Science.gov

Sample records for acid-induced epileptic seizures

  1. Increase in α-tubulin modifications in the neuronal processes of hippocampal neurons in both kainic acid-induced epileptic seizure and Alzheimer’s disease

    PubMed Central

    Vu, Hang Thi; Akatsu, Hiroyasu; Hashizume, Yoshio; Setou, Mitsutoshi; Ikegami, Koji

    2017-01-01

    Neurodegeneration includes acute changes and slow-developing alterations, both of which partly involve common cellular machinery. During neurodegeneration, neuronal processes are impaired along with dysregulated post-translational modifications (PTMs) of cytoskeletal proteins. In neuronal processes, tubulin undergoes unique PTMs including a branched form of modification called glutamylation and loss of the C-terminal tyrosine residue and the penultimate glutamic acid residue forming Δ2-tubulin. Here, we investigated the state of two PTMs, glutamylation and Δ2 form, in both acute and slow-developing neurodegenerations, using a newly generated monoclonal antibody, DTE41, which had 2-fold higher affinity to glutamylated Δ2-tubulin, than to unmodified Δ2-tubulin. DTE41 recognised glutamylated Δ2-tubulin preferentially in immunostaining than in enzyme-linked immunosorbent assay and immunoblotting. In normal mouse brain, DTE41 stained molecular layer of the cerebellum as well as synapse-rich regions in pyramidal neurons of the cerebral cortex. In kainic acid-induced epileptic seizure, DTE41-labelled signals were increased in the hippocampal CA3 region, especially in the stratum lucidum. In the hippocampi of post-mortem patients with Alzheimer’s disease, intensities of DTE41 staining were increased in mossy fibres in the CA3 region as well as in apical dendrites of the pyramidal neurons. Our findings indicate that glutamylation on Δ2-tubulin is increased in both acute and slow-developing neurodegeneration. PMID:28067280

  2. Long-Term Intake of Uncaria rhynchophylla Reduces S100B and RAGE Protein Levels in Kainic Acid-Induced Epileptic Seizures Rats

    PubMed Central

    Tang, Nou-Ying; Ho, Tin-Yun; Chen, Chao-Hsiang

    2017-01-01

    Epileptic seizures are crucial clinical manifestations of recurrent neuronal discharges in the brain. An imbalance between the excitatory and inhibitory neuronal discharges causes brain damage and cell loss. Herbal medicines offer alternative treatment options for epilepsy because of their low cost and few side effects. We established a rat epilepsy model by injecting kainic acid (KA, 12 mg/kg, i.p.) and subsequently investigated the effect of Uncaria rhynchophylla (UR) and its underlying mechanisms. Electroencephalogram and epileptic behaviors revealed that the KA injection induced epileptic seizures. Following KA injection, S100B levels increased in the hippocampus. This phenomenon was attenuated by the oral administration of UR and valproic acid (VA, 250 mg/kg). Both drugs significantly reversed receptor potentiation for advanced glycation end product proteins. Rats with KA-induced epilepsy exhibited no increase in the expression of metabotropic glutamate receptor 3, monocyte chemoattractant protein 1, and chemokine receptor type 2, which play a role in inflammation. Our results provide novel and detailed mechanisms, explaining the role of UR in KA-induced epileptic seizures in hippocampal CA1 neurons. PMID:28386293

  3. Uncaria rhynchophylla and rhynchophylline improved kainic acid-induced epileptic seizures via IL-1β and brain-derived neurotrophic factor.

    PubMed

    Ho, Tin-Yun; Tang, Nou-Ying; Hsiang, Chien-Yun; Hsieh, Ching-Liang

    2014-05-15

    Uncaria rhynchophylla (UR) has been used for the treatment of convulsions and epilepsy in traditional Chinese medicine. This study reported the major anti-convulsive signaling pathways and effective targets of UR and rhynchophylline (RP) using genomic and immunohistochemical studies. Epileptic seizure model was established by intraperitoneal injection of kainic acid (KA) in rats. Electroencephalogram and electromyogram recordings indicated that UR and RP improved KA-induced epileptic seizures. Toll-like receptor (TLR) and neurotrophin signaling pathways were regulated by UR in both cortex and hippocampus of KA-treated rats. KA upregulated the expression levels of interleukin-1β (IL-1β) and brain-derived neurotrophin factor (BDNF), which were involved in TLR and neurotrophin signaling pathways, respectively. However, UR and RP downregulated the KA-induced IL-1β and BDNF gene expressions. Our findings suggested that UR and RP exhibited anti-convulsive effects in KA-induced rats via the regulation of TLR and neurotrophin signaling pathways, and the subsequent inhibition of IL-1β and BDNF gene expressions. Copyright © 2014 Elsevier GmbH. All rights reserved.

  4. The diagnosis of epileptic and non-epileptic seizures.

    PubMed

    Kotsopoulos, Irene A W; de Krom, Marc C T F M; Kessels, Fons G H; Lodder, Jan; Troost, Jaap; Twellaar, Mascha; van Merode, Tiny; Knottnerus, André J

    2003-11-01

    The aim of this prospective population-based study was to systematically define a cluster of diagnostic items which can assist in the early identification and classification of epileptic and non-epileptic seizures. A cohort of patients aged > or =14 years, suspected with a first epileptic seizure, were included in this study. A team of neurologists evaluated and classified all cases. Diagnostic items for epileptic and non-epileptic seizures were identified using logistic regression analysis. Three hundred and fifty cases entered this study. Distinctive features for epileptic seizures were postictal confusion (OR 0.09), an epileptiform EEG pattern (OR 0.02), and abnormal neuroimaging findings (OR 0.07), whereas for non-epileptic seizures of organic origin there was a history of hypertension (OR 7.5), and provoking factors (OR 13.4) such as exercise and warmth. Diagnostic items for seizures of non-organic origin were a history of febrile seizures (OR 5.8), treatment by a psychologist or psychiatrist (OR 9.1), and presentiment of the seizure (OR 3.7) such as a feeling of choking and palpitations. A separate analysis for the patients who were systematically investigated provided some additional diagnostic items for the different subgroups of patients. For instance, back arching during the seizure for the patients with seizures of non-organic origin and female sex for the patients with non-epileptic seizures of organic origin.

  5. Predicting Epileptic Seizures in Advance

    PubMed Central

    Moghim, Negin; Corne, David W.

