Science.gov

Sample records for acid-induced epileptic seizures

  1. Increase in α-tubulin modifications in the neuronal processes of hippocampal neurons in both kainic acid-induced epileptic seizure and Alzheimer’s disease

    PubMed Central

    Vu, Hang Thi; Akatsu, Hiroyasu; Hashizume, Yoshio; Setou, Mitsutoshi; Ikegami, Koji

    2017-01-01

    Neurodegeneration includes acute changes and slow-developing alterations, both of which partly involve common cellular machinery. During neurodegeneration, neuronal processes are impaired along with dysregulated post-translational modifications (PTMs) of cytoskeletal proteins. In neuronal processes, tubulin undergoes unique PTMs including a branched form of modification called glutamylation and loss of the C-terminal tyrosine residue and the penultimate glutamic acid residue forming Δ2-tubulin. Here, we investigated the state of two PTMs, glutamylation and Δ2 form, in both acute and slow-developing neurodegenerations, using a newly generated monoclonal antibody, DTE41, which had 2-fold higher affinity to glutamylated Δ2-tubulin, than to unmodified Δ2-tubulin. DTE41 recognised glutamylated Δ2-tubulin preferentially in immunostaining than in enzyme-linked immunosorbent assay and immunoblotting. In normal mouse brain, DTE41 stained molecular layer of the cerebellum as well as synapse-rich regions in pyramidal neurons of the cerebral cortex. In kainic acid-induced epileptic seizure, DTE41-labelled signals were increased in the hippocampal CA3 region, especially in the stratum lucidum. In the hippocampi of post-mortem patients with Alzheimer’s disease, intensities of DTE41 staining were increased in mossy fibres in the CA3 region as well as in apical dendrites of the pyramidal neurons. Our findings indicate that glutamylation on Δ2-tubulin is increased in both acute and slow-developing neurodegeneration. PMID:28067280

  2. Long-Term Intake of Uncaria rhynchophylla Reduces S100B and RAGE Protein Levels in Kainic Acid-Induced Epileptic Seizures Rats

    PubMed Central

    Tang, Nou-Ying; Ho, Tin-Yun; Chen, Chao-Hsiang

    2017-01-01

    Epileptic seizures are crucial clinical manifestations of recurrent neuronal discharges in the brain. An imbalance between the excitatory and inhibitory neuronal discharges causes brain damage and cell loss. Herbal medicines offer alternative treatment options for epilepsy because of their low cost and few side effects. We established a rat epilepsy model by injecting kainic acid (KA, 12 mg/kg, i.p.) and subsequently investigated the effect of Uncaria rhynchophylla (UR) and its underlying mechanisms. Electroencephalogram and epileptic behaviors revealed that the KA injection induced epileptic seizures. Following KA injection, S100B levels increased in the hippocampus. This phenomenon was attenuated by the oral administration of UR and valproic acid (VA, 250 mg/kg). Both drugs significantly reversed receptor potentiation for advanced glycation end product proteins. Rats with KA-induced epilepsy exhibited no increase in the expression of metabotropic glutamate receptor 3, monocyte chemoattractant protein 1, and chemokine receptor type 2, which play a role in inflammation. Our results provide novel and detailed mechanisms, explaining the role of UR in KA-induced epileptic seizures in hippocampal CA1 neurons. PMID:28386293

  3. Predicting Epileptic Seizures in Advance

    PubMed Central

    Moghim, Negin; Corne, David W.

    2014-01-01

    Epilepsy is the second most common neurological disorder, affecting 0.6–0.8% of the world's population. In this neurological disorder, abnormal activity of the brain causes seizures, the nature of which tend to be sudden. Antiepileptic Drugs (AEDs) are used as long-term therapeutic solutions that control the condition. Of those treated with AEDs, 35% become resistant to medication. The unpredictable nature of seizures poses risks for the individual with epilepsy. It is clearly desirable to find more effective ways of preventing seizures for such patients. The automatic detection of oncoming seizures, before their actual onset, can facilitate timely intervention and hence minimize these risks. In addition, advance prediction of seizures can enrich our understanding of the epileptic brain. In this study, drawing on the body of work behind automatic seizure detection and prediction from digitised Invasive Electroencephalography (EEG) data, a prediction algorithm, ASPPR (Advance Seizure Prediction via Pre-ictal Relabeling), is described. ASPPR facilitates the learning of predictive models targeted at recognizing patterns in EEG activity that are in a specific time window in advance of a seizure. It then exploits advanced machine learning coupled with the design and selection of appropriate features from EEG signals. Results, from evaluating ASPPR independently on 21 different patients, suggest that seizures for many patients can be predicted up to 20 minutes in advance of their onset. Compared to benchmark performance represented by a mean S1-Score (harmonic mean of Sensitivity and Specificity) of 90.6% for predicting seizure onset between 0 and 5 minutes in advance, ASPPR achieves mean S1-Scores of: 96.30% for prediction between 1 and 6 minutes in advance, 96.13% for prediction between 8 and 13 minutes in advance, 94.5% for prediction between 14 and 19 minutes in advance, and 94.2% for prediction between 20 and 25 minutes in advance. PMID:24911316

  4. Epileptic seizure induced by fennel essential oil.

    PubMed

    Skalli, Souad; Soulaymani Bencheikh, Rachida

    2011-09-01

    An epileptic seizure is reported in a 38-year-old woman, known to be an epileptic patient. Although she was under antiepileptic treatment and had well-controlled epilepsy, she developed a typical generalised tonic-clonic seizure and remained unconscious for 45 minutes following ingestion of a number of cakes containing an unknown quantity of fennel essential oil. Involuntary diarrhoea accompanied her epileptic seizure. This reported case recalls the fact that fennel essential oil can induce seizures and that this oil should probably be avoided by patients with epilepsy. Labelling of products with fennel essential oil should refer to the risk of seizures, particularly for patients with epilepsy. An awareness programme should involve all stakeholders affected by this issue.

  5. Long-term electrical stimulation at ear and electro-acupuncture at ST36-ST37 attenuated COX-2 in the CA1 of hippocampus in kainic acid-induced epileptic seizure rats.

    PubMed

    Liao, En-Tzu; Tang, Nou-Ying; Lin, Yi-Wen; Liang Hsieh, Ching

    2017-03-28

    Seizures produce brain inflammation, which in turn enhances neuronal excitability. Therefore, anti-inflammation has become a therapeutic strategy for antiepileptic treatment. Cycloxygenase-2 (COX-2) plays a critical role in postseizure brain inflammation and neuronal hyperexcitability. Our previous studies have shown that both electrical stimulation (ES) at the ear and electro-acupuncture (EA) at the Zusanli and Shangjuxu acupoints (ST36-ST37) for 6 weeks can reduce mossy fiber sprouting, spike population, and high-frequency hippocampal oscillations in kainic acid (KA)-induced epileptic seizure rats. This study further investigated the effect of long-term ear ES and EA at ST36-ST37 on the inflammatory response in KA-induced epileptic seizure rats. Both the COX-2 levels in the hippocampus and the number of COX-2 immunoreactive cells in the hippocampal CA1 region were increased after KA-induced epileptic seizures, and these were reduced through the 6-week application of ear ES or EA at ST36-ST37. Thus, long-term ear ES or long-term EA at ST36-ST37 have an anti-inflammatory effect, suggesting that they are beneficial for the treatment of epileptic seizures.

  6. Epileptic seizure after treatment with thiocolchicoside

    PubMed Central

    Giavina-Bianchi, Pedro; Giavina-Bianchi, Mara; Tanno, Luciana Kase; Ensina, Luis Felipe Chiaverini; Motta, Antôno Abílio; Kalil, Jorge

    2009-01-01

    Background: Adverse drug reactions are important determinants of inpatient and outpatient morbidity. Thiocolchicoside is a semisynthetic derivate of naturally occurring colchicoside, which is largely used in humans as a centrally acting muscle relaxant. Epileptic seizures after thiocolchicoside intake have been reported in individuals with a history of epilepsy, acute brain injury or possible blood–brain barrier disruption. Case report: We report the case of a 66-year-old male patient presenting a sudden epileptic seizure temporally related to the intake of thiocolchicoside for muscle contracture and pain. The probably causes of the seizures were thiocolchicoside intake and cerebral microhemorrhages attributed to cerebral amyloid angiopathy. Discussion: Drugs only rarely cause focal seizures. Our case indicates that thiocolchicoside can precipitate seizures in predisposed patients, and that its use should be avoided in patients with brain diseases (and therefore lower seizure thresholds) or blood–brain barrier disruption. This information should be provided in the drug package insert. PMID:19707540

  7. Nonlinear analysis of EEG for epileptic seizures

    SciTech Connect

    Hively, L.M.; Clapp, N.E.; Daw, C.S.; Lawkins, W.F.; Eisenstadt, M.L.

    1995-04-01

    We apply chaotic time series analysis (CTSA) to human electroencephalogram (EEG) data. Three epoches were examined: epileptic seizure, non-seizure, and transition from non-seizure to seizure. The CTSA tools were applied to four forms of these data: raw EEG data (e-data), artifact data (f-data) via application of a quadratic zero-phase filter of the raw data, artifact-filtered data (g- data) and that was the residual after subtracting f-data from e-data, and a low-pass-filtered version (h-data) of g-data. Two different seizures were analyzed for the same patient. Several nonlinear measures uniquely indicate an epileptic seizure in both cases, including an abrupt decrease in the time per wave cycle in f-data, an abrupt increase in the Kolmogorov entropy and in the correlation dimension for e-h data, and an abrupt increase in the correlation dimension for e-h data. The transition from normal to seizure state also is characterized by distinctly different trends in the nonlinear measures for each seizure and may be potential seizure predictors for this patient. Surrogate analysis of e-data shows that statistically significant nonlinear structure is present during the non-seizure, transition , and seizure epoches.

  8. [Research advances in circadian rhythm of epileptic seizures].

    PubMed

    Yang, Wen-Qi; Li, Hong

    2017-01-01

    The time phase of epileptic seizures has attracted more and more attention. Epileptic seizures have their own circadian rhythm. The same type of epilepsy has different seizure frequencies in different time periods and states (such as sleeping/awakening state and natural day/night cycle). The circadian rhythm of epileptic seizures has complex molecular and endocrine mechanisms, and currently there are several hypotheses. Clarification of the circadian rhythm of epileptic seizures and prevention and administration according to such circadian rhythm can effectively control seizures and reduce the adverse effects of drugs. The research on the circadian rhythm of epileptic seizures provides a new idea for the treatment of epilepsy.

  9. Cerebrospinal fluid findings after epileptic seizures.

    PubMed

    Chatzikonstantinou, Anastasios; Ebert, Anne D; Hennerici, Michael G

    2015-12-01

    We aimed to evaluate ictally-induced CSF parameter changes after seizures in adult patients without acute inflammatory diseases or infectious diseases associated with the central nervous system. In total, 151 patients were included in the study. All patients were admitted to our department of neurology following acute seizures and received an extensive work-up including EEG, cerebral imaging, and CSF examinations. CSF protein elevation was found in most patients (92; 60.9%) and was significantly associated with older age, male sex, and generalized seizures. Abnormal CSF-to-serum glucose ratio was found in only nine patients (5.9%) and did not show any significant associations. CSF lactate was elevated in 34 patients (22.5%) and showed a significant association with focal seizures with impaired consciousness, status epilepticus, the presence of EEG abnormalities in general and epileptiform potentials in particular, as well as epileptogenic lesions on cerebral imaging. Our results indicate that non-inflammatory CSF elevation of protein and lactate after epileptic seizures is relatively common, in contrast to changes in CSF-to-serum glucose ratio, and further suggest that these changes are caused by ictal activity and are related to seizure type and intensity. We found no indication that these changes may have further-reaching pathological implications besides their postictal character.

  10. Epileptic Seizure Detection and Warning Device

    SciTech Connect

    Elarton, J.K.; Koepsel, K.L.

    1999-06-21

    Flint Hills Scientific, L.L.C. (FHS) has invented what is believed to be the first real-time epileptic seizure detection and short-term prediction method in the world. They have demonstrated an IBM PC prototype with a multi-channel EEG monitoring configuration. This CRADA effort applied AlliedSignal FM and T hardware design, manufacturing miniaturization, and high quality manufacturing expertise in converting the prototype into a small, portable, self-contained, multi-channel EEG epileptic seizure detection and warning device. The purpose of this project was to design and build a proof-of-concept miniaturized prototype of the FHS-developed PC-based prototype. The resultant DSP prototype, measuring 4'' x 6'' x 2'', seizure detection performance compared favorably with the FHS PC prototype, thus validating the DSP design goals. The very successful completion of this project provided valuable engineering information for FHS for future prototype commercialization as well as providing AS/FM and T engineers DSP design experience.

  11. Epileptic Seizures From Abnormal Networks: Why Some Seizures Defy Predictability

    PubMed Central

    Azhar, Feraz; Kudela, Pawel; Bergey, Gregory K.; Franaszczuk, Piotr J.

    2011-01-01

    Summary Seizure prediction has proven to be difficult in clinically realistic environments. Is it possible that fluctuations in cortical firing could influence the onset of seizures in an ictal zone? To test this, we have now used neural network simulations in a computational model of cortex having a total of 65,536 neurons with intercellular wiring patterned after histological data. A spatially distributed Poisson driven background input representing the activity of neighboring cortex affected 1% of the neurons. Gamma distributions were fit to the interbursting phase intervals, a non-parametric test for randomness was applied, and a dynamical systems analysis was performed to search for period-1 orbits in the intervals. The non-parametric analysis suggests that intervals are being drawn at random from their underlying joint distribution and the dynamical systems analysis is consistent with a nondeterministic dynamical interpretation of the generation of bursting phases. These results imply that in a region of cortex with abnormal connectivity analogous to a seizure focus, it is possible to initiate seizure activity with fluctuations of input from the surrounding cortical regions. These findings suggest one possibility for ictal generation from abnormal focal epileptic networks. This mechanism additionally could help explain the difficulty in predicting partial seizures in some patients. PMID:22169211

  12. Epileptic Seizure Forewarning by Nonlinear Techniques

    SciTech Connect

    Hively, LM

    2001-02-05

    Nicolet Biomedical Inc. (NBI) is collaborating with Oak Ridge National Laboratory (ORNL) under a Cooperative Research and Development Agreement (CRADA) to convert ORNL.s patented technology for forewarning of epileptic seizures to a clinical prototype. This technical report describes the highlights of the first year.s effort. The software requirements for the clinical device were specified from which the hardware specifications were obtained. ORNL's research-class FORTRAN was converted to run under a graphical user interface (GUI) that was custom-built for this application by NBI. The resulting software package was cloned to desktop computers that are being tested in five different clinical sites. Two hundred electroencephalogram (EEG) datasets from those clinical sites were provided to ORNL for detailed analysis and improvement of the forewarning methodology. Effort under this CRADA is continuing into the second year as planned.

  13. Hypnotic induction of an epileptic seizure: a brief communication.

    PubMed

    Bryant, R A; Somerville, E

    1995-07-01

    This case study investigated the utility of hypnosis to precipitate a seizure in a patient with refractory epilepsy. The patient was twice administered a hypnotic induction and a suggestion to age regress to a day when he was distressed and suffered repeated seizures. The patient did not respond to the first hypnotic suggestion; however, an epileptic seizure was observed in the second hypnotic session. Videorecording and subdural electroencephalograph recording confirmed that he suffered an epileptic seizure. Postexperimental inquiry revealed that the patient used deliberate cognitive strategies to avoid seizure onset in the first session but adopted a more constructive cognitive style in the second session. Findings are discussed in terms of emotions, hypnosis, and cognitive style as mediating factors in the experimental precipitation of epileptic seizures.

  14. Quadriplegia Following Epileptic Seizure : Things to Keep in Mind

    PubMed Central

    Yeşilbudak, Zülal; Şişman, Lokman; Uca, Ali Ulvi

    2016-01-01

    People with epilepsy are believed to be at a higher risk of incurring accidental injury than people who do not have seizures. The incidence of injury, either due to seizure or accident as a consequent of seizure is also high and varies from 0.03% to 3%. The most common injuries are head contusions, lacerations, burns and fractures. In this article, we present a case of quadriplegia after a generalized epileptic seizure. PMID:27226869

  15. A Novel Dynamic Update Framework for Epileptic Seizure Prediction

    PubMed Central

    Wang, Minghui; Hong, Xiaojun; Han, Jie

    2014-01-01

    Epileptic seizure prediction is a difficult problem in clinical applications, and it has the potential to significantly improve the patients' daily lives whose seizures cannot be controlled by either drugs or surgery. However, most current studies of epileptic seizure prediction focus on high sensitivity and low false-positive rate only and lack the flexibility for a variety of epileptic seizures and patients' physical conditions. Therefore, a novel dynamic update framework for epileptic seizure prediction is proposed in this paper. In this framework, two basic sample pools are constructed and updated dynamically. Furthermore, the prediction model can be updated to be the most appropriate one for the prediction of seizures' arrival. Mahalanobis distance is introduced in this part to solve the problem of side information, measuring the distance between two data sets. In addition, a multichannel feature extraction method based on Hilbert-Huang transform and extreme learning machine is utilized to extract the features of a patient's preseizure state against the normal state. At last, a dynamic update epileptic seizure prediction system is built up. Simulations on Freiburg database show that the proposed system has a better performance than the one without update. The research of this paper is significantly helpful for clinical applications, especially for the exploitation of online portable devices. PMID:25050381

  16. Asynchronous electrical activity in epileptic seizures

    NASA Astrophysics Data System (ADS)

    Holman, Katherine; Lim, Eugene; Gliske, Stephen; Stacey, William; Fink, Christian

    High-frequency oscillations (HFOs) have been postulated to be potential biomarkers for focal epileptic seizures, with fast ripples (>250 Hz) as the most interesting candidate. The mechanisms underlying the generation of fast ripples, however, are not well understood. In this study, we draw upon results from previous computational studies on HFOs to develop a new mathematical model from first principles describing the generation of HFOs through asynchronous neuronal firing. Asynchrony in the model is obtained with the introduction of two parameters of heterogeneity: variability in the inter-spike interval (ISI) and jitter. The model predicts the generation of harmonic narrow-band oscillations if the heterogeneity-governing parameters do not differ from the predefined ISI by more than 20%. Comparisons against results from a separately constructed computational model verify the accuracy of the model in study. These results provide us with a rigorous framework in which we may investigate the mechanisms driving the generation of abnormal HFOs, and may serve as groundwork for future research in epileptogenesis. Nsf Grant 1003992, Ohio Wesleyan University SSRP.

  17. Traumatic rupture of sternocleidomastoid muscle following an epileptic seizure.

    PubMed

    Wooles, Nicola Rachel; Bell, Philip Robert; Korda, Marian

    2014-11-19

    A 29-year-old man, a known epileptic, presented to an accident and emergency department following a tonic-clonic seizure, suffering a second seizure in the department. Subsequently, he reported neck pain, swelling and stiffness. An otorhinolaryngology neck examination revealed a tender left side with two palpable masses and a reduced range of movement. Ultrasound confirmed a ruptured middle third of the left sternocleidomastoid muscle, which was successfully treated non-surgically with analgaesia and intensive physiotherapy. Uncommonly, sternocleidomastoid muscle rupture has been reported following high-velocity trauma, but to the best of our knowledge this is the first case described in the literature following an epileptic seizure.

  18. Epileptic seizure prediction by non-linear methods

    DOEpatents

    Hively, L.M.; Clapp, N.E.; Day, C.S.; Lawkins, W.F.

    1999-01-12

    This research discloses methods and apparatus for automatically predicting epileptic seizures monitor and analyze brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis tools; obtaining time serial trends in the nonlinear measures; comparison of the trend to known seizure predictors; and providing notification that a seizure is forthcoming. 76 figs.

  19. Epileptic seizure prediction by non-linear methods

    DOEpatents

    Hively, Lee M.; Clapp, Ned E.; Daw, C. Stuart; Lawkins, William F.

    1999-01-01

    Methods and apparatus for automatically predicting epileptic seizures monitor and analyze brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis tools; obtaining time serial trends in the nonlinear measures; comparison of the trend to known seizure predictors; and providing notification that a seizure is forthcoming.

  20. A novel genetic programming approach for epileptic seizure detection.

    PubMed

    Bhardwaj, Arpit; Tiwari, Aruna; Krishna, Ramesh; Varma, Vishaal

    2016-02-01

    The human brain is a delicate mix of neurons (brain cells), electrical impulses and chemicals, known as neurotransmitters. Any damage has the potential to disrupt the workings of the brain and cause seizures. These epileptic seizures are the manifestations of epilepsy. The electroencephalograph (EEG) signals register average neuronal activity from the cerebral cortex and label changes in activity over large areas. A detailed analysis of these electroencephalograph (EEG) signals provides valuable insights into the mechanisms instigating epileptic disorders. Moreover, the detection of interictal spikes and epileptic seizures in an EEG signal plays an important role in the diagnosis of epilepsy. Automatic seizure detection methods are required, as these epileptic seizures are volatile and unpredictable. This paper deals with an automated detection of epileptic seizures in EEG signals using empirical mode decomposition (EMD) for feature extraction and proposes a novel genetic programming (GP) approach for classifying the EEG signals. Improvements in the standard GP approach are made using a Constructive Genetic Programming (CGP) in which constructive crossover and constructive subtree mutation operators are introduced. A hill climbing search is integrated in crossover and mutation operators to remove the destructive nature of these operators. A new concept of selecting the Globally Prime offspring is also presented to select the best fitness offspring generated during crossover. To decrease the time complexity of GP, a new dynamic fitness value computation (DFVC) is employed to increase the computational speed. We conducted five different sets of experiments to evaluate the performance of the proposed model in the classification of different mixtures of normal, interictal and ictal signals, and the accuracies achieved are outstandingly high. The experimental results are compared with the existing methods on same datasets, and these results affirm the potential use of

  1. Assortative mixing in functional brain networks during epileptic seizures

    NASA Astrophysics Data System (ADS)

    Bialonski, Stephan; Lehnertz, Klaus

    2013-09-01

    We investigate assortativity of functional brain networks before, during, and after one-hundred epileptic seizures with different anatomical onset locations. We construct binary functional networks from multi-channel electroencephalographic data recorded from 60 epilepsy patients; and from time-resolved estimates of the assortativity coefficient, we conclude that positive degree-degree correlations are inherent to seizure dynamics. While seizures evolve, an increasing assortativity indicates a segregation of the underlying functional network into groups of brain regions that are only sparsely interconnected, if at all. Interestingly, assortativity decreases already prior to seizure end. Together with previous observations of characteristic temporal evolutions of global statistical properties and synchronizability of epileptic brain networks, our findings may help to gain deeper insights into the complicated dynamics underlying generation, propagation, and termination of seizures.

  2. Neurogenesis in a young dog with epileptic seizures.

    PubMed

    Borschensky, C M; Woolley, J S; Kipar, A; Herden, C

    2012-09-01

    Epileptic seizures can lead to various reactions in the brain, ranging from neuronal necrosis and glial cell activation to focal structural disorganization. Furthermore, increased hippocampal neurogenesis has been documented in rodent models of acute convulsions. This is a report of hippocampal neurogenesis in a dog with spontaneous epileptic seizures. A 16-week-old epileptic German Shepherd Dog had marked neuronal cell proliferation (up to 5 mitotic figures per high-power field and increased immunohistochemical expression of proliferative cell nuclear antigen) in the dentate gyrus accompanied by microglial and astroglial activation. Some granule cells expressed doublecortin, a marker of immature neurons; mitotically active cells expressed neuronal nuclear antigen. No mitotic figures were found in the brain of age-matched control dogs. Whether increased neurogenesis represents a general reaction pattern of young epileptic dogs should be investigated.

  3. Anticipating epileptic seizures: from mathematics to clinical applications.

    PubMed

    Le Van Quyen, Michel

    2005-02-01

    The study of dynamical changes in the neural activity preceding an epileptic seizure allows the characterization of a preictal state several minutes prior to seizure onset. This opens new perspectives for studying the mechanisms of ictogenesis as well as for possible therapeutic interventions that represent a major breakthrough. In this review we present and discuss the results from our group in this domain using nonlinear analysis of brain signals, as well as its limitation and open questions.

  4. Prevention of epileptic seizures by taurine.

    PubMed

    El Idrissi, Abdeslem; Messing, Jeffrey; Scalia, Jason; Trenkner, Ekkhart

    2003-01-01

    Parenteral injection of kainic acid (KA), a glutamate receptor agonist, causes severe and stereotyped behavioral convulsions in mice and is used as a rodent model for human temporal lobe epilepsy. The goal of this study is to examine the potential anti-convulsive effects of the neuro-active amino acid taurine, in the mouse model of KA-induced limbic seizures. We found that taurine (43 mg/Kg, s.c.) had a significant antiepileptic effect when injected 10 min prior to KA. Acute injection of taurine increased the onset latency and reduced the occurrence of tonic seizures. Taurine also reduced the duration of tonic-clonic convulsions and mortality rate following KA-induced seizures. Furthermore, taurine significantly reduced neuronal cell death in the CA3 region of the hippocampus, the most susceptible region to KA in the limbic system. On the other hand, supplementation of taurine in drinking water (0.05%) for 4 continuous weeks failed to decrease the number or latency of partial or tonic-clonic seizures. To the contrary, we found that taurine-fed mice showed increased susceptibility to KA-induced seizures, as demonstrated by a decreased latency for clonic seizures, an increased incidence and duration of tonic-clonic seizures, increased neuronal death in the CA3 region of the hippocampus and a higher post-seizure mortality of the animals. We suggest that the reduced susceptibility to KA-induced seizures in taurine-injected mice is due to an increase in GABA receptor function in the brain which increases the inhibitory drive within the limbic system. This is supported by our in vitro data obtained in primary neuronal cultures showing that taurine acts as a low affinity agonist for GABA(A) receptors, protects neurons against kainate excitotoxic insults and modulates calcium homeostasis. Therefore, taurine is potentially capable of treating seizure-associated brain damage.

  5. Canine and feline epileptic seizures and the lunar cycle: 2,507 seizures (2000-2008).

    PubMed

    Browand-Stainback, Laura; Levesque, Donald; McBee, Matthew

    2011-01-01

    Epileptic seizures in 211 canine and feline patients diagnosed with idiopathic epilepsy were evaluated for temporal significance in relation to the lunar cycle. Seizure counts were compared among each of the eight individual lunar phases, among each of eight exact lunar phase dates, and by percent of lunar illumination using generalized estimating equations. No statistical significance was found in any of these comparisons excluding a relationship between the onset of epileptic seizures and the phases of the moon. Alteration in anticonvulsant treatment or monitoring of canine and feline patients with idiopathic epilepsy at large was not warranted based on the lunar cycle.

  6. Unsupervised EEG analysis for automated epileptic seizure detection

    NASA Astrophysics Data System (ADS)

    Birjandtalab, Javad; Pouyan, Maziyar Baran; Nourani, Mehrdad

    2016-07-01

    Epilepsy is a neurological disorder which can, if not controlled, potentially cause unexpected death. It is extremely crucial to have accurate automatic pattern recognition and data mining techniques to detect the onset of seizures and inform care-givers to help the patients. EEG signals are the preferred biosignals for diagnosis of epileptic patients. Most of the existing pattern recognition techniques used in EEG analysis leverage the notion of supervised machine learning algorithms. Since seizure data are heavily under-represented, such techniques are not always practical particularly when the labeled data is not sufficiently available or when disease progression is rapid and the corresponding EEG footprint pattern will not be robust. Furthermore, EEG pattern change is highly individual dependent and requires experienced specialists to annotate the seizure and non-seizure events. In this work, we present an unsupervised technique to discriminate seizures and non-seizures events. We employ power spectral density of EEG signals in different frequency bands that are informative features to accurately cluster seizure and non-seizure events. The experimental results tried so far indicate achieving more than 90% accuracy in clustering seizure and non-seizure events without having any prior knowledge on patient's history.

  7. Focal epileptic seizures mimicking sleep paralysis.

    PubMed

    Galimberti, Carlo Andrea; Ossola, Maria; Colnaghi, Silvia; Arbasino, Carla

    2009-03-01

    Sleep paralysis (SP) is a common parasomnia. The diagnostic criteria for SP, as reported in the International Classification of Sleep Disorders, are essentially clinical, as electroencephalography (EEG)-polysomnography (PSG) is not mandatory. We describe a subject whose sleep-related events fulfilled the diagnostic criteria for SP, even though her visual hallucinations were elementary, repetitive and stereotyped, thus differing from those usually reported by patients with SP. Video/EEG-PSG documented the focal epileptic nature of the SP-like episodes.

  8. The quantitative measurement of consciousness during epileptic seizures.

    PubMed

    Nani, Andrea; Cavanna, Andrea E

    2014-01-01

    The assessment of consciousness is a fundamental element in the classification of epileptic seizures. It is, therefore, of great importance for clinical practice to develop instruments that enable an accurate and reliable measurement of the alteration of consciousness during seizures. Over the last few years, three psychometric scales have been specifically proposed to measure ictal consciousness: the Ictal Consciousness Inventory (ICI), the Consciousness Seizure Scale (CSS), and the Responsiveness in Epilepsy Scale--versions I and II (RES-I and RES-II). The ICI is a self-report psychometric instrument which retrospectively assesses ictal consciousness along the dimensions of the level/arousal and contents/awareness. The CSS has been used by clinicians to quantify the impairment of consciousness in order to establish correlations with the brain mechanisms underlying alterations of consciousness during temporal lobe seizures. The most recently developed observer-rated instrument is the RES-I, which has been used to assess responsiveness during epileptic seizures in patients undergoing video-EEG. The implementation of standardized psychometric tools for the assessment of ictal consciousness can complement clinical observations and contribute to improve accuracy in seizure classification.

  9. Detecting and localizing the foci in human epileptic seizures

    NASA Astrophysics Data System (ADS)

    Ben-Jacob, Eshel; Boccaletti, Stefano; Pomyalov, Anna; Procaccia, Itamar; Towle, Vernon L.

    2007-12-01

    We consider the electrical signals recorded from a subdural array of electrodes placed on the pial surface of the brain for chronic evaluation of epileptic patients before surgical resection. A simple and computationally fast method to analyze the interictal phase synchrony between such electrodes is introduced and developed with the aim of detecting and localizing the foci of the epileptic seizures. We evaluate the method by comparing the results of surgery to the localization predicted here. We find an indication of good correspondence between the success or failure in the surgery and the agreement between our identification and the regions actually operated on.

  10. [Diagnosis and treatment of non-triggered single epileptic seizures].

    PubMed

    Martinez-Juarez, I E; Moreno, J; Ladino, L D; Castro, N; Hernandez-Vanegas, L; Burneo, J G; Hernandez-Ronquillo, L; Tellez-Zenteno, J F

    2016-08-16

    Epileptic seizures are one of the main reasons for neurological visits in an emergency department. Convulsions represent a traumatic event for the patient and the family, with significant medical and social consequences. Due to their prevalence and impact, the initial management is of vital importance. Although following the first epileptic seizure, early recurrence diminishes after establishing treatment with antiepileptic drugs, the forecast for developing epilepsy and long-term outcomes are not altered by any early intervention. Detailed questioning based on the symptoms of the convulsions, the patient's medical history and a full electroencephalogram and neuroimaging study make it possible to define the risk of recurrence of the seizure and the possible diagnosis of epilepsy. Epileptic abnormalities, the presence of old or new potentially epileptogenic brain lesions, as well as nocturnal seizures, increase the risk of recurrence. Physicians must assess each patient on an individual basis to determine the most suitable treatment, and explain the risk of not being treated versus the risk that exists if treatment with antiepileptic drugs is established.

  11. Cardiac arrhythmias during or after epileptic seizures

    PubMed Central

    van der Lende, Marije; Surges, Rainer; Sander, Josemir W; Thijs, Roland D

    2016-01-01

    Seizure-related cardiac arrhythmias are frequently reported and have been implicated as potential pathomechanisms of Sudden Unexpected Death in Epilepsy (SUDEP). We attempted to identify clinical profiles associated with various (post)ictal cardiac arrhythmias. We conducted a systematic search from the first date available to July 2013 on the combination of two terms: ‘cardiac arrhythmias’ and ‘epilepsy’. The databases searched were PubMed, Embase (OVID version), Web of Science and COCHRANE Library. We attempted to identify all case reports and case series. We identified seven distinct patterns of (post)ictal cardiac arrhythmias: ictal asystole (103 cases), postictal asystole (13 cases), ictal bradycardia (25 cases), ictal atrioventricular (AV)-conduction block (11 cases), postictal AV-conduction block (2 cases), (post)ictal atrial flutter/atrial fibrillation (14 cases) and postictal ventricular fibrillation (3 cases). Ictal asystole had a mean prevalence of 0.318% (95% CI 0.316% to 0.320%) in people with refractory epilepsy who underwent video-EEG monitoring. Ictal asystole, bradycardia and AV-conduction block were self-limiting in all but one of the cases and seen during focal dyscognitive seizures. Seizure onset was mostly temporal (91%) without consistent lateralisation. Postictal arrhythmias were mostly found following convulsive seizures and often associated with (near) SUDEP. The contrasting clinical profiles of ictal and postictal arrhythmias suggest different pathomechanisms. Postictal rather than ictal arrhythmias seem of greater importance to the pathophysiology of SUDEP. PMID:26038597

  12. Cardiac arrhythmias during or after epileptic seizures.

    PubMed

    van der Lende, Marije; Surges, Rainer; Sander, Josemir W; Thijs, Roland D

    2016-01-01

    Seizure-related cardiac arrhythmias are frequently reported and have been implicated as potential pathomechanisms of Sudden Unexpected Death in Epilepsy (SUDEP). We attempted to identify clinical profiles associated with various (post)ictal cardiac arrhythmias. We conducted a systematic search from the first date available to July 2013 on the combination of two terms: 'cardiac arrhythmias' and 'epilepsy'. The databases searched were PubMed, Embase (OVID version), Web of Science and COCHRANE Library. We attempted to identify all case reports and case series. We identified seven distinct patterns of (post)ictal cardiac arrhythmias: ictal asystole (103 cases), postictal asystole (13 cases), ictal bradycardia (25 cases), ictal atrioventricular (AV)-conduction block (11 cases), postictal AV-conduction block (2 cases), (post)ictal atrial flutter/atrial fibrillation (14 cases) and postictal ventricular fibrillation (3 cases). Ictal asystole had a mean prevalence of 0.318% (95% CI 0.316% to 0.320%) in people with refractory epilepsy who underwent video-EEG monitoring. Ictal asystole, bradycardia and AV-conduction block were self-limiting in all but one of the cases and seen during focal dyscognitive seizures. Seizure onset was mostly temporal (91%) without consistent lateralisation. Postictal arrhythmias were mostly found following convulsive seizures and often associated with (near) SUDEP. The contrasting clinical profiles of ictal and postictal arrhythmias suggest different pathomechanisms. Postictal rather than ictal arrhythmias seem of greater importance to the pathophysiology of SUDEP.

  13. Epileptic Seizure Forewarning by Nonlinear Techniques

    SciTech Connect

    Hively, L.M.

    2002-04-19

    This report describes work that was performed under a Cooperative Research and Development Agreement (CRADA) between UT-Battelle, LLC (Contractor) and a commercial participant, VIASYS Healthcare Inc. (formerly Nicolet Biomedical, Inc.). The Contractor has patented technology that forewarns of impending epileptic events via scalp electroencephalograph (EEG) data and successfully demonstrated this technology on 20 datasets from the Participant under pre-CRADA effort. This CRADA sought to bridge the gap between the Contractor's existing research-class software and a prototype medical device for subsequent commercialization by the Participant. The objectives of this CRADA were (1) development of a combination of existing computer hardware and Contractor-patented software into a clinical process for warning of impending epileptic events in human patients, and (2) validation of the epilepsy warning methodology. This work modified the ORNL research-class FORTRAN for forewarning to run under a graphical user interface (GUI). The GUI-FORTRAN software subsequently was installed on desktop computers at five epilepsy monitoring units. The forewarning prototypes have run for more than one year without any hardware or software failures. This work also reported extensive analysis of model and EEG datasets to demonstrate the usefulness of the methodology. However, the Participant recently chose to stop work on the CRADA, due to a change in business priorities. Much work remains to convert the technology into a commercial clinical or ambulatory device for patient use, as discussed in App. H.

  14. Change of seizure frequency in pregnant epileptic women.

    PubMed Central

    Schmidt, D; Canger, R; Avanzini, G; Battino, D; Cusi, C; Beck-Mannagetta, G; Koch, S; Rating, D; Janz, D

    1983-01-01

    The effect of pregnancy on seizure frequency was monitored prospectively in 136 pregnancies of 122 epileptic women. Pregnancy did not influence the seizure frequency in 68 pregnancies (50%). In 50 pregnancies (37%) the number of seizures increased during pregnancy or puerperium. The seizure frequency decreased in 18 pregnancies (13%). In 34 out of 50 pregnancies (68%) the increase was associated with non-compliance with the drug regimen or sleep deprivation. In seven out of 18 pregnancies (39%) improvement was related to correction of non-compliance or sleep deprivation during the pregestational nine months. Insufficiently low plasma concentrations of antiepileptic drugs were found in 47% of the women with uncontrolled epilepsy during pregnancy. The course of epilepsy during pregnancy is primarily influenced by non-compliance, sleep deprivation during pregnancy, and inadequate therapy before and during pregnancy. With good medical attention pregnancy itself seems to have only a minimal influence on the course of epilepsy. PMID:6411866

  15. Convulsive Syncope Induced by Ventricular Arrhythmia Masquerading as Epileptic Seizures: Case Report and Literature Review

    PubMed Central

    Sabu, John; Regeti, Kalyani; Mallappallil, Mary; Kassotis, John; Islam, Hamidul; Zafar, Shoaib; Khan, Rafay; Ibrahim, Hiyam; Kanta, Romana; Sen, Shuvendu; Yousif, Abdalla; Nai, Qiang

    2016-01-01

    It is important but difficult to distinguish convulsive syncope from epileptic seizure in many patients. We report a case of a man who presented to emergency department after several witnessed seizure-like episodes. He had a previous medical history of systolic heart failure and automated implantable converter defibrillator (AICD) in situ. The differential diagnoses raised were epileptic seizures and convulsive syncope secondary to cardiac arrhythmia. Subsequent AICD interrogation revealed ventricular tachycardia and fibrillation (v-tach/fib). Since convulsive syncope and epileptic seizure share many similar clinical features, early diagnosis is critical for choosing the appropriate management and preventing sudden cardiac death in patients with presumed epileptic seizure. PMID:27429683

  16. [Portable Epileptic Seizure Monitoring Intelligent System Based on Android System].

    PubMed

    Liang, Zhenhu; Wu, Shufeng; Yang, Chunlin; Jiang, Zhenzhou; Yu, Tao; Lu, Chengbiao; Li, Xiaoli

    2016-02-01

    The clinical electroencephalogram (EEG) monitoring systems based on personal computer system can not meet the requirements of portability and home usage. The epilepsy patients have to be monitored in hospital for an extended period of time, which imposes a heavy burden on hospitals. In the present study, we designed a portable 16-lead networked monitoring system based on the Android smart phone. The system uses some technologies including the active electrode, the WiFi wireless transmission, the multi-scale permutation entropy (MPE) algorithm, the back-propagation (BP) neural network algorithm, etc. Moreover, the software of Android mobile application can realize the processing and analysis of EEG data, the display of EEG waveform and the alarm of epileptic seizure. The system has been tested on the mobile phones with Android 2. 3 operating system or higher version and the results showed that this software ran accurately and steadily in the detection of epileptic seizure. In conclusion, this paper provides a portable and reliable solution for epileptic seizure monitoring in clinical and home applications.

  17. Preictal Dynamics of EEG Complexity in Intracranially Recorded Epileptic Seizure

    PubMed Central

    Bob, Petr; Roman, Robert; Svetlak, Miroslav; Kukleta, Miloslav; Chladek, Jan; Brazdil, Milan

    2014-01-01

    Abstract Recent findings suggest that neural complexity reflecting a number of independent processes in the brain may characterize typical changes during epileptic seizures and may enable to describe preictal dynamics. With respect to previously reported findings suggesting specific changes in neural complexity during preictal period, we have used measure of pointwise correlation dimension (PD2) as a sensitive indicator of nonstationary changes in complexity of the electroencephalogram (EEG) signal. Although this measure of complexity in epileptic patients was previously reported by Feucht et al (Applications of correlation dimension and pointwise dimension for non-linear topographical analysis of focal onset seizures. Med Biol Comput. 1999;37:208–217), it was not used to study changes in preictal dynamics. With this aim to study preictal changes of EEG complexity, we have examined signals from 11 multicontact depth (intracerebral) EEG electrodes located in 108 cortical and subcortical brain sites, and from 3 scalp EEG electrodes in a patient with intractable epilepsy, who underwent preoperative evaluation before epilepsy surgery. From those 108 EEG contacts, records related to 44 electrode contacts implanted into lesional structures and white matter were not included into the experimental analysis. The results show that in comparison to interictal period (at about 8–6 minutes before seizure onset), there was a statistically significant decrease in PD2 complexity in the preictal period at about 2 minutes before seizure onset in all 64 intracranial channels localized in various brain sites that were included into the analysis and in 3 scalp EEG channels as well. Presented results suggest that using PD2 in EEG analysis may have significant implications for research of preictal dynamics and prediction of epileptic seizures. PMID:25415671

  18. Epileptic Seizure, Postictal Hemiparesis, and Hyperleukocytosis

    PubMed Central

    Olivieri, Martin; Kurnik, Karin; Heinen, Florian; Schmid, Irene; Hoffmann, Florian; Reiter, Karl; Gerstl, Lucia

    2016-01-01

    Introduction: Acute ischemic stroke (AIS) is a rare event in infancy. Besides vasculopathy, thrombophilia, or cardiac disorders, cancer and chemotherapy are known predisposing factors for AIS. Leukemia can be associated with different abnormal coagulation parameters, but severe bleeding or thrombosis occurs rarely. Clinical Course: We report the case of a 2-year-old boy who was presented to our emergency ward after a prolonged seizure with right sided postictal hemiparesis. Cranial computed tomography scan revealed a large infarction and edema due to thrombosis of the left carotid artery, the middle cerebral artery, and the anterior cerebral artery. Laboratory workup showed 196 g/L leukocytes with 75% myeloid blast cells. Immediate exchange transfusion, hydration, and chemotherapy with cytarabine were started. During the hospital course intracranial pressure increased and the patient developed a unilateral dilated pupil unresponsive to light. Cranial computed tomography scan revealed a new infarction in the right middle cerebral artery territory. Refractory increased intracranial pressure and brain stem herniation developed, and the child died 3 days after admission to hospital. Conclusion: Seizures with postictal hemiparesis due to cerebral infarction can be a rare manifestation of acute myeloid leukemia. Leukocytosis and cancer-induced coagulopathy are main reasons for thrombosis and/or hemorrhage. High leukocyte counts need immediate interventions with hydration, careful chemotherapy, and perhaps exchange transfusion or leukapharesis. In the presence of thrombosis, anticoagulation must be discussed despite the risk of bleeding due to hyperfibrinolysis and low platelet counts. Mortality may be reduced by awareness of this rare presentation of leukemia and prompt institution of leucoreductive treatment. PMID:28229095

  19. Epileptic Seizures Induced by a Spontaneous Carotid Cavernous Fistula

    PubMed Central

    Yildirim, Erkan

    2016-01-01

    A 79-year-old woman was admitted to our emergency department with complaints of fainting and loss of consciousness three times during the past month. She was diagnosed with epilepsy and started to be treated with antiepileptic drug. Physical examination showed, in the left eye, chemosis, limited eye movements in all directions, and minimal exophthalmos as unexisting symptoms on admission developed on the sixth day. Orbital magnetic resonance imaging (MRI) and digital subtraction angiography (DSA) imaging revealed a carotid cavernous fistula (CCF). Epileptic attacks and ophthalmic findings previously present but diagnosed during our examinations were determined to ameliorate completely after performing the coil embolization. Based on literature, we present the first case with nontraumatic CCF manifesting with epileptic seizures and intermittent eye symptoms in the present report. PMID:28077946

  20. Patterns of human local cerebral glucose metabolism during epileptic seizures

    SciTech Connect

    Engel, J. Jr.; Kuhl, D.E.; Phelps, M.E.

    1982-10-01

    Ictal patterns of local cerebral metabolic rate have been studied in epileptic patients by positron computed tomography with /sup 18/F-labeled 2-fluoro-2-deoxy-D-glucose. Partial seizures were associated with activation of anatomic structures unique to each patient studied. Ictal increases and decreases in local cerebral metabolism were observed. Scans performed during generalized convulsions induced by electroshock demonstrated a diffuse ictal increase and postictal decrease in cerebral metabolism. Petit mal absences were associated with a diffuse increase in cerebral metabolic rate. The ictal fluorodeoxyglucose patterns obtained from patients do not resemble autoradiographic patterns obtained from common experimental animal models of epilepsy.

  1. Do energy drinks cause epileptic seizure and ischemic stroke?

    PubMed

    Dikici, Suber; Saritas, Ayhan; Besir, Fahri Halit; Tasci, Ahmet Hakan; Kandis, Hayati

    2013-01-01

    Energy drinks are popular among young individuals and marketed to college students, athletes, and active individuals between the ages of 21 and 35 years. We report a case that had ischemic stroke and epileptic seizure after intake of energy drink with alcohol. To the best of our knowledge, the following case is the first report of ischemic stroke after intake of energy drink. A previously healthy 37-year-old man was brought to the emergency department after a witnessed tonic-clonic seizure. According to his wife's testimony, just before loss of consciousness, the patient had been drinking 3 boxes of energy drinks (Redbull, Istanbul, Turkey, 250 mL) with vodka on an empty stomach. He did not have a history of seizures, head trauma, or family history of seizures or another disease. In cranial diffusion magnetic resonance imaging, there were hyperintense signal changes in bilateral occipital area (more pronounced in the left occipital lobe), right temporal lobe, frontal lobe, and posterior parietal lobe. All tests associated with possible etiologic causes of ischemic stroke in young patients were negative. Herein, we want to attract attention to adverse effect of energy drink usage.

  2. Chronic alcohol use and first symptomatic epileptic seizures

    PubMed Central

    Leone, M; Tonini, C; Bogliun, G; Monaco, F; Mutani, R; Bottacchi, E; Gambaro, P; Rocci, E; Tassinari, T; Cavestro, C; Beghi, E

    2002-01-01

    Objective: To establish whether chronic alcoholism and alcohol consumption are risk factors for developing a first symptomatic epileptic seizure. Methods: Multicentre case-control study of 293 patients (160 men, 133 women) with a first seizure symptomatic (either acute or remote) of head trauma, stroke, or brain tumour, matched to 444 hospital controls for centre, sex, age (±5 years), and underlying pathology. Results: The risk of first seizure in alcoholics was no higher than in non-alcoholics for men (odds ratio 1.2, 95% confidence interval 0.4 to 3.2) or women (1.5, 0.1 to 54.4). The odds ratio (both sexes) was 1.2 (0.8 to 1.7) for an average intake of absolute alcohol of 1–25 g/day, 0.9 (0.5 to 1.5) for 26–50 g/day, 1.6 (0.8 to 3.0) for 51–100 g/day, and 1.4 (0.5 to 3.5) for >100 g/day. Conclusions: We found no evidence of an association between alcohol use or alcoholism and a first symptomatic seizure. PMID:12397140

  3. What is the impact of electromagnetic waves on epileptic seizures?

    PubMed Central

    Cinar, Nilgun; Sahin, Sevki; Erdinc, Oguz O.

    2013-01-01

    Background The effects of electromagnetic waves (EMWs) on humans and their relationship with various disorders have been investigated. We aimed to investigate the effects of exposure to different frequencies of EMWs in various durations in a mouse epilepsy model induced by pentylenetetrazole (PTZ). Material/Methods A total of 180 4-week-old male mice weighing 25–30 g were used in this study. Each experimental group consisted of 10 mice. They were exposed to 900, 700, 500, 300, and 100 MHz EMWs for 20 hours, 12 hours and 2 hours. Following electromagnetic radiation exposure, 60 mg/kg of PTZ was injected intraperitoneally to all mice. Each control was also injected with PTZ without any exposure to EMW. The latency of initial seizure and most severe seizure onset were compared with controls. Results The shortest initial seizure latency was noted in the 12-hour group, followed by the 700 MHz. The mean initial seizure latencies in the 2-hour EMW exposed group was significantly shorter compared to that in the 12- and 20-hour groups. There was no significant difference between 12- and 20-hour EMW exposed groups. There was a significant difference between control and 2- and 10-hour EMW exposed groups. No statistically significant differences were noted in mean latencies of the most severe seizure latency, following 20-, 12-, and 2- hour EMW exposed groups and control groups. Conclusions Our findings suggest that acute exposure to EMW may facilitate epileptic seizures, which may be independent of EMW exposure time. This information might be important for patients with epilepsy. Further studies are needed. PMID:23676765

  4. Resetting of brain dynamics: epileptic versus psychogenic nonepileptic seizures.

    PubMed

    Krishnan, Balu; Faith, Aaron; Vlachos, Ioannis; Roth, Austin; Williams, Korwyn; Noe, Katie; Drazkowski, Joe; Tapsell, Lisa; Sirven, Joseph; Iasemidis, Leon

    2011-12-01

    We investigated the possibility of differential diagnosis of patients with epileptic seizures (ES) and patients with psychogenic nonepileptic seizures (PNES) through an advanced analysis of the dynamics of the patients' scalp EEGs. The underlying principle was the presence of resetting of brain's preictal spatiotemporal entrainment following onset of ES and the absence of resetting following PNES. Long-term (days) scalp EEGs recorded from five patients with ES and six patients with PNES were analyzed. It was found that: (1) Preictal entrainment of brain sites was reset at ES (P<0.05) in four of the five patients with ES, and not reset (P=0.28) in the fifth patient. (2) Resetting did not occur (p>0.1) in any of the six patients with PNES. These preliminary results in patients with ES are in agreement with our previous findings from intracranial EEG recordings on resetting of brain dynamics by ES and are expected to constitute the basis for the development of a reliable and supporting tool in the differential diagnosis between ES and PNES. Finally, we believe that these results shed light on the electrophysiology of PNES by showing that occurrence of PNES does not assist patients in overcoming a pathological entrainment of brain dynamics. This article is part of a Supplemental Special Issue entitled The Future of Automated Seizure Detection and Prediction.

  5. [Preditive clinical factors for epileptic seizures after ischemic stroke].

    PubMed

    Fukujima, M M; Cardeal, J O; Lima, J G

    1996-06-01

    Preditive clinical factors for epileptic seizures after ischemic stroke. Clinical features of 35 patients with ischemic stroke who developed epilepsy (Group 1) were compared with those of 35 patients with ischemic stroke without epilepsy (Group 2). The age of the patients did not differ between the groups. There were more men than women and more white than other races in both groups. Diabetes melitus, hypertension, transient ischemic attack, previous stroke, migraine, Chagas disease, cerebral embolism of cardiac origin and use of oral contraceptive did not differ between the groups. Smokers and alcohol users were more frequent in Group 1 (p < 0.05). Most patients of Group 1 presented with hemiparesis; none presented cerebellar or brainstem involvement. Perhaps strokes in smokers have some different aspects, that let them more epileptogenic than in non smokers.

  6. Evaluation of the pentylenetetrazole seizure threshold test in epileptic mice as surrogate model for drug testing against pharmacoresistant seizures.

    PubMed

    Töllner, Kathrin; Twele, Friederike; Löscher, Wolfgang

    2016-04-01

    Resistance to antiepileptic drugs (AEDs) is a major problem in epilepsy therapy, so that development of more effective AEDs is an unmet clinical need. Several rat and mouse models of epilepsy with spontaneous difficult-to-treat seizures exist, but because testing of antiseizure drug efficacy is extremely laborious in such models, they are only rarely used in the development of novel AEDs. Recently, the use of acute seizure tests in epileptic rats or mice has been proposed as a novel strategy for evaluating novel AEDs for increased antiseizure efficacy. In the present study, we compared the effects of five AEDs (valproate, phenobarbital, diazepam, lamotrigine, levetiracetam) on the pentylenetetrazole (PTZ) seizure threshold in mice that were made epileptic by pilocarpine. Experiments were started 6 weeks after a pilocarpine-induced status epilepticus. At this time, control seizure threshold was significantly lower in epileptic than in nonepileptic animals. Unexpectedly, only one AED (valproate) was less effective to increase seizure threshold in epileptic vs. nonepileptic mice, and this difference was restricted to doses of 200 and 300 mg/kg, whereas the difference disappeared at 400mg/kg. All other AEDs exerted similar seizure threshold increases in epileptic and nonepileptic mice. Thus, induction of acute seizures with PTZ in mice pretreated with pilocarpine does not provide an effective and valuable surrogate method to screen drugs for antiseizure efficacy in a model of difficult-to-treat chronic epilepsy as previously suggested from experiments with this approach in rats.

  7. Phase synchronization analysis of voltage-sensitive dye imaging during drug-induced epileptic seizures.

    NASA Astrophysics Data System (ADS)

    Takeshita, Daisuke; Tsytsarev, Vassiliy; Bahar, Sonya

    2008-03-01

    Epileptic seizures are generally held to result from excess and synchronized neural activity. However, recent studies have suggested that this is not necessarily the case. We investigate how the spatiotemporal pattern of synchronization changes during drug-induced in vivo neocortical seizures in rats. Epileptic seizures are caused by the potassium channel blocker 4-aminopyridine, which is often used in experiments to induce epileptic seizures. In our experiments, the neocortex is stained with the voltage-sensitive dye RH-1691. The intensity changes in dye fluorescence are measured by a CCD camera and are consistent with the signal from local field potential recording. We apply phase synchronization analysis to the voltage-sensitive dye signals from pairs of pixels in order to investigate the degree to which synchronization occurs, and how spatial patterns of synchrony may change, during the course of the seizure. Our preliminary results show that two distant pixels are well synchronized during a seizure event.

  8. Persistent neurological damage associated with spontaneous recurrent seizures and atypical aggressive behavior of domoic acid epileptic disease.

    PubMed

    Tiedeken, Jessica A; Ramsdell, John S

    2013-05-01

    The harmful alga Pseudo-nitzschia sp. is the cause of human amnesic shellfish poisoning and the stranding of thousands of sea lions with seizures as a hallmark symptom. A human case study and epidemiological report of hundreds of stranded sea lions found individuals presenting months after recovery with a neurological disease similar to temporal lobe epilepsy. A rat model developed to establish and better predict how epileptic disease results from domoic acid poisoning demonstrated that a single episode of status epilepticus (SE), after a latent period, leads to a progressive state of spontaneous recurrent seizure (SRS) and expression of atypical aggressive behaviors. Structural damage associated with domoic acid-induced SE is prominent in olfactory pathways. Here, we examine structural damage in seven rats that progressed to epileptic disease. Diseased animals show progressive neuronal loss in the piriform cortex and degeneration of terminal fields in these layers and the posteromedial cortical amygdaloid nucleus. Animals that display aggressive behavior had additional neuronal damage to the anterior olfactory cortex. This study provides insight into the structural basis for the progression of domoic acid epileptic disease and relates to the California sea lion, where poisoned animals progress to a disease characterized by SRS and aggressive behaviors.

  9. Epileptic seizure classification of EEG time-series using rational discrete short-time fourier transform.

    PubMed

    Samiee, Kaveh; Kovács, Petér; Gabbouj, Moncef

    2015-02-01

    A system for epileptic seizure detection in electroencephalography (EEG) is described in this paper. One of the challenges is to distinguish rhythmic discharges from nonstationary patterns occurring during seizures. The proposed approach is based on an adaptive and localized time-frequency representation of EEG signals by means of rational functions. The corresponding rational discrete short-time Fourier transform (DSTFT) is a novel feature extraction technique for epileptic EEG data. A multilayer perceptron classifier is fed by the coefficients of the rational DSTFT in order to separate seizure epochs from seizure-free epochs. The effectiveness of the proposed method is compared with several state-of-art feature extraction algorithms used in offline epileptic seizure detection. The results of the comparative evaluations show that the proposed method outperforms competing techniques in terms of classification accuracy. In addition, it provides a compact representation of EEG time-series.

  10. Medical management of epileptic seizures: challenges and solutions

    PubMed Central

    Sarma, Anand K; Khandker, Nabil; Kurczewski, Lisa; Brophy, Gretchen M

    2016-01-01

    Epilepsy is one of the most common neurologic illnesses. This condition afflicts 2.9 million adults and children in the US, leading to an economic impact amounting to $15.5 billion. Despite the significant burden epilepsy places on the population, it is not very well understood. As this understanding continues to evolve, it is important for clinicians to stay up to date with the latest advances to provide the best care for patients. In the last 20 years, the US Food and Drug Administration has approved 15 new antiepileptic drugs (AEDs), with many more currently in development. Other advances have been achieved in terms of diagnostic modalities like electroencephalography technology, treatment devices like vagal nerve and deep-brain stimulators, novel alternate routes of drug administration, and improvement in surgical techniques. Specific patient populations, such as the pregnant, elderly, those with HIV/AIDS, and those with psychiatric illness, present their own unique challenges, with AED side effects, drug interactions, and medical–psychiatric comorbidities adding to the conundrum. The purpose of this article is to review the latest literature guiding the management of acute epileptic seizures, focusing on the current challenges across different practice settings, and it discusses studies in various patient populations, including the pregnant, geriatric, those with HIV/AIDS, comatose, psychiatric, and “pseudoseizure” patients, and offers possible evidence-based solutions or the expert opinion of the authors. Also included is information on newer AEDs, routes of administration, and significant AED-related drug-interaction tables. This review has tried to address only some of these issues that any practitioner who deals with the acute management of seizures may encounter. The document also highlights the numerous avenues for new research that would help practitioners optimize epilepsy management. PMID:26966367

  11. CA3 Synaptic Silencing Attenuates Kainic Acid-Induced Seizures and Hippocampal Network Oscillations123

    PubMed Central

    Yu, Lily M. Y.; Wintzer, Marie E.

    2016-01-01

    Abstract Epilepsy is a neurological disorder defined by the presence of seizure activity, manifest both behaviorally and as abnormal activity in neuronal networks. An established model to study the disorder in rodents is the systemic injection of kainic acid, an excitatory neurotoxin that at low doses quickly induces behavioral and electrophysiological seizures. Although the CA3 region of the hippocampus has been suggested to be crucial for kainic acid-induced seizure, because of its strong expression of kainate glutamate receptors and its high degree of recurrent connectivity, the precise role of excitatory transmission in CA3 in the generation of seizure and the accompanying increase in neuronal oscillations remains largely untested. Here we use transgenic mice in which CA3 pyramidal cell synaptic transmission can be inducibly silenced in the adult to demonstrate CA3 excitatory output is required for both the generation of epileptiform oscillatory activity and the progression of behavioral seizures. PMID:27022627

  12. Epileptic seizures as condensed sleep: an analysis of network dynamics from electroencephalogram signals.

    PubMed

    Gast, Heidemarie; Müller, Markus; Rummel, Christian; Roth, Corinne; Mathis, Johannes; Schindler, Kaspar; Bassetti, Claudio L

    2014-06-01

    Both deepening sleep and evolving epileptic seizures are associated with increasing slow-wave activity. Larger-scale functional networks derived from electroencephalogram indicate that in both transitions dramatic changes of communication between brain areas occur. During seizures these changes seem to be 'condensed', because they evolve more rapidly than during deepening sleep. Here we set out to assess quantitatively functional network dynamics derived from electroencephalogram signals during seizures and normal sleep. Functional networks were derived from electroencephalogram signals from wakefulness, light and deep sleep of 12 volunteers, and from pre-seizure, seizure and post-seizure time periods of 10 patients suffering from focal onset pharmaco-resistant epilepsy. Nodes of the functional network represented electrical signals recorded by single electrodes and were linked if there was non-random cross-correlation between the two corresponding electroencephalogram signals. Network dynamics were then characterized by the evolution of global efficiency, which measures ease of information transmission. Global efficiency was compared with relative delta power. Global efficiency significantly decreased both between light and deep sleep, and between pre-seizure, seizure and post-seizure time periods. The decrease of global efficiency was due to a loss of functional links. While global efficiency decreased significantly, relative delta power increased except between the time periods wakefulness and light sleep, and pre-seizure and seizure. Our results demonstrate that both epileptic seizures and deepening sleep are characterized by dramatic fragmentation of larger-scale functional networks, and further support the similarities between sleep and seizures.

  13. Capparis ovata modulates brain oxidative toxicity and epileptic seizures in pentylentetrazol-induced epileptic rats.

    PubMed

    Nazıroğlu, Mustafa; Akay, Mehmet Berk; Çelik, Ömer; Yıldırım, Muhammed İkbal; Balcı, Erdinç; Yürekli, Vedat Ali

    2013-04-01

    It has been widely suggested that oxidative stress products play an important role in the pathophysiology of epilepsy. Capparis ovata (C. ovata) may useful treatment of epilepsy because it contains antioxidant flavonoids. The current study was designed to determine the effects of C. ovata on lipid peroxidation, antioxidant levels and electroencephalography (EEG) records in pentylentetrazol (PTZ)-induced epileptic rats. Thirty-two rats were randomly divided into four groups. First group was used as control although second group was PTZ group. Oral 100 and 200 mg/kg C. ovata were given to rats constituting the third and fourth groups for 7 days before PTZ administration. Second, third and forth groups received 60 mg/kg PTZ for induction of epilepsy. Three hours after administration of PTZ, EEG records, brain cortex and blood samples were taken all groups. The lipid peroxidation levels of the brain cortex, number of spikes and epileptiform discharges of EEG were higher in PTZ group than in control and C. ovata group whereas they were decreased by C. ovata administration. Vitamin A, vitamin C, vitamin E and β-carotene concentrations of brain cortex and latency to first spike of EEG were decreased by the PTZ administration although the brain cortex and plasma vitamin concentrations, and brain cortex and erythrocyte glutathione and glutathione peroxidase values were increased in PTZ + 100 and PTZ + 200 mg C. ovata groups. In conclusion, C. ovata administration caused protection against the PTZ-induced brain oxidative toxicity by inhibiting free radical and epileptic seizures, and supporting antioxidant redox system.

  14. [Semiological comparison of spontaneous and bemegride-induced epileptic seizures (author's transl)].

    PubMed

    Micheletti, M; Laroye, M; Coquillat, G; Micheletti, G; Kurtz, D

    1979-01-01

    The authors view an epileptic seizure as a series of symptoms which they can localize on the bases of data taken from stereoelectroencephalography literature. They reconstruct and compare the presumed organization (origin and propagation) of the discharge in 100 epileptic subjects. Both spontaneous and megimide-induced seizures are considered. The results involve 34 subjects with quite similar spontaneous and induced seizures. Comparison of the two critical modalities show that : 1) There is no variation in the chronological relationship of the symptoms. 3) There are differences in the symptomatology. These differences may be interpreted as non-uniform response of involved structures to the source of activation, or as involvement of new structures.

  15. Complex phase synchronization in epileptic seizures: Evidence for a devil's staircase

    NASA Astrophysics Data System (ADS)

    Perez Velazquez, J. L.; Garcia Dominguez, L.; Wennberg, R.

    2007-01-01

    We describe multifrequency phase synchronization in epileptic seizures. Using magnetoencephalographic recordings from three patients suffering generalized seizures, the evidence is presented that, in addition to the commonly studied 1:1 frequency locking, there exists complex multifrequency coordination that, in some cases, follows a classical “devil’s staircase.” Within the limitations of observing this phenomenon in a clinical experimental setting, these observations reveal that in pathological brain activity, complex frequency locking can be found similar to that identified in certain pathological cardiac re-entrant arrhythmias. This may suggest the existence of similar re-entrant mechanisms active in cerebral neocortex during epileptic seizures.

  16. Apparatus and method for epileptic seizure detection using non-linear techniques

    DOEpatents

    Hively, L.M.; Clapp, N.E.; Daw, C.S.; Lawkins, W.F.

    1998-04-28

    Methods and apparatus are disclosed for automatically detecting epileptic seizures by monitoring and analyzing brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis; obtaining time serial trends in the nonlinear measures; determining that one or more trends in the nonlinear measures indicate a seizure, and providing notification of seizure occurrence. 76 figs.

  17. Apparatus and method for epileptic seizure detection using non-linear techniques

    DOEpatents

    Hively, Lee M.; Clapp, Ned E.; Daw, C. Stuart; Lawkins, William F.

    1998-01-01

    Methods and apparatus for automatically detecting epileptic seizures by monitoring and analyzing brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis; obtaining time serial trends in the nonlinear measures; determining that one or more trends in the nonlinear measures indicate a seizure, and providing notification of seizure occurrence.

  18. Protective effect of hispidulin on kainic acid-induced seizures and neurotoxicity in rats.

    PubMed

    Lin, Tzu Yu; Lu, Cheng Wei; Wang, Su Jane; Huang, Shu Kuei

    2015-05-15

    Hispidulin is a flavonoid compound which is an active ingredient in a number of traditional Chinese medicinal herbs, and it has been reported to inhibit glutamate release. The purpose of this study was to investigate whether hispidulin protects against seizures induced by kainic acid, a glutamate analog with excitotoxic properties. The results indicated that intraperitoneally administering hispidulin (10 or 50mg/kg) to rats 30 min before intraperitoneally injecting kainic acid (15 mg/kg) increased seizure latency and decreased seizure score. In addition, hispidulin substantially attenuated kainic acid-induced hippocampal neuronal cell death, and this protective effect was accompanied by the suppression of microglial activation and the production of proinflammatory cytokines such as interleukin-1β, interleukin-6, and tumor necrosis factor-α in the hippocampus. Moreover, hispidulin reduced kainic acid-induced c-Fos expression and the activation of mitogen-activated protein kinases in the hippocampus. These data suggest that hispidulin has considerable antiepileptic, neuroprotective, and antiinflammatory effects on kainic acid-induced seizures in rats.

  19. Neural networks with periodogram and autoregressive spectral analysis methods in detection of epileptic seizure.

    PubMed

    Kiymik, M Kemal; Subasi, Abdulhamit; Ozcalik, H Riza

    2004-12-01

    Approximately 1% of the people in the world suffer from epilepsy. Careful analyses of the electroencephalograph (EEG) records can provide valuable insight and improved understanding of the mechanisms causing epileptic disorders. Predicting the onset of epileptic seizure is an important and difficult biomedical problem, which has attracted substantial attention of the intelligent computing community over the past two decades. The purpose of this work was to investigate the performance of the periodogram and autoregressive (AR) power spectrum methods to extract classifiable features from human electroencephalogram (EEG) by using artificial neural networks (ANN). The feedforward ANN system was trained and tested with the backpropagation algorithm using a large data set of exemplars. We present a method for the automatic comparison of epileptic seizures in EEG, allowing the grouping of seizures having similar overall patterns. Each channel of the EEG is first broken down into segments having relatively stationary characteristics. Features are then calculated for each segment, and all segments of all channels of the seizures of a patient are grouped into clusters of similar morphology. This clustering allows labeling of every EEG segment. Examples from 5 patients with scalp electrodes illustrate the ability of the method to group seizures of similar morphology. It was observed that ANN classification of EEG signals with AR preprocessing gives better results, and these results can also be used for the deduction of epileptic seizure.

  20. Fractal spectral analysis of pre-epileptic seizures in terms of criticality

    NASA Astrophysics Data System (ADS)

    Li, Xiaoli; Polygiannakis, J.; Kapiris, P.; Peratzakis, A.; Eftaxias, K.; Yao, X.

    2005-06-01

    The analysis of pre-epileptic seizure through EEG (electroencephalography) is an important issue for epilepsy diagnosis. Currently, there exist some methods derived from the dynamics to analyse the pre-epileptic EEG data. It is still necessary to create a novel method to better fit and explain the EEG data for making sense of the seizures' predictability. In this paper, a fractal wavelet-based spectral method is proposed and applied to analyse EEG recordings from rat experiments. Three types of patterns are found from the 12 experiments; moreover three typical cases corresponding to the three types of seizures are sorted out and analysed in detail by using the new method. The results indicate that this method can reveal the characteristic signs of an approaching seizure, which includes the emergence of long-range correlation, the decrease of anti-persistence behaviour with time and the decrease of the fractal dimension. The pre-seizure features and their implications are further discussed in the framework of the theory of criticality. We suggest that an epileptic seizure could be considered as a generalized kind of 'critical phenomenon', culminating in a large event that is analogous to a kind of 'critical point'. We also emphasize that epileptic event emergence is a non-repetitive process, so the critical interpretation meets a certain number of cases.

  1. Wavelet-based texture analysis of EEG signal for prediction of epileptic seizure

    NASA Astrophysics Data System (ADS)

    Petrosian, Arthur A.; Homan, Richard; Pemmaraju, Suryalakshmi; Mitra, Sunanda

    1995-09-01

    Electroencephalographic (EEG) signal texture content analysis has been proposed for early warning of an epileptic seizure. This approach was evaluated by investigating the interrelationship between texture features and basic signal informational characteristics, such as Kolmogorov complexity and fractal dimension. The comparison of several traditional techniques, including higher-order FIR digital filtering, chaos, autoregressive and FFT time- frequency analysis was also carried out on the same epileptic EEG recording. The purpose of this study is to investigate whether wavelet transform can be used to further enhance the developed methods for prediction of epileptic seizures. The combined consideration of texture and entropy characteristics extracted from subsignals decomposed by wavelet transform are explored for that purpose. Yet, the novel neuro-fuzzy clustering algorithm is performed on wavelet coefficients to segment given EEG recording into different stages prior to an actual seizure onset.

  2. Rapidly Learned Identification of Epileptic Seizures from Sonified EEG

    PubMed Central

    Loui, Psyche; Koplin-Green, Matan; Frick, Mark; Massone, Michael

    2014-01-01

    Sonification refers to a process by which data are converted into sound, providing an auditory alternative to visual display. Currently, the prevalent method for diagnosing seizures in epilepsy is by visually reading a patient’s electroencephalogram (EEG). However, sonification of the EEG data provides certain advantages due to the nature of human auditory perception. We hypothesized that human listeners will be able to identify seizures from EEGs using the auditory modality alone, and that accuracy of seizure identification will increase after a short training session. Here, we describe an algorithm that we have used to sonify EEGs of both seizure and non-seizure activity, followed by a training study in which subjects listened to short clips of sonified EEGs and determined whether each clip was of seizure or normal activity, both before and after a short training session. Results show that before training subjects performed at chance level in differentiating seizures from non-seizures, but there was a significant improvement of accuracy after the training session. After training, subjects successfully distinguished seizures from non-seizures using the auditory modality alone. Further analyses using signal detection theory demonstrated improvement in sensitivity and reduction in response bias as a result of training. This study demonstrates the potential of sonified EEGs to be used for the detection of seizures. Future studies will attempt to increase accuracy using novel training and sonification modifications, with the goals of managing, predicting, and ultimately controlling seizures using sonification as a possible biofeedback-based intervention for epilepsy. PMID:25352802

  3. Multi-Biosignal Analysis for Epileptic Seizure Monitoring.

    PubMed

    Cogan, Diana; Birjandtalab, Javad; Nourani, Mehrdad; Harvey, Jay; Nagaraddi, Venkatesh

    2017-02-01

    Persons who suffer from intractable seizures are safer if attended when seizures strike. Consequently, there is a need for wearable devices capable of detecting both convulsive and nonconvulsive seizures in everyday life. We have developed a three-stage seizure detection methodology based on 339 h of data (26 seizures) collected from 10 patients in an epilepsy monitoring unit. Our intent is to develop a wearable system that will detect seizures, alert a caregiver and record the time of seizure in an electronic diary for the patient's physician. Stage I looks for concurrent activity in heart rate, arterial oxygenation and electrodermal activity, all of which can be monitored by a wrist-worn device and which in combination produce a very low false positive rate. Stage II looks for a specific pattern created by these three biosignals. For the patients whose seizures cannot be detected by Stage II, Stage III detects seizures using limited-channel electroencephalogram (EEG) monitoring with at most three electrodes. Out of 10 patients, Stage I recognized all 11 seizures from seven patients, Stage II detected all 10 seizures from six patients and Stage III detected all of the seizures of two out of the three patients it analyzed.

  4. PRRT2 Mutations Are Related to Febrile Seizures in Epileptic Patients

    PubMed Central

    He, Zheng-Wen; Qu, Jian; Zhang, Ying; Mao, Chen-Xue; Wang, Zhi-Bin; Mao, Xiao-Yuan; Deng, Zhi-Yong; Zhou, Bo-Ting; Yin, Ji-Ye; Long, Hong-Yu; Xiao, Bo; Zhang, Yu; Zhou, Hong-Hao; Liu, Zhao-Qian

    2014-01-01

    Previous studies reported that the proline-rich transmembrane protein 2 (PRRT2) gene was identified to be related to paroxysmal kinesigenic dyskinesia (PKD), infantile convulsions with PKD, PKD with migraine and benign familial infantile epilepsy (BFIE). The present study explores whether the PRRT2 mutation is a potential cause of febrile seizures, including febrile seizures plus (FS+), generalized epilepsy with febrile seizures plus (GEFS+) and Dravet syndrome (DS); thus, it may provide a new drug target for personalized medicine for febrile seizure patients. We screened PRRT2 exons in a cohort of 136 epileptic patients with febrile seizures, including FS+, GEFS+ and DS. PRRT2 genetic mutations were identified in 25 out of 136 (18.4%) febrile seizures in epileptic patients. Five loss-of-function and coding missense mutations were identified: c.649delC (p.R217Efs*12), c.649_650insC (p.R217Pfs*8), c.412C>G (p.Pro138Ala), c.439G>C (p.Asp147His) and c.623C>A (p.Ser208Tyr). PRRT2 variants were probably involved in the etiology of febrile seizures in epileptic patients. PMID:25522171

  5. Emperor Napoleon Bonaparte: did he have seizures? Psychogenic or epileptic or both?

    PubMed

    Hughes, John R

    2003-12-01

    Napoleon Bonaparte was a general in the French army at 24 years of age, later conquering most of Europe. He was one of the greatest military geniuses the world has ever known, but also an extremely intelligent individual. Did he have seizures? The evidence shows that he had both psychogenic and epileptic attacks. The psychogenic attacks were likely related to the tremendous stress in his life, and the epileptic seizures were the result of chronic uremia from a severe urethral stricture caused by gonorrhea that was transmitted from his wife, Empress Josephine.

