5 were sufficient to render a nonheat-responsive promoter heat-inducible, in both Haloferax volcanii and Halobacterium sp. NRC-1. DNA–protein interactions revealed that two heat-inducible GTFs, TFB2 from H. volcanii and TFBb from Halobacterium sp. NRC-1, could specifically bind to Phsp5 likely in a temperature-dependent manner. Taken together, the heat-responsiveness of Phsp5 was mainly ascribed to the core promoter elements that were efficiently recognized by specific heat-induced GTFs at elevated temperature, thus providing a new paradigm for GTF-directed gene regulation in the domain of Archaea. PMID:18390887

  17. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism.

    PubMed

    Shahriari, Ali; Dawson, Neal J; Bell, Ryan A V; Storey, Kenneth B

    2013-01-01

    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD(+), which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. 1.1.1.28) from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in V max (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves. PMID:24233354

  18. Stable Suppression of Lactate Dehydrogenase Activity during Anoxia in the Foot Muscle of Littorina littorea and the Potential Role of Acetylation as a Novel Posttranslational Regulatory Mechanism

    PubMed Central

    Shahriari, Ali; Dawson, Neal J.; Bell, Ryan A. V.; Storey, Kenneth B.

    2013-01-01

    The intertidal marine snail, Littorina littorea, has evolved to withstand extended bouts of oxygen deprivation brought about by changing tides or other potentially harmful environmental conditions. Survival is dependent on a strong suppression of its metabolic rate and a drastic reorganization of its cellular biochemistry in order to maintain energy balance under fixed fuel reserves. Lactate dehydrogenase (LDH) is a crucial enzyme of anaerobic metabolism as it is typically responsible for the regeneration of NAD+, which allows for the continued functioning of glycolysis in the absence of oxygen. This study compared the kinetic and structural characteristics of the D-lactate specific LDH (E.C. 1.1.1.28) from foot muscle of aerobic control versus 24 h anoxia-exposed L. littorea. Anoxic LDH displayed a near 50% decrease in Vmax (pyruvate-reducing direction) as compared to control LDH. These kinetic differences suggest that there may be a stable modification and regulation of LDH during anoxia, and indeed, subsequent dot-blot analyses identified anoxic LDH as being significantly less acetylated than the corresponding control enzyme. Therefore, acetylation may be the regulatory mechanism that is responsible for the suppression of LDH activity during anoxia, which could allow for the production of alternative glycolytic end products that in turn would increase the ATP yield under fixed fuel reserves. PMID:24233354

  19. A multilayered regulatory mechanism for the autoinhibition and activation of a plant CC-NB-LRR resistance protein with an extra N-terminal domain.

    PubMed

    Chen, Xiaojiao; Zhu, Min; Jiang, Lei; Zhao, Wenyang; Li, Jia; Wu, Jianyan; Li, Chun; Bai, Baohui; Lu, Gang; Chen, Hongyu; Moffett, Peter; Tao, Xiaorong

    2016-10-01

    The tomato resistance protein Sw-5b differs from the classical coiled-coil nucleotide-binding leucine-rich repeat (CC-NB-LRR) resistance proteins by having an extra N-terminal domain (NTD). To understand how NTD, CC and NB-LRR regulate autoinhibition and activation of Sw-5b, we dissected the function(s) of each domain. When viral elicitor was absent, Sw-5b LRR suppressed the central NB-ARC to maintain autoinhibition of the NB-LRR segment. The CC and NTD domains independently and additively enhanced the autoinhibition of NB-LRR. When viral elicitor was present, the NB-LRR segment of Sw-5b was specifically activated to trigger a hypersensitive response. Surprisingly, Sw-5b CC suppressed the activation of NB-LRR, whereas the extra NTD of Sw-5b became a positive regulator and fully activated the resistance protein, probably by relieving the inhibitory effects of the CC. In infection assays of transgenic plants, the NB-LRR segment alone was insufficient to confer resistance against Tomato spotted wilt tospovirus; the layers of NTD and CC regulation on NB-LRR were required for Sw-5b to confer resistance. Based on these findings, we propose that, to counter the negative regulation of the CC on NB-LRR, Sw-5b evolved an extra NTD to coordinate with the CC, thus developing a multilayered regulatory mechanism to control autoinhibition and activation. PMID:27558751

  20. 78 FR 36698 - Microbiology Devices; Reclassification of Nucleic Acid-Based Systems for Mycobacterium tuberculosis

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-19

    ... Nucleic Acid-Based Systems for Mycobacterium tuberculosis Complex in Respiratory Specimens AGENCY: Food...) is proposing to reclassify nucleic acid-based in vitro diagnostic devices for the detection of... Controls Guideline: Nucleic Acid-Based In Vitro Diagnostic Devices for the Detection of...

  1. BosR (BB0647) Controls the RpoN-RpoS Regulatory Pathway and Virulence Expression in Borrelia burgdorferi by a Novel DNA-Binding Mechanism

    PubMed Central

    Ouyang, Zhiming; Deka, Ranjit K.; Norgard, Michael V.

    2011-01-01

    In Borrelia burgdorferi (Bb), the Lyme disease spirochete, the alternative σ factor σ54 (RpoN) directly activates transcription of another alternative σ factor, σS (RpoS) which, in turn, controls the expression of virulence-associated membrane lipoproteins. As is customary in σ54-dependent gene control, a putative NtrC-like enhancer-binding protein, Rrp2, is required to activate the RpoN-RpoS pathway. However, recently it was found that rpoS transcription in Bb also requires another regulator, BosR, which was previously designated as a Fur or PerR homolog. Given this unexpected requirement for a second activator to promote σ54-dependent gene transcription, and the fact that regulatory mechanisms among similar species of pathogenic bacteria can be strain-specific, we sought to confirm the regulatory role of BosR in a second virulent strain (strain 297) of Bb. Indeed, BosR displayed the same influence over lipoprotein expression and mammalian infectivity for strain Bb 297 that were previously noted for Bb strain B31. We subsequently found that recombinant BosR (rBosR) bound to the rpoS gene at three distinct sites, and that binding occurred despite the absence of consensus Fur or Per boxes. This led to the identification of a novel direct repeat sequence (TAAATTAAAT) critical for rBosR binding in vitro. Mutations in the repeat sequence markedly inhibited or abolished rBosR binding. Taken together, our studies provide new mechanistic insights into how BosR likely acts directly on rpoS as a positive transcriptional activator. Additional novelty is engendered by the facts that, although BosR is a Fur or PerR homolog and it contains zinc (like Fur and PerR), it has other unique features that clearly set it apart from these other regulators. Our findings also have broader implications regarding a previously unappreciated layer of control that can be involved in σ54–dependent gene regulation in bacteria. PMID:21347346

  2. Viral complement regulatory proteins.

    PubMed

    Rosengard, A M; Ahearn, J M

    1999-05-01

    The inactivation of complement provides cells and tissues critical protection from complement-mediated attack and decreases the associated recruitment of other inflammatory mediators. In an attempt to evade the host immune response, viruses have evolved two mechanisms to acquire complement regulatory proteins. They can directly seize the host cell complement regulators onto their outer envelope and/or they can produce their own proteins which are either secreted into the neighboring intercellular space or expressed as membrane-bound proteins on the infected host cell. The following review will concentrate on the viral homologues of the mammalian complement regulatory proteins, specifically those containing complement control protein (CCP) repeats. PMID:10408371

  3. Manganese salen complexes with acid-base catalytic auxiliary: functional mimetics of catalase.

    PubMed

    Noritake, Yukinobu; Umezawa, Naoki; Kato, Nobuki; Higuchi, Tsunehiko

    2013-04-01

    Antioxidant therapies have been considered for a wide variety of disorders associated with oxidative stress, and synthetic catalytic scavengers of reactive oxygen species would be clinically superior to stoichiometric ones. Among them, salen-manganese complexes (Mn(Salen)) seem promising, because they exhibit dual functions, i.e. superoxide dismutase- and catalase-mimetic activities. We have been developing enzyme-mimetic Mn(Salen) complexes bearing a functional group that enhances their catalytic activity. Here, we describe the design and synthesis of novel Mn(Salen) complexes with general acid-base catalytic functionality, inspired by the reaction mechanism of catalase. As expected, these Mn(Salen) complexes showed superior catalase-like activity and selectivity, while retaining moderate SOD-like activity. An unsubstituted pyridyl group worked well as a functionality to promote catalase-like activity. The introduced functionality did not alter the redox potential suggesting that the auxiliary-modified complex acted as an acid-base catalyst analogous to catalase. We believe that our approach provides a new design principle for sophisticated catalyst design. Further, the compounds described here appear to be good candidates for use in antioxidant therapy.

  4. Acid-base regulation during heating and cooling in the lizard, Varanus exanthematicus.

    PubMed

    Wood, S C; Johansen, K; Glass, M L; Hoyt, R W

    1981-04-01

    Current concepts of acid-base balance in ectothermic animals require that arterial pH vary inversely with body temperature in order to maintain a constant OH-/H+ and constant net charge on proteins. The present study evaluates acid-base regulation in Varanus exanthematicus under various regimes of heating and cooling between 15 and 38 degrees C. Arterial blood was sampled during heating and cooling at various rates, using restrained and unrestrained animals with and without face masks. Arterial pH was found to have a small temperature dependence, i.e., pH = 7.66--0.005 (T). The slope (dpH/dT = -0.005), while significantly greater than zero (P less than 0.05), is much less than that required for a constant OH-/H+ or a constant imidazole alphastat (dpH/dT congruent to 0.018). The physiological mechanism that distinguishes this species from most other ectotherms is the presence of a ventilatory response to temperature-induced changes in CO2 production and O2 uptake, i.e., VE/VO2 is constant. This results in a constant O2 extraction and arterial saturation (approx. 90%), which is adaptive to the high aerobic requirements of this species.

  5. General acid-base catalysis mediated by nucleobases in the hairpin ribozyme

    PubMed Central

    Kath-Schorr, Stephanie; Wilson, Timothy J.; Li, Nan-Sheng; Lu, Jun; Piccirilli, Joseph A.; Lilley, David M. J.

    2012-01-01

    The catalytic mechanism by which the hairpin ribozyme accelerates cleavage or ligation of the phosphodiester backbone of RNA has been incompletely understood. There is experimental evidence for an important role for an adenine (A38) and a guanine (G8), and it has been proposed that these act in general acid-base catalysis. In this work we show that a large reduction in cleavage rate on substitution of A38 by purine (A38P) can be reversed by replacement of the 5′-oxygen atom at the scissile phosphate by sulfur (5′-PS), which is a much better leaving group. This is consistent with A38 acting as the general acid in the unmodified ribozyme. The rate of cleavage of the 5′-PS substrate by the A38P ribozyme increases with pH log-linearly, indicative of a requirement for a deprotonated base with a relatively high pKa. On substitution of G8 by diaminopurine, the 5′-PS substrate cleavage rate at first increases with pH and then remains at a plateau, exhibiting an apparent pKa consistent with this nucleotide acting in general base catalysis. Alternative explanations for the pH dependence of hairpin ribozyme reactivity are discussed, from which we conclude that general acid-base catalysis by A38 and G8 is the simplest and most probable explanation consistent with all the experimental data. PMID:22958171

  6. A Prebiotic Chemistry Experiment on the Adsorption of Nucleic Acids Bases onto a Natural Zeolite

    NASA Astrophysics Data System (ADS)

    Anizelli, Pedro R.; Baú, João Paulo T.; Gomes, Frederico P.; da Costa, Antonio Carlos S.; Carneiro, Cristine E. A.; Zaia, Cássia Thaïs B. V.; Zaia, Dimas A. M.

    2015-09-01

    There are currently few mechanisms that can explain how nucleic acid bases were synthesized, concentrated from dilute solutions, and/or protected against degradation by UV radiation or hydrolysis on the prebiotic Earth. A natural zeolite exhibited the potential to adsorb adenine, cytosine, thymine, and uracil over a range of pH, with greater adsorption of adenine and cytosine at acidic pH. Adsorption of all nucleic acid bases was decreased in artificial seawater compared to water, likely due to cation complexation. Furthermore, adsorption of adenine appeared to protect natural zeolite from thermal degradation. The C=O groups from thymine, cytosine and uracil appeared to assist the dissolution of the mineral while the NH2 group from adenine had no effect. As shown by FT-IR spectroscopy, adenine interacted with a natural zeolite through the NH2 group, and cytosine through the C=O group. A pseudo-second-order model best described the kinetics of adenine adsorption, which occurred faster in artificial seawaters.

  7. A Prebiotic Chemistry Experiment on the Adsorption of Nucleic Acids Bases onto a Natural Zeolite.

    PubMed

    Anizelli, Pedro R; Baú, João Paulo T; Gomes, Frederico P; da Costa, Antonio Carlos S; Carneiro, Cristine E A; Zaia, Cássia Thaïs B V; Zaia, Dimas A M

    2015-09-01

    There are currently few mechanisms that can explain how nucleic acid bases were synthesized, concentrated from dilute solutions, and/or protected against degradation by UV radiation or hydrolysis on the prebiotic Earth. A natural zeolite exhibited the potential to adsorb adenine, cytosine, thymine, and uracil over a range of pH, with greater adsorption of adenine and cytosine at acidic pH. Adsorption of all nucleic acid bases was decreased in artificial seawater compared to water, likely due to cation complexation. Furthermore, adsorption of adenine appeared to protect natural zeolite from thermal degradation. The C=O groups from thymine, cytosine and uracil appeared to assist the dissolution of the mineral while the NH2 group from adenine had no effect. As shown by FT-IR spectroscopy, adenine interacted with a natural zeolite through the NH2 group, and cytosine through the C=O group. A pseudo-second-order model best described the kinetics of adenine adsorption, which occurred faster in artificial seawaters. PMID:25754589

  8. A Prebiotic Chemistry Experiment on the Adsorption of Nucleic Acids Bases onto a Natural Zeolite.

    PubMed

    Anizelli, Pedro R; Baú, João Paulo T; Gomes, Frederico P; da Costa, Antonio Carlos S; Carneiro, Cristine E A; Zaia, Cássia Thaïs B V; Zaia, Dimas A M

    2015-09-01

    There are currently few mechanisms that can explain how nucleic acid bases were synthesized, concentrated from dilute solutions, and/or protected against degradation by UV radiation or hydrolysis on the prebiotic Earth. A natural zeolite exhibited the potential to adsorb adenine, cytosine, thymine, and uracil over a range of pH, with greater adsorption of adenine and cytosine at acidic pH. Adsorption of all nucleic acid bases was decreased in artificial seawater compared to water, likely due to cation complexation. Furthermore, adsorption of adenine appeared to protect natural zeolite from thermal degradation. The C=O groups from thymine, cytosine and uracil appeared to assist the dissolution of the mineral while the NH2 group from adenine had no effect. As shown by FT-IR spectroscopy, adenine interacted with a natural zeolite through the NH2 group, and cytosine through the C=O group. A pseudo-second-order model best described the kinetics of adenine adsorption, which occurred faster in artificial seawaters.

  9. Analytic calculation of physiological acid-base parameters in plasma.

    PubMed

    Wooten, E W

    1999-01-01

    Analytic expressions for plasma total titratable base, base excess (DeltaCB), strong-ion difference, change in strong-ion difference (DeltaSID), change in Van Slyke standard bicarbonate (DeltaVSSB), anion gap, and change in anion gap are derived as a function of pH, total buffer ion concentration, and conditional molar equilibrium constants. The behavior of these various parameters under respiratory and metabolic acid-base disturbances for constant and variable buffer ion concentrations is considered. For constant noncarbonate buffer concentrations, DeltaSID = DeltaCB = DeltaVSSB, whereas these equalities no longer hold under changes in noncarbonate buffer concentration. The equivalence is restored if the reference state is changed to include the new buffer concentrations.

  10. Ultrasonic and densimetric titration applied for acid-base reactions.

    PubMed

    Burakowski, Andrzej; Gliński, Jacek

    2014-01-01

    Classical acoustic acid-base titration was monitored using sound speed and density measurements. Plots of these parameters, as well as of the adiabatic compressibility coefficient calculated from them, exhibit changes with the volume of added titrant. Compressibility changes can be explained and quantitatively predicted theoretically in terms of Pasynski theory of non-compressible hydrates combined with that of the additivity of the hydration numbers with the amount and type of ions and molecules present in solution. It also seems that this development could be applied in chemical engineering for monitoring the course of chemical processes, since the applied experimental methods can be carried out almost independently on the medium under test (harmful, aggressive, etc.).

  11. Nucleic acid-based tissue biomarkers of urologic malignancies.

    PubMed

    Dietrich, Dimo; Meller, Sebastian; Uhl, Barbara; Ralla, Bernhard; Stephan, Carsten; Jung, Klaus; Ellinger, Jörg; Kristiansen, Glen

    2014-08-01

    Molecular biomarkers play an important role in the clinical management of cancer patients. Biomarkers allow estimation of the risk of developing cancer; help to diagnose a tumor, ideally at an early stage when cure is still possible; and aid in monitoring disease progression. Furthermore, they hold the potential to predict the outcome of the disease (prognostic biomarkers) and the response to therapy (predictive biomarkers). Altogether, biomarkers will help to avoid tumor-related deaths and reduce overtreatment, and will contribute to increased survival and quality of life in cancer patients due to personalized treatments. It is well established that the process of carcinogenesis is a complex interplay between genomic predisposition, acquired somatic mutations, epigenetic changes and genomic aberrations. Within this complex interplay, nucleic acids, i.e. RNA and DNA, play a fundamental role and therefore represent ideal candidates for biomarkers. They are particularly promising candidates because sequence-specific hybridization and amplification technologies allow highly accurate and sensitive assessment of these biomarker levels over a broad dynamic range. This article provides an overview of nucleic acid-based biomarkers in tissues for the management of urologic malignancies, i.e. tumors of the prostate, testis, kidney, penis, urinary bladder, renal pelvis, ureter and other urinary organs. Special emphasis is put on genomic, transcriptomic and epigenomic biomarkers (SNPs, mutations [genomic and mitochondrial], microsatellite instabilities, viral and bacterial DNA, DNA methylation and hydroxymethylation, mRNA expression, and non-coding RNAs [lncRNA, miRNA, siRNA, piRNA, snRNA, snoRNA]). Due to the multitude of published biomarker candidates, special focus is given to the general applicability of different molecular classes as biomarkers and some particularly promising nucleic acid biomarkers. Furthermore, specific challenges regarding the development and clinical

  12. Study on the regulatory mechanism of the lipid metabolism pathways during chicken male germ cell differentiation based on RNA-seq.

    PubMed

    Zuo, Qisheng; Li, Dong; Zhang, Lei; Elsayed, Ahmed Kamel; Lian, Chao; Shi, Qingqing; Zhang, Zhentao; Zhu, Rui; Wang, Yinjie; Jin, Kai; Zhang, Yani; Li, Bichun

    2015-01-01

    Here, we explore the regulatory mechanism of lipid metabolic signaling pathways and related genes during differentiation of male germ cells in chickens, with the hope that better understanding of these pathways may improve in vitro induction. Fluorescence-activated cell sorting was used to obtain highly purified cultures of embryonic stem cells (ESCs), primitive germ cells (PGCs), and spermatogonial stem cells (SSCs). The total RNA was then extracted from each type of cell. High-throughput analysis methods (RNA-seq) were used to sequence the transcriptome of these cells. Gene Ontology (GO) analysis and the KEGG database were used to identify lipid metabolism pathways and related genes. Retinoic acid (RA), the end-product of the retinol metabolism pathway, induced in vitro differentiation of ESC into male germ cells. Quantitative real-time PCR (qRT-PCR) was used to detect changes in the expression of the genes involved in the retinol metabolic pathways. From the results of RNA-seq and the database analyses, we concluded that there are 328 genes in 27 lipid metabolic pathways continuously involved in lipid metabolism during the differentiation of ESC into SSC in vivo, including retinol metabolism. Alcohol dehydrogenase 5 (ADH5) and aldehyde dehydrogenase 1 family member A1 (ALDH1A1) are involved in RA synthesis in the cell. ADH5 was specifically expressed in PGC in our experiments and aldehyde dehydrogenase 1 family member A1 (ALDH1A1) persistently increased throughout development. CYP26b1, a member of the cytochrome P450 superfamily, is involved in the degradation of RA. Expression of CYP26b1, in contrast, decreased throughout development. Exogenous RA in the culture medium induced differentiation of ESC to SSC-like cells. The expression patterns of ADH5, ALDH1A1, and CYP26b1 were consistent with RNA-seq results. We conclude that the retinol metabolism pathway plays an important role in the process of chicken male germ cell differentiation.