    2014-01-01

    Epilepsy is the second most common neurological disorder, affecting 0.6–0.8% of the world's population. In this neurological disorder, abnormal activity of the brain causes seizures, the nature of which tend to be sudden. Antiepileptic Drugs (AEDs) are used as long-term therapeutic solutions that control the condition. Of those treated with AEDs, 35% become resistant to medication. The unpredictable nature of seizures poses risks for the individual with epilepsy. It is clearly desirable to find more effective ways of preventing seizures for such patients. The automatic detection of oncoming seizures, before their actual onset, can facilitate timely intervention and hence minimize these risks. In addition, advance prediction of seizures can enrich our understanding of the epileptic brain. In this study, drawing on the body of work behind automatic seizure detection and prediction from digitised Invasive Electroencephalography (EEG) data, a prediction algorithm, ASPPR (Advance Seizure Prediction via Pre-ictal Relabeling), is described. ASPPR facilitates the learning of predictive models targeted at recognizing patterns in EEG activity that are in a specific time window in advance of a seizure. It then exploits advanced machine learning coupled with the design and selection of appropriate features from EEG signals. Results, from evaluating ASPPR independently on 21 different patients, suggest that seizures for many patients can be predicted up to 20 minutes in advance of their onset. Compared to benchmark performance represented by a mean S1-Score (harmonic mean of Sensitivity and Specificity) of 90.6% for predicting seizure onset between 0 and 5 minutes in advance, ASPPR achieves mean S1-Scores of: 96.30% for prediction between 1 and 6 minutes in advance, 96.13% for prediction between 8 and 13 minutes in advance, 94.5% for prediction between 14 and 19 minutes in advance, and 94.2% for prediction between 20 and 25 minutes in advance. PMID:24911316

  6. [Epileptic seizures in childhood: from seizure type to diagnosis].

    PubMed

    Milh, M; Ticus, I; Villeneuve, N; Hugonencq, C; Mancini, J; Chabrol, B

    2008-02-01

    Epileptic seizures can be difficult to recognize in infancy and childhood because the semeiology can be misleading. Already, in the acute phase, precise assessment of the seizure is required, with active questioning about circumstances of occurrence, clinical manifestations and postictal symptoms. Laboratory tests and toxicologic screening should only be performed according to the circumstances and clinical examination in order to distinguish between symptomatic seizure and epilepsy at the beginning. Epilepsy consists in repetition of several unprovoked epileptic seizure. Assessment of the age of onset, type of seizures, interictal EEG and the neuropsychological profile are instrumental for both the diagnosis of epileptic syndrome and the choice of the right treatment. Epileptic seizures cause distress to parents and the fear they experience of death must always be taken into account.

  7. Long-term electrical stimulation at ear and electro-acupuncture at ST36-ST37 attenuated COX-2 in the CA1 of hippocampus in kainic acid-induced epileptic seizure rats.

    PubMed

    Liao, En-Tzu; Tang, Nou-Ying; Lin, Yi-Wen; Liang Hsieh, Ching

    2017-03-28

    Seizures produce brain inflammation, which in turn enhances neuronal excitability. Therefore, anti-inflammation has become a therapeutic strategy for antiepileptic treatment. Cycloxygenase-2 (COX-2) plays a critical role in postseizure brain inflammation and neuronal hyperexcitability. Our previous studies have shown that both electrical stimulation (ES) at the ear and electro-acupuncture (EA) at the Zusanli and Shangjuxu acupoints (ST36-ST37) for 6 weeks can reduce mossy fiber sprouting, spike population, and high-frequency hippocampal oscillations in kainic acid (KA)-induced epileptic seizure rats. This study further investigated the effect of long-term ear ES and EA at ST36-ST37 on the inflammatory response in KA-induced epileptic seizure rats. Both the COX-2 levels in the hippocampus and the number of COX-2 immunoreactive cells in the hippocampal CA1 region were increased after KA-induced epileptic seizures, and these were reduced through the 6-week application of ear ES or EA at ST36-ST37. Thus, long-term ear ES or long-term EA at ST36-ST37 have an anti-inflammatory effect, suggesting that they are beneficial for the treatment of epileptic seizures.

  8. Epileptic seizure induced by fennel essential oil.

    PubMed

    Skalli, Souad; Soulaymani Bencheikh, Rachida

    2011-09-01

    An epileptic seizure is reported in a 38-year-old woman, known to be an epileptic patient. Although she was under antiepileptic treatment and had well-controlled epilepsy, she developed a typical generalised tonic-clonic seizure and remained unconscious for 45 minutes following ingestion of a number of cakes containing an unknown quantity of fennel essential oil. Involuntary diarrhoea accompanied her epileptic seizure. This reported case recalls the fact that fennel essential oil can induce seizures and that this oil should probably be avoided by patients with epilepsy. Labelling of products with fennel essential oil should refer to the risk of seizures, particularly for patients with epilepsy. An awareness programme should involve all stakeholders affected by this issue.

  9. Localizing epileptic seizure onsets with Granger causality

    NASA Astrophysics Data System (ADS)

    Adhikari, Bhim M.; Epstein, Charles M.; Dhamala, Mukesh

    2013-09-01

    Accurate localization of the epileptic seizure onset zones (SOZs) is crucial for successful surgery, which usually depends on the information obtained from intracranial electroencephalography (IEEG) recordings. The visual criteria and univariate methods of analyzing IEEG recordings have not always produced clarity on the SOZs for resection and ultimate seizure freedom for patients. Here, to contribute to improving the localization of the SOZs and to understanding the mechanism of seizure propagation over the brain, we applied spectral interdependency methods to IEEG time series recorded from patients during seizures. We found that the high-frequency (>80 Hz) Granger causality (GC) occurs before the onset of any visible ictal activity and causal relationships involve the recording electrodes where clinically identifiable seizures later develop. These results suggest that high-frequency oscillatory network activities precede and underlie epileptic seizures, and that GC spectral measures derived from IEEG can assist in precise delineation of seizure onset times and SOZs.

  10. [Semiology and propagation of epileptic seizures].

    PubMed

    Gellner, A-K; Fritsch, B

    2013-06-01

    The evaluation of episodic seizure-like symptoms is a common challenge in the neurologist's daily routine. The clinical signs (semiology) are the most important puzzle pieces to distinguish epileptic seizures from other episodic entities. Due to the often far-reaching health and social consequences of the diagnosis of epilepsy, the early and rigorous assessment of episodic symptoms by means of the patient history is important. This assessment is based on knowledge of the association of certain semiologies with epileptic syndromes and brain regions; however, certain limitations and pitfalls have to be considered. Typical propagation pathways of seizure activity determine the serial occurrence of semiological features and provide supplementary information.