  6. Epileptic seizure in a patient with an implantable cardioverter-defibrillator: Quo vadis right ventricular lead?

    PubMed

    Wedekind, Horst; Rozhnev, Andrey; Kleine-Katthöfer, Peter; Kranig, Wolfgang

    2016-03-01

    The case of a 77-year-old man admitted for suspected epileptic seizure is reported. Patient history showed implantation of a single-chamber implantable cardioverter-defibrillator (ICD) after cardiac arrest in 2007 with replacement in 2012 due to battery depletion; the patient reported no previous syncope, unconsciousness or seizures. Interrogation records of the ICD showed five ventricular tachyarrhythmia episodes that corresponded to the "seizure". Further examination revealed incorrect position of the RV-lead. Diagnosis was a provoked epileptic seizure due to undersensing of ventricular tachycardia because of improper ICD lead implantation in the coronary sinus. Treatment consisted of implantation of a new device with an additional ICD lead into the right ventricle.

  7. Wavelet-based analysis of electroencephalogram (EEG) signals for detection and localization of epileptic seizures

    NASA Astrophysics Data System (ADS)

    Benke, George; Bozek-Kuzmicki, Maribeth; Colella, David; Jacyna, Garry M.; Benedetto, John J.

    1995-04-01

    A wavelet-based technique WISP is used to discriminate normal brain activity from brain activity during epileptic seizures. The WISP technique is used to exploit the noted difference in frequency content during the normal brain state and the seizure brain state so that detection and localization decisions can be made. An AR-Pole statistic technique is used as a comparative measure to base-line the WISP performance.

  8. Surface acoustic wave probe implant for predicting epileptic seizures

    DOEpatents

    Gopalsami, Nachappa [Naperville, IL; Kulikov, Stanislav [Sarov, RU; Osorio, Ivan [Leawood, KS; Raptis, Apostolos C [Downers Grove, IL

    2012-04-24

    A system and method for predicting and avoiding a seizure in a patient. The system and method includes use of an implanted surface acoustic wave probe and coupled RF antenna to monitor temperature of the patient's brain, critical changes in the temperature characteristic of a precursor to the seizure. The system can activate an implanted cooling unit which can avoid or minimize a seizure in the patient.

  9. Involvement of Thalamus in Initiation of Epileptic Seizures Induced by Pilocarpine in Mice

    PubMed Central

    Li, Yong-Hua; Li, Jia-Jia; Lu, Qin-Chi; Gong, Hai-Qing; Liang, Pei-Ji

    2014-01-01

    Studies have suggested that thalamus is involved in temporal lobe epilepsy, but the role of thalamus is still unclear. We obtained local filed potentials (LFPs) and single-unit activities from CA1 of hippocampus and parafascicular nucleus of thalamus during the development of epileptic seizures induced by pilocarpine in mice. Two measures, redundancy and directionality index, were used to analyze the electrophysiological characters of neuronal activities and the information flow between thalamus and hippocampus. We found that LFPs became more regular during the seizure in both hippocampus and thalamus, and in some cases LFPs showed a transient disorder at seizure onset. The variation tendency of the peak values of cross-correlation function between neurons matched the variation tendency of the redundancy of LFPs. The information tended to flow from thalamus to hippocampus during seizure initiation period no matter what the information flow direction was before the seizure. In some cases the information flow was symmetrically bidirectional, but none was found in which the information flowed from hippocampus to thalamus during the seizure initiation period. In addition, inactivation of thalamus by tetrodotoxin (TTX) resulted in a suppression of seizures. These results suggest that thalamus may play an important role in the initiation of epileptic seizures. PMID:24778885

  10. Epileptic Seizure Prediction Using a New Similarity Index for Chaotic Signals

    NASA Astrophysics Data System (ADS)

    Niknazar, Hamid; Nasrabadi, Ali Motie

    Epileptic seizures are generated by abnormal activity of neurons. The prediction of epileptic seizures is an important issue in the field of neurology, since it may improve the quality of life of patients suffering from drug resistant epilepsy. In this study a new similarity index based on symbolic dynamic techniques which can be used for extracting behavior of chaotic time series is presented. Using Freiburg EEG dataset, it is found that the method is able to detect the behavioral changes of the neural activity prior to epileptic seizures, so it can be used for prediction of epileptic seizure. A sensitivity of 63.75% with 0.33 false positive rate (FPR) in all 21 patients and sensitivity of 96.66% with 0.33 FPR in eight patients were achieved using the proposed method. Moreover, the method was evaluated by applying on Logistic and Tent map with different parameters to demonstrate its robustness and ability in determining similarity between two time series with the same chaotic characterization.

  11. Seizure-Related Regulation of GABAA Receptors in Spontaneously Epileptic Rats

    PubMed Central

    González, Marco I.; Grabenstatter, Heidi L.; del Rio, Christian Cea; Del Angel, Yasmin Cruz; Carlsen, Jessica; Laoprasert, Rick; White, Andrew M.; Huntsman, Molly M.; Brooks-Kayal, Amy

    2015-01-01

    In this study, we analyzed the impact that spontaneous seizures might have on the plasma membrane expression, composition and function of GABAA receptors (GABAARs). For this, tissue of chronically epileptic rats was collected within 3 hours of seizure occurrence (≤3 hours group) or at least 24 hours after seizure occurrence (≥24 hours group). A retrospective analysis of seizure frequency revealed that selecting animals on the bases of seizure proximity also grouped animals in terms of overall seizure burden with a higher seizure burden observed in the ≤3 hours group. A biochemical analysis showed that although animals with more frequent/recent seizures (≤3 hours group) had similar levels of GABAAR at the plasma membrane they showed deficits in inhibitory neurotransmission. In contrast, tissue obtained from animals experiencing infrequent seizures (≥24 hours group) had increased plasma membrane levels of GABAAR and showed no deficit in inhibitory function. Together, our findings offer an initial insight into the molecular changes that might help to explain how alterations in GABAAR function can be associated with differential seizure burden. Our findings also suggest that increased plasma membrane levels of GABAAR might act as a compensatory mechanism to more effectively maintain inhibitory function, repress hyperexcitability and reduce seizure burden. This study is an initial step towards a fuller characterization of the molecular events that trigger alterations in GABAergic neurotransmission during chronic epilepsy. PMID:25769812

  12. Levetiracetam in the Treatment of Epileptic Seizures After Liver Transplantation.

    PubMed

    Lin, Chih-Hsiang; Chen, Chao-Long; Lin, Tsu-Kung; Chen, Nai-Ching; Tsai, Meng-Han; Chuang, Yao-Chung

    2015-09-01

    After liver transplantation, patients may develop seizures or epilepsy due to a variety of etiologies. The ideal antiepileptic drugs for these patients are those with fewer drug interactions and less hepatic toxicity. In this study, we present patients using levetiracetam to control seizures after liver transplantation. We retrospectively enrolled patients who received levetiracetam for seizure control after liver transplantation. We analyzed the etiology of liver failure that required liver transplantation, etiology of the seizures, outcomes of seizure control, and the condition of the patient after follow-up at the outpatient department. Hematological and biochemical data before and after the use of levetiracetam were also collected. Fifteen patients who received intravenous or oral levetiracetam monotherapy for seizure control after liver transplantation were enrolled into this study. All of the patients remained seizure-free during levetiracetam treatment. Two patients died during the follow-up, and the other 13 patients were alive at the end of the study period and all were seizure-free without neurological sequelae that interfered with their daily activities. No patients experienced liver failure or rejection of the donor liver due to ineffective immunosuppressant medications. The dosage of immunosuppressants did not change before and after levetiracetam treatment, and there were no changes in hematological and biochemical data before and after treatment. Levetiracetam may be a suitable antiepileptic drug for patients who undergo liver transplantation due to fewer drug interactions and a favorable safety profile.

  13. Neuroethological approach to frontolimbic epileptic seizures and parasomnias: The same central pattern generators for the same behaviours.

    PubMed

    Tassinari, C A; Cantalupo, G; Högl, B; Cortelli, P; Tassi, L; Francione, S; Nobili, L; Meletti, S; Rubboli, G; Gardella, E

    2009-10-01

    The aim of this report is not to make a differential diagnosis between epileptic nocturnal seizures and non-epileptic sleep-related movement disorders, or parasomnias. On the contrary, our goal is to emphasize the commonly shared semiological features of some epileptic seizures and parasomnias. Such similar features might be explained by the activation of the same neuronal networks (so-called 'central pattern generators' or CPG). These produce the stereotypical rhythmic motor sequences - in other words, behaviours - that are adaptive and species-specific (such as eating/alimentary, attractive/aversive, locomotor and nesting habits). CPG are located at the subcortical level (mainly in the brain stem and spinal cord) and, in humans, are under the control of the phylogenetically more recent neomammalian neocortical structures, according to a simplified Jacksonian model. Based on video-polygraphic recordings of sleep-related epileptic seizures and non-epileptic events (parasomnias), we have documented how a transient "neomammalian brain" dysfunction - whether epileptic or not - can 'release' (disinhibition?) the CPG responsible for involuntary motor behaviours. Thus, in both epileptic seizures and parasomnias, we can observe: (a) oroalimentary automatisms, bruxism and biting; (b) ambulatory behaviours, ranging from the classical bimanual-bipedal activity of 'frontal' hypermotor seizures, epileptic and non-epileptic wanderings, and somnambulism to periodic leg movements (PLM), alternating leg muscle activation (ALMA) and restless legs syndrome (RLS); and (c) various sleep-related events such as ictal fear, sleep terrors, nightmares and violent behaviour.

  14. Automatic epileptic seizure detection in EEGs based on line length feature and artificial neural networks.

    PubMed

    Guo, Ling; Rivero, Daniel; Dorado, Julián; Rabuñal, Juan R; Pazos, Alejandro

    2010-08-15

    About 1% of the people in the world suffer from epilepsy. The main characteristic of epilepsy is the recurrent seizures. Careful analysis of the electroencephalogram (EEG) recordings can provide valuable information for understanding the mechanisms behind epileptic disorders. Since epileptic seizures occur irregularly and unpredictably, automatic seizure detection in EEG recordings is highly required. Wavelet transform (WT) is an effective analysis tool for non-stationary signals, such as EEGs. The line length feature reflects the waveform dimensionality changes and is a measure sensitive to variation of the signal amplitude and frequency. This paper presents a novel method for automatic epileptic seizure detection, which uses line length features based on wavelet transform multiresolution decomposition and combines with an artificial neural network (ANN) to classify the EEG signals regarding the existence of seizure or not. To the knowledge of the authors, there exists no similar work in the literature. A famous public dataset was used to evaluate the proposed method. The high accuracy obtained for three different classification problems testified the great success of the method.

  15. Early presentation of de novo high grade glioma with epileptic seizures: electroclinical and neuroimaging findings.

    PubMed

    Rossi, Rosario; Figus, Andrea; Corraine, Simona

    2010-10-01

    We report the clinical, EEG and neuroradiologic findings from three adult patients who developed new-onset seizure disorders as early clinical manifestations of de novo high grade glioma. The malignancies could not be recognised at the time of the first epileptic seizure because of minimal non-specific brain abnormalities, which showed no signs of necrosis or significant contrast enhancement on computed tomography and magnetic resonance imaging. Focal EEG abnormalities were recorded in all cases and appeared consistent with the neuroradiologic findings. The patients regained normal neurological status after the first seizure but rapidly developed space-occupying necrotic lesions. Two patients underwent surgery and received histological diagnoses of the tumours. Another patient was finally diagnosed with a malignant glioma based on the neuroradiologic picture and rapid progression of the cerebral lesion. It should be noted that in adult patients, new-onset epileptic seizures might reveal the presence of malignant gliomas at a very early stage in the tumour formation process. This report indicates that typical anatomoradiologic features of de novo high grade glioma, such as necrosis and rim-contrast enhancement, could be absent at the time of the first epileptic seizure but become clear within a short period after clinical presentation.

  16. Seizure, Fit or Attack? The Use of Diagnostic Labels by Patients with Epileptic or Non-Epileptic Seizures

    ERIC Educational Resources Information Center

    Plug, Leendert; Sharrack, Basil; Reuber, Markus

    2010-01-01

    We present an analysis of the use of diagnostic labels such as "seizure", "attack", "fit", and "blackout" by patients who experience seizures. While previous research on patients' preferences for diagnostic terminology has relied on questionnaires, we assess patients' own preferences and their responses to a doctor's use of different labels…

  17. Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure.

    PubMed

    Xi, Zhiqin; Deng, Wanni; Wang, Liang; Xiao, Fei; Li, Jie; Wang, Zhihua; Wang, Xin; Mi, Xiujuan; Wang, Na; Wang, Xuefeng

    2015-11-01

    Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6 h to 3 days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.

  18. Alterations of endocannabinoids in cerebrospinal fluid of dogs with epileptic seizure disorder

    PubMed Central

    2013-01-01

    Background Epilepsy is one of the most common chronic neurological disorders in dogs characterized by recurrent seizures. The endocannabinoid (EC) system plays a central role in suppressing pathologic neuronal excitability and in controlling the spread of activity in an epileptic network. Endocannabinoids are released on demand and their dysregulation has been described in several pathological conditions. Recurrent seizures may lead to an adverse reorganization of the EC system and impairment of its protective effect. In the current study, we tested the hypothesis that cerebrospinal fluid (CSF) concentrations of the endocannabinoids anandamide (AEA) and 2-arachidonoyl glycerol (2AG) are altered in epileptic dogs. Concentrations of AEA and total AG (sum of 2AG and 1AG) were measured in 40 dogs with idiopathic epilepsy and in 16 unaffected, healthy control dogs using liquid chromatography combined with tandem mass spectrometry. Results AEA and total AG were measured at 4.94 (3.18 – 9.17) pM and 1.43 (0.90 – 1.92) nM in epileptic dogs and at 3.19 (2.04 – 4.28) pM and 1.76 (1.08 – 2.69) nM in the control group, respectively (median, 25 – 75% percentiles in brackets). The AEA difference between epileptic and healthy dogs was statistically significant (p < 0.05). Values correlated with seizure severity and duration of seizure activity. Dogs with cluster seizures and/or status epilepticus and with seizure activity for more than six months displayed the highest EC concentrations. Conclusion In conclusion, we present the first endocannabinoid measurements in canine CSF and confirm the hypothesis that the EC system is altered in canine idiopathic epilepsy. PMID:24370333

  19. High performance seizure-monitoring system using a vibration sensor and videotape recording: behavioral analysis of genetically epileptic rats.

    PubMed

    Amano, S; Yokoyama, M; Torii, R; Fukuoka, J; Tanaka, K; Ihara, N; Hazama, F

    1997-06-01

    A new seizure-monitoring apparatus containing a piezoceramic vibration sensor combined with videotape recording was developed. Behavioral analysis of Ihara's genetically epileptic rat (IGER), which is a recently developed novel mutant with spontaneously limbic-like seizures, was performed using this new device. Twenty 8-month-old male IGERs were monitored continuously for 72 h. Abnormal behaviors were detected by use of a vibration recorder, and epileptic seizures were confirmed by videotape recordings taken synchronously with vibration recording. Representative forms of seizures were generalized convulsions and circling seizures. Generalized convulsions were found in 13 rats, and circling seizures in 7 of 20 animals. Two rats had generalized and circling seizures, and two rats did not have seizures. Although there was no apparent circadian rhythm to the generalized seizures, circling seizures occurred mostly between 1800 and 0800 h. A correlation between the sleep-wake cycle and the occurrence of circling seizures seems likely. Without exception, all the seizure actions were recorded by the vibration recorder and the videotape recorder. To eliminate the risk of a false-negative result, investigators scrutinized the information obtained from the vibration sensor and the videotape recorder. The newly developed seizure-monitoring system was found to facilitate detailed analysis of epileptic seizures in rats.

  20. Oxidative Stress Measurement and Prediction of Epileptic Seizure in Children and Adults With Severe Motor and Intellectual Disabilities

    PubMed Central

    Morimoto, Masahito; Satomura, Shigeko; Hashimoto, Toshiaki; Ito, Etsuro; Kyotani, Shojiro

    2016-01-01

    Background The medical care of severe motor and intellectual disabilities (SMID) depends on the empirical medical care. Epileptic seizure specific to SMID is difficult to suppress using anti-epileptic drugs, and its tendency to persist for long periods poses an issue. The present study was undertaken to evaluate the relationship between epileptic seizure in cases with SMID and oxidative stress in the living body by examining endogenous antioxidants, the degree of oxidation (reactive oxygen metabolites (d-ROMs)), and the biological antioxidant potential (BAP) as indicators. Methods Target patients were 43 SMID epilepsy patients. Blood was sampled before breakfast and medication. As for the specimen, d-ROMs and BAP were measured using the free radical analyzer. Results The present study did not reveal any correlation between endogenous antioxidants (albumin) and the frequency of epileptic seizures. On the other hand, d-ROMs were correlated with the frequency of epileptic seizure. In particular, strong correlations between the frequency of epileptic seizures and the d-ROMs/BAP ratio as well as the BAP/d-ROMs ratio were noted. Conclusions These results indicate that the use of d-ROMs and BAP as biomarkers can provide a tool for predicting the prognosis of epileptic seizures in patients with SMID. PMID:27222671

  1. Gaussian mixture model for the identification of psychogenic non-epileptic seizures using a wearable accelerometer sensor.

    PubMed

    Kusmakar, Shitanshu; Muthuganapathy, Ramanathan; Yan, Bernard; O'Brien, Terence J; Palaniswami, Marimuthu

    2016-08-01

    Any abnormal hypersynchronus activity of neurons can be characterized as an epileptic seizure (ES). A broad class of non-epileptic seizures is comprised of Psychogenic non-epileptic seizures (PNES). PNES are paroxysmal events, which mimics epileptic seizures and pose a diagnostic challenge with epileptic seizures due to their clinical similarities. The diagnosis of PNES is done using video-electroencephalography (VEM) monitoring. VEM being a resource intensive process calls for alternative methods for detection of PNES. There is now an emerging interest in the use of accelerometer based devices for the detection of seizures. In this work, we present an algorithm based on Gaussian mixture model (GMM's) for the identification of PNES, ES and normal movements using a wrist-worn accelerometer device. Features in time, frequency and wavelet domain are extracted from the norm of accelerometry signal. All events are then classified into three classes i.e normal, PNES and ES using a parametric estimate of the multivariate normal probability density function. An algorithm based on GMM's allows us to accurately model the non-epileptic and epileptic movements, thus enhancing the overall predictive accuracy of the system. The new algorithm was tested on data collected from 16 patients and showed an overall detection accuracy of 91% with 25 false alarms.

  2. Measure profile surrogates: A method to validate the performance of epileptic seizure prediction algorithms

    NASA Astrophysics Data System (ADS)

    Kreuz, Thomas; Andrzejak, Ralph G.; Mormann, Florian; Kraskov, Alexander; Stögbauer, Harald; Elger, Christian E.; Lehnertz, Klaus; Grassberger, Peter

    2004-06-01

    In a growing number of publications it is claimed that epileptic seizures can be predicted by analyzing the electroencephalogram (EEG) with different characterizing measures. However, many of these studies suffer from a severe lack of statistical validation. Only rarely are results passed to a statistical test and verified against some null hypothesis H0 in order to quantify their significance. In this paper we propose a method to statistically validate the performance of measures used to predict epileptic seizures. From measure profiles rendered by applying a moving-window technique to the electroencephalogram we first generate an ensemble of surrogates by a constrained randomization using simulated annealing. Subsequently the seizure prediction algorithm is applied to the original measure profile and to the surrogates. If detectable changes before seizure onset exist, highest performance values should be obtained for the original measure profiles and the null hypothesis. “The measure is not suited for seizure prediction” can be rejected. We demonstrate our method by applying two measures of synchronization to a quasicontinuous EEG recording and by evaluating their predictive performance using a straightforward seizure prediction statistics. We would like to stress that the proposed method is rather universal and can be applied to many other prediction and detection problems.

  3. Epileptic seizure classifications of single-channel scalp EEG data using wavelet-based features and SVM.

    PubMed

    Janjarasjitt, Suparerk

    2017-02-13

    In this study, wavelet-based features of single-channel scalp EEGs recorded from subjects with intractable seizure are examined for epileptic seizure classification. The wavelet-based features extracted from scalp EEGs are simply based on detail and approximation coefficients obtained from the discrete wavelet transform. Support vector machine (SVM), one of the most commonly used classifiers, is applied to classify vectors of wavelet-based features of scalp EEGs into either seizure or non-seizure class. In patient-based epileptic seizure classification, a training data set used to train SVM classifiers is composed of wavelet-based features of scalp EEGs corresponding to the first epileptic seizure event. Overall, the excellent performance on patient-dependent epileptic seizure classification is obtained with the average accuracy, sensitivity, and specificity of, respectively, 0.9687, 0.7299, and 0.9813. The vector composed of two wavelet-based features of scalp EEGs provide the best performance on patient-dependent epileptic seizure classification in most cases, i.e., 19 cases out of 24. The wavelet-based features corresponding to the 32-64, 8-16, and 4-8 Hz subbands of scalp EEGs are the mostly used features providing the best performance on patient-dependent classification. Furthermore, the performance on both patient-dependent and patient-independent epileptic seizure classifications are also validated using tenfold cross-validation. From the patient-independent epileptic seizure classification validated using tenfold cross-validation, it is shown that the best classification performance is achieved using the wavelet-based features corresponding to the 64-128 and 4-8 Hz subbands of scalp EEGs.

  4. Treatment of typical absence seizures and related epileptic syndromes.

    PubMed

    Panayiotopoulos, C P

    2001-01-01

    Typical absences are brief (seconds) generalised seizures of sudden onset and termination. They have 2 essential components: clinically, the impairment of consciousness (absence) and, generalised 3 to 4Hz spike/polyspike and slow wave discharges on electroencephalogram (EEG). They differ fundamentally from other seizures and are pharmacologically unique. Their clinical and EEG manifestations are syndrome-related. Impairment of consciousness may be severe, moderate, mild or inconspicuous. This is often associated with motor manifestations, automatisms and autonomic disturbances. Clonic, tonic and atonic components alone or in combination are motor symptoms; myoclonia, mainly of facial muscles, is the most common. The ictal EEG discharge may be consistently brief (2 to 5 seconds) or long (15 to 30 seconds), continuous or fragmented, with single or multiple spikes associated with the slow wave. The intradischarge frequency may be constant or may vary (2.5 to 5Hz). Typical absences are easily precipitated by hyperventilation in about 90% of untreated patients. They are usually spontaneous, but can be triggered by photic, pattern, video games stimuli, and mental or emotional factors. Typical absences usually start in childhood or adolescence. They occur in around 10 to 15% of adults with epilepsies, often combined with other generalised seizures. They may remit with age or be lifelong. Syndromic diagnosis is important for treatment strategies and prognosis. Absences may be severe and the only seizure type, as in childhood absence epilepsy. They may predominate in other syndromes or be mild and nonpredominant in syndromes such as juvenile myoclonic epilepsy where myoclonic jerks and generalised tonic clonic seizures are the main concern. Typical absence status epilepticus occurs in about 30% of patients and is more common in certain syndromes, e.g. idiopathic generalised epilepsy with perioral myoclonia or phantom absences. Typical absence seizures are often easy to

  5. Focal seizures and epileptic spasms in a child with Down syndrome from a family with a PRRT2 mutation.

    PubMed

    Igarashi, Ayuko; Okumura, Akihisa; Shimojima, Keiko; Abe, Shinpei; Ikeno, Mitsuru; Shimizu, Toshiaki; Yamamoto, Toshiyuki

    2016-06-01

    We describe a girl with Down syndrome who experienced focal seizures and epileptic spasms during infancy. The patient was diagnosed as having trisomy 21 during the neonatal period. She had focal seizures at five months of age, which were controlled with phenobarbital. However, epileptic spasms appeared at seven months of age in association with hypsarrhythmia. Upon treatment with adrenocorticotropic hormone, her epileptic spasms disappeared. Her younger brother also had focal seizures at five months of age. His development and interictal electroencephalogram were normal. The patient's father had had infantile epilepsy and paroxysmal kinesigenic dyskinesia. We performed a mutation analysis of the PRRT2 gene and found a c.841T>C mutation in the present patient, her father, and in her younger brother. We hypothesized that the focal seizures in our patient were caused by the PRRT2 mutation, whereas the epileptic spasms were attributable to trisomy 21.

  6. Network dynamics of the brain and influence of the epileptic seizure onset zone.

    PubMed

    Burns, Samuel P; Santaniello, Sabato; Yaffe, Robert B; Jouny, Christophe C; Crone, Nathan E; Bergey, Gregory K; Anderson, William S; Sarma, Sridevi V

    2014-12-09

    The human brain is a dynamic networked system. Patients with partial epileptic seizures have focal regions that periodically diverge from normal brain network dynamics during seizures. We studied the evolution of brain connectivity before, during, and after seizures with graph-theoretic techniques on continuous electrocorticographic (ECoG) recordings (5.4 ± 1.7 d per patient, mean ± SD) from 12 patients with temporal, occipital, or frontal lobe partial onset seizures. Each electrode was considered a node in a graph, and edges between pairs of nodes were weighted by their coherence within a frequency band. The leading eigenvector of the connectivity matrix, which captures network structure, was tracked over time and clustered to uncover a finite set of brain network states. Across patients, we found that (i) the network connectivity is structured and defines a finite set of brain states, (ii) seizures are characterized by a consistent sequence of states, (iii) a subset of nodes is isolated from the network at seizure onset and becomes more connected with the network toward seizure termination, and (iv) the isolated nodes may identify the seizure onset zone with high specificity and sensitivity. To localize a seizure, clinicians visually inspect seizures recorded from multiple intracranial electrode contacts, a time-consuming process that may not always result in definitive localization. We show that network metrics computed from all ECoG channels capture the dynamics of the seizure onset zone as it diverges from normal overall network structure. This suggests that a state space model can be used to help localize the seizure onset zone in ECoG recordings.

  7. Comparison of fractal dimension estimation algorithms for epileptic seizure onset detection

    NASA Astrophysics Data System (ADS)

    Polychronaki, G. E.; Ktonas, P. Y.; Gatzonis, S.; Siatouni, A.; Asvestas, P. A.; Tsekou, H.; Sakas, D.; Nikita, K. S.

    2010-08-01

    Fractal dimension (FD) is a natural measure of the irregularity of a curve. In this study the performances of three waveform FD estimation algorithms (i.e. Katz's, Higuchi's and the k-nearest neighbour (k-NN) algorithm) were compared in terms of their ability to detect the onset of epileptic seizures in scalp electroencephalogram (EEG). The selection of parameters involved in FD estimation, evaluation of the accuracy of the different algorithms and assessment of their robustness in the presence of noise were performed based on synthetic signals of known FD. When applied to scalp EEG data, Katz's and Higuchi's algorithms were found to be incapable of producing consistent changes of a single type (either a drop or an increase) during seizures. On the other hand, the k-NN algorithm produced a drop, starting close to the seizure onset, in most seizures of all patients. The k-NN algorithm outperformed both Katz's and Higuchi's algorithms in terms of robustness in the presence of noise and seizure onset detection ability. The seizure detection methodology, based on the k-NN algorithm, yielded in the training data set a sensitivity of 100% with 10.10 s mean detection delay and a false positive rate of 0.27 h-1, while the corresponding values in the testing data set were 100%, 8.82 s and 0.42 h-1, respectively. The above detection results compare favourably to those of other seizure onset detection methodologies applied to scalp EEG in the literature. The methodology described, based on the k-NN algorithm, appears to be promising for the detection of the onset of epileptic seizures based on scalp EEG.

  8. Comparison of fractal dimension estimation algorithms for epileptic seizure onset detection.

    PubMed

    Polychronaki, G E; Ktonas, P Y; Gatzonis, S; Siatouni, A; Asvestas, P A; Tsekou, H; Sakas, D; Nikita, K S

    2010-08-01

    Fractal dimension (FD) is a natural measure of the irregularity of a curve. In this study the performances of three waveform FD estimation algorithms (i.e. Katz's, Higuchi's and the k-nearest neighbour (k-NN) algorithm) were compared in terms of their ability to detect the onset of epileptic seizures in scalp electroencephalogram (EEG). The selection of parameters involved in FD estimation, evaluation of the accuracy of the different algorithms and assessment of their robustness in the presence of noise were performed based on synthetic signals of known FD. When applied to scalp EEG data, Katz's and Higuchi's algorithms were found to be incapable of producing consistent changes of a single type (either a drop or an increase) during seizures. On the other hand, the k-NN algorithm produced a drop, starting close to the seizure onset, in most seizures of all patients. The k-NN algorithm outperformed both Katz's and Higuchi's algorithms in terms of robustness in the presence of noise and seizure onset detection ability. The seizure detection methodology, based on the k-NN algorithm, yielded in the training data set a sensitivity of 100% with 10.10 s mean detection delay and a false positive rate of 0.27 h(-1), while the corresponding values in the testing data set were 100%, 8.82 s and 0.42 h(-1), respectively. The above detection results compare favourably to those of other seizure onset detection methodologies applied to scalp EEG in the literature. The methodology described, based on the k-NN algorithm, appears to be promising for the detection of the onset of epileptic seizures based on scalp EEG.

  9. Phase reduction analysis of coupled neural oscillators: application to epileptic seizure dynamics

    NASA Astrophysics Data System (ADS)

    Takeshita, Daisuke; Sato, Yasuomi; Bahar, Sonya

    2006-03-01

    Epileptic seizures are generally held to be result from excess and synchronized neural activity. To investigate how seizures initiate, we develop a model of a neocortical network based on a model suggested by Wilson [1]. We simulate the effect of the potassium channel blocker 4-aminopyridine, which is often used in experiments to induce epileptic seizures, by decreasing the conductance of the potassium channels (gK) in neurons in our model. We applied phase reduction to the Wilson model to study how gK in the model affects the stability of the phase difference. At a normal value of gK, the stable phase difference is small, but the neurons are not exactly in phase. At low gK, in-phase and out-of-phase firing patterns become simultaneously stable. We constructed a network of 20 by 20 neurons. By decreasing gK to zero, a dramatic increase in the amplitude of mean field was observed. This is due to the fact that in-phase firing becomes stable at low gK. The pattern was similar to local field potential in 4-aminopyridine induced seizures. Therefore, it was concluded that the neural activity in drug-induced seizure may be caused by a bifurcation in stable phase differences between neurons. [1] Wilson H.R., J. Theor. Biol. (1999) 200, 375-388 [2] Ermentrout, G.B. and Kopell, N., SIAM J. Math. Anal. (1984), 215-237

  10. An incident case-referent study of epileptic seizures in adults.

    PubMed

    Forsgren, L; Nyström, L

    1990-01-01

    An epidemiological community-based study of incident cases with non-provoked epileptic seizures, using case-referent methodology, was carried out to explore possible risk factors for epileptic seizures. 83 cases, between 17 and 74 years of age, of whom 67.4% had seizures of localized onset, were compared with 2 age- and sex-matched referents. Higher birth weight, movement disabilities, mental retardation, head trauma, brain tumor, depression, a period of unemployment during the previous 6 months and a history of epilepsy in relatives were more common in cases than in referent subjects. No difference was found in the socioeconomic factors investigated, except that the cases belonged to smaller households. Prematurity, home or hospital birth, parents' age at birth of cases or referents, febrile convulsions in relatives, various infections including meningitis and encephalitis, cerebrovascular disease, and alcohol, tobacco, sleep and nutritional habits were not found to be associated with development of seizures. The recent life events investigated, at home or at work, occurred as often in cases as in referents, except that significantly fewer cases had received any increase in salary during the last 6 months. The relationship between depression and development of seizures should be explored further. Moreover, the possibility of false negative results should be considered because of the sample size.

  11. Trichotillomania and Non-Epileptic Seizures as Sleep-Related Dissociative Phenomena

    PubMed Central

    Angulo-Franco, Melina; Bush-Martínez, Alejandra; Nenclares-Portocarrero, Alejandro; Jiménez-Genchi, Alejandro

    2015-01-01

    The occurrence of non-epileptic seizures (NES) and trichotillomania during sleep is rare. We describe the case of an adult woman with a personal history of childhood maltreatment and psychiatric morbidity (major depression, trichotillomania, and conversion disorder), who was referred to the sleep unit because of nocturnal hair-pulling and psychomotor agitation during sleep. An all-night PSG recording with audiovisual monitoring documented seven episodes of trichotillomania and one NES, all of which arose from unequivocal wakefulness. Improvement of nocturnal behaviors was observed after long-term psychotherapy. This case illustrates that nocturnal trichotillomania and NES may be symptoms of a sleep-related dissociative disorder. Citation: Angulo-Franco M, Bush-Martínez A, Nenclares-Portocarrero A, Jiménez-Genchi A. Trichotillomania and non-epileptic seizures as sleep-related dissociative phenomena. J Clin Sleep Med 2015;11(3):271–273. PMID:25515284

  12. [The structural and functional neurovisualization in patients with epileptic seizures in cerebro-vascular diseases].

    PubMed

    Bazilevich, S N; Odinak, M M; Dyskin, D E; Krasakov, I V; Fokin, V A; P'ianov, I V; Dekan, V S; Okol'zin, A V; Pozdniakov, A V; Stanzhevskiĭ, A A

    2008-01-01

    The results of the dynamic study of patients with epileptic seizures in chronic and acute cerebral vascular pathology are presented. Various methods of structural and functional neurovisualization--magnetic resonance tomography using perfusion- and diffusion-weighted imaging, proton magnetic resonance spectroscopy, positron emission tomography, single photon emission computed tomography were used. Based on the results obtained in the study, the authors discuss etiopathogenetic variants of the development of these seizures and new possible approaches to the complex treatment besides the administration of antiepileptic medications.

  13. Hypothalamic hamartoma, precocious puberty and gelastic seizures: a special model of "epileptic" developmental disorder.

    PubMed

    Deonna, T; Ziegler, A L

    2000-03-01

    Based on a review of the literature and a detailed longitudinal single case study of a child with early onset gelastic seizures and hypothalamic hamartoma, the authors review the arguments suggesting that the acquired cognitive and behavioral symptoms seen in the majority of cases of this special epileptic syndrome result from a direct effect of the seizures. The early neurobehavioral profile of the case presented in this paper and that of a previous study is particular and combines features of a pervasive developmental and an attention deficit disorder which are probably closely related to the particular location of the epilepsy and its spread from the hypothalamus.

  14. A study of synchronization of nonlinear oscillators: Application to epileptic seizures

    NASA Astrophysics Data System (ADS)

    Takeshita, Daisuke

    This dissertation focuses on several problems in neuroscience from the perspective of nonlinear dynamics and stochastic processes. The first part concerns a method to visualize the idea of the power spectrum of spike trains, which has an educational value to introductory students in biophysics. The next part consists of experimental and computational work on drug-induced epileptic seizures in the rat neocortex. In the experimental part, spatiotemporal patterns of electrical activities in the rat neocortex are measured using voltage-sensitive dye imaging. Epileptic regions show well-synchronized, in-phase activity during epileptic seizures. In the computational part, a network of a Hodgkin-Huxley type neocortical neural model is constructed. Phase reduction, which is a dimension reduction technique for a stable limit cycle, is applied to the system. The results propose a possible mechanism for the initiation of the drug-induced seizure as a result of a bifurcation. In the last part, a theoretical framework is developed to obtain the statistics for the period of oscillations of a stable limit cycle under stochastic perturbation. A stochastic version of phase reduction and first passage time analysis are utilized for this purpose. The method presented here shows a good agreement with numerical results for the weak noise regime.

  15. Time-frequency texture descriptors of EEG signals for efficient detection of epileptic seizure.

    PubMed

    Şengür, Abdulkadir; Guo, Yanhui; Akbulut, Yaman

    2016-06-01

    Detection of epileptic seizure in electroencephalogram (EEG) signals is a challenging task and requires highly skilled neurophysiologists. Therefore, computer-aided detection helps neurophysiologist in interpreting the EEG. In this paper, texture representation of the time-frequency (t-f) image-based epileptic seizure detection is proposed. More specifically, we propose texture descriptor-based features to discriminate normal and epileptic seizure in t-f domain. To this end, three popular texture descriptors are employed, namely gray-level co-occurrence matrix (GLCM), texture feature coding method (TFCM), and local binary pattern (LBP). The features that are obtained on the GLCM are contrast, correlation, energy, and homogeneity. Moreover, in the TFCM method, several statistical features are calculated. In addition, for the LBP, the histogram is used as a feature. In the classification stage, a support vector machine classifier is employed. We evaluate our proposal with extensive experiments. According to the evaluated terms, our method produces successful results. 100 % accuracy is obtained with LIBLINEAR. We also compare our method with other published methods and the results show the superiority of our proposed method.

  16. Preictal dynamics of EEG complexity in intracranially recorded epileptic seizure: a case report.

    PubMed

    Bob, Petr; Roman, Robert; Svetlak, Miroslav; Kukleta, Miloslav; Chladek, Jan; Brazdil, Milan

    2014-11-01

    Recent findings suggest that neural complexity reflecting a number of independent processes in the brain may characterize typical changes during epileptic seizures and may enable to describe preictal dynamics. With respect to previously reported findings suggesting specific changes in neural complexity during preictal period, we have used measure of pointwise correlation dimension (PD2) as a sensitive indicator of nonstationary changes in complexity of the electroencephalogram (EEG) signal. Although this measure of complexity in epileptic patients was previously reported by Feucht et al (Applications of correlation dimension and pointwise dimension for non-linear topographical analysis of focal onset seizures. Med Biol Comput. 1999;37:208-217), it was not used to study changes in preictal dynamics. With this aim to study preictal changes of EEG complexity, we have examined signals from 11 multicontact depth (intracerebral) EEG electrodes located in 108 cortical and subcortical brain sites, and from 3 scalp EEG electrodes in a patient with intractable epilepsy, who underwent preoperative evaluation before epilepsy surgery. From those 108 EEG contacts, records related to 44 electrode contacts implanted into lesional structures and white matter were not included into the experimental analysis.The results show that in comparison to interictal period (at about 8-6 minutes before seizure onset), there was a statistically significant decrease in PD2 complexity in the preictal period at about 2 minutes before seizure onset in all 64 intracranial channels localized in various brain sites that were included into the analysis and in 3 scalp EEG channels as well. Presented results suggest that using PD2 in EEG analysis may have significant implications for research of preictal dynamics and prediction of epileptic seizures.

  17. Can hyper-synchrony in meditation lead to seizures? Similarities in meditative and epileptic brain states.

    PubMed

    Lindsay, Shane

    2014-10-01

    Meditation is used worldwide by millions of people for relaxation and stress relief. Given sufficient practice, meditators may also experience a variety of altered states of consciousness. These states can lead to a variety of unusual experiences, including physical, emotional and psychic disturbances. This paper highlights the correspondences between brain states associated with these experiences and the symptoms and neurophysiology of epileptic simple partial seizures. Seizures, like meditation practice, can result in both positive and negative experiences. The neurophysiology and chemistry underlying simple partial seizures are characterised by a high degree of excitability and high levels of neuronal synchrony in gamma-band brain activity. Following a survey of the literature that shows that meditation practice is also linked to high power gamma activity, an account of how meditation could cause such activity is provided. This paper discusses the diagnostic challenges for the claim that meditation practices lead to brain states similar to those found in epileptic seizures, and seeks to develop our understanding of the range of pathological and non-pathological states that result from a hyper-excited and hyper-synchronous brain.

  18. [Memory disorders in epileptic children with temporal psychomotor seizures].

    PubMed

    Madorskiĭ, V A; Shestakova, T B

    1975-01-01

    The authors demonstrate the results of experimental psychological examination of memory in 57 patients with epilepsy in psychomotor temporal seizures. It was possible to show that in such cases there was a total decline of short-time memory. In bilateral foci and a long-term development of the disease there was a formation of an amnestic syndrome. The most distinct changes were seen in a delayed reproduction. In an electrostimulation of the structures of the temporal lobe by means of implanted electrodes the experiments displayed an intactness of direct reproduction during a stimulation of the neocortex, a moderate decrease in a stimulation of the hypocampus and a grave -- when stimulating the amygdalar complex.

  19. Quantifying limb movements in epileptic seizures through color-based video analysis.

    PubMed

    Lu, Haiping; Pan, Yaozhang; Mandal, Bappaditya; Eng, How-Lung; Guan, Cuntai; Chan, Derrick W S

    2013-02-01

    This paper proposes a color-based video analytic system for quantifying limb movements in epileptic seizure monitoring. The system utilizes colored pyjamas to facilitate limb segmentation and tracking. Thus, it is unobtrusive and requires no sensor/marker attached to patient's body. We employ Gaussian mixture models in background/foreground modeling and detect limbs through a coarse-to-fine paradigm with graph-cut-based segmentation. Next, we estimate limb parameters with domain knowledge guidance and extract displacement and oscillation features from movement trajectories for seizure detection/analysis. We report studies on sequences captured in an epilepsy monitoring unit. Experimental evaluations show that the proposed system has achieved comparable performance to EEG-based systems in detecting motor seizures.

  20. Dynamical analogy between epileptic seizures and seismogenic electromagnetic emissions by means of nonextensive statistical mechanics

    NASA Astrophysics Data System (ADS)

    Eftaxias, Konstantinos; Minadakis, George; Potirakis, Stelios. M.; Balasis, Georgios

    2013-02-01

    The field of study of complex systems considers that the dynamics of complex systems are founded on universal principles that may be used to describe a great variety of scientific and technological approaches of different types of natural, artificial, and social systems. Several authors have suggested that earthquake dynamics and neurodynamics can be analyzed within similar mathematical frameworks. Recently, authors have shown that a dynamical analogy supported by scale-free statistics exists between seizures and earthquakes, analyzing populations of different seizures and earthquakes, respectively. The purpose of this paper is to suggest a shift in emphasis from the large to the small scale: our analyses focus on a single epileptic seizure generation and the activation of a single fault (earthquake) and not on the statistics of sequences of different seizures and earthquakes. We apply the concepts of the nonextensive statistical physics to support the suggestion that a dynamical analogy exists between the two different extreme events, seizures and earthquakes. We also investigate the existence of such an analogy by means of scale-free statistics (the Gutenberg-Richter distribution of event sizes and the distribution of the waiting time until the next event). The performed analysis confirms the existence of a dynamic analogy between earthquakes and seizures, which moreover follow the dynamics of magnetic storms and solar flares.

  1. Electroencephalographic evaluation of gold wire implants inserted in acupuncture points in dogs with epileptic seizures.

    PubMed

    Goiz-Marquez, G; Caballero, S; Solis, H; Rodriguez, C; Sumano, H

    2009-02-01

    The purpose of this study was to evaluate both, clinically and with electroencephalographic (EEG) recordings, the effect of gold wire implants in acupuncture points in dogs with uncontrolled idiopathic epileptic seizures. Fifteen dogs with such diagnosis were enrolled in the study. A first EEG recording was performed in all dogs under anaesthesia with xylazine (1mg/kg) and propofol (6 mg/kg) before the treatment protocol, and a second EEG was performed 15 weeks later. Relative frequency power, intrahemispheric coherence available through EEG, number of seizures and seizure severity were compared before and after treatment using a Wilcoxon signed-rank test. There were no significant statistical differences before and after treatment in relative power or in intrahemispheric coherence in the EEG recording. However, there was a significant mean difference in seizure frequency and seizure severity between control and treatment periods. After treatment, nine of the 15 dogs (60%) had at least a 50% reduction in seizures frequency during the 15 weeks established as follow-up of this treatment.

  2. Epileptic Seizure Detection in Eeg Signals Using Multifractal Analysis and Wavelet Transform

    NASA Astrophysics Data System (ADS)

    Uthayakumar, R.; Easwaramoorthy, D.

    2013-06-01

    This paper explores the three different methods to explicitly recognize the healthy and epileptic EEG signals: Modified, Improved, and Advanced forms of Generalized Fractal Dimensions (GFD). The newly proposed scheme is based on GFD and the discrete wavelet transform (DWT) for analyzing the EEG signals. First EEG signals are decomposed into approximation and detail coefficients using DWT and then GFD values of the original EEGs, approximation and detail coefficients are computed. Significant differences are observed among the GFD values of the healthy and epileptic EEGs allowing us to classify seizures with high accuracy. It is shown that the classification rate is very less accurate without DWT as a preprocessing step. The proposed idea is illustrated through the graphical and statistical tools. The EEG data is further tested for linearity by using normal probability plot and we proved that epileptic EEG had significant nonlinearity whereas healthy EEG distributed normally and similar to Gaussian linear process. Therefore, we conclude that the GFD and the wavelet decomposition through DWT are the strong indicators of the state of illness of epileptic patients.

  3. Ecstatic Epileptic Seizures: A Glimpse into the Multiple Roles of the Insula

    PubMed Central

    Gschwind, Markus; Picard, Fabienne

    2016-01-01

    Ecstatic epileptic seizures are a rare but compelling epileptic entity. During the first seconds of these seizures, ecstatic auras provoke feelings of well-being, intense serenity, bliss, and “enhanced self-awareness.” They are associated with the impression of time dilation, and can be described as a mystic experience by some patients. The functional neuroanatomy of ecstatic seizures is still debated. During recent years several patients presenting with ecstatic auras have been reported by others and us (in total n = 52); a few of them in the setting of presurgical evaluation including electrical brain stimulation. According to the recently recognized functions of the insula, and the results of nuclear brain imaging and electrical stimulation, the ecstatic symptoms in these patients seem to localize to a functional network centered around the anterior insular cortex, where we thus propose to locate this rare ictal phenomenon. Here we summarize the role of the multiple sensory, autonomic, affective, and cognitive functions of the insular cortex, which are integrated into the creation of self-awareness, and we suggest how this system may become dysfunctional on several levels during ecstatic aura. PMID:26924970

  4. Dynamic Causal Modelling of epileptic seizure propagation pathways: a combined EEG-fMRI study.

    PubMed

    Murta, Teresa; Leal, Alberto; Garrido, Marta I; Figueiredo, Patrícia

    2012-09-01

    Simultaneous EEG-fMRI offers the possibility of non-invasively studying the spatiotemporal dynamics of epileptic activity propagation from the focus towards an extended brain network, through the identification of the haemodynamic correlates of ictal electrical discharges. In epilepsy associated with hypothalamic hamartomas (HH), seizures are known to originate in the HH but different propagation pathways have been proposed. Here, Dynamic Causal Modelling (DCM) was employed to estimate the seizure propagation pathway from fMRI data recorded in a HH patient, by testing a set of clinically plausible network connectivity models of discharge propagation. The model consistent with early propagation from the HH to the temporal-occipital lobe followed by the frontal lobe was selected as the most likely model to explain the data. Our results demonstrate the applicability of DCM to investigate patient-specific effective connectivity in epileptic networks identified with EEG-fMRI. In this way, it is possible to study the propagation pathway of seizure activity, which has potentially great impact in the decision of the surgical approach for epilepsy treatment.

  5. The spectrum of psychogenic non-epileptic seizures and comorbidities seen in an epilepsy monitoring unit.

    PubMed

    Seneviratne, Udaya; Briggs, Belinda; Lowenstern, David; D'Souza, Wendyl

    2011-03-01

    We sought to study characteristics of patients presenting with psychogenic non-epileptic seizures (PNES), with and without major psychiatric comorbidity. A total of 39 patients who were diagnosed with PNES in a tertiary care setting were studied, and those patients with and without axis I psychiatric disorders in the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) were compared. The mean time in confirming the diagnosis was 9 years. More than half the patients were taking anti-epileptic medications when they presented for video-electroencephalographic monitoring. The mean monitoring time required to capture a PNES was 0.6 days. Comorbid chronic medical conditions were found in 38.5% and axis I-psychiatric diagnoses in 48.7%. There were no significant differences in characteristics between those with and without major psychiatric comorbidities.

  6. Epileptic Seizure Prediction by a System of Particle Filter Associated with a Neural Network

    NASA Astrophysics Data System (ADS)

    Liu, Derong; Pang, Zhongyu; Wang, Zhuo

    2009-12-01

    None of the current epileptic seizure prediction methods can widely be accepted, due to their poor consistency in performance. In this work, we have developed a novel approach to analyze intracranial EEG data. The energy of the frequency band of 4-12 Hz is obtained by wavelet transform. A dynamic model is introduced to describe the process and a hidden variable is included. The hidden variable can be considered as indicator of seizure activities. The method of particle filter associated with a neural network is used to calculate the hidden variable. Six patients' intracranial EEG data are used to test our algorithm including 39 hours of ictal EEG with 22 seizures and 70 hours of normal EEG recordings. The minimum least square error algorithm is applied to determine optimal parameters in the model adaptively. The results show that our algorithm can successfully predict 15 out of 16 seizures and the average prediction time is 38.5 minutes before seizure onset. The sensitivity is about 93.75% and the specificity (false prediction rate) is approximately 0.09 FP/h. A random predictor is used to calculate the sensitivity under significance level of 5%. Compared to the random predictor, our method achieved much better performance.

  7. An Automatic Prediction of Epileptic Seizures Using Cloud Computing and Wireless Sensor Networks.

    PubMed

    Sareen, Sanjay; Sood, Sandeep K; Gupta, Sunil Kumar

    2016-11-01

    Epilepsy is one of the most common neurological disorders which is characterized by the spontaneous and unforeseeable occurrence of seizures. An automatic prediction of seizure can protect the patients from accidents and save their life. In this article, we proposed a mobile-based framework that automatically predict seizures using the information contained in electroencephalography (EEG) signals. The wireless sensor technology is used to capture the EEG signals of patients. The cloud-based services are used to collect and analyze the EEG data from the patient's mobile phone. The features from the EEG signal are extracted using the fast Walsh-Hadamard transform (FWHT). The Higher Order Spectral Analysis (HOSA) is applied to FWHT coefficients in order to select the features set relevant to normal, preictal and ictal states of seizure. We subsequently exploit the selected features as input to a k-means classifier to detect epileptic seizure states in a reasonable time. The performance of the proposed model is tested on Amazon EC2 cloud and compared in terms of execution time and accuracy. The findings show that with selected HOS based features, we were able to achieve a classification accuracy of 94.6 %.

  8. State of the Art Approach to the Classification of Epileptic Seizures and Epilepsies

    PubMed Central

    BARÇIN, Ebru; AKTEKİN, Berrin

    2014-01-01

    In the light of the latest knowledge acquired from clinical and laboratory research dealing with genetic, molecular biology and neuroimaging, existing classifications were successively revised by the International League Against Epilepsy (ILAE) in 2001, 2006, and 2010. In the latest classification established in 2010, proposals articulated radical changes in terms of concepts and definitions of the previously published classifications and put forward new classifications for epileptic seizures, epilepsies and electroclinical syndromes. This review refers to the changes of the new classification with their reasons and criticisms.

  9. Brain network dynamics characterization in epileptic seizures. Joint directed graph and pairwise synchronization measures

    NASA Astrophysics Data System (ADS)

    Rodrigues, A. C.; Machado, B. S.; Florence, G.; Hamad, A. P.; Sakamoto, A. C.; Fujita, A.; Baccalá, L. A.; Amaro, E.; Sameshima, K.

    2014-12-01

    Here we propose and evaluate a new approach to analyse multichannel mesial temporal lobe epilepsy EEG data from eight patients through complex network and synchronization theories. The method employs a Granger causality test to infer the directed connectivity graphs and a wavelet transform based phase synchronization measure whose characteristics allow studying dynamical transitions during epileptic seizures. We present a new combined graph measure that quantifies the level of network hub formation, called network hub out-degree, which closely reflects the level of synchronization observed during the ictus.

  10. Drug therapy of epileptic seizures among adult epileptic outpatients of University of Gondar Referral and Teaching Hospital, Gondar, North West Ethiopia

    PubMed Central

    Birru, Eshetie Melese; Shafi, Miftah; Geta, Mestayet

    2016-01-01

    Objective The aim of this study was to assess the practice of pharmacotherapy of epilepsy and its treatment outcomes in adult epileptic outpatients at the University of Gondar Referral and Teaching Hospital, Gondar, North West Ethiopia. Methods An institution based, retrospective cross-sectional study was conducted from the medical charts of 336 adult epileptic patients at the outpatient epileptic clinic of Neurology Department of University of Gondar Teaching Hospital from May 2014 to April 2015. Reviewing follow-up information from the medical charts was used to evaluate antiepileptic drug (AED) prescribing patterns and treatment outcome. Data were collected by using data collection format and analyzed using SPSS software version 16. Results The most common type of seizure diagnosed was generalized tonic–clonic seizure (n=245, 72.91%). Monotherapy with an AED accounted for 80.35% of the cases, whereas dual therapy and polytherapy with three AED combinations accounted for 16.37% and 3.28%, respectively. The most frequently prescribed AED was phenobarbitone (62.47%) followed by carbamazepine (17.91%). From the total epileptic cases, 277 (82.4%) had well-controlled seizure status in the last three consecutive months. Conclusion Most of the patients were maintained by monotherapy, and largely this was by the older antiepileptic drug, phenobarbitone. Considering the development of pharmacotherapy of epilepsy and other patient related factors, the standard treatment guideline for Ethiopia needs to be revised periodically. PMID:28053533

  11. Epileptic Seizure Detection with Log-Euclidean Gaussian Kernel-Based Sparse Representation.

    PubMed

    Yuan, Shasha; Zhou, Weidong; Wu, Qi; Zhang, Yanli

    2016-05-01

    Epileptic seizure detection plays an important role in the diagnosis of epilepsy and reducing the massive workload of reviewing electroencephalography (EEG) recordings. In this work, a novel algorithm is developed to detect seizures employing log-Euclidean Gaussian kernel-based sparse representation (SR) in long-term EEG recordings. Unlike the traditional SR for vector data in Euclidean space, the log-Euclidean Gaussian kernel-based SR framework is proposed for seizure detection in the space of the symmetric positive definite (SPD) matrices, which form a Riemannian manifold. Since the Riemannian manifold is nonlinear, the log-Euclidean Gaussian kernel function is applied to embed it into a reproducing kernel Hilbert space (RKHS) for performing SR. The EEG signals of all channels are divided into epochs and the SPD matrices representing EEG epochs are generated by covariance descriptors. Then, the testing samples are sparsely coded over the dictionary composed by training samples utilizing log-Euclidean Gaussian kernel-based SR. The classification of testing samples is achieved by computing the minimal reconstructed residuals. The proposed method is evaluated on the Freiburg EEG dataset of 21 patients and shows its notable performance on both epoch-based and event-based assessments. Moreover, this method handles multiple channels of EEG recordings synchronously which is more speedy and efficient than traditional seizure detection methods.

  12. Up-to-date Critical Review of the Classification of Epilepsies and Epileptic Seizures

    PubMed Central

    AKTEKİN, Berrin

    2015-01-01

    The classification of epileptic seizures and epilepsies is a subject of interest in various medical disciplines (such as neurology, pediatric neurology, molecular biology and genetics, neurosurgery, pharmacology, radiology, histopathology), and each of them requires a different approach in their practice. In last 15 years, enormous amount of debate in which irrelevant to actual level of knowledge, were ongoing in the literature. Epilepsy classification is a fundamental tool that impacts not only daily clinical practice but also research era and education. The current lack of consensus in this field causes a serious obstacle in patient management, student and resident education, and information sharing among different scientific interest groups. The comparison of different classification proposals by means of positive and negative aspects is beyond the scope of discussion in this article; therefore, I will try to give a brief summary of our current level of understanding. Main issues regarding the classifications proposal are as follows: Concepts of epileptic seizure/epilepsy/syndromeFocal & generalized epilepsy conceptIdiopathic, genetic, cryptogenic, and symptomatic (structural/metabolic) concepts

  13. All together now: Analogies between chimera state collapses and epileptic seizures

    NASA Astrophysics Data System (ADS)

    Andrzejak, Ralph G.; Rummel, Christian; Mormann, Florian; Schindler, Kaspar

    2016-03-01

    Conceptually and structurally simple mathematical models of coupled oscillator networks can show a rich variety of complex dynamics, providing fundamental insights into many real-world phenomena. A recent and not yet fully understood example is the collapse of coexisting synchronous and asynchronous oscillations into a globally synchronous motion found in networks of identical oscillators. Here we show that this sudden collapse is promoted by a further decrease of synchronization, rather than by critically high synchronization. This strikingly counterintuitive mechanism can be found also in nature, as we demonstrate on epileptic seizures in humans. Analyzing spatiotemporal correlation profiles derived from intracranial electroencephalographic recordings (EEG) of seizures in epilepsy patients, we found a pronounced decrease of correlation at the seizure onsets. Applying our findings in a closed-loop control scheme to models of coupled oscillators in chimera states, we succeed in both provoking and preventing outbreaks of global synchronization. Our findings not only advance the understanding of networks of coupled dynamics but can open new ways to control them, thus offering a vast range of potential new applications.

  14. All together now: Analogies between chimera state collapses and epileptic seizures

    PubMed Central

    Andrzejak, Ralph G.; Rummel, Christian; Mormann, Florian; Schindler, Kaspar

    2016-01-01

    Conceptually and structurally simple mathematical models of coupled oscillator networks can show a rich variety of complex dynamics, providing fundamental insights into many real-world phenomena. A recent and not yet fully understood example is the collapse of coexisting synchronous and asynchronous oscillations into a globally synchronous motion found in networks of identical oscillators. Here we show that this sudden collapse is promoted by a further decrease of synchronization, rather than by critically high synchronization. This strikingly counterintuitive mechanism can be found also in nature, as we demonstrate on epileptic seizures in humans. Analyzing spatiotemporal correlation profiles derived from intracranial electroencephalographic recordings (EEG) of seizures in epilepsy patients, we found a pronounced decrease of correlation at the seizure onsets. Applying our findings in a closed-loop control scheme to models of coupled oscillators in chimera states, we succeed in both provoking and preventing outbreaks of global synchronization. Our findings not only advance the understanding of networks of coupled dynamics but can open new ways to control them, thus offering a vast range of potential new applications. PMID:26957324

  15. Dynamic Electrical Source Imaging (DESI) of Seizures and Interictal Epileptic Discharges Without Ensemble Averaging

    PubMed Central

    Erem, Burak; Hyde, Damon E.; Peters, Jurriaan M.; Duffy, Frank H.; Warfield, Simon K.

    2016-01-01

    We propose an algorithm for electrical source imaging of epileptic discharges that takes a data-driven approach to regularizing the dynamics of solutions. The method is based on linear system identification on short time segments, combined with a classical inverse solution approach. Whereas ensemble averaging of segments or epochs discards inter-segment variations by averaging across them, our approach explicitly models them. Indeed, it may even be possible to avoid the need for the time-consuming process of marking epochs containing discharges altogether. We demonstrate that this approach can produce both stable and accurate inverse solutions in experiments using simulated data and real data from epilepsy patients. In an illustrative example, we show that we are able to image propagation using this approach. We show that when applied to imaging seizure data, our approach reproducibly localized frequent seizure activity to within the margins of surgeries that led to patients’ seizure freedom. The same approach could be used in the planning of epilepsy surgeries, as a way to localize potentially epileptogenic tissue that should be resected. PMID:27479957

  16. Non-intrusive head movement analysis of videotaped seizures of epileptic origin.

    PubMed

    Mandal, Bappaditya; Eng, How-Lung; Lu, Haiping; Chan, Derrick W S; Ng, Yen-Ling

    2012-01-01

    In this work we propose a non-intrusive video analytic system for patient's body parts movement analysis in Epilepsy Monitoring Unit. The system utilizes skin color modeling, head/face pose template matching and face detection to analyze and quantify the head movements. Epileptic patients' heads are analyzed holistically to infer seizure and normal random movements. The patient does not require to wear any special clothing, markers or sensors, hence it is totally non-intrusive. The user initializes the person-specific skin color and selects few face/head poses in the initial few frames. The system then tracks the head/face and extracts spatio-temporal features. Support vector machines are then used on these features to classify seizure-like movements from normal random movements. Experiments are performed on numerous long hour video sequences captured in an Epilepsy Monitoring Unit at a local hospital. The results demonstrate the feasibility of the proposed system in pediatric epilepsy monitoring and seizure detection.

  17. Refractory epileptic seizures due to vitamin B6 deficiency in a patient with Parkinson's disease under duodopa® therapy.

    PubMed

    Skodda, Sabine; Müller, Thomas

    2013-02-01

    Levodopa/carbidopa intestinal gel (LCIG) infusion for the treatment of advanced Parkinson's disease (PD) has been suspected to provoke polyneuropathy in conjunction with vitamin B6, B12 and folate deficiency and elevated homocysteine levels. We describe a PD patient under LCIG therapy developing refractory epileptic seizures obviously promoted by vitamin B6 deficiency.

  18. Chronic Trigeminal Nerve Stimulation Protects Against Seizures, Cognitive Impairments, Hippocampal Apoptosis, and Inflammatory Responses in Epileptic Rats.

    PubMed

    Wang, Qian-Qian; Zhu, Li-Jun; Wang, Xian-Hong; Zuo, Jian; He, Hui-Yan; Tian, Miao-Miao; Wang, Lei; Liang, Gui-Ling; Wang, Yu

    2016-05-01

    Trigeminal nerve stimulation (TNS) has recently been demonstrated effective in the treatment of epilepsy and mood disorders. Here, we aim to determine the effects of TNS on epileptogenesis, cognitive function, and the associated hippocampal apoptosis and inflammatory responses. Rats were injected with pilocarpine to produce status epilepticus (SE) and the following chronic epilepsy. After SE induction, TNS treatment was conducted for 4 consecutive weeks. A pilocarpine re-injection was then used to induce a seizure in the epileptic rats. The hippocampal neuronal apoptosis induced by seizure was assessed by TUNEL staining and inflammatory responses by immunohistochemistry and enzyme-linked immunosorbent assay (ELISA). The spontaneous recurrent seizure (SRS) number was counted through video monitoring, and the cognitive function assessed through Morris Water Maze (MWM) test. TNS treatment attenuated the SRS attacks and improved the cognitive impairment in epileptic rats. A pilocarpine re-injection resulted in less hippocampal neuronal apoptosis and reduced level of interleukin-1 beta (IL-1β), tumor necrosis factor-α (TNF-α), and microglial activation in epileptic rats with TNS treatment in comparison to the epileptic rats without TNS treatment. It is concluded that TNS treatment shortly after SE not only protected against the chronic spontaneous seizures but also improved cognitive impairments. These antiepileptic properties of TNS may be related to its attenuating effects on hippocampal apoptosis and pro-inflammatory responses.

  19. Controlled test for predictive power of Lyapunov exponents: Their inability to predict epileptic seizures

    NASA Astrophysics Data System (ADS)

    Lai, Ying-Cheng; Harrison, Mary Ann F.; Frei, Mark G.; Osorio, Ivan

    2004-09-01

    Lyapunov exponents are a set of fundamental dynamical invariants characterizing a system's sensitive dependence on initial conditions. For more than a decade, it has been claimed that the exponents computed from electroencephalogram (EEG) or electrocorticogram (ECoG) signals can be used for prediction of epileptic seizures minutes or even tens of minutes in advance. The purpose of this paper is to examine the predictive power of Lyapunov exponents. Three approaches are employed. (1) We present qualitative arguments suggesting that the Lyapunov exponents generally are not useful for seizure prediction. (2) We construct a two-dimensional, nonstationary chaotic map with a parameter slowly varying in a range containing a crisis, and test whether this critical event can be predicted by monitoring the evolution of finite-time Lyapunov exponents. This can thus be regarded as a "control test" for the claimed predictive power of the exponents for seizure. We find that two major obstacles arise in this application: statistical fluctuations of the Lyapunov exponents due to finite time computation and noise from the time series. We show that increasing the amount of data in a moving window will not improve the exponents' detective power for characteristic system changes, and that the presence of small noise can ruin completely the predictive power of the exponents. (3) We report negative results obtained from ECoG signals recorded from patients with epilepsy. All these indicate firmly that, the use of Lyapunov exponents for seizure prediction is practically impossible as the brain dynamical system generating the ECoG signals is more complicated than low-dimensional chaotic systems, and is noisy.

  20. Ngram-derived pattern recognition for the detection and prediction of epileptic seizures.

    PubMed

    Eftekhar, Amir; Juffali, Walid; El-Imad, Jamil; Constandinou, Timothy G; Toumazou, Christofer

    2014-01-01

    This work presents a new method that combines symbol dynamics methodologies with an Ngram algorithm for the detection and prediction of epileptic seizures. The presented approach specifically applies Ngram-based pattern recognition, after data pre-processing, with similarity metrics, including the Hamming distance and Needlman-Wunsch algorithm, for identifying unique patterns within epochs of time. Pattern counts within each epoch are used as measures to determine seizure detection and prediction markers. Using 623 hours of intracranial electrocorticogram recordings from 21 patients containing a total of 87 seizures, the sensitivity and false prediction/detection rates of this method are quantified. Results are quantified using individual seizures within each case for training of thresholds and prediction time windows. The statistical significance of the predictive power is further investigated. We show that the method presented herein, has significant predictive power in up to 100% of temporal lobe cases, with sensitivities of up to 70-100% and low false predictions (dependant on training procedure). The cases of highest false predictions are found in the frontal origin with 0.31-0.61 false predictions per hour and with significance in 18 out of 21 cases. On average, a prediction sensitivity of 93.81% and false prediction rate of approximately 0.06 false predictions per hour are achieved in the best case scenario. This compares to previous work utilising the same data set that has shown sensitivities of up to 40-50% for a false prediction rate of less than 0.15/hour.

  1. [Tetraplegia, resuscitation and epileptic seizures after partial colon resection in a 41-year-old woman].

    PubMed

    Wagner, W

    2014-01-01

    A 41-year-old woman, suffering from continuous abdominal pain, only presented a non-specific inflammation of the whole colon and an unclaryfied hyponatriaemia; in spite of the only doubtful explanation by an enormous elongation of the colon, it was partially resected. Thereafter, the patient's decline, hypaesthesia, areflexia and tetraparesis required intensive care. Despite immunoglobulin therapy, assuming a Guillain-Barré syndrome, the patient needed resuscitation, followed by signs of severe hypoxia (high level of neuron-specific enolase, hippocampal lesions). The abdominal pain, hyponatriaemia, persistent tachycardia, sensory deficits, tetraplegia, circulation arrest, later epileptic seizures and unusual urine color were finally explained by an acute intermittent porphyria (AIP). Although the symptoms were classic, the disease was recognized only very late. Indeed, it is so rare that most physicians will never be confronted with an AIP or only once or twice.

  2. Occurrence of menstrual cycle related seizure patterns among epileptic women attending the tertiary neurology clinics of the National Hospital of Sri Lanka.

    PubMed

    Kariyawasam, S H; Mannapperuma, U; Jayasuriya, W J A B N; Weerathunga, J; Munasinghe, K

    2009-04-01

    Female sex hormones estrogen and progesterone have effects on seizure activity. Patterns of seizure exacerbations associated with the menstrual cycle have been described as catamenial epilepsy. This study was done to investigate the menstrual cycle related seizure occurrence among female epileptics using seizure-menstrual calendars and sex hormonal assays. Frequency and the patterns of seizure occurrence within the menstrual cycles were determined analyzing seizure-menstrual calendars. Luteal phase serum estradiol and progesterone were determined in those with menstrual cycle related seizure patterns to be compared with that of healthy women. Out of 349 epileptics, 6% showed occurrence of perimenstrual, periovulatory or perimenstrual+periovulatory seizure patterns on analysis of seizure-menstrual calendars. These women showed significantly higher luteal serum estradiol concentrations in comparison to age-matched healthy volunteers. There was no significant difference in the luteal serum progesterone concentrations. This study showed menstrual cycle related patterns of seizure occurrence in a minority of Sri Lankan epileptic women, similar to catamenial epilepsy patterns described by previous studies. These seizure patterns may be due to altered hypothalamo-pituitary-gonadal axis function playing a role in the pathophysiology of epilepsy. We suggest the importance of maintaining seizure-menstrual calendars and hormonal studies in all epileptic women to establish the role of hypothalamo-pituitary-gonadal axis in epilepsy and to achieve efficient control of epilepsy in women of childbearing age.

  3. Nonrandom connectivity of the epileptic dentate gyrus predicts a major role for neuronal hubs in seizures

    PubMed Central

    Morgan, Robert J.; Soltesz, Ivan

    2008-01-01

    Many complex neuronal circuits have been shown to display nonrandom features in their connectivity. However, the functional impact of nonrandom network topologies in neurological diseases is not well understood. The dentate gyrus is an excellent circuit in which to study such functional implications because proepileptic insults cause its structure to undergo a number of specific changes in both humans and animals, including the formation of previously nonexistent granule cell-to-granule cell recurrent excitatory connections. Here, we use a large-scale, biophysically realistic model of the epileptic rat dentate gyrus to reconnect the aberrant recurrent granule cell network in four biologically plausible ways to determine how nonrandom connectivity promotes hyperexcitability after injury. We find that network activity of the dentate gyrus is quite robust in the face of many major alterations in granule cell-to-granule cell connectivity. However, the incorporation of a small number of highly interconnected granule cell hubs greatly increases network activity, resulting in a hyperexcitable, potentially seizure-prone circuit. Our findings demonstrate the functional relevance of nonrandom microcircuits in epileptic brain networks, and they provide a mechanism that could explain the role of granule cells with hilar basal dendrites in contributing to hyperexcitability in the pathological dentate gyrus. PMID:18375756

  4. Driving regulations and psychogenic non-epileptic seizures: perspectives from the United Kingdom.

    PubMed

    Morrison, Ian; Razvi, Saif S M

    2011-03-01

    The Driver and Vehicle Licensing Agency (DVLA) in the United Kingdom provides guidance on fitness to drive for patients with a number of medical illnesses, including epilepsy and psychogenic non-epileptic seizures (PNES). The Association of British Neurologists circulates a monthly electronic newsletter to its membership by email. We used this newsletter to survey its recipients on the driving advice they offer patients with PNES, and their awareness of current DVLA guidelines. 54 replies were received (19/54 were epilepsy specialists). 11/54 respondents were unaware of any DVLA guidance regarding PNES. Of 43/54 aware of DVLA guidance, only 7% felt that it was sufficient. 40% of respondents did not recommend any driving restriction. 68% of epilepsy specialists recommended driving restriction as compared to 54% of non-epilepsy specialists. 2 respondents reported patients with PNES who had an accident as a consequence of a non-epileptic attack. The risk of motor vehicle accidents in patients with PNES needs further study. Until the establishment of evidence-based guidelines, there is a need to seek consensus and provide sufficient guidance regarding driving for both patients with PNES and their clinicians.

  5. Effects of A1 receptor agonist/antagonist on spontaneous seizures in pilocarpine-induced epileptic rats.

    PubMed

    Amorim, Beatriz Oliveira; Hamani, Clement; Ferreira, Elenn; Miranda, Maísa Ferreira; Fernandes, Maria José S; Rodrigues, Antonio M; de Almeida, Antônio-Carlos G; Covolan, Luciene

    2016-08-01

    Adenosine is an endogenous anticonvulsant that activates pre- and postsynaptic adenosine A1 receptors. A1 receptor agonists increase the latency for the development of seizures and status epilepticus following pilocarpine administration. Although hippocampal adenosine is increased in the chronic phase of the pilocarpine model, it is not known whether the modulation of A1 receptors may influence the frequency of spontaneous recurrent seizures (SRS). Here, we tested the hypothesis that the A1 receptor agonist RPia ([R]-N-phenylisopropyladenosine) and the A1 antagonist DPCPX (8-Cyclopentyl-1,3-dipropylxanthine) administered to chronic pilocarpine epileptic rats would respectively decrease and increase the frequency of SRS and hippocampal excitability. Four months after Pilo-induced SE, chronic epileptic rats were video-monitored for the recording of SRS before (basal) and after a 2-week treatment with RPia (25μg/kg) or DPCPX (50μg/kg). Following sacrifice, brain slices were studied with electrophysiology. We found that rats given RPia had a 93% nonsignificant reduction in the frequency of seizures compared with their own pretreatment baseline. In contrast, the administration of DPCPX resulted in an 87% significant increase in seizure rate. Nontreated epileptic rats had a similar frequency of seizures along the study. Corroborating our behavioral data, in vitro recordings showed that slices from animals previously given DPCPX had a shorter latency to develop epileptiform activity, longer and higher DC shifts, and higher spike amplitude compared with slices from nontreated Pilo controls. In contrast, smaller spike amplitude was recorded in slices from animals given RPia. In summary, the administration of A1 agonists reduced hippocampal excitability but not the frequency of spontaneous recurrent seizures in chronic epileptic rats, whereas A1 receptor antagonists increased both.

  6. A coupled ordinary differential equation lattice model for the simulation of epileptic seizures.

    PubMed

    Larter, Raima; Speelman, Brent; Worth, Robert M.