  13. Analysis of tomato plasma membrane H(+)-ATPase gene family suggests a mycorrhiza-mediated regulatory mechanism conserved in diverse plant species.

    PubMed

    Liu, Junli; Liu, Jianjian; Chen, Aiqun; Ji, Minjie; Chen, Jiadong; Yang, Xiaofeng; Gu, Mian; Qu, Hongye; Xu, Guohua

    2016-10-01

    In plants, the plasma membrane H(+)-ATPase (HA) is considered to play a crucial role in regulating plant growth and respoding to environment stresses. Multiple paralogous genes encoding different isozymes of HA have been identified and characterized in several model plants, while limited information of the HA gene family is available to date for tomato. Here, we describe the molecular and expression features of eight HA-encoding genes (SlHA1-8) from tomato. All these genes are interrupted by multiple introns with conserved positions. SlHA1, 2, and 4 were widely expressed in all tissues, while SlHA5, 6, and 7 were almost only expressed in flowers. SlHA8, the transcripts of which were barely detectable under normal or nutrient-/salt-stress growth conditions, was strongly activated in arbuscular mycorrhizal (AM) fungal-colonized roots. Extreme lack of SlHA8 expression in M161, a mutant defective to AM fungal colonization, provided genetic evidence towards the dependence of its expression on AM symbiosis. A 1521-bp SlHA8 promoter could direct the GUS reporter expression specifically in colonized cells of transgenic tobacco, soybean, and rice mycorrhizal roots. Promoter deletion assay revealed a 223-bp promoter fragment of SlHA8 containing a variant of AM-specific cis-element MYCS (vMYCS) sufficient to confer the AM-induced activity. Targeted deletion of this motif in the corresponding promoter region causes complete abolishment of GUS staining in mycorrhizal roots. Together, these results lend cogent evidence towards the evolutionary conservation of a potential regulatory mechanism mediating the activation of AM-responsive HA genes in diverse mycorrhizal plant species.

  14. Rab27a negatively regulates CFTR chloride channel function in colonic epithelia: Involvement of the effector proteins in the regulatory mechanism

    SciTech Connect

    Saxena, Sunil K. . E-mail: ssaxena@stevens.edu; Kaur, Simarna

    2006-07-21

    Cystic fibrosis, an autosomal recessive disorder, is caused by the disruption of biosynthesis or function of CFTR. CFTR regulatory mechanisms include channel transport to plasma membrane and protein-protein interactions. Rab proteins are small GTPases involved in vesicle transport, docking, and fusion. The colorectal epithelial HT-29 cells natively express CFTR and respond to cAMP with an increase in CFTR-mediated currents. DPC-inhibited currents could be completely eliminated with CFTR-specific SiRNA. Over-expression of Rab27a inhibited, while isoform specific SiRNA and Rab27a antibody stimulated CFTR-mediated currents in HT-29 cells. CFTR activity is inhibited both by Rab27a (Q78L) (constitutive active GTP-bound form of Rab27a) and Rab27a (T23N) (constitutive negative form that mimics the GDP-bound form). Rab27a mediated effects could be reversed by Rab27a-binding proteins, the synaptotagmin-like protein (SLP-5) and Munc13-4 accessory protein (a putative priming factor for exocytosis). The SLP reversal of Rab27a effect was restricted to C2A/C2B domains while the SHD motif imparted little more inhibition. The CFTR-mediated currents remain unaffected by Rab3 though SLP-5 appears to weakly bind it. The immunoprecipitation experiments suggest protein-protein interactions between Rab27a and CFTR. Rab27a appears to impair CFTR appearance at the cell surface by trapping CFTR in the intracellular compartments. Munc13-4 and SLP-5, on the other hand, limit Rab27a availability to CFTR, thus minimizing its effect on channel function. These observations decisively prove that Rab27a is involved in CFTR channel regulation through protein-protein interactions involving Munc13-4 and SLP-5 effector proteins, and thus could be a potential target for cystic fibrosis therapy.

  15. The Functional and Regulatory Mechanisms of the Thellungiella salsuginea Ascorbate Peroxidase 6 (TsAPX6) in Response to Salinity and Water Deficit Stresses

    PubMed Central

    Li, Zeqin; Zhang, Jilong; Li, Jingxiao; Li, Hongjie; Zhang, Genfa

    2016-01-01

    Soil salinization is a resource and ecological problem in the world. Thellungiella salsuginea is becoming a new model plant because it resembles its relative species, Arabidopsis thaliana, in small genome and short life cycle. It is highly tolerant to salinity and drought stresses. Ascorbate peroxidase (APX) is an enzyme that clears H2O2 in plants. The function and molecular and regulation mechanisms of APX in T. salsuginea have rarely been reported. In this study, an APX gene, TsApx6, was cloned from T. salsuginea and its responses to abiotic stresses in transgenic Arabidopsis were studied. Under high salinity treatment, the expression of TsApx6 was significantly induced. Under drought treatment, overexpression of TsApx6 increased the survival rate and reduced leaf water loss rate in Arabidopsis. Compared to the wild type plants, high salinity treatment reduced the concentrations of MDA, H2O2 and proline but elevated the activities of APX, GPX, CAT and SOD in the TsApx6-overexpressing plants. Meanwhile, germination rate, cotyledon greening, and root length were improved in the transgenic plants compared to the wild type plants under salt and water deficit conditions. Based on these findings, TsApx6 has an important function in the resistance of plants to certain abiotic stresses. The TsApx6 promoter sequence was obtained using Genome Walking technology. Bioinformatics analysis indicated that it contains some cis-acting elements related to stress response. The treatments of salt, dehydration, and ABA induced the expression of Gus gene under the regulation of the TsApx6 promoter. Mutation analysis showed that the MBS motif present in the TsApx6 promoter might be a key negative regulatory element which has an important effect on the growth and developmental process of plants. PMID:27097028

  16. Integrated proteomic and transcriptomic analysis reveals novel genes and regulatory mechanisms involved in salt stress responses in Synechocystis sp. PCC 6803.

    PubMed

    Qiao, Jianjun; Huang, Siqiang; Te, Rigen; Wang, Jiangxin; Chen, Lei; Zhang, Weiwen

    2013-09-01

    Salt stress is a common stress that limits growth and productivity of photosynthetic microbes in natural environments. Although cellular responses of a model cyanobacterium Synechocystis sp. PCC6803 to high and changing salt concentration have been studied, it remains undefined of the gene components and their regulation in the long-term salt acclimation networks. In this study, we performed an integrated study coupling a quantitative iTRAQ-LC-MS/MS proteomics and a next-generation sequencing-based RNA-seq transcriptomics on Synechocystis under salt stress for an extended period of time. Comparative quantification of protein abundances led to the identification of 68 and 108 proteins differentially regulated by salt treatment at 24 and 48 h, respectively. RNA-seq transcriptomic analysis showed that genes involved in energy metabolism and protein synthesis, and genes encoding hypothetical proteins responded to salt stress in a phase-dependent pattern. Notably, a gene encoding CO2-uptake-related protein (CupA) and three genes encoding hypothetical proteins were induced significantly at either transcript or protein level after long-term salt stress. Gene knockout and comparative growth analysis demonstrated that these four genes were involved in salt tolerance in Synechocystis. In addition, a complementary proteome and transcriptome analysis showed that concordance between protein abundances and their corresponding mRNAs varied significantly between various gene-protein pairs, indicating divergent regulation of transcriptional and post-transcriptional processes during salt stress adaptation in Synechocystis. The study provided new insights on genes and regulatory mechanism involved in salt stress response in Synechocystis.

  17. Regulatory mechanism of the light-activable allosteric switch LOV-TAP for the control of DNA binding: a computer simulation study.

    PubMed

    Peter, Emanuel; Dick, Bernhard; Baeurle, Stephan A

    2013-03-01

    The spatio-temporal control of gene expression is fundamental to elucidate cell proliferation and deregulation phenomena in living systems. Novel approaches based on light-sensitive multiprotein complexes have recently been devised, showing promising perspectives for the noninvasive and reversible modulation of the DNA-transcriptional activity in vivo. This has lately been demonstrated in a striking way through the generation of the artificial protein construct light-oxygen-voltage (LOV)-tryptophan-activated protein (TAP), in which the LOV-2-Jα photoswitch of phototropin1 from Avena sativa (AsLOV2-Jα) has been ligated to the tryptophan-repressor (TrpR) protein from Escherichia coli. Although tremendous progress has been achieved on the generation of such protein constructs, a detailed understanding of their functioning as opto-genetical tools is still in its infancy. Here, we elucidate the early stages of the light-induced regulatory mechanism of LOV-TAP at the molecular level, using the noninvasive molecular dynamics simulation technique. More specifically, we find that Cys450-FMN-adduct formation in the AsLOV2-Jα-binding pocket after photoexcitation induces the cleavage of the peripheral Jα-helix from the LOV core, causing a change of its polarity and electrostatic attraction of the photoswitch onto the DNA surface. This goes along with the flexibilization through unfolding of a hairpin-like helix-loop-helix region interlinking the AsLOV2-Jα- and TrpR-domains, ultimately enabling the condensation of LOV-TAP onto the DNA surface. By contrast, in the dark state the AsLOV2-Jα photoswitch remains inactive and exerts a repulsive electrostatic force on the DNA surface. This leads to a distortion of the hairpin region, which finally relieves its tension by causing the disruption of LOV-TAP from the DNA.

  18. The Functional and Regulatory Mechanisms of the Thellungiella salsuginea Ascorbate Peroxidase 6 (TsAPX6) in Response to Salinity and Water Deficit Stresses.

    PubMed

    Li, Zeqin; Zhang, Jilong; Li, Jingxiao; Li, Hongjie; Zhang, Genfa

    2016-01-01

    Soil salinization is a resource and ecological problem in the world. Thellungiella salsuginea is becoming a new model plant because it resembles its relative species, Arabidopsis thaliana, in small genome and short life cycle. It is highly tolerant to salinity and drought stresses. Ascorbate peroxidase (APX) is an enzyme that clears H2O2 in plants. The function and molecular and regulation mechanisms of APX in T. salsuginea have rarely been reported. In this study, an APX gene, TsApx6, was cloned from T. salsuginea and its responses to abiotic stresses in transgenic Arabidopsis were studied. Under high salinity treatment, the expression of TsApx6 was significantly induced. Under drought treatment, overexpression of TsApx6 increased the survival rate and reduced leaf water loss rate in Arabidopsis. Compared to the wild type plants, high salinity treatment reduced the concentrations of MDA, H2O2 and proline but elevated the activities of APX, GPX, CAT and SOD in the TsApx6-overexpressing plants. Meanwhile, germination rate, cotyledon greening, and root length were improved in the transgenic plants compared to the wild type plants under salt and water deficit conditions. Based on these findings, TsApx6 has an important function in the resistance of plants to certain abiotic stresses. The TsApx6 promoter sequence was obtained using Genome Walking technology. Bioinformatics analysis indicated that it contains some cis-acting elements related to stress response. The treatments of salt, dehydration, and ABA induced the expression of Gus gene under the regulation of the TsApx6 promoter. Mutation analysis showed that the MBS motif present in the TsApx6 promoter might be a key negative regulatory element which has an important effect on the growth and developmental process of plants. PMID:27097028

  19. [On improvement of the mechanism for establishing and changing indicators of quality and food safety in the regulatory and legal acts of the Eurasian Economical Union].

    PubMed

    Arnautov, O V

    2016-01-01

    In accordance with the Treaty on the Eurasian Economic Union (EAEU) to ensure the sanitary and epidemiological welfare of the population within the Union, a coordinated policy in agreed policy in the sphere of application of sanitary measures is carried out. Sanitary measures are the obligatory requirements and procedures, including requirements for the final product, processing methods, production, transportation, storage and disposal, sampling procedures, methods of research (tests), risk assessment, the state registration, requirements for packaging directly aimed at ensuring the safety of products (goods) in order to protect human welfare, and they should be applied on the basis having a scientific explanation, and only to the extent that is necessary to protect human welfare. Sanitary measures applied within the Union should be based on international and regional standards, guidelines and (or) the recommendations, except when they based on appropriate scientific studies and explanations. In this case sanitary measures which could provide a higher level of sanitary protection are introduced. At present, the mechanism of the development, justification and approval of common sanitary and epidemiological requirements (ESR) and procedures of the Eurasian Economic Commission (the Commission) is not installed. The absence of a clear mechanism for the development, approval and implementation of the ESR to the products (goods) on the basis having a scientific explanation on the one hand could lead to the creation of unjustified barriers to foreign and mutual trade, on the other--to weaken the level of safety for human life and health of products (goods) placed on markets of the Union. In order to bring the regulatory legal acts of the Customs Union in accordance with the Treaty on the Eurasian Economic Union the Commission in cooperation with the competent authorities of the Member States in the field of sanitary and epidemiological welfare developed the project of

  20. [On improvement of the mechanism for establishing and changing indicators of quality and food safety in the regulatory and legal acts of the Eurasian Economical Union].

    PubMed

    Arnautov, O V

    2016-01-01

    In accordance with the Treaty on the Eurasian Economic Union (EAEU) to ensure the sanitary and epidemiological welfare of the population within the Union, a coordinated policy in agreed policy in the sphere of application of sanitary measures is carried out. Sanitary measures are the obligatory requirements and procedures, including requirements for the final product, processing methods, production, transportation, storage and disposal, sampling procedures, methods of research (tests), risk assessment, the state registration, requirements for packaging directly aimed at ensuring the safety of products (goods) in order to protect human welfare, and they should be applied on the basis having a scientific explanation, and only to the extent that is necessary to protect human welfare. Sanitary measures applied within the Union should be based on international and regional standards, guidelines and (or) the recommendations, except when they based on appropriate scientific studies and explanations. In this case sanitary measures which could provide a higher level of sanitary protection are introduced. At present, the mechanism of the development, justification and approval of common sanitary and epidemiological requirements (ESR) and procedures of the Eurasian Economic Commission (the Commission) is not installed. The absence of a clear mechanism for the development, approval and implementation of the ESR to the products (goods) on the basis having a scientific explanation on the one hand could lead to the creation of unjustified barriers to foreign and mutual trade, on the other--to weaken the level of safety for human life and health of products (goods) placed on markets of the Union. In order to bring the regulatory legal acts of the Customs Union in accordance with the Treaty on the Eurasian Economic Union the Commission in cooperation with the competent authorities of the Member States in the field of sanitary and epidemiological welfare developed the project of

  1. Effect of temperature on the acid-base properties of the alumina surface: microcalorimetry and acid-base titration experiments.

    PubMed

    Morel, Jean-Pierre; Marmier, Nicolas; Hurel, Charlotte; Morel-Desrosiers, Nicole

    2006-06-15

    Sorption reactions on natural or synthetic materials that can attenuate the migration of pollutants in the geosphere could be affected by temperature variations. Nevertheless, most of the theoretical models describing sorption reactions are at 25 degrees C. To check these models at different temperatures, experimental data such as the enthalpies of sorption are thus required. Highly sensitive microcalorimeters can now be used to determine the heat effects accompanying the sorption of radionuclides on oxide-water interfaces, but enthalpies of sorption cannot be extracted from microcalorimetric data without a clear knowledge of the thermodynamics of protonation and deprotonation of the oxide surface. However, the values reported in the literature show large discrepancies and one must conclude that, amazingly, this fundamental problem of proton binding is not yet resolved. We have thus undertaken to measure by titration microcalorimetry the heat effects accompanying proton exchange at the alumina-water interface at 25 degrees C. Based on (i) the surface sites speciation provided by a surface complexation model (built from acid-base titrations at 25 degrees C) and (ii) results of the microcalorimetric experiments, calculations have been made to extract the enthalpic variations associated respectively to first and second deprotonation of the alumina surface. Values obtained are deltaH1 = 80+/-10 kJ mol(-1) and deltaH2 = 5+/-3 kJ mol(-1). In a second step, these enthalpy values were used to calculate the alumina surface acidity constants at 50 degrees C via the van't Hoff equation. Then a theoretical titration curve at 50 degrees C was calculated and compared to the experimental alumina surface titration curve. Good agreement between the predicted acid-base titration curve and the experimental one was observed.

  2. Hydrodynamic Instabilities Driven by Acid-base Neutralization Reaction in Immiscible System

    NASA Astrophysics Data System (ADS)

    Asad, Ahmed; Yang, Ya-hui; Chai, Chuan; Wu, Jiang-tao

    2010-10-01

    The hydrodynamic instabilities driven by an acid-base neutralization reaction, in contact along a plane interface, placed in a Hele-Shaw cell under the gravitational field are reported. The system consists of the heavier aqueous tetramethyle-ammonium hydroxide below the lighter layer of organic phase with propionic acid as reacting specie. The effect of chemical composition on hydrodynamic instabilities during interfacial mass transfer accompanied by a neutralization reaction is investigated. Depending on the initial concentration of the reacting species, Marangoni convection in the form of roll cells or trains of waves is observed. Mach-Zehnder interferometer is used to measure the change in base concentration at the time of instability formation. The results show that the instabilities resulted from the convection flow are more efficient to the mechanism of mass transfer and can drastically alter pattern formation in the system.

  3. Enabling the Tablet Product Development of 5-Fluorocytosine by Conjugate Acid Base Cocrystals.

    PubMed

    Perumalla, Sathyanarayana R; Paul, Shubhajit; Sun, Changquan C

    2016-06-01

    5-Fluorocytosine (FC) is a high-dose antifungal drug that challenges the development of a tablet product due to poor solid-state stability and tabletability. Using 2 pharmaceutically acceptable conjugate acid base (CAB) cocrystals of FC with HCl and acesulfame, we have developed commercially viable high loading FC tablets. The tablets were prepared by direct compression using nano-coated microcrystalline cellulose Avicel PH105 as a tablet binder, which provided both excellent tabletability and good flowability. Commercial manufacturability of formulations based on both CAB cocrystals was verified on a compaction simulator. The results from an expedited friability study were used to set the compaction force, which yielded tablets with sufficient mechanical strength and rapid tablet disintegration. This work demonstrates the potential value of CAB cocrystals in drug product development. PMID:27238493

  4. Kinetics of acid base catalyzed transesterification of Jatropha curcas oil.

    PubMed

    Jain, Siddharth; Sharma, M P

    2010-10-01

    Out of various non-edible oil resources, Jatropha curcas oil (JCO) is considered as future feedstock for biodiesel production in India. Limited work is reported on the kinetics of transesterification of high free fatty acids containing oil. The present study reports the results of kinetic study of two-step acid base catalyzed transesterification process carried out at an optimum temperature of 65 °C and 50 °C for esterification and transesterification respectively under the optimum methanol to oil ratio of 3:7 (v/v), catalyst concentration 1% (w/w) for H₂SO₄ and NaOH. The yield of methyl ester (ME) has been used to study the effect of different parameters. The results indicate that both esterification and transesterification reaction are of first order with reaction rate constant of 0.0031 min⁻¹ and 0.008 min⁻¹ respectively. The maximum yield of 21.2% of ME during esterification and 90.1% from transesterification of pretreated JCO has been obtained.

  5. Acid-base metabolism: implications for kidney stones formation.

    PubMed

    Hess, Bernhard

    2006-04-01

    The physiology and pathophysiology of renal H+ ion excretion and urinary buffer systems are reviewed. The main focus is on the two major conditions related to acid-base metabolism that cause kidney stone formation, i.e., distal renal tubular acidosis (dRTA) and abnormally low urine pH with subsequent uric acid stone formation. Both the entities can be seen on the background of disturbances of the major urinary buffer system, NH3+ <--> NH4+. On the one hand, reduced distal tubular secretion of H+ ions results in an abnormally high urinary pH and either incomplete or complete dRTA. On the other hand, reduced production/availability of NH4+ is the cause of an abnormally low urinary pH, which predisposes to uric acid stone formation. Most recent research indicates that the latter abnormality may be a renal manifestation of the increasingly prevalent metabolic syndrome. Despite opposite deviations from normal urinary pH values, both the dRTA and uric acid stone formation due to low urinary pH require the same treatment, i.e., alkali. In the dRTA, alkali is needed for improving the body's buffer capacity, whereas the goal of alkali treatment in uric acid stone formers is to increase the urinary pH to 6.2-6.8 in order to minimize uric acid crystallization.

  6. Solution influence on biomolecular equilibria - Nucleic acid base associations

    NASA Technical Reports Server (NTRS)

    Pohorille, A.; Pratt, L. R.; Burt, S. K.; Macelroy, R. D.