  11. Epileptic seizure after treatment with thiocolchicoside

    PubMed Central

    Giavina-Bianchi, Pedro; Giavina-Bianchi, Mara; Tanno, Luciana Kase; Ensina, Luis Felipe Chiaverini; Motta, Antôno Abílio; Kalil, Jorge

    2009-01-01

    Background: Adverse drug reactions are important determinants of inpatient and outpatient morbidity. Thiocolchicoside is a semisynthetic derivate of naturally occurring colchicoside, which is largely used in humans as a centrally acting muscle relaxant. Epileptic seizures after thiocolchicoside intake have been reported in individuals with a history of epilepsy, acute brain injury or possible blood–brain barrier disruption. Case report: We report the case of a 66-year-old male patient presenting a sudden epileptic seizure temporally related to the intake of thiocolchicoside for muscle contracture and pain. The probably causes of the seizures were thiocolchicoside intake and cerebral microhemorrhages attributed to cerebral amyloid angiopathy. Discussion: Drugs only rarely cause focal seizures. Our case indicates that thiocolchicoside can precipitate seizures in predisposed patients, and that its use should be avoided in patients with brain diseases (and therefore lower seizure thresholds) or blood–brain barrier disruption. This information should be provided in the drug package insert. PMID:19707540

  12. [Research advances in circadian rhythm of epileptic seizures].

    PubMed

    Yang, Wen-Qi; Li, Hong

    2017-01-01

    The time phase of epileptic seizures has attracted more and more attention. Epileptic seizures have their own circadian rhythm. The same type of epilepsy has different seizure frequencies in different time periods and states (such as sleeping/awakening state and natural day/night cycle). The circadian rhythm of epileptic seizures has complex molecular and endocrine mechanisms, and currently there are several hypotheses. Clarification of the circadian rhythm of epileptic seizures and prevention and administration according to such circadian rhythm can effectively control seizures and reduce the adverse effects of drugs. The research on the circadian rhythm of epileptic seizures provides a new idea for the treatment of epilepsy.

  13. Nonlinear analysis of EEG for epileptic seizures

    SciTech Connect

    Hively, L.M.; Clapp, N.E.; Daw, C.S.; Lawkins, W.F.; Eisenstadt, M.L.

    1995-04-01

    We apply chaotic time series analysis (CTSA) to human electroencephalogram (EEG) data. Three epoches were examined: epileptic seizure, non-seizure, and transition from non-seizure to seizure. The CTSA tools were applied to four forms of these data: raw EEG data (e-data), artifact data (f-data) via application of a quadratic zero-phase filter of the raw data, artifact-filtered data (g- data) and that was the residual after subtracting f-data from e-data, and a low-pass-filtered version (h-data) of g-data. Two different seizures were analyzed for the same patient. Several nonlinear measures uniquely indicate an epileptic seizure in both cases, including an abrupt decrease in the time per wave cycle in f-data, an abrupt increase in the Kolmogorov entropy and in the correlation dimension for e-h data, and an abrupt increase in the correlation dimension for e-h data. The transition from normal to seizure state also is characterized by distinctly different trends in the nonlinear measures for each seizure and may be potential seizure predictors for this patient. Surrogate analysis of e-data shows that statistically significant nonlinear structure is present during the non-seizure, transition , and seizure epoches.

  14. Adaptive electric field control of epileptic seizures.

    PubMed

    Gluckman, B J; Nguyen, H; Weinstein, S L; Schiff, S J

    2001-01-15

    We describe a novel method of adaptively controlling epileptic seizure-like events in hippocampal brain slices using electric fields. Extracellular neuronal activity is continuously recorded during field application through differential extracellular recording techniques, and the applied electric field strength is continuously updated using a computer-controlled proportional feedback algorithm. This approach appears capable of sustained amelioration of seizure events in this preparation when used with negative feedback. Seizures can be induced or enhanced by using fields of opposite polarity through positive feedback. In negative feedback mode, such findings may offer a novel technology for seizure control. In positive feedback mode, adaptively applied electric fields may offer a more physiological means of neural modulation for prosthetic purposes than previously possible.

  15. Do oral contraceptives increase epileptic seizures?

    PubMed

    Reddy, Doodipala Samba

    2017-02-01

    Hormonal contraceptives are used by over 100 million people worldwide. Recently, there has been an emerging interest in studying the potential impact of oral contraceptives (OCs) on certain neurological conditions. It has been suspected for some time that hormonal birth control increases seizure activity in women with epilepsy, but there is little supportive data. Areas covered: Literature from PubMed and online sources was analyzed with respect to hormonal contraception and epilepsy or seizures. New evidence indicates that OCs can cause an increase in seizures in women with epilepsy. The epilepsy birth control registry, which surveyed women with epilepsy, found that those using hormonal contraceptives self-reported 4.5 times more seizures than those that did not use such contraceptives. A preclinical study confirmed these outcomes wherein epileptic animals given ethinyl estradiol, the primary component of OCs, had more frequent seizures that are more likely to be resistant. Expert commentary: OC pills may increase seizures in women with epilepsy and such refractory seizures are more likely to cause neuronal damage in the brain. Thus, women of child bearing age with epilepsy should consider using non-hormonal forms of birth control to avoid risks from OC pills. Additional research into the mechanisms and prospective clinical investigation are needed.

  16. Relations between epileptic seizures and headaches.

    PubMed

    Gameleira, Fernando Tenório; Ataíde, Luiz; Raposo, Maria Cristina Falcão

    2013-10-01

    To describe headaches in patients with epilepsy and try to identify relations between epileptic seizures and headaches. Cross-sectional study, with 304 patients from the epilepsy out-patient section of University Hospital of Federal University of Alagoas (Brazil) between February 2007 and February 2008. The presence of headaches and their relationships with the epileptic seizures were analyzed. Frequent seizures were associated with a greater tendency of occurrence of headaches (odds ratio=1.6 times, p=0.077). Headaches occurred in 66.1% of the cases. The highest occurrence was of migraine (32.9% of the patients), followed by tension-type headaches (9.2%). Two syndromes with a continuum epilepsy-migraine in the same seizure are worth mentioning: migralepsy in 6.6% and epilepgraine in 10.2% of the patients with epilepsy. A high prevalence of headaches in patients with epilepsy was observed, with emphasis on hybrid crises of epilepsy and migraine. Copyright © 2013 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  17. Cerebrospinal fluid findings after epileptic seizures.

    PubMed

    Chatzikonstantinou, Anastasios; Ebert, Anne D; Hennerici, Michael G

    2015-12-01

    We aimed to evaluate ictally-induced CSF parameter changes after seizures in adult patients without acute inflammatory diseases or infectious diseases associated with the central nervous system. In total, 151 patients were included in the study. All patients were admitted to our department of neurology following acute seizures and received an extensive work-up including EEG, cerebral imaging, and CSF examinations. CSF protein elevation was found in most patients (92; 60.9%) and was significantly associated with older age, male sex, and generalized seizures. Abnormal CSF-to-serum glucose ratio was found in only nine patients (5.9%) and did not show any significant associations. CSF lactate was elevated in 34 patients (22.5%) and showed a significant association with focal seizures with impaired consciousness, status epilepticus, the presence of EEG abnormalities in general and epileptiform potentials in particular, as well as epileptogenic lesions on cerebral imaging. Our results indicate that non-inflammatory CSF elevation of protein and lactate after epileptic seizures is relatively common, in contrast to changes in CSF-to-serum glucose ratio, and further suggest that these changes are caused by ictal activity and are related to seizure type and intensity. We found no indication that these changes may have further-reaching pathological implications besides their postictal character.