    1999-09-01

    A coupled ordinary differential equation lattice model for the CA3 region of the hippocampus (a common location of the epileptic focus) is developed. This model consists of a hexagonal lattice of nodes, each describing a subnetwork consisting of a group of prototypical excitatory pyramidal cells and a group of prototypical inhibitory interneurons connected via on/off excitatory and inhibitory synapses. The nodes communicate using simple rules to simulate the diffusion of extracellular potassium. Both the integration time over which a node's trajectory is integrated before the diffusional event is allowed to occur and the level of inhibition in each node were found to be important parameters. Shorter integration times lead to total synchronization of the lattice (similar to synchronous neural activity occurring during a seizure) whereas longer times cause more random spatiotemporal behavior. Moderately diminished levels of inhibition lead to simple nodal oscillatory behavior. It is postulated that both the lack of inhibition and an alteration in conduction time may be necessary for the development of a behaviorally manifest seizure. (c) 1999 American Institute of Physics.

  7. Repeat interruptions in spinocerebellar ataxia type 10 expansions are strongly associated with epileptic seizures.

    PubMed

    McFarland, Karen N; Liu, Jilin; Landrian, Ivette; Zeng, Desmond; Raskin, Salmo; Moscovich, Mariana; Gatto, Emilia M; Ochoa, Adriana; Teive, Hélio A G; Rasmussen, Astrid; Ashizawa, Tetsuo

    2014-03-01

    Spinocerebellar ataxia type 10 (SCA10), an autosomal dominant neurodegenerative disorder, is the result of a non-coding, pentanucleotide repeat expansion within intron 9 of the Ataxin 10 gene. SCA10 patients present with pure cerebellar ataxia; yet, some families also have a high incidence of epilepsy. SCA10 expansions containing penta- and heptanucleotide interruption motifs, termed "ATCCT interruptions," experience large contractions during germline transmission, particularly in paternal lineages. At the same time, these alleles confer an earlier age at onset which contradicts traditional rules of genetic anticipation in repeat expansions. Previously, ATCCT interruptions have been associated with a higher prevalence of epileptic seizures in one Mexican-American SCA10 family. In a large cohort of SCA10 families, we analyzed whether ATCCT interruptions confer a greater risk for developing seizures in these families. Notably, we find that the presence of repeat interruptions within the SCA10 expansion confers a 6.3-fold increase in the risk of an SCA10 patient developing epilepsy (6.2-fold when considering patients of Mexican ancestry only) and a 13.7-fold increase in having a positive family history of epilepsy (10.5-fold when considering patients of Mexican ancestry only). We conclude that the presence of repeat interruptions in SCA10 repeat expansion indicates a significant risk for the epilepsy phenotype and should be considered during genetic counseling.

  8. A coupled ordinary differential equation lattice model for the simulation of epileptic seizures

    NASA Astrophysics Data System (ADS)

    Larter, Raima; Speelman, Brent; Worth, Robert M.

    1999-09-01

    A coupled ordinary differential equation lattice model for the CA3 region of the hippocampus (a common location of the epileptic focus) is developed. This model consists of a hexagonal lattice of nodes, each describing a subnetwork consisting of a group of prototypical excitatory pyramidal cells and a group of prototypical inhibitory interneurons connected via on/off excitatory and inhibitory synapses. The nodes communicate using simple rules to simulate the diffusion of extracellular potassium. Both the integration time over which a node's trajectory is integrated before the diffusional event is allowed to occur and the level of inhibition in each node were found to be important parameters. Shorter integration times lead to total synchronization of the lattice (similar to synchronous neural activity occurring during a seizure) whereas longer times cause more random spatiotemporal behavior. Moderately diminished levels of inhibition lead to simple nodal oscillatory behavior. It is postulated that both the lack of inhibition and an alteration in conduction time may be necessary for the development of a behaviorally manifest seizure.

  9. Epileptic Seizure Prediction based on Ratio and Differential Linear Univariate Features

    PubMed Central

    Rasekhi, Jalil; Mollaei, Mohammad Reza Karami; Bandarabadi, Mojtaba; Teixeira, César A.; Dourado, António

    2015-01-01

    Bivariate features, obtained from multichannel electroencephalogram recordings, quantify the relation between different brain regions. Studies based on bivariate features have shown optimistic results for tackling epileptic seizure prediction problem in patients suffering from refractory epilepsy. A new bivariate approach using univariate features is proposed here. Differences and ratios of 22 linear univariate features were calculated using pairwise combination of 6 electroencephalograms channels, to create 330 differential, and 330 relative features. The feature subsets were classified using support vector machines separately, as one of the two classes of preictal and nonpreictal. Furthermore, minimum Redundancy Maximum Relevance feature reduction method is employed to improve the predictions and reduce the number of false alarms. The studies were carried out on features obtained from 10 patients. For reduced subset of 30 features and using differential approach, the seizures were on average predicted in 60.9% of the cases (28 out of 46 in 737.9 h of test data), with a low false prediction rate of 0.11 h−1. Results of bivariate approaches were compared with those achieved from original linear univariate features, extracted from 6 channels. The advantage of proposed bivariate features is the smaller number of false predictions in comparison to the original 22 univariate features. In addition, reduction in feature dimension could provide a less complex and the more cost-effective algorithm. Results indicate that applying machine learning methods on a multidimensional feature space resulting from relative/differential pairwise combination of 22 univariate features could predict seizure onsets with high performance. PMID:25709936

  10. Parcel-based connectivity analysis of fMRI data for the study of epileptic seizure propagation.

    PubMed

    Tana, Maria Gabriella; Bianchi, Anna Maria; Sclocco, Roberta; Franchin, Tiziana; Cerutti, Sergio; Leal, Alberto

    2012-10-01

    The aim of this work is to improve fMRI Granger Causality Analysis (GCA) by proposing and comparing two strategies for defining the topology of the networks among which cerebral connectivity is measured and to apply fMRI GCA for studying epileptic seizure propagation. The first proposed method is based on information derived from anatomical atlas only; the other one is based on functional information and employs an algorithm of hierarchical clustering applied to fMRI data directly. Both methods were applied to signals recorded during seizures on a group of epileptic subjects and two connectivity matrices were obtained for each patient. The performances of the different parcellation strategies were evaluated in terms of their capability to recover information about the source and the sink of the network (i.e., the starting and the ending point of the seizure propagation). The first method allows to clearly identify the seizure onset in all patients, whereas the network sources are not so immediately recognizable when the second method was used. Nevertheless, results obtained using functional clustering do not contradict those obtained with the anatomical atlas and are able to individuate the main pattern of propagation. In conclusion, the way nodes are defined can influence the easiness of identification of the epileptogenic focus but does not produce contradictory results showing the effectiveness of proposed approach to formulate hypothesis about seizure propagation at least in the early phase of investigation.

  11. Three-dimensional optical tomographic brain imaging during kainic-acid-induced seizures in rats

    NASA Astrophysics Data System (ADS)

    Bluestone, Avraham Y.; Sakamoto, Kenichi; Hielscher, Andreas H.; Stewart, Mark

    2005-04-01

    In this study, we explored the potential of diffuse optical tomography for brain oximetry and describe our efforts towards imaging hemodynamic changes in rat brains during kainic-acid (KA) induced seizures. Using electrophysiological techniques we first showed that KA induces a pronounced transient hypotension in urethane anesthetized rats that is coincident with seizure activity beginning in ventral and spreading to dorsal hippocampus. We observed sustained increases in vagus and sympathetic activity during generalized limbic seizure activity, which alters blood pressure regulation and heart rhythms. Subsequently, we used optical tomographic methods to study KA induced seizures in anesthetized animals to better define the hemodynamic cerebral vascular response. We observed a lateralized increase in deoxyhemoglobin after KA injection at the time when the blood pressure (BP) was decreased. By contrast, injection of phenylephrine produced a symmetric global increase in total hemoglobin. These findings indicate that our instrument is sensitive to the local hemodynamics, both in response to a global increase in blood pressure (phenylephrine injection) and a lateralized decrease in oxyhemoglobin produced by an asymmetric response to KA; a response that may be critically important for severe autonomic nervous system alterations during seizures. The results of this study provide the impetus for combining complimentary modalities, imaging and electrophysiological, to ultimately gain a better understanding of the underlying physiology of seizure activity in the rat.

  12. [Multicystic encephalopathy with frontal lobe-originated gelastic seizure, ipsilateral oculogyric crisis, and horizontal epileptic nystagmus: an autopsy case].

    PubMed

    Ohara, K; Morita, Y; Takauchi, S; Takeda, T; Hayashi, S

    1996-08-01

    Attacks of gelastic (laughing) seizure are usually reported as complex partial seizures of temporal lobe epilepsy and seizures associated with hypothalamic hamartomas, but are rarely reported as complex partial seizures of frontal lobe origin. We recently encountered a 29-year-old woman who had gelastic seizure attacks from age 17. She had shown severe mental retardation with cerebral palsy at 7 months, and entered precocious puberty at age 7. Attacks of gelastic seizure with ipsilateral adversive seizures, ipsilateral oculogyric crisis, and horizontal epileptic nystagmus were observed until her death at age 29. Each gelastic seizure lasted 1 to 10 minutes. Her laughing was very strong and loud. Interictal spikes were observed over the right fronto-parietal lobe, but no ictal spike was detected. The neuropathological examinations of her brain revealed no hypothalamic lesions such as hamartomas, gliosis, and distinct neuronal loss. Her brain was severely affected with multicystic encephalopathy, and the bilateral temporal lobe tissues were almost replaced by the cystic changes. The right frontal lobe and occipital lobe were not cystic. From the clinicopathological examinations, the focus of her gelastic seizure was considered to be of the right frontal origin. The hippocampus and parahippocampal gyrus are major components of the limbic system, which is involved in affective emotions. Although the right hippocampus and parahippocampal gyrus were completely lost, and those of the left hemisphere were almost completely lost, by the multicystic replacements in this case, the gelastic seizure attacks were evoked from right frontal origin. The frontal lobe may play an important role in motor expressions of laughing. The motor expressions of the loud and strong laughing may be one of the characteristic features of frontal lobe-originated gelastic seizure of this case.

  13. Psychogenic non-epileptic seizures: so-called psychiatric comorbidity and underlying defense mechanisms

    PubMed Central

    Beghi, Massimiliano; Negrini, Paola Beffa; Perin, Cecilia; Peroni, Federica; Magaudda, Adriana; Cerri, Cesare; Cornaggia, Cesare Maria

    2015-01-01

    In Diagnostic and Statistical Manual of Mental Disorders, fifth edition, psychogenic non-epileptic seizures (PNES) do not have a unique classification as they can be found within different categories: conversion, dissociative, and somatization disorders. The ICD-10, instead, considers PNES within dissociative disorders, merging the dissociative disorders and conversion disorders, although the underlying defense mechanisms are different. The literature data show that PNES are associated with cluster B (mainly borderline) personality disorders and/or to people with depressive or anxiety disorders. Defense mechanisms in patients with PNES with a prevalence of anxious/depressive symptoms are of “neurotic” type; their goal is to lead to a “split”, either vertical (dissociation) or horizontal (repression). The majority of patients with this type of PNES have alexithymia traits, meaning that they had difficulties in feeling or perceiving emotions. In subjects where PNES are associated with a borderline personality, in which the symbolic function is lost, the defense mechanisms are of a more archaic nature (denial). PNES with different underlying defense mechanisms have different prognoses (despite similar severity of PNES) and need usually a different treatment (pharmacological or psychological). Thus, it appears superfluous to talk about psychiatric comorbidity, since PNES are a different symptomatic expression of specific psychiatric disorders. PMID:26491330

  14. Psychological and psychiatric aspects of psychogenic non-epileptic seizures (PNES): A systematic review.

    PubMed

    Brown, Richard J; Reuber, Markus

    2016-04-01

    Psychogenic non-epileptic seizures (PNES) are common in neurological settings and often associated with considerable distress and disability. The psychological mechanisms underlying PNES are poorly understood and there is a lack of well-established, evidence-based treatments. This paper advances our understanding of PNES by providing a comprehensive systematic review of the evidence pertaining to the main theoretical models of this phenomenon. Methodological quality appraisal and effect size calculation were conducted on one hundred forty empirical studies on the following aspects of PNES: life adversity, dissociation, anxiety, suggestibility, attentional dysfunction, family/relationship problems, insecure attachment, defence mechanisms, somatization/conversion, coping, emotion regulation, alexithymia, emotional processing, symptom modelling, learning and expectancy. Although most of the studies were only of low to moderate quality, some findings are sufficiently consistent to warrant tentative conclusions: (i) physical symptom reporting is elevated in patients with PNES; (ii) trait dissociation and exposure to traumatic events are common but not inevitable correlates of PNES; (iii) there is a mismatch between subjective reports of anxiety and physical arousal during PNES; and (iv) inconsistent findings in this area are likely to be attributable to the heterogeneity of patients with PNES. Empirical, theoretical and clinical implications are discussed.

  15. Identification of compounds with anti-convulsant properties in a zebrafish model of epileptic seizures

    PubMed Central

    Baxendale, Sarah; Holdsworth, Celia J.; Meza Santoscoy, Paola L.; Harrison, Michael R. M.; Fox, James; Parkin, Caroline A.; Ingham, Philip W.; Cunliffe, Vincent T.

    2012-01-01

    SUMMARY The availability of animal models of epileptic seizures provides opportunities to identify novel anticonvulsants for the treatment of people with epilepsy. We found that exposure of 2-day-old zebrafish embryos to the convulsant agent pentylenetetrazole (PTZ) rapidly induces the expression of synaptic-activity-regulated genes in the CNS, and elicited vigorous episodes of calcium (Ca2+) flux in muscle cells as well as intense locomotor activity. We then screened a library of ∼2000 known bioactive small molecules and identified 46 compounds that suppressed PTZ-inducedtranscription of the synaptic-activity-regulated gene fos in 2-day-old (2 dpf) zebrafish embryos. Further analysis of a subset of these compounds, which included compounds with known and newly identified anticonvulsant properties, revealed that they exhibited concentration-dependent inhibition of both locomotor activity and PTZ-induced fos transcription, confirming their anticonvulsant characteristics. We conclude that this in situ hybridisation assay for fos transcription in the zebrafish embryonic CNS is a robust, high-throughput in vivo indicator of the neural response to convulsant treatment and lends itself well to chemical screening applications. Moreover, our results demonstrate that suppression of PTZ-induced fos expression provides a sensitive means of identifying compounds with anticonvulsant activities. PMID:22730455

  16. Large-Scale Modeling of Epileptic Seizures: Scaling Properties of Two Parallel Neuronal Network Simulation Algorithms

    DOE PAGES

    Pesce, Lorenzo L.; Lee, Hyong C.; Hereld, Mark; ...

    2013-01-01

    Our limited understanding of the relationship between the behavior of individual neurons and large neuronal networks is an important limitation in current epilepsy research and may be one of the main causes of our inadequate ability to treat it. Addressing this problem directly via experiments is impossibly complex; thus, we have been developing and studying medium-large-scale simulations of detailed neuronal networks to guide us. Flexibility in the connection schemas and a complete description of the cortical tissue seem necessary for this purpose. In this paper we examine some of the basic issues encountered in these multiscale simulations. We have determinedmore » the detailed behavior of two such simulators on parallel computer systems. The observed memory and computation-time scaling behavior for a distributed memory implementation were very good over the range studied, both in terms of network sizes (2,000 to 400,000 neurons) and processor pool sizes (1 to 256 processors). Our simulations required between a few megabytes and about 150 gigabytes of RAM and lasted between a few minutes and about a week, well within the capability of most multinode clusters. Therefore, simulations of epileptic seizures on networks with millions of cells should be feasible on current supercomputers.« less

  17. Chronic activity wheel running reduces the severity of kainic acid-induced seizures in the rat: possible role of galanin.

    PubMed

    Reiss, J I; Dishman, R K; Boyd, H E; Robinson, J K; Holmes, P V

    2009-04-17

    Studies in both humans and rodents suggest that exercise can be neuroprotective, but the mechanisms by which this occurs are still poorly understood. Three weeks of voluntary, physical activity in rats upregulates prepro-galanin messenger RNA levels in the locus coeruleus. Galanin is a neuropeptide extensively coexisting with norepinephrine that decreases neuronal hyperexcitability both in vivo and in vitro. Thus, exercise may diminish neural hyperexcitability through a galaninergic mechanism. The current experiments tested whether voluntary activity wheel running would protect against kainic acid-evoked seizures and whether galaninergic signaling is a necessary factor in this protection. In experiment 1, rats were given access to running wheels or remained sedentary for three weeks. After this period, rats received an intraperitoneal (i.p.) injection of 0, 7, 10 or 14 mg/kg kainic acid. Exercise decreased the severity of or eliminated seizure behaviors and hippocampal c-fos expression induced by kainic acid. In experiment 2, exercising or sedentary rats were injected intracerebroventricularly (i.c.v.) with 0.2 or 0.4 microg of kainic acid following either an injection of M-40 (a galanin receptor antagonist) or saline. Exercise decreased kainic acid-induced seizures at the 0.2 microg dose, and M-40 (6 nmol) decreased this effect. In contrast, there were no detectable differences between exercising and sedentary rats in behavior at the 0.4 microg dose. The results suggest that the protective effects of exercise against seizures are at least partially mediated by regulation of neural excitability through a process involving galanin.

  18. Classification of epileptic seizures using wavelet packet log energy and norm entropies with recurrent Elman neural network classifier.

    PubMed

    Raghu, S; Sriraam, N; Kumar, G Pradeep

    2017-02-01

    Electroencephalogram shortly termed as EEG is considered as the fundamental segment for the assessment of the neural activities in the brain. In cognitive neuroscience domain, EEG-based assessment method is found to be superior due to its non-invasive ability to detect deep brain structure while exhibiting superior spatial resolutions. Especially for studying the neurodynamic behavior of epileptic seizures, EEG recordings reflect the neuronal activity of the brain and thus provide required clinical diagnostic information for the neurologist. This specific proposed study makes use of wavelet packet based log and norm entropies with a recurrent Elman neural network (REN) for the automated detection of epileptic seizures. Three conditions, normal, pre-ictal and epileptic EEG recordings were considered for the proposed study. An adaptive Weiner filter was initially applied to remove the power line noise of 50 Hz from raw EEG recordings. Raw EEGs were segmented into 1 s patterns to ensure stationarity of the signal. Then wavelet packet using Haar wavelet with a five level decomposition was introduced and two entropies, log and norm were estimated and were applied to REN classifier to perform binary classification. The non-linear Wilcoxon statistical test was applied to observe the variation in the features under these conditions. The effect of log energy entropy (without wavelets) was also studied. It was found from the simulation results that the wavelet packet log entropy with REN classifier yielded a classification accuracy of 99.70 % for normal-pre-ictal, 99.70 % for normal-epileptic and 99.85 % for pre-ictal-epileptic.

  19. Enhanced seizures and hippocampal neurodegeneration following kainic acid-induced seizures in metallothionein-I + II-deficient mice.

    PubMed

    Carrasco, J; Penkowa, M; Hadberg, H; Molinero, A; Hidalgo, J

    2000-07-01

    Metallothioneins (MTs) are major zinc binding proteins in the CNS that could be involved in the control of zinc metabolism as well as in protection against oxidative stress. Mice lacking MT-I and MT-II (MT-I + II deficient) because of targeted gene inactivation were injected with kainic acid (KA), a potent convulsive agent, to examine the neurobiological importance of these MT isoforms. At 35 mg/kg KA, MT-I + II deficient male mice showed a higher number of convulsions and a longer convulsion time than control mice. Three days later, KA-injected mice showed gliosis and neuronal injury in the hippocampus. MT-I + II deficiency decreased both astrogliosis and microgliosis and potentiated neuronal injury and apoptosis as shown by terminal deoxynucleotidyl transferase-mediated in situ end labelling (TUNEL), detection of single stranded DNA (ssDNA) and by increased interleukin-1beta-converting enzyme (ICE) and caspase-3 levels. Histochemically reactive zinc in the hippocampus was increased by KA to a greater extent in MT-I + II-deficient compared with control mice. KA-induced seizures also caused increased oxidative stress, as suggested by the malondialdehyde (MDA) and protein tyrosine nitration (NITT) levels and by the expression of MT-I + II, nuclear factor-kappaB (NF-kappaB), and Cu/Zn-superoxide dismutase (Cu/Zn-SOD). MT-I + II deficiency potentiated the oxidative stress caused by KA. Both KA and MT-I + II deficiency significantly affected the expression of MT-III, granulocyte-macrophage colony stimulating factor (GM-CSF) and its receptor (GM-CSFr). The present results indicate MT-I + II as important for neuron survival during KA-induced seizures, and suggest that both impaired zinc regulation and compromised antioxidant activity contribute to the observed neuropathology of the MT-I + II-deficient mice.

  20. Optogenetic activation of VGLUT2-expressing excitatory neurons blocks epileptic seizure-like activity in the mouse entorhinal cortex

    PubMed Central

    Yekhlef, Latefa; Breschi, Gian Luca; Taverna, Stefano

    2017-01-01

    We investigated whether an anti-epileptic effect is obtained by selectively activating excitatory neurons expressing ChR2 under the promoter for the synaptic vesicular glutamate transporter 2 (VGLUT2). VGLUT2-expressing cells were optically stimulated while local field potential and whole-cell patch-clamp recordings were performed in mouse entorhinal cortical slices perfused with the proconvulsive compound 4-aminopyridine (4-AP). In control conditions, blue light flashes directly depolarized the majority of putative glutamatergic cells, which in turn synaptically excited GABAergic interneurons. During bath perfusion with 4-AP, photostimuli triggered a fast EPSP-IPSP sequence which was often followed by tonic-clonic seizure-like activity closely resembling spontaneous ictal discharges. The GABAA-receptor antagonist gabazine blocked the progression of both light-induced and spontaneous seizures. Surprisingly, prolonged photostimuli delivered during ongoing seizures caused a robust interruption of synchronous discharges. Such break was correlated with a membrane potential depolarization block in principal cells, while putative GABAergic interneurons changed their firing activity from a burst-like to an irregular single-spike pattern. These data suggest that photostimulation of glutamatergic neurons triggers seizure-like activity only in the presence of an intact GABAergic transmission and that selectively activating the same glutamatergic cells robustly interrupts ongoing seizures by inducing a strong depolarization block, resulting in the disruption of paroxysmal burst-like firing. PMID:28230208

  1. Independent Neuronal Origin of Seizures and Behavioral Comorbidities in an Animal Model of a Severe Childhood Genetic Epileptic Encephalopathy

    PubMed Central

    Asinof, Samuel K.; Sukoff Rizzo, Stacey J.; Buckley, Alexandra R.; Beyer, Barbara J.; Letts, Verity A.; Frankel, Wayne N.; Boumil, Rebecca M.

    2015-01-01

    The childhood epileptic encephalopathies (EE’s) are seizure disorders that broadly impact development including cognitive, sensory and motor progress with severe consequences and comorbidities. Recently, mutations in DNM1 (dynamin 1) have been implicated in two EE syndromes, Lennox-Gastaut Syndrome and Infantile Spasms. Dnm1 encodes dynamin 1, a large multimeric GTPase necessary for activity-dependent membrane recycling in neurons, including synaptic vesicle endocytosis. Dnm1Ftfl or “fitful” mice carry a spontaneous mutation in the mouse ortholog of DNM1 and recapitulate many of the disease features associated with human DNM1 patients, providing a relevant disease model of human EE’s. In order to examine the cellular etiology of seizures and behavioral and neurological comorbidities, we engineered a conditional Dnm1Ftfl mouse model of DNM1 EE. Observations of Dnm1 Ftfl/flox mice in combination with various neuronal subpopulation specific cre strains demonstrate unique seizure phenotypes and clear separation of major neurobehavioral comorbidities from severe seizures associated with the germline model. This demonstration of pleiotropy suggests that treating seizures per se may not prevent severe comorbidity observed in EE associated with dynamin-1 mutations, and is likely to have implications for other genetic forms of EE. PMID:26125563

  2. Total corpus callosotomy for epileptic spasms after acute encephalopathy with biphasic seizures and late reduced diffusion (AESD) in a case with tuberous sclerosis complex.

    PubMed

    Okanishi, Tohru; Fujimoto, Ayataka; Motoi, Hirotaka; Kanai, Sotaro; Nishimura, Mitsuyo; Yamazoe, Tomohiro; Takagi, Atsushi; Yamamoto, Takamichi; Enoki, Hideo

    2016-12-03

    Corpus callosotomy is a palliative therapy for refractory epilepsy, including West syndrome, without a resectable epileptic focus. The surgical outcome of corpus callosotomy is relatively favorable in cryptogenic (non-lesional) West syndrome. Tuberous sclerosis complex (TSC) is a disorder that frequently leads to the development of refractory seizures by multiple cortical tubers. The multiple cortical tubers cause multiple or wide epileptic networks in these cases. Most of West syndrome cases in TSC with multiple tubers need additional resective surgery after corpus callosotomy. We describe a case of TSC in a boy aged 4years and 8months. He had multiple cortical tubers on his brain and developed epileptic spasms. The seizures were controlled with valproate. At the age of 1year and 4months, he presented with acute encephalopathy with biphasic seizures and late reduced diffusion (AESD), and had relapsed epileptic spasms one month after the onset of the encephalopathy. The seizures were refractory to multiple antiepileptic drugs. A total corpus callosotomy was performed at the age of 3years and 8months. The patient did not show any seizures after the surgery. During 12months of the follow-up, the patient was free from any seizures. Even in cases of symptomatic WS with multiple lesions, total corpus callosotomy may be a good strategy if the patients have secondary diffuse brain insults.

  3. The similarities between the hallucinations associated with the partial epileptic seizures of the occipital lobe and ball lightning observations

    NASA Astrophysics Data System (ADS)

    Cooray, G. K.; Cooray, V.

    2007-12-01

    Ball Lightning was seen and described since antiquity and recorded in many places. Ball lightning is usually observed during thunderstorms but large number of ball lightning observations is also reported during fine weather without any connection to thunderstorms or lightning. However, so far no one has managed to generate them in the laboratory. It is photographed very rarely and in many cases the authenticity of them is questionable. It is possible that many different phenomena are grouped together and categorized simply as ball lightning. Indeed, the visual hallucinations associated with simple partial epileptic seizures, during which the patient remains conscious, may also be categorized by a patient unaware of his or her condition as ball lightning observation. Such visual hallucinations may occur as a result of an epileptic seizure in the occipital, temporo-occipital or temporal lobes of the cerebrum [1,2,3]. In some cases the hallucination is perceived as a coloured ball moving horizontally from the periphery to the centre of the vision. The ball may appear to be rotating or spinning. The colour of the ball can be red, yellow, blue or green. Sometimes, the ball may appear to have a solid structure surrounded by a thin glow or in other cases the ball appears to generate spark like phenomena. When the ball is moving towards the centre of the vision it may increase its intensity and when it reaches the centre it can 'explode' illuminating the whole field of vision. During the hallucinations the vision is obscured only in the area occupied by the apparent object. The hallucinations may last for 5 to 30 seconds and rarely up to a minute. Occipital seizures may spread into other regions of the brain giving auditory, olfactory and sensory sensations. These sensations could be buzzing sounds, the smell of burning rubber, pain with thermal perception especially in the arms and the face, and numbness and tingling sensation. In some cases a person may experience only

  4. A low-power configurable neural recording system for epileptic seizure detection.

    PubMed

    Qian, Chengliang; Shi, Jess; Parramon, Jordi; Sánchez-Sinencio, Edgar

    2013-08-01

    This paper describes a low-power configurable neural recording system capable of capturing and digitizing both neural action-potential (AP) and fast-ripple (FR) signals. It demonstrates the functionality of epileptic seizure detection through FR recording. This system features a fixed-gain, variable-bandwidth (BW) front-end circuit and a sigma-delta ADC with scalable bandwidth and power consumption. The ADC employs a 2nd-order single-bit sigma-delta modulator (SDM) followed by a low-power decimation filter. Direct impulse-response implementation of a sinc(3) filter and 8-cycle data pipelining in an IIR filter are proposed for the decimation filter design to improve the power and area efficiency. In measurements, the front end exhibits 39.6-dB DC gain, 0.8 Hz to 5.2 kHz of BW, 5.86- μVrms input-referred noise, and 2.4- μW power consumption in AP mode, while showing 38.5-dB DC gain, 250 to 486 Hz of BW, 2.48- μVrms noise, and 4.5- μW power consumption in FR mode. The noise efficiency factor (NEF) is 2.93 and 7.6 for the AP and FR modes, respectively. At 77-dB dynamic range (DR), the ADC has a peak SNR and SNDR of 75.9 dB and 67 dB, respectively, while consuming 2.75-mW power in AP mode. It achieves 78-dB DR, 76.2-dB peak SNR, 73.2-dB peak SNDR, and 588- μW power consumption in FR mode. Both analog and digital power supply voltages are 2.8 V. The chip is fabricated in a standard 0.6- μm CMOS process. The die size is 11.25 mm(2).

  5. Dynamics of regional brain activity in epilepsy: a cross-disciplinary study on both intracranial and scalp-recorded epileptic seizures

    NASA Astrophysics Data System (ADS)

    Minadakis, George; Ventouras, Errikos; Gatzonis, Stylianos D.; Siatouni, Anna; Tsekou, Hara; Kalatzis, Ioannis; Sakas, Damianos E.; Stonham, John

    2014-04-01

    Objective. Recent cross-disciplinary literature suggests a dynamical analogy between earthquakes and epileptic seizures. This study extends the focus of inquiry for the applicability of models for earthquake dynamics to examine both scalp-recorded and intracranial electroencephalogram recordings related to epileptic seizures. Approach. First, we provide an updated definition of the electric event in terms of magnitude and we focus on the applicability of (i) a model for earthquake dynamics, rooted in a nonextensive Tsallis framework, (ii) the traditional Gutenberg and Richter law and (iii) an alternative method for the magnitude-frequency relation for earthquakes. Second, we apply spatiotemporal analysis in terms of nonextensive statistical physics and we further examine the behavior of the parameters included in the nonextensive formula for both types of electroencephalogram recordings under study. Main results. We confirm the previously observed power-law distribution, showing that the nonextensive formula can adequately describe the sequences of electric events included in both types of electroencephalogram recordings. We also show the intermittent behavior of the epileptic seizure cycle which is analogous to the earthquake cycles and we provide evidence of self-affinity of the regional electroencephalogram epileptic seizure activity. Significance. This study may provide a framework for the analysis and interpretation of epileptic brain activity and other biological phenomena with similar underlying dynamical mechanisms.

  6. Phenobarbital administration every eight hours: improvement of seizure management in idiopathic epileptic dogs with decreased phenobarbital elimination half-life.

    PubMed

    Stabile, F; Barnett, C R; De Risio, L

    2017-02-18

    Estimated prevalence of canine idiopathic epilepsy is 0.6 per cent in the first-opinion canine population in the UK. Phenobarbital monotherapy has been reported to reduce/eradicate seizure activity in 60-93 per cent of idiopathic epileptic dogs (IEDs). The objective of this study was to evaluate safety and efficacy of the administration of phenobarbital orally every eight hours in IEDs with phenobarbital elimination half-life less than 20 hours. Medical records of 10 IEDs in which steady state trough serum phenobarbital levels were within the reference range and phenobarbital elimination half-life had become less than 20 hours following prolonged administration every 12 hours were reviewed. Side effects and seizure frequency when phenobarbital was administered every 12 hours or 8 hours were compared. In all dogs the side effects of the antiepileptic medication treatment improved. When phenobarbital was administered every eight hours, 9/10 dogs experienced improvement in seizure frequency and 8/10 dogs maintained seizure freedom for a period three times longer than the longest interictal interval period previously recorded. Reduction in the severity and number of clusters of seizures was recorded in one of the remaining two dogs. The administration of phenobarbital orally every eight hours in IEDs with decreased phenobarbital elimination half-life appears safe and can improve seizure management. The results of this study were presented in abstract form (poster) for the 28th symposium of the European Society of Veterinary Neurology - European College of Veterinary Neurology (ESVN), September 18-19, 2015, Amsterdam, Netherlands.

  7. Altered expression of adrenocorticotropic hormone in the epileptic gerbil hippocampus following spontaneous seizure.

    PubMed

    Oh, Yun-Jung; Kim, Heung-No; Jeong, Ji-Heon; Park, Dae-Kyoon; Park, Kyung-Ho; Ko, Jeong-Sik; Kim, Duk-Soo

    2013-02-01

    We investigated the temporal alterations of adrenocorticotropic hormone (ACTH) immunoreactivity in the hippocampus after seizure onset. Expression of ACTH was observed within interneurons in the pre-seizure group of seizure sensitive gerbils, whereas its immunoreactivities were rarely detected in seizure resistant gerbil. Three hr after the seizure, ACTH immunoreactivity was significantly increased in interneurons within all hippocampal regions. On the basis of their localization and morphology through immunofluorescence staining, these cells were identified as GABAA α1-containing interneurons. At the 12 hr postictal period, ACTH expression in these regions was down-regulated, in a similar manner to the pre-seizure group of gerbils. These findings support the increase in ACTH synthesis that contributes to a reduction of corticotrophin-releasing factor via the negative feedback system which in turn provides an opportunity to enhance the excitability of GABAergic interneurons. Therefore, ACTH may play an important role in the reduction of excitotoxicity in all hippocampal regions.

  8. Plic-1, a new target in repressing epileptic seizure by regulation of GABAAR function in patients and a rat model of epilepsy.

    PubMed

    Zhang, Yujiao; Li, Zengyou; Gu, Juan; Zhang, Yanke; Wang, Wei; Shen, Hui; Chen, Guojun; Wang, Xuefeng

    2015-12-01

    Dysfunction of γ-aminobutyric acid A (GABAA) receptors (GABAARs) is a prominent factor affecting intractable epilepsy. Plic-1, an ubiquitin-like protein enriched in the inhibitory synapses connecting GABAARs and the ubiquitin protease system (UPS), plays a key role in the modification of GABAAR functions. However, the relationship between Plic-1 and epileptogenesis is not known. In the present study, we aimed to investigate Plic-1 levels in patients with temporal lobe epilepsy, as well as the role of Plic-1 in regulating onset and progression of epilepsy in animal models. We found that Plic-1 expression was significantly decreased in patients with epilepsy as well as pilocarpine- and pentylenetetrazol (PTZ)-induced rat epileptic models. Intrahippocampal injection of the PePα peptide, which disrupts Plic-1 binding to GABAARs, significantly shortened the latency of seizure onset, and increased the seizure severity and duration in these two epileptic models. Overexpressed Plic-1 through lentivirus transfection into a PTZ model resulted in a reduction in both seizure severity and generalized tonic-clonic seizure duration. Whole-cell clamp recordings revealed that the PePα peptide decreased miniature inhibitory postsynaptic currents (mIPSCs) whereas overexpressed Plic-1 increased mIPSCs in the pyramidal neurons of the hippocampus. These effects can be blocked by picrotoxin, a GABAAR inhibitor. Our results indicate that Plic-1 plays an important role in managing epileptic seizures by enhancing seizure inhibition through regulation of GABAARs at synaptic sites.

  9. NeuroKinect: A Novel Low-Cost 3Dvideo-EEG System for Epileptic Seizure Motion Quantification.

    PubMed

    Cunha, João Paulo Silva; Choupina, Hugo Miguel Pereira; Rocha, Ana Patrícia; Fernandes, José Maria; Achilles, Felix; Loesch, Anna Mira; Vollmar, Christian; Hartl, Elisabeth; Noachtar, Soheyl

    2016-01-01

    motion trajectories when compared to a 2D frame by frame tracking procedure. We conclude that this new approach provides a more comfortable (both for patients and clinical professionals), simpler, faster and lower-cost procedure than previous approaches, therefore providing a reliable tool to quantitatively analyze MOI patterns of epileptic seizures in the routine of EMUs around the world. We hope this study encourages other EMUs to adopt similar approaches so that more quantitative information is used to improve epilepsy diagnosis.

  10. [Effect of citicoline on the development of chronic epileptization of the brain (pentylenetetrazole kindling) and acute seizures reaction of kindled mice C57Bl/6].

    PubMed

    Kuznetzova, L V; Karpova, M N; Zinkovsky, K A; Klishina, N V

    2014-01-01

    In experiments on mice C57Bl/6 was studied effects of citicoline (500 mg/kg, i.p.) on development of chronically epileptization of the brain--pentylenetetrazole (PTZ) kindling (30 mg/kg PTZ, i.p. during 24 days) and on acute generalized seizures (i.v., 1% solution of PTZ with the speed of 0.01 ml/s). It was shown that daily injection of citicoline an hour before the introduction of PTZ had no effect on development of chronically epileptization of the brain --PTZ-kindling (the latency of seizures appearance and their severity). However, citicoIine posses anticonvulsive effects on acute seizures in kindled mice. In animals with increased seizure susceptibility of the brain caused by kindling and severity of seizures 2-3 points injection citicoline after 14 days of kindling had anticonvulsive effect, increasing the threshold clonic seizures. Injection of citicoline during 24 days of kindled animals and severity of seizures 3-5 points caused the increase of thresholds as clonic and tonic phase of seizures with lethal outcome. Thus, the anticonvulsant effect of citicoline more pronounced in the long-term use.

  11. NeuroKinect: A Novel Low-Cost 3Dvideo-EEG System for Epileptic Seizure Motion Quantification

    PubMed Central

    Cunha, João Paulo Silva; Choupina, Hugo Miguel Pereira; Rocha, Ana Patrícia; Fernandes, José Maria; Achilles, Felix; Loesch, Anna Mira; Vollmar, Christian; Hartl, Elisabeth; Noachtar, Soheyl

    2016-01-01

    body motion trajectories when compared to a 2D frame by frame tracking procedure. We conclude that this new approach provides a more comfortable (both for patients and clinical professionals), simpler, faster and lower-cost procedure than previous approaches, therefore providing a reliable tool to quantitatively analyze MOI patterns of epileptic seizures in the routine of EMUs around the world. We hope this study encourages other EMUs to adopt similar approaches so that more quantitative information is used to improve epilepsy diagnosis. PMID:26799795

  12. Cannabidiol Post-Treatment Alleviates Rat Epileptic-Related Behaviors and Activates Hippocampal Cell Autophagy Pathway Along with Antioxidant Defense in Chronic Phase of Pilocarpine-Induced Seizure.

    PubMed

    Hosseinzadeh, Mahshid; Nikseresht, Sara; Khodagholi, Fariba; Naderi, Nima; Maghsoudi, Nader

    2016-04-01

    Abnormal and sometimes severe behavioral and molecular symptoms are usually observed in epileptic humans and animals. To address this issue, we examined the behavioral and molecular aspects of seizure evoked by pilocarpine. Autophagy can promote both cell survival and death, but there are controversial reports about the neuroprotective or neurodegenerative effects of autophagy in seizure. Cannabidiol has anticonvulsant properties in some animal models when used as a pretreatment. In this study, we investigated alteration of seizure scores, autophagy pathway proteins, and antioxidant status in hippocampal cells during the chronic phase of pilocarpine-induced epilepsy after treatment with cannabidiol. Cannabidiol (100 ng, intracerebroventricular injection) delayed the chronic phase of epilepsy. Single administration of cannabidiol during the chronic phase of seizure significantly diminished seizure scores such as mouth clonus, head nodding, monolateral and bilateral forelimb clonus and increased the activity of catalase enzyme and reduced glutathione content. Such a protective effect in the behavioral scores of epileptic rats was also observed after repeated administrations of cannabidiol at the onset of the silent phase. Moreover, the amount of Atg7, conjugation of Atg5/12, Atg12, and LC3II/LC3I ratio increased significantly in epileptic rats treated with repeated injections of cannabidiol. In short, our results suggest that post-treatment of Cannabidiol could enhance the induction of autophagy pathway and antioxidant defense in the chronic phase of epilepsy, which could be considered as the protective mechanisms of cannabidiol in a temporal lobe epilepsy model.

  13. Continuous administration of antisense oligonucleotides to c-fos reduced the development of seizure susceptibility after ethacrynic acid-induced seizure in mice.

    PubMed

    Suzukawa, Junko; Omori, Kyoko; Yang, Li; Inagaki, Chiyoko

    2003-09-25

    We previously demonstrated that seizure susceptibility developed by the 14th day post-ethacrynic acid (EA)-induced seizure in mice, with a prolonged increase in the expression of c-fos mRNA in the brain during days 10-14. To examine whether such c-fos increase contributes to the development of seizure susceptibility, we administered antisense oligodeoxynucleotide to c-fos by continuous infusion into the lateral ventricle of mice that had shown a moderate stage of EA seizure, and evaluated the seizure susceptibility to kainic acid (10 mg/kg) on the 14th day. Antisense-infused mice displayed significant reduction of the c-Fos level in the hippocampus and cerebral cortex on the 7th and 14th days, and a significant decrease in seizure severity. These findings suggest that the prolonged increase in c-fos expression after EA seizure may lead to the development of seizure susceptibility.

  14. Which Brain Regions are Important for Seizure Dynamics in Epileptic Networks? Influence of Link Identification and EEG Recording Montage on Node Centralities.

    PubMed

    Geier, Christian; Lehnertz, Klaus

    2017-02-01

    Nodes in large-scale epileptic networks that are crucial for seizure facilitation and termination can be regarded as potential targets for individualized focal therapies. Graph-theoretical approaches based on centrality concepts can help to identify such important nodes, however, they may be influenced by the way networks are derived from empirical data. Here we investigate evolving functional epileptic brain networks during 82 focal seizures with different anatomical onset locations that we derive from multichannel intracranial electroencephalographic recordings from 51 patients. We demonstrate how the various methodological steps (from the recording montage via node and link inference to the assessment of node centralities) affect importance estimation and discuss their impact on the interpretability of findings in the context of pathophysiological aspects of seizure dynamics.

  15. Effects of cell phone radiation on lipid peroxidation, glutathione and nitric oxide levels in mouse brain during epileptic seizure.

    PubMed

    Esmekaya, Meric Arda; Tuysuz, Mehmet Zahid; Tomruk, Arın; Canseven, Ayse G; Yücel, Engin; Aktuna, Zuhal; Keskil, Semih; Seyhan, Nesrin

    2016-09-01

    The objective of the this study was to evaluate the effects of cellular phone radiation on oxidative stress parameters and oxide levels in mouse brain during pentylenetetrazole (PTZ) induced epileptic seizure. Eight weeks old mice were used in the study. Animals were distributed in the following groups: Group I: Control group treated with PTZ, Group II: 15min cellular phone radiation+PTZ treatment+30min cellular phone radiation, Group III: 30min cellular phone radiation+PTZ treatment+30min cellular phone radiation. The RF radiation was produced by a 900MHz cellular phone. Lipid peroxidation, which is the indicator of oxidative stress was quantified by measuring the formation of thiobarbituric acid reactive substances (TBARS). The glutathione (GSH) levels were determined by the Ellman method. Tissue total nitric oxide (NOx) levels were obtained using the Griess assay. Lipid peroxidation and NOx levels of brain tissue increased significantly in group II and III compared to group I. On the contrary, GSH levels were significantly lower in group II and III than group I. However, no statistically significant alterations in any of the endpoints were noted between group II and Group III. Overall, the experimental findings demonstrated that cellular phone radiation may increase the oxidative damage and NOx level during epileptic activity in mouse brain.

  16. Rat epileptic seizures evoked by BmK {alpha}IV and its possible mechanisms involved in sodium channels

    SciTech Connect

    Chai Zhifang; Bai Zhantao; Zhang Xuying; Liu Tong; Pang Xueyan; Ji Yonghua . E-mail: yhji@server.shcnc.ac.cn

    2007-05-01

    This study showed that rat unilateral intracerebroventricular injection of BmK {alpha}IV, a sodium channel modulator derived from scorpion Buthus martensi Karsch, induced clusters of spikes, epileptic discharges and convulsion-related behavioral changes. BmK {alpha}IV potently promoted the release of endogenous glutamate from rat cerebrocortical synaptosomes. In vitro examination of the effect of BmK {alpha}IV on intrasynaptosomal free calcium concentration [Ca{sup 2+}]{sub i} and sodium concentration [Na{sup +}]{sub i} revealed that BmK {alpha}IV-evoked glutamate release from synaptosomes was associated with an increase in Ca{sup 2+} and Na{sup +} influx. Moreover, BmK {alpha}IV-mediated glutamate release and ion influx was completely blocked by tetrodotoxin, a blocker of sodium channel. Together, these results suggest that the induction of BmK {alpha}IV-evoked epileptic seizures may be involved in the modulation of BmK {alpha}IV on tetrodotoxin-sensitive sodium channels located on the nerve terminal, which subsequently enhances the Ca{sup 2+} influx to cause an increase of glutamate release. These findings may provide some insight regarding the mechanism of neuronal action of BmK {alpha}IV in the central nervous system for understanding epileptogenesis involved in sodium channels.

  17. Baccoside A suppresses epileptic-like seizure/convulsion in Caenorhabditis elegans.

    PubMed

    Pandey, Rakesh; Gupta, Shipra; Tandon, Sudeep; Wolkenhauer, Olaf; Vera, Julio; Gupta, Shailendra K

    2010-09-01

    The 1 mm long Caenorhabditis elegans is one of the prime research tools to study different human neurodegenerative diseases. We have considered the case in which increase in the surrounding temperature of this multicellular model leads to abnormal bursts of neuronal cells that can be linked to seizure or convulsion. The induction of such seizure/convulsion mechanism was done by gradually increasing the temperature with 1x buffer (100 mM NaCl, 50 mM MgCl(2)) in adult C. elegans. In the present experiment it is demonstrated that Baccoside A can significantly reduce the seizure/convulsion in C. elegans at higher temperatures (26-28+/-1 degrees C). Furthermore, in T-type Ca(2+) channel cca-1 mutant worms, no convulsion was recorded. Our experimental results suggest that plant molecules from Bacopa monnieri may be useful in suppressing the seizure/convulsion in worms.

  18. Development of a body sensor network to detect motor patterns of epileptic seizures.

    PubMed

    Dalton, Anthony; Patel, Shyamal; Chowdhury, Atanu Roy; Welsh, Matt; Pang, Trudy; Schachter, Steven; OLaighin, Gearóid; Bonato, Paolo

    2012-11-01

    The objective of this study was the development of a remote monitoring system to monitor and detect simple motor seizures. Using accelerometer-based kinematic sensors, data were gathered from subjects undergoing medication titration at the Beth Israel Deaconess Medical Center. Over the course of the study, subjects repeatedly performed a predefined set of instrumental activities of daily living (iADLs). During the monitoring sessions, EEG and video data were also recorded and provided the gold standard for seizure detection. To distinguish seizure events from iADLs, we developed a template matching algorithm. Considering the unique signature of seizure events and the inherent temporal variability of seizure types across subjects, we incorporated a customized mass-spring template into the dynamic time warping algorithm. We then ported this algorithm onto a commercially available internet tablet and developed our body sensor network on the Mercury platform. We designed several policies on this platform to compare the tradeoffs between feature calculation, raw data transmission, and battery lifetime. From a dataset of 21 seizures, the sensitivity for our template matching algorithm was found to be 0.91 and specificity of 0.84. We achieved a battery lifetime of 10.5 h on the Mercury platform.

  19. Seizures

    MedlinePlus

    ... Your 1- to 2-Year-Old First Aid: Seizures KidsHealth > For Parents > First Aid: Seizures Print A A A en español Folleto de instructiones: Convulsiones (Seizures) Although seizures can be frightening, many last only ...

  20. BAD-Dependent Regulation of Fuel Metabolism and KATP Channel Activity Confers Resistance to Epileptic Seizures

    PubMed Central

    Giménez-Cassina, Alfredo; Martínez-François, Juan Ramón; Fisher, Jill K.; Szlyk, Benjamin; Polak, Klaudia; Wiwczar, Jessica; Tanner, Geoffrey R.; Lutas, Andrew; Yellen, Gary; Danial, Nika N.

    2012-01-01

    Summary Neuronal excitation can be substantially modulated by alterations in metabolism, as evident from the anticonvulsant effect of diets that reduce glucose utilization and promote ketone body metabolism. We provide genetic evidence that BAD, a protein with dual functions in apoptosis and glucose metabolism, imparts reciprocal effects on metabolism of glucose and ketone bodies in brain cells. These effects involve phospho-regulation of BAD and are independent of its apoptotic function. BAD modifications that reduce glucose metabolism produce a marked increase in the activity of metabolically sensitive KATP channels in neurons, as well as resistance to behavioral and electrographic seizures in vivo. Seizure resistance is reversed by genetic ablation of the KATP channel, implicating the BAD-KATP axis in metabolic control of neuronal excitation and seizure responses. PMID:22632729

  1. Automated Video Detection of Epileptic Convulsion Slowing as a Precursor for Post-Seizure Neuronal Collapse.

    PubMed

    Kalitzin, Stiliyan N; Bauer, Prisca R; Lamberts, Robert J; Velis, Demetrios N; Thijs, Roland D; Lopes Da Silva, Fernando H

    2016-12-01

    Automated monitoring and alerting for adverse events in people with epilepsy can provide higher security and quality of life for those who suffer from this debilitating condition. Recently, we found a relation between clonic slowing at the end of a convulsive seizure (CS) and the occurrence and duration of a subsequent period of postictal generalized EEG suppression (PGES). Prolonged periods of PGES can be predicted by the amount of progressive increase of interclonic intervals (ICIs) during the seizure. The purpose of the present study is to develop an automated, remote video sensing-based algorithm for real-time detection of significant clonic slowing that can be used to alert for PGES. This may help preventing sudden unexpected death in epilepsy (SUDEP). The technique is based on our previously published optical flow video sequence processing paradigm that was applied for automated detection of major motor seizures. Here, we introduce an integral Radon-like transformation on the time-frequency wavelet spectrum to detect log-linear frequency changes during the seizure. We validate the automated detection and quantification of the ICI increase by comparison to the results from manually processed electroencephalography (EEG) traces as "gold standard". We studied 48 cases of convulsive seizures for which synchronized EEG-video recordings were available. In most cases, the spectral ridges obtained from Gabor-wavelet transformations of the optical flow group velocities were in close proximity to the ICI traces detected manually from EEG data during the seizure. The quantification of the slowing-down effect measured by the dominant angle in the Radon transformed spectrum was significantly correlated with the exponential ICI increase factors obtained from manual detection. If this effect is validated as a reliable precursor of PGES periods that lead to or increase the probability of SUDEP, the proposed method would provide an efficient alerting device.

  2. Automatic Epileptic Seizure Detection Using Scalp EEG and Advanced Artificial Intelligence Techniques

    PubMed Central

    2015-01-01

    The epilepsies are a heterogeneous group of neurological disorders and syndromes characterised by recurrent, involuntary, paroxysmal seizure activity, which is often associated with a clinicoelectrical correlate on the electroencephalogram. The diagnosis of epilepsy is usually made by a neurologist but can be difficult to be made in the early stages. Supporting paraclinical evidence obtained from magnetic resonance imaging and electroencephalography may enable clinicians to make a diagnosis of epilepsy and investigate treatment earlier. However, electroencephalogram capture and interpretation are time consuming and can be expensive due to the need for trained specialists to perform the interpretation. Automated detection of correlates of seizure activity may be a solution. In this paper, we present a supervised machine learning approach that classifies seizure and nonseizure records using an open dataset containing 342 records. Our results show an improvement on existing studies by as much as 10% in most cases with a sensitivity of 93%, specificity of 94%, and area under the curve of 98% with a 6% global error using a k-class nearest neighbour classifier. We propose that such an approach could have clinical applications in the investigation of patients with suspected seizure disorders. PMID:25710040

  3. Aspartame has no effect on seizures or epileptiform discharges in epileptic children.

    PubMed

    Shaywitz, B A; Anderson, G M; Novotny, E J; Ebersole, J S; Sullivan, C M; Gillespie, S M

    1994-01-01

    The effects of aspartame (L-aspartyl-L-phenylalanine methyl ester; APM) on the neurological status of children with well-documented seizures were examined in a randomized, double-blind, placebo-controlled, crossover study. We report on 10 children (5 boys, 5 girls, ages 5-13 yr) who were tested for 2 weeks each on APM and placebo (single morning dose, 34 mg/kg). Seven children had generalized convulsions with 4 also having absence episodes. One child had absence seizures and 2 had complex partial seizures only. On each arm of the study, children were admitted to the hospital for a standard 21-lead electroencephalogram (EEG), continuous 24-hour cassette EEG, and determination of biochemical variables in plasma and urine. Subjects completed the Subjects Treatment Emergent Symptoms Scale (STESS) and parents the Conners Behavior Rating Scale. There were no significant differences between APM and placebo in the standard EEG or 24-hour EEG. No differences were noted for the STESS or the Conners ratings, and no differences were noted for any of the biochemical measures (except for expected increases in phenylalanine and tyrosine after APM). Our findings indicate that, in this group of vulnerable children, APM does not provoke seizures.

  4. Efficient epileptic seizure detection by a combined IMF-VoE feature.

    PubMed

    Qi, Yu; Wang, Yueming; Zheng, Xiaoxiang; Zhang, Jianmin; Zhu, Junming; Guo, Jianping

    2012-01-01

    Automatic seizure detection from the electroen-cephalogram (EEG) plays an important role in an on-demand closed-loop therapeutic system. A new feature, called IMF-VoE, is proposed to predict the occurrence of seizures. The IMF-VoE feature combines three intrinsic mode functions (IMFs) from the empirical mode decomposition of a EEG signal and the variance of the range between the upper and lower envelopes (VoE) of the signal. These multiple cues encode the intrinsic characteristics of seizure states, thus are able to distinguish them from the background. The feature is tested on 80.4 hours of EEG data with 10 seizures of 4 patients. The sensitivity of 100% is obtained with a low false detection rate of 0.16 per hour. Average time delays are 19.4s, 13.2s, and 10.7s at the false detection rates of 0.16 per hour, 0.27 per hour, and 0.41 per hour respectively, when different thresholds are used. The result is competitive among recent studies. In addition, since the IMF-VoE is compact, the detection system is of high computational efficiency and able to run in real time.

  5. Children with convulsive epileptic seizures presenting to padua pediatric emergency department: the first retrospective population-based descriptive study in an Italian Health District.

    PubMed

    Bergamo, Silvia; Parata, Francesca; Nosadini, Margherita; Boniver, Clementina; Toldo, Irene; Suppiej, Agnese; Vecchi, Marilena; Amigoni, Angela; Da Dalt, Liviana; Zanconato, Stefania; Perilongo, Giorgio; Sartori, Stefano

    2015-03-01

    Convulsive epileptic seizures in children represent a common cause of admission to pediatric emergency department. Data about incidence, etiology, and outcome are still lacking in literature. We retrospectively reviewed medical records of children presenting to our pediatric emergency department with convulsive seizures during a 12-month period and collected their diagnoses over the following year. In all, 182 children met the inclusion criteria, for a total of 214 visits (1.2% of all attendances, n = 24 864). Seizures lasted less than 5 minutes in 76%, 5 to 30 minutes in 20%, 30 to 60 minutes in 2%, and over 60 minutes in 2% visits ("early," "established," "refractory," convulsive status epilepticus, respectively). Incidence of "early" (seizure lasting 5-30 minutes) and "established" (seizure lasting 30-60 minutes) status epilepticus was 52/100 000/year and 7/100 000/year respectively. Most common causes were febrile seizures (56%) and remote symptomatic seizures (19%). Knowing the epidemiology of convulsive seizures in children is important to guide appropriate management and individualized follow-up.

  6. The body comes to family therapy: Treatment of a school-aged boy with hyperventilation-induced non-epileptic seizures.

    PubMed

    Kozlowska, Kasia; Chudleigh, Catherine; Elliott, Bronwen; Landini, Andrea

    2016-10-01

    We present the case of a 10-year-old boy, Evan, where a knock to the head activated memories of past bullying, causing intense distress, activation of the body's stress-regulation systems and recurrent hospital presentations with hyperventilation-induced non-epileptic seizures. We describe the initial assessment session that enabled Evan and his family to understand the context for Evan's non-epileptic seizures, to engage with the therapeutic team and to collaborate in the implementation of a mind-body multimodal family-based intervention. Once the physical symptoms had been addressed therapeutically, we explored possible dangers within the family and school systems and we worked with Evan and his family to increase his ability to access comfort and protection from his parents. Our short hospital intervention highlighted the importance of ongoing therapeutic work with Evan and the family and laid the foundation stones for the next part of the family's therapeutic journey.

  7. [A case of a pediatric patient with tuberous sclerosis (Bourneville-Pringle disease) and frequent epileptic seizure for intensive dental treatment under general anesthesia].

    PubMed

    Mimura, Shinichiro; Kikura, Mutsuhito; Itagaki, Taiga; Inokuma, Mie; Iwamoto, Tatsuaki; Kawakubo, Atsushi; Hirano, Kazuhiro; Sato, Shigehito

    2006-04-01

    Tuberous sclerosis (Bourneville-Pringle disease) is a rare disease with a triad of mental retardation, epilepsy, and facial spot. Management of the patients with tuberous sclerosis under general anesthesia has been previously reported. However, there are few case reports about management under general anesthesia of a pediatric patient with tuberous sclerosis with frequent epileptic seizure. Here, we report a case of a pediatric patient with tuberous sclerosis and frequent epileptic seizure who underwent intensive dental treatment under general anesthesia with careful management of epilepsy. The patient was discharged on the day of surgery without any complications. In this case report, we discussed the appropriate assessment of the complications of tuberous sclerosis; such as, of central nervous, circulatory, respiratory, endocrine, and urinary systems including the management of general anesthesia.

  8. Analysis of resting noise characteristics of three EIT systems in order to compare suitability for time difference imaging with scalp electrodes during epileptic seizures.

    PubMed

    Fabrizi, L; McEwan, A; Woo, E; Holder, D S

    2007-07-01

    Electrical impedance tomography measurements in clinical applications are limited by an undesired noise component. We have investigated the noise in three systems suitable for imaging epileptic seizures, the UCH Mark1b, UCH Mark2.5 and KHU Mark1 16 channel, at applied frequencies in three steps from 1 to 100 kHz, by varying load impedance, single terminal or multiplexed measurements, and in test objects of increasing complexity from a resistor to a saline filled tank and human volunteer. The noise was white, and increased from about 0.03% rms on the resistor to 0.08% on the human; it increased with load but was independent of use of the multiplexer. The KHU Mark1 delivered the best performance with noise spectra of about 0.02%, which could be further reduced by averaging to a level where reliable imaging of changes of about 0.1% estimated during epileptic seizures appears plausible.

  9. Evaluating the role of astrocytes on β-estradiol effect on seizures of Pilocarpine epileptic model.

    PubMed

    Sarfi, Masoumeh; Elahdadi Salmani, Mahmoud; Goudarzi, Iran; Lashkar Boluki, Taghi; Abrari, Kataneh

    2017-02-15

    Epilepsy with periodic and unpredictable seizures is associated with hippocampal glutamate toxicity and tissue reorganization. Astrocytes play an important role in mediating the neuroprotective effects of estradiol and reducing seizure severity. Accordingly, the protective effects of low and high doses of estradiol on behavioral, astrocytic involvement and neuronal survival aspects of Pilocarpine-induced epilepsy were investigated. Lithium- Pilocarpine (30mg/kg) model was used to provoke epilepsy. Βeta-estradiol (2,40μg/µl) was injected subcutaneously from 48 before to 48h after seizure induction. Behavioral convulsions were then monitored and recorded on the day of induction. Four weeks later, glutamine synthetase (GS) activity and the astrocyte transporter GLT-1 expression of the hippocampus were measured. Moreover, hippocampal glutamate and GABA were evaluated to study excitability changes. Finally, neuronal counting in the hippocampus was also performed using Nissl staining. The latency for generalized clonic (GC) convulsions significantly increased while the rate of GC and death significantly reduced due to β-estradiol treatment. GS activity and GLT-1 expression increased in the groups receiving the high dose of β-estradiol and Pilocarpine. Furthermore, the amount of both GABA and glutamate content decreased due to high dose of estradiol, while only GABA increased in Pilocarpine treated rats. Finally, administration of β-estradiol with low and high doses increased and improved the density of nerve cells. It is concluded that chronic administration β-estradiol has anticonvulsant and neuroprotective properties which are plausibly linked to astrocytic activity.

  10. Epileptic seizures in a population of 6000. II: Treatment and prognosis.

    PubMed Central

    Goodridge, D M; Shorvon, S D

    1983-01-01

    Treatment and prognosis were studied in 122 patients with non-febrile seizures in a population of 6000. Phenytoin and phenobarbitone were the most commonly prescribed drugs, although the popularity of phenobarbitone had declined over time. The average duration of treatment was relatively short, and most patients received single drug treatment. Treatment patterns were erratic, and the surveillance and audit of treatment generally poor. Recurrence after a first attack was found in four fifths of the patients. Generally the total number of seizures suffered by each patient was small, the period of active epilepsy short, and remission when it occurred was usually permanent. The cumulative probability of continuing activity fell and the proportion of patients in remission rose over time. Patients with partial or mixed seizure types had a poorer overall prognosis. The course of the epilepsy in the early years of treatment proved to be a useful guide to the long term prognosis, and the possibility that effective treatment might influence long term prognosis is raised. PMID:6411264

  11. Dynamics of large-scale brain activity in normal arousal states and epileptic seizures

    NASA Astrophysics Data System (ADS)

    Robinson, P. A.; Rennie, C. J.; Rowe, D. L.

    2002-04-01

    Links between electroencephalograms (EEGs) and underlying aspects of neurophysiology and anatomy are poorly understood. Here a nonlinear continuum model of large-scale brain electrical activity is used to analyze arousal states and their stability and nonlinear dynamics for physiologically realistic parameters. A simple ordered arousal sequence in a reduced parameter space is inferred and found to be consistent with experimentally determined parameters of waking states. Instabilities arise at spectral peaks of the major clinically observed EEG rhythms-mainly slow wave, delta, theta, alpha, and sleep spindle-with each instability zone lying near its most common experimental precursor arousal states in the reduced space. Theta, alpha, and spindle instabilities evolve toward low-dimensional nonlinear limit cycles that correspond closely to EEGs of petit mal seizures for theta instability, and grand mal seizures for the other types. Nonlinear stimulus-induced entrainment and seizures are also seen, EEG spectra and potentials evoked by stimuli are reproduced, and numerous other points of experimental agreement are found. Inverse modeling enables physiological parameters underlying observed EEGs to be determined by a new, noninvasive route. This model thus provides a single, powerful framework for quantitative understanding of a wide variety of brain phenomena.

  12. Wavelet Jensen Shannon divergence as a tool for studying the dynamics of frequency band components in EEG epileptic seizures

    NASA Astrophysics Data System (ADS)

    Pereyra, M. E.; Lamberti, P. W.; Rosso, O. A.

    2007-06-01

    We develop a quantitative method of analysis of EEG records. The method is based on the wavelet analysis of the record and on the capability of the Jensen-Shannon divergence (JSD) to identify dynamical changes in a time series. The JSD is a measure of distance between probability distributions. Therefore for its evaluation it is necessary to define a (time dependent) probability distribution along the record. We define this probability distribution from the wavelet decomposition of the associated time series. The wavelet JSD provides information about dynamical changes in the scales and can be considered a complementary methodology reported earlier [O.A. Rosso, S. Blanco, A. Rabinowicz, Signal Processing 86 (2003) 1275; O.A. Rosso, S. Blanco, J. Yordanova, V. Kolev, A. Figliola, M. Schürmann, E. Başar, J. Neurosci. Methods 105 (2001) 65; O.A. Rosso, M.T. Martin, A. Figliola, K. Keller, A. Plastino, J. Neurosci. Methods 153 (2006) 163]. In the present study we have demonstrated it by analyzing EEG signal of tonic-clonic epileptic seizures applying the JSD method. The display of the JSD curves enables easy comparison of frequency band component dynamics. This would, in turn, promise easy and successful comparison of the EEG records from various scalp locations of the brain.

  13. Overtightening of halo pins resulting in intracranial penetration, pneumocephalus, and epileptic seizure.

    PubMed

    Glover, Alexander W; Zakaria, Rasheed; May, Paul; Barrett, Chris

    2013-01-01

    A 60-year-old man sustained an undisplaced type III odontoid fracture following a fall down a full flight of stairs. His medical history was remarkable for a partial pancreatectomy and splenectomy in 2006 for chronic pancreatitis. This had rendered him diabetic, on insulin, and he required long-term administration of penicillin V. The fracture was treated with a halo vest, and, unknowing of its potentially serious consequences, the patient continued to tighten the halo pins himself. He presented 1 month later following a witnessed seizure. A computed tomography scan was performed, which demonstrated 2 cranial perforations, with the halo pins penetrating the cranium and resultant pneumocephalus. He was started on antiepileptic medication and was placed in a pinless halo system. He had no further seizures and has made an uneventful neurological recovery. This paper serves to highlight the potential complications which may arise from the use of a halo vest. Proper patient education is essential to avoid these serious yet avoidable events, and patients with low bone density and the immunosuppressed should be monitored closely.

  14. Tonicity-responsive enhancer binding protein haplodeficiency attenuates seizure severity and NF-κB-mediated neuroinflammation in kainic acid-induced seizures

    PubMed Central

    Shin, H J; Kim, H; Heo, R W; Kim, H J; Choi, W S; Kwon, H M; Roh, G S

    2014-01-01

    Kainic acid (KA)-induced seizures followed by neuronal death are associated with neuroinflammation and blood–brain barrier (BBB) leakage. Tonicity-responsive enhancer binding protein (TonEBP) is known as a transcriptional factor activating osmoprotective genes, and in brain, it is expressed in neuronal nuclei. Thus dysregulation of TonEBP may be involved in the pathology of KA-induced seizures. Here we used TonEBP heterozygote (+/−) mice to study the roles of TonEBP. Electroencephalographic study showed that TonEBP (+/−) mice reduced seizure frequency and severity compared with wild type during KA-induced status epilepticus. Immunohistochemistry and western blotting analysis showed that KA-induced neuroinflammation and BBB leakage were dramatically reduced in TonEBP (+/−) mice. Similarly, TonEBP-specific siRNA reduced glutamate-induced death in HT22 hippocampal neuronal cells. TonEBP haplodeficiency prevented KA-induced nuclear translocation of NF-κB p65 and attenuated inflammation. Our findings identify TonEBP as a critical regulator of neuroinflammation and BBB leakage in KA-induced seizures, which suggests TonEBP as a good therapeutic target. PMID:24608792

  15. Mutations in SLC13A5 Cause Autosomal-Recessive Epileptic Encephalopathy with Seizure Onset in the First Days of Life

    PubMed Central

    Thevenon, Julien; Milh, Mathieu; Feillet, François; St-Onge, Judith; Duffourd, Yannis; Jugé, Clara; Roubertie, Agathe; Héron, Delphine; Mignot, Cyril; Raffo, Emmanuel; Isidor, Bertrand; Wahlen, Sandra; Sanlaville, Damien; Villeneuve, Nathalie; Darmency-Stamboul, Véronique; Toutain, Annick; Lefebvre, Mathilde; Chouchane, Mondher; Huet, Frédéric; Lafon, Arnaud; de Saint Martin, Anne; Lesca, Gaetan; El Chehadeh, Salima; Thauvin-Robinet, Christel; Masurel-Paulet, Alice; Odent, Sylvie; Villard, Laurent; Philippe, Christophe; Faivre, Laurence; Rivière, Jean-Baptiste

    2014-01-01

    Epileptic encephalopathy (EE) refers to a clinically and genetically heterogeneous group of severe disorders characterized by seizures, abnormal interictal electro-encephalogram, psychomotor delay, and/or cognitive deterioration. We ascertained two multiplex families (including one consanguineous family) consistent with an autosomal-recessive inheritance pattern of EE. All seven affected individuals developed subclinical seizures as early as the first day of life, severe epileptic disease, and profound developmental delay with no facial dysmorphism. Given the similarity in clinical presentation in the two families, we hypothesized that the observed phenotype was due to mutations in the same gene, and we performed exome sequencing in three affected individuals. Analysis of rare variants in genes consistent with an autosomal-recessive mode of inheritance led to identification of mutations in SLC13A5, which encodes the cytoplasmic sodium-dependent citrate carrier, notably expressed in neurons. Disease association was confirmed by cosegregation analysis in additional family members. Screening of 68 additional unrelated individuals with early-onset epileptic encephalopathy for SLC13A5 mutations led to identification of one additional subject with compound heterozygous mutations of SLC13A5 and a similar clinical presentation as the index subjects. Mutations affected key residues for sodium binding, which is critical for citrate transport. These findings underline the value of careful clinical characterization for genetic investigations in highly heterogeneous conditions such as EE and further highlight the role of citrate metabolism in epilepsy. PMID:24995870

  16. Mutations in SLC13A5 cause autosomal-recessive epileptic encephalopathy with seizure onset in the first days of life.

    PubMed

    Thevenon, Julien; Milh, Mathieu; Feillet, François; St-Onge, Judith; Duffourd, Yannis; Jugé, Clara; Roubertie, Agathe; Héron, Delphine; Mignot, Cyril; Raffo, Emmanuel; Isidor, Bertrand; Wahlen, Sandra; Sanlaville, Damien; Villeneuve, Nathalie; Darmency-Stamboul, Véronique; Toutain, Annick; Lefebvre, Mathilde; Chouchane, Mondher; Huet, Frédéric; Lafon, Arnaud; de Saint Martin, Anne; Lesca, Gaetan; El Chehadeh, Salima; Thauvin-Robinet, Christel; Masurel-Paulet, Alice; Odent, Sylvie; Villard, Laurent; Philippe, Christophe; Faivre, Laurence; Rivière, Jean-Baptiste

    2014-07-03

    Epileptic encephalopathy (EE) refers to a clinically and genetically heterogeneous group of severe disorders characterized by seizures, abnormal interictal electro-encephalogram, psychomotor delay, and/or cognitive deterioration. We ascertained two multiplex families (including one consanguineous family) consistent with an autosomal-recessive inheritance pattern of EE. All seven affected individuals developed subclinical seizures as early as the first day of life, severe epileptic disease, and profound developmental delay with no facial dysmorphism. Given the similarity in clinical presentation in the two families, we hypothesized that the observed phenotype was due to mutations in the same gene, and we performed exome sequencing in three affected individuals. Analysis of rare variants in genes consistent with an autosomal-recessive mode of inheritance led to identification of mutations in SLC13A5, which encodes the cytoplasmic sodium-dependent citrate carrier, notably expressed in neurons. Disease association was confirmed by cosegregation analysis in additional family members. Screening of 68 additional unrelated individuals with early-onset epileptic encephalopathy for SLC13A5 mutations led to identification of one additional subject with compound heterozygous mutations of SLC13A5 and a similar clinical presentation as the index subjects. Mutations affected key residues for sodium binding, which is critical for citrate transport. These findings underline the value of careful clinical characterization for genetic investigations in highly heterogeneous conditions such as EE and further highlight the role of citrate metabolism in epilepsy.

  17. Seizures

    MedlinePlus

    ... often with a loss of or change in consciousness. Seizures can be frightening, but most last only ... unusual sensations, uncontrollable muscle spasms, and loss of consciousness. Some seizures may be due to another medical ...

  18. Phase-Amplitude Coupling Is Elevated in Deep Sleep and in the Onset Zone of Focal Epileptic Seizures

    PubMed Central

    Amiri, Mina; Frauscher, Birgit; Gotman, Jean

    2016-01-01

    The interactions between different EEG frequency bands have been widely investigated in normal and pathologic brain activity. Phase-amplitude coupling (PAC) is one of the important forms of this interaction where the amplitude of higher frequency oscillations is modulated by the phase of lower frequency activity. Here, we studied the dynamic variations of PAC of high (gamma and ripple) and low (delta, theta, alpha, and beta) frequency bands in patients with focal epilepsy in different sleep stages during the interictal period, in an attempt to see if coupling is different in more or less epileptogenic regions. Sharp activities were excluded to avoid their effect on the PAC. The results revealed that the coupling intensity was generally the highest in stage N3 of sleep and the lowest in rapid eye movement sleep. We also compared the coupling strength in different regions [seizure onset zone (SOZ), exclusively irritative zone, and normal zone]. PAC between high and low frequency rhythms was found to be significantly stronger in the SOZ compared to normal regions. Also, the coupling was generally more elevated in spiking channels outside the SOZ than in normal regions. We also examined how the power in the delta band correlates to the PAC, and found a mild but statistically significant correlation between slower background activity in epileptic channels and the elevated coupling in these channels. The results suggest that an elevated PAC may reflect some fundamental abnormality, even after exclusion of sharp activities and even in the interictal period. PAC may therefore contribute to understanding the underlying dynamics of epileptogenic brain regions. PMID:27536227

  19. An Integrative Neurocircuit Perspective on Psychogenic Non-Epileptic Seizures and Functional Movement Disorders: Neural Functional Unawareness

    PubMed Central

    Perez, DL; Dworetzky, BA; Dickerson, BC; Leung, L; Cohn, R; Baslet, G; Silbersweig, DA

    2014-01-01

    Functional Neurological Disorder (conversion disorder) is a neurobehavioral condition frequently encountered by neurologists. Psychogenic Non-Epileptic Seizure (PNES) and Functional Movement Disorder (FMD) patients present to epileptologists and movement disorder specialists respectively, yet neurologists lack a neurobiological perspective through which to understand these enigmatic groups. Observational research studies suggest that PNES and FMD may represent variants of similar (or the same) conditions given that both groups exhibit a female predominance, have increased prevalence of mood-anxiety disorders, frequently endorse prior abuse, and share phenotypic characteristics. In this perspective article, neuroimaging studies in PNES and FMD are reviewed, and discussed using studies of emotional dysregulation, dissociation and psychological trauma in the context of motor control. Convergent neuroimaging findings implicate alterations in brain circuits mediating emotional expression, regulation and awareness (anterior cingulate and ventromedial prefrontal cortices, insula, amygdala, vermis), cognitive control and motor inhibition (dorsal anterior cingulate, dorsolateral prefrontal, inferior frontal cortices), self-referential processing and perceptual awareness (posterior parietal cortex, temporoparietal junction), and motor planning and coordination (supplementary motor area, cerebellum). Striatal-thalamic components of prefrontal-parietal networks may also play a role in pathophysiology. Aberrant medial prefrontal and amygdalar neuroplastic changes mediated by chronic stress may facilitate the development of functional neurological symptoms in a subset of patients. Improved biological understanding of PNES and FMD will likely reduce stigma and aid the identification of neuroimaging biomarkers guiding treatment development, selection and prognosis. Additional research should investigate neurocircuit abnormalities within and across functional neurological disorder

  20. Optimized Seizure Detection Algorithm: A Fast Approach for Onset of Epileptic in EEG Signals Using GT Discriminant Analysis and K-NN Classifier

    PubMed Central

    Rezaee, Kh.; Azizi, E.; Haddadnia, J.