    1984-01-01

    Various attempts to construct an understanding of the influence of solution environment on biomolecular equilibria at the molecular level using computer simulation are discussed. First, the application of the formal statistical thermodynamic program for investigating biomolecular equilibria in solution is presented, addressing modeling and conceptual simplications such as perturbative methods, long-range interaction approximations, surface thermodynamics, and hydration shell. Then, Monte Carlo calculations on the associations of nucleic acid bases in both polar and nonpolar solvents such as water and carbon tetrachloride are carried out. The solvent contribution to the enthalpy of base association is positive (destabilizing) in both polar and nonpolar solvents while negative enthalpies for stacked complexes are obtained only when the solute-solute in vacuo energy is added to the total energy. The release upon association of solvent molecules from the first hydration layer around a solute to the bulk is accompanied by an increase in solute-solvent energy and decrease in solvent-solvent energy. The techniques presented are expectd to displace less molecular and more heuristic modeling of biomolecular equilibria in solution.

  7. Acid/base account and minesoils: A review

    SciTech Connect

    Hossner, L.R.; Brandt, J.E.

    1997-12-31

    Generation of acidity from the oxidation of iron sulfides (FeS{sub 2}) is a common feature of geological materials exposed to the atmosphere by mining activities. Acid/base accounting (ABA) has been the primary method to evaluate the acid- or alkaline-potential of geological materials and to predict if weathering of these materials will have an adverse effect on terrestrial and aquatic environments. The ABA procedure has also been used to evaluate minesoils at different stages of weathering and, in some cases, to estimate lime requirements. Conflicting assessments of the methodology have been reported in the literature. The ABA is the fastest and easiest way to evaluate the acid-forming characteristics of overburden materials; however, accurate evaluations sometimes require that ABA data be examined in conjunction with additional sample information and results from other analytical procedures. The end use of ABA data, whether it be for minesoil evaluation or water quality prediction, will dictate the method`s interpretive criteria. Reaction kinetics and stoichiometry may vary and are not clearly defined for all situations. There is an increasing awareness of the potential for interfering compounds, particularly siderite (FeCO{sub 3}), to be present in geological materials associated with coal mines. Hardrock mines, with possible mixed sulfide mineralogy, offer a challenge to the ABA, since acid generation may be caused by minerals other than pyrite. A combination of methods, static and kinetic, is appropriate to properly evaluate the presence of acid-forming materials.

  8. Environmental applications of poly(amic acid)-based nanomaterials.

    PubMed

    Okello, Veronica A; Du, Nian; Deng, Boling; Sadik, Omowunmi A

    2011-05-01

    Nanoscale materials offer new possibilities for the development of novel remediation and environmental monitoring technologies. Different nanoscale materials have been exploited for preventing environmental degradation and pollutant transformation. However, the rapid self-aggregation of nanoparticles or their association with suspended solids or sediments where they could bioaccumulate supports the need for polymeric coatings to improve mobility, allows faster site cleanups and reduces remediation cost. The ideal material must be able to coordinate different nanomaterials functionalities and exhibit the potential for reusability. We hereby describe two novel environmental applications of nanostructured poly (amic acid)-based (nPAA) materials. In the first application, nPAA was used as both reductant and stabilizer during the in situ chemical reduction of chromium(vi) to chromium(iii). Results showed that Cr(vi) species were rapidly reduced within the concentration range of 10(-1) to 10(2) mM with efficiency of 99.9% at 40 °C in water samples and 90% at 40 °C in soil samples respectively. Furthermore, the presence of PdNPs on the PAA-Au electrode was found to significantly enhance the rate of reduction. In the second application, nPAA membranes were tested as filters to capture, isolate and detect nanosilver. Preliminary results demonstrate the capability of the nPAA membranes to quantitatively capture nanoparticles from suspension and quantify their abundance on the membranes. Silver nanoparticles detection at concentrations near the toxic threshold of silver was also demonstrated.

  9. DEOXYRIBONUCLEIC ACID BASE COMPOSITION OF PROTEUS AND PROVIDENCE ORGANISMS

    PubMed Central

    Falkow, Stanley; Ryman, I. R.; Washington, O.

    1962-01-01

    Falkow, Stanley (Walter Reed Army Institute of Research, Washington D.C.), I. R. Ryman, and O. Washington. Deoxyribonucleic acid base composition of Proteus and Providence organisms. J. Bacteriol. 83:1318–1321. 1962.—Deoxyribonucleic acids (DNA) from various species of Proteus and of Providence bacteria have been examined for their guanine + cytosine (GC) content. P. vulgaris, P. mirabilis, and P. rettgeri possess essentially identical mean GC contents of 39%, and Providence DNA has a GC content of 41.5%. In marked contrast, P. morganii DNA was found to contain 50% GC. The base composition of P. morganii is only slightly lower than those observed for representatives of the Escherichia, Shigella, and Salmonella groups. Aerobacter and Serratia differ significantly from the other members of the family by their relatively high GC content. Since a minimal requirement for genetic compatibility among different species appears to be similarity of their DNA base composition, it is suggested that P. morganii is distinct genetically from the other species of Proteus as well as Providence strains. The determination of the DNA base composition of microorganisms is important for its predictive information. This information should prove of considerable value in investigating genetic and taxonomic relationships among bacteria. PMID:13891463

  10. Nucleic acid-based nanoengineering: novel structures for biomedical applications

    PubMed Central

    Li, Hanying; LaBean, Thomas H.; Leong, Kam W.

    2011-01-01

    Nanoengineering exploits the interactions of materials at the nanometre scale to create functional nanostructures. It relies on the precise organization of nanomaterials to achieve unique functionality. There are no interactions more elegant than those governing nucleic acids via Watson–Crick base-pairing rules. The infinite combinations of DNA/RNA base pairs and their remarkable molecular recognition capability can give rise to interesting nanostructures that are only limited by our imagination. Over the past years, creative assembly of nucleic acids has fashioned a plethora of two-dimensional and three-dimensional nanostructures with precisely controlled size, shape and spatial functionalization. These nanostructures have been precisely patterned with molecules, proteins and gold nanoparticles for the observation of chemical reactions at the single molecule level, activation of enzymatic cascade and novel modality of photonic detection, respectively. Recently, they have also been engineered to encapsulate and release bioactive agents in a stimulus-responsive manner for therapeutic applications. The future of nucleic acid-based nanoengineering is bright and exciting. In this review, we will discuss the strategies to control the assembly of nucleic acids and highlight the recent efforts to build functional nucleic acid nanodevices for nanomedicine. PMID:23050076

  11. Acid Base Equilibrium in a Lipid/Water Gel

    NASA Astrophysics Data System (ADS)

    Streb, Kristina K.; Ilich, Predrag-Peter

    2003-12-01

    A new and original experiment in which partition of bromophenol blue dye between water and lipid/water gel causes a shift in the acid base equilibrium of the dye is described. The dye-absorbing material is a monoglyceride food additive of plant origin that mixes freely with water to form a stable cubic phase gel; the nascent gel absorbs the dye from aqueous solution and converts it to the acidic form. There are three concurrent processes taking place in the experiment: (a) formation of the lipid/water gel, (b) absorption of the dye by the gel, and (c) protonation of the dye in the lipid/water gel environment. As the aqueous solution of the dye is a deep purple-blue color at neutral pH and yellow at acidic pH the result of these processes is visually striking: the strongly green-yellow particles of lipid/water gel are suspended in purple-blue aqueous solution. The local acidity of the lipid/water gel is estimated by UV vis spectrophotometry. This experiment is an example of host-guest (lipid/water gel dye) interaction and is suitable for project-type biophysics, physical chemistry, or biochemistry labs. The experiment requires three, 3-hour lab sessions, two of which must not be separated by more than two days.

  12. Water-wire catalysis in photoinduced acid-base reactions.

    PubMed

    Kwon, Oh-Hoon; Mohammed, Omar F

    2012-07-01

    The pronounced ability of water to form a hyperdense hydrogen (H)-bond network among itself is at the heart of its exceptional properties. Due to the unique H-bonding capability and amphoteric nature, water is not only a passive medium, but also behaves as an active participant in many chemical and biological reactions. Here, we reveal the catalytic role of a short water wire, composed of two (or three) water molecules, in model aqueous acid-base reactions synthesizing 7-hydroxyquinoline derivatives. Utilizing femtosecond-resolved fluorescence spectroscopy, we tracked the trajectories of excited-state proton transfer and discovered that proton hopping along the water wire accomplishes the reaction more efficiently compared to the transfer occurring with bulk water clusters. Our finding suggests that the directionality of the proton movements along the charge-gradient H-bond network may be a key element for long-distance proton translocation in biological systems, as the H-bond networks wiring acidic and basic sites distal to each other can provide a shortcut for a proton in searching a global minimum on a complex energy landscape to its destination.

  13. Differential competence of redox-regulatory mechanism under extremes of temperature determines growth performances and cross tolerance in two indica rice cultivars.

    PubMed

    Chakraborty, Ananya; Bhattacharjee, Soumen

    2015-03-15

    The present study investigated the relationship between reactive oxygen species (ROS) accumulation (total and individual), antioxidant and radical scavenging capacity (total and individual), transcript abundance of some antioxidative genes and oxidative damages to membrane protein and lipid in germinating tissues of a salt resistant (SR26B) and salt sensitive (Ratna) rice cultivars under extremes of temperature to elucidate redox-regulatory mechanism governing differential oxidative stress tolerance associated with better growth and yield potential and identification of cross tolerance, if any. Imbibitional heat and chilling stress caused disruption of redox-homeostasis and oxidative damage to a newly assembled membrane system by increasing pro-oxidant/antioxidant ratio and by aggravating membrane lipid peroxidation and protein oxidation [measured in terms of accumulation of thiobarbituric acid reactive substances (TBARS), free carbonyl content (CO groups), and membrane protein thiol level (MPTL)]. A concomitant increase in accumulation of individual ROS (superoxide and hydrogen peroxide) and significant reduction of radical scavenging activity (assessed in terms of ABTS, FRAP and DPPH methods), non-enzymatic and enzymatic anti-oxidative defense [assessed in terms of total thiol content and activities of superoxide dismutase (EC 1.15.1.1), catalase (EC 1.11.1.6), ascorbate peroxidase (EC 1.11.1.11), and glutathione reductase (EC 1.6.4.2)] are also noticed in both the salt sensitive (Ratna) and resistant (SR26B) germinating tissues of rice cultivars. When compared, salt resistant cultivar SR26B was found to suffer significantly less redox-imbalance and related oxidative damages to membrane protein and lipid as compared to salt sensitive cultivar Ratna. The salt tolerant cultivar SR26B resisted imbibitional chilling and heat stress due to its early preparedness to combat oxidative stress by up-regulation of gene expression of anti-oxidative enzymes and better

  14. Hypoxia and Its Acid-Base Consequences: From Mountains to Malignancy.

    PubMed

    Swenson, Erik R

    2016-01-01

    Hypoxia, depending upon its magnitude and circumstances, evokes a spectrum of mild to severe acid-base changes ranging from alkalosis to acidosis, which can alter many responses to hypoxia at both non-genomic and genomic levels, in part via altered hypoxia-inducible factor (HIF) metabolism. Healthy people at high altitude and persons hyperventilating to non-hypoxic stimuli can become alkalotic and alkalemic with arterial pH acutely rising as high as 7.7. Hypoxia-mediated respiratory alkalosis reduces sympathetic tone, blunts hypoxic pulmonary vasoconstriction and hypoxic cerebral vasodilation, and increases hemoglobin oxygen affinity. These effects and others can be salutary or counterproductive to tissue oxygen delivery and utilization, based upon magnitude of each effect and summation. With severe hypoxia either in the setting of profound arterial hemoglobin desaturation and reduced O2 content or poor perfusion (ischemia) at the global or local level, metabolic and hypercapnic acidosis develop along with considerable lactate formation and pH falling to below 6.8. Although conventionally considered to be injurious and deleterious to cell function and survival, both acidoses may be cytoprotective by various anti-inflammatory, antioxidant, and anti-apoptotic mechanisms which limit total hypoxic or ischemic-reperfusion injury. Attempts to correct acidosis by giving bicarbonate or other alkaline agents under these circumstances ahead of or concurrent with reoxygenation efforts may be ill advised. Better understanding of this so-called "pH paradox" or permissive acidosis may offer therapeutic possibilities. Rapidly growing cancers often outstrip their vascular supply compromising both oxygen and nutrient delivery and metabolic waste disposal, thus limiting their growth and metastatic potential. However, their excessive glycolysis and lactate formation may not necessarily represent oxygen insufficiency, but rather the Warburg effect-an attempt to provide a large amount

  15. Characterization of low-molecular-weight hyaluronic acid-based hydrogel and differential stem cell responses in the hydrogel microenvironments.

    PubMed

    Kim, Jungju; Park, Yongdoo; Tae, Giyoong; Lee, Kyu Back; Hwang, Chang Mo; Hwang, Soon Jung; Kim, In Sook; Noh, Insup; Sun, Kyung

    2009-03-15

    Hyaluronic acid is a natural glycosaminoglycan involved in biological processes. Low-molecular-weight hyaluronic acid (10 and 50 kDa)-based hydrogel was synthesized using derivatized hyaluronic acid. Hyaluronic acid was acrylated by two steps: (1) introduction of an amine group using adipic acid dihydrazide, and (2) acrylation by N-acryloxysuccinimide. Injectable hyaluronic acid-based hydrogel was prepared by using acrylated hyaluronic acid and poly(ethylene glycol) tetra-thiols via Michael-type addition reaction. Mechanical properties of the hydrogel were evaluated by varying the molecular weight of acrylated hyaluronic acid (10 and 50 kDa) and the weight percent of hydrogel. Hydrogel based on 50-kDa hyaluronic acid showed the shortest gelation time and the highest complex modulus. Next, human mesenchymal stem cells were cultured in cell-adhesive RGD peptide-immobilized hydrogels together with bone morphogenic protein-2 (BMP-2). Cells cultured in the RGD/BMP-2-incorporated hydrogels showed proliferation rates higher than that of control or RGD-immobilized hydrogels. Real-time RT-PCR showed that the expression of osteoblast marker genes such as CBFalpha1 and alkaline phosphatase was increased in hyaluronic acid-based hydrogel, and the expression level was dependent on the molecular weight of hyaluronic acid, RGD peptide, and BMP-2. This study indicates that low-molecular-weight hyaluronic acid-based hydrogel can be applied to tissue regeneration as differentiation guidance materials of stem cells. PMID:18384163

  16. Hemolymph acid-base balance of the crayfish Astacus leptodactylus as a function of the oxygenation and the acid-base balance of the ambient water.

    PubMed

    Dejours, P; Armand, J

    1980-07-01

    The acid-base balance of the prebranchial hemolymph of the crayfish Astacus leptodactylus was studied at various acid-base balances and levels of oxygenation of the ambient water at 13 degrees C. The water acid-base balance was controlled automatically by a pH-CO2-stat. Into water of constant titration alkalinity, TA, this device intermittenly injects carbon dioxide to maintain the pH at a preset value. Water pH was reduced to the same value either by hypercapnia (at constant TA) or by adding HCl or H2SO4 to decrease the TA (at constant CO2 tension). Decrease of hemolymph pH and increase of hemolymph PCO2 were similar for the three acidic waters. Water oxygenation changes strongly affected hemolymph ABB. In crayfish living in hyperoxic water (PO2 congruent to 600 Torr) compared to those in hypoxic water (PO2 congruent to 40 Torr), hemolymph pH was 0.3 to 0.4 unit lower and hemolymph PCO2 several times higher, the exact values of pH and PCO2 depending on the controlled ambient acid-base balance. In any study of the hemolymph acid-base balance of the crayfish, it is an important to control ambient water's acid-base balance and oxygenation as it is to control its temperature, a conclusion which probably holds true for studies on all water breathers.

  17. Regulatory Mechanisms Underlying Oil Palm Fruit Mesocarp Maturation, Ripening, and Functional Specialization in Lipid and Carotenoid Metabolism1[W][OA

    PubMed Central

    Tranbarger, Timothy J.; Dussert, Stéphane; Joët, Thierry; Argout, Xavier; Summo, Marilyne; Champion, Antony; Cros, David; Omore, Alphonse; Nouy, Bruno; Morcillo, Fabienne

    2011-01-01

    Fruit provide essential nutrients and vitamins for the human diet. Not only is the lipid-rich fleshy mesocarp tissue of the oil palm (Elaeis guineensis) fruit the main source of edible oil for the world, but it is also the richest dietary source of provitamin A. This study examines the transcriptional basis of these two outstanding metabolic characters in the oil palm mesocarp. Morphological, cellular, biochemical, and hormonal features defined key phases of mesocarp development. A 454 pyrosequencing-derived transcriptome was then assembled for the developmental phases preceding and during maturation and ripening, when high rates of lipid and carotenoid biosynthesis occur. A total of 2,629 contigs with differential representation revealed coordination of metabolic and regulatory components. Further analysis focused on the fatty acid and triacylglycerol assembly pathways and during carotenogenesis. Notably, a contig similar to the Arabidopsis (Arabidopsis thaliana) seed oil transcription factor WRINKLED1 was identified with a transcript profile coordinated with those of several fatty acid biosynthetic genes and the high rates of lipid accumulation, suggesting some common regulatory features between seeds and fruits. We also focused on transcriptional regulatory networks of the fruit, in particular those related to ethylene transcriptional and GLOBOSA/PISTILLATA-like proteins in the mesocarp and a central role for ethylene-coordinated transcriptional regulation of type VII ethylene response factors during ripening. Our results suggest that divergence has occurred in the regulatory components in this monocot fruit compared with those identified in the dicot tomato (Solanum lycopersicum) fleshy fruit model. PMID:21487046

  18. Electroreduction and acid-base properties of dipyrrolylquinoxalines.

    PubMed

    Fu, Zhen; Zhang, Min; Zhu, Weihua; Karnas, Elizabeth; Mase, Kentaro; Ohkubo, Kei; Sessler, Jonathan L; Fukuzumi, Shunichi; Kadish, Karl M

    2012-10-18

    The electroreduction and acid-base properties of dipyrrolylquinoxalines of the form H(2)DPQ, H(2)DPQ(NO(2)), and H(2)DPQ(NO(2))(2) were investigated in benzonitrile (PhCN) containing 0.1 M tetra-n-butylammonium perchlorate (TBAP). This study focuses on elucidating the complete electrochemistry, spectroelectrochemistry, and acid-base properties of H(2)DPQ(NO(2))(n) (n = 0, 1, or 2) in PhCN before and after the addition of trifluoroacetic acid (TFA), tetra-n-butylammonium hydroxide (TBAOH), tetra-n-butylammonium fluoride (TBAF), or tetra-n-butylammonium acetate (TBAOAc) to solution. Electrochemical and spectroelectrochemical data provide support for the formation of a monodeprotonated anion after disproportionation of a dipyrrolylquinoxaline radical anion produced initially. The generated monoanion is then further reduced in two reversible one-electron-transfer steps at more negative potentials in the case of H(2)DPQ(NO(2)) and H(2)DPQ(NO(2))(2). Electrochemically monitored titrations of H(2)DPQ(NO(2))(n) with OH(-), F(-), or OAc(-) (in the form of TBA(+)X(-) salts) give rise to the same monodeprotonated H(2)DPQ(NO(2))(n) produced during electroreduction in PhCN. This latter anion can then be reduced in two additional one-electron-transfer steps in the case of H(2)DPQ(NO(2)) and H(2)DPQ(NO(2))(2). Spectroscopically monitored titrations of H(2)DPQ(NO(2))(n) with X(-) show a 1:2 stoichiometry and provide evidence for the production of both [H(2)DPQ(NO(2))(n)](-) and XHX(-). The spectroscopically measured equilibrium constants range from log β(2) = 5.3 for the reaction of H(2)DPQ with TBAOAc to log β(2) = 8.8 for the reaction of H(2)DPQ(NO(2))(2) with TBAOH. These results are consistent with a combined deprotonation and anion binding process. Equilibrium constants for the addition of one H(+) to each quinoxaline nitrogen of H(2)DPQ, H(2)DPQ(NO(2)), and H(2)DPQ(NO(2))(2) in PhCN containing 0.1 M TBAP were also determined via electrochemical and spectroscopic means

  19. Adansonian Analysis and Deoxyribonucleic Acid Base Composition of Serratia marcescens

    PubMed Central

    Colwell, R. R.; Mandel, M.