  18. Epileptic Seizure Detection and Warning Device

    SciTech Connect

    Elarton, J.K.; Koepsel, K.L.

    1999-06-21

    Flint Hills Scientific, L.L.C. (FHS) has invented what is believed to be the first real-time epileptic seizure detection and short-term prediction method in the world. They have demonstrated an IBM PC prototype with a multi-channel EEG monitoring configuration. This CRADA effort applied AlliedSignal FM and T hardware design, manufacturing miniaturization, and high quality manufacturing expertise in converting the prototype into a small, portable, self-contained, multi-channel EEG epileptic seizure detection and warning device. The purpose of this project was to design and build a proof-of-concept miniaturized prototype of the FHS-developed PC-based prototype. The resultant DSP prototype, measuring 4'' x 6'' x 2'', seizure detection performance compared favorably with the FHS PC prototype, thus validating the DSP design goals. The very successful completion of this project provided valuable engineering information for FHS for future prototype commercialization as well as providing AS/FM and T engineers DSP design experience.

  19. [Psychogenic non epileptic seizures: a review].

    PubMed

    Auxéméry, Y; Hubsch, C; Fidelle, G

    2011-04-01

    This paper summarizes the recent literature on the phenomena of psychogenic non epileptic seizures (PNES). DEFINITION AND EPIDEMIOLOGY: PNES are, as altered movement, sensation or experience, similar to epilepsy, but caused by a psychological process. Although in the ICD-10, PNES belong to the group of dissociative disorders, they are classified as somatoform disorders in the DSM-IV. That represents a challenging diagnosis: the mean latency between manifestations and diagnosis remains as long as 7 years. It has been estimated that between 10 and 30% of patients referred to epilepsy centers have paroxysmal events that despite looking like epileptic episodes are in fact non-epileptic. Many pseudo epileptic seizures have received the wrong diagnosis of epilepsy being treated with anticonvulsants. The prevalence of epilepsy in PNES patients is higher than in the general population and epilepsy may be a risk factor for PNES. It has been considered that 65 to 80% of PNES patients are young females but a new old men subgroup has been recently described. POSITIVE DIAGNOSIS AND PSYCHIATRIC COMORBIDITIES: Even if clinical characteristics of seizures were defined as important in the diagnosis algorithm, this point of view could be inadequate because of its lack of sensitivity. Because neuron-specific enolase, prolactin and creatine kinase are not reliable and able to validate the diagnosis, video electroencephalography monitoring (with or without provocative techniques) is currently the gold standard for the differential diagnosis of ES, and PNES patients with pseudoseizures have high rates of psychiatric disorders such as depression, anxiety, somatoform symptoms, dissociative disorders and post-traumatic stress disorder. We found evidence for correlations between childhood trauma, history of childhood abuse, PTSD, and PNES diagnoses. PNES could also be hypothesized of a dissociative phenomena generated by childhood trauma. Some authors report that PNES can be associated with

  20. Emergence of semiology in epileptic seizures.

    PubMed

    Chauvel, Patrick; McGonigal, Aileen

    2014-09-01

    Semiology, the manifestation of epilepsy, is dependent upon electrical activity produced by epileptic seizures that are organized within existing neural pathways. Clinical signs evolve as the epileptic discharge spreads in both time and space. Studying the relation between these, of which the temporal component is at least as important as the spatial one, is possible using anatomo-electro-clinical correlations of stereoelectroencephalography (SEEG) data. The period of semiology production occurs with variable time lag after seizure onset and signs then emerge more or less rapidly depending on seizure type (temporal seizures generally propagating more slowly and frontal seizures more quickly). The subset of structures involved in semiological production, the "early spread network", is tightly linked to those constituting the epileptogenic zone. The level of complexity of semiological features varies according to the degree of involvement of the primary or associative cortex, with the former having a direct relation to peripheral sensory and motor systems with production of hallucinations (visual and auditory) or elementary sensorimotor signs. Depending on propagation pattern, these signs can occur in a "march" fashion as described by Jackson. On the other hand, seizures involving the associative cortex, having a less direct relation with the peripheral nervous system, and necessarily involving more widely distributed networks manifest with altered cognitive and/or behavioral signs whose neural substrate involves a network of cortical structures, as has been observed for normal cognitive processes. Other than the anatomical localization of these structures, the frequency of the discharge is a crucial determinant of semiological effect since a fast (gamma) discharge will tend to deactivate normal function, whereas a slower theta discharge can mimic physiological function. In terms of interaction between structures, the degree of synchronization plays a key role in

  1. Comparing maximum autonomic activity of psychogenic non-epileptic seizures and epileptic seizures using heart rate variability.

    PubMed

    Jeppesen, Jesper; Beniczky, Sándor; Johansen, Peter; Sidenius, Per; Fuglsang-Frederiksen, Anders

    2016-04-01

    The semiology of psychogenic non-epileptic seizures (PNES) can resemble epileptic seizures, and differentiation between epileptic seizures with no EEG-correlate and PNES can be challenging even for trained experts. Therefore, there has been a search for a quantitative measure, other than EEG and semiology that could distinguish PNES from epileptic seizures. We used ECG to measure heart rate variability (HRV) in order to compare maximum autonomic activity of epileptic seizures and PNES. These comparisons could potentially serve as biomarkers for distinguishing these types of clinical episodes. Forty-nine epileptic seizures from 17 patients and 24 PNES from 7 patients with analyzable ECG were recorded during long-term video-EEG monitoring. Moving windows of 100 R-R intervals throughout each seizure were used to find maximum values of Cardiac Sympathetic Index (CSI) (sympathetic tonus) and minimum values of Cardiac Vagal Index (CVI), Root-Mean-Square-of-Successive-Differences (RMSSD) and HF-power (parasympathetic tonus). In addition, non-seizure recordings of each patient were used to compare HRV-parameters between the groups. The maximum CSI for epilepsy seizures were higher than PNES (P=0.015). The minimum CVI, minimum RMSSD and HF-power did not show significant difference between epileptic seizures and PNES (P=0.762; P=0.152; P=0.818). There were no statistical difference of non-seizure HRV-parameters between the PNES and epilepsy patients. We found the maximum sympathetic activity accompanying the epileptic seizures to be higher, than that during the PNES. However, the great variation of autonomic response within both groups makes it difficult to use these HRV-measures as a sole measurement in distinguishing epileptic seizures from PNES. Copyright © 2016 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  2. Epileptic Seizures From Abnormal Networks: Why Some Seizures Defy Predictability

    PubMed Central

    Azhar, Feraz; Kudela, Pawel; Bergey, Gregory K.; Franaszczuk, Piotr J.