    2016-01-01

    Background Epilepsy is a severe disorder of the central nervous system that predisposes the person to recurrent seizures. Fifty million people worldwide suffer from epilepsy; after Alzheimer’s and stroke, it is the third widespread nervous disorder. Objective In this paper, an algorithm to detect the onset of epileptic seizures based on the analysis of brain electrical signals (EEG) has been proposed. 844 hours of EEG were recorded form 23 pediatric patients consecutively with 163 occurrences of seizures. Signals had been collected from Children’s Hospital Boston with a sampling frequency of 256 Hz through 18 channels in order to assess epilepsy surgery. By selecting effective features from seizure and non-seizure signals of each individual and putting them into two categories, the proposed algorithm detects the onset of seizures quickly and with high sensitivity. Method In this algorithm, L-sec epochs of signals are displayed in form of a third-order tensor in spatial, spectral and temporal spaces by applying wavelet transform. Then, after applying general tensor discriminant analysis (GTDA) on tensors and calculating mapping matrix, feature vectors are extracted. GTDA increases the sensitivity of the algorithm by storing data without deleting them. Finally, K-Nearest neighbors (KNN) is used to classify the selected features. Results The results of simulating algorithm on algorithm standard dataset shows that the algorithm is capable of detecting 98 percent of seizures with an average delay of 4.7 seconds and the average error rate detection of three errors in 24 hours. Conclusion Today, the lack of an automated system to detect or predict the seizure onset is strongly felt. PMID:27672628

  1. Seizures

    MedlinePlus

    ... because of sudden, abnormal electrical activity in the brain. When people think of seizures, they often think of convulsions in which a person's body shakes rapidly and uncontrollably. Not all seizures ... part of the brain. Generalized seizures are a result of abnormal activity ...

  2. Counselling the Epileptic Patient

    PubMed Central

    Jones, Barry

    1983-01-01

    Today, most epileptics can participate freely in a wide range of activities. However, their epilepsy does create some special problems. The degree to which they participate in sports is governed by their degree of seizure control, as are their employment opportunities and driving privileges. Epilepsy does not appear to be a major stress factor in marriage as long as the spouse is knowledgeable about the condition. Epileptic women usually have normal pregnancies though their relative risks are perhaps double those for the non-epileptic population. Children of epileptic women have about four times the general population's risk of seizure but the absolute level of risk is not high. PMID:21286585

  3. Domoic acid-induced seizures in California sea lions (Zalophus californianus) are associated with neuroinflammatory brain injury.

    PubMed

    Kirkley, Kelly S; Madl, James E; Duncan, Colleen; Gulland, Frances M; Tjalkens, Ronald B

    2014-11-01

    California sea lions (CSLs) exposed to the marine biotoxin domoic acid (DA) develop an acute or chronic toxicosis marked by seizures and act as sentinels of the disease. Experimental evidence suggests that oxidative stress and neuroinflammation are important mechanisms underlying the seizurogenic potential of environmental toxicants but these pathways are relatively unstudied in CSLs. In the current study, we investigated the role of glutamate-glutamine changes and gliosis in DA-exposed CSLs to better understand the neurotoxic mechanisms occurring during DA toxicity. Sections from archived hippocampi from control and CSLs diagnosed with DA toxicosis were immunofluorescently stained for markers of gliosis, oxidative/nitrative stress and changes in glutamine synthetase (GS). Quantitative assessment revealed increasing loss of microtubule associated protein-2 positive neurons with elevations in 4-hydroxynonenal correlating with chronicity of exposure, whereas the pattern of activated glia expressing nitric oxide synthase 2 and tumor necrosis factor followed pathological severity. There was no significant change in the amount of GS positive cells but there was increased 3-nitrotyrosine in GS expressing cells and in neurons, particularly in animals with chronic DA toxicosis. These changes were consistently seen in the dentate gyrus and in the cornu ammonis (CA) sectors CA3, CA4, and CA1. The results of this study indicate that gliosis and resultant changes in GS are likely important mechanisms in DA-induced seizure that need to be further explored as potential therapies in treating exposed wildlife.

  4. Protective effects of bupivacaine against kainic acid-induced seizure and neuronal cell death in the rat hippocampus.

    PubMed

    Chiu, Kuan Ming; Wu, Chia Chan; Wang, Ming Jiuh; Lee, Ming Yi; Wang, Su Jane

    2015-01-01

    The excessive release of glutamate is a critical element in the neuropathology of epilepsy, and bupivacaine, a local anesthetic agent, has been shown to inhibit the release of glutamate in rat cerebrocortical nerve terminals. This study investigated whether bupivacaine produces antiseizure and antiexcitotoxic effects using a kainic acid (KA) rat model, an animal model used for temporal lobe epilepsy, and excitotoxic neurodegeneration experiments. The results showed that administering bupivacaine (0.4 mg/kg or 2 mg/kg) intraperitoneally to rats 30 min before intraperitoneal injection of KA (15 mg/kg) increased seizure latency and reduced the seizure score. In addition, bupivacaine attenuated KA-induced hippocampal neuronal cell death, and this protective effect was accompanied by the inhibition of microglial activation and production of proinflammatory cytokines such as interleukin (IL)-1β, IL-6, and tumor necrosis factor-α in the hippocampus. Moreover, bupivacaine shortened the latency of escaping onto the platform in the Morris water maze learning performance test. Collectively, these data suggest that bupivacaine has therapeutic potential for treating epilepsy.

  5. Video-ambulatory EEG in a secondary care center: A retrospective evaluation of utility in the diagnosis of epileptic and nonepileptic seizures.

    PubMed

    Lawley, Andrew; Manfredonia, Francesco; Cavanna, Andrea E

    2016-04-01

    The development and optimization of protocols using simultaneous video recording alongside long-term electroencephalography (EEG), such as ambulatory EEG (AEEG), expanded the range of available techniques for the investigation of paroxysmal clinical events. In particular, video-AEEG has received increasing attention over the last few years because of its potential to further improve diagnostic utility in the differential diagnosis between epileptic and nonepileptic seizures. We retrospectively evaluated 88 video-AEEG studies in order to assess the diagnostic utility of video-AEEG in 87 patients consecutively referred to a neurophysiology department. Typical clinical events occurred during 55 studies (62.5%). In 26 of these, at least one event was also clearly seen on video recording, contributing to a confident diagnosis. Clinical events were classified according to three diagnostic categories: epileptic seizures (6 studies, 6.8%), physiologic nonepileptic events (13 studies, 14.8%), or psychogenic nonepileptic seizures (36 studies, 40.9%). Of the studies with an event not recorded on video, a confident diagnosis could be reached in 55.2% of cases. The main reason for unsuccessful video recording was failure to activate the camcorder by the patient or carer. We found an overall diagnostic utility of 67.0%, which confirms the findings of previous reports evaluating the diagnostic yield of AEEG. Implementation of video-AEEG protocols in a secondary care center appears to have high diagnostic utility, particularly for patients with psychogenic nonepileptic seizures. Our findings prompt further research into the potential applications of video-AEEG, in consideration of important implications for successful patient management and healthcare resource allocation.

  6. Bumetanide, an NKCC1 antagonist, does not prevent formation of epileptogenic focus but blocks epileptic focus seizures in immature rat hippocampus.

    PubMed

    Nardou, Romain; Ben-Ari, Yehezkel; Khalilov, Ilgam

    2009-06-01

    Excitatory GABA action induced by high [Cl(-)](i) is thought to contribute to seizure generation in neonatal neurons although the mechanism of this effect remains unclear. We report that bumetanide, a NKCC1 antagonist, reduces driving force of GABA-mediated currents (DF(GABA)) in neonatal hippocampal neurons and blocks the giant depolarizing potentials (GDPs), a spontaneous pattern of network activity. In the preparation composed of two intact interconnected hippocampi, bumetanide did not prevent generation of kainate-induced seizures, their propagation to the contralateral hippocampus, and formation of an epileptogenic mirror focus. However, in the isolated mirror focus, bumetanide effectively blocked spontaneous epileptiform activity transforming it to the GDP-like activity pattern. Bumetanide partially reduced DF(GABA) and therefore the excitatory action of GABA in epileptic neurons. Therefore bumetanide is a potent anticonvulsive agent although it cannot prevent formation of the epileptogenic mirror focus. We suggest that an additional mechanism other than NKCC1-mediated contributes to the persistent increase of DF(GABA) in epileptic neurons.

  7. Parvalbumin interneurons and calretinin fibers arising from the thalamic nucleus reuniens degenerate in the subiculum after kainic acid-induced seizures.

    PubMed

    Drexel, M; Preidt, A P; Kirchmair, E; Sperk, G

    2011-08-25

    The subiculum is the major output area of the hippocampus. It is closely interconnected with the entorhinal cortex and other parahippocampal areas. In animal models of temporal lobe epilepsy (TLE) and in TLE patients it exerts increased network excitability and may crucially contribute to the propagation of limbic seizures. Using immunohistochemistry and in situ-hybridization we now investigated neuropathological changes affecting parvalbumin and calretinin containing neurons in the subiculum and other parahippocampal areas after kainic acid-induced status epilepticus. We observed prominent losses in parvalbumin containing interneurons in the subiculum and entorhinal cortex, and in the principal cell layers of the pre- and parasubiculum. Degeneration of parvalbumin-positive neurons was associated with significant precipitation of parvalbumin-immunoreactive debris 24 h after kainic acid injection. In the subiculum the superficial portion of the pyramidal cell layer was more severely affected than its deep part. In the entorhinal cortex, the deep layers were more severely affected than the superficial ones. The decrease in number of parvalbumin-positive neurons in the subiculum and entorhinal cortex correlated with the number of spontaneous seizures subsequently experienced by the rats. The loss of parvalbumin neurons thus may contribute to the development of spontaneous seizures. On the other hand, surviving parvalbumin neurons revealed markedly increased expression of parvalbumin mRNA notably in the pyramidal cell layer of the subiculum and in all layers of the entorhinal cortex. This indicates increased activity of these neurons aiming to compensate for the partial loss of this functionally important neuron population. Furthermore, calretinin-positive fibers terminating in the molecular layer of the subiculum, in sector CA1 of the hippocampus proper and in the entorhinal cortex degenerated together with their presumed perikarya in the thalamic nucleus reuniens. In

  8. Low distribution of synaptic vesicle protein 2A and synaptotagimin-1 in the cerebral cortex and hippocampus of spontaneously epileptic rats exhibiting both tonic convulsion and absence seizure.

    PubMed

    Hanaya, R; Hosoyama, H; Sugata, S; Tokudome, M; Hirano, H; Tokimura, H; Kurisu, K; Serikawa, T; Sasa, M; Arita, K

    2012-09-27

    The spontaneously epileptic rat (SER) is a double mutant (zi/zi, tm/tm) which begins to exhibit tonic convulsions and absence seizures after 6 weeks of age, and repetitive tonic seizures over time induce sclerosis-like changes in SER hippocampus with high brain-derived neurotrophic factor (BDNF) expression. Levetiracetam, which binds to synaptic vesicle protein 2A (SV2A), inhibited both tonic convulsions and absence seizures in SERs. We studied SER brains histologically and immunohistochemically after verification by electroencephalography (EEG), as SERs exhibit seizure-related alterations in the cerebral cortex and hippocampus. SERs did not show interictal abnormal spikes and slow waves typical of focal epilepsy or symptomatic generalized epilepsy. The difference in neuronal density of the cerebral cortex was insignificant between SER and Wistar rats, and apoptotic neurons did not appear in SERs. BDNF distributions portrayed higher values in the entorhinal and piriform cortices which would relate with hippocampal sclerosis-like changes. Similar synaptophysin expression in the cerebral cortex and hippocampus was found in both animals. Low and diffuse SV2A distribution portrayed in the cerebral cortex and hippocampus of SERs was significantly less than that of all cerebral lobes and inner molecular layer (IML) of the dentate gyrus (DG) of Wistar rats. The extent of low SV2A expression/distribution in SERs was particularly remarkable in the frontal (51% of control) and entorhinal cortices (47%). Lower synaptotagmin-1 expression (vs Wistar rats) was located in the frontal (31%), piriform (13%) and entorhinal (39%) cortices, and IML of the DG (38%) in SER. Focal low distribution of synaptotagmin-1 accompanying low SV2A expression may contribute to epileptogenesis and seizure propagation in SER.

  9. Human fetal brain-derived neural stem/progenitor cells grafted into the adult epileptic brain restrain seizures in rat models of temporal lobe epilepsy.

    PubMed

    Lee, Haejin; Yun, Seokhwan; Kim, Il-Sun; Lee, Il-Shin; Shin, Jeong Eun; Park, Soo Chul; Kim, Won-Joo; Park, Kook In

    2014-01-01

    Cell transplantation has been suggested as an alternative therapy for temporal lobe epilepsy (TLE) because this can suppress spontaneous recurrent seizures in animal models. To evaluate the therapeutic potential of human neural stem/progenitor cells (huNSPCs) for treating TLE, we transplanted huNSPCs, derived from an aborted fetal telencephalon at 13 weeks of gestation and expanded in culture as neurospheres over a long time period, into the epileptic hippocampus of fully kindled and pilocarpine-treated adult rats exhibiting TLE. In vitro, huNSPCs not only produced all three central nervous system neural cell types, but also differentiated into ganglionic eminences-derived γ-aminobutyric acid (GABA)-ergic interneurons and released GABA in response to the depolarization induced by a high K+ medium. NSPC grafting reduced behavioral seizure duration, afterdischarge duration on electroencephalograms, and seizure stage in the kindling model, as well as the frequency and the duration of spontaneous recurrent motor seizures in pilocarpine-induced animals. However, NSPC grafting neither improved spatial learning or memory function in pilocarpine-treated animals. Following transplantation, grafted cells showed extensive migration around the injection site, robust engraftment, and long-term survival, along with differentiation into β-tubulin III+ neurons (∼34%), APC-CC1+ oligodendrocytes (∼28%), and GFAP+ astrocytes (∼8%). Furthermore, among donor-derived cells, ∼24% produced GABA. Additionally, to explain the effect of seizure suppression after NSPC grafting, we examined the anticonvulsant glial cell-derived neurotrophic factor (GDNF) levels in host hippocampal astrocytes and mossy fiber sprouting into the supragranular layer of the dentate gyrus in the epileptic brain. Grafted cells restored the expression of GDNF in host astrocytes but did not reverse the mossy fiber sprouting, eliminating the latter as potential mechanism. These results suggest that human fetal

  10. Human Fetal Brain-Derived Neural Stem/Progenitor Cells Grafted into the Adult Epileptic Brain Restrain Seizures in Rat Models of Temporal Lobe Epilepsy

    PubMed Central

    Lee, Haejin; Yun, Seokhwan; Kim, Il-Sun; Lee, Il-Shin; Shin, Jeong Eun; Park, Soo Chul; Kim, Won-Joo; Park, Kook In

    2014-01-01

    Cell transplantation has been suggested as an alternative therapy for temporal lobe epilepsy (TLE) because this can suppress spontaneous recurrent seizures in animal models. To evaluate the therapeutic potential of human neural stem/progenitor cells (huNSPCs) for treating TLE, we transplanted huNSPCs, derived from an aborted fetal telencephalon at 13 weeks of gestation and expanded in culture as neurospheres over a long time period, into the epileptic hippocampus of fully kindled and pilocarpine-treated adult rats exhibiting TLE. In vitro, huNSPCs not only produced all three central nervous system neural cell types, but also differentiated into ganglionic eminences-derived γ-aminobutyric acid (GABA)-ergic interneurons and released GABA in response to the depolarization induced by a high K+ medium. NSPC grafting reduced behavioral seizure duration, afterdischarge duration on electroencephalograms, and seizure stage in the kindling model, as well as the frequency and the duration of spontaneous recurrent motor seizures in pilocarpine-induced animals. However, NSPC grafting neither improved spatial learning or memory function in pilocarpine-treated animals. Following transplantation, grafted cells showed extensive migration around the injection site, robust engraftment, and long-term survival, along with differentiation into β-tubulin III+ neurons (∼34%), APC-CC1+ oligodendrocytes (∼28%), and GFAP+ astrocytes (∼8%). Furthermore, among donor-derived cells, ∼24% produced GABA. Additionally, to explain the effect of seizure suppression after NSPC grafting, we examined the anticonvulsant glial cell-derived neurotrophic factor (GDNF) levels in host hippocampal astrocytes and mossy fiber sprouting into the supragranular layer of the dentate gyrus in the epileptic brain. Grafted cells restored the expression of GDNF in host astrocytes but did not reverse the mossy fiber sprouting, eliminating the latter as potential mechanism. These results suggest that human fetal

  11. Fractal analysis of electroencephalographic signals intracerebrally recorded during 35 epileptic seizures: evaluation of a new method for synoptic visualisation of ictal events.

    PubMed

    Bullmore, E T; Brammer, M J; Bourlon, P; Alarcon, G; Polkey, C E; Elwes, R; Binnie, C D

    1994-11-01

    Traditional electroencephalography (EEG) produces a large volume display of brain electrical activity, which creates problems particularly in assessment of long periods of intracranial, stereoelectroencephalographic (SEEG) recording. A method for fractal analysis that describes 100 SEEG data points in terms of a single estimate of fractal dimension (1 < FD < 2) is reported; the central processing unit time costs amount to approximately 2 min/Mbyte of input signal (using a Sun SPARCstation LX). The diagnostic sensitivity of this method, applied to quantification and synoptic visualisation of SEEG signals recorded during 35 epileptic seizures in 7 patients, is evaluated. It is found that the method consistently defines ictal onset in terms of rapid relative increase in FD across several channels. Clinically severe seizures are characterised by more intense and generalised ictal changes in FD than clinically less severe events. For all 7 patients, and for 75% of individual seizures, "fractal diagnoses" of anatomically defined ictal onset zone coincided closely with ictal onset zone independently determined by inspection of traditional EEG displays of the same data. We conclude that the method is a computationally feasible way to achieve substantial reduction in the volume of SEEG data without undue loss of diagnostically important information in the primary signal.

  12. Can Seizure-Alert Dogs predict seizures?

    PubMed

    Brown, Stephen W; Goldstein, Laura H

    2011-12-01

    An index observation where a dog was trained to alert to, as well as respond to, human tonic-clonic seizures led to further research and refinement of training techniques. This was followed by anecdotal reports of pet dogs spontaneously anticipating human epileptic seizures. An industry has since developed training Seizure-Alert Dogs (SADs) to give humans warnings of their seizures. In some cases this has been accompanied by a reduction in seizure frequency. SADs may be trained along with the person with epilepsy, responding specifically to that person's seizures, or may be trained separately. Recent sceptical reports of non-epileptic seizures in some people with SADs have cast doubt on dogs' ability to anticipate true epileptic seizures. This may reflect selection criteria for training programmes as well as training methods used, but does not necessarily indicate that SADs might not be able to predict epileptic seizures. Whether the seizures are epileptic or non-epileptic, it is speculated that SADs probably alert to subtle pre-ictal human behaviour changes, but may also be sensitive to heart rate or olfactory cues. As yet, however, no rigorous data exist as to whether seizure prediction by SADS is better than chance, and what false positive and negative prediction rates might be.

  13. Nitric Oxide-induced Activation of the Type 1 Ryanodine Receptor Is Critical for Epileptic Seizure-induced Neuronal Cell Death.

    PubMed

    Mikami, Yoshinori; Kanemaru, Kazunori; Okubo, Yohei; Nakaune, Takuya; Suzuki, Junji; Shibata, Kazuki; Sugiyama, Hiroki; Koyama, Ryuta; Murayama, Takashi; Ito, Akihiro; Yamazawa, Toshiko; Ikegaya, Yuji; Sakurai, Takashi; Saito, Nobuhito; Kakizawa, Sho; Iino, Masamitsu

    2016-09-01

    Status epilepticus (SE) is a life-threatening emergency that can cause neurodegeneration with debilitating neurological disorders. However, the mechanism by which convulsive SE results in neurodegeneration is not fully understood. It has been shown that epileptic seizures produce markedly increased levels of nitric oxide (NO) in the brain, and that NO induces Ca(2+) release from the endoplasmic reticulum via the type 1 ryanodine receptor (RyR1), which occurs through S-nitrosylation of the intracellular Ca(2+) release channel. Here, we show that through genetic silencing of NO-induced activation of the RyR1 intracellular Ca(2+) release channel, neurons were rescued from seizure-dependent cell death. Furthermore, dantrolene, an inhibitor of RyR1, was protective against neurodegeneration caused by SE. These results demonstrate that NO-induced Ca(2+) release via RyR is involved in SE-induced neurodegeneration, and provide a rationale for the use of RyR1 inhibitors for the prevention of brain damage following SE.

  14. Repeated citalopram administration counteracts kainic acid-induced spreading of PSA-NCAM-immunoreactive cells and loss of reelin in the adult mouse hippocampus.

    PubMed

    Jaako, Külli; Aonurm-Helm, Anu; Kalda, Anti; Anier, Kaili; Zharkovsky, Tamara; Shastin, Dmitri; Zharkovsky, Alexander

    2011-09-01

    Systemic or intracerebral administration of kainic acid in rodents induces neuronal death followed by a cascade of neuroplastic changes in the hippocampus. Kainic acid-induced neuroplasticity is evidenced by alterations in hippocampal neurogenesis, dispersion of the granule cell layer and re-organisation of mossy fibres. Similar abnormalities are observed in patients with temporal lobe epilepsy and, therefore, kainic acid-induced hippocampal neuroplasticity might mimic pathological mechanisms leading to the formation of 'epileptic brain' in patients with temporal lobe epilepsy. Previous studies have demonstrated that selective serotonin re-uptake inhibitor antidepressants might reduce the severity of seizures in epileptic patients and reduce neuronal death in laboratory animal models of kainic acid-induced neurotoxicity. In the present study, we investigated whether kainic acid-induced neuroplasticity in mice is modulated by the repeated administration of citalopram, a selective serotonin reuptake inhibitor. We found that at the histopathological level, repeated citalopram treatment counteracted the kainic acid-induced neuronal loss and dispersion of young granule neurons expressing the polysialylated neural cell adhesion molecule within the granule cell layer of the hippocampus. Citalopram also counteracted the downregulation of reelin on both mRNA and protein levels induced by kainic acid administration. Our findings indicate that repeated administration of citalopram is able to prevent kainic acid-induced abnormal brain plasticity and thereby prevent the formation of an epileptic phenotype.

  15. Shift-back of right into left hemisphere language dominance after control of epileptic seizures: evidence for epilepsy driven functional cerebral organization.

    PubMed

    Helmstaedter, C; Fritz, N E; González Pérez, P A; Elger, C E; Weber, B

    2006-08-01

    Atypical, i.e. right hemisphere language dominance is frequently observed in early onset left hemisphere epilepsies. In left mesial temporal lobe epilepsy, where eloquent cortex is not directly involved, it is a matter of debate, to which degree atypical language dominance is driven not only by morphological lesions but also by epileptic dysfunction, and whether atypical dominance is hardwired or not. Taking this as the background this study evaluated the hypothesis that epilepsy driven atypical dominancy might be reversible when seizures are successfully controlled. This was evaluated in patients with left mesial temporal lobe epilepsy, who were atypically language dominant by means of language fMRI before surgery, and became seizure free after left selective amygdalo-hippocampectomy. Three out of 53 consecutive atypically dominant patients with chronic epilepsy fulfilled these criteria. Postoperative follow-up language fMRI indicated reversal of right into left dominance in one patient going along with unexpected losses in verbal memory performance. The two other patients experienced unchanged or even enhancement of the pre-existing dominance pattern, going along with consistent postoperative performance changes in cognition. The data thus provide supporting evidence that atypical language dominance can indeed be functionally driven and moreover that in at least some patients, right hemispheric language can shift-back to the left hemisphere when the driving factor, i.e. seizures, becomes successfully controlled. The results have clinical implications for outcome prediction after brain surgery in atypically dominant patients with epilepsy. However, further research in larger groups of atypically dominant patients is required to identify the conditions under which atypical dominance becomes hardwired and when not.

  16. Long-Term Seizure Suppression and Optogenetic Analyses of Synaptic Connectivity in Epileptic Mice with Hippocampal Grafts of GABAergic Interneurons

    PubMed Central

    Henderson, Katharine W.; Gupta, Jyoti; Tagliatela, Stephanie; Litvina, Elizabeth; Zheng, XiaoTing; Van Zandt, Meghan A.; Woods, Nicholas; Grund, Ethan; Lin, Diana; Royston, Sara; Yanagawa, Yuchio; Aaron, Gloster B.

    2014-01-01

    Studies in rodent epilepsy models suggest that GABAergic interneuron progenitor grafts can reduce hyperexcitability and seizures in temporal lobe epilepsy (TLE). Although integration of the transplanted cells has been proposed as the underlying mechanism for these disease-modifying effects, prior studies have not explicitly examined cell types and synaptic mechanisms for long-term seizure suppression. To address this gap, we transplanted medial ganglionic eminence (MGE) cells from embryonic day 13.5 VGAT-Venus or VGAT-ChR2-EYFP transgenic embryos into the dentate gyrus (DG) of adult mice 2 weeks after induction of TLE with pilocarpine. Beginning 3–4 weeks after status epilepticus, we conducted continuous video-electroencephalographic recording until 90–100 d. TLE mice with bilateral MGE cell grafts in the DG had significantly fewer and milder electrographic seizures, compared with TLE controls. Immunohistochemical studies showed that the transplants contained multiple neuropeptide or calcium-binding protein-expressing interneuron types and these cells established dense terminal arborizations onto the somas, apical dendrites, and axon initial segments of dentate granule cells (GCs). A majority of the synaptic terminals formed by the transplanted cells were apposed to large postsynaptic clusters of gephyrin, indicative of mature inhibitory synaptic complexes. Functionality of these new inhibitory synapses was demonstrated by optogenetically activating VGAT-ChR2-EYFP-expressing transplanted neurons, which generated robust hyperpolarizations in GCs. These findings suggest that fetal GABAergic interneuron grafts may suppress pharmacoresistant seizures by enhancing synaptic inhibition in DG neural circuits. PMID:25274826

  17. Fibromyalgia and seizures.

    PubMed

    Tatum, William O; Langston, Michael E; Acton, Emily K

    2016-06-01

    The purpose of this case-matched study was to determine how frequently fibromyalgia is associated with different paroxysmal neurological disorders and explore the utility of fibromyalgia as a predictor for the diagnosis of psychogenic non-epileptic seizures. The billing diagnosis codes of 1,730 new, non-selected patient encounters were reviewed over a three-year period for an epileptologist in a neurology clinic to identify all patients with historical diagnoses of fibromyalgia. The frequency with which epileptic seizures, psychogenic non-epileptic seizures, and physiological non-epileptic events were comorbid with fibromyalgia was assessed. Age and gender case-matched controls were used for a between-group comparison. Wilcoxon tests were used to analyse interval data, and Chi-square was used to analyse categorical data (p<0.05). Fibromyalgia was retrospectively identified in 95/1,730 (5.5%) patients in this cohort. Females represented 95% of the fibromyalgia sample (age: 53 years; 95% CI: 57, 51). Forty-three percent of those with fibromyalgia had a non-paroxysmal, neurological primary clinical diagnosis, most commonly chronic pain. Paroxysmal events were present in 57% of fibromyalgia patients and 54% of case-matched controls. Among patients with fibromyalgia and paroxysmal disorders, 11% had epileptic seizures, 74% had psychogenic non-epileptic seizures, and 15% had physiological non-epileptic events, compared to case-matched controls with 37% epileptic seizures, 51% psychogenic non-epileptic events, and 12% physiological non-epileptic events (p = 0.009). Fibromyalgia was shown to be a predictor for the diagnosis of psychogenic non-epileptic seizures in patients with undifferentiated paroxysmal spells. However, our results suggest that the specificity and sensitivity of fibromyalgia as a marker for psychogenic non-epileptic seizures in a mixed general neurological population of patients is less than previously described.

  18. Updated ILAE evidence review of antiepileptic drug efficacy and effectiveness as initial monotherapy for epileptic seizures and syndromes.

    PubMed

    Glauser, Tracy; Ben-Menachem, Elinor; Bourgeois, Blaise; Cnaan, Avital; Guerreiro, Carlos; Kälviäinen, Reetta; Mattson, Richard; French, Jacqueline A; Perucca, Emilio; Tomson, Torbjorn

    2013-03-01

    The purpose of this report was to update the 2006 International League Against Epilepsy (ILAE) report and identify the level of evidence for long-term efficacy or effectiveness for antiepileptic drugs (AEDs) as initial monotherapy for patients with newly diagnosed or untreated epilepsy. All applicable articles from July 2005 until March 2012 were identified, evaluated, and combined with the previous analysis (Glauser et al., 2006) to provide a comprehensive update. The prior analysis methodology was utilized with three modifications: (1) the detectable noninferiority boundary approach was dropped and both failed superiority studies and prespecified noninferiority studies were analyzed using a noninferiority approach, (2) the definition of an adequate comparator was clarified and now includes an absolute minimum point estimate for efficacy/effectiveness, and (3) the relationship table between clinical trial ratings, level of evidence, and conclusions no longer includes a recommendation column to reinforce that this review of efficacy/evidence for specific seizure types does not imply treatment recommendations. This evidence review contains one clarification: The commission has determined that class I superiority studies can be designed to detect up to a 20% absolute (rather than relative) difference in the point estimate of efficacy/effectiveness between study treatment and comparator using an intent-to-treat analysis. Since July, 2005, three class I randomized controlled trials (RCT) and 11 class III RCTs have been published. The combined analysis (1940-2012) now includes a total of 64 RCTs (7 with class I evidence, 2 with class II evidence) and 11 meta-analyses. New efficacy/effectiveness findings include the following: levetiracetam and zonisamide have level A evidence in adults with partial onset seizures and both ethosuximide and valproic acid have level A evidence in children with childhood absence epilepsy. There are no major changes in the level of evidence

  19. Time distribution of epileptic seizures during video-EEG monitoring. Implications for health insurance systems in developing countries.

    PubMed

    Quiroga, R C; Pirra, L; Podestá, C; Leiguarda, R C; Rabinowicz, A L

    1997-12-01

    An attempt was made to identify guidelines to help establish epilepsy monitoring units in developing countries. We assessed the time distribution of seizures during video-EEG monitoring and we also estimated the minimum time required for such a procedure and the impact of these variables upon the health insurance system. Mean time for recording five stereotyped clinical events was 72 hours, with a significant number of events recorded between midnight and 0600 hours (P < 0.05). This pilot study may help to establish local policies that will warrant an adequate work-up for our patients.

  20. Pro-Brain-Derived Neurotrophic Factor (proBDNF)-Mediated p75NTR Activation Promotes Depolarizing Actions of GABA and Increases Susceptibility to Epileptic Seizures.

    PubMed

    Riffault, Baptiste; Kourdougli, Nazim; Dumon, Camille; Ferrand, Nadine; Buhler, Emmanuelle; Schaller, Fabienne; Chambon, Caroline; Rivera, Claudio; Gaiarsa, Jean-Luc; Porcher, Christophe

    2016-12-01

    The brain-derived neurotrophic factor (BDNF) is synthesized as a precursor, namely proBDNF, which can be processed into mature BDNF (mBDNF). Evidences suggest that proBDNF signaling through p75(NTR) may account for the emergence of neurological disorders. These findings support the view that the relative availability of mBDNF and proBDNF forms is an important mechanism underlying brain circuit formation and cognitive functions. Here we describe novel insights into the proBDNF/p75(NTR) mechanisms and function in vivo in modulating neuronal circuit and synaptic plasticity during the first postnatal weeks in rats. Our results showed that increased proBDNF/p75(NTR) signaling during development maintains a depolarizing γ-aminobutyric acid (GABA) response in a KCC2-dependent manner in mature neuronal cells. This resulted in altered excitation/inhibition balance and enhanced neuronal network activity. The enhanced proBDNF/p75(NTR) signaling ultimately led to increased seizure susceptibility that was abolished by in vivo injection of function blocking p75(NTR) antibody. Altogether, our study shed new light on how proBDNF/p75(NTR) signaling can orchestrate the GABA excitatory/inhibitory developmental sequence leading to depolarizing and excitatory actions of GABA in adulthood and subsequent epileptic disorders.

  1. Synchrotron X-ray microtransections: a non invasive approach for epileptic seizures arising from eloquent cortical areas

    NASA Astrophysics Data System (ADS)

    Pouyatos, B.; Nemoz, C.; Chabrol, T.; Potez, M.; Bräuer, E.; Renaud, L.; Pernet-Gallay, K.; Estève, F.; David, O.; Kahane, P.; Laissue, J. A.; Depaulis, A.; Serduc, R.

    2016-06-01

    Synchrotron-generated X-ray (SRX) microbeams deposit high radiation doses to submillimetric targets whilst minimizing irradiation of neighboring healthy tissue. We developed a new radiosurgical method which demonstrably transects cortical brain tissue without affecting adjacent regions. We made such image-guided SRX microtransections in the left somatosensory cortex in a rat model of generalized epilepsy using high radiation doses (820 Gy) in thin (200 μm) parallel slices of tissue. This procedure, targeting the brain volume from which seizures arose, altered the abnormal neuronal activities for at least 9 weeks, as evidenced by a decrease of seizure power and coherence between tissue slices in comparison to the contralateral cortex. The brain tissue located between transections stayed histologically normal, while the irradiated micro-slices remained devoid of myelin and neurons two months after irradiation. This pre-clinical proof of concept highlights the translational potential of non-invasive SRX transections for treating epilepsies that are not eligible for resective surgery.

  2. Nuclear Factor-Kappa B Activity Regulates Brain Expression of P-Glycoprotein in the Kainic Acid-Induced Seizure Rats

    PubMed Central

    Yu, Nian; Di, Qing; Liu, Hao; Hu, Yong; Jiang, Ying; Yan, Yu-kui; Zhang, Yan-fang; Zhang, Ying-dong

    2011-01-01

    This study was aimed to investigate the effect of NF-κB activity on the seizure susceptibility, brain damage, and P-gp expression in kainic acid- (KA-) induced seizure rats. Male SD rats were divided into saline control group (NS group), KA induced epilepsy group (EP group), and epilepsy group intervened with NF-κB inhibitor-pyrrolidine dithiocarbamate salt (PDTC group) or with dexamethasone (DEX group). No seizures were observed in the rats of NS group. Compared with NS group, increased P-gp expression and NF-κB activation in the rat brain of the EP group were observed after KA micro-injection. Both PDTC and DEX pre-treatment significantly increased the latency to grade III or V seizure onset compared to EP group but failed to show neuron-protective effect as the number of survival neurons didn't significantly differ from that in EP group. Furthermore, PDTC pre-treatment significantly decreased P-gp expression along with NF-κB activation in the hippocampus CA3 area and amygdala complex of rats compared with the EP group, implying that NF-κB activation involved in the seizure susceptibility and seizure induced brain P-gp over-expression. Additionally, DEX pre-treatment only decreased P-gp expression level without inhibition of NF-κB activation, suggesting NF-κB independent pathway may also participate in regulating seizure induced P-gp over-expression. PMID:21403895

  3. Epileptic Encephalopathies in Adults and Childhood

    PubMed Central

    Kural, Zekiye; Ozer, Ali Fahir

    2012-01-01

    Epileptic encephalopathies are motor-mental retardations or cognitive disorders secondary to epileptic seizures or epileptiform activities. Encephalopaties due to brain damage, medications, or systemic diseases are generally not in the scope of this definition, but they may rarely accompany the condition. Appropriate differential diagnosis of epileptic seizures as well as subclinical electroencephalographic discharges are crucial for management of seizures and epileptiform discharges and relative regression of cognitive deterioration in long-term followup. Proper antiepileptic drug, hormonal treatment, or i.v. immunoglobulin choice play major role in prognosis. In this paper, we evaluated the current treatment approaches by reviewing clinical electrophysiological characteristics of epileptic encephalopathies. PMID:23056934

  4. Intracerebroventricular administration of inosine is anticonvulsant against quinolinic acid-induced seizures in mice: an effect independent of benzodiazepine and adenosine receptors.

    PubMed

    Ganzella, Marcelo; Faraco, Rafael Berger; Almeida, Roberto Farina; Fernandes, Vinícius Fornari; Souza, Diogo Onofre

    2011-12-01

    Inosine (INO) has an anticonvulsant effect against seizures induced by antagonists of GABAergic system. Quinolinic acid (QA) is an agonist NMDA receptors implicated in the neurobiology of seizures. In the present study, we investigated the anticonvulsant effect of intracerebroventricular (i.c.v.) INO administration against QA-induced seizures in adult mice. We also investigated whether the benzodiazepines (BZ) or adenosine (ADO) receptors were involved in the INO effects. Animals were pretreated with an i.c.v. injection of either vehicle or INO before an i.c.v. administration of 4 μl QA (36.8 nmol). All animals pretreated with vehicle followed by QA presented seizures. INO protected against QA-induced seizures in a time and dose dependent manner (up to 60% at 400 nmol, 5 min before QA injection). Diazepam (DZ) and ADO (i.c.v.) also exhibited anticonvulsant effect against QA induced seizures. Additionally, i.p. administration of either flumazenil, a BZ receptor antagonist, or caffeine, an ADO receptor antagonist, did not change the anticonvulsant potency of INO i.c.v. injection, but completely abolished the DZ and ADO anticonvulsant effects, respectively. In conclusion, this study demonstrated that INO exert anticonvulsant effect against hyperactivity of the glutamatergic system independently of BZ or ADO receptors activation.

  5. A method for removing artefacts from continuous EEG recordings during functional electrical impedance tomography for the detection of epileptic seizures.

    PubMed

    Fabrizi, L; Yerworth, R; McEwan, A; Gilad, O; Bayford, R; Holder, D S

    2010-08-01

    Electrical impedance tomography (EIT) is a portable, non-invasive medical imaging method, which could be employed to image the seizure onset in subjects undergoing assessment prior to epilepsy surgery. Each image is obtained from impedance measurements conducted with imperceptible current at tens of kHz. For concurrent imaging with video electroencephalogram (EEG), the EIT introduces a substantial artefact into the EEG due to current switching at frequencies in the EEG band. We present here a method for its removal, so that EIT and the EEG could be acquired simultaneously. A low-pass analogue filter for EEG channels (-6 dB at 48 Hz) and a high-pass filter (-3 dB at 72 Hz) for EIT channels reduced the artefact from 2-3 mV to 50-300 microV, but still left a periodic artefact at about 3 Hz. This was reduced to less than 10 microV with a software filter, which subtracted an artefact template from the EEG raw traces. The EEG was made clinically acceptable at four times its acquisition speed. This method could enable EIT to become a technique for imaging on telemetry units alongside EEG, without interfering with routine EEG reporting.

  6. Anti-Epileptic Drug Combination Efficacy in an In Vitro Seizure Model – Phenytoin and Valproate, Lamotrigine and Valproate

    PubMed Central

    O’Brien, Terence J.; Williams, David A.; French, Chris R.

    2017-01-01

    In this study, we investigated the relative efficacy of different classes of commonly used anti-epileptic drugs (AEDs) with different mechanisms of action, individually and in combination, to suppress epileptiform discharges in an in vitro model. Extracellular field potential were recorded in 450 μm thick transverse hippocampal slices prepared from juvenile Wistar rats, in which “epileptiform discharges” (ED’s) were produced with a high-K+ (8.5 mM) bicarbonate-buffered saline solution. Single and dual recordings in stratum pyramidale of CA1 and CA3 regions were performed with 3–5 MΩ glass microelectrodes. All drugs—lamotrigine (LTG), phenytoin (PHT) and valproate (VPA)—were applied to the slice by superfusion at a rate of 2 ml/min at 32°C. Effects upon frequency of ED’s were assessed for LTG, PHT and VPA applied at different concentrations, in isolation and in combination. We demonstrated that high-K+ induced ED frequency was reversibly reduced by LTG, PHT and VPA, at concentrations corresponding to human therapeutic blood plasma concentrations. With a protocol using several applications of drugs to the same slice, PHT and VPA in combination displayed additivity of effect with 50μM PHT and 350μM VPA reducing SLD frequency by 44% and 24% individually (n = 19), and together reducing SLD frequency by 66% (n = 19). 20μM LTG reduced SLD frequency by 32% and 350μM VPA by 16% (n = 18). However, in combination there was a supra-linear suppression of ED’s of 64% (n = 18). In another independent set of experiments, similar results of drug combination responses were also found. In conclusion, a combination of conventional AEDs with different mechanisms of action, PHT and VPA, displayed linear additivity of effect on epileptiform activity. More intriguingly, a combination of LTG and VPA considered particularly efficacious clinically showed a supra-additive suppression of ED’s. This approach may be useful as an in vitro platform for assessing drug

  7. The effects of quercetin on the gene expression of the GABAA receptor α5 subunit gene in a mouse model of kainic acid-induced seizure.

    PubMed

    Moghbelinejad, Sahar; Alizadeh, Safar; Mohammadi, Ghazaleh; Khodabandehloo, Fatemeh; Rashvand, Zahra; Najafipour, Reza; Nassiri-Asl, Marjan

    2017-03-01

    The flavonoid quercetin has recently been reported to have neuroprotective effects, and the role of the gamma-aminobutyric acid A alpha 5 subunit (GABAA α5) receptor has been determined in some nervous system disorders. The aim of this study was to identify the molecular mechanism of the effect of quercetin administered at anticonvulsive doses on the expression of the GABAA α5 receptor gene in kainic acid (KA)-induced seizures in mice. The experimental animals were divided into four groups: control, KA, and KA + quercetin at 50 or 100 mg/kg, respectively. The results showed a dose-dependent reduction in the behavioral seizure score with quercetin pre-treatment in the KA mouse model. Two hours after the end of the 7-day treatment regimen, expression of the GABAA α5 receptor gene in the hippocampus was found to be increased in the KA group, but this increase was reduced in the KA + quercetin 50 or 100 mg/kg treatment groups. These results suggest that expression of the GABAA α5 receptor could be a mechanism for reducing seizure severity or may be a marker of seizure severity. Further studies are necessary to clarify quercetin's mechanism of action and the relation of GABAA α5 receptor gene expression to seizure severity.

  8. A 1.83 μJ/Classification, 8-Channel, Patient-Specific Epileptic Seizure Classification SoC Using a Non-Linear Support Vector Machine.

    PubMed

    Bin Altaf, Muhammad Awais; Yoo, Jerald

    2016-02-01

    A non-linear support vector machine (NLSVM) seizure classification SoC with 8-channel EEG data acquisition and storage for epileptic patients is presented. The proposed SoC is the first work in literature that integrates a feature extraction (FE) engine, patient specific hardware-efficient NLSVM classification engine, 96 KB SRAM for EEG data storage and low-noise, high dynamic range readout circuits. To achieve on-chip integration of the NLSVM classification engine with minimum area and energy consumption, the FE engine utilizes time division multiplexing (TDM)-BPF architecture. The implemented log-linear Gaussian basis function (LL-GBF) NLSVM classifier exploits the linearization to achieve energy consumption of 0.39 μ J/operation and reduces the area by 28.2% compared to conventional GBF implementation. The readout circuits incorporate a chopper-stabilized DC servo loop to minimize the noise level elevation and achieve noise RTI of 0.81 μ Vrms for 0.5-100 Hz bandwidth with an NEF of 4.0. The 5 × 5 mm (2) SoC is implemented in a 0.18 μm 1P6M CMOS process consuming 1.83 μ J/classification for 8-channel operation. SoC verification has been done with the Children's Hospital Boston-MIT EEG database, as well as with a specific rapid eye-blink pattern detection test, which results in an average detection rate, average false alarm rate and latency of 95.1%, 0.94% (0.27 false alarms/hour) and 2 s, respectively.

  9. Ischemia-induced degeneration of CA1 pyramidal cells decreases seizure severity in a subgroup of epileptic gerbils and affects parvalbumin immunoreactivity of CA1 interneurons.

    PubMed

    Winkler, D T; Scotti, A L; Nitsch, C

    2001-04-01

    Mongolian gerbils are epilepsy-prone animals. In adult gerbils two major groups can be differentiated according to their seizure behavior: Highly seizure-sensitive gerbils exhibit facial and forelimb clonus or generalized tonic-clonic seizures from the first test on, while kindled-like gerbils are seizure free for the first three to six consecutive tests, later develop forelimb myoclonus, and eventually progress to generalized tonic-clonic seizures. In the hippocampus, seizure history of the individual animal is mirrored in the intensity in which GABAergic neurons are immunostained for the calcium-binding protein parvalbumin: they lose parvalbumin with increasing seizure incidence. In a first step to clarify the influence of hippocampal projection neurons on spontaneous seizure behavior and related parvalbumin expression, we induced degeneration of the CA1 pyramidal cells by transient forebrain ischemia. This results in a decreased seizure sensitivity in highly seizure-sensitive gerbils. The kindling-like process, however, is not permanently blocked by the ischemic nerve cell loss, suggesting that an intact CA1 field is not a prerequisite for the development of seizure behavior. The seizure-induced loss of parvalbumin from the ischemia-resistant interneurons recovers after ischemia. Thus, changes in parvalbumin content brought about by repeated seizures are not permanent but can rather be modulated by novel stimuli.

  10. Pathophysiology of epileptic encephalopathies.

    PubMed

    Lado, Fred A; Rubboli, Guido; Capovilla, Giuseppe; Capovilla, Pippo; Avanzini, Giuliano; Moshé, Solomon L

    2013-11-01

    The application of metabolic imaging and genetic analysis, and now the development of appropriate animal models, has generated critical insights into the pathogenesis of epileptic encephalopathies. In this article we present ideas intended to move from the lesions associated with epileptic encephalopathies toward understanding the effects of these lesions on the functioning of the brain, specifically of the cortex. We argue that the effects of focal lesions may be magnified through the interaction between cortical and subcortical structures, and that disruption of subcortical arousal centers that regulate cortex early in life may lead to alterations of intracortical synapses that affect a critical period of cognitive development. Impairment of interneuronal function globally through the action of a genetic lesion similarly causes widespread cortical dysfunction manifesting as increased delta slow waves on electroencephalography (EEG) and as developmental delay or arrest clinically. Finally, prolonged focal epileptic activity during sleep (as occurring in the syndrome of continuous spike-wave in slow sleep, or CSWSS) might interfere with local slow wave activity at the site of the epileptic focus, thereby impairing the neural processes and, possibly, the local plastic changes associated with learning and other cognitive functions. Seizures may certainly add to these pathologic processes, but they are likely not necessary for the development of the cognitive pathology. Nevertheless, although seizures may be either a consequence or symptom of the underlying lesion, their effective treatment can improve outcomes as both clinical and experimental studies may suggest. Understanding their substrates may lead to novel, effective treatments for all aspects of the epileptic encephalopathy phenotype.

  11. [Gelastic seizures: etiology, semiology, therapeutic perspectives].

    PubMed

    Usacheva, E L; Mukhin, K Iu; Prityko, A G; Aĭvazian, S O; Kharlamov, L A; Shorina, M Iu

    2003-01-01

    Gelastic seizures (laughing seizures) are a rare type of epileptic seizure in which laugh in a main and dominating manifestation of the seizure. As a rule, the seizures are caused by organic cerebral pathology and are often reported as a specific epilepsy marker related to hypothalamic hamartoma. The interictal EEG frequently shows a focal activity. Based on examination of 2 patients with gelastic seizures and hypothalamic hamartoma, clinical features, EEG characteristics and therapeutic perspectives for the disorder are discussed.

  12. Classification of seizures and epilepsy.

    PubMed

    Riviello, James J

    2003-07-01

    The management of seizures and epilepsy begins with forming a differential diagnosis, making the diagnosis, and then classifying seizure type and epileptic syndrome. Classification guides treatment, including ancillary testing, management, prognosis, and if needed, selection of the appropriate antiepileptic drug (AED). Many AEDs are available, and certain seizure types or epilepsy syndromes respond to specific AEDs. The identification of the genetics, molecular basis, and pathophysiologic mechanisms of epilepsy has resulted from classification of specific epileptic syndromes. The classification system used by the International League Against Epilepsy is periodically revised. The proposed revision changes the classification emphasis from the anatomic origin of seizures (focal vs generalized) to seizure semiology (ie, the signs or clinical manifestations). Modified systems have been developed for specific circumstances (eg, neonatal seizures, infantile seizures, status epilepticus, and epilepsy surgery). This article reviews seizure and epilepsy classification, emphasizing new data.

  13. Frontal lobe nonconvulsive status epilepticus: a case of epileptic stuttering, aphemia, and aphasia--not a sign of psychogenic nonepileptic seizures.

    PubMed

    Kaplan, Peter W; Stagg, Ryan

    2011-06-01

    Stuttering is a repetitive, iterative disfluency of speech, and is usually seen as a developmental problem in childhood. Acquired causes in adults include strokes and medications. When stuttering occurs with seizure-like events, it is usually attributed to psychogenic nonepileptic seizures. We describe an elderly man who experienced personality change and bouts of stuttering, followed by anarthria with preserved writing and then aphasia affecting written and uttered language, and ending with confusion. EEG recordings showed nonconvulsive status epilepticus (NCSE) with focality in the left frontal region followed by bifrontal NCSE. This case enlarges our understanding of the behavioral correlates of focal frontal seizures to include simple partial seizures with speech and then language output disturbances (aphemia, then aphasia), progressing to complex partial phenomenology in the setting of frontal NCSE.

  14. [ECG characteristics in epilepsy of homo- and heterospecific hereditary origin and schizophrenia with latent epileptic predisposition].

    PubMed

    Dvirskiĭ, A G; Shevtsov, A G; Glasner, A K; Dubrovin, Iu B; Krut'ko, Iu A; Svaĭdan, S

    1991-01-01

    The EEG data were compared among 260 epileptic patients, including 94 patients loaded with schizophrenia, 71 patients loaded with epilepsy, 95 patients without revealed hereditary loading with mental diseases, and among 32 schizophrenics in whom epileptic seizures could be seen during insulin therapy. Hereditary loading with epilepsy or schizophrenia in epileptic patients together with latent epileptic schizophrenia ++predisposition influence the characteristics of the electroencephalogram.

  15. Clinical review of genetic epileptic encephalopathies

    PubMed Central

    Noh, Grace J.; Asher, Y. Jane Tavyev; Graham, John M.

    2012-01-01

    Seizures are a frequently encountered finding in patients seen for clinical genetics evaluations. The differential diagnosis for the cause of seizures is quite diverse and complex, and more than half of all epilepsies have been attributed to a genetic cause. Given the complexity of such evaluations, we highlight the more common causes of genetic epileptic encephalopathies and emphasize the usefulness of recent technological advances. The purpose of this review is to serve as a practical guide for clinical geneticists in the evaluation and counseling of patients with genetic epileptic encephalopathies. Common syndromes will be discussed, in addition to specific seizure phenotypes, many of which are refractory to anti-epileptic agents. Divided by etiology, we overview the more common causes of infantile epileptic encephalopathies, channelopathies, syndromic, metabolic, and chromosomal entities. For each condition, we will outline the diagnostic evaluation and discuss effective treatment strategies that should be considered. PMID:22342633

  16. [Video electroencephalographic diagnosis of epileptic and non-epileptic paroxysmal episodes in infants and children at the pre-school age].

    PubMed

    Pérez-Jiménez, Angeles; García-Fernández, Marta; Santiago, M del Mar; Fournier-Del Castillo, M Concepción

    2012-05-21

    The main usefulness of video electroencephalographic (video-EEG) monitoring lies in the fact that it allows proper classification of the type of epileptic seizure and epileptic syndrome, identification of minor seizures, location of the epileptogenic zone and differentiation between epileptic seizures and non-epileptic paroxysmal manifestations (NEPM). In infants and pre-school age children, the clinical signs with which epileptic seizures are expressed differ to those of older children, seizures with bilateral motor signs such as epileptic spasms, tonic and myoclonic seizures predominate, and seizures with interruption of activity or hypomotor seizures, and no prominent automatisms are observed. In children with focal epilepsies, focal and generalised signs are often superposed, both clinically and in the EEG. NEPM may be benign transitory disorders or they can be episodic symptoms of different neurological or psychopathological disorders. NEPM are often observed in children with mental retardation, neurological compromise or autism spectrum disorders, who present epileptic seizures and epileptiform abnormalities in the baseline EEG. It then becomes necessary to determine which episodes correspond to epileptic seizures and which do not. The NEPM that are most frequently registered in the video-EEG in infants and pre-school age children are unexpected sudden motor contractions ('spasms'), introspective tendencies, motor stereotypic movements and paroxysmal sleep disorders.

  17. [Clinical approach to the first epileptic crisis in adults].

    PubMed

    Espinosa-Jovel, Camilo Alfonso; Sobrino-Mejía, Fidel Ernesto

    2014-04-16

    Seizures are one of the main reasons for visits to emergency and neurology. Represent a traumatic event with potential medical and social consequences. A first epileptic seizure, can be the initial manifestation of malignancy, systemic disorder or infection, but can also be the first manifestation of epilepsy. The misdiagnosis of symptomatic seizures and unprovoked seizure, significantly affects prognosis and patient outcomes. The aim of this review is to examine the general concepts that enable successful diagnostic and therapeutic approach to the patient presenting with a first epileptic seizure.

  18. Astrocytes in the epileptic brain.

    PubMed

    Wetherington, Jonathon; Serrano, Geidy; Dingledine, Ray

    2008-04-24

    The roles that astrocytes play in the evolution of abnormal network excitability in chronic neurological disorders involving brain injury, such as acquired epilepsy, are receiving renewed attention due to improved understanding of the molecular events underpinning the physiological functions of astrocytes. In epileptic tissue, evidence is pointing to enhanced chemical signaling and disrupted linkage between water and potassium balance by reactive astrocytes, which together conspire to enhance local synchrony in hippocampal microcircuits. Reactive astrocytes in epileptic tissue both promote and oppose seizure development through a variety of specific mechanisms; the new findings suggest several novel astrocyte-related targets for drug development.

  19. Astrocytes in the Epileptic Brain

    PubMed Central

    Wetherington, Jonathon; Serrano, Geidy; Dingledine, Ray

    2014-01-01

    The roles that astrocytes play in the evolution of abnormal network excitability in chronic neurological disorders involving brain injury, such as acquired epilepsy, are receiving renewed attention due to improved understanding of the molecular events underpinning the physiological functions of astrocytes. In epileptic tissue, evidence is pointing to enhanced chemical signaling and disrupted linkage between water and potassium balance by reactive astrocytes, which together conspire to enhance local synchrony in hippocampal microcircuits. Reactive astrocytes in epileptic tissue both promote and oppose seizure development through a variety of specific mechanisms; the new findings suggest several novel astrocyte-related targets for drug development. PMID:18439402

  20. eEF2K/eEF2 Pathway Controls the Excitation/Inhibition Balance and Susceptibility to Epileptic Seizures.

    PubMed

    Heise, Christopher; Taha, Elham; Murru, Luca; Ponzoni, Luisa; Cattaneo, Angela; Guarnieri, Fabrizia C; Montani, Caterina; Mossa, Adele; Vezzoli, Elena; Ippolito, Giulio; Zapata, Jonathan; Barrera, Iliana; Ryazanov, Alexey G; Cook, James; Poe, Michael; Stephen, Michael Rajesh; Kopanitsa, Maksym; Benfante, Roberta; Rusconi, Francesco; Braida, Daniela; Francolini, Maura; Proud, Christopher G; Valtorta, Flavia; Passafaro, Maria; Sala, Mariaelvina; Bachi, Angela; Verpelli, Chiara; Rosenblum, Kobi; Sala, Carlo

    2016-03-21

    Alterations in the balance of inhibitory and excitatory synaptic transmission have been implicated in the pathogenesis of neurological disorders such as epilepsy. Eukaryotic elongation factor 2 kinase (eEF2K) is a highly regulated, ubiquitous kinase involved in the control of protein translation. Here, we show that eEF2K activity negatively regulates GABAergic synaptic transmission. Indeed, loss of eEF2K increases GABAergic synaptic transmission by upregulating the presynaptic protein Synapsin 2b and α5-containing GABAAreceptors and thus interferes with the excitation/inhibition balance. This cellular phenotype is accompanied by an increased resistance to epilepsy and an impairment of only a specific hippocampal-dependent fear conditioning. From a clinical perspective, our results identify eEF2K as a potential novel target for antiepileptic drugs, since pharmacological and genetic inhibition of eEF2K can revert the epileptic phenotype in a mouse model of human epilepsy.

  1. Diagnosis and Management of Epileptic Encephalopathies in Children

    PubMed Central

    Jain, Puneet; Tripathi, Manjari

    2013-01-01

    Epileptic encephalopathies refer to a group of disorders in which the unremitting epileptic activity contributes to severe cognitive and behavioral impairments above and beyond what might be expected from the underlying pathology alone, and these can worsen over time leading to progressive cerebral dysfunction. Several syndromes have been described based on their electroclinical features (age of onset, seizure type, and EEG pattern). This review briefly describes the clinical evaluation and management of commonly encountered epileptic encephalopathies in children. PMID:23970964

  2. [Reflex seizures, cinema and television].

    PubMed

    Olivares-Romero, Jesús

    2015-12-16

    In movies and television series are few references to seizures or reflex epilepsy even though in real life are an important subgroup of total epileptic syndromes. It has performed a search on the topic, identified 25 films in which they appear reflex seizures. Most seizures observed are tonic-clonic and visual stimuli are the most numerous, corresponding all with flashing lights. The emotions are the main stimuli in higher level processes. In most cases it is not possible to know if a character suffers a reflex epilepsy or suffer reflex seizures in the context of another epileptic syndrome. The main conclusion is that, in the movies, the reflex seizures are merely a visual reinforcing and anecdotal element without significant influence on the plot.

  3. Psychogenic gelastic seizures in a patient with hypothalamic hamartoma.

    PubMed

    Scarella, Timothy; Macken, Michael P; Gerard, Elizabeth; Schuele, Stephan U

    2012-06-01

    Gelastic seizures are classically associated with hypothalamic hamartoma. The most effective treatment for gelastic epilepsy is surgery, although confirming that a hypothalamic hamartoma is an epileptic lesion prior to surgical intervention is challenging. Here, we report the case of a patient with a hypothalamic hamartoma who was diagnosed with psychogenic non-epileptic gelastic seizures using video-EEG monitoring. [Published with video sequences].

  4. Prosthetic management of an epileptic patient.

    PubMed

    Akeredolu, P A; Temisanren, O T; Danesi, M A

    2005-12-01

    This case report illustrates the problems of tooth loss in an epileptic patient. The patient presented with a broken denture following a seizure. She gave a history of breaking and swallowing her dentures during seizures. Before presentation she had worn five upper removable partial dentures. An upper removable partial denture with increased thickness of the acrylic palatal was fabricated and fitted satisfactorily. The patient was taught how to insert and remove the prosthesis as quickly as possible. Epileptic patients can use dentures but run the risk of frequently breaking and swallowing them during seizures. The risk can be reduced if patients and relatives are taught how to remove the dentures prior to or during seizures.

  5. Postnatal disruption of the disintegrin/metalloproteinase ADAM10 in brain causes epileptic seizures, learning deficits, altered spine morphology, and defective synaptic functions.

    PubMed

    Prox, Johannes; Bernreuther, Christian; Altmeppen, Hermann; Grendel, Jasper; Glatzel, Markus; D'Hooge, Rudi; Stroobants, Stijn; Ahmed, Tariq; Balschun, Detlef; Willem, Michael; Lammich, Sven; Isbrandt, Dirk; Schweizer, Michaela; Horré, Katrien; De Strooper, Bart; Saftig, Paul

    2013-08-07

    The metalloproteinase ADAM10 is of importance for Notch-dependent cortical brain development. The protease is tightly linked with α-secretase activity toward the amyloid precursor protein (APP) substrate. Increasing ADAM10 activity is suggested as a therapy to prevent the production of the neurotoxic amyloid β (Aβ) peptide in Alzheimer's disease. To investigate the function of ADAM10 in postnatal brain, we generated Adam10 conditional knock-out (A10cKO) mice using a CaMKIIα-Cre deleter strain. The lack of ADAM10 protein expression was evident in the brain cortex leading to a reduced generation of sAPPα and increased levels of sAPPβ and endogenous Aβ peptides. The A10cKO mice are characterized by weight loss and increased mortality after weaning associated with seizures. Behavioral comparison of adult mice revealed that the loss of ADAM10 in the A10cKO mice resulted in decreased neuromotor abilities and reduced learning performance, which were associated with altered in vivo network activities in the hippocampal CA1 region and impaired synaptic function. Histological and ultrastructural analysis of ADAM10-depleted brain revealed astrogliosis, microglia activation, and impaired number and altered morphology of postsynaptic spine structures. A defect in spine morphology was further supported by a reduction of the expression of NMDA receptors subunit 2A and 2B. The reduced shedding of essential postsynaptic cell adhesion proteins such as N-Cadherin, Nectin-1, and APP may explain the postsynaptic defects and the impaired learning, altered network activity, and synaptic plasticity of the A10cKO mice. Our study reveals that ADAM10 is instrumental for synaptic and neuronal network function in the adult murine brain.

  6. Long-lasting c-fos and NGF mRNA expressions and loss of perikaryal parvalbumin immunoreactivity in the development of epileptogenesis after ethacrynic acid-induced seizure.

    PubMed

    Suzukawa, J; Omori, K; Okugawa, G; Fujiseki, Y; Heizmann, C W; Inagaki, C

    1999-07-10

    A single cerebroventricular injection of ethacrynic acid (EA), a Cl(-)-ATPase inhibitor, induces generalized tonic-clonic convulsions in mice. To clarify whether such convulsive stimulus triggers a long-lasting rearrangement of the neural circuitry culminating in seizure susceptibility, we examined molecular, cellular and behavioral changes following the EA-induced seizure. The expression of immediate early gene c-fos mRNA as an index for cellular activation increased biphasically, with an early transient increase at 60 min and a late prolonged increase on the 10th to 14th day post-EA administration, most remarkably in the hippocampus and pyriform cortex. On the 14th day post-EA seizure, subconvulsive dose of kainic acid (5-17.5 mg/kg) caused severe (stage 5) seizure in 77% of the mice, with 70% mortality. In addition, the expression of nerve growth factor (NGF) also showed biphasic increases with close spatiotemporal correlation with c-fos expression. Moreover, the number of cell somata and the density of axon fibers of parvalbumin (PARV)-positive cells, a subpopulation of GABAergic interneurons, decreased in area dentata, CA1 and CA3 on the 7th and 14th day post-EA seizure. In area dentata and CA1, the density of glutamic acid decarboxylase (GAD)-positive cells also decreased on the 14th day. Thus, the transient EA-induced seizures appear to develop seizure susceptibility by causing damage of a subpopulation of inhibitory interneurons along with increases in the expression of c-fos and NGF in limbic structures.

  7. Causative factors for suicide attempts by overdose in epileptics.

    PubMed

    Mendez, M F; Lanska, D J; Manon-Espaillat, R; Burnstine, T H

    1989-10-01

    We investigated possible causative factors for the high epileptic suicide rate by reviewing the cases of 22 patients with idiopathic epilepsy found among 711 patients hospitalized for a suicide attempt by overdose. Suicide attempts occurred with increased seizure activity in one epileptic; otherwise, no relationships were found with seizure-related variables. When matched by age, sex, and race with 44 nonepileptic controls from the same population, the epileptics had more borderline personality disorders with multiple impulsive suicide attempts (45.5% vs 13.6%), more psychotic disturbances, including command hallucinations (31.8% vs 9.1%), fewer adjustment disorders (18.2% vs 45.5%), and a comparable frequency of depression (13.6% vs 25%). We conclude that suicide attempts in epileptics are primarily associated with interictal psychopathologic factors, such as borderline personality disorder and psychosis, rather than with specific psychosocial stressors, seizure variables, or anticonvulsant medications.

  8. Transient epileptic amnesia: clinical report of a cohort of patients.

    PubMed

    Lapenta, Leonardo; Brunetti, Valerio; Losurdo, Anna; Testani, Elisa; Giannantoni, Nadia Mariagrazia; Quaranta, Davide; Di Lazzaro, Vincenzo; Della Marca, Giacomo

    2014-07-01

    Transient epileptic amnesia is a seizure disorder, usually with onset in the middle-elderly and good response to low dosages of antiepileptic drugs. We describe the clinical, electroencephalography (EEG), and neuroimaging features of 11 patients with a temporal lobe epilepsy characterized by amnesic seizures as the sole or the main symptom. We outline the relevance of a detailed clinical history to recognize amnesic seizures and to avoid the more frequent misdiagnoses. Moreover, the response to monotherapy was usually good, although the epileptic disorder was symptomatic of acquired lesions in the majority of patients.

  9. Progress in autoimmune epileptic encephalitis

    PubMed Central

    Wright, S.; Vincent, A.

    2016-01-01

    Purpose of review Autoimmune epileptic encephalopathy is a potentially treatable neurological syndrome characterized by the coexistence of a neuronal antibody in the CSF and serum. Patients present with combinations of seizures, neuropsychiatric features, movement disorder and cognitive decline, but some patients have isolated seizures either at first presentation or during their illness. This review summarises our current understanding of the roles of specific neuronal antibodies in epilepsy-related syndromes and aims to aid the clinician in diagnosis and treatment. Recent findings Antigen discovery methods in three neuroimmunology centres independently identified antibodies to different subunits of the GABAA receptor; high levels of these antibodies were found mainly in patients with severe refractory seizures. These and other antibodies were also found in a proportion (<10%) of children and adults with epilepsy. A clinical study comparing immunotherapy in patients with autoantibodies or without an identified target antigen found neuroinflammatory features were predictive of a therapeutic response. New in-vitro and in-vivo studies, and spontaneous animal models, have confirmed the pathogenicity and epileptogenicity of neuronal antibodies and their relevance to other mammals. Summary Neuronal antibodies are an important cause of autoimmune epileptic encephalopathy, early recognition is important as there may be an underlying tumour, and early treatment is associated with a better outcome. In the absence of an antibody, the clinician should adopt a pragmatic approach and consider a trial of immunotherapy when other causes have been excluded. PMID:26886357

  10. Frequency interactions in human epileptic brain.

    PubMed

    Cotic, Marija; Zalay, Osbert; Valiante, Taufik; Carlen, Peter L; Bardakjian, Berj L

    2011-01-01

    We have used two algorithms, wavelet phase coherence (WPC) and modulation index (MI) analysis to study frequency interactions in the human epileptic brain. Quantitative analyses were performed on intracranial electroencephalographic (iEEG) segments from three patients with neocortical epilepsy. Interelectrode coherence was measured using WPC and intraelectrode frequency interactions were analyzed using MI. WPC was performed on electrode pairings and the temporal evolution of phase couplings in the following frequency ranges: 1-4 Hz, 4-8 Hz, 8-13 Hz, 13-30 Hz and 30-100 Hz was studied. WPC was strongest in the 1-4 Hz frequency range during both seizure and non-seizure activities; however, WPC values varied minimally between electrode pairings. The 13-30 Hz band showed the lowest WPC values during seizure activity. MI analysis yielded two prominent patterns of frequency-specific activity, during seizure and non-seizure activities, which were present across all patients.

  11. Analyzing reliability of seizure diagnosis based on semiology.

    PubMed

    Jin, Bo; Wu, Han; Xu, Jiahui; Yan, Jianwei; Ding, Yao; Wang, Z Irene; Guo, Yi; Wang, Zhongjin; Shen, Chunhong; Chen, Zhong; Ding, Meiping; Wang, Shuang

    2014-12-01

    This study aimed to determine the accuracy of seizure diagnosis by semiological analysis and to assess the factors that affect diagnostic reliability. A total of 150 video clips of seizures from 50 patients (each with three seizures of the same type) were observed by eight epileptologists, 12 neurologists, and 20 physicians (internists). The videos included 37 series of epileptic seizures, eight series of physiologic nonepileptic events (PNEEs), and five series of psychogenic nonepileptic seizures (PNESs). After observing each video, the doctors chose the diagnosis of epileptic seizures or nonepileptic events for the patient; if the latter was chosen, they further chose the diagnosis of PNESs or PNEEs. The overall diagnostic accuracy rate for epileptic seizures and nonepileptic events increased from 0.614 to 0.660 after observations of all three seizures (p < 0.001). The diagnostic sensitivity and specificity of epileptic seizures were 0.770 and 0.808, respectively, for the epileptologists. These values were significantly higher than those for the neurologists (0.660 and 0.699) and physicians (0.588 and 0.658). A wide range of diagnostic accuracy was found across the various seizures types. An accuracy rate of 0.895 for generalized tonic-clonic seizures was the highest, followed by 0.800 for dialeptic seizures and then 0.760 for automotor seizures. The accuracy rates for myoclonic seizures (0.530), hypermotor seizures (0.481), gelastic/dacrystic seizures (0.438), and PNESs (0.430) were poor. The reliability of semiological diagnosis of seizures is greatly affected by the seizure type as well as the doctor's experience. Although the overall reliability is limited, it can be improved by observing more seizures.

  12. Biotelemetry system for Epilepsy Seizure Control

    SciTech Connect

    Smith, LaCurtise; Bohnert, George W.

    2009-07-02

    The Biotelemetry System for Epilepsy Seizure Control Project developed and tested an automated telemetry system for use in an epileptic seizure prevention device that precisely controls localized brain temperature. This project was a result of a Department of Energy (DOE) Global Initiatives for Proliferation Prevention (GIPP) grant to the Kansas City Plant (KCP), Argonne National Laboratory (ANL), and Pacific Northwest National Laboratory (PNNL) to partner with Flint Hills Scientific, LLC, Lawrence, KS and Biophysical Laboratory Ltd (BIOFIL), Sarov, Russia to develop a method to help control epileptic seizures.

  13. TONIC INFLUENCE OF NEOCORTEX ON HIPPOCAMPAL SEIZURES.

    PubMed

    Saralidze, E; Khuchua, L; Kobaidze, I

    2016-09-01

    The interaction between different brain structures could be crucial to predicting seizure occurrence, threshold and spread. Moreover, the sleep-wake cycle and electrical activity of brain structures in different phases of sleep could significantly affect the pattern and extent of seizure spread, and therefore the characteristics of epileptic activity. In this animal model using 15 Wistar rats, we show that the duration of hippocampal seizures, induced by electrical stimulation of the hippocampus, is significantly increased during slow sleep. Moreover, decreasing the electrical activity of the neocortex by cooling of the cortical surface or induction of cortical spreading depression also caused an increase in hippocampal seizure duration. Conversely, warming the cortical surface triggered a remission in spreading depression, in turn restoring the duration of epileptic episodes. Our data suggest that the neocortex probably exerts a tonic inhibitory influence on hippocampal seizures. Thus, cortico-hippocampal interaction could be an important component in the manifestation and generalization of limbic seizures.

  14. Absence seizure

    MedlinePlus

    Seizure - petit mal; Seizure - absence; Petit mal seizure; Epilepsy - absence seizure ... Abou-Khalil BW, Gallagher MJ, Macdonald RL. Epilepsies. In: Daroff ... Practice . 7th ed. Philadelphia, PA: Elsevier; 2016:chap 101. ...

  15. [Epileptic seizures complicated by Takotsubo syndrome].

    PubMed

    Garea Garcia-Malvar, M J; Gonzalez-Silva, Y; Epureanu-Epureanu, V

    2014-11-01

    Introduccion. El sindrome de takotsubo es un trastorno caracterizado por disfuncion ventricular reversible, dolor precordial de tipo anginoso y cambios electrocardiograficos sin evidencia de obstruccion coronaria en coronariografia. Se desencadena por estres, y es frecuente tras crisis epilepticas. Presentamos el caso de una paciente que inicia esta miocardiopatia tras una crisis epileptica al finalizar su sesion de hemodialisis. Caso clinico. Mujer de 55 años en hemodialisis por insuficiencia renal cronica, con epilepsia secundaria a lesion residual frontoparietal derecha por un hematoma que preciso evacuacion quirurgica. Tras una sesion de hemodialisis experimenta una crisis epileptica focal con generalizacion secundaria y, horas despues de esta, dolor centrotoracico. En seriacion enzimatica se objetiva elevacion de troponina I y, electrocardiograficamente, ondas T negativas en derivaciones precordiales (V2-V6). Se realiza coronariografia, cuyo resultado es normal, y se demuestran alteraciones de la contractilidad, confirmadas como de caracter transitorio en un estudio ecocardiografico seriado. Todos los datos anteriores hacen sospechar el diagnostico de sindrome de takotsubo. Conclusion. Las complicaciones cardiacas son una de las causas de morbimortalidad en la epilepsia, y entre ellas se encuentra el sindrome de takotsubo. La incidencia real de dicho sindrome se desconoce, pero dada su implicacion en la mortalidad de causa cardiaca en la epilepsia es importante sospecharlo ante la presencia de disfuncion cardiaca tras una crisis epileptica.