    1965-01-01

    Colwell, R. R. (Georgetown University, Washington, D.C.), and M. Mandel. Adansonian analysis and deoxyribonucleic acid base composition of Serratia marcescens. J. Bacteriol. 89:454–461. 1965.—A total of 33 strains of Serratia marcescens were subjected to Adansonian analysis for which more than 200 coded features for each of the organisms were included. In addition, the base composition [expressed as moles per cent guanine + cytosine (G + C)] of the deoxyribonucleic acid (DNA) prepared from each of the strains was determined. Except for four strains which were intermediate between Serratia and the Hafnia and Aerobacter group C of Edwards and Ewing, the S. marcescens species group proved to be extremely homogeneous, and the different strains showed high affinities for each other (mean similarity, ¯S = 77%). The G + C ratio of the DNA from the Serratia strains ranged from 56.2 to 58.4% G + C. Many species names have been listed for the genus, but only a single clustering of the strains was obtained at the species level, for which the species name S. marcescens was retained. S. kiliensis, S. indica, S. plymuthica, and S. marinorubra could not be distinguished from S. marcescens; it was concluded, therefore, that there is only a single species in the genus. The variety designation kiliensis does not appear to be valid, since no subspecies clustering of strains with negative Voges-Proskauer reactions could be detected. The characteristics of the species are listed, and a description of S. marcescens is presented. PMID:14255714

  20. Human skeletal muscle and erythrocyte proteins involved in acid-base homeostasis: adaptations to chronic hypoxia.

    PubMed

    Juel, C; Lundby, C; Sander, M; Calbet, J A L; Hall, G van

    2003-04-15

    Chronic hypoxia is accompanied by changes in blood and skeletal muscle acid-base control. We hypothesized that the underlying mechanisms include altered protein expression of transport systems and the enzymes involved in lactate, HCO3- and H+ fluxes in skeletal muscle and erythrocytes. Immunoblotting was used to quantify densities of the transport systems and enzymes. Muscle and erythrocyte samples were obtained from eight Danish lowlanders at sea level and after 2 and 8 weeks at 4100 m (Bolivia). For comparison, samples were obtained from eight Bolivian natives. In muscle membranes there were no changes in fibre-type distribution, lactate dehydrogenase isoforms, Na+,K+-pump subunits or in the lactate-H+ co-transporters MCT1 and MCT4. The Na+-H+ exchanger protein NHE1 was elevated by 39 % in natives compared to lowlanders. The Na+-HCO3- co-transporter density in muscle was elevated by 47-69 % after 2 and 8 weeks at altitude. The membrane-bound carbonic anhydrase (CA) IV in muscle increased in the lowlanders by 39 %, whereas CA XIV decreased by 23-47 %. Levels of cytosolic CA II and III in muscle and CA I and II in erythrocytes were unchanged. The erythrocyte lactate-H+ co-transporter MCT1 increased by 230-405 % in lowlanders and was 324 % higher in natives. The erythrocyte inorganic anion exchanger (Cl--HCO3- exchanger AE1) was increased by 149-228 %. In conclusion, chronic hypoxia induces dramatic changes in erythrocyte proteins, but only moderate changes in muscle proteins involved in acid-base control. Together, these changes suggest a hypoxia-induced increase in the capacity for lactate, HCO3- and H+ fluxes from muscle to blood and from blood to erythrocytes. PMID:12611920

  1. Regulatory Anatomy

    PubMed Central

    2015-01-01

    This article proposes the term “safety logics” to understand attempts within the European Union (EU) to harmonize member state legislation to ensure a safe and stable supply of human biological material for transplants and transfusions. With safety logics, I refer to assemblages of discourses, legal documents, technological devices, organizational structures, and work practices aimed at minimizing risk. I use this term to reorient the analytical attention with respect to safety regulation. Instead of evaluating whether safety is achieved, the point is to explore the types of “safety” produced through these logics as well as to consider the sometimes unintended consequences of such safety work. In fact, the EU rules have been giving rise to complaints from practitioners finding the directives problematic and inadequate. In this article, I explore the problems practitioners face and why they arise. In short, I expose the regulatory anatomy of the policy landscape. PMID:26139952

  2. Regulatory Physiology

    NASA Technical Reports Server (NTRS)

    Lane, Helen W.; Whitson, Peggy A.; Putcha, Lakshmi; Baker, Ellen; Smith, Scott M.; Stewart, Karen; Gretebeck, Randall; Nimmagudda, R. R.; Schoeller, Dale A.; Davis-Street, Janis

    1999-01-01

    As noted elsewhere in this report, a central goal of the Extended Duration Orbiter Medical Project (EDOMP) was to ensure that cardiovascular and muscle function were adequate to perform an emergency egress after 16 days of spaceflight. The goals of the Regulatory Physiology component of the EDOMP were to identify and subsequently ameliorate those biochemical and nutritional factors that deplete physiological reserves or increase risk for disease, and to facilitate the development of effective muscle, exercise, and cardiovascular countermeasures. The component investigations designed to meet these goals focused on biochemical and physiological aspects of nutrition and metabolism, the risk of renal (kidney) stone formation, gastrointestinal function, and sleep in space. Investigations involved both ground-based protocols to validate proposed methods and flight studies to test those methods. Two hardware tests were also completed.

  3. Using the Logarithmic Concentration Diagram, Log "C", to Teach Acid-Base Equilibrium

    ERIC Educational Resources Information Center

    Kovac, Jeffrey

    2012-01-01

    Acid-base equilibrium is one of the most important and most challenging topics in a typical general chemistry course. This article introduces an alternative to the algebraic approach generally used in textbooks, the graphical log "C" method. Log "C" diagrams provide conceptual insight into the behavior of aqueous acid-base systems and allow…

  4. The acid-base resistant zone in three dentin bonding systems.

    PubMed

    Inoue, Go; Nikaido, Toru; Foxton, Richard M; Tagami, Junji

    2009-11-01

    An acid-base resistant zone has been found to exist after acid-base challenge adjacent to the hybrid layer using SEM. The aim of this study was to examine the acid-base resistant zone using three different bonding systems. Dentin disks were applied with three different bonding systems, and then a resin composite was light-cured to make dentin disk sandwiches. After acid-base challenge, the polished surfaces were observed using SEM. For both one- and two-step self-etching primer systems, an acid-base resistant zone was clearly observed adjacent to the hybrid layer - but with differing appearances. For the wet bonding system, the presence of an acid-base resistant zone was unclear. This was because the self-etching primer systems etched the dentin surface mildly, such that the remaining mineral phase of dentin and the bonding agent yielded clear acid-base resistant zones. In conclusion, the acid-base resistant zone was clearly observed when self-etching primer systems were used, but not so for the wet bonding system.

  5. Thai Grade 11 Students' Alternative Conceptions for Acid-Base Chemistry

    ERIC Educational Resources Information Center

    Artdej, Romklao; Ratanaroutai, Thasaneeya; Coll, Richard Kevin; Thongpanchang, Tienthong

    2010-01-01

    This study involved the development of a two-tier diagnostic instrument to assess Thai high school students' understanding of acid-base chemistry. The acid-base diagnostic test (ABDT) comprising 18 items was administered to 55 Grade 11 students in a science and mathematics programme during the second semester of the 2008 academic year. Analysis of…

  6. A Comparative Study of French and Turkish Students' Ideas on Acid-Base Reactions

    ERIC Educational Resources Information Center

    Cokelez, Aytekin

    2010-01-01

    The goal of this comparative study was to determine the knowledge that French and Turkish upper secondary-school students (grades 11 and 12) acquire on the concept of acid-base reactions. Following an examination of the relevant curricula and textbooks in the two countries, 528 students answered six written questions about the acid-base concept.…

  7. High School Students' Understanding of Acid-Base Concepts: An Ongoing Challenge for Teachers

    ERIC Educational Resources Information Center

    Damanhuri, Muhd Ibrahim Muhamad; Treagust, David F.; Won, Mihye; Chandrasegaran, A. L.

    2016-01-01

    Using a quantitative case study design, the "Acids-Bases Chemistry Achievement Test" ("ABCAT") was developed to evaluate the extent to which students in Malaysian secondary schools achieved the intended curriculum on acid-base concepts. Responses were obtained from 260 Form 5 (Grade 11) students from five schools to initially…

  8. Modeling description and spectroscopic evidence of surface acid-base properties of natural illites.

    PubMed

    Liu, W

    2001-12-01

    The acid-base properties of natural illites from different areas were studied by potentiometric titrations. The acidimetric supernatant was regarded as the system blank to calculate the surface site concentration due to consideration of substrate dissolution during the prolonged acidic titration. The following surface complexation model could give a good interpretation of the surface acid-base reactions of the aqueous illites:

  9. Collaborative Strategies for Teaching Common Acid-Base Disorders to Medical Students

    ERIC Educational Resources Information Center

    Petersen, Marie Warrer; Toksvang, Linea Natalie; Plovsing, Ronni R.; Berg, Ronan M. G.

    2014-01-01

    The ability to recognize and diagnose acid-base disorders is of the utmost importance in the clinical setting. However, it has been the experience of the authors that medical students often have difficulties learning the basic principles of acid-base physiology in the respiratory physiology curriculum, particularly when applying this knowledge to…

  10. Canonical Pedagogical Content Knowledge by Cores for Teaching Acid-Base Chemistry at High School

    ERIC Educational Resources Information Center

    Alvarado, Clara; Cañada, Florentina; Garritz, Andoni; Mellado, Vicente

    2015-01-01

    The topic of acid-base chemistry is one of the oldest in general chemistry courses and it has been almost continuously in academic discussion. The central purpose of documenting the knowledge and beliefs of a group of ten Mexican teachers with experience in teaching acid-base chemistry in high school was to know how they design, prepare and…

  11. [Dynamics of blood gases and acid-base balance in patients with carbon monoxide acute poisoning].

    PubMed

    Polozova, E V; Shilov, V V; Bogachova, A S; Davydova, E V

    2015-01-01

    Evaluation of blood gases and acid-base balance covered patients with carbon monoxide acute poisoning, in accordance with inhalation trauma presence. Evidence is that thermochemical injury of respiratory tract induced severe acid-base dysbalance remaining decompensated for a long time despite the treatment.

  12. Transition State Charge Stabilization and Acid-Base Catalysis of mRNA Cleavage by the Endoribonuclease RelE.

    PubMed

    Dunican, Brian F; Hiller, David A; Strobel, Scott A

    2015-12-01

    The bacterial toxin RelE is a ribosome-dependent endoribonuclease. It is part of a type II toxin-antitoxin system that contributes to antibiotic resistance and biofilm formation. During amino acid starvation, RelE cleaves mRNA in the ribosomal A-site, globally inhibiting protein translation. RelE is structurally similar to microbial RNases that employ general acid-base catalysis to facilitate RNA cleavage. The RelE active site is atypical for acid-base catalysis, in that it is enriched with positively charged residues and lacks the prototypical histidine-glutamate catalytic pair, making the mechanism of mRNA cleavage unclear. In this study, we use a single-turnover kinetic analysis to measure the effect of pH and phosphorothioate substitution on the rate constant for cleavage of mRNA by wild-type RelE and seven active-site mutants. Mutation and thio effects indicate a major role for stabilization of increased negative change in the transition state by arginine 61. The wild-type RelE cleavage rate constant is pH-independent, but the reaction catalyzed by many of the mutants is strongly dependent on pH, suggestive of general acid-base catalysis. pH-rate curves indicate that wild-type RelE operates with the pK(a) of at least one catalytic residue significantly downshifted by the local environment. Mutation of any single active-site residue is sufficient to disrupt this microenvironment and revert the shifted pK(a) back above neutrality. pH-rate curves are consistent with K54 functioning as a general base and R81 as a general acid. The capacity of RelE to effect a large pK(a) shift and facilitate a common catalytic mechanism by uncommon means furthers our understanding of other atypical enzymatic active sites.

  13. Acid-base chemistry of frustrated water at protein interfaces.

    PubMed

    Fernández, Ariel

    2016-01-01

    Water molecules at a protein interface are often frustrated in hydrogen-bonding opportunities due to subnanoscale confinement. As shown, this condition makes them behave as a general base that may titrate side-chain ammonium and guanidinium cations. Frustration-based chemistry is captured by a quantum mechanical treatment of proton transference and shown to remove same-charge uncompensated anticontacts at the interface found in the crystallographic record and in other spectroscopic information on the aqueous interface. Such observations are untenable within classical arguments, as hydronium is a stronger acid than ammonium or guanidinium. Frustration enables a directed Grotthuss mechanism for proton transference stabilizing same-charge anticontacts.

  14. Acid-base chemistry of frustrated water at protein interfaces.

    PubMed

    Fernández, Ariel

    2016-01-01

    Water molecules at a protein interface are often frustrated in hydrogen-bonding opportunities due to subnanoscale confinement. As shown, this condition makes them behave as a general base that may titrate side-chain ammonium and guanidinium cations. Frustration-based chemistry is captured by a quantum mechanical treatment of proton transference and shown to remove same-charge uncompensated anticontacts at the interface found in the crystallographic record and in other spectroscopic information on the aqueous interface. Such observations are untenable within classical arguments, as hydronium is a stronger acid than ammonium or guanidinium. Frustration enables a directed Grotthuss mechanism for proton transference stabilizing same-charge anticontacts. PMID:26762189

  15. Improving pharmacy students' understanding and long-term retention of acid-base chemistry.

    PubMed

    Roche, Victoria F

    2007-12-15

    Despite repeated exposure to the principles underlying the behavior of organic acids and bases in aqueous solution, some pharmacy students remain confused about the topic of acid-base chemistry. Since a majority of organic drug molecules have acid-base character, the ability to predict their reactivity and the extent to which they will ionize in a given medium is paramount to students' understanding of essentially all aspects of drug action in vivo and in vitro. This manuscript presents a medicinal chemistry lesson in the fundamentals of acid-base chemistry that many pharmacy students have found enlightening and clarifying.

  16. [Practical diagnostics of acid-base disorders: part I: differentiation between respiratory and metabolic disturbances].

    PubMed

    Deetjen, P; Lichtwarck-Aschoff, M

    2012-11-01

    The first part of this overview on diagnostic tools for acid-base disorders focuses on basic knowledge for distinguishing between respiratory and metabolic causes of a particular disturbance. Rather than taking sides in the great transatlantic or traditional-modern debate on the best theoretical model for understanding acid-base physiology, this article tries to extract what is most relevant for everyday clinical practice from the three schools involved in these keen debates: the Copenhagen, the Boston and the Stewart schools. Each school is particularly strong in a specific diagnostic or therapeutic field. Appreciating these various strengths a unifying, simplified algorithm together with an acid-base calculator will be discussed.

  17. Acid-base and chelatometric photo-titrations with photosensors and membrane photosensors.

    PubMed

    Matsuo, T; Masuda, Y; Sekido, E

    1986-08-01

    Photosensors (PS) and membrane photosensors (MPS), which can be immersed in the test solution and facilitate the measurement of concentration, have been developed by miniaturizing an optical system consisting of a light source and a photocell. For use in acid-base or complexometric titrations a poly(vinyl chloride) membrane containing an acid-base or metallochromic indicator can be applied as a coating to the photocell. Spectrophotometric determination of copper(II), and photometric acid-base and chelatometric titrations have been performed with the PS and MPS systems.

  18. Regulatory Snapshots: integrative mining of regulatory modules from expression time series and regulatory networks.

    PubMed

    Gonçalves, Joana P; Aires, Ricardo S; Francisco, Alexandre P; Madeira, Sara C

    2012-01-01

    Explaining regulatory mechanisms is crucial to understand complex cellular responses leading to system perturbations. Some strategies reverse engineer regulatory interactions from experimental data, while others identify functional regulatory units (modules) under the assumption that biological systems yield a modular organization. Most modular studies focus on network structure and static properties, ignoring that gene regulation is largely driven by stimulus-response behavior. Expression time series are key to gain insight into dynamics, but have been insufficiently explored by current methods, which often (1) apply generic algorithms unsuited for expression analysis over time, due to inability to maintain the chronology of events or incorporate time dependency; (2) ignore local patterns, abundant in most interesting cases of transcriptional activity; (3) neglect physical binding or lack automatic association of regulators, focusing mainly on expression patterns; or (4) limit the discovery to a predefined number of modules. We propose Regulatory Snapshots, an integrative mining approach to identify regulatory modules over time by combining transcriptional control with response, while overcoming the above challenges. Temporal biclustering is first used to reveal transcriptional modules composed of genes showing coherent expression profiles over time. Personalized ranking is then applied to prioritize prominent regulators targeting the modules at each time point using a network of documented regulatory associations and the expression data. Custom graphics are finally depicted to expose the regulatory activity in a module at consecutive time points (snapshots). Regulatory Snapshots successfully unraveled modules underlying yeast response to heat shock and human epithelial-to-mesenchymal transition, based on regulations documented in the YEASTRACT and JASPAR databases, respectively, and available expression data. Regulatory players involved in functionally enriched

  19. Degradation of cyanoacrylic acid-based organic sensitizers in dye-sensitized solar cells.

    PubMed

    Chen, Cheng; Yang, Xichuan; Cheng, Ming; Zhang, Fuguo; Sun, Licheng

    2013-07-01

    Organic dyes have become widely used in dye-sensitized solar cells (DSSCs) because of their good performance, flexible structural modifications, and low costs. To increase the photostability of organic dye-based DSSCs, we conducted a full study on the degradation mechanism of cyanoacrylic acid-based organic sensitizers in DSSCs. The results showed that with the synergy between water and UV light, the sensitizer could desorb from the TiO2 surface and the cyanoacrylic acid unit of the sensitizer was transformed into the aldehyde group. It was also observed that the water content had a great effect on the degradation process. Our experiments conducted using (18) O-labeled water demonstrated that the oxygen atom of the aldehyde group identified in the degraded dye came from the solvent water in the DSSCs. Therefore, controlling the water content during DSSC fabrication, good sealing of cells, and filtering the UV light are crucial to produce DSSCs that are more durable and robust.

  20. Comparison of the acid-base properties of ribose and 2'-deoxyribose nucleotides.

    PubMed

    Mucha, Ariel; Knobloch, Bernd; Jezowska-Bojczuk, Małgorzata; Kozłowski, Henryk; Sigel, Roland K O

    2008-01-01

    The extent to which the replacement of a ribose unit by a 2'-deoxyribose unit influences the acid-base properties of nucleotides has not hitherto been determined in detail. In this study, by potentiometric pH titrations in aqueous solution, we have measured the acidity constants of the 5'-di- and 5'-triphosphates of 2'-deoxyguanosine [i.e., of H(2)(dGDP)(-) and H(2)(dGTP)(2-)] as well as of the 5'-mono-, 5'-di-, and 5'-triphosphates of 2'-deoxyadenosine [i.e., of H(2)(dAMP)(+/-), H(2)(dADP)(-), and H(2)(dATP)(2-)]. These 12 acidity constants (of the 56 that are listed) are compared with those of the corresponding ribose derivatives (published data) measured under the same experimental conditions. The results show that all protonation sites in the 2'-deoxynucleotides are more basic than those in their ribose counterparts. The influence of the 2'-OH group is dependent on the number of 5'-phosphate groups as well as on the nature of the purine nucleobase. The basicity of N7 in guanine nucleotides is most significantly enhanced (by about 0.2 pK units), while the effect on the phosphate groups and the N1H or N1H(+) sites is less pronounced but clearly present. In addition, (1)H NMR chemical shift change studies in dependence on pD in D(2)O have been carried out for the dAMP, dADP, and dATP systems, which confirmed the results from the potentiometric pH titrations and showed the nucleotides to be in their anti conformations. Overall, our results are not only of relevance for metal ion binding to nucleotides or nucleic acids, but also constitute an exact basis for the calculation, determination, and understanding of perturbed pK(a) values in DNAzymes and ribozymes, as needed for the delineation of acid-base mechanisms in catalysis.

  1. Envisioning an enzymatic Diels-Alder reaction by in situ acid-base catalyzed diene generation.

    PubMed

    Linder, Mats; Johansson, Adam Johannes; Manta, Bianca; Olsson, Philip; Brinck, Tore

    2012-06-01

    We present and evaluate a new and potentially efficient route for enzyme-mediated Diels-Alder reactions, utilizing general acid-base catalysis. The viability of employing the active site of ketosteroid isomerase is demonstrated.

  2. An Intuitive and General Approach to Acid-Base Equilibrium Calculations.

    ERIC Educational Resources Information Center

    Felty, Wayne L.