    2011-01-01

    Summary Seizure prediction has proven to be difficult in clinically realistic environments. Is it possible that fluctuations in cortical firing could influence the onset of seizures in an ictal zone? To test this, we have now used neural network simulations in a computational model of cortex having a total of 65,536 neurons with intercellular wiring patterned after histological data. A spatially distributed Poisson driven background input representing the activity of neighboring cortex affected 1% of the neurons. Gamma distributions were fit to the interbursting phase intervals, a non-parametric test for randomness was applied, and a dynamical systems analysis was performed to search for period-1 orbits in the intervals. The non-parametric analysis suggests that intervals are being drawn at random from their underlying joint distribution and the dynamical systems analysis is consistent with a nondeterministic dynamical interpretation of the generation of bursting phases. These results imply that in a region of cortex with abnormal connectivity analogous to a seizure focus, it is possible to initiate seizure activity with fluctuations of input from the surrounding cortical regions. These findings suggest one possibility for ictal generation from abnormal focal epileptic networks. This mechanism additionally could help explain the difficulty in predicting partial seizures in some patients. PMID:22169211

  3. Epileptic seizures from abnormal networks: why some seizures defy predictability.

    PubMed

    Anderson, William S; Azhar, Feraz; Kudela, Pawel; Bergey, Gregory K; Franaszczuk, Piotr J

    2012-05-01

    Seizure prediction has proven to be difficult in clinically realistic environments. Is it possible that fluctuations in cortical firing could influence the onset of seizures in an ictal zone? To test this, we have now used neural network simulations in a computational model of cortex having a total of 65,536 neurons with intercellular wiring patterned after histological data. A spatially distributed Poisson driven background input representing the activity of neighboring cortex affected 1% of the neurons. Gamma distributions were fit to the interbursting phase intervals, a non-parametric test for randomness was applied, and a dynamical systems analysis was performed to search for period-1 orbits in the intervals. The non-parametric analysis suggests that intervals are being drawn at random from their underlying joint distribution and the dynamical systems analysis is consistent with a nondeterministic dynamical interpretation of the generation of bursting phases. These results imply that in a region of cortex with abnormal connectivity analogous to a seizure focus, it is possible to initiate seizure activity with fluctuations of input from the surrounding cortical regions. These findings suggest one possibility for ictal generation from abnormal focal epileptic networks. This mechanism additionally could help explain the difficulty in predicting partial seizures in some patients. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Epileptic Seizure Forewarning by Nonlinear Techniques

    SciTech Connect

    Hively, LM

    2001-02-05

    Nicolet Biomedical Inc. (NBI) is collaborating with Oak Ridge National Laboratory (ORNL) under a Cooperative Research and Development Agreement (CRADA) to convert ORNL.s patented technology for forewarning of epileptic seizures to a clinical prototype. This technical report describes the highlights of the first year.s effort. The software requirements for the clinical device were specified from which the hardware specifications were obtained. ORNL's research-class FORTRAN was converted to run under a graphical user interface (GUI) that was custom-built for this application by NBI. The resulting software package was cloned to desktop computers that are being tested in five different clinical sites. Two hundred electroencephalogram (EEG) datasets from those clinical sites were provided to ORNL for detailed analysis and improvement of the forewarning methodology. Effort under this CRADA is continuing into the second year as planned.

  5. Absinthe, epileptic seizures and Valentin Magnan.

    PubMed

    Eadie, M J

    2009-03-01

    Absinthe is an alcoholic liquor containing extracts from the wormwood plant. It was widely consumed in France in the late nineteenth century. Its production was banned in 1915, partly because it was thought to cause neurological disturbances, including mental changes and epileptic seizures. Modern knowledge of an acceptable content of the convulsant alpha-thujone in absinthe has allowed the lifting of the production bans, and called into question the experimental work of Valentin Magnan in the 1870s, which formed the scientific background to the campaign against absinthe. An examination of Magnan's published investigations suggests that his science was very adequate by the standards of his time, and that he had shown that an alcohol-soluble component of wormwood did produce lapses of consciousness, myoclonic jerks and tonic-clonic convulsions in animals. Whether that component, presumably thujone, was present at convulsant concentrations in some of the available absinthes of Magnan's time cannot now be known.

  6. Hypnotic induction of an epileptic seizure: a brief communication.

    PubMed

    Bryant, R A; Somerville, E

    1995-07-01

    This case study investigated the utility of hypnosis to precipitate a seizure in a patient with refractory epilepsy. The patient was twice administered a hypnotic induction and a suggestion to age regress to a day when he was distressed and suffered repeated seizures. The patient did not respond to the first hypnotic suggestion; however, an epileptic seizure was observed in the second hypnotic session. Videorecording and subdural electroencephalograph recording confirmed that he suffered an epileptic seizure. Postexperimental inquiry revealed that the patient used deliberate cognitive strategies to avoid seizure onset in the first session but adopted a more constructive cognitive style in the second session. Findings are discussed in terms of emotions, hypnosis, and cognitive style as mediating factors in the experimental precipitation of epileptic seizures.

  7. Block term decomposition for modelling epileptic seizures

    NASA Astrophysics Data System (ADS)

    Hunyadi, Borbála; Camps, Daan; Sorber, Laurent; Paesschen, Wim Van; Vos, Maarten De; Huffel, Sabine Van; Lathauwer, Lieven De

    2014-12-01

    Recordings of neural activity, such as EEG, are an inherent mixture of different ongoing brain processes as well as artefacts and are typically characterised by low signal-to-noise ratio. Moreover, EEG datasets are often inherently multidimensional, comprising information in time, along different channels, subjects, trials, etc. Additional information may be conveyed by expanding the signal into even more dimensions, e.g. incorporating spectral features applying wavelet transform. The underlying sources might show differences in each of these modes. Therefore, tensor-based blind source separation techniques which can extract the sources of interest from such multiway arrays, simultaneously exploiting the signal characteristics in all dimensions, have gained increasing interest. Canonical polyadic decomposition (CPD) has been successfully used to extract epileptic seizure activity from wavelet-transformed EEG data (Bioinformatics 23(13):i10-i18, 2007; NeuroImage 37:844-854, 2007), where each source is described by a rank-1 tensor, i.e. by the combination of one particular temporal, spectral and spatial signature. However, in certain scenarios, where the seizure pattern is nonstationary, such a trilinear signal model is insufficient. Here, we present the application of a recently introduced technique, called block term decomposition (BTD) to separate EEG tensors into rank- ( L r , L r ,1) terms, allowing to model more variability in the data than what would be possible with CPD. In a simulation study, we investigate the robustness of BTD against noise and different choices of model parameters. Furthermore, we show various real EEG recordings where BTD outperforms CPD in capturing complex seizure characteristics.