  16. Factors associated with hopelessness in epileptic patients

    PubMed Central

    Pompili, Maurizio; Serafini, Gianluca; Innamorati, Marco; Montebovi, Franco; Lamis, Dorian A; Milelli, Mariantonietta; Giuliani, Manuela; Caporro, Matteo; Tisei, Paolo; Lester, David; Amore, Mario; Girardi, Paolo; Buttinelli, Carla

    2014-01-01

    AIM: To investigate factors related to hopelessness in a sample of epileptic patients, including measures of depression and quality of life (QOL). METHODS: Sixty-nine participants were administered the following psychometric instruments: Beck Depression Inventory-II, Beck Hopelessness Scale (BHS), and QOL in Epilepsy (QOLIE)-89. Patients were dichotomized into two categories: those affected by epilepsy with generalized tonic-clonic seizures vs those having epilepsy with partial seizures. RESULTS: The groups differed on the QOLIE Role Limitation/Emotional dimension. Patients with generalized seizures reported more limitations in common social/role activities related to emotional problems than patients with other types of epilepsy (89.57 ± 25.49 vs 72.86 ± 36.38; t63 = -2.16; P < 0.05). All of the respondents reported moderate to severe depression, and 21.7% of patients with generalized seizures and 28.6% of patients with other diagnoses had BHS total scores ≥ 9 indicating a higher suicidal risk. The study did not control for years of the illness. CONCLUSION: Patients with generalized seizures reported more limitations in common social/role activities related to emotional problems compared to patients with other types of seizures. Patients at increased suicide risk as evaluated by the BHS were older than those who had a lower suicidal risk. Future studies are required to further investigate the impact of hopelessness on the outcome of epileptic patients. PMID:25540729

  17. Features and futures: seizure detection in partial epilepsies.

    PubMed

    Han, Yu; Hsin, Yue-Loong; Harnod, Tomor; Liu, Wentai

    2011-10-01

    Many factors underlying basic epileptic conditions determine the characteristics of epileptic seizures and the therapeutic outcome. Diagnosis and treatment rely on the clinical manifestations as well as electroencephalographic (EEG) epileptic activities. This article briefly reviews the fundamentals of the EEG, interictal, and ictal electrical activities of both extracranial and intracranial EEG of partial epilepsies, based on the information obtained from epilepsy patients who have undergone epilepsy surgery. The authors also present the status of their current research, focusing on decomposed seizure sources and the rendered spatial-temporal transitions in focal seizure.

  18. Increased excitability and metabolism in pilocarpine induced epileptic rats: effect of Bacopa monnieri.

    PubMed

    Mathew, Jobin; Paul, Jes; Nandhu, M S; Paulose, C S

    2010-09-01

    We have evaluated the acetylcholine esterase and malate dehydrogenase activity in the muscle, epinephrine, norepinephrine, insulin and T3 content in the serum of epileptic rats. Acetylcholine esterase and malate dehydrogenase activity increased in the muscle and decreased in the heart of the epileptic rats compared to control. Insulin and T3 content were increased significantly in the serum of the epileptic rats. Our results suggest that repetitive seizures resulted in increased metabolism and excitability in epileptic rats. Bacopa monnieri and Bacoside-A treatment prevents the occurrence of seizures there by reducing the impairment on peripheral nervous system.

  19. A cupric silver histochemical analysis of domoic acid damage to olfactory pathways following status epilepticus in a rat model for chronic recurrent spontaneous seizures and aggressive behavior.

    PubMed

    Tiedeken, Jessica A; Muha, Noah; Ramsdell, John S

    2013-01-01

    The amnesic shellfish toxin, domoic acid, interferes with glutamatergic pathways leading to neuronal damage, most notably causing memory loss and seizures. In this study, the authors utilized a recently developed rat model for domoic acid-induced epilepsy, an emerging disease appearing in California sea lions weeks to months after poisoning, to identify structural damage that may lead to a permanent epileptic state. Sprague Dawley rats were kindled with several low hourly intraperitoneal doses of domoic acid until a state of status epilepticus (SE) appears. This kindling approach has previously been shown to induce a permanent state of epileptic disease in 96% animals within 6 months. Three animals were selected for neurohistology a week after the initial SE. An amino cupric silver staining method using neutral red counterstain was used on every eighth 40 µm coronal section from each brain to highlight neural degeneration from the olfactory bulb through the brain stem. The most extensive damage was found in the olfactory bulb and related olfactory pathways, including the anterior/medial olfactory cortices, endopiriform nucleus, and entorhinal cortex. These findings indicate that damage to olfactory pathways is prominent in a rat model for domoic acid-induced chronic recurrent spontaneous seizures and aggressive behavior.

  20. Epileptic Seizures from Abnormal Networks: Why Some Seizures Defy Predictability

    DTIC Science & Technology

    2011-12-12

    joint distribution. This was based on the circular definition of the lag-1 serial correlation coefficient ( Wald and Wolfowitz , 1943). p-Values were...randomness to the interbursting phase intervals ( Wald and Wolfowitz , 1943). In the case of Continuous Run 1, we found that one cannot reject the null... Wald , A., Wolfowitz , J., 1943. An exact test for randomness in the non-parametric case based on serial correlation. Ann. Math. Stat. 14 (4), 378—388

  1. Ion dynamics during seizures

    PubMed Central

    Raimondo, Joseph V.; Burman, Richard J.; Katz, Arieh A.; Akerman, Colin J.

    2015-01-01

    Changes in membrane voltage brought about by ion fluxes through voltage and transmitter-gated channels represent the basis of neural activity. As such, electrochemical gradients across the membrane determine the direction and driving force for the flow of ions and are therefore crucial in setting the properties of synaptic transmission and signal propagation. Ion concentration gradients are established by a variety of mechanisms, including specialized transporter proteins. However, transmembrane gradients can be affected by ionic fluxes through channels during periods of elevated neural activity, which in turn are predicted to influence the properties of on-going synaptic transmission. Such activity-induced changes to ion concentration gradients are a feature of both physiological and pathological neural processes. An epileptic seizure is an example of severely perturbed neural activity, which is accompanied by pronounced changes in intracellular and extracellular ion concentrations. Appreciating the factors that contribute to these ion dynamics is critical if we are to understand how a seizure event evolves and is sustained and terminated by neural tissue. Indeed, this issue is of significant clinical importance as status epilepticus—a type of seizure that does not stop of its own accord—is a life-threatening medical emergency. In this review we explore how the transmembrane concentration gradient of the six major ions (K+, Na+, Cl−, Ca2+, H+and HCO3−) is altered during an epileptic seizure. We will first examine each ion individually, before describing how multiple interacting mechanisms between ions might contribute to concentration changes and whether these act to prolong or terminate epileptic activity. In doing so, we will consider how the availability of experimental techniques has both advanced and restricted our ability to study these phenomena. PMID:26539081

  2. Metabolic Causes of Epileptic Encephalopathy

    PubMed Central

    Pearl, Phillip L.

    2013-01-01

    Epileptic encephalopathy can be induced by inborn metabolic defects that may be rare individually but in aggregate represent a substantial clinical portion of child neurology. These may present with various epilepsy phenotypes including refractory neonatal seizures, early myoclonic encephalopathy, early infantile epileptic encephalopathy, infantile spasms, and generalized epilepsies which in particular include myoclonic seizures. There are varying degrees of treatability, but the outcome if untreated can often be catastrophic. The importance of early recognition cannot be overemphasized. This paper provides an overview of inborn metabolic errors associated with persistent brain disturbances due to highly active clinical or electrographic ictal activity. Selected diseases are organized by the defective molecule or mechanism and categorized as small molecule disorders (involving amino and organic acids, fatty acids, neurotransmitters, urea cycle, vitamers and cofactors, and mitochondria) and large molecule disorders (including lysosomal storage disorders, peroxisomal disorders, glycosylation disorders, and leukodystrophies). Details including key clinical features, salient electrophysiological and neuroradiological findings, biochemical findings, and treatment options are summarized for prominent disorders in each category. PMID:23762547

  3. Concepts of Connectivity and Human Epileptic Activity

    PubMed Central

    Lemieux, Louis; Daunizeau, Jean; Walker, Matthew C.

    2011-01-01

    This review attempts to place the concept of connectivity from increasingly sophisticated neuroimaging data analysis methodologies within the field of epilepsy research. We introduce the more principled connectivity terminology developed recently in neuroimaging and review some of the key concepts related to the characterization of propagation of epileptic activity using what may be called traditional correlation-based studies based on EEG. We then show how essentially similar methodologies, and more recently models addressing causality, have been used to characterize whole-brain and regional networks using functional MRI data. Following a discussion of our current understanding of the neuronal system aspects of the onset and propagation of epileptic discharges and seizures, we discuss the most advanced and ambitious framework to attempt to fully characterize epileptic networks based on neuroimaging data. PMID:21472027

  4. Reflex gelastic-dacrystic seizures following hypoxic-ischaemic encephalopathy.

    PubMed

    Verma, Rajesh; Praharaj, Heramba Narayan

    2013-07-12

    Reflex or stimulus-sensitive epilepsies are uncommon epileptic syndromes triggered by exogenous-specific sensory stimulus or endogenous various mental activities. Gelastic-dacrystic seizures are rare epileptic manifestations characterised by ictal laughter and crying. Gelastic-dacrystic seizures are commonly caused by hypothalamic hamartoma but rarely described due to cortical dysplasia, lesions of frontal and temporal lobes, tumours and vascular malformations. We report a young woman who presented with somatosensory-evoked gelastic-dacrystic seizures. This patient had a positive history of perinatal insult substantiated by MRI findings. Hypoxic-ischaemic encephalopathy as the cause of gelastic-dacrystic seizures has not been reported so far in the literature.

  5. Utility of different seizure induction protocols in psychogenic nonepileptic seizures.

    PubMed

    Goyal, Gourav; Kalita, Jayantee; Misra, Usha K

    2014-08-01

    Psychogenic non epileptic seizure (PNES) can be induced by several induction tests but their relative usefulness has not been evaluated. In this study, we report the sensitivity and specificity of various induction tests in the diagnosis of PNES and assess their discomfort level. The induction tests were: (a) compression of temple region (CTR), (b) verbal suggestion (VS), (c) tuning fork application (TFA), (d) moist swab application (MSA), (e) torch light stimulation (TLS) and (f) saline injection (SI). Up to 3 trials were done for each test except for normal saline injection which was given once. For comparison of these tests, patients with epileptic seizures were included as controls. The time to precipitate PNES was recorded and patients' discomfort levels were noted on a 0-10 scale. Video EEG was recorded in the PNES patients. 140 patients with PNES and 50 controls with epileptic seizures were included. The diagnostic yield of CTR was 65.7%, TFA 61.4%, MSA 60.7%, SI 55.6%, VS 54.3% and TLS 40.7%. These tests did not induce seizures in the controls. All these tests had 100% specificity and 100% positive predictive value in the diagnosis of PNES. The maximum discomfort was reported with SI and minimum with MSA. The similarity of efficacy and discomfort with CTR and TFA appear to be the most optimal induction techniques when compared with VS, AMS, TLS, and SI.

  6. Vitamin-Responsive Epileptic Encephalopathies in Children

    PubMed Central

    Agadi, Satish; Quach, Michael M.

    2013-01-01

    Untreated epileptic encephalopathies in children may potentially have disastrous outcomes. Treatment with antiepileptic drugs (AEDs) often may not control the seizures, and even if they do, this measure is only symptomatic and not specific. It is especially valuable to identify potential underlying conditions that have specific treatments. Only a few conditions have definitive treatments that can potentially modify the natural course of disease. In this paper, we discuss the few such conditions that are responsive to vitamin or vitamin derivatives. PMID:23984056

  7. Epileptic EEG: a comprehensive study of nonlinear behavior.

    PubMed

    Daneshyari, Moayed; Kamkar, L Lily; Daneshyari, Matin

    2010-01-01

    In this study, the nonlinear properties of the electroencephalograph (EEG) signals are investigated by comparing two sets of EEG, one set for epileptic and another set for healthy brain activities. Adopting measures of nonlinear theory such as Lyapunov exponent, correlation dimension, Hurst exponent, fractal dimension, and Kolmogorov entropy, the chaotic behavior of these two sets is quantitatively computed. The statistics for the two groups of all measures demonstrate the differences between the normal healthy group and epileptic one. The statistical results along with phase-space diagram verify that brain under epileptic seizures possess limited trajectory in the state space than in healthy normal state, consequently behaves less chaotically compared to normal condition.

  8. Neurophysiological aspects of neonatal seizures.

    PubMed

    Watanabe, Kazuyoshi

    2014-05-01

    Recently, amplitude-integrated EEG (aEEG) has been increasingly used and proved useful in neonatal intensive care units (NICU) for the management of neonatal seizures. It does not replace, but is supplementary to standard EEG. This article reviews some of findings obtained with standard EEGs, and tries to interpret them with recent findings in the field of basic science. Seizures mainly occur in active-REM sleep in neonates. This is in sharp contrast to those in older children and adults, in whom epileptic seizures occur mainly in NREM sleep. This may be explained by neurotransmitter effects on sleep mechanisms of the neonatal brain that are different from those of older individuals. When all clinical seizures have no electrical correlates, they are non-epileptic, but when the correlation between clinical seizures and frequent electrical discharges are inconsistent, they should rather be considered epileptic, reflecting progression of status epilepticus causing electro-clinical dissociation. Electro-clinical dissociation is not a characteristic of neonatal seizures per se, but a feature of prolonged status epilepticus in adults as well as children. It occurs when prolonged status epilepticus itself causes a progressively severe encephalopathy, or when status occurs in the presence of a severe underlying encephalopathy. In neonates without pre-existing brain damage, frequent seizures per se may cause mild depression characterized by the loss of high voltage slow patterns, an important constituent of slow wave sleep reflecting cortico-cortical connectivity. Mild depression only in the acute stage is not associated with neurological sequelae, but previously damaged brain may be more vulnerable than normal brain.

  9. Cellular and network mechanisms of electrographic seizures

    PubMed Central

    Bazhenov, Maxim; Timofeev, Igor; Fröhlich, Flavio; Sejnowski, Terrence J.

    2008-01-01

    Epileptic seizures constitute a complex multiscale phenomenon that is characterized by synchronized hyperexcitation of neurons in neuronal networks. Recent progress in understanding pathological seizure dynamics provides crucial insights into underlying mechanisms and possible new avenues for the development of novel treatment modalities. Here we review some recent work that combines in vivo experiments and computational modeling to unravel the pathophysiology of seizures of cortical origin. We particularly focus on how activity-dependent changes in extracellular potassium concentration affects the intrinsic dynamics of neurons involved in cortical seizures characterized by spike/wave complexes and fast runs. PMID:19190736

  10. Absence Seizure (Petit Mal Seizure)

    MedlinePlus

    ... Staff Absence seizures involve brief, sudden lapses of consciousness. They're more common in children than adults. ... have seizures, the brain's usual electrical activity is altered. During an absence seizure, these electrical signals repeat ...

  11. [The influence of epileptic predisposition on clinical features of schizophrenia in patients after delirium tremens].

    PubMed

    Dvirskiĭ, A A

    2001-01-01

    153 patients with schizophrenia in combination with alcoholic delirium were examined. Latent epilepsy has been found in 36 patients (23.5%). The basis of the epileptic seizures during alcoholic delirium was hereditary epileptic predisposition. Frequency of the progredient course was high while that of the favourable--recurrent course of schizophrenia was low in these cases.

  12. [Lateralization of the epileptic process and psychology].

    PubMed

    Preiss, J; Kristof, M

    1989-04-01

    In a group of 70 patients with a unilateral epileptic process in the temporal limbic structures, localized in the left half of the brain in 38 patients (26 men, 12 women) and in the right half of the brain in 32 patients (17 men, 15 women) the lateralization of motor functions, asymmetry of emotional mimicry, conjugated deviation of the eye bulbs, intellect, memory, psychomotor rate and personality (laterality test of Matĕjcek--Zlab, Wechsler's intellect and memory scale, Benton, Stroop, VAROS, SUPOS, DSF, Washington Psychosocial--Seizure Inventory WPSI was investigated. Patient with a left-sided epileptic process had only insignificantly lower contact with psychiatry (31.6% as compared with 40.6%). Significantly lower contacts with psychiatry were recorded in 35 patients with a predominance of emotional mimicry (while smiling) on the left (25.0% as compared with 47.1%, p less than 0.05) and particularly significantly low in 18 patients with a combination of signs left-sided epileptic process + predominance of emotional mimicry on the left + deviation of the eyeballs on the right (mathematical stimulus) + genotypical righthandedness (16.7% as compared with 42.3%, p less than 0.025). Men with a left-sided epileptic process displayed a significantly greater anxiety, in women this trend was only indicated. Four women with a left-sided epileptic process anticipating regulation of behaviour was typical, for women with a right-sided epileptic process lower autoregulating inhibitions. A left-sided epileptic process had significantly more often a favourable course of epilepsy (in 65.8% as compared with 25.0%, p less than 0.005). In psychological tests, however, the differentiating criteria were much more than the course of the disease invalid pension, contact with psychiatry and subjective need of assistance from a psychiatrist or psychologist.

  13. Epilepsy, Psychogenic Seizure, Trauma in the Developmental Process

    PubMed Central

    ALYANAK, Behiye

    2013-01-01

    An epileptic seizure, can cause trauma for its sudden emergence, leading to functional impairment, accidents and injuries, and fear of death. The seizure can be traumatizing itself, besides, an head trauma that may occur during the seizure can also cause epilepsy. As the severity and duration of epilepsy increases, disturbances in development and traumatic effects occur. Conversion (psychogenic) seizures may be added over the years in epileptic patients. The comorbidity of trauma-related dissociative disorder and psychogenic seizures is observed in approximately half of the cases. Dissociative disorders are known to occur in children with chronic diseases due to the traumatic effect of the disease. Conversion disorder and psychogenic seizures are frequently seen in dissociative disorders. Posttraumatic stress disorder, dissociative disorders, and psychogenic seizures are often comorbid diagnoses in epilepsy. For this reason, traumatic effect and associated dissociative disorder dimension should be kept in mind in the psychiatric approach when handling with cases of epilepsy.

  14. Automatic multi-modal intelligent seizure acquisition (MISA) system for detection of motor seizures from electromyographic data and motion data.

    PubMed

    Conradsen, Isa; Beniczky, Sándor; Wolf, Peter; Kjaer, Troels W; Sams, Thomas; Sorensen, Helge B D

    2012-08-01

    The objective is to develop a non-invasive automatic method for detection of epileptic seizures with motor manifestations. Ten healthy subjects who simulated seizures and one patient participated in the study. Surface electromyography (sEMG) and motion sensor features were extracted as energy measures of reconstructed sub-bands from the discrete wavelet transformation (DWT) and the wavelet packet transformation (WPT). Based on the extracted features all data segments were classified using a support vector machine (SVM) algorithm as simulated seizure or normal activity. A case study of the seizure from the patient showed that the simulated seizures were visually similar to the epileptic one. The multi-modal intelligent seizure acquisition (MISA) system showed high sensitivity, short detection latency and low false detection rate. The results showed superiority of the multi-modal detection system compared to the uni-modal one. The presented system has a promising potential for seizure detection based on multi-modal data.

  15. Occurrence and clinical features of epileptic and non-epileptic paroxysmal events in five children with Pallister-Killian syndrome.

    PubMed

    Filloux, Francis M; Carey, John C; Krantz, Ian D; Ekstrand, Jeffrey J; Candee, Meghan S

    2012-05-01

    Pallister-Killian syndrome (PKS) is a rare, sporadic genetic disorder caused by tetrasomy 12p mosaicism associated with a supernumerary isochromosome. Craniofacial dysmorphism, learning impairment and seizures are considered characteristic. However, little is known of the seizure and epilepsy patterns seen in PKS. To better define the occurrence and nature of epileptic and non-epileptic paroxysmal events in PKS, we describe our experience with 5 patients and compare their features with data from a larger cohort of PKS patients ascertained via a web-based parental questionnaire. Three of the 5 patients have had definite epileptic seizures, and one other has had paroxysmal events as yet not clarified. Four of the 5 have also had either non-epileptic paroxysmal events or episodes of uncertain nature. In those with epilepsy, all have had some period of relatively refractory seizures, all have required more than one antiepileptic drug, but none experienced status epilepticus. Only one of the patients with epilepsy (the oldest) has gone into remission. In two of the four with non-epileptic events, video-electroencephalographic monitoring has been valuable in clarifying the nature of the events. EEG characteristics include a slow dominant frequency as well as generalized and focal epileptiform features. Brain MRI findings can be normal but are variable. These specific findings correspond well to information reported by parents in a larger cohort of 51 individuals with PKS. Better understanding of the nature of epileptic and non-epileptic events in PKS will result from a more detailed analysis of objective data obtained from this larger cohort, and from deeper understanding of the molecular impact of 12p tetrasomy in selected cell lines.

  16. Occurrence and clinical features of epileptic and non-epileptic paroxysmal events in five children with Pallister–Killian syndrome

    PubMed Central

    Filloux, Francis M.; Carey, John C.; Krantz, Ian D.; Ekstrand, Jeffrey J.; Candee, Meghan S.

    2013-01-01

    Pallister–Killian syndrome (PKS) is a rare, sporadic genetic disorder caused by tetrasomy 12p mosaicism associated with a supernumerary isochromosome. Craniofacial dysmorphism, learning impairment and seizures are considered characteristic. However, little is known of the seizure and epilepsy patterns seen in PKS. To better define the occurrence and nature of epileptic and non-epileptic paroxysmal events in PKS, we describe our experience with 5 patients and compare their features with data from a larger cohort of PKS patients ascertained via a web-based parental questionnaire. Three of the 5 patients have had definite epileptic seizures, and one other has had paroxysmal events as yet not clarified. Four of the 5 have also had either non-epileptic paroxysmal events or episodes of uncertain nature. In those with epilepsy, all have had some period of relatively refractory seizures, all have required more than one antiepileptic drug, but none experienced status epilepticus. Only one of the patients with epilepsy (the oldest) has gone into remission. In two of the four with non-epileptic events, video-electroencephalographic monitoring has been valuable in clarifying the nature of the events. EEG characteristics include a slow dominant frequency as well as generalized and focal epileptiform features. Brain MRI findings can be normal but are variable. These specific findings correspond well to information reported by parents in a larger cohort of 51 individuals with PKS. Better understanding of the nature of epileptic and non-epileptic events in PKS will result from a more detailed analysis of objective data obtained from this larger cohort, and from deeper understanding of the molecular impact of 12p tetrasomy in selected cell lines. PMID:22349688

  17. Epileptic drivers--a study of 1,089 patients.

    PubMed

    Beaussart, M; Beaussart-Defaye, J; Lamiaux, J M; Grubar, J C

    1997-01-01

    A longitudinal study of 1,089 epileptic patients followed up by the same specialist between 1965-1991, allowed close observation of the seizures occurring to the patient at the wheel and their consequences and to relate them to detailed epileptological criteria. The results show road accidents caused by epileptic seizures are few and most of them are minor. The repatriation of risks between patients is very uneven. The quality of the neuro-psychic inter-critical state as well as the patients' degree of compliance seem to be more reliable risk indicators than some more traditional criteria like the length of remission between seizures. Although seizures occur more frequently in patients suffering from Complex Partial seizures as opposed to other forms of epileptic seizures, the differences between patients with epilepsy lies mostly in their behaviour and in their own representation of the risks. There is a need for a body of rules and regulations serving as an official framework regulating the driving test. This widely circulated document should take into account the multiplicity of cases, including the small number of patients thought to be dangerous. Its mode of application should allow doctors as well as patients to opt for a realistic attitude based on decision-making criteria involving a thorough knowledge of epilepsy as well as a thorough knowledge of the psychological characteristics of the patient concerned.

  18. Seizure-induced disinhibition of the HPA axis increases seizure susceptibility.

    PubMed

    O'Toole, Kate K; Hooper, Andrew; Wakefield, Seth; Maguire, Jamie

    2014-01-01

    Stress is the most commonly reported precipitating factor for seizures. The proconvulsant actions of stress hormones are thought to mediate the effects of stress on seizure susceptibility. Interestingly, epileptic patients have increased basal levels of stress hormones, including corticotropin-releasing hormone (CRH) and corticosterone, which are further increased following seizures. Given the proconvulsant actions of stress hormones, we proposed that seizure-induced activation of the hypothalamic-pituitary-adrenal (HPA) axis may contribute to future seizure susceptibility. Consistent with this hypothesis, our data demonstrate that pharmacological induction of seizures in mice with kainic acid or pilocarpine increases circulating levels of the stress hormone, corticosterone, and exogenous corticosterone administration is sufficient to increase seizure susceptibility. However, the mechanism(s) whereby seizures activate the HPA axis remain unknown. Here we demonstrate that seizure-induced activation of the HPA axis involves compromised GABAergic control of CRH neurons, which govern HPA axis function. Following seizure activity, there is a collapse of the chloride gradient due to changes in NKCC1 and KCC2 expression, resulting in reduced amplitude of sIPSPs and even depolarizing effects of GABA on CRH neurons. Seizure-induced activation of the HPA axis results in future seizure susceptibility which can be blocked by treatment with an NKCC1 inhibitor, bumetanide, or blocking the CRH signaling with Antalarmin. These data suggest that compromised GABAergic control of CRH neurons following an initial seizure event may cause hyperexcitability of the HPA axis and increase future seizure susceptibility.

  19. CADASIL Initially Presented with a Seizure

    PubMed Central

    Oh, Jung-Hwan; Kang, Bong Su; Choi, Jay Chol

    2016-01-01

    Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is a hereditary disease of the cerebral small blood vessels characterized by recurrent ischemic strokes, migraine, and progressive cognitive impairment. In patients with CADASIL, in whom subcortical white matter structures are typically involved, epileptic seizures have been rarely reported as an initial clinical symptom. We describe a patient genetically confirmed as having CADASIL who initially presented with a seizure. PMID:28101484

  20. Neuroligin-1 Knockdown Suppresses Seizure Activity by Regulating Neuronal Hyperexcitability.

    PubMed

    Fang, Min; Wei, Jin-Lai; Tang, Bo; Liu, Jing; Chen, Ling; Tang, Zhao-Hua; Luo, Jing; Chen, Guo-Jun; Wang, Xue-Feng

    2016-01-01

    Abnormally synchronized synaptic transmission in the brain leads to epilepsy. Neuroligin-1 (NL1) is a synaptic cell adhesion molecule localized at excitatory synapses. NL1 modulates synaptic transmission and determines the properties of neuronal networks in the mammalian central nervous system. We showed that the expression of NL1 and its binding partner neurexin-1β was increased in temporal lobe epileptic foci in patients and lithium-pilocarpine-treated epileptic rats. We investigated electrophysiological and behavioral changes in epileptic rats after lentivirally mediated NL1 knockdown in the hippocampus to determine whether NL1 suppression prevented seizures and, if so, to explore the probable underlying mechanisms. Our behavioral studies revealed that NL1 knockdown in epileptic rats reduced seizure severity and increased seizure latency. Whole-cell patch-clamp recordings of CA1 pyramidal neurons in hippocampal slices from NL1 knockdown epileptic rats revealed a decrease in spontaneous action potential frequency and a decrease in miniature excitatory postsynaptic current (mEPSC) frequency but not amplitude. The amplitude of N-methyl-D-aspartate receptor (NMDAR)-dependent EPSCs was also selectively decreased. Notably, NL1 knockdown reduced total NMDAR1 expression and the surface/total ratio in the hippocampus of epileptic rats. Taken together, these data indicate that NL1 knockdown in epileptic rats may reduce the frequency and severity of seizures and suppress neuronal hyperexcitability via changes in postsynaptic NMDARs.

  1. Intravenous methylprednisolone pulse therapy for children with epileptic encephalopathy

    PubMed Central

    Pera, Maria Carmela; Randazzo, Giovanna; Masnada, Silvia; Dontin, Serena Donetti; De Giorgis, Valentina; Balottin, Umberto; Veggiotti, Pierangelo

    2015-01-01

    Summary The aim of this retrospective study of children affected by epileptic encephalopathy was to evaluate seizure frequency, electroencephalographic pattern and neuropsychological status, before and after intravenous methylprednisolone therapy. Eleven children with epileptic encephalopathy were administered one cycle of intravenous methylprednisolone (15–30 mg/kg/day for three consecutive days, once a month for four months) in addition to constant dosages of their regular antiepileptic drugs. The treatment resulted in statistically significant reductions of generalized slow spike-and-wave discharges (p<0.0028) and seizure frequency (p<0.013), which persisted even after methylprednisolone pulse therapy was stopped. A globally positive outcome was noted in 9/11 patients (81.8%). This methylprednisolone treatment regimen did not cause significant or persistent adverse effects. We suggest that children with epileptic encephalopathy without an underlying structural lesion could be the best candidates for intravenous methylprednisolone pulse therapy. PMID:26910177

  2. [Ecstatic seizures].

    PubMed

    Likhachev, S A; Astapenko, A V; Osos, E L; Zmachynskaya, O L; Gvishch, T G

    2015-01-01

    Ecstatic seizures is a rare manifestation of epilepsy. They were described for the first time by F.M. Dostoevsky. Currently, the description of ecstatic seizures is possible to find in the scientific literature. The description of the own observation of a patient with emotional-affective seizures is presented. A role of the anterior insular cortex in the ecstatic seizures origin is discussed. The similarities between the feelings reported during ecstatic seizures and the feelings experienced under the effect of stimulant addictive drugs are described. The possible reasons of the low frequency of emotional-affective seizures are considered.

  3. The role of antiepileptic drugs in free radicals generation and antioxidant levels in epileptic patients.

    PubMed

    Eldin, Essam Eldin Mohamed Nour; Elshebiny, Hosam Abdel-Fattah; Mohamed, Tarek Mostafa; Abdel-Aziz, Mohamed Abdel-Azim; El-Readi, Mahmoud Zaki

    2016-01-01

    Many risk factors are encountered during the pathogenesis of epilepsy. In this study, the effect of seizure frequency on free radical generation and antioxidants levels in epileptic patients was evaluated. This study was carried out on 15 healthy controls (GI) and 60 epileptic patients treated with mono- or poly-therapy of carbamazepine, valproic acid, or phenytoin. The treated epileptic patients were divided into 2 main groups according to the seizure frequency: controlled seizure patients GII (n = 30) and uncontrolled seizure patients GIII (n = 30). GII included the GIIA subgroup (n = 15) which had been seizure free for more than 12 months and the GIIB subgroup (n = 15) which had been seizure free for a period from 6 to12 months. GIII included GIIIA (n = 15) and GIIIB (n = 15) for patients which had a seizure frequency of less than and more than four times/month, respectively. In comparison to the control group (GI), the levels of nitric oxide (NO) and malondialdehyde/creatinine ratio were significantly increased in GIIB, GIIIA, and GIIIB, while vitamins A and E levels were significantly decreased in GIIIB. Serum NO levels had significant negative correlations with serum vitamin E in the GIIA and GIIB groups, and with vitamin A in the GIIIA and GIIIB groups. However, serum NO had positive correlation with urinary MDA/Cr ratio. The imbalance between free radical generation and antioxidant system in epileptic patients may be a factor in seizure frequency.

  4. [The role of the nurse in the patient education of young epileptic patients].

    PubMed

    Danse, Marion; Goujon, Estelle

    2015-01-01

    An epileptic seizure in a child is a major source of anxiety and turns the family's everyday life upside down. Through therapeutic education, the nurse guides the families towards the autonomous management of the seizures, antiepileptic treatments, adaptations to daily life and potential comorbidities.

  5. Epileptic Encephalopathies and Their Relationship to Developmental Disorders: Do Spikes Cause Autism?

    ERIC Educational Resources Information Center

    Tharp, Barry R.

    2004-01-01

    Epileptic encephalopathies are progressive clinical and electroencephalographic syndromes where deterioration is thought to be caused by frequent seizures and abundant EEG epileptiform activity. Seizures occur in approximately 10-15% of children with pervasive developmental disorders (PDD) and 8-10% have epileptiform EEG abnormalities without…

  6. Febrile Seizures and Behavioural and Cognitive Outcomes in Preschool Children: An Old Issue Revisited

    ERIC Educational Resources Information Center

    Deonna, Thierry

    2012-01-01

    The possible deleterious role of febrile seizures on development is an old issue. It took a long time to realize that impaired development or occurrence of chronic epilepsy affected a very small minority of children with febrile seizures. These children either had pre-existing brain damage, specific genetic epileptic conditions, or seizure-induced…

  7. How I treat a first single seizure in a child

    PubMed Central

    Gulati, Sheffali; Kaushik, Jaya Shankar

    2016-01-01

    An epileptic seizure is defined as transient occurrence of signs and/or symptoms due to abnormal excessive or synchronous neuronal activity in brain. There are diverse etiologies for acute seizure in infants and children. The present review provides a broad approach to diagnosis and treatment plan for acute seizure in children. The approach to a child with acute seizure is discussed with special emphasis on clinical approach based on history and focused examination with judicious choice of investigation and further management plan. The review also emphasizes on recognizing common nonepileptic events that masquerade as true seizure among infants and children. PMID:27011625

  8. Nonlinear Dynamic Analysis of Scalp EEG Epileptic Signals

    NASA Astrophysics Data System (ADS)

    Blanco, Susana A.; Creso, Judith; Figliola, Alejandra; Quiroga, Rodrigo Quian; Rosso, Osvaldo A.

    Noisy signals obtained during a tonic-clonic epileptic seizure, are usually neglected for visual inspection by the physicians due to the presence of muscle artifacts. Although noise obscures completely the recording, information about the underlying brain activity can be obtained by filtering, through the Orthogonal Wavelet Transforms, those frequencies bands associated with muscle activity. After generating a "noise free" signal by removing the muscle artifacts with wavelets, a dynamical analysis of the brain behavior will be performed by using nonlinear dynamics methods. The values for nonlinear metric invariants, like the correlation dimension and the maximum Lyapunov exponent, confirm that the brain dynamical behavior is more ordered during the epileptic seizure than pre-seizure stage.

  9. Optical imaging of acute epileptic networks in mice.

    PubMed

    Guevara, Edgar; Pouliot, Philippe; Nguyen, Dang Khoa; Lesage, Frédéric

    2013-07-01

    The potential of intrinsic optical imaging and resting-state analysis under anesthetized conditions as a tool to study brain networks associated with epileptic seizures is investigated. Using an acute model of epileptiform activity, the 4-aminopyridine model in live mice, we observe the changes in resting-state networks with the onset of seizure activity and in conditions of spiking activity. Resting-state networks identified before and after the onset of epileptiform activity show both decreased and increased homologous correlations, with a small dependence on seizure intensity. The observed changes are not uniform across the different hemodynamic measures, suggesting a potential decoupling between blood flow and metabolism in the low-frequency networks. This study supports the need for a more extensive investigation of epileptic networks including more than one independent hemodynamic measurement.

  10. [Autoscopic occipital seizures and occipital poroencephalic lesion: considerations on a case].

    PubMed

    Salati, M R; Anelli, M E; Bortone, E; Mancia, D; Terzano, M G

    1983-01-01

    Autoscopy is an hallucinatory phenomenon during which the subject see his own image. It may be caused by organic processes like migraine, vascular diseases, tumoral lesions, and exceptionally by epileptic seizure. The case of 15 years old boy is reported, affected by hemianopia, surgically treated squint, who presented occipital epileptic seizures consisting of autoscopic hallucinations, leftward conjugate eye deviation, followed by a typical major seizures. A right parieto-occipital epileptic focus was a constant finding on EEG. On CT a poroencephalic cyst in the corresponding cerebral region could be demonstrated.

  11. [Liposteroid therapy for refractory epileptic spasms].

    PubMed

    Shimono, Kuriko Kagitani; Imai, Katsumi; Idoguchi, Rie; Kamio, Noriko; Okinaga, Takeshi; Ozono, Keiichi

    2003-11-01

    Liposteroid was administered intravenously to 6 patients with refractory epileptic spasms. In one case, the spasms initially disappeared but then reappeared after three months. Another case had a transient and slight decrease of epileptic spasms. In the only patient in whom spasms disappeared, EEG abnormalities were greatly improved with diffuse spikes and waves changing into focal spikes. Two cases displayed hyperexcitability, insomnia and acting out behavior, and the therapy was discontinued in one of them. One case had appetite loss and another showed an increase in tonic seizures. No patient had serious adverse effects such as infection, edema, subdural hematoma and brain shrinkage. Although liposteroid therapy has been recommended as an easy, useful and safe alternative for ACTH, we found considerable adverse effects and only a small effect on refractory spasms, and conclude that the regimen should be modified.

  12. Compulsive versifying after treatment of transient epileptic amnesia

    PubMed Central

    Woollacott, Ione O. C.; Fletcher, Phillip D.; Massey, Luke A.; Pasupathy, Amirtha; Rossor, Martin N.; Caine, Diana; Rohrer, Jonathan D.; Warren, Jason D.

    2015-01-01

    Compulsive production of verse is an unusual form of hypergraphia that has been reported mainly in patients with right temporal lobe seizures. We present a patient with transient epileptic amnesia and a left temporal seizure focus, who developed isolated compulsive versifying, producing multiple rhyming poems, following seizure cessation induced by lamotrigine. Functional neuroimaging studies in the healthy brain implicate left frontotemporal areas in generating novel verbal output and rhyme, while dysregulation of neocortical and limbic regions occurs in temporal lobe epilepsy. This case complements previous observations of emergence of altered behavior with reduced seizure frequency in patients with temporal lobe epilepsy. Such cases suggest that reduced seizure frequency has the potential not only to stabilize or improve memory function, but also to trigger complex, specific behavioral alterations. PMID:25157425

  13. Compulsive versifying after treatment of transient epileptic amnesia.

    PubMed

    Woollacott, Ione O C; Fletcher, Phillip D; Massey, Luke A; Pasupathy, Amirtha; Rossor, Martin N; Caine, Diana; Rohrer, Jonathan D; Warren, Jason D

    2015-01-01

    Compulsive production of verse is an unusual form of hypergraphia that has been reported mainly in patients with right temporal lobe seizures. We present a patient with transient epileptic amnesia and a left temporal seizure focus, who developed isolated compulsive versifying, producing multiple rhyming poems, following seizure cessation induced by lamotrigine. Functional neuroimaging studies in the healthy brain implicate left frontotemporal areas in generating novel verbal output and rhyme, while dysregulation of neocortical and limbic regions occurs in temporal lobe epilepsy. This case complements previous observations of emergence of altered behavior with reduced seizure frequency in patients with temporal lobe epilepsy. Such cases suggest that reduced seizure frequency has the potential not only to stabilize or improve memory function, but also to trigger complex, specific behavioral alterations.

  14. Music and its association with epileptic disorders.

    PubMed

    Maguire, Melissa

    2015-01-01

    The association between music and epileptic seizures is complex and intriguing. Musical processing within the human brain recruits a network which involves many cortical areas that could activate as part of a temporal lobe seizure or become hyperexcitable on musical exposure as in the case of musicogenic epilepsy. The dichotomous effect of music on seizures may be explained by modification of dopaminergic circuitry or counteractive cognitive and sensory input in ictogenesis. Research has explored the utility of music as a therapy in epilepsy and while limited studies show some evidence of an effect on seizure activity; further work is required to ascertain its clinical potential. Sodium channel-blocking antiepileptic drugs, e.g., carbamazepine and oxcarbazepine, appear to effect pitch perception particularly in native-born Japanese, a rare but important adverse effect, particularly if a professional musician. Temporal lobe surgery for right lateralizing epilepsy has the capacity to effect all facets of musical processing, although risk and correlation to resection area need further research. There is a need for the development of investigative tools of musical processing that could be utilized along the surgical pathway. Similarly, work is also required in devising a musical paradigm as part of electroencephalography to improve surveillance of musicogenic seizures. These clinical applications could aid the management of epilepsy and preservation of musical ability.

  15. [Seizures revealing phosphocalcic metabolism abnormalities].

    PubMed

    Hmami, F; Chaouki, S; Benmiloud, S; Souilmi, F Z; Abourazzak, S; Idrissi, M; Atmani, S; Bouharrou, A; Hida, M

    2014-01-01

    Hypocalcemia due to hypoparathyroidism produces a broad spectrum of clinical manifestations, but overt symptoms may be sparse. One unusual presentation is onset or aggravation of epilepsy in adolescence revealing hypoparathyroidism. This situation can lead to delayed diagnosis, with inefficacity of the antiepileptic drugs. We report five cases of adolescence-onset epilepsy with unsuccessful antiepileptic therapy, even with gradually increasing dose. Physical examination revealed signs of hypocalcemia, confirmed biologically. Full testing disclosed the origin of the seizures: hypoparathyroidism in three patients and pseudohypoparathyroidism in the other two. In four of five patients, computed tomography showed calcification of the basal ganglia, defining Fahr's syndrome. The patients were treated with oral calcium and active vitamin D (1-alphahydroxy vitamin D3). Seizure frequency progressively decreased and serum calcium levels returned to normal. These cases illustrate the importance of the physical examination and of routine serum calcium assay in patients with new-onset epileptic seizures in order to detect hypocalcemia secondary to hypoparathyroidism.

  16. Seizure related accidents and injuries in childhood.

    PubMed

    Buffo, Thais Helena; Guerreiro, Marilisa M; Tai, Peter; Montenegro, Maria Augusta

    2008-09-01

    Several studies show that the risk of accidents involving patients with epilepsy is much higher compared to the general population. The objective of this study was to identify the frequency and type of seizure related injuries in children diagnosed with epilepsy. In addition we also assessed possible risk factors associated with this seizure related accidents in childhood. This study was conducted at the pediatric epilepsy clinic of Unicamp, from January 2005 to August 2006. We evaluated 100 consecutive children with epilepsy. Parents were interviewed by one of the authors using a structured questionnaire that included questions about seizure related accidents and related injuries. Forty-four patients reported seizure related accidents. Eighteen patients needed medical assistance at an emergency room due the severity of their seizure related accident. Forty patients reported having a seizure related accident prevented by a bystander. Another 14 patients reported avoiding a seizure related accident by luck alone. Contusions and lacerations were the most common type of lesion associated with seizures. Patients with symptomatic/probable symptomatic epilepsy and those using higher numbers of anti-epileptic drugs (AEDs) were at greater risk for seizure related accidents (p<0.05). We conclude that patients with symptomatic/probable symptomatic epilepsy and on multiple AEDs are at increased risk of seizure related accidents. Parents and caretakers should be even more cautious about risk of injury in such patients.

  17. Predictability of uncontrollable multifocal seizures – towards new treatment options

    NASA Astrophysics Data System (ADS)

    Lehnertz, Klaus; Dickten, Henning; Porz, Stephan; Helmstaedter, Christoph; Elger, Christian E.

    2016-04-01

    Drug-resistant, multifocal, non-resectable epilepsies are among the most difficult epileptic disorders to manage. An approach to control previously uncontrollable seizures in epilepsy patients would consist of identifying seizure precursors in critical brain areas combined with delivering a counteracting influence to prevent seizure generation. Predictability of seizures with acceptable levels of sensitivity and specificity, even in an ambulatory setting, has been repeatedly shown, however, in patients with a single seizure focus only. We did a study to assess feasibility of state-of-the-art, electroencephalogram-based seizure-prediction techniques in patients with uncontrollable multifocal seizures. We obtained significant predictive information about upcoming seizures in more than two thirds of patients. Unexpectedly, the emergence of seizure precursors was confined to non-affected brain areas. Our findings clearly indicate that epileptic networks, spanning lobes and hemispheres, underlie generation of seizures. Our proof-of-concept study is an important milestone towards new therapeutic strategies based on seizure-prediction techniques for clinical practice.

  18. Epileptogenesis and epileptic maturation in phosphorylation site-specific SNAP-25 mutant mice.

    PubMed

    Watanabe, Shigeru; Yamamori, Saori; Otsuka, Shintaro; Saito, Masanori; Suzuki, Eiji; Kataoka, Masakazu; Miyaoka, Hitoshi; Takahashi, Masami

    2015-09-01

    Snap25(S187A/S187A) mouse is a knock-in mouse with a single amino acid substitution at a protein kinase C-dependent phosphorylation site of the synaptosomal-associated protein of 25 kDa (SNAP-25), which is a target-soluble NSF attachment protein receptor (t-SNARE) protein essential for neurotransmitter release. Snap25(S187A/S187A) mice exhibit several distinct phenotypes, including reductions in dopamine and serotonin release in the brain, anxiety-like behavior, and cognitive dysfunctions. Homozygous mice show spontaneous epileptic convulsions, and about 15% of the mice die around three weeks after birth. The remaining mice survive for almost two years and exhibit spontaneous recurrent seizures throughout their lifetime. Here, we conducted long-term continuous video electroencephalogram recording of the mice and analyzed the process of epileptogenesis and epileptic maturation in detail. Spikes and slow-wave discharges (SWDs) were observed in the cerebral cortex and thalamus before epileptic convulsions began. SWDs showed several properties similar to those observed in absence seizures including (1) lack of in the hippocampus, (2) movement arrest during SWDs, and (3) inhibition by ethosuximide. Multiple generalized seizures occurred in all homozygous mice around three weeks after birth. However, seizure generation stopped within several days, and a seizure-free latent period began. Following a spike-free quiet period, the number of spikes increased gradually, and epileptic seizures reappeared. Subsequently, spontaneous seizures occurred cyclically throughout the life of the mice, and several progressive changes in seizure frequency, seizure duration, seizure cycle interval, seizure waveform, and the number and waveform of epileptic discharges during slow-wave sleep occurred with different time courses over 10 weeks. Anxiety-related behaviors appeared suddenly within three days after epileptic seizures began and were delayed markedly by oral administration of

  19. Nonlinear times series analysis of epileptic human electroencephalogram (EEG)

    NASA Astrophysics Data System (ADS)

    Li, Dingzhou

    The problem of seizure anticipation in patients with epilepsy has attracted significant attention in the past few years. In this paper we discuss two approaches, using methods of nonlinear time series analysis applied to scalp electrode recordings, which is able to distinguish between epochs temporally distant from and just prior to, the onset of a seizure in patients with temporal lobe epilepsy. First we describe a method involving a comparison of recordings taken from electrodes adjacent to and remote from the site of the seizure focus. In particular, we define a nonlinear quantity which we call marginal predictability. This quantity is computed using data from remote and from adjacent electrodes. We find that the difference between the marginal predictabilities computed for the remote and adjacent electrodes decreases several tens of minutes prior to seizure onset, compared to its value interictally. We also show that these difl'crcnc es of marginal predictability intervals are independent of the behavior state of the patient. Next we examine the please coherence between different electrodes both in the long-range and the short-range. When time is distant from seizure onsets ("interictally"), epileptic patients have lower long-range phase coherence in the delta (1-4Hz) and beta (18-30Hz) frequency band compared to nonepileptic subjects. When seizures approach (''preictally"), we observe an increase in phase coherence in the beta band. However, interictally there is no difference in short-range phase coherence between this cohort of patients and non-epileptic subjects. Preictally short-range phase coherence also increases in the alpha (10-13Hz) and the beta band. Next we apply the quantity marginal predictability on the phase difference time series. Such marginal predictabilities are lower in the patients than in the non-epileptic subjects. However, when seizure approaches, the former moves asymptotically towards the latter.

  20. Transient epileptic amnesia--a clinical update and a reformulation.

    PubMed Central

    Kapur, N

    1993-01-01

    While absence attacks and complex partial seizures have been well documented in patients with epilepsy, the delineation of pure episodes of memory loss without additional clinical manifestations remains poorly characterised. The recently described condition of transient epileptic amnesia (TEA) is critically examined, and four new cases are described, in each of which there were episodes of pure memory loss which subsequently proved to be epileptic in origin. The anatomical and pathophysiological basis of TEA is presumed to be similar to transient global amnesia (TGA), that is, it is likely to be primarily hippocampal in origin, but with more variable involvement of limbic and adjacent temporal lobe neocortical structures. PMID:8229029

  1. Epilepsy-associated gene Nedd4-2 mediates neuronal activity and seizure susceptibility through AMPA receptors

    PubMed Central

    Zhu, Jiuhe; Lee, Kwan Young; Man, Heng-Ye; Chung, Hee Jung

    2017-01-01

    The neural precursor cell expressed developmentally down-regulated gene 4–2, Nedd4-2, is an epilepsy-associated gene with at least three missense mutations identified in epileptic patients. Nedd4-2 encodes a ubiquitin E3 ligase that has high affinity toward binding and ubiquitinating membrane proteins. It is currently unknown how Nedd4-2 mediates neuronal circuit activity and how its dysfunction leads to seizures or epilepsies. In this study, we provide evidence to show that Nedd4-2 mediates neuronal activity and seizure susceptibility through ubiquitination of GluA1 subunit of the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor, (AMPAR). Using a mouse model, termed Nedd4-2andi, in which one of the major forms of Nedd4-2 in the brain is selectively deficient, we found that the spontaneous neuronal activity in Nedd4-2andi cortical neuron cultures, measured by a multiunit extracellular electrophysiology system, was basally elevated, less responsive to AMPAR activation, and much more sensitive to AMPAR blockade when compared with wild-type cultures. When performing kainic acid-induced seizures in vivo, we showed that elevated seizure susceptibility in Nedd4-2andi mice was normalized when GluA1 is genetically reduced. Furthermore, when studying epilepsy-associated missense mutations of Nedd4-2, we found that all three mutations disrupt the ubiquitination of GluA1 and fail to reduce surface GluA1 and spontaneous neuronal activity when compared with wild-type Nedd4-2. Collectively, our data suggest that impaired GluA1 ubiquitination contributes to Nedd4-2-dependent neuronal hyperactivity and seizures. Our findings provide critical information to the future development of therapeutic strategies for patients who carry mutations of Nedd4-2. PMID:28212375

  2. Understanding Genotypes and Phenotypes in Epileptic Encephalopathies

    PubMed Central

    Helbig, Ingo; Tayoun, Abou Ahmad N.

    2016-01-01

    Epileptic encephalopathies are severe often intractable seizure disorders where epileptiform abnormalities contribute to a progressive disturbance in brain function. Often, epileptic encephalopathies start in childhood and are accompanied by developmental delay and various neurological and non-neurological comorbidities. In recent years, this concept has become virtually synonymous with a group of severe childhood epilepsies including West syndrome, Lennox-Gastaut syndrome, Dravet syndrome, and several other severe childhood epilepsies for which genetic factors are increasingly recognized. In the last 5 years, the field has seen a virtual explosion of gene discovery, raising the number of bona fide genes and possible candidate genes for epileptic encephalopathies to more than 70 genes, explaining 20-25% of all cases with severe early-onset epilepsies that had otherwise no identifiable causes. This review will focus on the phenotypic variability as a characteristic aspect of genetic epilepsies. For many genetic epilepsies, the phenotypic presentation can be broad, even in patients with identical genetic alterations. Furthermore, patients with different genetic etiologies can have seemingly similar clinical presentations, such as in Dravet syndrome. While most patients carry mutations in SCN1A, similar phenotypes can be seen in patients with mutations in PCDH19, CHD2, SCN8A, or in rare cases GABRA1 and STXBP1. In addition to the genotypic and phenotypic heterogeneity, both benign phenotypes and severe encephalopathies have been recognized in an increasing number of genetic epilepsies, raising the question whether these conditions represent a fluid continuum or distinct entities. PMID:27781027

  3. Seizures in the critically ill.

    PubMed

    Ch'ang, J; Claassen, J

    2017-01-01

    Critically ill patients with seizures are either admitted to the intensive care unit because of uncontrolled seizures requiring aggressive treatment or are admitted for other reasons and develop seizures secondarily. These patients may have multiorgan failure and severe metabolic and electrolyte disarrangements, and may require complex medication regimens and interventions. Seizures can be seen as a result of an acute systemic illness, a primary neurologic pathology, or a medication side-effect and can present in a wide array of symptoms from convulsive activity, subtle twitching, to lethargy. In this population, untreated isolated seizures can quickly escalate to generalized convulsive status epilepticus or, more frequently, nonconvulsive status epileptics, which is associated with a high morbidity and mortality. Status epilepticus (SE) arises from a failure of inhibitory mechanisms and an enhancement of excitatory pathways causing permanent neuronal injury and other systemic sequelae. Carrying a high 30-day mortality rate, SE can be very difficult to treat in this complex setting, and a portion of these patients will become refractory, requiring narcotics and anesthetic medications. The most significant factor in successfully treating status epilepticus is initiating antiepileptic drugs as soon as possible, thus attentiveness and recognition of this disease are critical.

  4. [Epilepsy from a metaphysical perspective: an interpretation of the biblical story of the epileptic boy and Raphael's Transfiguration].

    PubMed

    Janz, D

    1994-01-01

    Raphael's last painting reveals, in the upper half of the picture, Christ's transfiguration on Mount Tabor and, in the lower half, the young boy's epileptic seizure at the foot of the mountain in the presence of the other disciples. Raphael depicts both events, which are told in succession in the Gospels, as if they took place at the same time. By synchronizing both scenes, Raphael demonstrated a significant correspondence between Christ and the epileptic boy which reveals the epileptic seizure as a symbolic representation of a transcendental event. This metaphysical aspect of epilepsy depicted by Raphael can also be found in the corresponding biblical passages. In the Gospels, the metamorphosis caused by the epileptic seizure is used as a simile for Christ's transfiguration through suffering, death and resurrection.

  5. Epilepsy, viewed metaphysically: an interpretation of the biblical story of the epileptic boy and of Raphael's transfiguration.

    PubMed

    Janz, D

    1986-01-01

    Raphael's last painting reveals, in the upper half of the picture, Christ's transfiguration on Mount Tabor and, in the lower half, the young boy's epileptic seizure at the foot of the mountain in the presence of the other disciples. Raphael depicts both events, which are told in succession in the Gospels, as if they took place at the same time. By synchronizing both scenes Raphael demonstrated a significant correspondence between Christ and the epileptic boy, which reveals the epileptic seizure as a symbolic representation of a transcendent event. This metaphysical aspect of epilepsy depicted by Raphael can also be found in the corresponding biblical passages. In the Gospels, the metamorphosis caused by the epileptic seizure is used as a simile for Christ's transfiguration through suffering, death, and resurrection.

  6. Ketogenic diet - A novel treatment for early epileptic encephalopathy due to PIGA deficiency.

    PubMed

    Joshi, Charuta; Kolbe, Diana L; Mansilla, M Adela; Mason, Sara; Smith, Richard J H; Campbell, Colleen A

    2016-10-01

    We describe the presentation and workup of two brothers with early-onset epileptic encephalopathy who became seizure-free on a ketogenic diet. Extensive testing culminated in whole exome sequencing, which led to the diagnosis of phosphatidyl inositol glycan biosynthesis class A protein (PIGA) deficiency. This familial case highlights the importance of genetic testing for early-onset epileptic encephalopathies and underscores the potential value of a ketogenic diet in the treatment of this condition.

  7. Multi-feature characterization of epileptic activity for construction of an automated internet-based annotated classification.

    PubMed

    Arvind, R; Karthik, B; Sriraam, Natarajan

    2012-06-01

    Continuous monitoring of EEG is essential for the neurologist to detect the epileptic seizures that occur at various intervals. Since large volume of data need to be analyzed, visual analysis has been proven to be time consuming and subsequently automated detection techniques have gained importance in the recent years. For the biomedical research community, the major challenge lies in providing a solution to neurologists in terms of diagnosis and EEG database management. This paper discusses the automated detection of epileptic seizure using frequency domain and entropy parameters which helps in the construction of epileptic database for handling EEG data. Experimental study indicates that the suggested mode of operation can be used for internet based framework which contains pure epileptic patterns in the server. This can be retrieved and analyzed for detection and annotation of epileptic spikes in extensive EEG recordings.

  8. [Psychogenic nonepileptic seizures: overview and implications for practice].

    PubMed

    Szita, Bernadett; Hidasi, Zoltán

    2016-05-15

    Psychogenic nonepileptic seizures are enigmatic disorders at the interface of neurology and psychiatry. Seizures resemble epileptic seizures but are not associated with electrical discharges in the brain. Symptoms typically start in early adulthood and women are far more affected than men. Video-EEG is widely considered to be the gold standard for diagnosis. Still psychogenic nonepileptic seizures are often misdiagnosed and treated as epilepsy for years that is burdensome to patients and costly to the healthcare system. Patients having psychogenic nonepileptic seizures show a high prevalence of traumatic life events, therefore, psychosocial factors are thought to play an important role in the etiology. Neurobiological factors may also contribute to the development of seizures as a subgroup of patients are characterized by cognitive impairment and subtle structural and functional brain abnormalities. Treatment includes psychotherapeutic procedures, particularly cognitive behavioral therapy and additional pharmacological interventions. This article presents an overview of the clinical context, diagnosis, etiology and treatment of psychogenic nonepileptic seizures.

  9. Mitochondrial dysfunction in neurological disorders with epileptic phenotypes.

    PubMed

    Zsurka, Gábor; Kunz, Wolfram S

    2010-12-01

    A broad variety of mutations of the mitochondrial DNA or nuclear genes that lead to the impairment of mitochondrial respiratory chain or mitochondrial ATP synthesis have been associated with epileptic phenotypes. Additionally, evidence for an impaired mitochondrial function in seizure focus of patients with temporal lobe epilepsy and Ammon's horn sclerosis, as well as, animal models of temporal lobe epilepsy has been accumulated. This implies a direct pathogenic role of mitochondrial dysfunction in the process of epileptogenesis and seizure generation in certain forms of epilepsy.

  10. The association between seizures and deposition of collagen in the brain in porcine Taenia solium neurocysticercosis.

    PubMed

    Christensen, Nina M; Trevisan, Chiara; Leifsson, Páll S; Johansen, Maria V

    2016-09-15

    Neurocysticercosis caused by infection with Taenia solium is a significant cause of epilepsy and seizures in humans. The aim of this study was to assess the association between seizures and the deposition of collagen in brain tissue in pigs with T. solium neurocysticercosis. In total 78 brain tissue sections from seven pigs were examined histopathologically i.e. two pigs with epileptic seizures and T. solium cysts, four pigs without seizures but with cysts, and one non-infected control pig. Pigs with epileptic seizures had a larger amount of collagen in their brain tissue, showing as large fibrotic scars and moderate amount of collagen deposited around cysts, compared to pigs without seizures and the negative control pig. Our results indicate that collagen is likely to play a considerable part in the pathogenesis of seizures in T. solium neurocysticercosis.

  11. Psychogenic nonepileptic seizures mimicking gelastic seizures: A description of two cases.

    PubMed

    Mascia, Addolorata; Quarato, Pier Paolo; D'Aniello, Alfredo; Di Gennaro, Giancarlo

    2015-01-01

    Psychogenic nonepileptic seizures (PNES) are sudden, involuntary seizure-like attacks that, unlike epileptic seizures, are not related to electrographic ictal discharges and are psychological in nature. Psychogenic nonepileptic seizures presenting symptoms mimic a wide array of nervous system dysfunctions, as they involve changes in behavior, motor activity, sensation, cognitive, and autonomic functions. Spontaneous paroxysms of laughing resembling gelastic seizure have only exceptionally been reported as main symptom of PNES. Here, we describe the cases of two patients with a prolonged history of laughter attacks mistaken for epilepsy and unresponsive to AED treatment. Brain MRI and interictal EEG were unremarkable. Video-EEG monitoring allowed us to document the spontaneous and suggestion-induced habitual episodes that were then diagnosed as PNES.

  12. Evaluation of first nonfebrile seizures.

    PubMed

    Wilden, Jessica A; Cohen-Gadol, Aaron A

    2012-08-15

    Nonfebrile seizures may indicate underlying disease or epilepsy. The patient history can often distinguish epileptic seizures from nonepileptic disorders by identifying the events directly preceding the convulsion, associated conditions, and details of the seizure, including triggers, length, and type of movements. Laboratory testing, lumbar puncture, and neuroimaging may be indicated depending on the presentation, suspected etiology, and patient's age. Electroencephalography should be performed 24 to 48 hours after a first seizure because of its substantial yield and ability to predict recurrence. Neuroimaging is recommended for adults, infants, and children who have cognitive or motor developmental delay or a focal seizure. Neuroimaging may be scheduled on an outpatient basis for patients with stable vital signs who are awake and have returned to neurologic baseline. Emergent neuroimaging should be performed in patients with persistent decreased mental status or a new focal neurologic abnormality. Although magnetic resonance imaging is generally preferred to head computed tomography because of its greater sensitivity for intracranial pathology, computed tomography should be performed if intracranial bleeding is suspected because of recent head trauma, coagulopathy, or severe headache. Treatment with an antiepileptic drug after a first seizure does not prevent epilepsy in the long term, but it decreases the short-term likelihood of a second seizure. Adults with an unremarkable neurologic examination, no comorbidities, and no known structural brain disease who have returned to neurologic baseline do not need to be started on antiepileptic therapy. Treatment decisions should weigh the benefit of decreased short-term risk of recurrence against the potential adverse effects of antiepileptic drugs.

  13. Seizures in a Pediatric Intensive Care Unit: A Prospective Study

    PubMed Central

    Yazici, Mutlu Uysal; Ayar, Ganime; Karalok, Zeynep Selen; Arhan, Ebru Petek

    2016-01-01

    Background: The aim of the research is to determine the etiology and clinical features of seizures in critically ill children admitted to a pediatric intensive care unit (PICU). Methods: A total of 203 children were admitted from June 2013 to November 2013; 45 patients were eligible. Age ranged from 2 months to 19 years. Seizures were organized as epileptic or acute symptomatic. Pediatric risk of mortality score III, Glasgow coma scale, risk factors, coexistent diagnosis, medications administered before admission, type and duration of seizures, drugs used, requirement and duration of mechanical ventilation, length of stay and neuroimaging findings were collected as demographic data prospectively. Results: The male–female ratio was 0.8. Mean age was 5.4. The most common causes of seizures were acute symptomatic. Most frequent coexistent diagnosis was infectious diseases, and 53.3% had recurrent seizures. Medications were administered to 51.1% of the patients before admission. Seizures were focal in 21 (46.7%), generalized in 11 (24.4%) and 13 (28.9%) had status epilepticus. Intravenous midazolam was first-line therapy in 48.9%. Acute symptomatic seizures were usually new-onset, and duration was shorter. Epileptic seizures tended to be recurrent and were likely to progress to status epilepticus. However, type of seizures did not change severity of the disease. Also, laboratory test results, medications administered before admission, requirement and duration of ventilation, mortality and length of stay were not significant between epileptic/acute symptomatic patients. Conclusion: Seizures in critically ill children, which may evolve into status epilepticus, is an important condition that requires attention regardless of cause. Intensified educational programs for PICU physicians and international guidelines are necessary for a more efficient approach to children with seizures. PMID:26892503

  14. Automatic Detection of Seizures with Applications

    NASA Technical Reports Server (NTRS)

    Olsen, Dale E.; Harris, John C.; Cutchis, Protagoras N.; Cristion, John A.; Lesser, Ronald P.; Webber, W. Robert S.

    1993-01-01

    There are an estimated two million people with epilepsy in the United States. Many of these people do not respond to anti-epileptic drug therapy. Two devices can be developed to assist in the treatment of epilepsy. The first is a microcomputer-based system designed to process massive amounts of electroencephalogram (EEG) data collected during long-term monitoring of patients for the purpose of diagnosing seizures, assessing the effectiveness of medical therapy, or selecting patients for epilepsy surgery. Such a device would select and display important EEG events. Currently many such events are missed. A second device could be implanted and would detect seizures and initiate therapy. Both of these devices require a reliable seizure detection algorithm. A new algorithm is described. It is believed to represent an improvement over existing seizure detection algorithms because better signal features were selected and better standardization methods were used.

  15. Oxygen and seizure dynamics: II. Computational modeling

    PubMed Central

    Wei, Yina; Ullah, Ghanim; Ingram, Justin

    2014-01-01

    Electrophysiological recordings show intense neuronal firing during epileptic seizures leading to enhanced energy consumption. However, the relationship between oxygen metabolism and seizure patterns has not been well studied. Recent studies have developed fast and quantitative techniques to measure oxygen microdomain concentration during seizure events. In this article, we develop a biophysical model that accounts for these experimental observations. The model is an extension of the Hodgkin-Huxley formalism and includes the neuronal microenvironment dynamics of sodium, potassium, and oxygen concentrations. Our model accounts for metabolic energy consumption during and following seizure events. We can further account for the experimental observation that hypoxia can induce seizures, with seizures occurring only within a narrow range of tissue oxygen pressure. We also reproduce the interplay between excitatory and inhibitory neurons seen in experiments, accounting for the different oxygen levels observed during seizures in excitatory vs. inhibitory cell layers. Our findings offer a more comprehensive understanding of the complex interrelationship among seizures, ion dynamics, and energy metabolism. PMID:24671540

  16. Valproic acid-induced hyperammonaemic coma and unrecognised portosystemic shunt.

    PubMed

    Nzwalo, Hipólito; Carrapatoso, Leonor; Ferreira, Fátima; Basilio, Carlos

    2013-06-01

    Hyperammonaemic encephalopathy is a rare and potentially fatal complication of valproic acid treatment. The clinical presentation of hyperammonaemic encephalopathy is wide and includes seizures and coma. We present a case of hyperammonaemic coma precipitated by sodium valproate use for symptomatic epilepsy in a patient with unrecognised portosystemic shunt, secondary to earlier alcoholism. The absence of any stigmata of chronic liver disease and laboratory markers of liver dysfunction delayed the recognition of this alcohol-related complication. The portal vein bypass led to a refractory, valproic acid-induced hyperammonaemic coma. The patient fully recovered after dialysis treatment.

  17. From bench to drug: Human seizure modeling using Drosophila

    PubMed Central

    Song, Juan; Tanouye, Mark A.

    2008-01-01

    Studies of human seizure disorders have revealed that susceptibility to seizures is greatly influenced by genetic factors. In addition to causing epilepsy, genetic factors can suppress seizures and epileptogenesis. Examination of seizure-suppressor genes is challenging in humans. However, such genes are readily identified and analyzed in a Drosophila animal model of epilepsy. In this article, the epilepsy phenotype of Drosophila seizure-sensitive mutants is reviewed. A novel class of genes called seizure-suppressors is described. Mutations defining suppressors revert the “epilepsy” phenotype of neurological mutants. We conclude this review with particular discussion of a seizure-suppressor gene encoding DNA topoisomerase I (top1). Mutations of top1 are especially effective at reverting the seizure-sensitive phenotype of Drosophila epilepsy mutants. In addition, an unexpected class of anti-epileptic drugs has been identified. These are DNA topoisomerase I inhibitors such as camptothecin and its derivatives; several candidates are comparable or perhaps better than traditional anti-epileptic drugs such as valproate at reducing seizures in Drosophila drug-feeding experiments. PMID:18063465

  18. Febrile seizures

    MedlinePlus

    Seizure - fever induced; Febrile convulsions ... an illness. It may not occur when the fever is highest. A cold or viral illness may ... other than symptoms of the illness causing the fever. Often, the child will not need a full ...

  19. Epileptic syndrome in systemic lupus erythematosus and neuronal autoantibody associations.

    PubMed

    Kampylafka, E I; Alexopoulos, H; Fouka, P; Moutsopoulos, H M; Dalakas, M C; Tzioufas, A G

    2016-10-01

    We investigated systemic lupus erythematosus (SLE) patients with epilepsy, a major and organic neurological symptom. Our aim was to test patients for the autoimmune epilepsy-associated antibodies anti-GAD, anti-NMDAR, anti-AMPAR1/2, anti-GABABR and anti-VGKC. We tested sera from ten SLE patients with current or previous episodes of epileptic seizures. In addition, sera were tested for staining on primary hippocampal neurons. The patients' clinical and neuroimaging profile, disease activity and accumulated damage scores and therapeutic regimens administered were recorded, and correlations were evaluated. Patients were negative for all anti-neuronal autoantibodies tested, and showed no staining on primary hippocampal cells, which suggests the absence of autoantibodies against neuronal cell surface antigens. Epileptic seizures were all tonic-clonic, and all patients had high disease activity (mean SLE Damage Acticity Index score 19.3 ± 7.3). Six patients had minor or no brain magnetic resonance imaging findings, and three had major findings. 9/10 patients received immunosuppression for 5 ± 4 months, while anti-convulsive treatment was administered to all patients (4.2 ± 3 years). Our results suggest that the majority of SLE-related epileptic seizures cannot be attributed to the action of a single antibody against neuronal antigens. Studies with larger neuropsychiatric SLE populations and stricter inclusion criteria are necessary to verify these findings.

  20. Reflex gelastic–dacrystic seizures following hypoxic–ischaemic encephalopathy

    PubMed Central

    Verma, Rajesh; Praharaj, Heramba Narayan

    2013-01-01

    Reflex or stimulus-sensitive epilepsies are uncommon epileptic syndromes triggered by exogenous-specific sensory stimulus or endogenous various mental activities. Gelastic–dacrystic seizures are rare epileptic manifestations characterised by ictal laughter and crying. Gelastic–dacrystic seizures are commonly caused by hypothalamic hamartoma but rarely described due to cortical dysplasia, lesions of frontal and temporal lobes, tumours and vascular malformations. We report a young woman who presented with somatosensory-evoked gelastic–dacrystic seizures. This patient had a positive history of perinatal insult substantiated by MRI findings. Hypoxic–ischaemic encephalopathy as the cause of gelastic–dacrystic seizures has not been reported so far in the literature. PMID:23853086

  1. Epileptic Activity Increases Cerebral Amino Acid Transport Assessed by 18F-Fluoroethyl-l-Tyrosine Amino Acid PET: A Potential Brain Tumor Mimic.

    PubMed

    Hutterer, Markus; Ebner, Yvonne; Riemenschneider, Markus J; Willuweit, Antje; McCoy, Mark; Egger, Barbara; Schröder, Michael; Wendl, Christina; Hellwig, Dirk; Grosse, Jirka; Menhart, Karin; Proescholdt, Martin; Fritsch, Brita; Urbach, Horst; Stockhammer, Guenther; Roelcke, Ulrich; Galldiks, Norbert; Meyer, Philipp T; Langen, Karl-Josef; Hau, Peter; Trinka, Eugen

    2017-01-01

    O-(2-(18)F-fluoroethyl)-l-tyrosine ((18)F-FET) PET is a well-established method increasingly used for diagnosis, treatment planning, and monitoring in gliomas. Epileptic activity, frequently occurring in glioma patients, can influence MRI findings. Whether seizures also affect (18)F-FET PET imaging is currently unknown. The aim of this retrospective analysis was to investigate the brain amino acid metabolism during epileptic seizures by (18)F-FET PET and to elucidate the pathophysiologic background.

  2. Epileptic homocide: a case report.

    PubMed

    Gunn, J

    1978-05-01

    This case report augments a paper published in 1971 (Gunn and Fenton) in which it was indicated that automatic behaviour is a rare explanation for the crimes of epileptic patients. It was claimed that although two possible "automatic" crimes were committed by two epileptic patients among the 46 male epileptics at Broadmoor there were no such crimes committed by any of the 158 male epileptic prisoners who came into a national sample. Since then it has become clear that one man serving life imprisonment, exluded from the epileptic prisoner sample in 1967 because of a doubt about his diagnosis, is definitely epileptic and probably killed his wife during an epileptic attack or its immediate sequela.

  3. Generalized tonic-clonic seizure

    MedlinePlus

    ... Seizure - grand mal; Grand mal seizure; Seizure - generalized; Epilepsy - generalized seizure ... occur as part of a repeated, chronic illness (epilepsy). Some seizures are due to psychological problems (psychogenic).

  4. [Non-epileptic motor paroxysmal phenomena in wakefulness in childhood].

    PubMed

    Ruggieri, Víctor L; Arberas, Claudia L

    2013-09-06

    Paroxysmal events in childhood are a challenge for pediatric neurologists, given its highly heterogeneous clinical manifestations, often difficult to distinguish between phenomena of epileptic seizure or not. The non-epileptic paroxysmal episodes are neurological phenomena, with motor, sensory symptoms, and/or sensory impairments, with or without involvement of consciousness, epileptic phenomena unrelated, so no electroencephalographic correlative expression between or during episodes. From the clinical point of view can be classified into four groups: motor phenomena, syncope, migraine (and associated conditions) and acute psychiatric symptoms. In this paper we analyze paroxysmal motor phenomena in awake children, dividing them according to their clinical manifestations: extrapyramidal episodes (paroxysmal kinesiogenic, non kinesiogenic and not related to exercise dyskinesias, Dopa responsive dystonia) and similar symptoms of dystonia (Sandifer syndrome); manifestations of startle (hyperekplexia); episodic eye and head movements (benign paroxysmal tonic upward gaze nistagmus deviation); episodic ataxia (familial episodic ataxias, paroxysmal benign vertigo); stereotyped and phenomena of self-gratification; and myoclonic events (benign myoclonus of early infancy). The detection of these syndromes will, in many cases, allow an adequate genetic counseling, initiate a specific treatment and avoid unnecessary additional studies. Molecular studies have demonstrated a real relationship between epileptic and non-epileptic basis of many of these entities and surely the identification of the molecular basis and understanding of the pathophysiological mechanisms in many of them allow us, in the near future will benefit our patients.

  5. Out-of-body experiences associated with seizures

    PubMed Central

    Greyson, Bruce; Fountain, Nathan B.; Derr, Lori L.; Broshek, Donna K.