    1978-01-01

    Describes the intuitive approach used in general chemistry and points out its pedagogical advantages. Explains how to extend it to acid-base equilibrium calculations without the need to introduce additional sophisticated concepts. (GA)

  3. Why and How To Teach Acid-Base Reactions without Equilibrium.

    ERIC Educational Resources Information Center

    Carlton, Terry S.

    1997-01-01

    Recommends an approach to the treatment of acid-base equilibria that involves treating each reaction as either going to completion or not occurring at all. Compares the method with the traditional approach step by step. (DDR)

  4. Ultrastructural observation of the acid-base resistant zone of all-in-one adhesives using three different acid-base challenges.

    PubMed

    Tsujimoto, Miho; Nikaido, Toru; Inoue, Go; Sadr, Alireza; Tagami, Junji

    2010-11-01

    The aim of this study was to analyze the ultrastructure of the dentin-adhesive interface using two all-in-one adhesive systems (Clearfil Tri-S Bond, TB; Tokuyama Bond Force, BF) after different acid-base challenges. Three solutions were used as acidic solutions for the acid-base challenges: a demineralizing solution (DS), a phosphoric acid solution (PA), and a hydrochloric acid solution (HCl). After the acid-base challenges, the bonded interfaces were examined by scanning electron microscopy. Thickness of the acid-base resistant zone (ABRZ) created in PA and HCl was thinner than in DS for both adhesive systems. For BF adhesive, an eroded area was observed beneath the ABRZ after immersion in PA and HCl, but not in DS. Conversely for TB adhesive, the eroded area was observed only after immersion in PA. In conclusion, although the ABRZ was observed for both all-in-one adhesive systems, its morphological features were influenced by the ingredients of both the adhesive material and acidic solution.

  5. Schiff base structured acid-base cooperative dual sites in an ionic solid catalyst lead to efficient heterogeneous knoevenagel condensations.

    PubMed

    Zhang, Mingjue; Zhao, Pingping; Leng, Yan; Chen, Guojian; Wang, Jun; Huang, Jun

    2012-10-01

    An acid-base bifunctional ionic solid catalyst [PySaIm](3)PW was synthesized by the anion exchange of the ionic-liquid (IL) precursor 1-(2-salicylaldimine)pyridinium bromide ([PySaIm]Br) with the Keggin-structured sodium phosphotungstate (Na(3) PW). The catalyst was characterized by FTIR, UV/Vis, XRD, SEM, Brunauer-Emmett-Teller (BET) theory, thermogravimetric analysis, (1)H NMR spectroscopy, ESI-MS, elemental analysis, and melting points. Together with various counterparts, [PySaIm](3)PW was evaluated in Knoevenagel condensation under solvent and solvent-free conditions. The Schiff base structure attached to the IL cation of [PySaIm](3)PW involves acidic salicyl hydroxyl and basic imine, and provides a controlled nearby position for the acid-base dual sites. The high melting and insoluble properties of [PySaIm](3)PW are relative to the large volume and high valence of PW anions, as well as the intermolecular hydrogen-bonding networks among inorganic anions and IL cations. The ionic solid catalyst [PySaIm](3)PW leads to heterogeneous Knoevenagel condensations. In solvent-free condensation of benzaldehyde with ethyl cyanoacetate, it exhibits a conversion of 95.8 % and a selectivity of 100 %; the conversion is even much higher than that (78.2 %) with ethanol as a solvent. The solid catalyst has a convenient recoverability with only a slight decrease in conversion following subsequent recyclings. Furthermore, the new catalyst is highly applicable to many substrates of aromatic aldehydes with activated methylene compounds. On the basis of the characterization and reaction results, a unique acid-base cooperative mechanism within a Schiff base structure is proposed and discussed, which thoroughly explains not only the highly efficient catalytic performance of [PySaIm](3)PW, but also the lower activities of various control catalysts.

  6. An explanation of flocculation using Lewis acid-base theory

    SciTech Connect

    Brown, P.M.; Stanley, D.A.; Scheiner, B.J.

    1988-01-01

    This paper describes a Bureau of Mines-devleoped method of dewatering clay slurries based on flocculation by high-molecular-weight polymers and water removal from the formed flocs using a trommel or hydrosieve. The exchange ion on the clays affects their dewaterability. Metal ions in solution and on the exchange sites of smectite clays are known to act as Lewis acids. Recent work has determined that these ions can be titrated with high-molecular-weight polymers. The relative acidity of the exchange ion and the basicity of the polymer determined by the new method give insight into the dewatering mechanism.

  7. Polylactic Acid-Based Polymer Blends for Durable Applications

    NASA Astrophysics Data System (ADS)

    Finniss, Adam

    There has been considerable scientific interest in both research and commercial communities as of late in the area of biologically based or sourced plastics. As the consumption of petroleum rises and concerns about climate change increase, this field is likely to grow even larger. One bioplastic that has received a great deal of attention is polylactic acid (PLA). In the past, this material was used mainly in medical or specialty applications, but advancements in manufacturing have led to a desire to use PLA more widely, especially in durable applications. Unfortunately, PLA has several drawbacks that hinder more widespread usage of the material as a durable item: it has low ductility and impact strength in bulk applications, along with poor stability in the face of heat, humidity or liquid media. To combat these deficiencies, a number of techniques were investigated. Samples were annealed to create crystalline domains that would improve mechanical properties and reduce diffusion, blended with graphene to create barriers to diffusion throughout the material, or compounded with a polycarbonate (PC) polymer phase to protect the PLA phase and to enhance the mechanical properties of the blend. If a material containing biologically sourced components with good mechanical properties can be created, it would be desirable for durable uses such as electronics components or as an automotive grade resin. Crystallization experiments were carried out in a differential scanning calorimeter to determine the effects of heat treatment and additives on the rather slow crystallization kinetics of PLA polymer. It was determined that the blending in of the PC phase did not significantly alter the kinetics or mechanism of crystal growth. The addition of graphene to any PC/PLA formulation served as a nucleating agent which speeded up the crystallization kinetics markedly, in some cases by several orders of magnitude. Results obtained from these experiments were internally consistent

  8. Development of polylactic acid-based materials through reactive modification

    NASA Astrophysics Data System (ADS)

    Fowlks, Alison Camille

    2009-12-01

    Polylactic acid (PLA)-based systems have shown to be of great potential for the development of materials requiring biobased content, biodegradation, and sufficient properties. The efforts in this study are directed toward addressing the current research need to overcome some of the inherent drawbacks of PLA. To meet this need, reactive extrusion was employed to develop new materials based on PLA by grafting, compounding, and polymer blending. In the first part of this work, maleic anhydride (MA) was grafted onto PLA by reactive extrusion. Two structurally different peroxides were used to initiate grafting and results were reported on the basis of grafting, molecular weight, and thermal behavior. An inverse relationship between degree of grafting and molecular weight was established. It was also found that, regardless of peroxide type, there is an optimum peroxid-to-MA ratio of 0.5:2 that promotes maximum grafting, beyond which degradation reactions become predominant. Overall, it was found that the maleated copolymer (MAPLA) could be used as an interfacial modifier in PLA-based composites. Therefore, MAPLA was incorporated into PLA-talc composites in varying concentrations. The influence of the MAPLA addition on the mechanical and thermal behavior was investigated. When added in an optimum concentration, MAPLA improved the tensile strength and crystallization of the composite. Furthermore, microscopic observation confirmed the compatibilization effect of MAPLA in PLA-talc composites. Vinyltrimethoxysilane was free-radically grafted onto the backbone of PLA and subsequently moisture crosslinked. The effects of monomer, initiator, and catalyst concentration on the degree of crosslinking and the mechanical and thermal properties were investigated. The presence of a small amount of catalyst showed to be a major contributor to the crosslinking formation in the time frame investigated, shown by an increase in gel content and decrease in crystallinity. Furthermore

  9. Interpretation of pH-activity profiles for acid-base catalysis from molecular simulations.

    PubMed

    Dissanayake, Thakshila; Swails, Jason M; Harris, Michael E; Roitberg, Adrian E; York, Darrin M

    2015-02-17

    The measurement of reaction rate as a function of pH provides essential information about mechanism. These rates are sensitive to the pK(a) values of amino acids directly involved in catalysis that are often shifted by the enzyme active site environment. Experimentally observed pH-rate profiles are usually interpreted using simple kinetic models that allow estimation of "apparent pK(a)" values of presumed general acid and base catalysts. One of the underlying assumptions in these models is that the protonation states are uncorrelated. In this work, we introduce the use of constant pH molecular dynamics simulations in explicit solvent (CpHMD) with replica exchange in the pH-dimension (pH-REMD) as a tool to aid in the interpretation of pH-activity data of enzymes and to test the validity of different kinetic models. We apply the methods to RNase A, a prototype acid-base catalyst, to predict the macroscopic and microscopic pK(a) values, as well as the shape of the pH-rate profile. Results for apo and cCMP-bound RNase A agree well with available experimental data and suggest that deprotonation of the general acid and protonation of the general base are not strongly coupled in transphosphorylation and hydrolysis steps. Stronger coupling, however, is predicted for the Lys41 and His119 protonation states in apo RNase A, leading to the requirement for a microscopic kinetic model. This type of analysis may be important for other catalytic systems where the active forms of the implicated general acid and base are oppositely charged and more highly correlated. These results suggest a new way for CpHMD/pH-REMD simulations to bridge the gap with experiments to provide a molecular-level interpretation of pH-activity data in studies of enzyme mechanisms.

  10. A citric acid-based hydroxyapatite composite for orthopedic implants.

    PubMed

    Qiu, Hongjin; Yang, Jian; Kodali, Pradeep; Koh, Jason; Ameer, Guillermo A

    2006-12-01

    We describe a novel approach to process bioceramic microparticles and poly(diol citrates) into bioceramic-elastomer composites for potential use in orthopedic surgery. The composite consists of the biodegradable elastomer poly(1,8-octanediol-citrate) (POC) and the bioceramic hydroxyapatite (HA). The objective of this work was to characterize POC-HA composites and assess the feasibility of fabricating tissue fixation devices using machining and molding techniques. The mechanical properties of POC-HA composites with HA (40, 50, 60, 65wt.%) were within the range of values reported for tissue fixation devices (for POC-HA 65wt.%, S(b)=41.4+/-3.1, E(b)=501.7+/-40.3, S(c)=74.6+/-9.0, E(c)=448.8+/-27.0, S(t)=9.7+/-2.3, E(t)=334.8+/-73.5, S(s)=27.7+/-2.4, T(s)=27.3+/-4.9, all values in MPa). At 20 weeks, the weight loss of POC-HA composites ranged between 8 and 12wt.%, with 65wt.% HA composites degrading the slowest. Exposure of POC-HA to simulated body fluid resulted in extensive mineralization in the form of calcium phosphate with Ca/P of 1.5-1.7 similar to bone. POC-HA supported osteoblast adhesion in vitro and histology results from POC-HA samples that were implanted in rabbit knees for 6 weeks suggest that the composite is biocompatible. Synthesis of POC-HA is easy and inexpensive, does not involve harsh solvents or initiators, and the mechanical properties of POC-HA with 65wt.% HA are suitable for the fabrication of potentially osteoconductive bone screws.

  11. Polylactic Acid-Based Polymer Blends for Durable Applications

    NASA Astrophysics Data System (ADS)

    Finniss, Adam

    There has been considerable scientific interest in both research and commercial communities as of late in the area of biologically based or sourced plastics. As the consumption of petroleum rises and concerns about climate change increase, this field is likely to grow even larger. One bioplastic that has received a great deal of attention is polylactic acid (PLA). In the past, this material was used mainly in medical or specialty applications, but advancements in manufacturing have led to a desire to use PLA more widely, especially in durable applications. Unfortunately, PLA has several drawbacks that hinder more widespread usage of the material as a durable item: it has low ductility and impact strength in bulk applications, along with poor stability in the face of heat, humidity or liquid media. To combat these deficiencies, a number of techniques were investigated. Samples were annealed to create crystalline domains that would improve mechanical properties and reduce diffusion, blended with graphene to create barriers to diffusion throughout the material, or compounded with a polycarbonate (PC) polymer phase to protect the PLA phase and to enhance the mechanical properties of the blend. If a material containing biologically sourced components with good mechanical properties can be created, it would be desirable for durable uses such as electronics components or as an automotive grade resin. Crystallization experiments were carried out in a differential scanning calorimeter to determine the effects of heat treatment and additives on the rather slow crystallization kinetics of PLA polymer. It was determined that the blending in of the PC phase did not significantly alter the kinetics or mechanism of crystal growth. The addition of graphene to any PC/PLA formulation served as a nucleating agent which speeded up the crystallization kinetics markedly, in some cases by several orders of magnitude. Results obtained from these experiments were internally consistent

  12. Fine-mapping analysis revealed complex pleiotropic effect and tissue-specific regulatory mechanism of TNFSF15 in primary biliary cholangitis, Crohn's disease and leprosy.

    PubMed

    Sun, Yonghu; Irwanto, Astrid; Toyo-Oka, Licht; Hong, Myunghee; Liu, Hong; Andiappan, Anand Kumar; Choi, Hyunchul; Hitomi, Yuki; Yu, Gongqi; Yu, Yongxiang; Bao, Fangfang; Wang, Chuan; Fu, Xian; Yue, Zhenhua; Wang, Honglei; Zhang, Huimin; Kawashima, Minae; Kojima, Kaname; Nagasaki, Masao; Nakamura, Minoru; Yang, Suk-Kyun; Ye, Byong Duk; Denise, Yosua; Rotzschke, Olaf; Song, Kyuyoung; Tokunaga, Katsushi; Zhang, Furen; Liu, Jianjun

    2016-01-01

    Genetic polymorphism within the 9q32 locus is linked with increased risk of several diseases, including Crohn's disease (CD), primary biliary cholangitis (PBC) and leprosy. The most likely disease-causing gene within 9q32 is TNFSF15, which encodes the pro-inflammatory cytokine TNF super-family member 15, but it was unknown whether these disparate diseases were associated with the same genetic variance in 9q32, and how variance within this locus might contribute to pathology. Using genetic data from published studies on CD, PBC and leprosy we revealed that bearing a T allele at rs6478108/rs6478109 (r(2) = 1) or rs4979462 was significantly associated with increased risk of CD and decreased risk of leprosy, while the T allele at rs4979462 was associated with significantly increased risk of PBC. In vitro analyses showed that the rs6478109 genotype significantly affected TNFSF15 expression in cells from whole blood of controls, while functional annotation using publicly-available data revealed the broad cell type/tissue-specific regulatory potential of variance at rs6478109 or rs4979462. In summary, we provide evidence that variance within TNFSF15 has the potential to affect cytokine expression across a range of tissues and thereby contribute to protection from infectious diseases such as leprosy, while increasing the risk of immune-mediated diseases including CD and PBC. PMID:27507062

  13. Tissue- and stage-specific modulation of RNA editing of the psbF and psbL transcript from spinach plastids--a new regulatory mechanism?

    PubMed

    Bock, R; Hagemann, R; Kössel, H; Kudla, J

    1993-08-01

    The psbE operon of spinach chloroplasts, which includes the genes psbE, psbF, psbL and psbJ, encodes two RNA editing sites. One site corresponds to the initiation codon of the psbL transcript, as has been described earlier for the homologous transcript from tobacco, while at a second editing site, newly reported here, an internal phenylalanine codon of the psbF transcript is restored. Both these sites were investigated with respect to the extent of editing in spinach plastids at various developmental stages. The apparent existence of only completely edited transcripts in etioplasts and chloroplasts, indicates that light-induced processes are not acting as determinants in eliciting the editing process. Reduced editing is, however, observed in the psbF and psbL transcript from seeds and roots. This finding suggests that the RNA editing process is differentially down-regulated in leucoplasts and proplastids and that editing may, therefore, function as a regulatory device in plastid gene expression. PMID:8355656

  14. Fine-mapping analysis revealed complex pleiotropic effect and tissue-specific regulatory mechanism of TNFSF15 in primary biliary cholangitis, Crohn’s disease and leprosy

    PubMed Central

    Sun, Yonghu; Irwanto, Astrid; Toyo-oka, Licht; Hong, Myunghee; Liu, Hong; Andiappan, Anand Kumar; Choi, Hyunchul; Hitomi, Yuki; Yu, Gongqi; Yu, Yongxiang; Bao, Fangfang; Wang, Chuan; Fu, Xian; Yue, Zhenhua; Wang, Honglei; Zhang, Huimin; Kawashima, Minae; Kojima, Kaname; Nagasaki, Masao; Nakamura, Minoru; Yang, Suk-Kyun; Ye, Byong Duk; Denise, Yosua; Rotzschke, Olaf; Song, Kyuyoung; Tokunaga, Katsushi; Zhang, Furen; Liu, Jianjun

    2016-01-01

    Genetic polymorphism within the 9q32 locus is linked with increased risk of several diseases, including Crohn’s disease (CD), primary biliary cholangitis (PBC) and leprosy. The most likely disease-causing gene within 9q32 is TNFSF15, which encodes the pro-inflammatory cytokine TNF super-family member 15, but it was unknown whether these disparate diseases were associated with the same genetic variance in 9q32, and how variance within this locus might contribute to pathology. Using genetic data from published studies on CD, PBC and leprosy we revealed that bearing a T allele at rs6478108/rs6478109 (r2 = 1) or rs4979462 was significantly associated with increased risk of CD and decreased risk of leprosy, while the T allele at rs4979462 was associated with significantly increased risk of PBC. In vitro analyses showed that the rs6478109 genotype significantly affected TNFSF15 expression in cells from whole blood of controls, while functional annotation using publicly-available data revealed the broad cell type/tissue-specific regulatory potential of variance at rs6478109 or rs4979462. In summary, we provide evidence that variance within TNFSF15 has the potential to affect cytokine expression across a range of tissues and thereby contribute to protection from infectious diseases such as leprosy, while increasing the risk of immune-mediated diseases including CD and PBC. PMID:27507062

  15. Improved physical stability of amorphous state through acid base interactions.

    PubMed

    Telang, Chitra; Mujumdar, Siddharthya; Mathew, Michael

    2009-06-01

    To investigate role of specific interactions in aiding formation and stabilization of amorphous state in ternary and binary dispersions of a weakly acidic drug. Indomethacin (IMC), meglumine (MU), and polyvinyl pyrollidone (PVP) were the model drug, base, and polymer, respectively. Dispersions were prepared using solvent evaporation. Physical mixtures were cryogenically coground. XRPD, PLM, DSC, TGA, and FTIR were used for characterization. MU has a high crystallization tendency and is characterized by a low T(g) (17 degrees C). IMC crystallization was inhibited in ternary dispersion with MU compared to IMC/PVP alone. An amorphous state formed readily even in coground mixtures. Spectroscopic data are indicative of an IMC-MU amorphous salt and supports solid-state proton transfer. IMC-MU salt displays a low T(g) approximately 50 degrees C, but is more physically stable than IMC, which in molecular mixtures with MU, resisted crystallization even when present in stoichiometric excess of base. This is likely due to a disrupted local structure of amorphous IMC due to specific interactions. IMC showed improved physical stability on incorporating MU in polymer, in spite of low T(g) of the base indicating that chemical interactions play a dominant role in physical stabilization. Salt formation could be induced thermally and mechanically.

  16. Influence of ions on aqueous acid-base reactions.

    PubMed

    Cox, M Jocelyn; Siwick, Bradley J; Bakker, Huib J

    2009-01-12

    We study the effects of bromide salts on the rate and mechanism of the aqueous proton/deuteron-transfer reaction between the photoacid 8-hydroxy-1,3,6-pyrenetrisulfonic acid (HPTS) and the base acetate. The proton/deuteron release is triggered by exciting HPTS with 400 nm femtosecond laser pulses. Probing the electronic and vibrational resonances of the photoacid, the conjugate photobase, the hydrated proton/deuteron and the accepting base with femtosecond visible and mid-infrared pulses monitors the proton transfer. Two reaction channels are identified: 1) direct long-range proton transfer over hydrogen-bonded water bridges that connect the acid and base and 2) acid dissociation to produce fully solvated protons followed by proton scavenging from solution by acetate. We observe that the addition of salt affects the long-range reaction pathway, and reduces both the rate at which protons are released to solution by HPTS and the rate at which solvated protons are scavenged from solution by acetate. We study the dependence of these effects on the nature and concentration of the dissolved salt.