  8. Evolving functional network properties and synchronizability during human epileptic seizures

    NASA Astrophysics Data System (ADS)

    Schindler, Kaspar A.; Bialonski, Stephan; Horstmann, Marie-Therese; Elger, Christian E.; Lehnertz, Klaus

    2008-09-01

    We assess electrical brain dynamics before, during, and after 100 human epileptic seizures with different anatomical onset locations by statistical and spectral properties of functionally defined networks. We observe a concave-like temporal evolution of characteristic path length and cluster coefficient indicative of a movement from a more random toward a more regular and then back toward a more random functional topology. Surprisingly, synchronizability was significantly decreased during the seizure state but increased already prior to seizure end. Our findings underline the high relevance of studying complex systems from the viewpoint of complex networks, which may help to gain deeper insights into the complicated dynamics underlying epileptic seizures.

  9. Quadriplegia Following Epileptic Seizure : Things to Keep in Mind.

    PubMed

    Kozak, Hasan Hüseyin; Yeşilbudak, Zülal; Şişman, Lokman; Uca, Ali Ulvi

    2016-05-01

    People with epilepsy are believed to be at a higher risk of incurring accidental injury than people who do not have seizures. The incidence of injury, either due to seizure or accident as a consequent of seizure is also high and varies from 0.03% to 3%. The most common injuries are head contusions, lacerations, burns and fractures. In this article, we present a case of quadriplegia after a generalized epileptic seizure.

  10. Quadriplegia Following Epileptic Seizure : Things to Keep in Mind

    PubMed Central

    Yeşilbudak, Zülal; Şişman, Lokman; Uca, Ali Ulvi

    2016-01-01

    People with epilepsy are believed to be at a higher risk of incurring accidental injury than people who do not have seizures. The incidence of injury, either due to seizure or accident as a consequent of seizure is also high and varies from 0.03% to 3%. The most common injuries are head contusions, lacerations, burns and fractures. In this article, we present a case of quadriplegia after a generalized epileptic seizure. PMID:27226869

  11. [Psychogenic non epileptic events and frontal lobe seizures].

    PubMed

    Epstein, Ana J; Thomson, Alfredo E

    2010-01-01

    The distinction between epilepsy and psychogenic non epileptic events or seizures (PNES) has been made since the middle of the first millennium (B.C.) Psychogenic non epileptic seizures (PNES) resemble epileptic seizures presenting as paroxysmal, involuntary, time-limited alterations in behaviour, motor activity, autonomic function, consciousness, or sensation. However, unlike epilepsy, NES do not result from epileptogenic pathology and are not accompanied by an epileptiform pattern during an ictal electroencephalogram (EEG). This article reviews the concept of psychogenic non epileptic events, its contemporary assessment including diagnostic and therapeutic issues, as well as the complexity related to various nosological topics. The PNES are a hallmark of an ancient illness, hysteria, which wanders between the somatoform and the dissociative disorders in the contemporary classification systems. With the availability of video electroencephalography (video-EEG), it has been possible to define more strictly the limits between epileptic and non epileptic disorders, avoiding unnecessary and even iatrogenic and invasive treatments. We also describe the clinical presentation and diagnosis of frontal lobe seizures, especially those that might be mistakenly diagnosed as psychogenic events. The frontal lobes are the largest cortical region from which seizures can arise; complex and/ or bizarre behavioural clinical presentations are frequent. In addition, some patients with epilepsy can also present non epileptic events.

  12. Content analysis of subjective experiences in partial epileptic seizures.

    PubMed

    Johanson, Mirja; Valli, Katja; Revonsuo, Antti; Wedlund, Jan-Eric

    2008-01-01

    A new content analysis method for systematically describing the phenomenology of subjective experiences in connection with partial epileptic seizures is described. Forty patients provided 262 descriptions of subjective experience relative to their partial epileptic seizures. The results revealed that subjective experiences during seizures consist mostly of sensory and bodily sensations, hallucinatory experiences, and thinking. The majority of subjective experiences during seizures are bizarre and distorted; nevertheless, the patients are able to engage in adequate behavior. To the best of our knowledge, this is the first study for which detailed subjective seizure descriptions were collected immediately after each seizure and the first study in which the content of verbal reports of subjective experiences during seizures, including both the ictal and postictal experiences, has been analyzed in detail.

  13. A Novel Dynamic Update Framework for Epileptic Seizure Prediction

    PubMed Central

    Wang, Minghui; Hong, Xiaojun; Han, Jie

    2014-01-01

    Epileptic seizure prediction is a difficult problem in clinical applications, and it has the potential to significantly improve the patients' daily lives whose seizures cannot be controlled by either drugs or surgery. However, most current studies of epileptic seizure prediction focus on high sensitivity and low false-positive rate only and lack the flexibility for a variety of epileptic seizures and patients' physical conditions. Therefore, a novel dynamic update framework for epileptic seizure prediction is proposed in this paper. In this framework, two basic sample pools are constructed and updated dynamically. Furthermore, the prediction model can be updated to be the most appropriate one for the prediction of seizures' arrival. Mahalanobis distance is introduced in this part to solve the problem of side information, measuring the distance between two data sets. In addition, a multichannel feature extraction method based on Hilbert-Huang transform and extreme learning machine is utilized to extract the features of a patient's preseizure state against the normal state. At last, a dynamic update epileptic seizure prediction system is built up. Simulations on Freiburg database show that the proposed system has a better performance than the one without update. The research of this paper is significantly helpful for clinical applications, especially for the exploitation of online portable devices. PMID:25050381

  14. Asynchronous electrical activity in epileptic seizures

    NASA Astrophysics Data System (ADS)

    Holman, Katherine; Lim, Eugene; Gliske, Stephen; Stacey, William; Fink, Christian

    High-frequency oscillations (HFOs) have been postulated to be potential biomarkers for focal epileptic seizures, with fast ripples (>250 Hz) as the most interesting candidate. The mechanisms underlying the generation of fast ripples, however, are not well understood. In this study, we draw upon results from previous computational studies on HFOs to develop a new mathematical model from first principles describing the generation of HFOs through asynchronous neuronal firing. Asynchrony in the model is obtained with the introduction of two parameters of heterogeneity: variability in the inter-spike interval (ISI) and jitter. The model predicts the generation of harmonic narrow-band oscillations if the heterogeneity-governing parameters do not differ from the predefined ISI by more than 20%. Comparisons against results from a separately constructed computational model verify the accuracy of the model in study. These results provide us with a rigorous framework in which we may investigate the mechanisms driving the generation of abnormal HFOs, and may serve as groundwork for future research in epileptogenesis. Nsf Grant 1003992, Ohio Wesleyan University SSRP.