    2014-01-01

    Alterations of consciousness are critical factors in the diagnosis of epileptic seizures. With these alterations in consciousness, some persons report sensations of separating from the physical body, experiences that may in rare cases resemble spontaneous out-of-body experiences. This study was designed to identify and characterize these out-of-body-like subjective experiences associated with seizure activity. Fifty-five percent of the patients in this study recalled some subjective experience in association with their seizures. Among our sample of 100 patients, 7 reported out-of-body experiences associated with their seizures. We found no differentiating traits that were associated with patients' reports of out-of-body experiences, in terms of either demographics; medical history, including age of onset and duration of seizure disorder, and seizure frequency; seizure characteristics, including localization, lateralization, etiology, and type of seizure, and epilepsy syndrome; or ability to recall any subjective experiences associated with their seizures. Reporting out-of-body experiences in association with seizures did not affect epilepsy-related quality of life. It should be noted that even in those patients who report out-of-body experiences, such sensations are extremely rare events that do not occur routinely with their seizures. Most patients who reported out-of-body experiences described one or two experiences that occurred an indeterminate number of years ago, which precludes the possibility of associating the experience with the particular characteristics of that one seizure or with medications taken or other conditions at the time. PMID:24592228

  6. The epileptic spectrum in the congenital bilateral perisylvian syndrome. CBPS Multicenter Collaborative Study.

    PubMed

    Kuzniecky, R; Andermann, F; Guerrini, R

    1994-03-01

    We studied the frequency, clinical and EEG characteristics, and outcome of the epileptic syndrome in 31 patients with a congenital neurologic syndrome characterized by pseudobulbar palsy, cognitive deficits, and bilateral perisylvian polymicrogyria. Seizures were present in 27 of 31 patients (87%) and usually began between the ages of 4 and 12 years; they commonly consisted of atypical absence, atonic/tonic, and generalized tonic-clonic seizures. Partial attacks were present in 26%. EEG demonstrated generalized spike and wave abnormalities and, less frequently, multifocal discharges, predominantly in centro-parietal regions. Seizures were poorly controlled in 65%, with the remaining patients well controlled. Seven patients underwent callosotomy, which resulted in seizure improvement. This study indicates that the epileptic spectrum in this syndrome is broad but follows predictable patterns. Callosotomy is a valuable treatment strategy in those with intractable drop attacks.

  7. Instruction manual for the ILAE 2017 operational classification of seizure types.

    PubMed

    Fisher, Robert S; Cross, J Helen; D'Souza, Carol; French, Jacqueline A; Haut, Sheryl R; Higurashi, Norimichi; Hirsch, Edouard; Jansen, Floor E; Lagae, Lieven; Moshé, Solomon L; Peltola, Jukka; Roulet Perez, Eliane; Scheffer, Ingrid E; Schulze-Bonhage, Andreas; Somerville, Ernest; Sperling, Michael; Yacubian, Elza Márcia; Zuberi, Sameer M

    2017-04-01

    This companion paper to the introduction of the International League Against Epilepsy (ILAE) 2017 classification of seizure types provides guidance on how to employ the classification. Illustration of the classification is enacted by tables, a glossary of relevant terms, mapping of old to new terms, suggested abbreviations, and examples. Basic and extended versions of the classification are available, depending on the desired degree of detail. Key signs and symptoms of seizures (semiology) are used as a basis for categories of seizures that are focal or generalized from onset or with unknown onset. Any focal seizure can further be optionally characterized by whether awareness is retained or impaired. Impaired awareness during any segment of the seizure renders it a focal impaired awareness seizure. Focal seizures are further optionally characterized by motor onset signs and symptoms: atonic, automatisms, clonic, epileptic spasms, or hyperkinetic, myoclonic, or tonic activity. Nonmotor-onset seizures can manifest as autonomic, behavior arrest, cognitive, emotional, or sensory dysfunction. The earliest prominent manifestation defines the seizure type, which might then progress to other signs and symptoms. Focal seizures can become bilateral tonic-clonic. Generalized seizures engage bilateral networks from onset. Generalized motor seizure characteristics comprise atonic, clonic, epileptic spasms, myoclonic, myoclonic-atonic, myoclonic-tonic-clonic, tonic, or tonic-clonic. Nonmotor (absence) seizures are typical or atypical, or seizures that present prominent myoclonic activity or eyelid myoclonia. Seizures of unknown onset may have features that can still be classified as motor, nonmotor, tonic-clonic, epileptic spasms, or behavior arrest. This "users' manual" for the ILAE 2017 seizure classification will assist the adoption of the new system.

  8. Hypothalamic hamartoma presenting with gelastic seizures, generalized convulsions, and ictal psychosis.

    PubMed

    Al-Hail, Hassan J; Sokrab, Tag-Eldin O; Al-Moslamani, Nasir J; Miyares, Francisco R

    2010-01-01

    We report a case of hypothalamic hamartoma in an adult female who presented with gelastic seizures, generalized convulsions, and ictal aggressive psychotic behavior. Anticonvulsant treatment was ineffective in controlling the epileptic seizures. Surgical excision after accurate imaging diagnosis 3 decades after the onset of symptoms markedly ameliorated her condition. Delayed and erroneous diagnosis had unnecessarily prolonged the suffering of our patient.

  9. Early Post Traumatic Seizures in Military Personnel Result in Long Term Disability

    DTIC Science & Technology

    2013-10-01

    injured patients have seizures within 1 week after injury when monitored intensively by continuous electroencephalography (cEEG). With the use of...Specific Aim 1: To determine the regional seizure focus and secondary epileptic spread regions using continuous electroencephalography in moderate to

  10. Aripiprazole-induced seizure: a second case report.

    PubMed

    Yueh, Che-Lin; Yu, Sung-Lin; Chen, Hsiao-Min; Wu, Bo-Jian; Chen, Wen-Ching

    2009-01-01

    Aripiprazole has been recognised as a third generation antipsychotic and is considered to be distinguished from typical and atypical antipsychotics. In clinical trials, researchers did not mention the risk of aripiprazole-induced seizure, but during a literature review a case report was found that discussed this potential side effect. The present report concerns a 54-year-old man with chronic schizophrenia who developed a witnessed grand mal seizure after he had abruptly discontinued clozapine and benzodiazepam (BZD) treatment and concurrently reinitiated aripiprazole treatment as the result of an involuntary clinical error. The possible causes were explored, including clozapine-induced or withdrawal seizure, BZD withdrawal syndrome, psychogenic non-epileptic seizure, hyponatraemia, brain tumour and major physical illness, but none of the hypotheses can explain the seizure observed in this case. This second case is presented to corroborate a previous finding and emphasise the possibility of aripiprazole-induced seizure.

  11. Seizure facilitating activity of the oral contraceptive ethinyl estradiol.

    PubMed

    Younus, Iyan; Reddy, Doodipala Samba

    2016-03-01

    Contraceptive management is critical in women with epilepsy. Although oral contraceptives (OCs) are widely used by many women with epilepsy, little is known about their impact on epileptic seizures and epileptogenesis. Ethinyl estradiol (EE) is the primary component of OC pills. In this study, we investigated the pharmacological effect of EE on epileptogenesis and kindled seizures in female mice using the hippocampus kindling model. Animals were stimulated daily with or without EE until generalized stage 5 seizures were elicited. EE treatment significantly accelerated the rate of epileptogenesis. In acute studies, EE caused a significant decrease in the afterdischarge threshold and increased the incidence and severity of seizures in fully-kindled mice. In chronic studies, EE treatment caused a greater susceptibility to kindled seizures. Collectively, these results are consistent with moderate proconvulsant-like activity of EE. Such excitatory effects may affect seizure risk in women with epilepsy taking OC pills.

  12. Epileptic activity in Alzheimer's disease: causes and clinical relevance.

    PubMed

    Vossel, Keith A; Tartaglia, Maria C; Nygaard, Haakon B; Zeman, Adam Z; Miller, Bruce L

    2017-04-01

    Epileptic activity is frequently associated with Alzheimer's disease; this association has therapeutic implications, because epileptic activity can occur at early disease stages and might contribute to pathogenesis. In clinical practice, seizures in patients with Alzheimer's disease can easily go unrecognised because they usually present as non-motor seizures, and can overlap with other symptoms of the disease. In patients with Alzheimer's disease, seizures can hasten cognitive decline, highlighting the clinical relevance of early recognition and treatment. Some evidence indicates that subclinical epileptiform activity in patients with Alzheimer's disease, detected by extended neurophysiological monitoring, can also lead to accelerated cognitive decline. Treatment of clinical seizures in patients with Alzheimer's disease with select antiepileptic drugs (AEDs), in low doses, is usually well tolerated and efficacious. Moreover, studies in mouse models of Alzheimer's disease suggest that certain classes of AEDs that reduce network hyperexcitability have disease-modifying properties. These AEDs target mechanisms of epileptogenesis involving amyloid β and tau. Clinical trials targeting network hyperexcitability in patients with Alzheimer's disease will identify whether AEDs or related strategies could improve their cognitive symptoms or slow decline.

  13. Partial (focal) seizure

    MedlinePlus

    ... Jacksonian seizure; Seizure - partial (focal); Temporal lobe seizure; Epilepsy - partial seizures ... Abou-Khalil BW, Gallagher MJ, Macdonald RL. Epilepsies. In: Daroff ... Practice . 7th ed. Philadelphia, PA: Elsevier; 2016:chap 101. ...

  14. Frontal Lobe Seizures

    MedlinePlus

    Frontal lobe seizures Overview By Mayo Clinic Staff Frontal lobe seizures are a common form of epilepsy, a ... seizures originate in the front of the brain. Frontal lobe seizures may also be caused by abnormal brain ...

  15. Seizures beget seizures in temporal lobe epilepsies: the boomerang effects of newly formed aberrant kainatergic synapses.

    PubMed

    Ben-Ari, Yehezkel; Crepel, Valérie; Represa, Alfonso

    2008-01-01

    Do temporal lobe epilepsy (TLE) seizures in adults promote further seizures? Clinical and experimental data suggest that new synapses are formed after an initial episode of status epilepticus, however their contribution to the transformation of a naive network to an epileptogenic one has been debated. Recent experimental data show that newly formed aberrant excitatory synapses on the granule cells of the fascia dentate operate by means of kainate receptor-operated signals that are not present on naive granule cells. Therefore, genuine epileptic networks rely on signaling cascades that differentiate them from naive networks. Recurrent limbic seizures generated by the activation of kainate receptors and synapses in naive animals lead to the formation of novel synapses that facilitate the emergence of further seizures. This negative, vicious cycle illustrates the central role of reactive plasticity in neurological disorders.

  16. [Clinical presentation and diagnosis of epileptic auras].

    PubMed

    Barletova, E I; Kremenchugskaia, M R; Mukhin, K Iu; Glukhova, L Iu; Mironov, M B

    2012-01-01

    To define clinical presentations of visual auras and to reveal their clinical, encephalographic and neuroimaging correlates, we examined 23 patients, aged from 5 to 25 years (mean 14±6 years), with focal forms of epilepsy. Patients had visual auras regardless of the etiology of epilepsy which developed immediately before epileptic seizures or were isolated. Patients had simple or complex visual hallucinations, the former occurring more frequently, visual illusions and ictal amaurosis. Positive visual phenomena were noted more frequently than negative ones. In most of the patients, visual hallucinations were associated with the pathological activity in cortical occipital regions of the brain and, in some cases, in temporal and parietal regions. The different pathologies (developmental defects, post-ischemic, atrophic and other disturbances) identified by MRI were found in a half of patients.

  17. Downregulated GABA and BDNF-TrkB pathway in chronic cyclothiazide seizure model.

    PubMed

    Kong, Shuzhen; Cheng, Zhihua; Liu, Jianhui; Wang, Yun

    2014-01-01

    Cyclothiazide (CTZ) has been reported to simultaneously enhance glutamate receptor excitation and inhibit GABAA receptor inhibition, and in turn it evokes epileptiform activities in hippocampal neurons. It has also been shown to acutely induce epileptic seizure behavior in freely moving rats. However, whether CTZ induced seizure rats could develop to have recurrent seizure still remains unknown. In the current study, we demonstrated that 46% of the CTZ induced seizure rats developed to have recurrent seizure behavior as well as epileptic EEG with a starting latency between 2 weeks and several months. In those chronic seizure rats 6 months after the seizure induction by the CTZ, our immunohistochemistry results showed that both GAD and GAT-1 were significantly decreased across CA1, CA3, and dentate gyrus area of the hippocampus studied. In addition, both BDNF and its receptor TrkB were also decreased in hippocampus of the chronic CTZ seizure rats. Our results indicate that CTZ induced seizure is capable of developing to have recurrent seizure, and the decreased GABA synthesis and transport as well as the impaired BDNF-TrkB signaling pathway may contribute to the development of the recurrent seizure. Thus, CTZ seizure rats may provide a novel animal model for epilepsy study and anticonvulsant drug testing in the future.

  18. Controlling Seizures

    ERIC Educational Resources Information Center

    Henderson, Nancy

    2008-01-01

    This article describes how an implantable device could greatly improve the quality of life for people with epilepsy. Gabe Anderson was diagnosed with bilateral heterotopia, a congenital condition that can lead to the onset of complex partial seizures stemming from both hemispheres of the brain. In early 2004, Gabe became one of the first 35…

  19. Apneas observed in trisomy 18 neonates should be differentiated from epileptic apneas.

    PubMed

    Fukasawa, Tatsuya; Kubota, Tetsuo; Tanaka, Masaharu; Asada, Hideyuki; Matsusawa, Kaname; Hattori, Tetsuo; Kato, Yuichi; Negoro, Tamiko

    2015-03-01

    Many children with trisomy 18 have apneas from the neonatal period. It has been reported that some children with trisomy 18 have epilepsy, including epileptic apneas. However, no previous report has described epileptic apneas in trisomy 18 neonates. We retrospectively reviewed the clinical records of neonates with trisomy 18 who were born at Anjo Kosei Hospital between July 2004 and October 2013 and investigated whether they had epileptic apneas during the neonatal period and whether antiepileptic drugs (AEDs) were effective for treating them. We identified 16 patients with trisomy 18. Nine patients who died within 3 days of birth were excluded. Five of the remaining seven patients had apneas. All five patients underwent electroencephalograms (EEGs) to assess whether they suffered epileptic apneas. Three of the five patients had EEG-confirmed seizures. In two patients, the apneas corresponded to ictal discharges. In one patient, ictal discharges were recorded when she was under mechanical ventilation, but no ictal discharges that corresponded to apneas were recorded after she was extubated. AEDs were effective for treating the apneas and stabilizing the SpO2 in all three patients. Among neonates with trisomy 18 who lived longer than 3 days, three of seven patients had EEG-confirmed seizures. AEDs were useful for treating their epileptic apneas and stabilizing their SpO2. Physicians should keep epileptic apneas in mind when treating apneas in neonates with trisomy 18.

  20. [Occupational health problems in epileptics].

    PubMed

    Romankow, Jacek

    2005-01-01

    From the point of view of occupational medicine some questions are important for epileptics; amongst others: falling, behavior during the paroxysm, shift work dependence of attack, behaviour after an epileptic episode. Occupational capacity depends on the process of epileptic episodes and their frequency. The development of neurology has rendered numerous cures from epilepsy, but the the occupational stigma is difficult in many professions--electrical engineering, working with machinery, milling machines and others. In some professions a care must be taken when hiring epileptics--for instance professions with a fall hazard, jobs connected with public transport or involving crane or excavator operation.

  1. The Persistence of Erroneous Familiarity in an Epileptic Male: Challenging Perceptual Theories of Deja Vu Activation

    ERIC Educational Resources Information Center

    O'Connor, Akira R.; Moulin, Christopher J. A.

    2008-01-01

    We report the case of a 39-year-old, temporal lobe epileptic male, MH. Prior to complex partial seizure, experienced up to three times a day, MH often experiences an aura experienced as a persistent sensation of deja vu. Data-driven theories of deja vu formation suggest that partial familiarity for the perceived stimulus is responsible for the…

  2. Adrenocorticotropic hormone protects learning and memory function in epileptic Kcna1-null mice.

    PubMed

    Scantlebury, Morris H; Chun, Kyoung-Chul; Ma, Shun-Chieh; Rho, Jong M; Kim, Do Young

    2017-04-03

    ACTH, a member of the melanocortin family of peptides, is often used in the treatment of the developmental epileptic encephalopathy spectrum disorders including, Ohtahara, West, Lennox Gastaut and Landau-Kleffner Syndromes and electrical status epilepticus of sleep. In these disorders, although ACTH is often successful in controlling the seizures and/or inter-ictal EEG abnormalities, it is unknown whether ACTH possesses other beneficial effects independent of seizure control. We tested whether ACTH can ameliorate the intrinsic impairment of hippocampal-based learning and memory in epileptic Kcna1-null (KO) mice. We found that ACTH - administered in the form of Acthar Gel given i.p. four times daily at a dose of 4 IU/kg (16 IU/kg/day) for 7days - prevented impairment of long-term potentiation (LTP) evoked with high-frequency stimulation in CA1 hippocampus and also restored spatial learning and memory on the Barnes maze test. However, with this treatment regimen, ACTH did not exert a significant effect on the frequency of spontaneous recurrent seizures. Together, our findings indicate that ACTH can ameliorate memory impairment in epileptic Kcna1-null mice separate from seizure control, and suggest that this widely used peptide may exert direct nootropic effects in the epileptic brain.

  3. Low dose zinc supplementation beneficially affects seizure development in experimental seizure models in rats.

    PubMed

    Kumar, Hemant; Katyal, Jatinder; Gupta, Yogendra K

    2015-02-01

    The role of zinc in seizure models and with antiepileptic drugs sodium valproate (SV) and phenytoin (PHT) was studied using experimental models of seizures in rats. Male Wistar rats, 150-250 g were administered zinc 2, 20, and 200 mg/kg, orally for 14 days. Sixty minutes after the last dose of zinc, rats were challenged with pentylenetetrazole (PTZ, 60 mg/kg, ip) or maximal electroshock (MES, 70 mA, 0.2 s duration). In another group, SV (150/300 mg/kg, ip) or PHT (40 mg/kg, ip) was administered after 30 min of zinc administration followed by seizure challenge. Zinc pretreatment at all doses had no effect on MES seizures. In PTZ seizures, with the lowest dose used, i.e., 2 mg/kg, a protective effect was observed. Neither the protection offered by the 100 % anticonvulsant dose of SV (300 mg/kg) in PTZ seizures was affected by pre-treatment with zinc nor a combination of subanticonvulsant dose of SV (150 mg/kg) and zinc offer any statistically significant advantage over either drug alone. The combination of phenytoin with zinc had no effect on any of the parameters tested. Apart from this, chronic zinc administration hampered development of chemically (PTZ)-kindled seizures in rats. Zinc supplementation is unlikely to have any undesirable effect when used in epileptics rather it may offer advantage in epileptic and seizure prone patients.

  4. Targeted treatment of migrating partial seizures of infancy with quinidine.

    PubMed

    Bearden, David; Strong, Alanna; Ehnot, Jessica; DiGiovine, Marissa; Dlugos, Dennis; Goldberg, Ethan M

    2014-09-01

    Migrating partial seizures of infancy is an early onset epileptic encephalopathy syndrome that is typically resistant to treatment. The most common cause is a gain of function mutation in the potassium channel KCNT1. The antiarrhythmic drug quinidine is a partial antagonist of KCNT1 and hence may be a candidate drug for treatment of this condition. We report the case of a child with migrating partial seizures of infancy secondary to an activating mutation in KCNT1 treated with quinidine. Treatment with quinidine was correlated with a marked reduction in seizure frequency and improved psychomotor development.

  5. Management of dental patients with seizure disorders.

    PubMed

    Bryan, Robert B; Sullivan, Steven M

    2006-10-01

    Dental practitioners from time to time must treat patients with epilepsy or similar seizure disorders. This article describes the various classification for epilepsy, explains how such disorders are evaluated and diagnosed, discusses management methods, and addresses related issues for special populations, such as pregnant women and elderly. In addition, the article offers information about what special steps dentists should take in treating such epileptic patients and others vulnerable to seizures and in preparing offices and staff for the possibility that a patient will have a seizure in the office. In general, a patient with severe, poorly controlled epilepsy should be treated in a hospital. Otherwise, a well-controlled patient should easily be treated in the office.

  6. Connectivity of epileptic brain regions in wake and sleep.

    PubMed

    Klimes, Petr; Duque, Juliano J; Jurak, Pavel; Halamek, Josef; Worrell, Gregory A

    2015-08-01

    Focal epileptic brain is characterized by a region of pathological tissue seizure onset zone (SOZ) - the pathologic tissue generating seizures. During the interictal period (nonseizure) the SOZ is characterized by epileptiform activity - interictal spikes & high-frequency oscillations (HFO). The SOZ also exhibits hyper-synchrony and functional disconnection from the surrounding areas. Recent studies have described the synchrony inside the SOZ and surrounding tissue for just small sets of patients (2-4) and without any distinction in behavioral states. Wake and sleep cycles can, however, have a significant influence on SOZ activity. Here we show the results of connectivity analysis in three fundamental areas of the epileptic brain - inside SOZ, outside SOZ and bridging areas in 7 patients during wake and sleep. We observed increased synchrony inside SOZ and decreased synchrony on its edges (bridging areas) in specific frequency bands. We also detected significant differences of synchrony levels between wake and sleep periods in HFO frequencies. Our results provide additional insight into the properties of SOZ connectivity. Knowledge of these principles may prove useful for SOZ localization and understanding epileptic brain function in general.

  7. Neuronal desynchronization as a trigger for seizure generation.

    PubMed

    Li, Yue; Fleming, Ioana Nicolaescu; Colpan, Mustafa Efkan; Mogul, David J

    2008-02-01

    Experimental reports have appeared which challenge the dogma that epileptic seizures arise as a consequence of neuronal hypersynchronization. We sought to explore what mechanisms that desynchronize neuronal firing could induce epileptic seizures. A computer model of connections in a mammalian hippocampal slice preparation was constructed including two recently-reported distinct inhibitory feedback circuits. When inhibition by interneurons that synapse on pyramidal dendrites was decreased, highly localized seizure-like bursting was observed in the CA3 region similar to that which occurs experimentally under GABAergic blockade. In contrast, when inhibition by interneurons that synapse in the axosomatic region was similarly decreased, no such bursting was observed. However, when this transient inhibition was increased, normal coordinated spread of excitation was interrupted by high-frequency localized seizure-like bursting. The increase of this inhibitory input resulted in decreased cell coupling of pyramidal neurons. A decrease in phase coherence was initially observed until seizure-like activity initiated causing a net increase in coherence as has been observed in epileptic patients. These results provide a possible pathway in which a decrease in synchronization could provide the trigger for inducing epileptiform activity.

  8. Treadmill exercise prevents GABAergic neuronal loss with suppression of neuronal activation in the pilocarpine-induced epileptic rats

    PubMed Central

    Lim, Baek-Vin; Shin, Mal-Soon; Lee, Jae-Min; Seo, Jin-Hee

    2015-01-01

    Epilepsy is a common neurological disorder characterized by seizure and loss of neuronal cells by abnormal rhythmic firing of neurons in the brain. In the present study, we investigated the effect of treadmill exercise on gamma-aminobutyric acid (GABA)ergic neuronal loss in relation with neuronal activation using pilocarpine-induced epileptic rats. The rats were divided into four groups: control group, control and treadmill exercise group, pilocarpine-induced epilepsy group, and pilocarpine-induced epilepsy and treadmill exercise group. Epilepsy was induced by intraperitoneal injection of 320 mg/kg pilocarpine hydrochloride. The rats in the exercise groups were forced to run on a motorized treadmill for 30 min once a day for 2 weeks. In the present results, neuronal loss in the hippocampal CA1 region was increased after pilocarpine-induced seizure. Treadmill exercise inhibited hippocampal neuronal loss in the epileptic rats. Glutamic acid decarboxylase (GAD67) expression in the hippocampal CA1 region was reduced by pilocarpine-induced seizure. Treadmill exercise increased GAD67 expression in the epileptic rats. c-Fos expression in the hippocampal CA1 region was increased in response to epileptic seizure. Treadmill exercise inhibited c-Fos expression in the epileptic rats. Epileptic seizure increased brain-derived neurotrophic factor (BDNF) and tyrosine kinase receptor B (TrkB) expressions in the hippocampus. Treadmill exercise suppressed BDNF and TrkB expressions in the epileptic rats. In the present study, treadmill exercise prevented GABAergic neuronal loss and inhibited neuronal activation in the hippocampal CA1 region through the down-regulation of BDNF-TrkB signaling pathway. PMID:25960980

  9. Reduction of pentylenetetrazole-induced seizure activity in awake rats by seizure-triggered trigeminal nerve stimulation.

    PubMed

    Fanselow, E E; Reid, A P; Nicolelis, M A

    2000-11-01

    Stimulation of the vagus nerve has become an effective method for desynchronizing the highly coherent neural activity typically associated with epileptic seizures. This technique has been used in several animal models of seizures as well as in humans suffering from epilepsy. However, application of this technique has been limited to unilateral stimulation of the vagus nerve, typically delivered according to a fixed duty cycle, independently of whether ongoing seizure activity is present. Here, we report that stimulation of another cranial nerve, the trigeminal nerve, can also cause cortical and thalamic desynchronization, resulting in a reduction of seizure activity in awake rats. Furthermore, we demonstrate that providing this stimulation only when seizure activity begins results in more effective and safer seizure reduction per second of stimulation than with previous methods. Seizure activity induced by intraperitoneal injection of pentylenetetrazole was recorded from microwire electrodes in the thalamus and cortex of awake rats while the infraorbital branch of the trigeminal nerve was stimulated via a chronically implanted nerve cuff electrode. Continuous unilateral stimulation of the trigeminal nerve reduced electrographic seizure activity by up to 78%, and bilateral trigeminal stimulation was even more effective. Using a device that automatically detects seizure activity in real time on the basis of multichannel field potential signals, we demonstrated that seizure-triggered stimulation was more effective than the stimulation protocol involving a fixed duty cycle, in terms of the percent seizure reduction per second of stimulation. In contrast to vagus nerve stimulation studies, no substantial cardiovascular side effects were observed by unilateral or bilateral stimulation of the trigeminal nerve. These findings suggest that trigeminal nerve stimulation is safe in awake rats and should be evaluated as a therapy for human seizures. Furthermore, the results

  10. ATPergic signalling during seizures and epilepsy.

    PubMed

    Engel, Tobias; Alves, Mariana; Sheedy, Caroline; Henshall, David C

    2016-05-01

    Much progress has been made over the last few decades in the identification of new anti-epileptic drugs (AEDs). However, 30% of epilepsy patients suffer poor seizure control. This underscores the need to identify alternative druggable neurotransmitter systems and drugs with novel mechanisms of action. An emerging concept is that seizure generation involves a complex interplay between neurons and glial cells at the tripartite synapse and neuroinflammation has been proposed as one of the main drivers of epileptogenesis. The ATP-gated purinergic receptor family is expressed throughout the brain and is functional on neurons and glial cells. ATP is released in high amounts into the extracellular space after increased neuronal activity and during chronic inflammation and cell death to act as a neuro- and gliotransmitter. Emerging work shows pharmacological targeting of ATP-gated purinergic P2 receptors can potently modulate seizure generation, inflammatory processes and seizure-induced brain damage. To date, work showing the functional contribution of P2 receptors has been mainly performed in animal models of acute seizures, in particular, by targeting the ionotropic P2X7 receptor subtype. Other ionotropic P2X and metabotropic P2Y receptor family members have also been implicated in pathological processes following seizures such as the P2X4 receptor and the P2Y12 receptor. However, during epilepsy, the characterization of P2 receptors was mostly restricted to the study of expressional changes of the different receptor subtypes. This review summarizes the work to date on ATP-mediated signalling during seizures and the functional impact of targeting the ATP-gated purinergic receptors on seizures and seizure-induced pathology. This article is part of the Special Issue entitled 'Purines in Neurodegeneration and Neuroregeneration'.

  11. Distribution entropy analysis of epileptic EEG signals.

    PubMed

    Li, Peng; Yan, Chang; Karmakar, Chandan; Liu, Changchun

    2015-01-01

    It is an open-ended challenge to accurately detect the epileptic seizures through electroencephalogram (EEG) signals. Recently published studies have made elaborate attempts to distinguish between the normal and epileptic EEG signals by advanced nonlinear entropy methods, such as the approximate entropy, sample entropy, fuzzy entropy, and permutation entropy, etc. Most recently, a novel distribution entropy (DistEn) has been reported to have superior performance compared with the conventional entropy methods for especially short length data. We thus aimed, in the present study, to show the potential of DistEn in the analysis of epileptic EEG signals. The publicly-accessible Bonn database which consisted of normal, interictal, and ictal EEG signals was used in this study. Three different measurement protocols were set for better understanding the performance of DistEn, which are: i) calculate the DistEn of a specific EEG signal using the full recording; ii) calculate the DistEn by averaging the results for all its possible non-overlapped 5 second segments; and iii) calculate it by averaging the DistEn values for all the possible non-overlapped segments of 1 second length, respectively. Results for all three protocols indicated a statistically significantly increased DistEn for the ictal class compared with both the normal and interictal classes. Besides, the results obtained under the third protocol, which only used very short segments (1 s) of EEG recordings showed a significantly (p <; 0.05) increased DistEn for the interictal class in compassion with the normal class, whereas both analyses using relatively long EEG signals failed in tracking this difference between them, which may be due to a nonstationarity effect on entropy algorithm. The capability of discriminating between the normal and interictal EEG signals is of great clinical relevance since it may provide helpful tools for the detection of a seizure onset. Therefore, our study suggests that the Dist

  12. [Transient epileptic amnesia].

    PubMed

    Muramatsu, Kazuhiro; Yoshizaki, Takahito

    2016-03-01

    Transient amnesia is one of common clinical phenomenon of epilepsy that are encountered by physicians. The amnestic attacks are often associated with persistent memory disturbances. Epilepsy is common among the elderly, with amnesia as a common symptom and convulsions relatively uncommon. Therefore, amnesia due to epilepsy can easily be misdiagnosed as dementia. The term 'transient epileptic amnesia (TEA)' was introduced in the early 1990s by Kapur, who highlighted that amnestic attacks caused by epilepsy can be similar to those occurring in 'transient global amnesia', but are distinguished by features brevity and recurrence. In 1998, Zeman et al. proposed diagnostic criteria for TEA.

  13. Selective changes in inhibition as determinants for limited hyperexcitability in the insular cortex of epileptic rats

    PubMed Central

    Bortel, Aleksandra; Longo, Daniela; de Guzman, Philip; Dubeau, François; Biagini, Giuseppe; Avoli, Massimo

    2016-01-01

    The insular cortex (IC) is involved in the generalization of epileptic discharges in temporal lobe epilepsy (TLE), whereas seizures originating in the IC can mimic the epileptic phenotype seen in some patients with TLE. However, few studies have addressed the changes occurring in the IC in TLE animal models. Here, we analyzed the immunohistochemical and electrophysiological properties of IC networks in non-epileptic control and pilocarpine-treated epileptic rats. Neurons identified with a neuron-specific nuclear protein antibody showed similar counts in the two types of tissue but parvalbumin- and neuropeptide Y-positive interneurons were significantly decreased (parvalbumin, approximately −35%; neuropeptide Y, approximately −38%; P < 0.01) in the epileptic IC. Nonadapting neurons were seen more frequently in the epileptic IC during intracellular injection of depolarizing current pulses. In addition, single-shock electrical stimuli elicited network-driven epileptiform responses in 87% of epileptic and 22% of non-epileptic control neurons (P < 0.01) but spontaneous postsynaptic potentials had similar amplitude, duration and intervals of occurrence in the two groups. Finally, pharmacologically isolated, GABAA receptor-mediated inhibitory postsynaptic potentials had more negative reversal potential (P < 0.01) and higher peak conductance (P < 0.05) in epileptic tissue. These data reveal moderate increased network excitability in the IC of pilocarpine-treated epileptic rats. We propose that this limited degree of hyperexcitability originates from the loss of parvalbumin- and neuropeptide Y-positive interneurons that is compensated by an increased drive for GABAA receptor-mediated inhibition. PMID:20497472

  14. Fractal Dimension in Epileptic EEG Signal Analysis

    NASA Astrophysics Data System (ADS)

    Uthayakumar, R.

    Fractal Analysis is the well developed theory in the data analysis of non-linear time series. Especially Fractal Dimension is a powerful mathematical tool for modeling many physical and biological time signals with high complexity and irregularity. Fractal dimension is a suitable tool for analyzing the nonlinear behaviour and state of the many chaotic systems. Particularly in analysis of chaotic time series such as electroencephalograms (EEG), this feature has been used to identify and distinguish specific states of physiological function.Epilepsy is the main fatal neurological disorder in our brain, which is analyzed by the biomedical signal called Electroencephalogram (EEG). The detection of Epileptic seizures in the EEG Signals is an important tool in the diagnosis of epilepsy. So we made an attempt to analyze the EEG in depth for knowing the mystery of human consciousness. EEG has more fluctuations recorded from the human brain due to the spontaneous electrical activity. Hence EEG Signals are represented as Fractal Time Series.The algorithms of fractal dimension methods have weak ability to the estimation of complexity in the irregular graphs. Divider method is widely used to obtain the fractal dimension of curves embedded into a 2-dimensional space. The major problem is choosing initial and final step length of dividers. We propose a new algorithm based on the size measure relationship (SMR) method, quantifying the dimensional behaviour of irregular rectifiable graphs with minimum time complexity. The evidence for the suitability (equality with the nature of dimension) of the algorithm is illustrated graphically.We would like to demonstrate the criterion for the selection of dividers (minimum and maximum value) in the calculation of fractal dimension of the irregular curves with minimum time complexity. For that we design a new method of computing fractal dimension (FD) of biomedical waveforms. Compared to Higuchi's algorithm, advantages of this method include

  15. SEIZURE FORECASTING AND THE PREICTAL STATE IN CANINE EPILEPSY

    PubMed Central

    Varatharajah, Yogatheesan; Iyer, Ravishankar K.; Berry, Brent M.; Worrell, Gregory A.; Brinkmann, Benjamin H.

    2017-01-01

    The ability to predict seizures may enable patients with epilepsy to better manage their medications and activities, potentially reducing side effects and improving quality of life. Forecasting epileptic seizures remains a challenging problem, but machine learning methods using intracranial electroencephalographic (iEEG) measures have shown promise. A machine-learning-based pipeline was developed to process iEEG recordings and generate seizure warnings. Results support the ability to forecast seizures at rates greater than a Poisson random predictor for all feature sets and machine learning algorithms tested. In addition, subject-specific neurophysiological changes in multiple features are reported preceding lead seizures, providing evidence supporting the existence of a distinct and identifiable preictal state. PMID:27464854

  16. Seizure Forecasting and the Preictal State in Canine Epilepsy.

    PubMed

    Varatharajah, Yogatheesan; Iyer, Ravishankar K; Berry, Brent M; Worrell, Gregory A; Brinkmann, Benjamin H

    2017-02-01

    The ability to predict seizures may enable patients with epilepsy to better manage their medications and activities, potentially reducing side effects and improving quality of life. Forecasting epileptic seizures remains a challenging problem, but machine learning methods using intracranial electroencephalographic (iEEG) measures have shown promise. A machine-learning-based pipeline was developed to process iEEG recordings and generate seizure warnings. Results support the ability to forecast seizures at rates greater than a Poisson random predictor for all feature sets and machine learning algorithms tested. In addition, subject-specific neurophysiological changes in multiple features are reported preceding lead seizures, providing evidence supporting the existence of a distinct and identifiable preictal state.

  17. The ketogenic diet can be used successfully in combination with corticosteroids for epileptic encephalopathies.

    PubMed

    Ville, Dorothée; Chiron, Catherine; Laschet, Jacques; Dulac, Olivier

    2015-07-01

    Hormonal therapy or ketogenic diet often permits overcoming the challenging periods of many epileptic encephalopathies (West and Lennox-Gastaut syndromes and encephalopathy with continuous spike-waves in slow sleep), but relapse affects over 20% of patients. We report here a monocenter pilot series of 42 consecutive patients in whom we combined oral steroids with the ketogenic diet for corticosteroid-resistant or -dependent epileptic encephalopathy. We retrospectively evaluated the effect on seizure frequency, interictal spike activity, neuropsychological course, and steroid treatment course. Twenty-three patients had West syndrome (WS), 13 had encephalopathy with continuous spike-waves in slow sleep (CSWS), and six others had miscellaneous epileptic encephalopathies. All patients succeeded to reach 0.8 to 1.6g/l ketone bodies in the urine following the usual KD regimen. For at least 6 months, 14/42 responded to the addition of the ketogenic diet: 4/23 with WS, 8/13 with CSWS, and 2/6 with miscellaneous epileptic encephalopathies. The addition of the KD allowed withdrawing steroids in all responders. Among them, 10/15 had been patients with steroid-dependent epileptic encephalopathy and 4/27 patients with steroid-resistant epileptic encephalopathy. Therefore, the ketogenic diet can be used successfully in combination with corticosteroids for epileptic encephalopathies. Patients presenting with steroid-dependent CSWS seem to be the best candidates.

  18. [Visual epileptic seizures. Signs and symptoms, and clinical implications].

    PubMed

    González-Cuevas, Montserrat; Toledo, Manuel; Santamarina, Estevo; Sueiras-Gil, María; Cambrodí-Masip, Roser; Sarria, Silvana; Quintana, Manuel; Salas-Puig, Javier

    2015-03-16

    Introduccion. Los fenomenos visuales pueden ser sintomas de crisis epilepticas, aunque con un significado clinico y una relacion con el foco epileptogeno incierto. Objetivo. Describir las implicaciones clinicas de las crisis epilepticas visuales segun su semiologia en adultos. Pacientes y metodos. Durante un año se recoge consecutivamente a pacientes que describian semiologia visual como manifestacion principal de sus crisis y se clasifican los sintomas visuales segun las caracteristicas de la descripcion. Resultados. Se incluye a 78 pacientes con una edad media de 43,5 años. El 97% de los casos eran epilepsias focales. Entre el 63% de las epilepsias sintomaticas, el 57% eran vasculares. Las crisis visuales eran, en un 81,9%, el aura previa a la crisis, y en un 17,9%, crisis visuales aisladas. La coexistencia de crisis visuales y otro tipo de crisis se asocio a farmacorresistencia (p = 0,021). Los sintomas visuales fueron: alucinaciones simples (55,1%), ilusiones (23,1%), alucinaciones complejas (15,4%) y perdida de vision (6,4%). La localizacion lobar de las lesiones era occipital (24,4%), temporoparietooccipital (21,8%), temporal (9%), parietal (3,8%) y frontal (1,3%). Las lesiones occipitales se asociaron con alucinaciones visuales simples (p < 0,001), y las ilusiones visuales y alucinaciones visuales complejas, con lesiones de la encrucijada temporoparietooccipital (p < 0,05). Del 55,1% de los pacientes con lesion unilateral en la resonancia magnetica, el 33% referia los sintomas en el hemicampo visual contralateral. Conclusiones. Las crisis visuales se presentan, principalmente, como auras epilepticas. Las alucinaciones simples se relacionan con el origen occipital, mientras que las alucinaciones complejas se asocian con regiones cerebrales mas anteriores. La aparicion de fenomenos visuales lateralizados nos orienta a un origen en el hemisferio contralateral.

  19. Functional Implications of Seizure-Induced Neurogenesis

    PubMed Central

    Scharfman, Helen E.

    2005-01-01

    The neurobiological doctrine governing the concept of neurogenesis has undergone a revolution in the past few years. What was once considered dubious is now well accepted: new neurons are born in the adult brain. Science fiction is quickly becoming a reality as scientists discover ways to convert skin, bone, or blood cells into neurons. In the epilepsy arena, widespread interest has developed because of the evidence that neurogenesis increases after seizures, trauma, and other insults or injuries that alter seizure susceptibility. This review discusses some of the initial studies in this field, and their often surprising functional implications. The emphasis will be on the granule cells of hippocampus, because they are perhaps more relevant to epilepsy than other areas in which neurogenesis occurs throughout life, the olfactory bulb and subventricular zone. In particular, the following questions will be addressed:Do granule cells that are born in the adult brain become functional, and what are the limits of their function? Do they behave homogeneously? Results from our own laboratory have focused on cells that become established outside the normal boundaries of the granule cell layer, forming a group of “ectopic” granule cells in the hilar region.Is increased neurogenesis beneficial, or might it actually exacerbate seizures? Evidence is presented that supports the hypothesis that new granule cells may not necessarily act to ameliorate seizures, and might even contribute to them. Furthermore, cognitive deficits following seizures might in part be due to new circuits that develop between new cells and the host brain.How do the new cells interact with the host brain? Several changes occur in the dentate gyrus after seizures, and increased neurogenesis is only one of many. What is the interdependence of this multitude of changes, if any?Is neurogenesis increased after seizures in man? Research suggests that the data from human epileptics are actually inconsistent

  20. Functional implications of seizure-induced neurogenesis.

    PubMed

    Scharfman, Helen E

    2004-01-01

    The neurobiological doctrine governing the concept of neurogenesis has undergone a revolution in the past few years. What was once considered dubious is now well accepted: new neurons are born in the adult brain. Science fiction is quickly becoming a reality as scientists discover ways to convert skin, bone, or blood cells into neurons. In the epilepsy arena, widespread interest has developed because of the evidence that neurogenesis increases after seizures, trauma, and other insults or injuries that alter seizure susceptibility. This review discusses some of the initial studies in this field, and their often surprising functional implications. The emphasis will be on the granule cells of hippocampus, because they are perhaps more relevant to epilepsy than other areas in which neurogenesis occurs throughout life, the olfactory bulb and subventricular zone. In particular, the following questions will be addressed: 1. Do granule cells that are born in the adult brain become functional, and what are the limits of their function? Do they behave homogeneously? Results from our own laboratory have focused on cells that become established outside the normal boundaries of the granule cell layer, forming a group of "ectopic" granule cells in the hilar region. 2. Is increased neurogenesis beneficial, or might it actually exacerbate seizures? Evidence is presented that supports the hypothesis that new granule cells may not necessarily act to ameliorate seizures, and might even contribute to them. Furthermore, cognitive deficits following seizures might in part be due to new circuits that develop between new cells and the host brain. 3. How do the new cells interact with the host brain? Several changes occur in the dentate gyrus after seizures, and increased neurogenesis is only one of many. What is the interdependence of this multitude of changes, if any? 4. Is neurogenesis increased after seizures in man? Research suggests that the data from human epileptics are actually

  1. Effects of antiepileptic drugs on the serum folate and vitamin B12 in various epileptic patients.

    PubMed

    Huang, Hong-Li; Zhou, Hao; Wang, Nuan; Yu, Chun-Yu

    2016-10-01

    Epilepsy is a common neurodegenerative disease with an increasing morbidity. Clinical treatment of epilepsy includes symptomatic treatment, etiological treatment, surgery and prevention. The aim of the present study was to determine the effects of antiepileptic drugs (AEDs) on serum folate and vitamin B12 in various epileptic patients, and to examine the correlation between these effects and secondary cerebrovascular events. A total of 68 epileptic patients, diagnosed between May 2012 and May 2014, were included in the present study. The study included 8 cases of autonomic seizures, 10 cases of absence seizures, 13 cases of complex partial seizures, 28 cases of generalized tonic-clonic seizures, and 9 cases of simple partial seizures. The patients received appropriate AED treatment according to the characteristics of epileptic seizure and the treatment guidance. The differences in the serum levels of folate and vitamin B12 in these patients, and the differences in the secondary cerebrovascular events in these patients after 1 year follow-up were analyzed. The difference in the AEDs used by various epileptic patients was statistically significant (P<0.05). The proportion of AED monotherapy in the autonomic seizure group and petit mal group was highest, and the proportion of two AED in combination with the psychomotor seizure, grand mal and simple partial seizure groups was highest. The serum levels of folate and vitamin B12 in these patients following treatment were significantly lower than those prior to treatment (P<0.05). The differences in the serum levels of folate and vitamin B12 in these groups following treatment were not statistically significant (P>0.05). The difference in the incidence of cerebrovascular events in these groups at follow up was not statistically significant (P>0.05). The multifactorial logistic regression analysis revealed that the serum levels of folate and vitamin B12 were the independent risk factors for epilepsy with secondary

  2. The effects of glycemic control on seizures and seizure-induced excitotoxic cell death

    PubMed Central

    2012-01-01

    Background Epilepsy is the most common neurological disorder after stroke, affecting more than 50 million persons worldwide. Metabolic disturbances are often associated with epileptic seizures, but the pathogenesis of this relationship is poorly understood. It is known that seizures result in altered glucose metabolism, the reduction of intracellular energy metabolites such as ATP, ADP and phosphocreatine and the accumulation of metabolic intermediates, such as lactate and adenosine. In particular, it has been suggested that the duration and extent of glucose dysregulation may be a predictor of the pathological outcome of status. However, little is known about neither the effects of glycemic control on brain metabolism nor the effects of managing systemic glucose concentrations in epilepsy. Results In this study, we examined glycemic modulation of kainate-induced seizure sensitivity and its neuropathological consequences. To investigate the relationship between glycemic modulation, seizure susceptibility and its neuropathological consequences, C57BL/6 mice (excitotoxin cell death resistant) were subjected to hypoglycemia or hyperglycemia, followed by systemic administration of kainic acid to induce seizures. Glycemic modulation resulted in minimal consequences with regard to seizure severity but increased hippocampal pathology, irrespective of whether mice were hypoglycemic or hyperglycemic prior to kainate administration. Moreover, we found that exogenous administration of glucose following kainic acid seizures significantly reduced the extent of hippocampal pathology in FVB/N mice (excitotoxin cell death susceptible) following systemic administration of kainic acid. Conclusion These findings demonstrate that modulation of the glycemic index can modify the outcome of brain injury in the kainate model of seizure induction. Moreover, modulation of the glycemic index through glucose rescue greatly diminishes the extent of seizure-induced cell death following kainate

  3. A signal processing based analysis and prediction of seizure onset in patients with epilepsy.

    PubMed

    Namazi, Hamidreza; Kulish, Vladimir V; Hussaini, Jamal; Hussaini, Jalal; Delaviz, Ali; Delaviz, Fatemeh; Habibi, Shaghayegh; Ramezanpoor, Sara

    2016-01-05

    One of the main areas of behavioural neuroscience is forecasting the human behaviour. Epilepsy is a central nervous system disorder in which nerve cell activity in the brain becomes disrupted, causing seizures or periods of unusual behaviour, sensations and sometimes loss of consciousness. An estimated 5% of the world population has epileptic seizure but there is not any method to cure it. More than 30% of people with epilepsy cannot control seizure. Epileptic seizure prediction, refers to forecasting the occurrence of epileptic seizures, is one of the most important but challenging problems in biomedical sciences, across the world. In this research we propose a new methodology which is based on studying the EEG signals using two measures, the Hurst exponent and fractal dimension. In order to validate the proposed method, it is applied to epileptic EEG signals of patients by computing the Hurst exponent and fractal dimension, and then the results are validated versus the reference data. The results of these analyses show that we are able to forecast the onset of a seizure on average of 25.76 seconds before the time of occurrence.

  4. A signal processing based analysis and prediction of seizure onset in patients with epilepsy

    PubMed Central

    Namazi, Hamidreza; Kulish, Vladimir V.

    2016-01-01

    One of the main areas of behavioural neuroscience is forecasting the human behaviour. Epilepsy is a central nervous system disorder in which nerve cell activity in the brain becomes disrupted, causing seizures or periods of unusual behaviour, sensations and sometimes loss of consciousness. An estimated 5% of the world population has epileptic seizure but there is not any method to cure it. More than 30% of people with epilepsy cannot control seizure. Epileptic seizure prediction, refers to forecasting the occurrence of epileptic seizures, is one of the most important but challenging problems in biomedical sciences, across the world. In this research we propose a new methodology which is based on studying the EEG signals using two measures, the Hurst exponent and fractal dimension. In order to validate the proposed method, it is applied to epileptic EEG signals of patients by computing the Hurst exponent and fractal dimension, and then the results are validated versus the reference data. The results of these analyses show that we are able to forecast the onset of a seizure on average of 25.76 seconds before the time of occurrence. PMID:26586477

  5. Massively multiplayer online role-playing game-induced seizures: a neglected health problem in Internet addiction.

    PubMed

    Chuang, Yao-Chung

    2006-08-01

    As the Internet has become rapidly and widely integrated into society, Internet addiction has become a growing psychosocial problem. However, epileptic seizure, another out-of-the-ordinary health problem, is often neglected in this regard. Ten patients who experienced epileptic seizures while playing the newest genre of electronic games -- Massively Multiplayer Online Role-Playing Games (MMORPGs) -- were investigated. Patients were predominantly male young adults, and most of the events were generalized tonic-clonic seizures, myoclonic seizures, and absences. These patients should be categorized into idiopathic generalized epilepsies. Even though photosensitivity was an important factor, behavioral and higher mental activities also seemed to be significant seizure precipitants. Results demonstrated that MMORPG-induced seizures were not analogous to the ordinary video game-induced seizures. Significantly, an epileptic seizure warning did not always appear on the websites of MMORPGs and instructions for the software. While the prevalence of MMORPG-induced seizures remains unknown, it may exceed our expectations and impact our society. Not only for clinical neurologists but also for the primary physicians, educators, sociologists, and global online game publishers, there should be an awareness of this special form of reflex seizures in order to provide an appropriate health warning to MMORPG players.

  6. Seizures and reproductive function: insights from female rats with epilepsy

    PubMed Central

    Scharfman, Helen E.; Kim, Michelle; Hintz, Tana M.; MacLusky, Neil J.

    2009-01-01

    OBJECTIVE Chronic seizures in women can have adverse effects on reproductive function, such as polycystic ovarian syndrome (PCOS), but it has been difficult to dissociate the effects of epilepsy per se from the role of antiepileptic drugs (AEDs). To distinguish the effects of chronic seizures from AEDs, we used the laboratory rat, where an epileptic condition can be induced without concomitant AED treatment. METHODS Adult female rats were administered the chemoconvulsant pilocarpine to initiate status epilepticus (SE), which was decreased in severity by the anticonvulsant diazepam. These rats developed spontaneous seizures in the ensuing weeks, and are therefore termed “epileptic.” Controls were saline-treated rats, or animals that were injected with pilocarpine but did not develop SE. Ovarian cyclicity and weight gain were evaluated for 2-3 months. Serum hormone levels were assayed from trunk blood, collected at the time of death. Paraformaldehyde-fixed ovaries were evaluated quantitatively. RESULTS Rats that had pilocarpine-induced seizures had an increased incidence of acyclicity by the end of the study, even if SE did not occur. Ovarian cysts and weight gain were significantly greater in epileptic rats than controls, whether rats maintained cyclicity or not. Serum testosterone was elevated in epileptic rats, but estradiol, progesterone and prolactin were not. INTERPRETATIONS The results suggest that an epileptic condition in the rat leads to increased body weight, cystic ovaries and elevated testosterone levels. Although caution is required when comparing female rats to women, the data suggest that epilepsy per se may be sufficient to induce abnormalities in the control of the ovary. PMID:19107990

  7. Seizure Disorders in Pregnancy

    MedlinePlus

    ... Seizures that cause a loss of consciousness and violent, jerking movements, called grand mal seizures , are especially ... of seizure that causes loss of consciousness and violent, jerking movements. Intrauterine Device: A small device that ...

  8. Modeling epileptic brain states using EEG spectral analysis and topographic mapping.

    PubMed

    Direito, Bruno; Teixeira, César; Ribeiro, Bernardete; Castelo-Branco, Miguel; Sales, Francisco; Dourado, António

    2012-09-30

    Changes in the spatio-temporal behavior of the brain electrical activity are believed to be associated to epileptic brain states. We propose a novel methodology to identify the different states of the epileptic brain, based on the topographic mapping of the time varying relative power of delta, theta, alpha, beta and gamma frequency sub-bands, estimated from EEG. Using normalized-cuts segmentation algorithm, points of interest are identified in the topographic mappings and their trajectories over time are used for finding out relations with epileptogenic propagations in the brain. These trajectories are used to train a Hidden Markov Model (HMM), which models the different epileptic brain states and the transition among them. Applied to 10 patients suffering from focal seizures, with a total of 30 seizures over 497.3h of data, the methodology shows good results (an average point-by-point accuracy of 89.31%) for the identification of the four brain states--interictal, preictal, ictal and postictal. The results suggest that the spatio-temporal dynamics captured by the proposed methodology are related to the epileptic brain states and transitions involved in focal seizures.

  9. Recognition and management of seizures in children in emergency departments.

    PubMed

    Caplan, Edward; Dey, Indranil; Scammell, Andrea; Burnage, Katy; Paul, Siba Prosad

    2016-09-01

    Seizure is defined as 'a sudden surge of electrical activity in the brain, which usually affects how a person appears or acts for a short time'. Children who have experienced seizures commonly present to emergency departments (EDs), and detailed history taking will usually help differentiate between epileptic and non-epileptic events. ED nurses are often the first health professionals to manage children with seizures, and this is best done by following the ABCDE approach. Treatment involves termination of seizures with anticonvulsants, and children may need other symptomatic management. Seizures in children can be an extremely distressing experience for parents, who should be supported and kept informed by experienced ED nurses. Nurses also play a vital role in educating parents on correct administration of anticonvulsants and safety advice. This article discusses the aetiology, clinical presentation, diagnosis and management of children with seizures, with particular emphasis on epilepsy. It includes two reflective case studies to highlight the challenges faced by healthcare professionals managing children who present with convulsions.

  10. Reflex seizures, traits, and epilepsies: from physiology to pathology.

    PubMed

    Koepp, Matthias J; Caciagli, Lorenzo; Pressler, Ronit M; Lehnertz, Klaus; Beniczky, Sándor

    2016-01-01

    Epileptic seizures are generally unpredictable and arise spontaneously. Patients often report non-specific triggers such as stress or sleep deprivation, but only rarely do seizures occur as a reflex event, in which they are objectively and consistently modulated, precipitated, or inhibited by external sensory stimuli or specific cognitive processes. The seizures triggered by such stimuli and processes in susceptible individuals can have different latencies. Once seizure-suppressing mechanisms fail and a critical mass (the so-called tipping point) of cortical activation is reached, reflex seizures stereotypically manifest with common motor features independent of the physiological network involved. The complexity of stimuli increases from simple sensory to complex cognitive-emotional with increasing age of onset. The topography of physiological networks involved follows the posterior-to-anterior trajectory of brain development, reflecting age-related changes in brain excitability. Reflex seizures and traits probably represent the extremes of a continuum, and understanding of their underlying mechanisms might help to elucidate the transition of normal physiological function to paroxysmal epileptic activity.

  11. Virtual Cortical Resection Reveals Push-Pull Network Control Preceding Seizure Evolution.

    PubMed

    Khambhati, Ankit N; Davis, Kathryn A; Lucas, Timothy H; Litt, Brian; Bassett, Danielle S

    2016-09-07

    In ∼20 million people with drug-resistant epilepsy, focal seizures originating in dysfunctional brain networks will often evolve and spread to surrounding tissue, disrupting function in otherwise normal brain regions. To identify network control mechanisms that regulate seizure spread, we developed a novel tool for pinpointing brain regions that facilitate synchronization in the epileptic network. Our method measures the impact of virtually resecting putative control regions on synchronization in a validated model of the human epileptic network. By applying our technique to time-varying functional networks, we identified brain regions whose topological role is to synchronize or desynchronize the epileptic network. Our results suggest that greater antagonistic push-pull interaction between synchronizing and desynchronizing brain regions better constrains seizure spread. These methods, while applied here to epilepsy, are generalizable to other brain networks and have wide applicability in isolating and mapping functional drivers of brain dynamics in health and disease.

  12. Ictal electrographic pattern of focal subcortical seizures induced by sound in rats.

    PubMed

    Vinogradova, Lyudmila V; Grinenko, Olesya A

    2016-03-15

    It is now recognized that both generalized and focal seizures may originate in subcortical structures. The well-known types of focal subcortically-driven seizures are gelastic seizures in patients with the hypothalamic hamartoma and sound-induced seizures in rodents with audiogenic epilepsy. The seizures are generated by subcortical intrinsically epileptogenic focus, the hamartoma in humans and the inferior colliculus (IC) in rodents. In patients with gelastic epilepsy additional seizure types may develop with time that are supposed to result from secondary epileptogenesis and spreading of epileptic discharges to the cortex. Repeated audiogenic seizures can also lead to development of additional seizure behavior and secondary epileptic activation of the cortex. This process, named audiogenic kindling, may be useful for studying secondary subcortico-cortical epileptogenesis. Using intracollicular and intracortical recordings, we studied an ictal electrographic pattern of focal subcortical seizures induced by repeated sound stimulation in Wistar audiogenic-susceptible rats. The audiogenic seizures, representing brief attacks of paroxysmal unidirectional running, were accompanied by epileptiform abnormalities in the IC, mostly on the side ipsilateral to run direction, and enhanced rhythmic 8-9Hz activity in the cortex. With repetition of the subcortical seizures and kindling development, a secondary cortical discharge began to follow the IC seizure. The secondary discharge initially involved the cortex homolateral to the side of dominant subcortical epileptiform abnormalities and behaviorally expressed as limbic (partial) clonus. Kindling progression was associated with bilateralization of the secondary cortical discharge, an increase in its amplitude and duration, intensification of associated behavioral seizures (from partial clonus to generalized tonic-clonic convulsions). Thus, ictal recordings during brief audiogenic running seizures showed their focal

  13. Uric acid is released in the brain during seizure activity and increases severity of seizures in a mouse model for acute limbic seizures.

    PubMed

    Thyrion, Lisa; Raedt, Robrecht; Portelli, Jeanelle; Van Loo, Pieter; Wadman, Wytse J; Glorieux, Griet; Lambrecht, Bart N; Janssens, Sophie; Vonck, Kristl; Boon, Paul

    2016-03-01

    Recent evidence points at an important role of endogenous cell-damage induced pro-inflammatory molecules in the generation of epileptic seizures. Uric acid, under the form of monosodium urate crystals, has shown to have pro-inflammatory properties in the body, but less is known about its role in seizure generation. This study aimed to unravel the contribution of uric acid to seizure generation in a mouse model for acute limbic seizures. We measured extracellular levels of uric acid in the brain and modulated them using complementary pharmacological and genetic tools. Local extracellular uric acid levels increased three to four times during acute limbic seizures and peaked between 50 and 100 min after kainic acid infusion. Manipulating uric acid levels through administration of allopurinol or knock-out of urate oxidase significantly altered the number of generalized seizures, decreasing and increasing them by a twofold respectively. Taken together, our results consistently show that uric acid is released during limbic seizures and suggest that uric acid facilitates seizure generalization.

  14. Liposteroid therapy for refractory seizures in children.

    PubMed

    Yoshikawa, H; Yamazaki, S; Abe, T; Oda, Y

    2000-10-01

    Liposteroid is dexamethasone palmitate incorporated into liposomes and was developed as an anti-inflammatory drug for targeting therapy mainly for rheumatoid arthritis. Recently, it was reported that liposteroid might be effective for the treatment of West syndrome, with fewer side effects than those of corticotropin therapy. We describe three patients, a 2-month-old boy with early infantile epileptic encephalopathy, a 4-month-old girl with symptomatic West syndrome, and a 2-year-old girl with symptomatic localization-related epilepsy, whose refractory seizures were treated with liposteroid according to the original method reported by Yamamoto and colleagues in 1998. Uncontrollable seizures ceased completely in two patients and the seizure frequency decreased markedly in the other patient. Electroencephalograms revealed marked improvement in all patients. They showed no relapse of the seizures, and all showed no adverse effects except for mild brain shrinkage in one patient. Our experience with these three patients suggests that liposteroid therapy might be a new option for the treatment of refractory seizures in children, as well as for West syndrome.

  15. Effects of Anterior Thalamic Nucleus Deep Brain Stimulation in Chronic Epileptic Rats

    PubMed Central

    Amorim, Beatriz; Cavarsan, Clarissa; Miranda, Maisa Ferreira; Aarão, Mayra C.; Madureira, Ana Paula; Rodrigues, Antônio M.; Nobrega, José N.; Mello, Luiz E.; Hamani, Clement

    2014-01-01

    Deep brain stimulation (DBS) has been investigated for the treatment of epilepsy. In rodents, an increase in the latency for the development of seizures and status epilepticus (SE) has been reported in different animal models but the consequences of delivering stimulation to chronic epileptic animals have not been extensively addressed. We study the effects of anterior thalamic nucleus (AN) stimulation at different current intensities in rats rendered epileptic following pilocarpine (Pilo) administration. Four months after Pilo-induced SE, chronic epileptic rats were bilaterally implanted with AN electrodes or had sham-surgery. Stimulation was delivered for 6 h/day, 5 days/week at 130 Hz, 90 µsec. and either 100 µA or 500 µA. The frequency of spontaneous recurrent seizures in animals receiving stimulation was compared to that recorded in the preoperative period and in rats given sham treatment. To investigate the effects of DBS on hippocampal excitability, brain slices from animals receiving AN DBS or sham surgery were studied with electrophysiology. We found that rats treated with AN DBS at 100 µA had a 52% non-significant reduction in the frequency of seizures as compared to sham-treated controls and 61% less seizures than at baseline. Animals given DBS at 500 µA had 5.1 times more seizures than controls and a 2.8 fold increase in seizure rate as compared to preoperative values. In non-stimulated controls, the average frequency of seizures before and after surgery remained unaltered. In vitro recordings have shown that slices from animals previously given DBS at 100 µA had a longer latency for the development of epileptiform activity, shorter and smaller DC shifts, and a smaller spike amplitude compared to non-stimulated controls. In contrast, a higher spike amplitude was recorded in slices from animals given AN DBS at 500 µA. PMID:24892420

  16. Startle-induced seizures associated with infantile hemiplegia: implication of the supplementary motor area.

    PubMed

    Nolan, Melinda A; Otsubo, Hiroshi; Iida, Koji; Minassian, Berge A

    2005-03-01

    This case illustrates an uncommon form of symptomatic startle-induced epilepsy associated with infantile hemiplegia. Seizure semiology, neuroimaging and neurophysiological findings support involvement of the supplementary motor area in the generation of this seizure type. We present the case of an 11-year-old girl with an uncommon form of startle-induced seizures, illustrated on video-EEG, against the background of left infantile hemiplegia associated with extensive right hemispheric porencephaly but preserved cognitive functioning. The epileptic focus appears to be in the dorsolateral frontal lobe, with seizure semiology involving the supplementary motor cortex.

  17. Treatable newborn and infant seizures due to inborn errors of metabolism.

    PubMed

    Campistol, Jaume; Plecko, Barbara

    2015-09-01

    About 25% of seizures in the neonatal period have causes other than asphyxia, ischaemia or intracranial bleeding. Among these are primary genetic epileptic encephalopathies with sometimes poor prognosis and high mortality. In addition, some forms of neonatal infant seizures are due to inborn errors of metabolism that do not respond to common AEDs, but are amenable to specific treatment. In this situation, early recognition can allow seizure control and will prevent neurological deterioration and long-term sequelae. We review the group of inborn errors of metabolism that lead to newborn/infant seizures and epilepsy, of which the treatment with cofactors is very different to that used in typical epilepsy management.

  18. Reducing premature KCC2 expression rescues seizure susceptibility and spine morphology in atypical febrile seizures.

    PubMed

    Awad, Patricia N; Sanon, Nathalie T; Chattopadhyaya, Bidisha; Carriço, Josianne Nunes; Ouardouz, Mohamed; Gagné, Jonathan; Duss, Sandra; Wolf, Daniele; Desgent, Sébastien; Cancedda, Laura; Carmant, Lionel; Di Cristo, Graziella

    2016-07-01

    Atypical febrile seizures are considered a risk factor for epilepsy onset and cognitive impairments later in life. Patients with temporal lobe epilepsy and a history of atypical febrile seizures often carry a cortical malformation. This association has led to the hypothesis that the presence of a cortical dysplasia exacerbates febrile seizures in infancy, in turn increasing the risk for neurological sequelae. The mechanisms linking these events are currently poorly understood. Potassium-chloride cotransporter KCC2 affects several aspects of neuronal circuit development and function, by modulating GABAergic transmission and excitatory synapse formation. Recent data suggest that KCC2 downregulation contributes to seizure generation in the epileptic adult brain, but its role in the developing brain is still controversial. In a rodent model of atypical febrile seizures, combining a cortical dysplasia and hyperthermia-induced seizures (LHS rats), we found a premature and sustained increase in KCC2 protein levels, accompanied by a negative shift of the reversal potential of GABA. In parallel, we observed a significant reduction in dendritic spine size and mEPSC amplitude in CA1 pyramidal neurons, accompanied by spatial memory deficits. To investigate whether KCC2 premature overexpression plays a role in seizure susceptibility and synaptic alterations, we reduced KCC2 expression selectively in hippocampal pyramidal neurons by in utero electroporation of shRNA. Remarkably, KCC2 shRNA-electroporated LHS rats show reduced hyperthermia-induced seizure susceptibility, while dendritic spine size deficits were rescued. Our findings demonstrate that KCC2 overexpression in a compromised developing brain increases febrile seizure susceptibility and contribute to dendritic spine alterations.

  19. Pallister-Killian syndrome: an unusual cause of epileptic spasms.

    PubMed

    Sánchez-Carpintero, Rocio; McLellan, Ailsa; Parmeggiani, Lucio; Cockwell, Annette E; Ellis, Richard J; Cross, J Helen; Eckhardt, Susan; Guerrini, Renzo

    2005-11-01

    Pallister-Killian syndrome (PKS) is a rare, sporadic, genetic disorder characterized by dysmorphic features, learning disability, and epilepsy. It is caused by a mosaic supernumerary isochromosome 12p (i[12p]). The i(12p) is rarely found in peripheral blood but it is present in skin fibroblasts. Recognition is essential for cytogenetic diagnosis. We describe a male aged 2 years 6 months and a female aged 11 years with PKS and epileptic spasms (ES). This type of seizure is not unusual in patients with brain malformations and with severe developmental delay, but it is sometimes difficult to recognize without video-electroencephalogram studies and could be mistaken for other types of seizure or behavioural manifestations. In these two patients with PKS, spasms had late onset, persisted beyond infancy, and were drug resistant. Clinicians should be aware of this possibility in PKS, which appears to be a rare cause of ES.

  20. Determination of epileptic focus side in mesial temporal lobe epilepsy using long-term noninvasive fNIRS/EEG monitoring for presurgical evaluation

    PubMed Central

    Rizki, Edmi Edison; Uga, Minako; Dan, Ippeita; Dan, Haruka; Tsuzuki, Daisuke; Yokota, Hidenori; Oguro, Keiji; Watanabe, Eiju

    2015-01-01

    Abstract. Noninvasive localization of an epileptogenic zone is a fundamental step for presurgical evaluation of epileptic patients. Here, we applied long-term simultaneous functional near-infrared spectroscopy (fNIRS)/electroencephalogram (EEG) monitoring for focus diagnosis in patients with mesial temporal lobe epilepsy (MTLE). Six MTLE patients underwent long-term (8–16 h per day for 4 days) fNIRS/EEG monitoring for the occurrence of spontaneous seizures. Four spontaneous seizures were successfully recorded out of the six patients. To determine oxy-Hb amplitude, the period-average values of oxy-Hb across 20 s from the EEG- or clinically defined epileptic onset were calculated for both hemispheres from the simultaneously recorded fNIRS data. The average oxy-Hb values for the temporal lobe at the earlier EEG- or clinically defined epileptic onsets were greater for the epileptic side than for the contralateral side after EEG activity suppression, spike train, and clinical seizure in all four cases. The true laterality was determined based on the relief of seizures by selective amygdalo-hippocampectomy. Thus, oxy-Hb amplitude could be a reliable measure for determining the epileptic focus side. Long-term simultaneous fNIRS/EEG measurement serves as an effective tool for recording spontaneous seizures. Cerebral hemodynamic measurement by fNIRS would serve as a valuable supplementary noninvasive measurement method for presurgical evaluation of MTLE. PMID:26158007

  1. Seizures and Teens: Stress, Sleep, & Seizures

    ERIC Educational Resources Information Center

    Shafer, Patricia Osborne

    2007-01-01

    Most parents are used to erratic sleep patterns and mood swings in their teenagers. When these occur in an adolescent with seizures, however, the parent may wonder if sleep and mood problems are related to seizures. Sorting out the cause and effects of sleep in an adolescent with seizures can be confusing. Since stress can be a contributor to both…

  2. Does the seizure frequency increase in Ramadan?

    PubMed

    Gomceli, Yasemin B; Kutlu, Gulnihal; Cavdar, Leyla; Inan, Levent E

    2008-12-01

    During Ramadan, the ninth month of the Islamic lunar calendar, adult Muslims are required to refrain from taking any food, beverages, or oral drugs, as well as from sexual intercourse between dawn and sunset. In this study, we aimed at discovering alterations in drug regimens and the seizure frequency of epileptic patients during Ramadan (15 October 2004-13 November 2004). In the 3 months following Ramadan in the year 2004, 114 patients with epilepsy who were fasting during Ramadan were examined at our Epilepsy Department. Of the 114 patients who were included in the study, 38 patients had seizures and one of these patients developed status epilepticus during Ramadan. When the seizure frequency of these patients during Ramadan was compared to that in the last 1 year and last 3 months period just prior to Ramadan, a statistically significant increase was observed (p<0.001). Moreover, there was an important increase in the risk of having seizures in the patients who changed their drug regimens compared with those who did not (p<0.05). In the patients who received monotherapy or polytherapy, no difference in the frequency of seizures during Ramadan was seen (p>0.05). During Ramadan, an increase in the seizure frequency of patients with epilepsy was observed. The most important reason for this situation was the alteration in the pharmacokinetics and pharmacodynamics of drugs, and consequently, in their efficacy. We believe that in the patients who received monotherapy and who did not change their drug regimes, the increase in seizure frequency may have been related to the changes in their daily rhythms, emotional stress, tiredness and their day-long fasting.

  3. Consciousness and epilepsy: why are complex-partial seizures complex?

    PubMed Central

    Englot, Dario J.; Blumenfeld, Hal

    2010-01-01

    changes depend on seizure spread to subcortical structures including the lateral septum. Understanding the contributions of network inhibition to impaired consciousness in TLE is an important goal, as recurrent limbic seizures often result in cortical dysfunction during and between epileptic events that adversely affects patients’ quality of life. PMID:19818900

  4. Synaptic Reorganization of the Perisomatic Inhibitory Network in Hippocampi of Temporal Lobe Epileptic Patients

    PubMed Central

    Wittner, Lucia

    2017-01-01

    GABAergic inhibition and particularly perisomatic inhibition play a crucial role in controlling the firing properties of large principal cell populations. Furthermore, GABAergic network is a key element in the therapy attempting to reduce epileptic activity. Here, we present a review showing the synaptic changes of perisomatic inhibitory neuronal subtypes in the hippocampus of temporal lobe epileptic patients, including parvalbumin- (PV-) containing and cannabinoid Type 1 (CB1) receptor-expressing (and mainly cholecystokinin-positive) perisomatic inhibitory cells, known to control hippocampal synchronies. We have examined the synaptic input of principal cells in the dentate gyrus and Cornu Ammonis region in human control and epileptic hippocampi. Perisomatic inhibitory terminals establishing symmetric synapses were found to be sprouted in the dentate gyrus. Preservation of perisomatic input was found in the Cornu Ammonis 1 and Cornu Ammonis 2 regions, as long as pyramidal cells are present. Higher density of CB1-immunostained terminals was found in the epileptic hippocampus of sclerotic patients, especially in the dentate gyrus. We concluded that both types of (PV- and GABAergic CB1-containing) perisomatic inhibitory cells are mainly preserved or showed sprouting in epileptic samples. The enhanced perisomatic inhibitory signaling may increase principal cell synchronization and contribute to generation of epileptic seizures and interictal spikes. PMID:28116310

  5. Seizure following the Use of the COX-2 Inhibitor Etoricoxib

    PubMed Central

    Arnao, Valentina; Riolo, Marianna; Fierro, Brigida

    2017-01-01

    We describe a case of epileptic seizures occurring after the use of a COX-2 inhibitor. A 61-year-old man was admitted to our department because of a generalized tonic-clonic seizure. EEG showed generalized slowdown of the activity. Neuroimaging and blood samples studies did not evidence alterations, but a careful pharmacological history revealed that the patient had taken the COX-2 inhibitor etoricoxib to treat lumbago few days before the onset of clinical symptoms. No seizures were reported after etoricoxib discontinuation and an EEG resulted to be normal two months after this. Conclusion. Knowing the pharmacological history of a patient is important for understanding the clinical presentation and selecting appropriate treatment. This is, to the best of our knowledge, the first reported case of generalized seizures associated with the use of COX-2 inhibitors. PMID:28210513

  6. Nicotine Elicits Convulsive Seizures by Activating Amygdalar Neurons

    PubMed Central

    Iha, Higor A.; Kunisawa, Naofumi; Shimizu, Saki; Tokudome, Kentaro; Mukai, Takahiro; Kinboshi, Masato; Ikeda, Akio; Ito, Hidefumi; Serikawa, Tadao; Ohno, Yukihiro

    2017-01-01

    Nicotinic acetylcholine (nACh) receptors are implicated in the pathogenesis of epileptic disorders; however, the mechanisms of nACh receptors in seizure generation remain unknown. Here, we performed behavioral and immunohistochemical studies in mice and rats to clarify the mechanisms underlying nicotine-induced seizures. Treatment of animals with nicotine (1–4 mg/kg, i.p.) produced motor excitement in a dose-dependent manner and elicited convulsive seizures at 3 and 4 mg/kg. The nicotine-induced seizures were abolished by a subtype non-selective nACh antagonist, mecamylamine (MEC). An α7 nACh antagonist, methyllycaconitine, also significantly inhibited nicotine-induced seizures whereas an α4β2 nACh antagonist, dihydro-β-erythroidine, affected only weakly. Topographical analysis of Fos protein expression, a biological marker of neural excitation, revealed that a convulsive dose (4 mg/kg) of nicotine region-specifically activated neurons in the piriform cortex, amygdala, medial habenula, paratenial thalamus, anterior hypothalamus and solitary nucleus among 48 brain regions examined, and this was also suppressed by MEC. In addition, electric lesioning of the amygdala, but not the piriform cortex, medial habenula and thalamus, specifically inhibited nicotine-induced seizures. Furthermore, microinjection of nicotine (100 and 300 μg/side) into the amygdala elicited convulsive seizures in a dose-related manner. The present results suggest that nicotine elicits convulsive seizures by activating amygdalar neurons mainly via α7 nACh receptors. PMID:28232801

  7. Gelastic seizures due to right temporal cortical dysplasia.

    PubMed

    Dericioglu, Nese; Cataltepe, Oguz; Tezel, Gaye Guler; Saygi, Serap

    2005-06-01

    Gelastic seizures are an uncommon seizure type. They are most frequently observed in patients with hypothalamic hamartoma. Their association with other types of cerebral lesions is rare. Depending on the location of the lesion, gelastic seizures may or may not be accompanied by a subjective feeling of mirth. The pathophysiological mechanisms of this type of seizure are still undefined, and little is known about which pathways promote laughter and its emotional content, mirth. We present a young man with drug-resistant, gelastic seizures due to focal cortical dysplasia of the right inferior temporal gyrus. The lesion was evident on cranial MRI. Interictal EEG displayed a right temporal focus, whereas ictal EEG was not informative. Ictal loss of consciousness precluded reporting of any possible emotional experience. The patient underwent surgical resection of the lesion and has been seizure-free with anti-epileptic medication for two years. Although various anatomical regions may elicit laughter, in view of the current literature it seems that the anterior cingulate region is involved in the motor aspects of laughter, while the basal temporal cortex is involved in the processing of mirth. The fact that the present case exhibited gelastic seizures stresses once more the importance of the baso-lateral temporal cortex in the genesis of this type of seizures.[Published with video sequences].