  17. Clinical assessment of acid-base status. Strong ion difference theory.

    PubMed

    Constable, P D

    1999-11-01

    The traditional approach to evaluating acid-base balance uses the Henderson-Hasselbalch equation to categorize four primary acid-base disturbances: respiratory acidosis (increased PCO2), respiratory alkalosis (decreased PCO2), metabolic acidosis (decreased extracellular base excess), or metabolic alkalosis (increased extracellular base excess). The anion gap is calculated to detect the presence of unidentified anions in plasma. This approach works well clinically and is recommended for use whenever serum total protein, albumin, and phosphate concentrations are approximately normal; however, when their concentrations are markedly abnormal, the Henderson-Hasselbalch equation frequently provides erroneous conclusions as to the cause of an acid-base disturbance. Moreover, the Henderson-Hasselbalch approach is more descriptive than mechanistic. The new approach to evaluating acid-base balance uses the simplified strong ion model to categorize eight primary acid-base disturbances: respiratory acidosis (increased PCO2), respiratory alkalosis (decreased PCO2), strong ion acidosis (decreased [SID+]) or strong ion alkalosis (increased [SID+]), nonvolatile buffer ion acidosis (increased [ATOT]) or nonvolatile buffer ion alkalosis (decreased [ATOT]), and temperature acidosis (increased body temperature) or temperature alkalosis (decreased body temperature). The strong ion gap is calculated to detect the presence of unidentified anions in plasma. This simplified strong ion approach works well clinically and is recommended for use whenever serum total protein, albumin, and phosphate concentrations are markedly abnormal. The simplified strong ion approach is mechanistic and is therefore well suited for describing the cause of any acid-base disturbance. The new approach should therefore be valuable in a clinical setting and in research studies investigating acid-base balance. The presence of unmeasured strong ions in plasma or serum (such as lactate, ketoacids, and uremic anions

  18. Mechanisms of action of hormone-sensitive lipase in mouse Leydig cells: its role in the regulation of the steroidogenic acute regulatory protein.

    PubMed

    Manna, Pulak R; Cohen-Tannoudji, Joëlle; Counis, Raymond; Garner, Charles W; Huhtaniemi, Ilpo; Kraemer, Fredric B; Stocco, Douglas M

    2013-03-22

    Hormone-sensitive lipase (HSL) catalyzes the hydrolysis of cholesteryl esters in steroidogenic tissues and, thus, facilitates cholesterol availability for steroidogenesis. The steroidogenic acute regulatory protein (StAR) controls the rate-limiting step in steroid biosynthesis. However, the modes of action of HSL in the regulation of StAR expression remain obscure. We demonstrate in MA-10 mouse Leydig cells that activation of the protein kinase A (PKA) pathway, by a cAMP analog Bt2cAMP, enhanced expression of HSL and its phosphorylation (P) at Ser-660 and Ser-563, but not at Ser-565, concomitant with increased HSL activity. Phosphorylation and activation of HSL coincided with increases in StAR, P-StAR (Ser-194), and progesterone levels. Inhibition of HSL activity by CAY10499 effectively suppressed Bt2cAMP-induced StAR expression and progesterone synthesis. Targeted silencing of endogenous HSL, with siRNAs, resulted in increased cholesteryl ester levels and decreased cholesterol content in MA-10 cells. Depletion of HSL affected lipoprotein-derived cellular cholesterol influx, diminished the supply of cholesterol to the mitochondria, and resulted in the repression of StAR and P-StAR levels. Cells overexpressing HSL increased the efficacy of liver X receptor (LXR) ligands on StAR expression and steroid synthesis, suggesting HSL-mediated steroidogenesis entails enhanced oxysterol production. Conversely, cells deficient in LXRs exhibited decreased HSL responsiveness. Furthermore, an increase in HSL was correlated with the LXR target genes, steroid receptor element-binding protein 1c and ATP binding cassette transporter A1, demonstrating HSL-dependent regulation of steroidogenesis predominantly involves LXR signaling. LXRs interact/cooperate with RXRs and result in the activation of StAR gene transcription. These findings provide novel insight and demonstrate the molecular events by which HSL acts to drive cAMP/PKA-mediated regulation of StAR expression and

  19. Regulatory physiology discipline science plan

    NASA Technical Reports Server (NTRS)

    1991-01-01

    The focus of the Regulatory Physiology discipline of the Space Physiology and Countermeasures Program is twofold. First, to determine and study how microgravity and associated factors of space flight affect the regulatory mechanisms by which humans adapt and achieve homeostasis and thereby regulate their ability to respond to internal and external signals; and, second, to study selected physiological systems that have been demonstrated to be influenced by gravity. The Regulatory Physiology discipline, as defined here, is composed of seven subdisciplines: (1) Circadian Rhythms, (2) Endocrinology, (3) Fluid and Electrolyte Regulation, (4) Hematology, (5) Immunology, (6) Metabolism and Nutrition, and (7) Temperature Regulation. The purpose of this Discipline Science Plan is to provide a conceptual strategy for NASA's Life Sciences Division research and development activities in the area of regulatory physiology. It covers the research areas critical to NASA's programmatic requirements for the Extended-Duration Orbiter, Space Station Freedom, and exploration mission science activities. These science activities include ground-based and flight; basic, applied, and operational; and animal and human research and development. This document summarizes the current status of the program, outlines available knowledge, establishes goals and objectives, identifies science priorities, and defines critical questions in regulatory physiology. It contains a general plan that will be used by both NASA Headquarters Program Offices and the field centers to review and plan basic, applied, and operational intramural and extramural research and development activities in this area.

  20. Cirrus cloud mimic surfaces in the laboratory: organic acids, bases and NOx heterogeneous reactions

    NASA Astrophysics Data System (ADS)

    Sodeau, J.; Oriordan, B.

    2003-04-01

    CIRRUS CLOUD MIMIC SURFACES IN THE LABORATORY:ORGANIC ACIDS, BASES AND NOX HETEROGENEOUS REACTIONS. B. ORiordan, J. Sodeau Department of Chemistry and Environment Research Institute, University College Cork, Ireland j.sodeau@ucc.ie /Fax: +353-21-4902680 There are a variety of biogenic and anthropogenic sources for the simple carboxylic acids to be found in the troposphere giving rise to levels as high as 45 ppb in certain urban areas. In this regard it is of note that ants of genus Formica produce some 10Tg of formic acid each year; some ten times that produced by industry. The expected sinks are those generally associated with tropospheric chemistry: the major routes studied, to date, being wet and dry deposition. No studies have been carried out hitherto on the role of water-ice surfaces in the atmospheric chemistry of carboxylic acids and the purpose of this paper is to indicate their potential function in the heterogeneous release of atmospheric species such as HONO. The deposition of formic acid on a water-ice surface was studied using FT-RAIR spectroscopy over a range of temperatures between 100 and 165K. In all cases ionization to the formate (and oxonium) ions was observed. The results were confirmed by TPD (Temperature Programmed Desorption) measurements, which indicated that two distinct surface species adsorb to the ice. Potential reactions between the formic acid/formate ion surface and nitrogen dioxide were subsequently investigated by FT-RAIRS. Co-deposition experiments showed that N2O3 and the NO+ ion (associated with water) were formed as products. A mechanism is proposed to explain these results, which involves direct reaction between the organic acid and nitrogen dioxide. Similar experiments involving acetic acid also indicate ionization on a water-ice surface. The results are put into the context of atmospheric chemistry potentially occuring on cirrus cloud surfaces.

  1. Salicylic Acid-Based Polymers for Guided Bone Regeneration Using Bone Morphogenetic Protein-2

    PubMed Central

    Subramanian, Sangeeta; Mitchell, Ashley; Yu, Weiling; Snyder, Sabrina; Uhrich, Kathryn

    2015-01-01

    Bone morphogenetic protein-2 (BMP-2) is used clinically to promote spinal fusion, treat complex tibia fractures, and to promote bone formation in craniomaxillofacial surgery. Excessive bone formation at sites where BMP-2 has been applied is an established complication and one that could be corrected by guided tissue regeneration methods. In this study, anti-inflammatory polymers containing salicylic acid [salicylic acid-based poly(anhydride-ester), SAPAE] were electrospun with polycaprolactone (PCL) to create thin flexible matrices for use as guided bone regeneration membranes. SAPAE polymers hydrolyze to release salicylic acid, which is a nonsteroidal anti-inflammatory drug. PCL was used to enhance the mechanical integrity of the matrices. Two different SAPAE-containing membranes were produced and compared: fast-degrading (FD-SAPAE) and slow-degrading (SD-SAPAE) membranes that release salicylic acid at a faster and slower rate, respectively. Rat femur defects were treated with BMP-2 and wrapped with FD-SAPAE, SD-SAPAE, or PCL membrane or were left unwrapped. The effects of different membranes on bone formation within and outside of the femur defects were measured by histomorphometry and microcomputed tomography. Bone formation within the defect was not affected by membrane wrapping at BMP-2 doses of 12 μg or more. In contrast, the FD-SAPAE membrane significantly reduced bone formation outside the defect compared with all other treatments. The rapid release of salicylic acid from the FD-SAPAE membrane suggests that localized salicylic acid treatment during the first few days of BMP-2 treatment can limit ectopic bone formation. The data support development of SAPAE polymer membranes for guided bone regeneration applications as well as barriers to excessive bone formation. PMID:25813520

  2. Novel Lipid and Polymeric Materials as Delivery Systems for Nucleic Acid Based Drugs.

    PubMed

    Barba, Anna Angela; Lamberti, Gaetano; Sardo, Carla; Dapas, Barbara; Abrami, Michela; Grassi, Mario; Farra, Rossella; Tonon, Federica; Forte, Giancarlo; Musiani, Francesco; Licciardi, Mariano; Pozzato, Gabriele; Zanconati, Fabrizio; Scaggiante, Bruna; Grassi, Gabriele; Cavallaro, Gennara

    2015-01-01

    Nucleic acid based drugs (NADBs) are short DNA/RNA molecules that include among others, antisense oligonucleotides, aptamers, small interfering RNAs and micro-interfering RNAs. Despite the different mechanisms of actions, NABDs have the ability to combat the effects of pathological gene expression in many experimental systems. Thus, nowadays, NABDs are considered to have a great therapeutic potential, possibly superior to that of available drugs. Unfortunately, however, the lack of effective delivery systems limits the practical use of NABDs. Due to their hydrophilic nature, NABDs cannot efficiently cross cellular membrane; in addition, they are subjected to fast degradation by cellular and extracellular nucleases. Together these aspects make the delivery of NABDs as naked molecules almost un-effective. To optimize NABD delivery, several solutions have been investigated. From the first attempts described in the beginning of the 1980s, a burst in the number of published papers occurred in the beginning of 1990 s reaching a peak in 2012-13. The extensive amount of work performed so far clearly witnesses the interest of the scientific community in this topic. In the present review, we will concentrate on the description of the most interesting advances in the field. Particular emphasis will be put on polymeric and lipid materials used alone or in combination with a promising delivery strategy based on the use of carbon nanotubes. The data presented suggest that, although further improvements are required, we are not far from the identification of effective delivery systems for NABDs thus making the clinical use of these molecules closer to reality.

  3. Salicylic Acid-Based Polymers for Guided Bone Regeneration Using Bone Morphogenetic Protein-2.

    PubMed

    Subramanian, Sangeeta; Mitchell, Ashley; Yu, Weiling; Snyder, Sabrina; Uhrich, Kathryn; O'Connor, J Patrick

    2015-07-01

    Bone morphogenetic protein-2 (BMP-2) is used clinically to promote spinal fusion, treat complex tibia fractures, and to promote bone formation in craniomaxillofacial surgery. Excessive bone formation at sites where BMP-2 has been applied is an established complication and one that could be corrected by guided tissue regeneration methods. In this study, anti-inflammatory polymers containing salicylic acid [salicylic acid-based poly(anhydride-ester), SAPAE] were electrospun with polycaprolactone (PCL) to create thin flexible matrices for use as guided bone regeneration membranes. SAPAE polymers hydrolyze to release salicylic acid, which is a nonsteroidal anti-inflammatory drug. PCL was used to enhance the mechanical integrity of the matrices. Two different SAPAE-containing membranes were produced and compared: fast-degrading (FD-SAPAE) and slow-degrading (SD-SAPAE) membranes that release salicylic acid at a faster and slower rate, respectively. Rat femur defects were treated with BMP-2 and wrapped with FD-SAPAE, SD-SAPAE, or PCL membrane or were left unwrapped. The effects of different membranes on bone formation within and outside of the femur defects were measured by histomorphometry and microcomputed tomography. Bone formation within the defect was not affected by membrane wrapping at BMP-2 doses of 12 μg or more. In contrast, the FD-SAPAE membrane significantly reduced bone formation outside the defect compared with all other treatments. The rapid release of salicylic acid from the FD-SAPAE membrane suggests that localized salicylic acid treatment during the first few days of BMP-2 treatment can limit ectopic bone formation. The data support development of SAPAE polymer membranes for guided bone regeneration applications as well as barriers to excessive bone formation.

  4. Potential Nociceptive Regulatory Effect of Probiotic Lactobacillus rhamnosus PB01 (DSM 14870) on Mechanical Sensitivity in Diet-Induced Obesity Model.

    PubMed

    Dardmeh, Fereshteh; Nielsen, Hans Ingolf; Alipour, Hiva; Kjærgaard, Benedict; Brandsborg, Erik; Gazerani, Parisa

    2016-01-01

    Treatments for obesity have been shown to reduce pain secondary to weight loss. Intestinal microbiota, as an endogenous factor, influences obesity and pain sensitivity but the effect of oral probiotic supplementation on musculoskeletal pain perception has not been studied systematically. The present study examined the effect of a single daily oral dose (1 × 10(9) CFU) of probiotics (Lactobacillus rhamnosus PB01, DSM14870) supplement on mechanical pain thresholds in behaving diet-induced obese (DIO) mice and their normal weight (NW) controls. The mice (N = 24, 6-week-old male) were randomly divided into four groups on either standard or high fat diet with and without probiotic supplementation. Both DIO and NW groups with probiotic supplementation maintained an insignificant weight gain while the control groups gained significant weight (P < 0.05). Similarly, both DIO and NW probiotics supplemented groups demonstrated a significantly (P < 0.05) lower sensitivity to mechanical stimulation compared to their corresponding control. The results of this study suggest a protective effect of probiotics on nociception circuits, which propose a direct result of the weight reduction or an indirect result of anti-inflammatory properties of the probiotics. Deciphering the exact underlying mechanism of the weight loss and lowering nociception effect of the probiotic applied in this study require further investigation. PMID:27647980

  5. Potential Nociceptive Regulatory Effect of Probiotic Lactobacillus rhamnosus PB01 (DSM 14870) on Mechanical Sensitivity in Diet-Induced Obesity Model

    PubMed Central

    Brandsborg, Erik

    2016-01-01

    Treatments for obesity have been shown to reduce pain secondary to weight loss. Intestinal microbiota, as an endogenous factor, influences obesity and pain sensitivity but the effect of oral probiotic supplementation on musculoskeletal pain perception has not been studied systematically. The present study examined the effect of a single daily oral dose (1 × 109 CFU) of probiotics (Lactobacillus rhamnosus PB01, DSM14870) supplement on mechanical pain thresholds in behaving diet-induced obese (DIO) mice and their normal weight (NW) controls. The mice (N = 24, 6-week-old male) were randomly divided into four groups on either standard or high fat diet with and without probiotic supplementation. Both DIO and NW groups with probiotic supplementation maintained an insignificant weight gain while the control groups gained significant weight (P < 0.05). Similarly, both DIO and NW probiotics supplemented groups demonstrated a significantly (P < 0.05) lower sensitivity to mechanical stimulation compared to their corresponding control. The results of this study suggest a protective effect of probiotics on nociception circuits, which propose a direct result of the weight reduction or an indirect result of anti-inflammatory properties of the probiotics. Deciphering the exact underlying mechanism of the weight loss and lowering nociception effect of the probiotic applied in this study require further investigation. PMID:27647980

  6. Potential Nociceptive Regulatory Effect of Probiotic Lactobacillus rhamnosus PB01 (DSM 14870) on Mechanical Sensitivity in Diet-Induced Obesity Model

    PubMed Central

    Brandsborg, Erik

    2016-01-01

    Treatments for obesity have been shown to reduce pain secondary to weight loss. Intestinal microbiota, as an endogenous factor, influences obesity and pain sensitivity but the effect of oral probiotic supplementation on musculoskeletal pain perception has not been studied systematically. The present study examined the effect of a single daily oral dose (1 × 109 CFU) of probiotics (Lactobacillus rhamnosus PB01, DSM14870) supplement on mechanical pain thresholds in behaving diet-induced obese (DIO) mice and their normal weight (NW) controls. The mice (N = 24, 6-week-old male) were randomly divided into four groups on either standard or high fat diet with and without probiotic supplementation. Both DIO and NW groups with probiotic supplementation maintained an insignificant weight gain while the control groups gained significant weight (P < 0.05). Similarly, both DIO and NW probiotics supplemented groups demonstrated a significantly (P < 0.05) lower sensitivity to mechanical stimulation compared to their corresponding control. The results of this study suggest a protective effect of probiotics on nociception circuits, which propose a direct result of the weight reduction or an indirect result of anti-inflammatory properties of the probiotics. Deciphering the exact underlying mechanism of the weight loss and lowering nociception effect of the probiotic applied in this study require further investigation.

  7. Absorption, fluorescence, and acid-base equilibria of rhodamines in micellar media of sodium dodecyl sulfate.

    PubMed

    Obukhova, Elena N; Mchedlov-Petrossyan, Nikolay O; Vodolazkaya, Natalya A; Patsenker, Leonid D; Doroshenko, Andrey O; Marynin, Andriy I; Krasovitskii, Boris M

    2017-01-01

    Rhodamine dyes are widely used as molecular probes in different fields of science. The aim of this paper was to ascertain to what extent the structural peculiarities of the compounds influence their absorption, emission, and acid-base properties under unified conditions. The acid-base dissociation (HR(+)⇄R+H(+)) of a series of rhodamine dyes was studied in sodium n-dodecylsulfate micellar solutions. In this media, the form R exists as a zwitterion R(±). The indices of apparent ionization constants of fifteen rhodamine cations HR(+) with different substituents in the xanthene moiety vary within the range of pKa(app)=5.04 to 5.53. The distinct dependence of emission of rhodamines bound to micelles on pH of bulk water opens the possibility of using them as fluorescent interfacial acid-base indicators.

  8. Potentiometric Measurement of Transition Ranges and Titration Errors for Acid/Base Indicators

    NASA Astrophysics Data System (ADS)

    Flowers, Paul A.

    1997-07-01

    Sophomore analytical chemistry courses typically devote a substantial amount of lecture time to acid/base equilibrium theory, and usually include at least one laboratory project employing potentiometric titrations. In an effort to provide students a laboratory experience that more directly supports their classroom discussions on this important topic, an experiment involving potentiometric measurement of transition ranges and titration errors for common acid/base indicators has been developed. The pH and visually-assessed color of a millimolar strong acid/base system are monitored as a function of added titrant volume, and the resultant data plotted to permit determination of the indicator's transition range and associated titration error. Student response is typically quite positive, and the measured quantities correlate reasonably well to literature values.

  9. [Effect of heparin on acid-base and blood gas parameters].

    PubMed

    Pöge, A W

    1981-09-15

    The influence of blood-heparin-mixing proportion on the acid-base- and blood-gas parameters was measured by means of the blood-gas- automation ABL 1 with the help of 15 test persons. More than 0.15 ml heparin per ml blood, i.e. more than 750 I.U. heparin per ml blood falsify the measuring data and may lead to wrong diagnostic and therapeutic measures. In clinical practice for one 2-ml-blood test only the dead space of the plastic of various producers are characterized by acid-base- and gas values considerable differing from each other. However, they do not influence the blood parameters. By heparin-Weddel (Wales), heparin-Spofa (CSSR), heparin-Richer (Hungary) and heparin-Polfa (Poland) the same acid-base- and blood gas values will be obtained.

  10. Paediatric acid-base disorders: A case-based review of procedures and pitfalls.

    PubMed

    Carmody, J Bryan; Norwood, Victoria F

    2013-01-01

    Acid-base disorders occur frequently in paediatric patients. Despite the perception that their analysis is complex and difficult, a straightforward set of rules is sufficient to interpret even the most complex disorders - provided certain pitfalls are avoided. Using a case-based approach, the present article reviews the fundamental concepts of acid-base analysis and highlights common mistakes and oversights. Specific topics include the proper identification of the primary disorder; distinguishing compensatory changes from additional primary disorders; use of the albumin-corrected anion gap to generate a differential diagnosis for patients with metabolic acidosis; screening for mixed disorders with the delta-delta formula; recognizing the limits of compensation; use of the anion gap to identify 'hidden' acidosis; and the importance of using information from the history and physical examination to identify the specific cause of a patient's acid-base disturbance.