  15. [Neurophysiological markers of generalized and focal epileptic seizures].

    PubMed

    Kravtsova, E Yu; Shulakova, K V

    To identify neurophysiological markers of focal and generalized epileptic seizures in the inter-epileptic period. Sixty-four patients, including 36 with isolated generalized tonic-clonic seizures and 28 with focal seizures, were examined. The control group consisted of 27 healthy people. EEG-video monitoring and bioelectric activity analysis of the brain during wakefulness and day sleep, spectral EEG analysis, quantitative and quality indicators of sleep were used. In generalized epileptic seizures, alpha rhythm is predominantly recorded in the left hemisphere. In wakefulness, the focal epileptiform activity develops during the first two stages of day sleep. In focal epileptic seizures, delta and beta-2 rhythms were recorded in the left hemisphere, regional epileptiform changes are aggravated during the 1st and 2nd stages of slow sleep initiated in the frontal regions. A focal component of the epileptiform activity in the inter-epileptic period in patients with different types of seizures should be taken into account in examination and treatment planning of patients who had difficulties with the diagnosis of epilepsy type.

  16. Traumatic rupture of sternocleidomastoid muscle following an epileptic seizure.

    PubMed

    Wooles, Nicola Rachel; Bell, Philip Robert; Korda, Marian

    2014-11-19

    A 29-year-old man, a known epileptic, presented to an accident and emergency department following a tonic-clonic seizure, suffering a second seizure in the department. Subsequently, he reported neck pain, swelling and stiffness. An otorhinolaryngology neck examination revealed a tender left side with two palpable masses and a reduced range of movement. Ultrasound confirmed a ruptured middle third of the left sternocleidomastoid muscle, which was successfully treated non-surgically with analgaesia and intensive physiotherapy. Uncommonly, sternocleidomastoid muscle rupture has been reported following high-velocity trauma, but to the best of our knowledge this is the first case described in the literature following an epileptic seizure.

  17. Epileptic seizure prediction by non-linear methods

    DOEpatents

    Hively, Lee M.; Clapp, Ned E.; Daw, C. Stuart; Lawkins, William F.

    1999-01-01

    Methods and apparatus for automatically predicting epileptic seizures monitor and analyze brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis tools; obtaining time serial trends in the nonlinear measures; comparison of the trend to known seizure predictors; and providing notification that a seizure is forthcoming.

  18. Epileptic seizure prediction by non-linear methods

    DOEpatents

    Hively, L.M.; Clapp, N.E.; Day, C.S.; Lawkins, W.F.

    1999-01-12

    This research discloses methods and apparatus for automatically predicting epileptic seizures monitor and analyze brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis tools; obtaining time serial trends in the nonlinear measures; comparison of the trend to known seizure predictors; and providing notification that a seizure is forthcoming. 76 figs.

  19. A novel genetic programming approach for epileptic seizure detection.

    PubMed

    Bhardwaj, Arpit; Tiwari, Aruna; Krishna, Ramesh; Varma, Vishaal

    2016-02-01

    The human brain is a delicate mix of neurons (brain cells), electrical impulses and chemicals, known as neurotransmitters. Any damage has the potential to disrupt the workings of the brain and cause seizures. These epileptic seizures are the manifestations of epilepsy. The electroencephalograph (EEG) signals register average neuronal activity from the cerebral cortex and label changes in activity over large areas. A detailed analysis of these electroencephalograph (EEG) signals provides valuable insights into the mechanisms instigating epileptic disorders. Moreover, the detection of interictal spikes and epileptic seizures in an EEG signal plays an important role in the diagnosis of epilepsy. Automatic seizure detection methods are required, as these epileptic seizures are volatile and unpredictable. This paper deals with an automated detection of epileptic seizures in EEG signals using empirical mode decomposition (EMD) for feature extraction and proposes a novel genetic programming (GP) approach for classifying the EEG signals. Improvements in the standard GP approach are made using a Constructive Genetic Programming (CGP) in which constructive crossover and constructive subtree mutation operators are introduced. A hill climbing search is integrated in crossover and mutation operators to remove the destructive nature of these operators. A new concept of selecting the Globally Prime offspring is also presented to select the best fitness offspring generated during crossover. To decrease the time complexity of GP, a new dynamic fitness value computation (DFVC) is employed to increase the computational speed. We conducted five different sets of experiments to evaluate the performance of the proposed model in the classification of different mixtures of normal, interictal and ictal signals, and the accuracies achieved are outstandingly high. The experimental results are compared with the existing methods on same datasets, and these results affirm the potential use of

  20. Assortative mixing in functional brain networks during epileptic seizures

    NASA Astrophysics Data System (ADS)

    Bialonski, Stephan; Lehnertz, Klaus

    2013-09-01

    We investigate assortativity of functional brain networks before, during, and after one-hundred epileptic seizures with different anatomical onset locations. We construct binary functional networks from multi-channel electroencephalographic data recorded from 60 epilepsy patients; and from time-resolved estimates of the assortativity coefficient, we conclude that positive degree-degree correlations are inherent to seizure dynamics. While seizures evolve, an increasing assortativity indicates a segregation of the underlying functional network into groups of brain regions that are only sparsely interconnected, if at all. Interestingly, assortativity decreases already prior to seizure end. Together with previous observations of characteristic temporal evolutions of global statistical properties and synchronizability of epileptic brain networks, our findings may help to gain deeper insights into the complicated dynamics underlying generation, propagation, and termination of seizures.

  1. Spontaneous resolution of intractable epileptic seizures following HHV-7 infection.

    PubMed

    Yamamoto, Hitoshi; Kamiyama, Noriko; Murakami, Hiroshi; Miyamoto, Yusaku; Fukuda, Miho

    2007-04-01

    We report a three-year-old female with intractable epilepsy post West syndrome whose seizures disappeared following an acute viral infection, without changes in anti-epileptic therapy. The female infant was born at term to a healthy mother after an uneventful pregnancy and delivery. At the age of five months, she developed intractable brief tonic spasms which had a series of infantile spasms, and an electroencephalogram indicated hypsarrhythmia. She was diagnosed with West syndrome. The seizures were uncontrollable with conventional therapy, including ACTH, vigabatrin, sodium valproate, clonazepam, zonisamide, and ketogenic diet. Daily multiple generalized tonic seizures and brief tonic spasms were observed before an episode of viral infection. At the age of three years, the intractable seizures disappeared after a febrile rash illness due to human herpesvirus 7 (HHV-7) infection, without changes in anti-epileptic drugs. The disappearance of intractable epileptic seizures following acute viral infections might be related to the inflammatory or immunologic processes associated with viral infections. This is the first documented case of spontaneous remission of intractable epileptic seizures following HHV-7 infection.