  8. Doublecortin expression in the normal and epileptic adult human brain.

    PubMed

    Liu, Y W J; Curtis, M A; Gibbons, H M; Mee, E W; Bergin, P S; Teoh, H H; Connor, B; Dragunow, M; Faull, R L M

    2008-12-01

    Mesial temporal lobe epilepsy (MTLE) is a neurological disorder associated with spontaneous recurrent complex partial seizures and hippocampal sclerosis. Although increased hippocampal neurogenesis has been reported in animal models of MTLE, increased neurogenesis has not been reported in the hippocampus of adult human MTLE cases. Here we showed that cells expressing doublecortin (Dcx), a microtubule-associated protein expressed in migrating neuroblasts, were present in the hippocampus and temporal cortex of the normal and MTLE adult human brain. In particular, increased numbers of Dcx-positive cells were observed in the epileptic compared with the normal temporal cortex. Importantly, 56% of Dcx-expressing cells in the epileptic temporal cortex coexpressed both the proliferative cell marker, proliferating cell nuclear antigen and early neuronal marker, TuJ1, suggesting that they may be newly generated neurons. A subpopulation of Dcx-positive cells in the epileptic temporal cortex also coexpressed the mature neuronal marker, NeuN, suggesting that epilepsy may promote the generation of new neurons in the temporal cortex. This study has identified, for the first time, a novel population of Dcx-positive cells in the adult human temporal cortex that can be upregulated by epilepsy and thus, raises the possibility that these cells may have functional significance in the pathophysiology of epilepsy.

  9. Epileptic and nonepileptic paroxysmal events out of sleep in children.

    PubMed

    Vendrame, Martina; Kothare, Sanjeev V

    2011-04-01

    The distinction between epileptic and nonepileptic events out of sleep may represent a significant challenge to the pediatrician. It is known that sleep can facilitate epileptic activity and that seizures in sleep tend to occur during specific sleep stages. Certain epilepsy syndromes have a well-documented and strong association with sleep and these can present with a variety of bizarre behaviors and motor activity. Disorders that may present with nocturnal nonepileptic paroxysmal events may include not only sleep-related disorders per se but also psychiatric/behavioral conditions"benign" paroxysmal phenomena with unrelated etiology, and nonneurologic disorders. These phenomena, especially when involving complex motor activity, such as that observed in parasomnias, nocturnal panic attacks, and rapid eye movement behavior disorders may be difficult to differentiate from seizures. Moreover, there is increasing awareness that certain sleep disorders, such as sleep-disordered breathing, may coexist with epilepsy. There are several clinical and electrographical features that allow an accurate diagnosis, and diagnostic tools such as video-EEG polysomnography may be essential.

  10. Coexistence of Epileptic Nocturnal Wanderings and an Arachnoid Cyst

    PubMed Central

    Jiménez-Genchi, Alejandro; Díaz-Galviz, John L.; García-Reyna, Juan Carlos; Ávila-Ordoñez, Mario U.

    2007-01-01

    Episodic nocturnal wanderings (ENWs) have rarely been associated with gross abnormalities of brain structures. We describe the case of a patient with ENWs in coexistence with an arachnoid cyst (AC). The patient was a 15-year-old boy who presented with nocturnal attacks characterized by complex motor behaviors. An MRI revealed a left temporal cyst and a SPECT Tc99 scan showed left temporal hypoperfusion and bilateral frontal hyperperfusion, more evident on the right side. During an all-night polysomnographic recording with audiovisual monitoring, dystonic posture followed by sleepwalking-like behavior was documented. The sleepwalking-like behavior was preceded by a spike discharge over the left frontocentral region with contralateral projection and secondary generalization during stage 2 sleep. Treatment with levetiracetam produced a striking remission of seizures. This supports a conservative management of an AC, considering that it may be an incidental finding. In epileptic patients, an AC may not necessarily be related to the location of the seizure focus. Citation: Jiménez-Genchi A; Díaz-Galviz JL; García-Reyna JC et al. Coexistence of epileptic nocturnal wanderings and an arachnoid cyst. J Clin Sleep Med 2007;3(4):399-401. PMID:17694730

  11. Neonatal seizure automatism and human inborn pattern of quadrupedal locomotion.

    PubMed

    Pavlidis, E; Cantalupo, G; Cattani, L; Tassinari, C A; Pisani, F

    2016-09-01

    Seizures in newborns do not always show a clear electro-clinical correlation. The real epileptic nature of some stereotyped rhythmic movements, included in the 'subtle seizures' and considered as brainstem release phenomena, is still debated. We report a brain injured newborn, who displayed several episodes of repetitive limb movements. The ictal EEG discharge, during one of these episodes, was associated with a motor pattern modification, which was endowed with quadrupedal locomotion kinematic features. This might represent an indirect evidence of cervical and lumbar Central Pattern Generators interconnection with in-phase coordination between diagonal limbs since the first hours of life in humans.

  12. Evaluation of selected recurrence measures in discriminating pre-ictal and inter-ictal periods from epileptic EEG data

    NASA Astrophysics Data System (ADS)

    Ngamga, Eulalie Joelle; Bialonski, Stephan; Marwan, Norbert; Kurths, Jürgen; Geier, Christian; Lehnertz, Klaus

    2016-04-01

    We investigate the suitability of selected measures of complexity based on recurrence quantification analysis and recurrence networks for an identification of pre-seizure states in multi-day, multi-channel, invasive electroencephalographic recordings from five epilepsy patients. We employ several statistical techniques to avoid spurious findings due to various influencing factors and due to multiple comparisons and observe precursory structures in three patients. Our findings indicate a high congruence among measures in identifying seizure precursors and emphasize the current notion of seizure generation in large-scale epileptic networks. A final judgment of the suitability for field studies, however, requires evaluation on a larger database.

  13. EEG-fMRI coregistration in non-ketotic hyperglycemic occipital seizures.

    PubMed

    Del Felice, Alessandra; Zanoni, Tiziano; Avesani, Mirko; Formaggio, Emanuela; Storti, Silvia; Fiaschi, Antonio; Moretto, Giuseppe; Manganotti, Paolo

    2009-08-01

    We report the first case, to our knowledge, of non-ketotic hyperglycemic (NKH) related occipital seizures studied by continuous EEG-fMRI in an undiagnosed diabetic patient. Ictal EEG showed left posterior spikes and sharp-waves. Seizures subsided after insulin therapy was started. Continuous EEG-fMRI was performed and BOLD activation was identified in the left Brodmann's area 18 (visual association area). Activation of an epileptic focus related with the patient's metabolic disturbance can be postulated.

  14. Feature Parameter Optimization for Seizure Detection/Prediction

    DTIC Science & Technology

    2007-11-02

    the window length for the feature under consideration. Figure 4 illustrates the variation of the k-factor for the fractal dimension feature, as...r Figure 4: K-Factor from the Fractal Dimension for Different Window Sizes Typically, the window sizes that maximized the k-factor were...Esteller R., Ph.D dissertation “Detection of seizure onset in epileptic patients from intracranial EEG signals ”, Georgia Institute of Technology

  15. The Lombrosian prejudice in medicine. The case of epilepsy. Epileptic psychosis. Epilepsy and aggressiveness.

    PubMed

    Granieri, Enrico; Fazio, Patrik

    2012-02-01

    In the nineteenth century, epilepsy became subject of experimental research. Lombroso established a relationship between epilepsy and criminality believing in the existence of epileptoid traits and atavism. He tried to demonstrate the common origin of epilepsy, criminality, and genius; factors deteriorating the CNS would act upon centers, which control behavior and ethics. This impairment would cause a lack of control on the lower nervous centers, reducing restraints of instincts and criminal behavior. He described developmental frontal cortex lesions in epileptic patients (today Taylor's dysplasia) and these observations supported the erroneous conviction of a relationship between criminality and epilepsy. Neurological, behavioral, and criminological sciences analyzed Lombroso's doctrine, whereas it was controversial that epileptic patients should be prone to violent actions and aggressive behavior. Today, there is an international panel of experts on epilepsy, which suggests five relevant criteria to determine if a crime committed with aggressiveness could result from epileptic seizures.

  16. Long-term variability of global statistical properties of epileptic brain networks

    NASA Astrophysics Data System (ADS)

    Kuhnert, Marie-Therese; Elger, Christian E.; Lehnertz, Klaus

    2010-12-01

    We investigate the influence of various pathophysiologic and physiologic processes on global statistical properties of epileptic brain networks. We construct binary functional networks from long-term, multichannel electroencephalographic data recorded from 13 epilepsy patients, and the average shortest path length and the clustering coefficient serve as global statistical network characteristics. For time-resolved estimates of these characteristics we observe large fluctuations over time, however, with some periodic temporal structure. These fluctuations can—to a large extent—be attributed to daily rhythms while relevant aspects of the epileptic process contribute only marginally. Particularly, we could not observe clear cut changes in network states that can be regarded as predictive of an impending seizure. Our findings are of particular relevance for studies aiming at an improved understanding of the epileptic process with graph-theoretical approaches.

  17. Management of a high risk epileptic patient under conscious sedation: A multidisciplinary approach

    PubMed Central

    Chellathurai, Burnice Nalina Kumari; Thiagarajan, Ramakrishnan; Jayakumaran, SelvaKumar; Devadoss, Pradeep; Elavazhagan

    2016-01-01

    Epilepsy, characterized by the risk of recurrent seizures, is a chronic disease that afflicts about 5% of the world's population. The main dental problems associated with epileptic patients include gingival hyperplasia, minor oral injuries, tooth trauma, and prosthodontic problems, which require the dental treatment. Stress and fear are the most common triggering factors for the epilepsy in dental chair. Therefore, a more appropriate method of treating such epileptic patients may be warranted. Conscious sedation is a technique of providing good anesthesia and analgesia to patients, the main advantage of which is the patient's rapid return to presentation levels. Midazolam used as a sedative agent has anticonvulsant properties. This case report highlights a case requiring multiple dental procedures carried out in a high risk epileptic patient under conscious sedation. PMID:27041847

  18. Management of a high risk epileptic patient under conscious sedation: A multidisciplinary approach.

    PubMed

    Chellathurai, Burnice Nalina Kumari; Thiagarajan, Ramakrishnan; Jayakumaran, SelvaKumar; Devadoss, Pradeep; Elavazhagan

    2016-01-01

    Epilepsy, characterized by the risk of recurrent seizures, is a chronic disease that afflicts about 5% of the world's population. The main dental problems associated with epileptic patients include gingival hyperplasia, minor oral injuries, tooth trauma, and prosthodontic problems, which require the dental treatment. Stress and fear are the most common triggering factors for the epilepsy in dental chair. Therefore, a more appropriate method of treating such epileptic patients may be warranted. Conscious sedation is a technique of providing good anesthesia and analgesia to patients, the main advantage of which is the patient's rapid return to presentation levels. Midazolam used as a sedative agent has anticonvulsant properties. This case report highlights a case requiring multiple dental procedures carried out in a high risk epileptic patient under conscious sedation.

  19. Sudden unexpected death in epileptics following sudden, intense, increases in geomagnetic activity: Prevalence of effect and potential mechanisms

    NASA Astrophysics Data System (ADS)

    Persinger, M. A.; Psych, C.

    1995-12-01

    Abrupt, intense increases in global geomagnetic activity during the local night may precipitate a significant proportion of sudden unexpected (or unexplained) deaths (SUD) in epileptics. Over a 2-year period SUD in healthy chronic epileptic rats occurred when the average daily geomagnetic activity exceeded 50 nT (nanoTesla) and suddenly began during local night. Other experiments demonstrated that epileptic rats displayed more spontaneous seizures per night if there had been sudden increases in geomagnetic activity. Analyses of previously published data indicated that the number of SUDs/month in a population of human epileptics was positively associated with the number of days/month when the average geomagnetic activity exceeded 50 nT. The results support the hypothesis that suppression of the nocturnal concentrations of the endogenous anticonvulsant melatonin by sudden increases in geomagnetic activity may encourage fatal cardiac arrhythmias by uncoupling the insular/amygdaloid-paraventricular hypothalamic-solitary nucleus pathways.

  20. Principal dynamic mode analysis of neural mass model for the identification of epileptic states

    NASA Astrophysics Data System (ADS)

    Cao, Yuzhen; Jin, Liu; Su, Fei; Wang, Jiang; Deng, Bin

    2016-11-01

    The detection of epileptic seizures in Electroencephalography (EEG) signals is significant for the diagnosis and treatment of epilepsy. In this paper, in order to obtain characteristics of various epileptiform EEGs that may differentiate different states of epilepsy, the concept of Principal Dynamic Modes (PDMs) was incorporated to an autoregressive model framework. First, the neural mass model was used to simulate the required intracerebral EEG signals of various epileptiform activities. Then, the PDMs estimated from the nonlinear autoregressive Volterra models, as well as the corresponding Associated Nonlinear Functions (ANFs), were used for the modeling of epileptic EEGs. The efficient PDM modeling approach provided physiological interpretation of the system. Results revealed that the ANFs of the 1st and 2nd PDMs for the auto-regressive input exhibited evident differences among different states of epilepsy, where the ANFs of the sustained spikes' activity encountered at seizure onset or during a seizure were the most differentiable from that of the normal state. Therefore, the ANFs may be characteristics for the classification of normal and seizure states in the clinical detection of seizures and thus provide assistance for the diagnosis of epilepsy.

  1. Principal dynamic mode analysis of neural mass model for the identification of epileptic states.

    PubMed

    Cao, Yuzhen; Jin, Liu; Su, Fei; Wang, Jiang; Deng, Bin

    2016-11-01

    The detection of epileptic seizures in Electroencephalography (EEG) signals is significant for the diagnosis and treatment of epilepsy. In this paper, in order to obtain characteristics of various epileptiform EEGs that may differentiate different states of epilepsy, the concept of Principal Dynamic Modes (PDMs) was incorporated to an autoregressive model framework. First, the neural mass model was used to simulate the required intracerebral EEG signals of various epileptiform activities. Then, the PDMs estimated from the nonlinear autoregressive Volterra models, as well as the corresponding Associated Nonlinear Functions (ANFs), were used for the modeling of epileptic EEGs. The efficient PDM modeling approach provided physiological interpretation of the system. Results revealed that the ANFs of the 1st and 2nd PDMs for the auto-regressive input exhibited evident differences among different states of epilepsy, where the ANFs of the sustained spikes' activity encountered at seizure onset or during a seizure were the most differentiable from that of the normal state. Therefore, the ANFs may be characteristics for the classification of normal and seizure states in the clinical detection of seizures and thus provide assistance for the diagnosis of epilepsy.

  2. A comprehensive oral and dental management of an epileptic and intellectually deteriorated adolescent

    PubMed Central

    Joshi, Sourabh Ramesh; Pendyala, Gowri Swaminatham; Saraf, Veena; Choudhari, Shantanu; Mopagar, Viddyasagar

    2013-01-01

    Epilepsy along with intellectual deterioration and other neurological disorders can have social, physical, and psychological consequences, especially, when they begin in childhood. Moreover, the seizure episode along with mental deterioration may compromise the oral and dental care resulting in numerous decayed teeth. This report presents the case history of an adolescent with poor oral hygiene and numerous decayed teeth. This report also presents the comprehensive endodontic, surgical, and prosthodontic management of epileptic mentally challenged patient in the dental office. Epilepsy along with intellectual deterioration and other neurological disorders can have social, physical, and psychological consequences, especially, when they begin in childhood. Moreover, the seizure episode along with mental deterioration may compromise the oral and dental care resulting in numerous decayed teeth. This report presents the case history of an adolescent with poor oral hygiene and numerous decayed teeth. This report also presents the comprehensive endodontic, surgical, and prosthodontic management of epileptic mentally challenged patient in the dental office. PMID:24130597

  3. A comprehensive oral and dental management of an epileptic and intellectually deteriorated adolescent.

    PubMed

    Joshi, Sourabh Ramesh; Pendyala, Gowri Swaminatham; Saraf, Veena; Choudhari, Shantanu; Mopagar, Viddyasagar

    2013-07-01

    Epilepsy along with intellectual deterioration and other neurological disorders can have social, physical, and psychological consequences, especially, when they begin in childhood. Moreover, the seizure episode along with mental deterioration may compromise the oral and dental care resulting in numerous decayed teeth. This report presents the case history of an adolescent with poor oral hygiene and numerous decayed teeth. This report also presents the comprehensive endodontic, surgical, and prosthodontic management of epileptic mentally challenged patient in the dental office. Epilepsy along with intellectual deterioration and other neurological disorders can have social, physical, and psychological consequences, especially, when they begin in childhood. Moreover, the seizure episode along with mental deterioration may compromise the oral and dental care resulting in numerous decayed teeth. This report presents the case history of an adolescent with poor oral hygiene and numerous decayed teeth. This report also presents the comprehensive endodontic, surgical, and prosthodontic management of epileptic mentally challenged patient in the dental office.

  4. Complex dynamics of epileptic EEG.

    PubMed

    Kannathal, N; Puthusserypady, Sadasivan K; Choo Min, Lim

    2004-01-01

    Electroencephalogram (EEG) - the recorded representation of electrical activity of the brain contain useful information about the state of the brain. Recent studies indicate that nonlinear methods can extract valuable information from neuronal dynamics. We compare the dynamical properties of EEG signals of healthy subjects with epileptic subjects using nonlinear time series analysis techniques. Chaotic invariants like correlation dimension (D2) , largest Lyapunov exponent (lambda1), Hurst exponent (H) and Kolmogorov entropy (K) are used to characterize the signal. Our study showed clear differences in dynamical properties of brain electrical activity of the normal and epileptic subjects with a confidence level of more than 90%. Furthermore to support this claim fractal dimension (FD) analysis is performed. The results indicate reduction in value of FD for epileptic EEG indicating reduction in system complexity.

  5. Cerebral perfusion alterations in epileptic patients during peri-ictal and post-ictal phase: PASL vs DSC-MRI.

    PubMed

    Pizzini, Francesca B; Farace, Paolo; Manganotti, Paolo; Zoccatelli, Giada; Bongiovanni, Luigi G; Golay, Xavier; Beltramello, Alberto; Osculati, Antonio; Bertini, Giuseppe; Fabene, Paolo F

    2013-07-01

    Non-invasive pulsed arterial spin labeling (PASL) MRI is a method to study brain perfusion that does not require the administration of a contrast agent, which makes it a valuable diagnostic tool as it reduces cost and side effects. The purpose of the present study was to establish the viability of PASL as an alternative to dynamic susceptibility contrast (DSC-MRI) and other perfusion imaging methods in characterizing changes in perfusion patterns caused by seizures in epileptic patients. We evaluated 19 patients with PASL. Of these, the 9 affected by high-frequency seizures were observed during the peri-ictal period (within 5hours since the last seizure), while the 10 patients affected by low-frequency seizures were observed in the post-ictal period. For comparison, 17/19 patients were also evaluated with DSC-MRI and CBF/CBV. PASL imaging showed focal vascular changes, which allowed the classification of patients in three categories: 8 patients characterized by increased perfusion, 4 patients with normal perfusion and 7 patients with decreased perfusion. PASL perfusion imaging findings were comparable to those obtained by DSC-MRI. Since PASL is a) sensitive to vascular alterations induced by epileptic seizures, b) comparable to DSC-MRI for detecting perfusion asymmetries, c) potentially capable of detecting time-related perfusion changes, it can be recommended for repeated evaluations, to identify the epileptic focus, and in follow-up and/or therapy-response assessment.

  6. Dynamic Network Drivers of Seizure Generation, Propagation and Termination in Human Neocortical Epilepsy

    PubMed Central

    Khambhati, Ankit N.; Davis, Kathryn A.; Oommen, Brian S.; Chen, Stephanie H.; Lucas, Timothy H.; Litt, Brian; Bassett, Danielle S.

    2015-01-01

    The epileptic network is characterized by pathologic, seizure-generating ‘foci’ embedded in a web of structural and functional connections. Clinically, seizure foci are considered optimal targets for surgery. However, poor surgical outcome suggests a complex relationship between foci and the surrounding network that drives seizure dynamics. We developed a novel technique to objectively track seizure states from dynamic functional networks constructed from intracranial recordings. Each dynamical state captures unique patterns of network connections that indicate synchronized and desynchronized hubs of neural populations. Our approach suggests that seizures are generated when synchronous relationships near foci work in tandem with rapidly changing desynchronous relationships from the surrounding epileptic network. As seizures progress, topographical and geometrical changes in network connectivity strengthen and tighten synchronous connectivity near foci—a mechanism that may aid seizure termination. Collectively, our observations implicate distributed cortical structures in seizure generation, propagation and termination, and may have practical significance in determining which circuits to modulate with implantable devices. PMID:26680762

  7. Optimal control based seizure abatement using patient derived connectivity

    PubMed Central

    Taylor, Peter N.; Thomas, Jijju; Sinha, Nishant; Dauwels, Justin; Kaiser, Marcus; Thesen, Thomas; Ruths, Justin

    2015-01-01

    Epilepsy is a neurological disorder in which patients have recurrent seizures. Seizures occur in conjunction with abnormal electrical brain activity which can be recorded by the electroencephalogram (EEG). Often, this abnormal brain activity consists of high amplitude regular spike-wave oscillations as opposed to low amplitude irregular oscillations in the non-seizure state. Active brain stimulation has been proposed as a method to terminate seizures prematurely, however, a general and widely-applicable approach to optimal stimulation protocols is still lacking. In this study we use a computational model of epileptic spike-wave dynamics to evaluate the effectiveness of a pseudospectral method to simulated seizure abatement. We incorporate brain connectivity derived from magnetic resonance imaging of a subject with idiopathic generalized epilepsy. We find that the pseudospectral method can successfully generate time-varying stimuli that abate simulated seizures, even when including heterogeneous patient specific brain connectivity. The strength of the stimulus required varies in different brain areas. Our results suggest that seizure abatement, modeled as an optimal control problem and solved with the pseudospectral method, offers an attractive approach to treatment for in vivo stimulation techniques. Further, if optimal brain stimulation protocols are to be experimentally successful, then the heterogeneity of cortical connectivity should be accounted for in the development of those protocols and thus more spatially localized solutions may be preferable. PMID:26089775

  8. Antioxidants as a Preventive Treatment for Epileptic Process: A Review of the Current Status

    PubMed Central

    Martinc, Boštjan; Grabnar, Iztok; Vovk, Tomaž

    2014-01-01

    Epilepsy is known as one of the most frequent neurological diseases, characterized by an enduring predisposition to generate epileptic seizures. Oxidative stress is believed to directly participate in pathways leading to neurodegeneration, which serves as the most important propagating factor, leading to the epileptic condition and cognitive decline. Moreover, there is also a growing body of evidence showing the disturbance of antioxidant system balance and consequently increased production of reactive species in patients with epilepsy. A meta-analysis, conducted in the present review confirms an association between epilepsy and increased lipid peroxidation. Furthermore, it was also shown that some of the antiepileptic drugs could potentially be responsible for additionally increased lipid peroxidation. Therefore, it is reasonable to propose that during the epileptic process neuroprotective treatment with antioxidants could lead to less sever structural damages, reduced epileptogenesis and milder cognitive deterioration. To evaluate this hypothesis studies investigating the neuroprotective therapeutic potential of various antioxidants in cells, animal seizure models and patients with epilepsy have been reviewed. Numerous beneficial effects of antioxidants on oxidative stress markers and in some cases also neuroprotective effects were observed in animal seizure models. However, despite these encouraging results, till now only a few antioxidants have been further applied to patients with epilepsy as an add-on therapy. Based on the several positive findings in animal models, a strong need for more carefully planned, randomized, double-blind, cross-over, placebo-controlled clinical trials for the evaluation of antioxidants efficacy in patients with epilepsy is warranted. PMID:25977679

  9. Stimulus-induced Epileptic Spike-Wave Discharges in Thalamocortical Model with Disinhibition

    PubMed Central

    Fan, Denggui; Liu, Suyu; Wang, Qingyun

    2016-01-01

    Epileptic absence seizure characterized by the typical 2–4 Hz spike-wave discharges (SWD) are known to arise due to the physiologically abnormal interactions within the thalamocortical network. By introducing a second inhibitory neuronal population in the cortical system, here we propose a modified thalamocortical field model to mathematically describe the occurrences and transitions of SWD under the mutual functions between cortex and thalamus, as well as the disinhibitory modulations of SWD mediated by the two different inhibitory interneuronal populations. We first show that stimulation can induce the recurrent seizures of SWD in the modified model. Also, we demonstrate the existence of various types of firing states including the SWD. Moreover, we can identify the bistable parametric regions where the SWD can be both induced and terminated by stimulation perturbations applied in the background resting state. Interestingly, in the absence of stimulation disinhibitory functions between the two different interneuronal populations can also both initiate and abate the SWD, which suggests that the mechanism of disinhibition is comparable to the effect of stimulation in initiating and terminating the epileptic SWD. Hopefully, the obtained results can provide theoretical evidences in exploring dynamical mechanism of epileptic seizures. PMID:27876879

  10. Cell death and synaptic reorganizations produced by seizures.

    PubMed

    Ben-Ari, Y

    2001-01-01

    The events that follow epilepsy seizures are not restricted to the immediate period. A series of long-term alterations occurs, including synaptic rearrangements, which have an impact on the brain circuit's mode of operation. With models of temporal lobe epilepsy, seizures have been shown to generate long-lasting changes in synaptic efficacy (epileptic long-term potentiation) because of removal of the magnesium block, activation of N-methyl-D-aspartate receptors, and an increase in intracellular calcium. This novel form of synaptic plasticity provides a link between memory effects and pathologic processes. Additionally, high-affinity kainate autoradiography, Timm stain, intraventricular injection of kainic acid, and 3D reconstruction experiments clearly indicate that even brief seizures produce changes in synaptic efficacy, followed 2-3 weeks later by aberrant neosynapse formation. Several key steps have been identified in the cascade leading from transient hyperactivity episodes to long-lasting, quasi-permanent modification of the neuronal circuit organization. These include the activation of immediate-early genes, activation of growth factor genes within hours, alterations in glutamate receptors, glial hypertrophy, and cytoskeletal protein changes. The cascade is activated by the increase in intracellular calcium and leads to axonal growth and neosynapse formation, which in turn participates in the etiology of the syndrome by reducing the threshold for further seizures. In summary, study data imply that the mature epileptic circuit has unique features in comparison with those present before a seizure episode, including new receptors, ionic channels, and other proteins. It is therefore essential to develop novel strategies based on the unique mode of operation of the mature epileptic circuit, rather than on acute models of epilepsy.

  11. Physics of the Brain: Interaction of the Optical-Fiber-Guided Multi-Ultraviolet-Photon Beams with the Epilepsy Topion, (the Seizure Onset Area)

    NASA Astrophysics Data System (ADS)

    Stefan, V. Alexander

    A novel method for the possible prevention of epileptic seizures is proposed, based on the multi-ultraviolet-photon beam interaction with the epilepsy topion, (nonlinear coupling of an ultra high frequency mode to the brain beta phonons). It is hypothesized that epilepsy is a chaotic-dynamics phenomenon: small electrical changes in the epilepsy-topion lead, (within the 10s of milliseconds), to the onset of chaos, (seizure--excessive electrical discharge), and subsequent cascading into adjacent areas. The ultraviolet photons may control the imbalance of sodium and potassium ions and, consequently, may prove to be efficient in the prevention of epileptic seizures. Supported by Nikola Tesla Labs, Stefan University.

  12. Using Lorenz plot and Cardiac Sympathetic Index of heart rate variability for detecting seizures for patients with epilepsy.

    PubMed

    Jeppesen, Jesper; Beniczky, Sandor; Johansen, Peter; Sidenius, Per; Fuglsang-Frederiksen, Anders

    2014-01-01

    Tachycardia is often seen during epileptic seizures, but it also occurs during physical exercise. In order to assess whether focal epileptic seizures can be detected by short term moving window Heart Rate Variability (HRV) analysis, we modified the geometric HRV method, Lorenz plot, to consist of only 30, 50 or 100 R-R intervals per analyzed window. From each window we calculated the longitudinal (L) and transverse (T) variability of Lorenz plot to retrieve the Cardiac Sympathetic Index (CSI) as (L/T) and "Modified CSI" (described in methods), and compared the maximum during the patient's epileptic seizures with that during the patient's own exercise and non-seizure sessions as control. All five analyzed patients had complex partial seizures (CPS) originating in the temporal lobe (11 seizures) during their 1-5 days long term video-EEG monitoring. All CPS with electroencephalographic correlation were selected for the HRV analysis. The CSI and Modified CSI were correspondently calculated after each heart beat depicting the prior 30, 50 and 100 R-R intervals at the time. CSI (30, 50 and 100) and Modified CSI (100) showed a higher maximum peak during seizures than exercise/non-seizure (121-296%) for 4 of the 5 patients within 4 seconds before till 60 seconds after seizure onset time even though exercise maximum HR exceeded that of the seizures. The results indicate a detectable, sudden and inordinate shift towards sympathetic overdrive in the sympathovagal balance of the autonomic nervous system just around seizure-onset for certain patients. This new modified moving window Lorenz plot method seems promising way of constructing a portable ECG-based epilepsy alarm for certain patients with epilepsy who needs aid during seizure.

  13. Multimodality localization of epileptic foci

    NASA Astrophysics Data System (ADS)

    Desco, Manuel; Pascau, Javier; Pozo, M. A.; Santos, Andres; Reig, Santiago; Gispert, Juan D.; Garcia-Barreno, Pedro

    2001-05-01

    This paper presents a multimodality approach for the localization of epileptic foci using PET, MRI and EEG combined without the need of external markers. Mutual Information algorithm is used for MRI-PET registration. Dipole coordinates (provided by BESA software) are projected onto the MRI using a specifically developed algorithm. The four anatomical references used for electrode positioning (nasion, inion and two preauricular points) are located on the MRI using a triplanar viewer combined with a surface-rendering tool. Geometric transformation using deformation of the ideal sphere used for dipole calculations is then applied to match the patient's brain size and shape. Eight treatment-refractory epileptic patients have been studied. The combination of the anatomical information from the MRI, hipoperfusion areas in PET and dipole position and orientation helped the physician in the diagnosis of epileptic focus location. Neurosurgery was not indicated for patients where PET and dipole results were inconsistent; in two cases it was clinically indicated despite the mismatch, showing a negative follow up. The multimodality approach presented does not require external markers for dipole projection onto the MRI, this being the main difference with previous methods. The proposed method may play an important role in the indication of surgery for treatment- refractory epileptic patients.

  14. Dental problems in epileptic patients.

    PubMed

    Zioło, Anna; Mielnik-Błaszczak, Maria

    2004-01-01

    On the grounds of literature and own clinical experience, pathological changes in epilepitic patients have been described. Dental management procedures in these patients have also been presented. The unquestionable importance of prophylaxis, which may markedly minimize the impact of epilepsy on the incidence of mouth diseases, has been emphasised. It has also been stated that epileptic patients should receive specialised and integrated dental treatment.

  15. Grand Mal Seizure

    MedlinePlus

    ... generalized tonic-clonic seizure — features a loss of consciousness and violent muscle contractions. It's the type of ... seizures have two stages: Tonic phase. Loss of consciousness occurs, and the muscles suddenly contract and cause ...

  16. Molecular Correlates of Age-Dependent Seizures in an Inherited Neonatal-Infantile Epilepsy

    ERIC Educational Resources Information Center

    Liao, Yunxiang; Deprez, Liesbet; Maljevic, Snezana; Pitsch, Julika; Claes, Lieve; Hristova, Dimitrina; Jordanova, Albena; Ala-Mello, Sirpa; Bellan-Koch, Astrid; Blazevic, Dragica; Schubert, Simone; Thomas, Evan A.; Petrou, Steven; Becker, Albert J.; De Jonghe, Peter; Lerche, Holger

    2010-01-01

    Many idiopathic epilepsy syndromes have a characteristic age dependence, the underlying molecular mechanisms of which are largely unknown. Here we propose a mechanism that can explain that epileptic spells in benign familial neonatal-infantile seizures occur almost exclusively during the first days to months of life. Benign familial…

  17. A KCNQ channel opener for experimental neonatal seizures and status epilepticus

    PubMed Central

    Raol, YogendraSinh H.; Lapides, David A.; Keating, Jeffery; Brooks-Kayal, Amy R.; Cooper, Edward C.

    2009-01-01

    Objective Neonatal seizures occur frequently, are often refractory to anticonvulsants, and are associated with considerable morbidity and mortality. Genetic and electrophysiological evidence indicates that KCNQ voltage-gated potassium channels are critical regulators of neonatal brain excitability. This study tests the hypothesis that selective openers of KCNQ channels may be effective for treatment of neonatal seizures. Methods We induced seizures in postnatal day 10 rats with either kainic acid or flurothyl. We measured seizure activity using quantified behavioral rating and electrocorticography. We compared the efficacy of flupirtine, a selective KCNQ channel opener, with phenobarbital and diazepam, two drugs in current use for neonatal seizures. Results Unlike phenobarbital or diazepam, flupirtine prevented animals from developing status epilepticus (SE) when administered prior to kainate. In the flurothyl model, phenobarbital and diazepam increased latency to seizure onset, but flupirtine completely prevented seizures throughout the experiment. Flupirtine was also effective in arresting electrographic and behavioral seizures when administered after animals had developed continuous kainate-induced SE. Flupirtine caused dose-related sedation and suppressed EEG activity, but did not result in respiratory suppression or result in any mortality. Interpretation Flupirtine appears more effective than either of two commonly used anti-epileptic drugs, phenobarbital and diazepam, in preventing and suppressing seizures in both the kainic acid and flurothyl models of symptomatic neonatal seizures. KCNQ channel openers merit further study as potential treatments for seizures in infants and children. PMID:19334075

  18. Dreaming of seizures.

    PubMed

    Vercueil, Laurent

    2005-08-01

    Could some dreams and temporal lobe seizures share an intrinsic neuronal network? At the interplay of emotion, memory, dream, and temporal lobe seizure, we report on a patient with a left dysplastic amygdala and temporal lobe epilepsy who presented with a typical seizure while dreaming. Neuronal networks subserving affective states are suggested to be involved in emotional dream, memory recall, and amygdalo-hippocampal seizures.

  19. Impaired peri-nidal cerebrovascular reserve in seizure patients with brain arteriovenous malformations.

    PubMed

    Fierstra, Jorn; Conklin, John; Krings, Timo; Slessarev, Marat; Han, Jay S; Fisher, Joseph A; Terbrugge, Karel; Wallace, M Christopher; Tymianski, Michael; Mikulis, David J

    2011-01-01

    Epileptic seizures are a common presentation in patients with newly diagnosed brain arteriovenous malformations, but the pathophysiological mechanisms causing the seizures remain poorly understood. We used magnetic resonance imaging-based quantitative cerebrovascular reactivity mapping and conventional angiography to determine whether seizure-prone patients with brain arteriovenous malformations exhibit impaired cerebrovascular reserve or morphological angiographic features predictive of seizures. Twenty consecutive patients with untreated brain arteriovenous malformations were recruited (10 with and 10 without epileptic seizures) along with 12 age-matched healthy controls. Blood oxygen level-dependent MRI was performed while applying iso-oxic step changes in end-tidal partial pressure of CO(2) to obtain quantitative cerebrovascular reactivity measurements. The brain arteriovenous malformation morphology was evaluated by angiography, to determine to what extent limitations of arterial blood supply or the presence of restricted venous outflow and tissue congestion correlated with seizure susceptibility. Only patients with seizures exhibited impaired peri-nidal cerebrovascular reactivity by magnetic resonance imaging (0.11 ± 0.10 versus 0.25 ± 0.07, respectively; P < 0.001) and venous drainage patterns suggestive of tissue congestion on angiography. However, cerebrovascular reactivity changes were not of a magnitude suggestive of arterial steal, and were probably compatible with venous congestion in aetiology. Our findings demonstrate a strong association between impaired peri-nidal cerebrovascular reserve and epileptic seizure presentation in patients with brain arteriovenous malformation. The impaired cerebrovascular reserve may be associated with venous congestion. Quantitative measurements of cerebrovascular reactivity using blood oxygen level-dependent MRI appear to correlate with seizure susceptibility in patients with brain arteriovenous malformation.

  20. [Dissociative seizures: a manual for neurologists for communicating the diagnosis].

    PubMed

    Fritzsche, K; Baumann, K; Schulze-Bonhage, A

    2013-01-01

    The great physical resemblance between epileptic and dissociative seizures and a diagnosis of epilepsy that had been made years ago and usually had been treated unsuccessfully makes it difficult for both physician and patient to communicate the diagnosis of dissociative seizures. A direct referral to psychotherapy treatment is rarely accepted by patients. Intermediate steps, which are based on cooperation between neurologists and psychotherapists, are necessary. The approach that we use to communicate diagnosis and motivation for psychotherapeutic treatment includes eight steps: 1. Welcome and introduction; 2. Jointly watching a video of documented seizures; 3. The message that the seizures are not of epileptic origin, 4. Development of an alternative disease concept; 5. Motivation for a conversation with a representative from psychosomatics; 6. Responding to the fear of "going crazy"; 7. If necessary, briefly touching on the subject of sexual violence; 8. More recommendations and conclusion of the conversation. The manual was discussed and practiced with the attending neurologist in two sessions and is now being regularly used by two neurologists with concomitant supervision.

  1. Hypocalcemic generalised seizures as a manifestation of iatrogenic hypoparathyroidism months to years after thyroid surgery.

    PubMed

    Mrowka, Matthias; Knake, Susanne; Klinge, Harald; Odin, Per; Rosenow, Felix

    2004-06-01

    Hypoparathyroidism is a relatively common side effect of a thyroidectomy and leads to hypocalcemia. Carpopedal spasm and tetany are typical manifestations and usually occur within weeks after surgery. The first signs can be less typical and include movement disorders such as chorea, as well as symptoms of increased intracranial pressure or epileptic seizures. We describe two cases with generalised tonic-clonic seizures as the first manifestation of postoperative hypoparathyroidism, appearing months and years after thyroidectomy. Iatrogenic hypoparathyroidism needs to be considered in the differential diagnosis of adult-onset, generalised, tonic-clonic seizures even if the thyroidectomy was performed years earlier.

  2. Quinolones potentiate cefazolin-induced seizures in DBA/2 mice.

    PubMed Central

    De Sarro, A; Zappalá, M; Chimirri, A; Grasso, S; De Sarro, G B

    1993-01-01

    The behavioral and convulsant effects of cefazolin, a beta-lactam derivative, were studied after intraperitoneal administration to DBA/2 mice, a strain genetically susceptible to sound-induced seizures, and Swiss mice. DBA/2 mice were more susceptible to seizures induced by cefazolin than were Swiss mice. The proconvulsant effects of some quinolones on seizures evoked by intraperitoneal administration of cefazolin were also evaluated in DBA/2 mice. Our study also demonstrated that the order of proconvulsant activity in our epileptic model was pefloxacin > enoxacin > ofloxacin > rufloxacin > norfloxacin > cinoxacin > ciprofloxacin > nalidixic acid. The relationships between the chemical structures and proconvulsant activities of quinolone derivatives were studied. The relationship between lipophilicity and proconvulsant activity was also investigated. PMID:8395790

  3. Clonic Seizures in GAERS Rats after Oral Administration of Enrofloxacin

    PubMed Central

    Bauquier, Sebastien H; Jiang, Jonathan L; Lai, Alan; Cook, Mark J

    2016-01-01

    The aim of this study was to evaluate the effect of oral enrofloxacin on the epileptic status of Genetic Absence Epilepsy Rats from Strasbourg (GAERS). Five adult female GAERS rats, with implanted extradural electrodes for EEG monitoring, were declared free of clonic seizures after an 8-wk observation period. Enrofloxacin was then added to their drinking water (42.5 mg in 750 mL), and rats were observed for another 3 days. The number of spike-and-wave discharges and mean duration of a single discharge did not differ before and after treatment, but 2 of the 5 rats developed clonic seizures after treatment. Enrofloxacin should be used with caution in GAERS rats because it might induce clonic seizures. PMID:27298247

  4. Weighted and directed interactions in evolving large-scale epileptic brain networks.

    PubMed

    Dickten, Henning; Porz, Stephan; Elger, Christian E; Lehnertz, Klaus

    2016-10-06

    Epilepsy can be regarded as a network phenomenon with functionally and/or structurally aberrant connections in the brain. Over the past years, concepts and methods from network theory substantially contributed to improve the characterization of structure and function of these epileptic networks and thus to advance understanding of the dynamical disease epilepsy. We extend this promising line of research and assess-with high spatial and temporal resolution and using complementary analysis approaches that capture different characteristics of the complex dynamics-both strength and direction of interactions in evolving large-scale epileptic brain networks of 35 patients that suffered from drug-resistant focal seizures with different anatomical onset locations. Despite this heterogeneity, we find that even during the seizure-free interval the seizure onset zone is a brain region that, when averaged over time, exerts strongest directed influences over other brain regions being part of a large-scale network. This crucial role, however, manifested by averaging on the population-sample level only - in more than one third of patients, strongest directed interactions can be observed between brain regions far off the seizure onset zone. This may guide new developments for individualized diagnosis, treatment and control.

  5. Weighted and directed interactions in evolving large-scale epileptic brain networks

    NASA Astrophysics Data System (ADS)

    Dickten, Henning; Porz, Stephan; Elger, Christian E.; Lehnertz, Klaus

    2016-10-01

    Epilepsy can be regarded as a network phenomenon with functionally and/or structurally aberrant connections in the brain. Over the past years, concepts and methods from network theory substantially contributed to improve the characterization of structure and function of these epileptic networks and thus to advance understanding of the dynamical disease epilepsy. We extend this promising line of research and assess—with high spatial and temporal resolution and using complementary analysis approaches that capture different characteristics of the complex dynamics—both strength and direction of interactions in evolving large-scale epileptic brain networks of 35 patients that suffered from drug-resistant focal seizures with different anatomical onset locations. Despite this heterogeneity, we find that even during the seizure-free interval the seizure onset zone is a brain region that, when averaged over time, exerts strongest directed influences over other brain regions being part of a large-scale network. This crucial role, however, manifested by averaging on the population-sample level only – in more than one third of patients, strongest directed interactions can be observed between brain regions far off the seizure onset zone. This may guide new developments for individualized diagnosis, treatment and control.

  6. Weighted and directed interactions in evolving large-scale epileptic brain networks

    PubMed Central

    Dickten, Henning; Porz, Stephan; Elger, Christian E.; Lehnertz, Klaus

    2016-01-01

    Epilepsy can be regarded as a network phenomenon with functionally and/or structurally aberrant connections in the brain. Over the past years, concepts and methods from network theory substantially contributed to improve the characterization of structure and function of these epileptic networks and thus to advance understanding of the dynamical disease epilepsy. We extend this promising line of research and assess—with high spatial and temporal resolution and using complementary analysis approaches that capture different characteristics of the complex dynamics—both strength and direction of interactions in evolving large-scale epileptic brain networks of 35 patients that suffered from drug-resistant focal seizures with different anatomical onset locations. Despite this heterogeneity, we find that even during the seizure-free interval the seizure onset zone is a brain region that, when averaged over time, exerts strongest directed influences over other brain regions being part of a large-scale network. This crucial role, however, manifested by averaging on the population-sample level only – in more than one third of patients, strongest directed interactions can be observed between brain regions far off the seizure onset zone. This may guide new developments for individualized diagnosis, treatment and control. PMID:27708381

  7. The dynamics of the epileptic brain reveal long-memory processes.

    PubMed

    Cook, Mark J; Varsavsky, Andrea; Himes, David; Leyde, Kent; Berkovic, Samuel Frank; O'Brien, Terence; Mareels, Iven

    2014-01-01

    The pattern of epileptic seizures is often considered unpredictable and the interval between events without correlation. A number of studies have examined the possibility that seizure activity respects a power-law relationship, both in terms of event magnitude and inter-event intervals. Such relationships are found in a variety of natural and man-made systems, such as earthquakes or Internet traffic, and describe the relationship between the magnitude of an event and the number of events. We postulated that human inter-seizure intervals would follow a power-law relationship, and furthermore that evidence for the existence of a long-memory process could be established in this relationship. We performed a post hoc analysis, studying eight patients who had long-term (up to 2 years) ambulatory intracranial EEG data recorded as part of the assessment of a novel seizure prediction device. We demonstrated that a power-law relationship could be established in these patients (β = - 1.5). In five out of the six subjects whose data were sufficiently stationary for analysis, we found evidence of long memory between epileptic events. This memory spans time scales from 30 min to 40 days. The estimated Hurst exponents range from 0.51 to 0.77 ± 0.01. This finding may provide evidence of phase-transitions underlying the dynamics of epilepsy.

  8. Preservation of perisomatic inhibitory input of granule cells in the epileptic human dentate gyrus.

    PubMed

    Wittner, L; Maglóczky, Z; Borhegyi, Z; Halász, P; Tóth, S; Eross, L; Szabó, Z; Freund, T F

    2001-01-01

    Temporal lobe epilepsy is known to be associated with hyperactivity that is likely to be generated or amplified in the hippocampal formation. The majority of granule cells, the principal cells of the dentate gyrus, are found to be resistant to damage in epilepsy, and may serve as generators of seizures if their inhibition is impaired. Therefore, the parvalbumin-containing subset of interneurons, known to provide the most powerful inhibitory input to granule cell somata and axon initial segments, were examined in human control and epileptic dentate gyrus. A strong reduction in the number of parvalbumin-containing cells was found in the epileptic samples especially in the hilar region, although in some patches of the granule cell layer parvalbumin-positive terminals that form vertical clusters characteristic of axo-axonic cells were more numerous than in controls. Analysis of the postsynaptic target elements of parvalbumin-positive axon terminals showed that they form symmetric synapses with somata, dendrites, axon initial segments and spines as in the control, but the ratio of axon initial segment synapses was increased in the epileptic tissue (control: 15.9%, epileptic: 31.3%). Furthermore, the synaptic coverage of granule cell axon initial segments increased more than three times (control: 0.52, epileptic: 2.10 microm synaptic length/100 microm axon initial segment membrane) in the epileptic samples, whereas the amount of somatic symmetric synapses did not change significantly. Although the number of parvalbumin-positive interneurons is decreased, the perisomatic inhibitory input of dentate granule cells is preserved in temporal lobe epilepsy. Basket and axo-axonic cell terminals - whether positive or negative for parvalbumin - are present, moreover, the axon collaterals targeting axon initial segments sprout in the epileptic dentate gyrus. We suggest that perisomatic inhibitory interneurons survive in epilepsy, but their somadendritic compartment and partly the

  9. Epilepsy, Seizures, and Inflammation: Role of the C-C Motif Ligand 2 Chemokine.

    PubMed

    Bozzi, Yuri; Caleo, Matteo

    2016-06-01

    Epilepsy is a chronic disorder characterized by spontaneous recurrent seizures. Several lines of evidence demonstrate that inflammatory processes within the brain parenchyma contribute to recurrence and precipitation of seizures. In both epileptic patients and animal models, seizures upregulate inflammatory mediators, which in turn may enhance brain excitability. We recently showed that the C-C motif ligand 2 (CCL2) chemokine (also known as monocyte chemoattractant protein-1 [MCP-1]) mediates the seizure-promoting effects of inflammation. Systemic inflammatory challenge in chronically epileptic mice markedly enhanced seizure frequency and upregulated CCL2 expression in the brain. Selective pharmacological blockade of CCL2 synthesis or C-C chemokine receptor type 2 (CCR2) significantly suppressed inflammation-induced seizures. These results have important implications for the development of novel anticonvulsant therapies: drugs interfering with CCL2 signaling are used clinically for several human disorders and might be redirected for use in pharmacoresistant epilepsy. Here we review the role of CCL2/CCR2 signaling in linking systemic inflammation with seizure susceptibility and discuss some open questions that arise from our recent studies.

  10. Modeling and analyzing non-seizure EEG data for patients with epilepsy

    SciTech Connect

    Lawkins, W.F.; Clapp, N.E. Jr.; Daw, C.S.; Hively, L.M.; Protopopescu, V.; Eisenstadt, M.L.

    1996-05-01

    We present nonlinear analysis of non-seizure electroencephalogram (EEG) time series data from four epileptic patients. A non-seizure state is a period that is free of any part of an epileptic seizure, including the transition to a fully developed episode. EEG measurements are typically contaminated with a large amount of non- neurophysiological source information, generally called artifact, which arises, for example, from eye movement, muscle tension, and physical motion. The first objective of this study is to gain some insight into how much variability in analysis results to be expected from patients having similar clinical characteristics. The second objective is to investigate the impact of eye movement on the analysis results. A special feature presented here is the introduction and testing of a filter for eye movement artifact. The third objective is to determine if neurophysiological activity as viewed from two adjacent channels appears dynamically to be the same.

  11. Frequency evolution during tonic-clonic seizures.

    PubMed

    Quiroga, R Quian; Garcia, H; Rabinowicz, A

    2002-09-01

    By using the Short Time Fourier Transform, we analyzed the EEG frequency evolution during tonic-clonic seizures on 18 scalp recordings corresponding to 7 patients admitted for Video-EEG monitoring. This information was correlated with clinical findings observed in the video recordings. From the time-frequency plots, we recognized patterns related with brain activity even when embedded in a background of muscle artifacts. In 13/18 seizures we found a clear frequency dynamics characterized by an activity originally localized at about 8 Hz, later slowing down to about 1.5 Hz. In the remaining cases muscle artifacts hinder the disclosure of a clear frequency evolution. The clonic phases started when the main frequency slowed down to about 3 Hz. We conclude that the Short Time Fourier Transform is very useful for a quantitative analysis of epileptic seizures, especially when muscle artifacts contaminate the recordings. We further conclude that the clonic phase starts as a response to brain activity that can be only established when brain oscillations are slow enough to be followed by the muscles.

  12. [Cell signaling in the epileptic hippocampus].

    PubMed

    Ferrer, I

    Cell signaling commanding death or survival in human epileptic hippocampus is difficult to trace because of the long interval between the beginning of symptoms and the sampling of damaged cerebral tissue for neuropathological examination. Intraperitoneal injection of the glutamate analogue kainic acid (KA) is a useful tool to analyze the effects of seizures and the excitotoxic damage in the rodent hippocampus. KA acts on NMDA and KA receptors, whereas it has little impact on AMPA receptors. Neurons of the hilus and CA3 neurons are primary targets of KA, although parvalbumin containing GABAergic neurons are less vulnerable than glutamatergic neurons. Immediate responses to KA are hsp 70 mRNA induction and HSP 70/72 protein expression, as well as c fos and c jun mRNA, and c Fos and c Jun protein expression in the hippocampus. Yet increased c Fos and c Jun expression is not a predictor of cell death or cell survival. In contrast, the tissular plasminogen activator (tPA) and the membrane Fas/Fas L signaling pathway probably have a role in facilitating cell death following KA injection. The involvement of other pathways remains controversial. Increased expression of the pro apoptotic Bax together with decreased Bcl 2 suggests Bax mediated apoptosis. Activation of the mitochondrial pathway includes leakage of citochrome c to the cytosol and activation of the caspase cascade leading to apoptosis. However, other studies have emphasized the limited expression of caspase 3, the main executioner of apoptosis, and the relevance of necrosis as the main form of cell death following KA excitotoxicity. Phosphorylation dependent activation of several kinases, including MAPK, p 38 and JNK/SAPK, and their substrates has been found in KA treated animals. Decreased CREBp expression is associated with cell death whereas increased ATF 2P and Elk 1P are associated with cell survival. Trophic factors probably do not play a significant role during the early stages of hippocanmpal damage but

  13. Seizure Prediction: Science Fiction or Soon to Become Reality?

    PubMed

    Freestone, Dean R; Karoly, Philippa J; Peterson, Andre D H; Kuhlmann, Levin; Lai, Alan; Goodarzy, Farhad; Cook, Mark J

    2015-11-01

    This review highlights recent developments in the field of epileptic seizure prediction. We argue that seizure prediction is possible; however, most previous attempts have used data with an insufficient amount of information to solve the problem. The review discusses four methods for gaining more information above standard clinical electrophysiological recordings. We first discuss developments in obtaining long-term data that enables better characterisation of signal features and trends. Then, we discuss the usage of electrical stimulation to probe neural circuits to obtain robust information regarding excitability. Following this, we present a review of developments in high-resolution micro-electrode technologies that enable neuroimaging across spatial scales. Finally, we present recent results from data-driven model-based analyses, which enable imaging of seizure generating mechanisms from clinical electrophysiological measurements. It is foreseeable that the field of seizure prediction will shift focus to a more probabilistic forecasting approach leading to improvements in the quality of life for the millions of people who suffer uncontrolled seizures. However, a missing piece of the puzzle is devices to acquire long-term high-quality data. When this void is filled, seizure prediction will become a reality.

  14. A low computation cost method for seizure prediction.

    PubMed

    Zhang, Yanli; Zhou, Weidong; Yuan, Qi; Wu, Qi

    2014-10-01

    The dynamic changes of electroencephalograph (EEG) signals in the period prior to epileptic seizures play a major role in the seizure prediction. This paper proposes a low computation seizure prediction algorithm that combines a fractal dimension with a machine learning algorithm. The presented seizure prediction algorithm extracts the Higuchi fractal dimension (HFD) of EEG signals as features to classify the patient's preictal or interictal state with Bayesian linear discriminant analysis (BLDA) as a classifier. The outputs of BLDA are smoothed by a Kalman filter for reducing possible sporadic and isolated false alarms and then the final prediction results are produced using a thresholding procedure. The algorithm was evaluated on the intracranial EEG recordings of 21 patients in the Freiburg EEG database. For seizure occurrence period of 30 min and 50 min, our algorithm obtained an average sensitivity of 86.95% and 89.33%, an average false prediction rate of 0.20/h, and an average prediction time of 24.47 min and 39.39 min, respectively. The results confirm that the changes of HFD can serve as a precursor of ictal activities and be used for distinguishing between interictal and preictal epochs. Both HFD and BLDA classifier have a low computational complexity. All of these make the proposed algorithm suitable for real-time seizure prediction.

  15. Delayed effect of craniotomy on experimental seizures in rats.

    PubMed

    Forcelli, Patrick A; Kalikhman, David; Gale, Karen

    2013-01-01

    Neurosurgical therapeutic interventions include components that are presumed to be therapeutically inert, such as craniotomy and electrode implantation. Because these procedures may themselves exert neuroactive actions, with anecdotal evidence suggesting that craniotomy and electrode placement may have a particularly significant impact on epileptic seizures, the importance of their inclusion in sham control groups has become more compelling. Here we set out to test the hypothesis that craniotomy alone is sufficient to alter experimental seizures in rats. We tested adult male rats for seizures evoked by pentylenetetrazole (70 mg/kg) between 3 and 20 days following placement of bilateral craniotomies (either 2.5 or 3.5 mm in diameter) in the parietal bone of the skull, without penetrating the dura. Control (sham-operated) animals underwent anesthesia and surgery without craniotomy. We found that craniotomy significantly decreased the severity of experimental seizures on postoperative days 3, 6, and 10; this effect was dependent on the size of craniotomy. Animals with craniotomies returned to control seizure severity by 20 days post-craniotomy. These data support the hypothesis that damage to the skull is sufficient to cause a significant alteration in seizure susceptibility over an extended postoperative period, and indicate that this damage should not be considered neurologically inert.

  16. Effects of TRPV1 on the hippocampal synaptic plasticity in the epileptic rat brain.

    PubMed

    Saffarzadeh, Fatemeh; Eslamizade, Mohammad J; Ghadiri, Tahereh; Modarres Mousavi, Sayed Mostafa; Hadjighassem, Mahmoudreza; Gorji, Ali

    2015-07-01

    Temporal lobe epilepsy is often presented by medically intractable recurrent seizures due to dysfunction of temporal lobe structures, mostly the temporomesial structures. The role of transient receptor potential vaniloid 1 (TRPV1) activity on synaptic plasticity of the epileptic brain tissues was investigated. We studied hippocampal TRPV1 protein content and distribution in the hippocampus of epileptic rats. Furthermore, the effects of pharmacologic modulation of TRPV1 receptors on field excitatory postsynaptic potentials have been analyzed after induction of long term potentiation (LTP) in the hippocampal CA1 and CA3 areas after 1 day (acute phase) and 3 months (chronic phase) of pilocarpine-induced status epilepticus (SE). A higher expression of TRPV1 protein in the hippocampus as well as a higher distribution of this channel in CA1 and CA3 areas in both acute and chronic phases of pilocarpine-induced SE was observed. Activation of TRPV1 using capsaicin (1 µM) enhanced LTP induction in CA1 region in non-epileptic rats. Inhibition of TRPV1 by capsazepine (10 µM) did not affect LTP induction in non-epileptic rats. In acute phase of SE, activation of TRPV1 enhanced LTP in both CA1 and CA3 areas but TRPV1 inhibition did not affect LTP. In chronic phase of SE, application of TRPV1 antagonist enhanced LTP induction in CA1 and CA3 regions but TRPV1 activation had no effect on LTP. These findings indicate that a higher expression of TRPV1 in epileptic conditions is accompanied by a functional impact on the synaptic plasticity in the hippocampus. This suggests TRPV1 as a potential target in treatment of seizure attacks.

  17. Ordinal patterns in epileptic brains: Analysis of intracranial EEG and simultaneous EEG-fMRI

    NASA Astrophysics Data System (ADS)

    Rummel, C.; Abela, E.; Hauf, M.; Wiest, R.; Schindler, K.

    2013-06-01

    Epileptic seizures are associated with high behavioral stereotypy of the patients. In the EEG of epilepsy patients characteristic signal patterns can be found during and between seizures. Here we use ordinal patterns to analyze EEGs of epilepsy patients and quantify the degree of signal determinism. Besides relative signal redundancy and the fraction of forbidden patterns we introduce the fraction of under-represented patterns as a new measure. Using the logistic map, parameter scans are performed to explore the sensitivity of the measures to signal determinism. Thereafter, application is made to two types of EEGs recorded in two epilepsy patients. Intracranial EEG shows pronounced determinism peaks during seizures. Finally, we demonstrate that ordinal patterns may be useful for improving analysis of non-invasive simultaneous EEG-fMRI.

  18. Long-term home monitoring of hypermotor seizures by patient-worn accelerometers.

    PubMed

    Van de Vel, Anouk; Cuppens, Kris; Bonroy, Bert; Milosevic, Milica; Van Huffel, Sabine; Vanrumste, Bart; Lagae, Lieven; Ceulemans, Berten

    2013-01-01

    Long-term home monitoring of epileptic seizures is not feasible with the gold standard of video/electro-encephalography (EEG) monitoring. The authors developed a system and algorithm for nocturnal hypermotor seizure detection in pediatric patients based on an accelerometer (ACM) attached to extremities. Seizure detection is done using normal movement data, meaning that the system can be installed in a new patient's room immediately as prior knowledge on the patient's seizures is not needed for the patient-specific model. In this study, the authors compared video/EEG-based seizure detection with ACM data in seven patients and found a sensitivity of 95.71% and a positive predictive value of 57.84%. The authors focused on hypermotor seizures given the availability of this seizure type in the data, the typical occurrence of these seizures during sleep, i.e., when the measurements were done, and the importance of detection of hypermotor seizures given their often refractory nature and the possible serious consequences. To our knowledge, it is the first detection system focusing on this type of seizure in pediatric patients.

  19. Phenomenology of hallucinations, illusions, and delusions as part of seizure semiology.

    PubMed

    Kasper, B S; Kasper, E M; Pauli, E; Stefan, H

    2010-05-01

    In partial epilepsy, a localized hypersynchronous neuronal discharge evolving into a partial seizure affecting a particular cortical region or cerebral subsystem can give rise to subjective symptoms, which are perceived by the affected person only, that is, ictal hallucinations, illusions, or delusions. When forming the beginning of a symptom sequence leading to impairment of consciousness and/or a classic generalized seizure, these phenomena are referred to as an epileptic aura, but they also occur in isolation. They often manifest in the fully awake state, as part of simple partial seizures, but they also can be associated to different degrees of disturbed consciousness. Initial ictal symptoms often are closely related to the physiological functions of the cortical circuit involved and, therefore, can provide localizing information. When brain regions related to sensory integration are involved, the seizure discharge can cause specific kinds of hallucinations, for example, visual, auditory, gustatory, olfactory, and cutaneous sensory sensations. In addition to these elementary sensory perceptions, quite complex hallucinations related to a partial seizure can arise, for example, perception of visual scenes or hearing music. By involving psychic and emotional spheres of human perception, many seizures also give rise to hallucinatory emotional states (e.g., fear or happiness) or even more complex hallucinations (e.g., visuospatial phenomena), illusions (e.g., déjà vu, out-of-body experience), or delusional beliefs (e.g., identity change) that often are not easily recognized as epileptic. Here we suggest a classification into elementary sensory, complex sensory, and complex integratory seizure symptoms. Epileptic hallucinations, illusions, and delusions shine interesting light on the physiology and functional anatomy of brain regions involved and their functions in the human being. This article, in which 10 cases are described, introduces the fascinating

  20. Athletes with seizure disorders.

    PubMed

    Knowles, Byron Don; Pleacher, Michael D

    2012-01-01

    Individuals with seizure disorders have long been restricted from participation in certain sporting activities. Those with seizure disorders are more likely than their peers to have a sedentary lifestyle and to develop obesity. Regular participation in physical activity can improve both physical and psychosocial outcomes for persons with seizure disorders. Seizure activity often is reduced among those patients who regularly engage in aerobic activity. Recent literature indicates that the diagnosis of seizure disorders remains highly stigmatizing in the adolescent population. Persons with seizure disorders may be more accepted by peer groups if they are allowed to participate in sports and recreational activities. Persons with seizure disorders are encouraged to participate in regular aerobic activities. They may participate in team sports and contact or collision activities provided that they utilize appropriate protective equipment. There seems to be no increased risk of injury or increasing seizure activity as the result of such participation. Persons with seizure disorders still are discouraged from participating in scuba diving and skydiving. The benefits of participation in regular sporting activity far outweigh any risk to the athlete with a seizure disorder who chooses to participate in sports.

  1. Decreased GABA receptor in the cerebral cortex of epileptic rats: effect of Bacopa monnieri and Bacoside-A

    PubMed Central

    2012-01-01

    Abstact Background Gamma amino butyric acid (GABA), the principal inhibitory neurotransmitter in the cerebral cortex, maintains the inhibitory tones that counter balances neuronal excitation. When this balance is perturbed, seizures may ensue. Methods In the present study, alterations of the general GABA, GABAA and GABAB receptors in the cerebral cortex of the epileptic rat and the therapeutic application of Bacopa monnieri were investigated. Results Scatchard analysis of [3H]GABA, [3H]bicuculline and [3H]baclofen in the cerebral cortex of the epileptic rat showed significant decrease in Bmax (P < 0.001) compared to control. Real Time PCR amplification of GABA receptor subunits such as GABAAά1, GABAAγ, GABAAδ, GABAB and GAD where down regulated (P < 0.001) in epileptic rats. GABAAά5 subunit and Cyclic AMP responsible element binding protein were up regulated. Confocal imaging study confirmed the decreased GABA receptors in epileptic rats. Epileptic rats have deficit in radial arm and Y maze performance. Conclusions Bacopa monnieri and Bacoside-A treatment reverses epilepsy associated changes to near control suggesting that decreased GABA receptors in the cerebral cortex have an important role in epileptic occurrence; Bacopa monnieri and Bacoside-A have therapeutic application in epilepsy management. PMID:22364254

  2. Aspartic acid aminotransferase activity is increased in actively spiking compared with non-spiking human epileptic cortex.

    PubMed Central

    Kish, S J; Dixon, L M; Sherwin, A L

    1988-01-01

    Increased concentration of the excitatory neurotransmitter aspartic acid in actively spiking human epileptic cerebral cortex was recently described. In order to further characterise changes in the aspartergic system in epileptic brain, the behaviour of aspartic acid aminotransferase (AAT), a key enzyme involved in aspartic acid metabolism has now been examined. Electrocorticography performed during surgery was employed to identify cortical epileptic spike foci in 16 patients undergoing temporal lobectomy for intractable seizures. Patients with spontaneously spiking lateral temporal cortex (n = 8) were compared with a non-spiking control group (n = 8) of patients in whom the epileptic lesions were confined to the hippocampus sparing the temporal convexity. Mean activity of AAT in spiking cortex was significantly elevated by 16-18%, with aspartic acid concentration increased by 28%. Possible explanations for the enhanced AAT activity include increased proliferation of cortical AAT-containing astrocytes at the spiking focus and/or a generalised increase in neuronal or extraneuronal metabolism consequent to the ongoing epileptic discharge. It is suggested that the data provide additional support for a disturbance of central excitatory aspartic acid mechanisms in human epileptic brain. PMID:2898010

  3. Mozart's music in children with drug-refractory epileptic encephalopathies.

    PubMed

    Coppola, Giangennaro; Toro, Annacarmela; Operto, Francesca Felicia; Ferrarioli, Giuseppe; Pisano, Simone; Viggiano, Andrea; Verrotti, Alberto

    2015-09-01

    Mozart's sonata for two pianos in D major, K448, has been shown to decrease interictal EEG discharges and recurrence of clinical seizures in both adults and young patients. In this prospective, open-label study, we evaluated the effect of listening to a set of Mozart's compositions, according to the Tomatis method, on sleep quality and behavioral disorders, including auto-/hetero-aggression, irritability, and hyperactivity, in a group of children and adolescents with drug-resistant epilepsy. The study group was composed of 11 outpatients (7 males and 4 females), between 1.5years and 21years of age (mean age: 11.9years), all suffering from drug-resistant epileptic encephalopathy (n=11). All of them had a severe/profound intellectual disability associated with cerebral palsy. During the study period, each patient had to listen to a set of Mozart's compositions 2h per day for fifteen days for a total of 30h, which could be distributed over the day depending on the habits and compliance of each patient. The music was filtered by a device preferably delivering higher sound frequencies (>3000Hz) according to the Tomatis principles. The antiepileptic drug therapy remained unchanged throughout the study period. During the 15-day music therapy, 2 out of 11 patients had a reduction of 50-75% in seizure recurrence, and 3 out of 12 patients had a reduction of 75-89%. Overall, 5 (45.4%) out of 11 patients had a ≥50% reduction in the total number of seizures, while the percentage decrease of the total seizure number (11/11) compared with baseline was -51.5% during the 15-day music therapy and -20.7% in the two weeks after the end of treatment. All responders also had an improvement in nighttime sleep and daytime behavior.

  4. Amplitude suppression and chaos control in epileptic EEG signals.

    PubMed

    Majumdar, Kaushik; Myers, Mark H

    2006-03-01

    In this paper we have proposed a novel amplitude suppression algorithm for EEG signals collected during epileptic seizure. Then we have proposed a measure of chaoticity for a chaotic signal, which is somewhat similar to measuring sensitive dependence on initial conditions by measuring Lyapunov exponent in a chaotic dynamical system. We have shown that with respect to this measure the amplitude suppression algorithm reduces chaoticity in a chaotic signal (EEG signal is chaotic). We have compared our measure with the estimated largest Lyapunov exponent measure by the largelyap function, which is similar to Wolf's algorithm. They fit closely for all but one of the cases. How the algorithm can help to improve patient specific dosage titration during vagus nerve stimulation therapy has been outlined.

  5. Resolution of epileptic encephalopathy following treatment with transdermal nicotine.

    PubMed

    Zerem, Ayelet; Nishri, Daniella; Yosef, Yael; Blumkin, Lubuv; Lev, Dorit; Leshinsky-Silver, Esther; Kivity, Sara; Lerman-Sagie, Tally

    2013-01-01

    We report resolution of an epileptic encephalopathy by administration of transdermal nicotine patches in an adolescent with severe nonlesional refractory frontal lobe epilepsy. The 18.5-year-old female patient had refractory epilepsy from the age of 11. Recurrent electroencephalography (EEG) recordings showed mostly generalized activity, albeit with right frontal predominance. Almost all antiepileptic medications failed to provide benefit. She developed an encephalopathic state with cognitive decline. The nonlesional frontal lobe epilepsy and a family history of a cousin with nocturnal epilepsy with frontal origin suggested genetic etiology. Transdermal nicotine patches brought complete resolution of the seizures, normalization of the EEG, and a significant improvement in her thinking process and speech organization. Sequencing of the CHRNB2 and CHRNA4 genes did not detect a mutation. Transdermal nicotine patches should be considered in severe pharmacoresistant frontal lobe epilepsy.

  6. The causes of new-onset epilepsy and seizures in the elderly

    PubMed Central

    Liu, Shasha; Yu, Weihua; Lü, Yang

    2016-01-01

    With increasing age, the prevalence and incidence of epilepsy and seizures increases correspondingly. New-onset epilepsy in elderly people often has underlying etiology, including cerebrovascular diseases, primary neuron degenerative disorders, intracerebral tumors, and traumatic head injury. In addition, an acute symptomatic seizure cannot be called epilepsy, which manifests usually as a common symptom secondary to metabolic or toxicity factors in older people. In this review, we have mainly focused on the causes of new-onset epilepsy and seizures in elderly people. This knowledge will certainly help us to understand the reasons for high incidences of epilepsy and seizures in elderly people. We look forward to controlling epileptic seizures via the treatment of primary diseases in the future. PMID:27382285

  7. Role of mitochondrial fission in neuronal injury in pilocarpine-induced epileptic rats.

    PubMed

    Qiu, X; Cao, L; Yang, X; Zhao, X; Liu, X; Han, Y; Xue, Y; Jiang, H; Chi, Z

    2013-08-15

    Mitochondrial fission has been reported to be involved in oxidative stress, apoptosis and many neurological diseases. However, the role of mitochondrial fission in seizures, which could induce oxidative stress and neuronal loss, remains unknown. In this study, we used pilocarpine to elicit seizures in rats. Meanwhile, we used mitochondrial division inhibitor 1 (mdivi-1), a selective inhibitor of mitochondrial fission protein dynamin-related protein1 (Drp1), to suppress mitochondrial fission in epileptic model of rats in vivo. We found that mitochondrial fission was increased after seizures and the inhibition of mitochondrial fission by mdivi-1 significantly attenuated oxidative stress and reduced neuronal loss after seizures, shown by the decreased 8-hydroxy deoxyguanosine (8-oHdG) content, the increased superoxide dismutase (SOD) activity, the reduced expression of cytochrome c and caspase3 and the increased surviving neurons in the hippocampus. These results indicated that mitochondrial fission is up-regulated after seizures and the inhibition of mitochondrial fission is protective against neuronal injury in seizures, the underlying mechanism may be through the mitochondria/reactive oxygen species (ROS)/cytochrome c pathway.