  11. Absorption, fluorescence, and acid-base equilibria of rhodamines in micellar media of sodium dodecyl sulfate.

    PubMed

    Obukhova, Elena N; Mchedlov-Petrossyan, Nikolay O; Vodolazkaya, Natalya A; Patsenker, Leonid D; Doroshenko, Andrey O; Marynin, Andriy I; Krasovitskii, Boris M

    2017-01-01

    Rhodamine dyes are widely used as molecular probes in different fields of science. The aim of this paper was to ascertain to what extent the structural peculiarities of the compounds influence their absorption, emission, and acid-base properties under unified conditions. The acid-base dissociation (HR(+)⇄R+H(+)) of a series of rhodamine dyes was studied in sodium n-dodecylsulfate micellar solutions. In this media, the form R exists as a zwitterion R(±). The indices of apparent ionization constants of fifteen rhodamine cations HR(+) with different substituents in the xanthene moiety vary within the range of pKa(app)=5.04 to 5.53. The distinct dependence of emission of rhodamines bound to micelles on pH of bulk water opens the possibility of using them as fluorescent interfacial acid-base indicators. PMID:27423469

  12. Influence of chronic respiratory acid-base disorders on acute CO2 titration curve.

    PubMed

    Adrogué, H J; Madias, N E

    1985-04-01

    We have recently shown that background presence of chronic metabolic acid-base disorder markedly alters in vivo acute CO2 titration curve. These studies were carried out to assess the influence of chronic respiratory acid-base disorders on response to acute hypercapnia and to explore whether the chronic level of plasma pH is the factor responsible for alterations in the CO2 titration curve. We compared whole-body responses to acute hypercapnia of dogs with preexisting chronic respiratory alkalosis (n = 8) with that of normal animals (n = 4) and animals with chronic respiratory acidosis (n = 13). Chronic respiratory alkalosis and acidosis, as well as the acute CO2 titrations, were produced in unanesthetized dogs within a large environmental chamber. For comparison with our data on chronic metabolic acidosis and alkalosis, plasma bicarbonate levels, which are secondarily altered in chronic respiratory acid-base disorders, were used as an index of chronic acid-base status of the animals. Results indicate that, as with chronic metabolic acid-base disorders, a larger increment in plasma bicarbonate occurs during acute hypercapnia when steady-state plasma bicarbonate is low (respiratory alkalosis) than when it is high (respiratory acidosis). Yet, in further analogy with the metabolic studies, plasma hydrogen ion concentration is better defended at higher plasma bicarbonate levels in accordance with mathematical relationships defined by the Henderson-Hasselbalch equation. Combined results demonstrate that the influence of chronic acid-base status on whole-body response to acute hypercapnia is independent of initial plasma pH.(ABSTRACT TRUNCATED AT 250 WORDS)

  13. A fundamental regulatory mechanism operating through OmpR and DNA topology controls expression of Salmonella pathogenicity islands SPI-1 and SPI-2.

    PubMed

    Cameron, Andrew D S; Dorman, Charles J

    2012-01-01

    DNA topology has fundamental control over the ability of transcription factors to access their target DNA sites at gene promoters. However, the influence of DNA topology on protein-DNA and protein-protein interactions is poorly understood. For example, relaxation of DNA supercoiling strongly induces the well-studied pathogenicity gene ssrA (also called spiR) in Salmonella enterica, but neither the mechanism nor the proteins involved are known. We have found that relaxation of DNA supercoiling induces expression of the Salmonella pathogenicity island (SPI)-2 regulator ssrA as well as the SPI-1 regulator hilC through a mechanism that requires the two-component regulator OmpR-EnvZ. Additionally, the ompR promoter is autoregulated in the same fashion. Conversely, the SPI-1 regulator hilD is induced by DNA relaxation but is repressed by OmpR. Relaxation of DNA supercoiling caused an increase in OmpR binding to DNA and a concomitant decrease in binding by the nucleoid-associated protein FIS. The reciprocal occupancy of DNA by OmpR and FIS was not due to antagonism between these transcription factors, but was instead a more intrinsic response to altered DNA topology. Surprisingly, DNA relaxation had no detectable effect on the binding of the global repressor H-NS. These results reveal the underlying molecular mechanism that primes SPI genes for rapid induction at the onset of host invasion. Additionally, our results reveal novel features of the archetypal two-component regulator OmpR. OmpR binding to relaxed DNA appears to generate a locally supercoiled state, which may assist promoter activation by relocating supercoiling stress-induced destabilization of DNA strands. Much has been made of the mechanisms that have evolved to regulate horizontally-acquired genes such as SPIs, but parallels among the ssrA, hilC, and ompR promoters illustrate that a fundamental form of regulation based on DNA topology coordinates the expression of these genes regardless of their origins.

  14. The Comparative Studies of Binding Activity of Curcumin and Didemethylated Curcumin with Selenite: Hydrogen Bonding vs Acid-Base Interactions.

    PubMed

    Liao, Jiahn-Haur; Wu, Tzu-Hua; Chen, Ming-Yi; Chen, Wei-Ting; Lu, Shou-Yun; Wang, Yi-Hsuan; Wang, Shao-Pin; Hsu, Yen-Min; Huang, Yi-Shiang; Huang, Zih-You; Lin, Yu-Ching; Chang, Ching-Ming; Huang, Fu-Yung; Wu, Shih-Hsiung

    2015-01-01

    In this report, the in vitro relative capabilities of curcumin (CCM) and didemethylated curcumin (DCCM) in preventing the selenite-induced crystallin aggregation were investigated by turbidity tests and isothermal titration calorimetry (ITC). DCCM showed better activity than CCM. The conformers of CCM/SeO3(2-) and DCCM/SeO3(2-) complexes were optimized by molecular orbital calculations. Results reveal that the selenite anion surrounded by CCM through the H-bonding between CCM and selenite, which is also observed via IR and NMR studied. For DCCM, the primary driving force is the formation of an acid-base adduct with selenite showing that the phenolic OH group of DCCM was responsible for forming major conformer of DCCM. The formation mechanisms of selenite complexes with CCM or DCCM explain why DCCM has greater activity than CCM in extenuating the toxicity of selenite as to prevent selenite-induced lens protein aggregation. PMID:26635113

  15. The Comparative Studies of Binding Activity of Curcumin and Didemethylated Curcumin with Selenite: Hydrogen Bonding vs Acid-Base Interactions.

    PubMed

    Liao, Jiahn-Haur; Wu, Tzu-Hua; Chen, Ming-Yi; Chen, Wei-Ting; Lu, Shou-Yun; Wang, Yi-Hsuan; Wang, Shao-Pin; Hsu, Yen-Min; Huang, Yi-Shiang; Huang, Zih-You; Lin, Yu-Ching; Chang, Ching-Ming; Huang, Fu-Yung; Wu, Shih-Hsiung

    2015-12-04

    In this report, the in vitro relative capabilities of curcumin (CCM) and didemethylated curcumin (DCCM) in preventing the selenite-induced crystallin aggregation were investigated by turbidity tests and isothermal titration calorimetry (ITC). DCCM showed better activity than CCM. The conformers of CCM/SeO3(2-) and DCCM/SeO3(2-) complexes were optimized by molecular orbital calculations. Results reveal that the selenite anion surrounded by CCM through the H-bonding between CCM and selenite, which is also observed via IR and NMR studied. For DCCM, the primary driving force is the formation of an acid-base adduct with selenite showing that the phenolic OH group of DCCM was responsible for forming major conformer of DCCM. The formation mechanisms of selenite complexes with CCM or DCCM explain why DCCM has greater activity than CCM in extenuating the toxicity of selenite as to prevent selenite-induced lens protein aggregation.

  16. The Comparative Studies of Binding Activity of Curcumin and Didemethylated Curcumin with Selenite: Hydrogen Bonding vs Acid-Base Interactions

    NASA Astrophysics Data System (ADS)

    Liao, Jiahn-Haur; Wu, Tzu-Hua; Chen, Ming-Yi; Chen, Wei-Ting; Lu, Shou-Yun; Wang, Yi-Hsuan; Wang, Shao-Pin; Hsu, Yen-Min; Huang, Yi-Shiang; Huang, Zih-You; Lin, Yu-Ching; Chang, Ching-Ming; Huang, Fu-Yung; Wu, Shih-Hsiung

    2015-12-01

    In this report, the in vitro relative capabilities of curcumin (CCM) and didemethylated curcumin (DCCM) in preventing the selenite-induced crystallin aggregation were investigated by turbidity tests and isothermal titration calorimetry (ITC). DCCM showed better activity than CCM. The conformers of CCM/SeO32- and DCCM/SeO32- complexes were optimized by molecular orbital calculations. Results reveal that the selenite anion surrounded by CCM through the H-bonding between CCM and selenite, which is also observed via IR and NMR studied. For DCCM, the primary driving force is the formation of an acid-base adduct with selenite showing that the phenolic OH group of DCCM was responsible for forming major conformer of DCCM. The formation mechanisms of selenite complexes with CCM or DCCM explain why DCCM has greater activity than CCM in extenuating the toxicity of selenite as to prevent selenite-induced lens protein aggregation.

  17. The effect of acid-base clustering and ions on the growth of atmospheric nano-particles

    NASA Astrophysics Data System (ADS)

    Lehtipalo, Katrianne; Rondo, Linda; Kontkanen, Jenni; Schobesberger, Siegfried; Jokinen, Tuija; Sarnela, Nina; Kürten, Andreas; Ehrhart, Sebastian; Franchin, Alessandro; Nieminen, Tuomo; Riccobono, Francesco; Sipilä, Mikko; Yli-Juuti, Taina; Duplissy, Jonathan; Adamov, Alexey; Ahlm, Lars; Almeida, João; Amorim, Antonio; Bianchi, Federico; Breitenlechner, Martin; Dommen, Josef; Downard, Andrew J.; Dunne, Eimear M.; Flagan, Richard C.; Guida, Roberto; Hakala, Jani; Hansel, Armin; Jud, Werner; Kangasluoma, Juha; Kerminen, Veli-Matti; Keskinen, Helmi; Kim, Jaeseok; Kirkby, Jasper; Kupc, Agnieszka; Kupiainen-Määttä, Oona; Laaksonen, Ari; Lawler, Michael J.; Leiminger, Markus; Mathot, Serge; Olenius, Tinja; Ortega, Ismael K.; Onnela, Antti; Petäjä, Tuukka; Praplan, Arnaud; Rissanen, Matti P.; Ruuskanen, Taina; Santos, Filipe D.; Schallhart, Simon; Schnitzhofer, Ralf; Simon, Mario; Smith, James N.; Tröstl, Jasmin; Tsagkogeorgas, Georgios; Tomé, António; Vaattovaara, Petri; Vehkamäki, Hanna; Vrtala, Aron E.; Wagner, Paul E.; Williamson, Christina; Wimmer, Daniela; Winkler, Paul M.; Virtanen, Annele; Donahue, Neil M.; Carslaw, Kenneth S.; Baltensperger, Urs; Riipinen, Ilona; Curtius, Joachim; Worsnop, Douglas R.; Kulmala, Markku

    2016-05-01

    The growth of freshly formed aerosol particles can be the bottleneck in their survival to cloud condensation nuclei. It is therefore crucial to understand how particles grow in the atmosphere. Insufficient experimental data has impeded a profound understanding of nano-particle growth under atmospheric conditions. Here we study nano-particle growth in the CLOUD (Cosmics Leaving OUtdoors Droplets) chamber, starting from the formation of molecular clusters. We present measured growth rates at sub-3 nm sizes with different atmospherically relevant concentrations of sulphuric acid, water, ammonia and dimethylamine. We find that atmospheric ions and small acid-base clusters, which are not generally accounted for in the measurement of sulphuric acid vapour, can participate in the growth process, leading to enhanced growth rates. The availability of compounds capable of stabilizing sulphuric acid clusters governs the magnitude of these effects and thus the exact growth mechanism. We bring these observations into a coherent framework and discuss their significance in the atmosphere.

  18. The Comparative Studies of Binding Activity of Curcumin and Didemethylated Curcumin with Selenite: Hydrogen Bonding vs Acid-Base Interactions

    PubMed Central

    Liao, Jiahn-Haur; Wu, Tzu-Hua; Chen, Ming-Yi; Chen, Wei-Ting; Lu, Shou-Yun; Wang, Yi-Hsuan; Wang, Shao-Pin; Hsu, Yen-Min; Huang, Yi-Shiang; Huang, Zih-You; Lin, Yu-Ching; Chang, Ching-Ming; Huang, Fu-Yung; Wu, Shih-Hsiung

    2015-01-01

    In this report, the in vitro relative capabilities of curcumin (CCM) and didemethylated curcumin (DCCM) in preventing the selenite-induced crystallin aggregation were investigated by turbidity tests and isothermal titration calorimetry (ITC). DCCM showed better activity than CCM. The conformers of CCM/SeO32− and DCCM/SeO32− complexes were optimized by molecular orbital calculations. Results reveal that the selenite anion surrounded by CCM through the H-bonding between CCM and selenite, which is also observed via IR and NMR studied. For DCCM, the primary driving force is the formation of an acid-base adduct with selenite showing that the phenolic OH group of DCCM was responsible for forming major conformer of DCCM. The formation mechanisms of selenite complexes with CCM or DCCM explain why DCCM has greater activity than CCM in extenuating the toxicity of selenite as to prevent selenite-induced lens protein aggregation. PMID:26635113

  19. Essentials in the diagnosis of acid-base disorders and their high altitude application.

    PubMed

    Paulev, P E; Zubieta-Calleja, G R

    2005-09-01

    This report describes the historical development in the clinical application of chemical variables for the interpretation of acid-base disturbances. The pH concept was already introduced in 1909. Following World War II, disagreements concerning the definition of acids and bases occurred, and since then two strategies have been competing. Danish scientists in 1923 defined an acid as a substance able to give off a proton at a given pH, and a base as a substance that could bind a proton, whereas the North American Singer-Hasting school in 1948 defined acids as strong non-buffer anions and bases as non-buffer cations. As a consequence of this last definition, electrolyte disturbances were mixed up with real acid-base disorders and the variable, strong ion difference (SID), was introduced as a measure of non-respiratory acid-base disturbances. However, the SID concept is only an empirical approximation. In contrast, the Astrup/Siggaard-Andersen school of scientists, using computer strategies and the Acid-base Chart, has made diagnosis of acid-base disorders possible at a glance on the Chart, when the data are considered in context with the clinical development. Siggaard-Andersen introduced Base Excess (BE) or Standard Base Excess (SBE) in the extracellular fluid volume (ECF), extended to include the red cell volume (eECF), as a measure of metabolic acid-base disturbances and recently replaced it by the term Concentration of Titratable Hydrogen Ion (ctH). These two concepts (SBE and ctH) represent the same concentration difference, but with opposite signs. Three charts modified from the Siggaard-Andersen Acid-Base Chart are presented for use at low, medium and high altitudes of 2500 m, 3500 m, and 4000 m, respectively. In this context, the authors suggest the use of Titratable Hydrogen Ion concentration Difference (THID) in the extended extracellular fluid volume, finding it efficient and better than any other determination of the metabolic component in acid-base

  20. Essentials in the diagnosis of acid-base disorders and their high altitude application.

    PubMed

    Paulev, P E; Zubieta-Calleja, G R

    2005-09-01

    This report describes the historical development in the clinical application of chemical variables for the interpretation of acid-base disturbances. The pH concept was already introduced in 1909. Following World War II, disagreements concerning the definition of acids and bases occurred, and since then two strategies have been competing. Danish scientists in 1923 defined an acid as a substance able to give off a proton at a given pH, and a base as a substance that could bind a proton, whereas the North American Singer-Hasting school in 1948 defined acids as strong non-buffer anions and bases as non-buffer cations. As a consequence of this last definition, electrolyte disturbances were mixed up with real acid-base disorders and the variable, strong ion difference (SID), was introduced as a measure of non-respiratory acid-base disturbances. However, the SID concept is only an empirical approximation. In contrast, the Astrup/Siggaard-Andersen school of scientists, using computer strategies and the Acid-base Chart, has made diagnosis of acid-base disorders possible at a glance on the Chart, when the data are considered in context with the clinical development. Siggaard-Andersen introduced Base Excess (BE) or Standard Base Excess (SBE) in the extracellular fluid volume (ECF), extended to include the red cell volume (eECF), as a measure of metabolic acid-base disturbances and recently replaced it by the term Concentration of Titratable Hydrogen Ion (ctH). These two concepts (SBE and ctH) represent the same concentration difference, but with opposite signs. Three charts modified from the Siggaard-Andersen Acid-Base Chart are presented for use at low, medium and high altitudes of 2500 m, 3500 m, and 4000 m, respectively. In this context, the authors suggest the use of Titratable Hydrogen Ion concentration Difference (THID) in the extended extracellular fluid volume, finding it efficient and better than any other determination of the metabolic component in acid-base

  1. Closed cycle ion exchange method for regenerating acids, bases and salts

    DOEpatents

    Dreyfuss, Robert M.

    1976-01-01

    A method for conducting a chemical reaction in acidic, basic, or neutral solution as required and then regenerating the acid, base, or salt by means of ion exchange in a closed cycle reaction sequence which comprises contacting the spent acid, base, or salt with an ion exchanger, preferably a synthetic organic ion-exchange resin, so selected that the counter ions thereof are ions also produced as a by-product in the closed reaction cycle, and then regenerating the spent ion exchanger by contact with the by-product counter ions. The method is particularly applicable to closed cycle processes for the thermochemical production of hydrogen.

  2. Investigation of the acid-base properties of mononitro-calix[4]arene with chemometric methods.

    PubMed

    Wang, Li; Shi, Xian-Fa; Zhu, Zhong-Liang

    2007-07-01

    The acid-base properties of mononitro-calix[4]arene was studied with chemometric methods by measurement of its UV absorbance under different pH. The chemometric method-iterative target transformation factor (ITTFA) was employed to resolve the acid-base fraction curves. Combining with other chemometric methods-principal component analysis (PCA) and evolving factor analysis (EFA), the proton dissociation behavior of the derivative was investigated in detail. The pK(a) values of the derivative were determined and the fraction curves and pure absorbing spectra of each absorbing component were obtained.

  3. [The background of acid-base interactions in nonaqueous solvents--an analytical approach].

    PubMed

    Barcza, Lajos; Barczáné, Buvári Agnes

    2002-01-01

    The acid-base determination of different substances by non-aqueous titrations is highly preferred in pharmaceutical analyses since the method is quantitative, exact and well reproducible. The modern interpretation of the reactions in nonaqueous solvents started in the past century, but several inconsistencies and unsolved problems can still be found in the literature. The acid-base theories of Brönsted-Lowry and Lewis as well as the so-called solvent theory are outlined first, then the promoting (and levelling) and the differentiating effects are discussed on the basis of the hydrogen bond concept.

  4. Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems

    PubMed Central

    Lui, Clarissa; Cady, Nathaniel C.; Batt, Carl A.