  8. Perirhinal Cortex Hyperexcitability in Pilocarpine-Treated Epileptic Rats

    PubMed Central

    Benini, Ruba; Longo, Daniela; Biagini, Giuseppe; Avoli, Massimo

    2016-01-01

    The perirhinal cortex (PC), which is heavily connected with several epileptogenic regions of the limbic system such as the entorhinal cortex and amygdala, is involved in the generation and spread of seizures. However, the functional alterations occurring within an epileptic PC network are unknown. Here, we analyzed this issue by using in vitro electrophysiology and immunohistochemistry in brain tissue obtained from pilocarpine-treated epileptic rats and age-matched, nonepileptic controls (NECs). Neurons recorded intracellularly from the PC deep layers in the two experimental groups had similar intrinsic and firing properties and generated spontaneous depolarizing and hyperpolarizing postsynaptic potentials with comparable duration and amplitude. However, spontaneous and stimulus-induced epileptiform discharges were seen with field potential recordings in over one-fifth of pilocarpine-treated slices but never in NEC tissue. These network events were reduced in duration by antagonizing NMDA receptors and abolished by NMDA + non-NMDA glutamatergic receptor antagonists. Pharmacologically isolated isolated inhibitory postsynaptic potentials had reversal potentials for the early GABAA receptor-mediated component that were significantly more depolarized in pilocarpine-treated cells. Experiments with a potassium-chloride cotransporter 2 antibody identified, in pilocarpine-treated PC, a significant immunostaining decrease that could not be explained by neuronal loss. However, interneurons expressing parvalbumin and neuropeptide Y were found to be decreased throughout the PC, whereas cholecystokinin-positive cells were diminished in superficial layers. These findings demonstrate synaptic hyper-excitability that is contributed by attenuated inhibition in the PC of pilocarpine-treated epileptic rats and underscore the role of PC networks in temporal lobe epilepsy. PMID:20865722

  9. Ictal tachycardia: its discriminating potential between temporal and extratemporal seizure foci.

    PubMed

    Garcia, M; D'Giano, C; Estellés, S; Leiguarda, R; Rabinowicz, A

    2001-09-01

    A wide variety of CNS lesions have been associated with changes in heart rate (HR). However, in epileptic patients their value to lateralize seizure onset remains controversial. This study aims to assess if HR changes associated with partial onset seizures could be useful in lateralizing seizure onset. We analysed HR changes on 100 seizures from 38 consecutive patients (mean age: 27.5 years) admitted for video-EEG telemetry monitoring. We evaluated the R-R interval 30 seconds before the seizure onset and 10, 20 and 120 seconds after the onset. We assessed whether there was a correlation between HR changes and seizure type, left/right differences and different semiological components for each seizure. We recorded 100 seizures. Three non-lateralized seizures were excluded from the analysis; 63/97 (65%) had left hemisphere onset, mainly from the temporal lobe (57.7%). The mean baseline HR was 77 beats per minute Ictal tachycardia (HR: > or = 107.06 beats per minute) was detected in 32 seizures, with ictal onset from the mesial temporal lobe structures in 23/32; 16/32 occurred during the first 10 seconds and 16/32 during the next 20 seconds from the seizure onset independently of the site of origin. Among the different semiological components for each seizure, only dystonic posturing and automatism correlated with HR increments. We did not find bradycardia in our series. Ictal tachycardia occurs most frequently with seizures arising from the mesial temporal lobe and it may not reliably predict the lateralization of seizure onset.

  10. Transient epileptic amnesia: a concise review.

    PubMed

    Asadi-Pooya, Ali A

    2014-02-01

    Transient epileptic amnesia (TEA) is a distinctive syndrome and comprises episodic transient amnesia with an epileptic basis, without impairment of other aspects of cognitive function. Additional interictal memory deficits are common in TEA. An epileptic origin, after other etiologies have been excluded, should be considered and carefully investigated in patients complaining of isolated memory disturbances, particularly with recurrent short-lasting amnesic attacks. In all suspected cases of epilepsy, a detailed clinical history is of paramount importance, but ancillary tests including EEG and MRI could be very helpful. Transient epileptic amnesia is typically a benign and treatable condition. Future studies should investigate the exact mechanism(s) of this unique syndrome.

  11. An unusual recurrence of dysembroplastic neuroepithelial tumours after a seizure-free period of 8 years

    PubMed Central

    Khan, Nadeem Israr; Khanna, Laxmi; Renjen, Pushpendra Nath; Fernandes, Cecilia Succour

    2013-01-01

    Dysembryoplastic neuroepithelial tumours (DNETs) are grade 1 central nervous tumours, which can be diagnosed judiciously based on clinical features and radiological investigations, having a good prognosis after surgical resection. However, the recurrence of tumours due to variable epileptic zones leading to persistence of seizures can make the management of such cases challenging. We present a case of DNET where the patient had recurrence of the tumour with worsening of seizure activity 8 years after initial surgical resection. PMID:24014330

  12. A novel KCNT1 mutation in a Japanese patient with epilepsy of infancy with migrating focal seizures.

    PubMed

    Shimada, Shino; Hirano, Yoshiko; Ito, Susumu; Oguni, Hirokazu; Nagata, Satoru; Shimojima, Keiko; Yamamoto, Toshiyuki

    2014-01-01

    Epilepsy of infancy with migrating focal seizures (EIFMS) is a rare, early-onset epileptic encephalopathy characterized by polymorphous focal seizures. De novo mutations of KCNT1 have been identified in cases of this disorder. We encountered a sporadic patient with EIFMS, who suffered tonic convulsions at the age of 9 days. Using Sanger sequencing, we identified a de novo missense mutation of the same amino acid affected by a previously identified mutation, c.1420C>T (p.Arg474Cys).

  13. Wavelet transforms for electroencephalographic spike and seizure detection

    NASA Astrophysics Data System (ADS)

    Schiff, Steven J.; Milton, John G.

    1993-11-01

    The application of wavelet transforms (WT) to experimental data from the nervous system has been hindered by the lack of a straightforward method to handle noise. A noise reduction technique, developed recently for use in wavelet cluster analysis in cosmology and astronomy, is here adapted for electroencephalographic (EEG) time-series data. Noise is filtered using control surrogate data sets generated from randomized aspects of the original time-series. In this study, WT were applied to EEG data from human patients undergoing brain mapping with implanted subdural electrodes for the localization of epileptic seizure foci. EEG data in 1D were analyzed from individual electrodes, and 2D data from electrode grids. These techniques are a powerful means to identify epileptic spikes in such data, and offer a method to identity the onset and spatial extent of epileptic seizure foci. The method is readily applied to the detection of structure in stationary and non-stationary time-series from a variety of physical systems.

  14. Interictal EEG discoordination in a rat seizure model.

    PubMed

    Neymotin, Samuel A; Lee, Heekyung; Fenton, André A; Lytton, William W

    2010-12-01

    Cognitive and psychiatric comorbidities are common and clinically important in medial temporal lobe epilepsy and are likely caused by ongoing abnormalities in brain activity. In addition, it is unclear how the dynamics of interictal brain activity in medial temporal lobe epilepsy contributes to the generation of seizures. To investigate these issues, the authors evaluated multisite interictal EEG from a perinatal excitotoxic, hippocampal lesion rat model of medial temporal lobe epilepsy. Sample entropy, an information theoretical measure, demonstrated decreased complexity at different time scales and across all channels in epileptic animals. However, higher-order multiarea measures showed evidence of increased variability in population correlation measures. This apparent paradox was resolved by noting that although the EEG from epileptic animals was overall more stereotyped, there were frequent periods where two or more brain areas "broke off" from ongoing brain activity in epileptic animals, producing decorrelations between areas. These decorrelations were particularly apparent across the midline, suggesting impairments of interhemispheric coordination, a form of interhemispheric diaschisis. Both the observed alterations could contribute to a reduction in brain functionality: an overall reduction in complexity and a failure of interhemispheric brain coordination, suggesting a breakdown in communication between hemispheres. The authors speculate that any tendency of areas to lose communication or break away from coordinated brain activity might predispose to seizures in these areas.

  15. Epileptic Neuronal Networks: Methods of Identification and Clinical Relevance

    PubMed Central

    Stefan, Hermann; Lopes da Silva, Fernando H.

    2012-01-01

    The main objective of this paper is to examine evidence for the concept that epileptic activity should be envisaged in terms of functional connectivity and dynamics of neuronal networks. Basic concepts regarding structure and dynamics of neuronal networks are briefly described. Particular attention is given to approaches that are derived, or related, to the concept of causality, as formulated by Granger. Linear and non-linear methodologies aiming at characterizing the dynamics of neuronal networks applied to EEG/MEG and combined EEG/fMRI signals in epilepsy are critically reviewed. The relevance of functional dynamical analysis of neuronal networks with respect to clinical queries in focal cortical dysplasias, temporal lobe epilepsies, and “generalized” epilepsies is emphasized. In the light of the concepts of epileptic neuronal networks, and recent experimental findings, the dichotomic classification in focal and generalized epilepsy is re-evaluated. It is proposed that so-called “generalized epilepsies,” such as absence seizures, are actually fast spreading epilepsies, the onset of which can be tracked down to particular neuronal networks using appropriate network analysis. Finally new approaches to delineate epileptogenic networks are discussed. PMID:23532203

  16. Magnetoencephalography in pediatric neurology and in epileptic syndromes.

    PubMed

    Verrotti, Alberto; Pizzella, Vittorio; Trotta, Daniela; Madonna, Laura; Chiarelli, Francesco; Romani, Gian Luca

    2003-04-01

    In recent years, great advances in the knowledge of neuromagnetism have permitted the application of Superconducting Quantum Interference Devices to the pathophysiologic study of the human brain. In particular, in pediatric neurology, the integration of biomagnetism with magnetic resonance imaging and other techniques for medical imaging have allowed for precise neuromagnetic measurements of the human brain. The more frequently used technique is magnetoencephalography. Recent data have illustrated the usefulness of magnetoencephalography in mapping activity of sensory and motor areas and in studying the spatiotemporal pattern of brain activation specific to somatosensory function. Moreover, magnetoencephalography is an important tool to localize epileptic activity; magnetic source imaging superimposes magnetoencephalographic localizations on the magnetic resonance imaging and yields improved spatial resolution as compared with surface electroencephalography. The role of magnetoencephalography in evaluating patients with epilepsy continues to evolve; in fact, it seems to be very useful in the localization of the epileptogenic zone in patients with partial epilepsy. This application of magnetoencephalography is essential in the selection of epileptic children candidates to surgical treatment of seizures.

  17. Epileptic neuronal networks: methods of identification and clinical relevance.

    PubMed

    Stefan, Hermann; Lopes da Silva, Fernando H

    2013-01-01

    The main objective of this paper is to examine evidence for the concept that epileptic activity should be envisaged in terms of functional connectivity and dynamics of neuronal networks. Basic concepts regarding structure and dynamics of neuronal networks are briefly described. Particular attention is given to approaches that are derived, or related, to the concept of causality, as formulated by Granger. Linear and non-linear methodologies aiming at characterizing the dynamics of neuronal networks applied to EEG/MEG and combined EEG/fMRI signals in epilepsy are critically reviewed. The relevance of functional dynamical analysis of neuronal networks with respect to clinical queries in focal cortical dysplasias, temporal lobe epilepsies, and "generalized" epilepsies is emphasized. In the light of the concepts of epileptic neuronal networks, and recent experimental findings, the dichotomic classification in focal and generalized epilepsy is re-evaluated. It is proposed that so-called "generalized epilepsies," such as absence seizures, are actually fast spreading epilepsies, the onset of which can be tracked down to particular neuronal networks using appropriate network analysis. Finally new approaches to delineate epileptogenic networks are discussed.

  18. A novel seizure detection algorithm informed by hidden Markov model event states

    NASA Astrophysics Data System (ADS)

    Baldassano, Steven; Wulsin, Drausin; Ung, Hoameng; Blevins, Tyler; Brown, Mesha-Gay; Fox, Emily; Litt, Brian

    2016-06-01

    Objective. Recently the FDA approved the first responsive, closed-loop intracranial device to treat epilepsy. Because these devices must respond within seconds of seizure onset and not miss events, they are tuned to have high sensitivity, leading to frequent false positive stimulations and decreased battery life. In this work, we propose a more robust seizure detection model. Approach. We use a Bayesian nonparametric Markov switching process to parse intracranial EEG (iEEG) data into distinct dynamic event states. Each event state is then modeled as a multidimensional Gaussian distribution to allow for predictive state assignment. By detecting event states highly specific for seizure onset zones, the method can identify precise regions of iEEG data associated with the transition to seizure activity, reducing false positive detections associated with interictal bursts. The seizure detection algorithm was translated to a real-time application and validated in a small pilot study using 391 days of continuous iEEG data from two dogs with naturally occurring, multifocal epilepsy. A feature-based seizure detector modeled after the NeuroPace RNS System was developed as a control. Main results. Our novel seizure detection method demonstrated an improvement in false negative rate (0/55 seizures missed versus 2/55 seizures missed) as well as a significantly reduced false positive rate (0.0012 h versus 0.058 h-1). All seizures were detected an average of 12.1 ± 6.9 s before the onset of unequivocal epileptic activity (unequivocal epileptic onset (UEO)). Significance. This algorithm represents a computationally inexpensive, individualized, real-time detection method suitable for implantable antiepileptic devices that may considerably reduce false positive rate relative to current industry standards.

  19. Monitoring neonatal seizures.

    PubMed

    Boylan, Geraldine B; Stevenson, Nathan J; Vanhatalo, Sampsa

    2013-08-01

    Neonatal seizures are a neurological emergency and prompt treatment is required. Seizure burden in neonates can be very high, status epilepticus a frequent occurrence, and the majority of seizures do not have any clinical correlate. Detection of neonatal seizures is only possible with continuous electroencephalogram (EEG) monitoring. EEG interpretation requires special expertise that is not available in most neonatal intensive care units (NICUs). As a result, a simplified method of EEG recording incorporating an easy-to-interpret compressed trend of the EEG output (amplitude integrated EEG) from one of the EEG output from one or two channels has emerged as a popular way to monitor neurological function in the NICU. This is not without limitations; short duration and low amplitude seizures can be missed, artefacts are problematic and may mimic seizure-like activity and only a restricted area of the brain is monitored. Continuous multichannel EEG is the gold standard for detecting seizures and monitoring response to therapy but expert interpretation of the EEG output is generally not available. Some centres have set up remote access for neurophysiologists to the cot-side EEG, but reliable interpretation is wholly dependent on the 24 h availability of experts, an expensive solution. A more practical solution for the NICU without such expertise is an automated seizure detection system. This review outlines the current state of the art regarding cot-side monitoring of neonatal seizures in the NICU.

  20. Multichannel continuous electroencephalography-functional near-infrared spectroscopy recording of focal seizures and interictal epileptiform discharges in human epilepsy: a review

    PubMed Central

    Peng, Ke; Pouliot, Philippe; Lesage, Frédéric; Nguyen, Dang Khoa

    2016-01-01

    Abstract. Functional near-infrared spectroscopy (fNIRS) has emerged as a promising neuroimaging technique as it allows noninvasive and long-term monitoring of cortical hemodynamics. Recent work by our group and others has revealed the potential of fNIRS, combined with electroencephalography (EEG), in the context of human epilepsy. Hemodynamic brain responses attributed to epileptic events, such as seizures and interictal epileptiform discharges (IEDs), are routinely observed with a good degree of statistical significance and in concordance with clinical presentation. Recording done with over 100 channels allows sufficiently large coverage of the epileptic focus and other areas. Three types of seizures have been documented: frontal lobe seizures, temporal lobe seizures, and posterior seizures. Increased oxygenation was observed in the epileptic focus in most cases, while rapid but similar hemodynamic variations were identified in the contralateral homologous region. While investigating IEDs, it was shown that their hemodynamic effect is observable with fNIRS, that their response is associated with significant (inhibitive) nonlinearities, and that the sensitivity and specificity of fNIRS to localize the epileptic focus can be estimated in a sample of 40 patients. This paper first reviews recent EEG-fNIRS developments in epilepsy research and then describes applications to the study of focal seizures and IEDs. PMID:26958576

  1. Cognitive functions of epileptic patients on monotherapy with phenobarbitone and healthy controls.

    PubMed

    Bigarella, M M; Mäder, M J; Doro, M P; Gorz, A M; Marcourakis, T; Tsanaclis, L; Bittencourt, P R

    1991-06-01

    Quantitative measurements have indicated that heredity, cerebral damage, psycho-social aspects, ictal and inter-ictal phenomena and antiepileptic drugs may interfere in the cognitive dysfunction of epileptic patients. In the present study objective methods included immediate and late recall and recognition of pictures, Stroop test and auditory selection. Twenty patients with symptomatic localized epilepsy aged 17-52 years (27 +/- 10, mean +/- sd) were compared to age and socially matched healthy controls. Patients were on therapeutic serum concentrations (25 +/- 12 mu/ml) of phenobarbitone and had active epilepsy with 1.94 generalized tonic-clonic, 0.85 simple partial and 6.28 complex partial seizures monthly (means). Patients performed worse than controls in all 6 tests (p less than 0.05 to p less than 0.001), indicating a generalized cognitive deficit related to seizures and/or barbiturate therapy. We suggest further studies should be carried out in populations with uniform monotherapeutic regimens and epileptic syndromes in order to isolate factors related to the cognitive dysfunction of epileptic patients.

  2. Body Packing: From Seizures to Laparotomy

    PubMed Central

    Janczak, Joanna M.; Beutner, Ulrich; Hasler, Karin

    2015-01-01

    Body packing is a common method for illegal drug trafficking. Complications associated with body packing can be severe and even lead to rapid death. Thus, a timely diagnosis is warranted. As most body packers initially do not show any symptoms, making a correct diagnosis can be rather challenging. We describe a case of a 41-year-old male, who was admitted with an epileptic seizure and who turned out to be a cocaine intoxicated body packer. Due to neurological and cardiovascular deterioration an emergency surgery was performed. Four bags of cocaine could be removed. We discuss the current management regimen in symptomatic and asymptomatic body packers and highlight pearls and pitfalls with diagnosis and treatment. PMID:25883813

  3. Epilepsy and electromagnetic fields: effects of simulated atmospherics and 100-Hz magnetic fields on audiogenic seizure in rats

    NASA Astrophysics Data System (ADS)

    Juutilainen, J.; Björk, E.; Saali, K.

    1988-03-01

    In order to study the possible association between epileptic seizures and natural electromagnetic fields, 32 female audiogenic seizure (AGS)-susceptible rats were exposed to simulated 10 kHz and 28 kHz atmospherics and to a sinusoidally oscillating magnetic field with a frequency of 100 Hz and field strength of 1 A/m. After the electromagnetic exposure, seizures were induced in the rats with a sound stimulus. The severity of the seizure was determined on an ordinal scale, the audiogenic response score (ARS). The time from the beginning of the sound stimulus to the onset of the seizure (seizure latency) and the duration of the convulsion was measured. No differences from the control experiments were found in the experiments with simulated atmospherics, but the 100 Hz magnetic field increased the seizure latency by about 13% ( P<0.02). The results do not support the hypothesis that natural atmospheric electromagnetic signals could affect the onset of epileptic seizures, but they suggest that AGS-susceptible rats may be a useful model for studying the biological effects of electromagnetic fields.

  4. Comparison of epileptic and nonepileptic cases with centrotemporal spikes in view of clinical findings and electroencephalographic characteristics.

    PubMed

    Tombul, Temel; Anlar, Omer; Caksen, Hüseyin

    2006-03-01

    The morphological features of centrotemporal spike discharges (CTSD) and relationship of them with clinical diagnosis in cases with benign epilepsy of childhood with centrotemporal spikes (BECTS) and the other epileptic syndromes of childhood as well as some nonconvulsive neurological disorders were detected in the routine patient population who referred to the authors' EEG laboratory. Thirty-six cases (21 males, 15 females; 8 months-14 years old), in which awake and/or sleep EEGs revealed CTSD were included in this study. The cases were divided into two groups as epileptic and nonepileptic. The cases with seizure were divided into BECTS and the other epilepsies. Of the epileptic cases, 14 (38.8%) patients had typical rolandic seizures. In five cases, there were partial or secondary generalized seizures. Two cases had myoclonic seizures. In the nonepileptic group, there was mental retardation/behavioral disturbances in five cases; there were periodic syndromes of childhood such as migraine and equivalents of migraine in three cases; febrile convulsion in three cases, breath-holding spells in two cases, and primary enuresis nocturna in two cases. In the nonepileptic group, the discharges were significantly fewer than the other groups (p = .014). More frequent discharges occuring for shorter periods were more significantly observed in BECTS group (64%). Typically isolated spike and slow-waves in T3/T4 and C3/C4 location were significantly more common (86%) in rolandic epilepsy group (p = .01). The EEGs of cases with BECTS had more frequency in the cluster of discharges than the other groups (p = .018). Multifocal discharges were observed in 28.5% of cases with BECTS, in 20% of nonepileptic group, and in 71.4% of other epileptics in the trial. Although these epileptic and nonepileptic conditions have some differences in view of frequency and morphology and location, CTSDs could be manifested in the group without seizure. It was concluded that the similar focal

  5. EPILEPTIC PSYCHOSIS: A RETROSPECTIVE STUDY

    PubMed Central

    Fernandez, Antony; Khanna, Sumant; Channabasavanna, S.M.

    1988-01-01

    SUMMARY The files of 60 cases who received a diagnosis of epileptic psychosis in the period 1980-1985 were reviewed. Unclassifiable psychosis and paranoid hallucinatory states were the most common presentations. Except for the gap between onset of epilepsy and psychosis, there were no other predictors of type of psychosis. Shorter psychotic episodes tended to be characterised by pressure of speech, inappropriate affect, generalised epilepsy and more past episodes. Memory deficits were more often associated with a longer gap between onset of epilepsy and psychosis, and the presence of hallucinations. PMID:21927290

  6. Mitochondrial dysfunction and seizures: the neuronal energy crisis.

    PubMed

    Zsurka, Gábor; Kunz, Wolfram S

    2015-09-01

    Seizures are often the key manifestation of neurological diseases caused by pathogenic mutations in 169 of the genes that have so far been identified to affect mitochondrial function. Mitochondria are the main producers of ATP needed for normal electrical activities of neurons and synaptic transmission. Additionally, they have a central role in neurotransmitter synthesis, calcium homoeostasis, redox signalling, production and modulation of reactive oxygen species, and neuronal death. Hypotheses link mitochondrial failure to seizure generation through changes in calcium homoeostasis, oxidation of ion channels and neurotransmitter transporters by reactive oxygen species, a decrease in neuronal plasma membrane potential, and reduced network inhibition due to interneuronal dysfunction. Seizures, irrespective of their origin, represent an excessive acute energy demand in the brain. Accordingly, secondary mitochondrial dysfunction has been described in various epileptic disorders, including disorders that are mainly of non-mitochondrial origin. An understanding of the reciprocal relation between mitochondrial dysfunction and epilepsy is crucial to select appropriate anticonvulsant treatment and has the potential to open up new therapeutic approaches in the subset of epileptic disorders caused by mitochondrial dysfunction.

  7. Microarray Noninvasive Neuronal Seizure Recordings from Intact Larval Zebrafish

    PubMed Central

    Meyer, Michaela; Dhamne, Sameer C.; LaCoursiere, Christopher M.; Tambunan, Dimira; Poduri, Annapurna; Rotenberg, Alexander

    2016-01-01

    Zebrafish epilepsy models are emerging tools in experimental epilepsy. Zebrafish larvae, in particular, are advantageous because they can be easily genetically altered and used for developmental and drug studies since agents applied to the bath penetrate the organism easily. Methods for electrophysiological recordings in zebrafish are new and evolving. We present a novel multi-electrode array method to non-invasively record electrical activity from up to 61 locations of an intact larval zebrafish head. This method enables transcranial noninvasive recording of extracellular field potentials (which include multi-unit activity and EEG) to identify epileptic seizures. To record from the brains of zebrafish larvae, the dorsum of the head of an intact larva was secured onto a multi-electrode array. We recorded from individual electrodes for at least three hours and quantified neuronal firing frequency, spike patterns (continuous or bursting), and synchrony of neuronal firing. Following 15 mM potassium chloride- or pentylenetetrazole-infusion into the bath, spike and burst rate increased significantly. Additionally, synchrony of neuronal firing across channels, a hallmark of epileptic seizures, also increased. Notably, the fish survived the experiment. This non-invasive method complements present invasive zebrafish neurophysiological techniques: it affords the advantages of high spatial and temporal resolution, a capacity to measure multiregional activity and neuronal synchrony in seizures, and fish survival for future experiments, such as studies of epileptogenesis and development. PMID:27281339

  8. Low Frequency Stimulation Decreases Seizure Activity in a Mutation Model of Epilepsy

    PubMed Central

    Kile, Kara Buehrer; Tian, Nan; Durand, Dominique M.

    2013-01-01

    Summary Purpose To investigate brain electrical activity in Q54 mice that display spontaneous seizures because of a gain-of-function mutation of the Scn2a sodium channel gene, and to evaluate the efficacy of low frequency deep brain stimulation (DBS) for seizure frequency reduction. Methods EEG, EMG, and hippocampal deep electrodes were implanted into Q54 mice expressing an epileptic phenotype (n = 6). Chronic six channel recordings (wideband, 0.1–300 Hz) were stored 24 hours a day for more than 12 days. Low Frequency stimulation (LFS) (3Hz, square wave, biphasic, 100μs, 400μA) was applied to the ventral hippocampal commisure (VHC) in alternating five minute cycles (on or off) 24 hours a day for a period of four days. Results LFS (3Hz) resulted in a significant reduction in seizure frequency and duration (21% and 35%, p<0.05), when applied to the VHC of epileptic Q54 mice (n = 6). Seizure frequency was not directly affected by stimulation state (“on” versus “off”). Conclusion LFS applied at a frequency of 3Hz significantly reduced seizure frequency and duration in the Q54 model. Furthermore, the reduction of seizure frequency and duration by LFS was not immediate but had a delayed and lasting effect, supporting complex, indirect mechanisms of action. PMID:20659150

  9. AMPA Receptor Antagonist NBQX Decreased Seizures by Normalization of Perineuronal Nets

    PubMed Central

    Chen, Wen; Li, Yan-Shuang; Gao, Jing; Lin, Xiao-Ying; Li, Xiao-Hong

    2016-01-01

    Epilepsy is a serious brain disorder with diverse seizure types and epileptic syndromes. AMPA receptor antagonist 2,3-dihydroxy-6-nitro-7-sulfamoyl-benzoquinoxaline-2,3-dione (NBQX) attenuates spontaneous recurrent seizures in rats. However, the anti-epileptic effect of NBQX in chronic epilepsy model is poorly understood. Perineuronal nets (PNNs), specialized extracellular matrix structures, surround parvalbumin-positive inhibitory interneurons, and play a critical role in neuronal cell development and synaptic plasticity. Here, we focused on the potential involvement of PNNs in the treatment of epilepsy by NBQX. Rats were intraperitoneally (i.p.) injected with pentylenetetrazole (PTZ, 50 mg/kg) for 28 consecutive days to establish chronic epilepsy models. Subsequently, NBQX (20 mg/kg, i.p.) was injected for 3 days for the observation of behavioral measurements of epilepsy. The Wisteria floribundi agglutinin (WFA)-labeled PNNs were measured by immunohistochemical staining to evaluate the PNNs. The levels of three components of PNNs such as tenascin-R, aggrecan and neurocan were assayed by Western blot assay. The results showed that there are reduction of PNNs and decrease of tenascin-R, aggrecan and neurocan in the medial prefrontal cortex (mPFC) in the rats injected with PTZ. However, NBQX treatment normalized PNNs, tenascin-R, aggrecan and neurocan levels. NBQX was sufficient to decrease seizures through increasing the latency to seizures, decrease the duration of seizure onset, and reduce the scores for the severity of seizures. Furthermore, the degradation of mPFC PNNs by chondroitinase ABC (ChABC) exacerbated seizures in PTZ-treated rats. Finally, the anti-epileptic effect of NBQX was reversed by pretreatment with ChABC into mPFC. These findings revealed that PNNs degradation in mPFC is involved in the pathophysiology of epilepsy and enhancement of PNNs may be effective for the treatment of epilepsy. PMID:27880801

  10. Development of a novel rat mutant with spontaneous limbic-like seizures.

    PubMed Central

    Amano, S.; Ihara, N.; Uemura, S.; Yokoyama, M.; Ikeda, M.; Serikawa, T.; Sasahara, M.; Kataoka, H.; Hayase, Y.; Hazama, F.

    1996-01-01

    A new epileptic rat mutant with spontaneous seizures was developed by successive mating and selection from an inherited cataract rat. The procedures for developing the mutant and the symptomatology, electroencephalographic correlates, and neuropathology of the mutant are reported. It is possible that this rat stain will provide a useful animal model for human temporal lobe epilepsy. The seizures of the rat usually begin with face and head myoclonus, followed by rearing, and generalized clonic and tonic convulsions, all of which are symptomatologically the same as limbic seizures. Electrographic recording during generalized convulsive seizures demonstrated that sustained spike discharges emerged at the hippocampus and then propagated to the neocortex. Seizures occurred spontaneously without any artificial stimuli. Furthermore, external stimuli such as auditory, flashing light, or vestibular stimulations could not elicit epileptic attacks. Almost all of the male animals had generalized convulsions, mostly from 5 months after birth, and the frequency of the seizures increased with aging. Generalized convulsions developed in approximately 20% of the female rats. Microdysgenesis, such as abnormal neuronal clustering, neuronal disarrangement, or interruption of pyramidal neurons in the hippocampal formation, was found in the young rats that had not yet had generalized seizures. This microdysgenesis, which is though to be genetically programmed, was very interesting from the aspect of the relationship between structural abnormalities and epileptogenesis in this mutant. In addition to microdysgenesis, there was sprouting of mossy fibers into the inner molecular layer of the dentate gyrus in those adult rats that had repeated generalized convulsions. An increase of glial-fibrillary-acidic-protein-positive astrocytes with thickened and numerous processes, ie, astrogliosis, was also found in the cerebral cortex, amygdala region, and hippocampus of these adult animals. Judging

  11. Palmitoylethanolamide attenuates PTZ-induced seizures through CB1 and CB2 receptors.

    PubMed

    Aghaei, Iraj; Rostampour, Mohammad; Shabani, Mohammad; Naderi, Nima; Motamedi, Fereshteh; Babaei, Parvin; Khakpour-Taleghani, Behrooz

    2015-11-01

    Epilepsy is one of the most common neurologic disorders. Though there are effective medications available to reduce the symptoms of the disease, their side effects have limited their usage. Palmitoylethanolamide (PEA) has been shown to attenuate seizure in different animal models. The objective of the current study was to evaluate the role of CB1 and CB2 receptors in this attenuation. Male wistar rats were used for the current experiment. PTZ was injected to induce chemical kindling in animals. After verification of kindling in animals, treatment was performed with PEA, AM251 and AM630 in different groups. Latency to induce seizure, seizure stages and latency and duration of fifth stage of seizure was recorded for each animal. Injection of PTZ led to seizure in the animals. Pretreatment with PEA increased the latency to initiate seizures and reduced the duration of seizure. Pretreatment with different dosages of AM251 had contrary effects so that at lower doses they increased the seizure in animals but at higher doses led to the attenuation of seizure. AM630 increased seizures in a dose dependent manner. Combination of the antagonists increased the seizure parameters and attenuated the effect of PEA on seizure. PEA attenuated the PTZ-induced seizures and pretreatment with CB1 and CB2 antagonists diminished this effect of PEA, but still PEA was effective, which might be attributed to the contribution of other receptors in PEA anti-epileptic properties. Findings of the current study implied that endocannabinoid signaling pathway might have an important role in the effects of PEA.

  12. Seizures induced by desloratadine, a second-generation antihistamine: clinical observations.

    PubMed

    Cerminara, Caterina; El-Malhany, Nadia; Roberto, Denis; Lo Castro, Adriana; Curatolo, Paolo

    2013-08-01

    Some clinical experiences indicate that H1-antihistamines, especially first-generation H1-antagonists, occasionally provoke convulsions in healthy children as well as epileptic patients. Desloratadine is a frequently used second-generation antihistamine considered to be effective and safe for the treatment of allergic diseases. We describe four children who experienced epilepsy associated with the nonsedating H(1)-antagonist desloratadine and discuss the neurophysiologic role of the central histaminergic system in seizure susceptibility. In conclusion, we recommend caution in treating epileptic patients with the histamine H(1)-antagonists, including second- and third-generation drugs that are frequently referred because they are considered to be nonsedating antihistamines.

  13. Genes, Seizures & Epilepsy

    ERIC Educational Resources Information Center

    Goldman, Alica M.

    2006-01-01

    The chance that someone will develop any disease is influenced by heredity and environment. Epilepsy is not an exception. Everybody inherits a unique degree of susceptibility to seizures. About 3 percent of the United States population is prone to seizures and will get epilepsy at some point of their lives (1). Two thirds of the people with…

  14. Nutritional Aspects of Treatment in Epileptic Patients

    PubMed Central

    SOLTANI, Danesh; GHAFFAR POUR, Majid; TAFAKHORI, Abbas; SARRAF, Payam; BITARAFAN, Sama

    2016-01-01

    Epilepsy is a neurological disorder characterized by interruption of normal neuronal functions that is manifested by behavioral disorders, changing of awareness level, and presence of some sensory, autonomic and motor symptoms or signs. It is resulted from many different causes. Many antiepileptic drugs (AEDs) are considered to manage epileptic attacks. Some of them change metabolism and absorption of many nutrients. Therefore, epileptic patients may be in higher risk of nutrient deficiency and its unwelcome effects. In the present paper, we intend to review the relationship between nutrition and epilepsy in two aspects. In one aspect we discuss the nutritional status in epileptic patients, the causes of nutritional deficiencies and the way of compensation of the nutrient deficiencies. It will guide these patients to have a healthy life. In another aspect we explain the role of some nutrients and specific diets in management of epileptic attacks. It can help to better control of epileptic attacks in these patients. PMID:27375750

  15. Nutritional Aspects of Treatment in Epileptic Patients.

    PubMed

    Soltani, Danesh; Ghaffar Pour, Majid; Tafakhori, Abbas; Sarraf, Payam; Bitarafan, Sama

    2016-01-01

    Epilepsy is a neurological disorder characterized by interruption of normal neuronal functions that is manifested by behavioral disorders, changing of awareness level, and presence of some sensory, autonomic and motor symptoms or signs. It is resulted from many different causes. Many antiepileptic drugs (AEDs) are considered to manage epileptic attacks. Some of them change metabolism and absorption of many nutrients. Therefore, epileptic patients may be in higher risk of nutrient deficiency and its unwelcome effects. In the present paper, we intend to review the relationship between nutrition and epilepsy in two aspects. In one aspect we discuss the nutritional status in epileptic patients, the causes of nutritional deficiencies and the way of compensation of the nutrient deficiencies. It will guide these patients to have a healthy life. In another aspect we explain the role of some nutrients and specific diets in management of epileptic attacks. It can help to better control of epileptic attacks in these patients.

  16. CAD mutations and uridine-responsive epileptic encephalopathy.

    PubMed

    Koch, Johannes; Mayr, Johannes A; Alhaddad, Bader; Rauscher, Christian; Bierau, Jörgen; Kovacs-Nagy, Reka; Coene, Karlien L M; Bader, Ingrid; Holzhacker, Monika; Prokisch, Holger; Venselaar, Hanka; Wevers, Ron A; Distelmaier, Felix; Polster, Tilman; Leiz, Steffen; Betzler, Cornelia; Strom, Tim M; Sperl, Wolfgang; Meitinger, Thomas; Wortmann, Saskia B; Haack, Tobias B

    2017-02-01

    Unexplained global developmental delay and epilepsy in childhood pose a major socioeconomic burden. Progress in defining the molecular bases does not often translate into effective treatment. Notable exceptions include certain inborn errors of metabolism amenable to dietary intervention. CAD encodes a multifunctional enzyme involved in de novo pyrimidine biosynthesis. Alternatively, pyrimidines can be recycled from uridine. Exome sequencing in three families identified biallelic CAD mutations in four children with global developmental delay, epileptic encephalopathy, and anaemia with anisopoikilocytosis. Two died aged 4 and 5 years after a neurodegenerative disease course. Supplementation of the two surviving children with oral uridine led to immediate cessation of seizures in both. A 4-year-old female, previously in a minimally conscious state, began to communicate and walk with assistance after 9 weeks of treatment. A 3-year-old female likewise showed developmental progress. Blood smears normalized and anaemia resolved. We establish CAD as a gene confidently implicated in this neurometabolic disorder, characterized by co-occurrence of global developmental delay, dyserythropoietic anaemia and seizures. While the natural disease course can be lethal in early childhood, our findings support the efficacy of uridine supplementation, rendering CAD deficiency a treatable neurometabolic disorder and therefore a potential condition for future (genetic) newborn screening.

  17. Accelerometry-based home monitoring for detection of nocturnal hypermotor seizures based on novelty detection.

    PubMed

    Cuppens, Kris; Karsmakers, Peter; Van de Vel, Anouk; Bonroy, Bert; Milosevic, Milica; Luca, Stijn; Croonenborghs, Tom; Ceulemans, Berten; Lagae, Lieven; Van Huffel, Sabine; Vanrumste, Bart

    2014-05-01

    Nocturnal home monitoring of epileptic children is often not feasible due to the cumbersome manner of seizure monitoring with the standard method of video/EEG-monitoring. We propose a method for hypermotor seizure detection based on accelerometers attached to the extremities. From the acceleration signals, multiple temporal, frequency, and wavelet-based features are extracted. After determining the features with the highest discriminative power, we classify movement events in epileptic and nonepileptic movements. This classification is only based on a nonparametric estimate of the probability density function of normal movements. Such approach allows us to build patient-specific models to classify movement data without the need for seizure data that are rarely available. If, in the test phase, the probability of a data point (event) is lower than a threshold, this event is considered to be an epileptic seizure; otherwise, it is considered as a normal nocturnal movement event. The mean performance over seven patients gives a sensitivity of 95.24% and a positive predictive value of 60.04%. However, there is a noticeable interpatient difference.

  18. Mechanisms and effects of seizures in the immature brain.

    PubMed

    Nardou, Romain; Ferrari, Diana C; Ben-Ari, Yehezkel

    2013-08-01

    The developing immature brain is not simply a small adult brain but rather possesses unique physiological properties. These include neuronal ionic currents that differ markedly from those in the adult brain, typically being longer-lasting and less selective. This enables immature heterogeneous neurons to connect and fire together but at the same time, along with other features may contribute to the enhanced propensity of the developing brain to become epileptic. Indeed, immature neurons tend to readily synchronize and thus generate seizures. Here, we review the differences between the immature and adult brain, with particular focus on the developmental sequence of γ-aminobutyric acid that excites immature neurons while being inhibitory in the normal adult brain. We review the mechanisms underlying the developmental changes to intracellular chloride levels, as well as how epileptiform activity can drive pathologic changes to chloride balance in the brain. We show that regulation of intracellular chloride is one important factor that underlies both the ease with which seizures can be generated and the facilitation of further seizures. We stress in particular the importance of understanding normal developmental sequences and how they are interrupted by seizures and other insults, and how this knowledge has led to the identification of potential novel treatments for conditions such as neonatal seizures.

  19. EEG seizure detection and prediction algorithms: a survey

    NASA Astrophysics Data System (ADS)

    Alotaiby, Turkey N.; Alshebeili, Saleh A.; Alshawi, Tariq; Ahmad, Ishtiaq; Abd El-Samie, Fathi E.

    2014-12-01

    Epilepsy patients experience challenges in daily life due to precautions they have to take in order to cope with this condition. When a seizure occurs, it might cause injuries or endanger the life of the patients or others, especially when they are using heavy machinery, e.g., deriving cars. Studies of epilepsy often rely on electroencephalogram (EEG) signals in order to analyze the behavior of the brain during seizures. Locating the seizure period in EEG recordings manually is difficult and time consuming; one often needs to skim through tens or even hundreds of hours of EEG recordings. Therefore, automatic detection of such an activity is of great importance. Another potential usage of EEG signal analysis is in the prediction of epileptic activities before they occur, as this will enable the patients (and caregivers) to take appropriate precautions. In this paper, we first present an overview of seizure detection and prediction problem and provide insights on the challenges in this area. Second, we cover some of the state-of-the-art seizure detection and prediction algorithms and provide comparison between these algorithms. Finally, we conclude with future research directions and open problems in this topic.

  20. Balancing accuracy, delay and battery autonomy for pervasive seizure detection.

    PubMed

    Karapatis, Athanasios; Seepers, Robert M; van Dongen, Marijn; Serdijn, Wouter A; Strydis, Christos

    2016-08-01

    A promising alternative for treating absence seizures has emerged through closed-loop neurostimulation, which utilizes a wearable or implantable device to detect and subsequently suppress epileptic seizures. Such devices should detect seizures fast and with high accuracy, while respecting the strict energy budget on which they operate. Previous work has overlooked one or more of these requirements, resulting in solutions which are not suitable for continuous closed-loop stimulation. In this paper, we perform an in-depth design space exploration of a novel seizure-detection algorithm, which uses a complex Morlet wavelet filter and a static thresholding mechanism to detect absence seizures. We consider both the accuracy and speed of our detection algorithm, as well as various trade-offs with device autonomy when executed on a low-power processor. For example, we demonstrate that a minimal decrease in average detection rate of only 1.83% (from 92.72% to 90.89%) allows for a substantial increase in device autonomy (of 3.7x) while also facilitating faster detection (from 710 ms to 540 ms).

  1. Seizures beget seizures: the quest for GABA as a key player.

    PubMed

    Ben-Ari, Yehezkel

    2006-01-01

    that has been confirmed in all developing systems and animal species studied. As a consequence, immature GABAergic synapses will excite targets and facilitate the emergence of seizures, in keeping with the well-known higher incidence of seizures in the developing brain. Using a unique preparation with two intact hippocampi placed in a three-compartment chamber in vitro, we have provided direct evidence that seizures beget seizures and that GABA signaling plays a central role in this phenomenon. Indeed, recurrent seizures triggered in one hippocampus by a convulsive agent propagate to the other hippocampus and transform the naive hippocampus into one that generates seizures once disconnected from the other hippocampus. This transformation is conditioned by the occurrence during the seizures of high-frequency oscillations (40 Hz and above). Interestingly, these oscillations are only produced when N-methyl-D-aspartate (NMDA-) and GABA receptors are operative and not blocked in the naïve hippocampus. Therefore, GABA-receptor antagonists are pro-convulsive in the developing brain but, in fact, anti-epileptic. This paradoxical conclusion has quite a few clinical implications that are discussed.

  2. Phenotypic spectrum of GNAO1 variants: epileptic encephalopathy to involuntary movements with severe developmental delay

    PubMed Central

    Saitsu, Hirotomo; Fukai, Ryoko; Ben-Zeev, Bruria; Sakai, Yasunari; Mimaki, Masakazu; Okamoto, Nobuhiko; Suzuki, Yasuhiro; Monden, Yukifumi; Saito, Hiroshi; Tziperman, Barak; Torio, Michiko; Akamine, Satoshi; Takahashi, Nagahisa; Osaka, Hitoshi; Yamagata, Takanori; Nakamura, Kazuyuki; Tsurusaki, Yoshinori; Nakashima, Mitsuko; Miyake, Noriko; Shiina, Masaaki; Ogata, Kazuhiro; Matsumoto, Naomichi

    2016-01-01

    De novo GNAO1 variants have been found in four patients including three patients with Ohtahara syndrome and one patient with childhood epilepsy. In addition, two patients showed involuntary movements, suggesting that GNAO1 variants can cause various neurological phenotypes. Here we report an additional four patients with de novo missense GNAO1 variants, one of which was identical to that of the previously reported. All the three novel variants were predicted to impair Gαo function by structural evaluation. Two patients showed early-onset epileptic encephalopathy, presenting with migrating or multifocal partial seizures in their clinical course, but the remaining two patients showed no or a few seizures. All the four patients showed severe intellectual disability, motor developmental delay, and involuntary movements. Progressive cerebral atrophy and thin corpus callosum were common features in brain images. Our study demonstrated that GNAO1 variants can cause involuntary movements and severe developmental delay with/without seizures, including various types of early-onset epileptic encephalopathy. PMID:25966631

  3. SCN2A-Related Early-Onset Epileptic Encephalopathy Responsive to Phenobarbital

    PubMed Central

    Baumer, Fiona M.; Peters, Jurriaan M.; El Achkar, Christelle M.; Pearl, Phillip L.

    2016-01-01

    Voltage-gated sodium channels (Nav) are critical regulators of neuronal excitability. Genes for the α-subunits of three sodium channel subtypes—SCN1A, SCN2A, and SCN3A—are all located on chromosome 2q24. A full-term boy with an unremarkable birth history presented at 1 month of age with unusual movements that had started on day of life 2. Exam was notable for lack of visual attention, hypotonia, and hyperreflexia. Electroencephalogram (EEG) showed an invariant burst suppression with multifocal spikes, ictal episodes with bicycling movements associated with buildups of rhythmic activity, and epileptic spasms. Work-up revealed a 1.77-Mb duplication at locus 2q24.3, encompassing the entirety of SCN2A and SCN3A, but not SCN1A. Phenobarbital led to rapid resolution of the clinical seizures and EEG background normalized other than rare sharp waves. Early-onset epileptic encephalopathy (EOEE), with neonatal seizures, burst suppression, and reversibility with phenobarbital, is part of the enlarging spectrum of Nav channelopathies. The delayed diagnosis provided an unusual opportunity to view the early natural history of this disorder and its remarkable responsiveness to barbiturate therapy. The clinical and EEG response to phenobarbital implicates seizures as the cause of the encephalopathy. PMID:27595042

  4. Localization of focal epileptic discharges using functional connectivity magnetic resonance imaging

    PubMed Central

    Stufflebeam, Steven M.; Liu, Hesheng; Sepulcre, Jorge; Tanaka, Naoaki; Buckner, Randy L.; Madsen, Joseph R.

    2011-01-01

    Object In patients with medically refractory epilepsy the accurate localization of the seizure onset zone is critical for successful surgical treatment. The object of this study was to investigate whether the degree of coupling of spontaneous brain activity as measured with functional connectivity MR imaging (fcMR imaging) can accurately identify and localize epileptic discharges. Methods The authors studied 6 patients who underwent fcMR imaging presurgical mapping and subsequently underwent invasive electroencephalography. Results Focal regions of statistically significant increases in connectivity were identified in 5 patients when compared with an ad hoc normative sample of 300 controls. The foci identified by fcMR imaging overlapped the epileptogenic areas identified by invasive encephalography in all 5 patients. Conclusions These results suggest that fcMR imaging may provide an effective high–spatial resolution and noninvasive method of localizing epileptic discharges in patients with refractory epilepsy. PMID:21351832

  5. Comparison of five directed graph measures for identification of leading interictal epileptic regions

    PubMed Central

    Amini, Ladan; Jutten, Christian; Achard, Sophie; David, Olivier; Kahane, Philippe; Vercueil, Laurent; Minotti, Lorella; Hossein-Zadeh, Gh. Ali; Soltanian-Zadeh, Hamid

    2010-01-01

    Directed graphs (digraphs) derived from interictal periods of intracerebral EEG (iEEG) recordings can be used to estimate the leading interictal epileptic regions for presurgery evaluations. For this purpose, quantification of the emittance contribution of each node to the rest of digraph is important. However, the usual digraph measures are not very well suited for this quantification. Here we compare the efficiency of recently introduced local information measure LI and a new measure called total global efficiency with classical measures like global efficiency, local efficiency and node degree. For evaluation, the estimated leading interictal epileptic regions based on five measures are compared with seizure onset zones obtained by visual inspection of epileptologists for five patients. The comparison revealed the superior performance of LI measure. We showed efficiency of different digraph measures for the purpose of source and sink node identification. PMID:20952817

  6. [Oral loading dose of phenytoin in the treatment of serial seizures, prevention of seizure recurrence and rapid drug substitution].

    PubMed

    Sokić, D; Janković, S M

    1994-01-01

    Over a period of nine months twenty-five epileptic patients were treated with the oral loading dose of phenytoin. The dose ranged from 12 to 23 mg/kg body weight during 1 to 12 hours. In 20 patients with serial seizures or intolerance to other antiepileptic drugs this treatment was effective. Seizures also stopped in 2 of 4 patients with serial partial motor seizures. These 2 patients required both higher loading dose and faster rate of administration than the other patients. A patient with epilepsia partialis continua failed to respond to the treatment. Patients that received phenytoin through the naso-gastric tube, in respect to oral administration, required higher doses to obtain therapeutic plasma levels of phenytoin. One patient had mild nausea, 3 mild dizziness, and 1 tinitus on the first day of the treatment. There was no correlation between a given dose and the achieved phenytoin plasma levels. In our opinion the therapy with oral loading dose of phenytoin is highly effective in the treatment of serial generalized seizures and rapid antiepileptic drug substitution, and partially effective in the prevention of partial motor seizures. It produces only mild and transient side-effects.

  7. Application of approximate entropy on dynamic characteristics of epileptic absence seizure☆

    PubMed Central

    Zhou, Yi; Huang, Ruimei; Chen, Ziyi; Chang, Xin; Chen, Jialong; Xie, Lingli

    2012-01-01

    Electroencephalogram signals are time-varying complex electrophysiological signals. Existing studies show that approximate entropy, which is a nonlinear dynamics index, is not an ideal method for electroencephalogram analysis. Clinical electroencephalogram measurements usually contain electrical interference signals, creating additional challenges in terms of maintaining robustness of the analytic methods. There is an urgent need for a novel method of nonlinear dynamical analysis of the electroencephalogram that can characterize seizure-related changes in cerebral dynamics. The aim of this paper was to study the fluctuations of approximate entropy in preictal, ictal, and postictal electroencephalogram signals from a patient with absence seizures, and to improve the algorithm used to calculate the approximate entropy. The approximate entropy algorithm, especially our modified version, could accurately describe the dynamical changes of the brain during absence seizures. We could also demonstrate that the complexity of the brain was greater in the normal state than in the ictal state. The fluctuations of the approximate entropy before epileptic seizures observed in this study can form a good basis for further study on the prediction of seizures with nonlinear dynamics. PMID:25745446

  8. Transient epileptic amnesia: Update on a slowly emerging epileptic syndrome.

    PubMed

    Felician, O; Tramoni, E; Bartolomei, F

    2015-03-01

    Transient epileptic amnesia (TEA) is a recently individualized, late-onset, pharmaco-sensitive form of mesial temporal lobe epilepsy with recurrent episodes of acute memory loss, but also interictal memory disturbances characterized by autobiographical and topographical memory impairment and a long-term consolidation deficit. In this article, we review the main clinical and electrophysiological characteristics of TEA, discuss its putative neuroanatomical substrate and mechanisms, common features and how it differs from related concepts, with the overall aim to defend the idea that TEA deserves to be recognized as a distinct epilepsy syndrome. While the pathophysiological basis remains largely unknown, emotional and/or dysimmune factors may have a potential influence. Most importantly, the concept of TEA is highly relevant to tertiary epilepsy and memory clinics, but also to routine neurology practice, leading to an adequate diagnosis and management of epilepsy-related, acute and long-standing memory deficits.

  9. Epileptic spasms in paediatric post-traumatic epilepsy at a tertiary referral centre.

    PubMed

    Park, Jun T; Chugani, Harry T

    2017-03-17

    To recognize epileptic spasms (ES) as a seizure type after traumatic brain injury (TBI), accidental or non-accidental, in infants and children. In the process, we aim to gain some insight into the mechanisms of epileptogenesis in ES. A retrospective electronic chart review was performed at the Children's Hospital of Michigan from 2002 to 2012. Electronic charts of 321 patients were reviewed for evidence of post-traumatic epilepsy. Various clinical variables were collected including age at TBI, mechanism of trauma, severity of brain injury, electroencephalography/neuroimaging data, and seizure semiology. Six (12.8%) of the 47 patients diagnosed with post-traumatic epilepsy (PTE) had ES. Epileptic spasms occurred between two months to two years after TBI. All patients with ES had multiple irritative zones, manifesting as multifocal epileptiform discharges, unilateral or bilateral. Cognitive delay and epileptic encephalopathy were seen in all six patients, five of whom were free of spasms after treatment with vigabatrin or adrenocorticotropic hormone. The risk of PTE is 47/321(14.6%) and the specific risk of ES after TBI is 6/321 (1.8%). The risk of ES appears to be high if the age at which severe TBI occurred was during infancy. Non-accidental head trauma is a risk factor of epileptic spasms. While posttraumatic epilepsy (not ES) may start 10 years after the head injury, ES starts within two years, according to our small cohort. The pathophysiology of ES is unknown, however, our data support a combination of previously proposed models in which the primary dysfunction is a focal or diffuse cortical abnormality, coupled with its abnormal interaction with the subcortical structures and brainstem at a critical maturation stage.

  10. Giant Intradural Mucocele in a Patient with Adult Onset Seizures

    PubMed Central

    Kechagias, E.; Georgakoulias, N.; Ioakimidou, C.; Kyriazi, S.; Kontogeorgos, G.; Seretis, A.

    2009-01-01

    A rare case of mucopyocele in a patient who presented with epileptic seizures is reported. The computed tomography scan (CT) and the magnetic resonance (MR) imaging revealed an intradural extension of a giant fronto-ethmoidal mucopyocele, eroding the cribriform plate and compressing both frontal lobes. The lesion was removed by craniotomy with elimination of the mass effect and reconstruction of the anterior skull base. An intracranial-intradural mucopyocele is an extremely rare cause of generalized convulsion as a presenting symptom, with only 6 cases reported in the literature. The total removal of the lesion associated with anterior fossa reconstruction is the treatment of choice. PMID:20847833

  11. Communicating the diagnosis of psychogenic nonepileptic seizures: The patient perspective.

    PubMed

    Arain, Amir; Tammaa, Maamoon; Chaudhary, Faria; Gill, Shazil; Yousuf, Syed; Bangalore-Vittal, Nandakumar; Singh, Pradumna; Jabeen, Shagufta; Ali, Shahid; Song, Yanna; Azar, Nabil J

    2016-06-01

    Psychogenic nonepileptic seizures (PNES) are a common cause of refractory seizures. Video-electroencephalographic (EEG) monitoring has allowed PNES to be effectively distinguished from epileptic seizures. Once the diagnosis of PNES is established, neurologists face the challenge of explaining it to patients. Patients may not always receive the diagnosis well. The aim of this study is to evaluate how effectively patients receive and perceive the diagnosis of PNES. This prospective study was conducted in an eight-bed epilepsy monitoring unit (EMU). Adult patients with newly confirmed PNES were included. After receiving written consent, a self-administered questionnaire was given to patients after the attending physician had communicated the diagnosis of PNES. A total of 75 patients were recruited. All patients had their typical seizures recorded on video-EEG (range 1-12, mean 2.18). Seventy patients were satisfied with the diagnosis of PNES. Nine patients did not agree that PNES has a psychological cause. Nineteen patients thought that the EMU doctors had no clue as to the cause of their seizures and 20 thought that there was no hope for a cure of their seizures. A significant number of patients with PNES feel that there is no hope for cure of their seizures. Thorough education about PNES, properly preparing patients before discussing the diagnosis of PNES, and preferably earlier diagnosis may prevent this miscommunication and result in better outcomes. A comprehensive approach including psychological counseling and psychiatric input, evaluation and treatment, in order to bring the illness from the subconscious to the conscious level, and effective follow-up may be helpful.

  12. Seizure prediction using polynomial SVM classification.

    PubMed

    Zisheng Zhang; Parhi, Keshab K

    2015-08-01

    This paper presents a novel patient-specific algorithm for prediction of seizures in epileptic patients with low hardware complexity and low power consumption. In the proposed approach, we first compute the spectrogram of the input fragmented EEG signals from a few electrodes. Each fragmented data clip is ten minutes in duration. Band powers, relative spectral powers and ratios of spectral powers are extracted as features. The features are then subjected to electrode selection and feature selection using classification and regression tree. The baseline experiment uses all features from selected electrodes and these features are then subjected to a radial basis function kernel support vector machine (RBF-SVM) classifier. The proposed method further selects a small number features from the selected electrodes and train a polynomial support vector machine (SVM) classifier with degree of 2 on these features. Prediction performances are compared between the baseline experiment and the proposed method. The algorithm is tested using intra-cranial EEG (iEEG) from the American Epilepsy Society Seizure Prediction Challenge database. The baseline experiment using a large number of features and RBF-SVM achieves a 100% sensitivity and an average AUC of 0.9985, while the proposed algorithm using only a small number of features and polynomial SVM with degree of 2 can achieve a sensitivity of 100.0%, an average area under curve (AUC) of 0.9795. For both experiments, only 10% of the available training data are used for training.

  13. Administration of Simvastatin after Kainic Acid-Induced Status Epilepticus Restrains Chronic Temporal Lobe Epilepsy

    PubMed Central

    Qiao, Weidong; Lu, Dunyue; Wei, Lanlan; Na, Meng; Song, Yuanyuan; Hou, Xiaohua; Lin, Zhiguo

    2011-01-01

    In this study, we examined the effect of chronic administration of simvastatin immediately after status epilepticus (SE) on rat brain with temporal lobe epilepsy (TLE). First, we evaluated cytokines expression at 3 days post KA-lesion in hippocampus and found that simvastatin-treatment suppressed lesion-induced expression of interleukin (IL)-1β and tumor necrosis factor-α (TNF-α). Further, we quantified reactive astrocytosis using glial fibrillary acidic protein (GFAP) staining and neuron loss using Nissl staining in hippocampus at 4–6 months after KA-lesion. We found that simvastatin suppressed reactive astrocytosis demonstrated by a significant decrease in GFAP-positive cells, and attenuated loss of pyramidal neurons in CA3 and interneurons in dentate hilar (DH). We next assessed aberrant mossy fiber sprouting (MFS) that is known to contribute to recurrence of spontaneous seizure in epileptic brain. In contrast to the robust MFS observed in saline-treated animals, the extent of MFS was restrained by simvastatin in epileptic rats. Attenuated MFS was related to decreased neuronal loss in CA3 and DH, which is possibly a mechanism underlying decreased hippocampal susceptibility in animal treated with simvastatin. Electronic encephalography (EEG) was recorded during 4 to 6 months after KA-lesion. The frequency of abnormal spikes in rats with simvastatin-treatment decreased significantly compared to the saline group. In summary, simvastatin treatment suppressed cytokines expression and reactive astrocytosis and decreased the frequency of discharges of epileptic brain, which might be due to the inhibition of MFS in DH. Our study suggests that simvastatin administration might be a possible intervention and promising strategy for preventing SE exacerbating to chronic epilepsy. PMID:21949812

  14. [A case of intractable epilepsy showing frequent gelastic seizures by administration of clobazam].

    PubMed

    Iwasaki, Toshiyuki; Miura, Hisao; Sunaoshi, Wataru; Hosoda, Nozomi; Takei, Kenji; Katayama, Fumihiko

    2003-09-01

    A 13-year-old boy patient had severe mental retardation and spastic quadriplegia due to fetal distress and hypoxic-ischemic brain damage in the perinatal period. He suffered from West syndrome at the age of 7 months, and subsequently was diagnosed as having symptomatic localization-related epilepsy. His intractable epileptic seizures were not controlled by combination of various antiepileptic drugs. After prescribing nitrazepam and zonisamide for more than 1 year, we added clobazam (CLB), which has been marketed in Japan since 2000, to this combination therapy. After the introduction of CLB, tonic seizures disappeared. However, gelastic seizures laughing with a stiff face and a wry mouth appeared frequently before falling asleep, and sleep disturbance worsened subsequently. It has not been reported previously that gelastic seizures are a side effect of CLB, although irritability and sleep disturbance have been described.

  15. Functional Modularity of Background Activities in Normal and Epileptic Brain Networks

    NASA Astrophysics Data System (ADS)

    Chavez, M.; Valencia, M.; Navarro, V.; Latora, V.; Martinerie, J.

    2010-03-01

    We analyze the connectivity structure of weighted brain networks extracted from spontaneous magnetoencephalographic signals of healthy subjects and epileptic patients (suffering from absence seizures) recorded at rest. We find that, for the activities in the 5-14 Hz range, healthy brains exhibit a sparse connectivity, whereas the brain networks of patients display a rich connectivity with a clear modular structure. Our results suggest that modularity plays a key role in the functional organization of brain areas during normal and pathological neural activities at rest.

  16. Seizure-Induced Axonal Sprouting: Assessing Connections Between Injury, Local Circuits, and Epileptogenesis

    PubMed Central

    Sutula, Thomas

    2002-01-01

    Neurons and neural circuits undergo extensive structural and functional remodeling in response to seizures. Sprouting of axons in the mossy fiber pathway of the hippocampus is a prominent example of a seizure-induced structural alteration which has received particular attention because it is easily detected, is induced by intense or repeated brief seizures in focal chronic models of epilepsy, and is also observed in the human epileptic hippocampus. During the last decade the association of mossy fiber sprouting with seizures and epilepsy has been firmly established. Many anatomical features of mossy fiber sprouting have been described in considerable detail, and there is evidence that sprouting occurs in a variety of other pathways in association with seizures and injury. There is uncertainty, however, about how or when mossy fiber sprouting may contribute to hippocampal dysfunction and generation of seizures. Study of mossy fiber sprouting has provided a strong theoretical and conceptual framework for efforts to understand how seizures and injury may contribute to epileptogenesis and its consequences. It is likely that investigation of mossy fiber sprouting will continure to offer significant opportunities for insights into seizure-induced plasticity of neural circuits at molecular, cellular, and systems levels. PMID:15309153

  17. The Control of Seizure-Like Activity in the Rat Hippocampal Slice

    PubMed Central

    Khosravani, Houman; Carlen, Peter L.; Velazquez, Jose L. Perez

    2003-01-01

    The sudden and transient hypersynchrony of neuronal firing that characterizes epileptic seizures can be considered as the transitory stabilization of metastable states present within the dynamical repertoire of a neuronal network. Using an in vitro model of recurrent spontaneous seizures in the rat horizontal hippocampal slice preparation, we present an approach to characterize the dynamics of the transition to seizure, and to use this information to control the activity and avoid the occurrence of seizure-like events. The transition from the interictal activity (between seizures) to the seizure-like event is aborted by brief (20–50 s) low-frequency (0.5 Hz) periodic forcing perturbations, applied via an extracellular stimulating electrode to the mossy fibers, the axons of the dentate neurons that synapse onto the CA3 pyramidal cells. This perturbation results in the stabilization of an interictal-like low-frequency firing pattern in the hippocampal slice. The results derived from this work shed light on the dynamics of the transition to seizure and will further the development of algorithms that can be used in automated devices to stop seizure occurrence. PMID:12524321

  18. Chronic obstructive pulmonary disease as a risk factor for stroke-related seizures.

    PubMed

    De Reuck, J; Proot, P; Van Maele, G

    2007-09-01

    Chronic obstructive pulmonary disease (COPD) is a risk factor for cardiovascular disorders and different types of stroke. The present retrospective study investigates whether COPD is also a risk factor for the development of seizures in stroke patients. The study population consisted of 237 patients with stroke-related seizures. The control population was composed of 939 patients, admitted for a stroke between 2002 and 2004 and who did not develop epileptic spells on a follow up of 2 years. The stroke type and aetiology, and the vascular risk factors, including COPD, were compared. The seizure patients were older (P = 0.009) and had more arterial hypertension (P = 0.046) and cardiac-embolic strokes (P = 0.045) than the control group. On logistic regression only partial anterior circulation syndrome/infarct (PACS/I) and COPD (P < 0.001) emerged as independent risk factors for the development of seizures in stroke patients. The occurrence of seizures was not related to the severity of the COPD or to its type of treatment. The present study confirms that seizures occur most frequently in patients with a PACS/I. Although we were unable to demonstrate why COPD is a risk factor for seizures in stroke patients, its frequent associated nocturnal oxygen desaturation seems to be the most plausible explanation. Further prospective are needed to assess the role of COPD as a possible independent risk factor for stroke-related seizures.

  19. Multistage seizure detection techniques optimized for low-power hardware platforms.

    PubMed

    Raghunathan, Shriram; Jaitli, Arjun; Irazoqui, Pedro P

    2011-12-01

    Closed-loop neurostimulation devices that stimulate the brain to treat epileptic seizures have shown great promise in treating more than a third of the 2 million people with epilepsy in the United States alone whose seizures are currently nonresponsive to pharmaceutical treatment. Seizure detection algorithms facilitate responsive therapeutic intervention that is believed to increase the efficacy of neurostimulation by improving on its spatial and temporal specificity. Translating these signal processing algorithms into battery-powered, implantable devices poses a number of challenges that severely limit the computational power of the chosen algorithm. We propose a cascaded two-stage seizure detection algorithm that is computationally efficient (resulting in a low-power hardware implementation) without compromising on detection efficacy. Unlike traditional detection algorithms, the proposed technique does not explicitly require a "training" phase from individual to individual and, instead, relies on using features that result in distinct "patterns" at the electrographic seizure onset. We tested the algorithm on spontaneous clinical seizures recorded using depth electrodes from patients with focal intractable epilepsy and annotated by epileptologists at the University of Freiburg Medical Center, via the Freiburg database. The algorithm performs with a specificity and sensitivity of 99.82 and 87.5%, detecting seizures in less than 9.08% of their duration after onset. The proposed technique is also shown to be computationally efficient, facilitating low-power hardware implementation. This article is part of a Supplemental Special Issue entitled The Future of Automated Seizure Detection and Prediction.

  20. Late-onset epileptic spasms in children with Pallister-Killian syndrome: a report of two new cases and review of the electroclinical aspects.

    PubMed

    Cerminara, Caterina; Compagnone, Eliana; Bagnolo, Valentina; Galasso, Cinzia; Lo-Castro, Adriana; Brinciotti, Mario; Curatolo, Paolo

    2010-02-01

    Pallister-Killian syndrome is a rare syndrome of multiple congenital anomalies attributable to the presence of a mosaic supernumerary isochromosome (12p). Although the clinical manifestations of Pallister-Killian syndrome are variable, the most common anomalies include craniofacial dysmorphisms, limb deformities, progressive psychomotor development delay, severe hypotonia, and epilepsy. Standard karyotype is nearly always normal, but the isochromosome (12p) is present in a high percentage of skin fibroblasts. In this article, we report the case of 2 boys with Pallister-Killian syndrome having late-onset, drug-resistant epileptic spasms. Seizures have been reported in 40% of patients with Pallister-Killian syndrome but are poorly described. Epileptic spasms are not unusual in patients with brain malformations, chromosomal aberrations, and genetic syndromes, but epileptic spasms could be easily mistaken for behavioral manifestations. A better electroclinical characterization of epileptic seizures in Pallister-Killian syndrome using appropriate polygraphic tests (video-electroencephalography, electromyography) may lead to an early diagnosis and specific treatment for this form of epileptic spasms caused by this rare syndrome.

  1. Optical triggered seizures using a caged 4-Aminopyridine

    PubMed Central

    Zhao, Mingrui; McGarry, Laura M.; Ma, Hongtao; Harris, Samuel; Berwick, Jason; Yuste, Rafael; Schwartz, Theodore H.

    2015-01-01

    Animal models of epilepsy are critical not only for understanding the fundamental mechanism of epilepsy but also for testing the efficacy of new antiepileptic drugs and novel therapeutic interventions. Photorelease of caged molecules is widely used in biological research to control pharmacologic events with high spatio-temporal resolution. We developed a technique for in vivo optical triggering of neocortical seizures using a novel caged compound based on ruthenium photochemistry (RuBi-4AP). Epileptiform events in mouse cortex were induced with blue light in both whole brain and focal illumination. Multi-electrode array recording and optical techniques were used to characterize the propagation of these epileptic events, including interictal spikes, polyspikes, and ictal discharges. These results demonstrate a novel optically-triggered seizure model, with high spatio-temporal control, that could have widespread application in the investigation of ictal onset, propagation and to develop novel light-based therapeutic interventions. PMID:25698919

  2. Seizures Following Cardiopulmonary Bypass

    PubMed Central

    Brouwer, Monique E.; McMeniman, William J.

    2016-01-01

    Abstract: Seizures following cardiopulmonary bypass are an immediate and alarming indication that a neurologic event has occurred. A case report of a 67-year-old man undergoing aortic valve surgery who unexpectedly experiences seizures following cardiopulmonary bypass is outlined. Possible contributing factors including atheromatous disease in the aorta, low cerebral perfusion pressures, an open-chamber procedure, and the use of tranexamic acid are identified. PMID:27729707

  3. Reflex operculoinsular seizures.

    PubMed

    Xiao, Handsun; Tran, Thi Phuoc Yen; Pétrin, Myriam; Boucher, Olivier; Mohamed, Ismail; Bouthillier, Alain; Nguyen, Dang Khoa

    2016-03-01

    Activation of specific cortical territories by certain stimuli is known to trigger focal seizures. We report three cases of well documented operculo-insular reflex seizures, triggered by somatosensory stimuli in two and loud noises in the third. Limited operculoinsular resection resulted in an excellent outcome for all. We discuss these observations in regard to the literature on reflex epilepsy and known functions of the insula. [Published with video sequences online].

  4. Looking for complexity in quantitative semiology of frontal and temporal lobe seizures using neuroethology and graph theory.

    PubMed

    Bertti, Poliana; Tejada, Julian; Martins, Ana Paula Pinheiro; Dal-Cól, Maria Luiza Cleto; Terra, Vera Cristina; de Oliveira, José Antônio Cortes; Velasco, Tonicarlo Rodrigues; Sakamoto, Américo Ceiki; Garcia-Cairasco, Norberto

    2014-09-01

    Epileptic syndromes and seizures are the expression of complex brain systems. Because no analysis of complexity has been applied to epileptic seizure semiology, our goal was to apply neuroethology and graph analysis to the study of the complexity of behavioral manifestations of epileptic seizures in human frontal lobe epilepsy (FLE) and temporal lobe epilepsy (TLE). We analyzed the video recordings of 120 seizures of 18 patients with FLE and 28 seizures of 28 patients with TLE. All patients were seizure-free >1 year after surgery (Engel Class I). All patients' behavioral sequences were analyzed by means of a glossary containing all behaviors and analyzed for neuroethology (Ethomatic software). The same series were used for graph analysis (CYTOSCAPE). Behaviors, displayed as nodes, were connected by edges to other nodes according to their temporal sequence of appearance. Using neuroethology analysis, we confirmed data in the literature such as in FLE: brief/frequent seizures, complex motor behaviors, head and eye version, unilateral/bilateral tonic posturing, speech arrest, vocalization, and rapid postictal recovery and in the case of TLE: presence of epigastric aura, lateralized dystonias, impairment of consciousness/speech during ictal and postictal periods, and development of secondary generalization. Using graph analysis metrics of FLE and TLE confirmed data from flowcharts. However, because of the algorithms we used, they highlighted more powerfully the connectivity and complex associations among behaviors in a quite selective manner, depending on the origin of the seizures. The algorithms we used are commonly employed to track brain connectivity from EEG and MRI sources, which makes our study very promising for future studies of complexity in this field.

  5. The effects of lossy compression on diagnostically relevant seizure information in EEG signals.

    PubMed

    Higgins, G; McGinley, B; Faul, S; McEvoy, R P; Glavin, M; Marnane, W P; Jones, E

    2013-01-01

    This paper examines the effects of compression on EEG signals, in the context of automated detection of epileptic seizures. Specifically, it examines the use of lossy compression on EEG signals in order to reduce the amount of data which has to be transmitted or stored, while having as little impact as possible on the information in the signal relevant to diagnosing epileptic seizures. Two popular compression methods, JPEG2000 and SPIHT, were used. A range of compression levels was selected for both algorithms in order to compress the signals with varying degrees of loss. This compression was applied to the database of epileptiform data provided by the University of Freiburg, Germany. The real-time EEG analysis for event detection automated seizure detection system was used in place of a trained clinician for scoring the reconstructed data. Results demonstrate that compression by a factor of up to 120:1 can be achieved, with minimal loss in seizure detection performance as measured by the area under the receiver operating characteristic curve of the seizure detection system.

  6. Migrating partial seizures of infancy: expansion of the electroclinical, radiological and pathological disease spectrum.

    PubMed

    McTague, Amy; Appleton, Richard; Avula, Shivaram; Cross, J Helen; King, Mary D; Jacques, Thomas S; Bhate, Sanjay; Cronin, Anthony; Curran, Andrew; Desurkar, Archana; Farrell, Michael A; Hughes, Elaine; Jefferson, Rosalind; Lascelles, Karine; Livingston, John; Meyer, Esther; McLellan, Ailsa; Poduri, Annapurna; Scheffer, Ingrid E; Spinty, Stefan; Kurian, Manju A; Kneen, Rachel

    2013-05-01

    Migrating partial seizures of infancy, also known as epilepsy of infancy with migrating focal seizures, is a rare early infantile epileptic encephalopathy with poor prognosis, presenting with focal seizures in the first year of life. A national surveillance study was undertaken in conjunction with the British Paediatric Neurology Surveillance Unit to further define the clinical, pathological and molecular genetic features of this disorder. Fourteen children with migrating partial seizures of infancy were reported during the 2 year study period (estimated prevalence 0.11 per 100,000 children). The study has revealed that migrating partial seizures of infancy is associated with an expanded spectrum of clinical features (including severe gut dysmotility and a movement disorder) and electrographic features including hypsarrhythmia (associated with infantile spasms) and burst suppression. We also report novel brain imaging findings including delayed myelination with white matter hyperintensity on brain magnetic resonance imaging in one-third of the cohort, and decreased N-acetyl aspartate on magnetic resonance spectroscopy. Putaminal atrophy (on both magnetic resonance imaging and at post-mortem) was evident in one patient. Additional neuropathological findings included bilateral hippocampal gliosis and neuronal loss in two patients who had post-mortem examinations. Within this cohort, we identified two patients with mutations in the newly discovered KCNT1 gene. Comparative genomic hybridization array, SCN1A testing and genetic testing for other currently known early infantile epileptic encephalopathy genes (including PLCB1 and SLC25A22) was non-informative for the rest of the cohort.