    2009-01-01

    The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform. PMID:22412335

  5. Deep Sequencing-Based Transcriptome Analysis Reveals the Regulatory Mechanism of Bemisia tabaci (Hemiptera: Aleyrodidae) Nymph Parasitized by Encarsia sophia (Hymenoptera: Aphelinidae)

    PubMed Central

    Wang, Ran; Li, Fei; Zhang, Fan; Wang, Su

    2016-01-01

    The whitefly Bemisia tabaci is a genetically diverse complex with multiple cryptic species, and some are the most destructive invasive pests of many ornamentals and crops worldwide. Encarsia sophia is an autoparasitoid wasp that demonstrated high efficiency as bio-control agent of whiteflies. However, the immune mechanism of B. tabaci parasitization by E. sophia is unknown. In order to investigate immune response of B. tabaci to E. Sophia parasitization, the transcriptome of E. sophia parasitized B. tabaci nymph was sequenced by Illumina sequencing. De novo assembly generated 393,063 unigenes with average length of 616 bp, in which 46,406 unigenes (15.8% of all unigenes) were successfully mapped. Parasitization by E. sophia had significant effects on the transcriptome profile of B. tabaci nymph. A total of 1482 genes were significantly differentially expressed, of which 852 genes were up-regulated and 630 genes were down-regulated. These genes were mainly involved in immune response, development, metabolism and host signaling pathways. At least 52 genes were found to be involved in the host immune response, 33 genes were involved in the development process, and 29 genes were involved in host metabolism. Taken together, the assembled and annotated transcriptome sequences provided a valuable genomic resource for further understanding the molecular mechanism of immune response of B. tabaci parasitization by E. sophia. PMID:27332546

  6. Genome-Wide Mapping of Targets of Maize Histone Deacetylase HDA101 Reveals Its Function and Regulatory Mechanism during Seed Development[OPEN

    PubMed Central

    Yang, Hua; Liu, Xinye; Xin, Mingming; Du, Jinkun; Hu, Zhaorong; Peng, HuiRu; Sun, Qixin; Ni, Zhongfu; Yao, Yingyin

    2016-01-01

    Histone deacetylases (HDACs) regulate histone acetylation levels by removing the acetyl group from lysine residues. The maize (Zea mays) HDAC HDA101 influences several aspects of development, including kernel size; however, the molecular mechanism by which HDA101 affects kernel development remains unknown. In this study, we find that HDA101 regulates the expression of transfer cell-specific genes, suggesting that their misregulation may be associated with the defects in differentiation of endosperm transfer cells and smaller kernels observed in hda101 mutants. To investigate HDA101 function during the early stages of seed development, we performed genome-wide mapping of HDA101 binding sites. We observed that, like mammalian HDACs, HDA101 mainly targets highly and intermediately expressed genes. Although loss of HDA101 can induce histone hyperacetylation of its direct targets, this often does not involve variation in transcript levels. A small subset of inactive genes that must be negatively regulated during kernel development is also targeted by HDA101 and its loss leads to hyperacetylation and increased expression of these inactive genes. Finally, we report that HDA101 interacts with members of different chromatin remodeling complexes, such as NFC103/MSI1 and SNL1/SIN3-like protein corepressors. Taken together, our results reveal a complex genetic network regulated by HDA101 during seed development and provide insight into the different mechanisms of HDA101-mediated regulation of transcriptionally active and inactive genes. PMID:26908760

  7. A Negative Regulatory Mechanism Involving 14-3-3ζ Limits Signaling Downstream of ROCK to Regulate Tissue Stiffness in Epidermal Homeostasis.

    PubMed

    Kular, Jasreen; Scheer, Kaitlin G; Pyne, Natasha T; Allam, Amr H; Pollard, Anthony N; Magenau, Astrid; Wright, Rebecca L; Kolesnikoff, Natasha; Moretti, Paul A; Wullkopf, Lena; Stomski, Frank C; Cowin, Allison J; Woodcock, Joanna M; Grimbaldeston, Michele A; Pitson, Stuart M; Timpson, Paul; Ramshaw, Hayley S; Lopez, Angel F; Samuel, Michael S

    2015-12-21

    ROCK signaling causes epidermal hyper-proliferation by increasing ECM production, elevating dermal stiffness, and enhancing Fak-mediated mechano-transduction signaling. Elevated dermal stiffness in turn causes ROCK activation, establishing mechano-reciprocity, a positive feedback loop that can promote tumors. We have identified a negative feedback mechanism that limits excessive ROCK signaling during wound healing and is lost in squamous cell carcinomas (SCCs). Signal flux through ROCK was selectively tuned down by increased levels of 14-3-3ζ, which interacted with Mypt1, a ROCK signaling antagonist. In 14-3-3ζ(-/-) mice, unrestrained ROCK signaling at wound margins elevated ECM production and reduced ECM remodeling, increasing dermal stiffness and causing rapid wound healing. Conversely, 14-3-3ζ deficiency enhanced cutaneous SCC size. Significantly, inhibiting 14-3-3ζ with a novel pharmacological agent accelerated wound healing 2-fold. Patient samples of chronic non-healing wounds overexpressed 14-3-3ζ, while cutaneous SCCs had reduced 14-3-3ζ. These results reveal a novel 14-3-3ζ-dependent mechanism that negatively regulates mechano-reciprocity, suggesting new therapeutic opportunities.

  8. A Negative Regulatory Mechanism Involving 14-3-3ζ Limits Signaling Downstream of ROCK to Regulate Tissue Stiffness in Epidermal Homeostasis.

    PubMed

    Kular, Jasreen; Scheer, Kaitlin G; Pyne, Natasha T; Allam, Amr H; Pollard, Anthony N; Magenau, Astrid; Wright, Rebecca L; Kolesnikoff, Natasha; Moretti, Paul A; Wullkopf, Lena; Stomski, Frank C; Cowin, Allison J; Woodcock, Joanna M; Grimbaldeston, Michele A; Pitson, Stuart M; Timpson, Paul; Ramshaw, Hayley S; Lopez, Angel F; Samuel, Michael S

    2015-12-21

    ROCK signaling causes epidermal hyper-proliferation by increasing ECM production, elevating dermal stiffness, and enhancing Fak-mediated mechano-transduction signaling. Elevated dermal stiffness in turn causes ROCK activation, establishing mechano-reciprocity, a positive feedback loop that can promote tumors. We have identified a negative feedback mechanism that limits excessive ROCK signaling during wound healing and is lost in squamous cell carcinomas (SCCs). Signal flux through ROCK was selectively tuned down by increased levels of 14-3-3ζ, which interacted with Mypt1, a ROCK signaling antagonist. In 14-3-3ζ(-/-) mice, unrestrained ROCK signaling at wound margins elevated ECM production and reduced ECM remodeling, increasing dermal stiffness and causing rapid wound healing. Conversely, 14-3-3ζ deficiency enhanced cutaneous SCC size. Significantly, inhibiting 14-3-3ζ with a novel pharmacological agent accelerated wound healing 2-fold. Patient samples of chronic non-healing wounds overexpressed 14-3-3ζ, while cutaneous SCCs had reduced 14-3-3ζ. These results reveal a novel 14-3-3ζ-dependent mechanism that negatively regulates mechano-reciprocity, suggesting new therapeutic opportunities. PMID:26702834

  9. A Sensitive Gel-based Method Combining Distinct Cyclophellitol-based Probes for the Identification of Acid/Base Residues in Human Retaining β-Glucosidases*

    PubMed Central

    Kallemeijn, Wouter W.; Witte, Martin D.; Voorn-Brouwer, Tineke M.; Walvoort, Marthe T. C.; Li, Kah-Yee; Codée, Jeroen D. C.; van der Marel, Gijsbert A.; Boot, Rolf G.; Overkleeft, Herman S.; Aerts, Johannes M. F. G.

    2014-01-01

    Retaining β-exoglucosidases operate by a mechanism in which the key amino acids driving the glycosidic bond hydrolysis act as catalytic acid/base and nucleophile. Recently we designed two distinct classes of fluorescent cyclophellitol-type activity-based probes (ABPs) that exploit this mechanism to covalently modify the nucleophile of retaining β-glucosidases. Whereas β-epoxide ABPs require a protonated acid/base for irreversible inhibition of retaining β-glucosidases, β-aziridine ABPs do not. Here we describe a novel sensitive method to identify both catalytic residues of retaining β-glucosidases by the combined use of cyclophellitol β-epoxide- and β-aziridine ABPs. In this approach putative catalytic residues are first substituted to noncarboxylic amino acids such as glycine or glutamine through site-directed mutagenesis. Next, the acid/base and nucleophile can be identified via classical sodium azide-mediated rescue of mutants thereof. Selective labeling with fluorescent β-aziridine but not β-epoxide ABPs identifies the acid/base residue in mutagenized enzyme, as only the β-aziridine ABP can bind in its absence. The Absence of the nucleophile abolishes any ABP labeling. We validated the method by using the retaining β-glucosidase GBA (CAZy glycosylhydrolase family GH30) and then applied it to non-homologous (putative) retaining β-glucosidases categorized in GH1 and GH116: GBA2, GBA3, and LPH. The described method is highly sensitive, requiring only femtomoles (nanograms) of ABP-labeled enzymes. PMID:25344605

  10. Regulatory cells and transplantation tolerance.

    PubMed

    Cobbold, Stephen P; Waldmann, Herman

    2013-06-01

    Transplantation tolerance is a continuing therapeutic goal, and it is now clear that a subpopulation of T cells with regulatory activity (Treg) that express the transcription factor foxp3 are crucial to this aspiration. Although reprogramming of the immune system to donor-specific transplantation tolerance can be readily achieved in adult mouse models, it has yet to be successfully translated in human clinical practice. This requires that we understand the fundamental mechanisms by which donor antigen-specific Treg are induced and function to maintain tolerance, so that we can target therapies to enhance rather than impede these regulatory processes. Our current understanding is that Treg act via numerous molecular mechanisms, and critical underlying components such as mTOR inhibition, are only now emerging. PMID:23732858

  11. Regulatory mechanisms controlling expression of the DAN/TIR mannoprotein genes during anaerobic remodeling of the cell wall in Saccharomyces cerevisiae.

    PubMed Central

    Abramova, N E; Cohen, B D; Sertil, O; Kapoor, R; Davies, K J; Lowry, C V

    2001-01-01

    The DAN/TIR genes of Saccharomyces cerevisiae encode homologous mannoproteins, some of which are essential for anaerobic growth. Expression of these genes is induced during anaerobiosis and in some cases during cold shock. We show that several heme-responsive mechanisms combine to regulate DAN/TIR gene expression. The first mechanism employs two repression factors, Mox1 and Mox2, and an activation factor, Mox4 (for mannoprotein regulation by oxygen). The genes encoding these proteins were identified by selecting for recessive mutants with altered regulation of a dan1::ura3 fusion. MOX4 is identical to UPC2, encoding a binucleate zinc cluster protein controlling expression of an anaerobic sterol transport system. Mox4/Upc2 is required for expression of all the DAN/TIR genes. It appears to act through a consensus sequence termed the AR1 site, as does Mox2. The noninducible mox4Delta allele was epistatic to the constitutive mox1 and mox2 mutations, suggesting that Mox1 and Mox2 modulate activation by Mox4 in a heme-dependent fashion. Mutations in a putative repression domain in Mox4 caused constitutive expression of the DAN/TIR genes, indicating a role for this domain in heme repression. MOX4 expression is induced both in anaerobic and cold-shocked cells, so heme may also regulate DAN/TIR expression through inhibition of expression of MOX4. Indeed, ectopic expression of MOX4 in aerobic cells resulted in partially constitutive expression of DAN1. Heme also regulates expression of some of the DAN/TIR genes through the Rox7 repressor, which also controls expression of the hypoxic gene ANB1. In addition Rox1, another heme-responsive repressor, and the global repressors Tup1 and Ssn6 are also required for full aerobic repression of these genes. PMID:11238402

  12. Regulatory mechanisms controlling expression of the DAN/TIR mannoprotein genes during anaerobic remodeling of the cell wall in Saccharomyces cerevisiae.

    PubMed

    Abramova, N E; Cohen, B D; Sertil, O; Kapoor, R; Davies, K J; Lowry, C V

    2001-03-01

    The DAN/TIR genes of Saccharomyces cerevisiae encode homologous mannoproteins, some of which are essential for anaerobic growth. Expression of these genes is induced during anaerobiosis and in some cases during cold shock. We show that several heme-responsive mechanisms combine to regulate DAN/TIR gene expression. The first mechanism employs two repression factors, Mox1 and Mox2, and an activation factor, Mox4 (for mannoprotein regulation by oxygen). The genes encoding these proteins were identified by selecting for recessive mutants with altered regulation of a dan1::ura3 fusion. MOX4 is identical to UPC2, encoding a binucleate zinc cluster protein controlling expression of an anaerobic sterol transport system. Mox4/Upc2 is required for expression of all the DAN/TIR genes. It appears to act through a consensus sequence termed the AR1 site, as does Mox2. The noninducible mox4Delta allele was epistatic to the constitutive mox1 and mox2 mutations, suggesting that Mox1 and Mox2 modulate activation by Mox4 in a heme-dependent fashion. Mutations in a putative repression domain in Mox4 caused constitutive expression of the DAN/TIR genes, indicating a role for this domain in heme repression. MOX4 expression is induced both in anaerobic and cold-shocked cells, so heme may also regulate DAN/TIR expression through inhibition of expression of MOX4. Indeed, ectopic expression of MOX4 in aerobic cells resulted in partially constitutive expression of DAN1. Heme also regulates expression of some of the DAN/TIR genes through the Rox7 repressor, which also controls expression of the hypoxic gene ANB1. In addition Rox1, another heme-responsive repressor, and the global repressors Tup1 and Ssn6 are also required for full aerobic repression of these genes.

  13. HER2 Stabilizes EGFR and Itself by Altering Autophosphorylation Patterns in a Manner That Overcomes Regulatory Mechanisms and Promotes Proliferative and Transformation Signaling

    PubMed Central

    Hartman, Zachary; Zhao, Hua; Agazie, Yehenew M.

    2012-01-01

    One of the causes of breast cancer is overexpression of the human epidermal growth factor receptor 2 (HER2). Enhanced receptor autophosphorylation and resistance to activation-induced down regulation have been suggested as mechanisms for HER2-induced sustained signaling and cell transformation. However, the molecular mechanisms underlying these possibilities remain incompletely understood. In the current report, we present evidence that show that HER2 overexpression does not lead to receptor hyper-autophosphorylation, but alters patterns in a manner that favors receptor stability and sustained signaling. Specifically, HER2 overexpression blocks EGFR tyrosine phosphorylation on Y1045 and Y1068, the known docking sites of c-Cbl and Grb2, respectively, while promoting phosphorylation on Y1173, the known docking site of the Gab adaptor proteins and phospholipase C gamma (PLCγ). Under these conditions, HER2 itself is phosphorylated on Y1221/1222, with no known role, and on Y1248 that corresponds to Y1173 of EGFR. Interestingly, suppressed EGFR autophosphorylation on the Grb2 and c-Cbl binding sites correlated with receptor stability and sustained signaling, suggesting that HER2 accomplishes these tasks by altering autophosphorylation patterns. In conformity with these findings, mutation of the Grb2 binding site on EGFR (Y1068F-EGFR) conferred resistance to ligand-induced degradation which in turn induced sustained signaling, and increased cell proliferation and transformation. These findings suggest that the Grb2 binding site on EGFR is redundant for signaling, but critical for receptor regulation. On the other hand, mutation of the putative Grb2 binding site in HER2 (Y1139) did not affect stability, signaling or transformation, suggesting that Y1139 in HER2 may not serve as a Grb2 binding site. In agreement with the role of EGFR in HER2 signaling, inhibition of EGFR expression reduced HER2-induced anchorage-independent growth and tumorigenesis. These results imply

  14. Regulatory Considerations for Biosimilars

    PubMed Central

    Nellore, Ranjani

    2010-01-01

    Currently there is considerable interest in the legislative debate around generic biological drugs or “biosimilars” in the EU and US due to the large, lucrative market that it offers to the industry. While some countries have issued a few regulatory guidelines as well as product specific requirements, there is no general consensus as to a single, simple mechanism similar to the bioequivalence determination that leads to approval of generic small molecules all over the world. The inherent complex nature of the molecules, along with complicated manufacturing and analytical techniques to characterize them make it difficult to rely on a single human pharmacokinetic study for assurance of safety and efficacy. In general, the concept of comparability has been used for evaluation of the currently approved “similar” biological where a step by step assessment on the quality, preclinical and clinical aspects is made. In India, the focus is primarily on the availability and affordability of life-saving drugs. In this context every product needs to be evaluated on its own merit irrespective of the innovator brand. The formation of the National Biotechnology Regulatory Authority may provide a step in the right direction for regulation of these complex molecules. However, in order to have an efficient machinery for initial approval and ongoing oversight with a country-specific focus, cooperation with international authorities for granting approvals and continuous risk-benefit review is essential. Several steps are still needed for India to be perceived as a country that leads the world in providing quality biological products. PMID:21829775

  15. Differential sensitivity to capture stress assessed by blood acid-base status in five carcharhinid sharks.

    PubMed

    Mandelman, John W; Skomal, Gregory B

    2009-04-01

    Stress from fishing capture can incite potentially lethal physiological changes in fishes. Blood acid-base status has routinely been utilized to gauge the magnitude of the stress response, which is dependent on the nature of the capture event and metabolic capacity of the species in question. The mortality induced by demersal longline capture has been shown to vary among taxonomically similar carcharhinid elasmobranchs. In this study, we aimed to: (1) quantify and compare blood acid-base disturbances associated with longline capture in five carcharhinid species; (2) examine the extent to which these disturbances correspond with reported at-vessel mortality rates; and (3) investigate how interspecific differences in the physiological stress response could relate to life history, ecology, and phylogeny. Results showed that blood acid-base disturbances from longline-capture varied between species, with relative degrees of disturbance by species proportional to previously reported at-vessel mortality rates. In addition, the degree in which metabolic and respiratory acidoses influenced relative depressions in blood pH also differed by species. The differences in blood acid-base status point to discrepancies in the aerobic and anaerobic capacities among these taxonomically similar species, and are important when considering the effects of, and possible means to mitigate deleterious consequences from, longline fishing capture. PMID:18846381

  16. Boronic acid-based enzyme inhibitors: a review of recent progress.

    PubMed

    Fu, H; Fang, H; Sun, Jie; Wang, H; Liu, A; Sun, J; Wu, Z

    2014-01-01

    Since Bortezomib was approved by US FDA as the first drug to treat multiple myeloma, various boronic acid compounds have been developed as enzyme inhibitors. This paper reviewed the progress of boronic acid-based inhibitors against enzymes including proteasome, serine protease, HDACs and other enzymes in the past decade.

  17. Barbituric acid-based magnetic N-halamine nanoparticles as recyclable antibacterial agents.

    PubMed

    Dong, Alideertu; Sun, Yue; Lan, Shi; Wang, Qin; Cai, Qian; Qi, Xiuzhen; Zhang, Yanling; Gao, Ge; Liu, Fengqi; Harnoode, Chokto

    2013-08-28

    Novel recyclable bactericidal materials, barbituric acid-based magnetic N-halamine nanoparticles (BAMNH NPs), were fabricated by coating of magnetic silica nanoparticles (MS NPs) with barbituric acid-based N-halamine by the aid of the radical polymerization. The sterilizing effect on the bacterial strain is investigated by incubating Gram-negative bacteria (Escherichia coli and Pseudomonas aeruginosa) and Gram-positive bacteria (Staphylococcus aureus and Bacillus subtilis). The as-prepared BAMNH NPs exhibit higher biocidal activity than the bulk powder barbituric acid-based N-halamine due to the high activated surface area. The structural effect of N-halamine on antimicrobial performance was fully clarified through the comparison between BAMNH NPs and hydantoin-based magnetic N-halamine nanoparticles (HMNH NPs). BAMNH NPs exhibited promising stability toward repeated washing and long-term storage. BAMNH NPs with different chlorine content were comparatively chosen to investigate the influence of chlorine content on the antimicrobial activity. An antibacterial recycle experiment revealed that no significant change occurred in the structure and antibacterial efficiency of BAMNH NPs after five recycle experiments. The combination of barbituric acid-based N-halamine with magnetic component results in an obvious synergistic effect and facilitates the repeated antibacterial applications, providing potential and ideal candidates for sterilization or even for the control of disease.

  18. Surveying Students' Conceptual and Procedural Knowledge of Acid-Base Behavior of Substances

    ERIC Educational Resources Information Center

    Furio-Mas, Carles; Calatayud, Maria-Luisa; Barcenas, Sergio L.

    2007-01-01

    By the end of their high school studies, students should be able to understand macroscopic and sub-microscopic conceptualization of acid-base behavior and the relationship between these conceptual models. The aim of this article is to ascertain whether grade-12 students have sufficient background knowledge to explain the properties of acids,…

  19. Analysis and Identification of Acid-Base Indicator Dyes by Thin-Layer Chromatography

    ERIC Educational Resources Information Center

    Clark, Daniel D.

    2007-01-01

    Thin-layer chromatography (TLC) is a very simple and effective technique that is used by chemists by different purposes, including the monitoring of the progress of a reaction. TLC can also be easily used for the analysis and identification of various acid-base indicator dyes.

  20. Isoelectric Point, Electric Charge, and Nomenclature of the Acid-Base Residues of Proteins

    ERIC Educational Resources Information Center

    Maldonado, Andres A.; Ribeiro, Joao M.; Sillero, Antonio

    2010-01-01

    The main object of this work is to present the pedagogical usefulness of the theoretical methods, developed in this laboratory, for the determination of the isoelectric point (pI) and the net electric charge of proteins together with some comments on the naming of the acid-base residues of proteins. (Contains 8 figures and 4 tables.)