  2. Neurogenesis in a young dog with epileptic seizures.

    PubMed

    Borschensky, C M; Woolley, J S; Kipar, A; Herden, C

    2012-09-01

    Epileptic seizures can lead to various reactions in the brain, ranging from neuronal necrosis and glial cell activation to focal structural disorganization. Furthermore, increased hippocampal neurogenesis has been documented in rodent models of acute convulsions. This is a report of hippocampal neurogenesis in a dog with spontaneous epileptic seizures. A 16-week-old epileptic German Shepherd Dog had marked neuronal cell proliferation (up to 5 mitotic figures per high-power field and increased immunohistochemical expression of proliferative cell nuclear antigen) in the dentate gyrus accompanied by microglial and astroglial activation. Some granule cells expressed doublecortin, a marker of immature neurons; mitotically active cells expressed neuronal nuclear antigen. No mitotic figures were found in the brain of age-matched control dogs. Whether increased neurogenesis represents a general reaction pattern of young epileptic dogs should be investigated.

  3. Characterization of epileptic seizure dynamics using Gabor atom density.

    PubMed

    Jouny, Christophe C; Franaszczuk, Piotr J; Bergey, Gregory K

    2003-03-01

    The study of epileptic electroencephalograph (EEG) dynamics can potentially provide insights into seizure onset, evolution and termination. We propose a new synthetic measure based on time-frequency decomposition to provide detailed characterization of these dynamic changes. The matching pursuit (MP) method allows for continuous time-frequency decomposition. We have developed a derivative of the MP method, the Gabor atom density method (GAD) that facilitates interpretation during the dynamic ictal period. The GAD analysis was applied to intracranial recordings of complex partial seizures (n = 43) of mesial temporal origin in 7 patients. Complex partial seizure occurrence is systematically associated with a GAD increase of 400 +/- 150%. The GAD increase coincides with the electrographical evidence of seizure onset. The similarity between seizures in a given patient is very high with uniform onset slope, maximum level and termination pattern. Global GAD responses over all channels can reveal detailed seizure propagation patterns including secondary independent foci and secondary generalization. The GAD measure based on the MP decomposition is a reliable tool to detect seizure occurrence in long-term recordings, to differentiate seizures from artifacts on a multi-channel basis and to examine patterns of seizure propagation. The reproducible GAD pattern suggests consistent changes in signal inner structure and may provide new clues about seizure dynamics and evolution. The GAD method can provide information about seizure dynamics that can contribute to methods of seizure detection. These analyses may lead to better understanding of seizure termination and help facilitate application of responsive seizure control devices in humans.

  4. Do epileptic seizures predict outcome in patients with oligodendroglioma?

    PubMed

    Mirsattari, Seyed M; Chong, Jaron J R; Hammond, Robert R; Megyesi, Joseph F; Macdonald, David R; Lee, Donald H; Cairncross, J Gregory

    2011-03-01

    Many patients with an oligodendroglioma (OD) experience seizures, some of which become refractory to anti-epileptic drugs (AEDs). This study aims (1) to quantify the rate of seizures and medically refractory epilepsy in patients with ODs; and (2) to determine if there is any association between short-term and long-term survival, and the presence and drug-responsiveness of seizures. A retrospective review was conducted of the medical records of patients who had been pathologically identified as having an OD at the London Health Sciences Centre or the London Regional Cancer Program in London, Ontario from January 1996 to July 2008. Deaths were ascertained by reviewing all hospital records. Survival analysis was performed. One-hundred sixty-six patients met inclusion criteria. Epileptic seizures were the presenting feature or occurred as part of the initial manifestation of the OD in 75.3% of patients, with 90.4% (n=150) experiencing at least one seizure and 76.5% developing epilepsy over the course of observation. Of the 150 patients with seizures, 23 experienced a single seizure (13.9% of the 166), whereas 127 patients experienced multiple seizures (76.5%). In those with multiple seizures, the epilepsy was refractory to drug treatment slightly more than half the time (54.3%). Survival analysis demonstrated consistently superior survival among those with a single seizure. Those without seizures had the worst survival rates over the first few years post-diagnosis; but then no further deaths occurred. Survival among those with refractory seizures tended to be better than among those whose seizures were drug responsive, over the first 10 years post-diagnosis. Seizures are common and may influence survival in patients with oligodendogliomas. Those who experience just one seizure appear to do best. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Anticipating epileptic seizures: from mathematics to clinical applications.

    PubMed

    Le Van Quyen, Michel

    2005-02-01

    The study of dynamical changes in the neural activity preceding an epileptic seizure allows the characterization of a preictal state several minutes prior to seizure onset. This opens new perspectives for studying the mechanisms of ictogenesis as well as for possible therapeutic interventions that represent a major breakthrough. In this review we present and discuss the results from our group in this domain using nonlinear analysis of brain signals, as well as its limitation and open questions.

  6. Prevention of epileptic seizures by taurine.

    PubMed

    El Idrissi, Abdeslem; Messing, Jeffrey; Scalia, Jason; Trenkner, Ekkhart

    2003-01-01

    Parenteral injection of kainic acid (KA), a glutamate receptor agonist, causes severe and stereotyped behavioral convulsions in mice and is used as a rodent model for human temporal lobe epilepsy. The goal of this study is to examine the potential anti-convulsive effects of the neuro-active amino acid taurine, in the mouse model of KA-induced limbic seizures. We found that taurine (43 mg/Kg, s.c.) had a significant antiepileptic effect when injected 10 min prior to KA. Acute injection of taurine increased the onset latency and reduced the occurrence of tonic seizures. Taurine also reduced the duration of tonic-clonic convulsions and mortality rate following KA-induced seizures. Furthermore, taurine significantly reduced neuronal cell death in the CA3 region of the hippocampus, the most susceptible region to KA in the limbic system. On the other hand, supplementation of taurine in drinking water (0.05%) for 4 continuous weeks failed to decrease the number or latency of partial or tonic-clonic seizures. To the contrary, we found that taurine-fed mice showed increased susceptibility to KA-induced seizures, as demonstrated by a decreased latency for clonic seizures, an increased incidence and duration of tonic-clonic seizures, increased neuronal death in the CA3 region of the hippocampus and a higher post-seizure mortality of the animals. We suggest that the reduced susceptibility to KA-induced seizures in taurine-injected mice is due to an increase in GABA receptor function in the brain which increases the inhibitory drive within the limbic system. This is supported by our in vitro data obtained in primary neuronal cultures showing that taurine acts as a low affinity agonist for GABA(A) receptors, protects neurons against kainate excitotoxic insults and modulates calcium homeostasis. Therefore, taurine is potentially capable of treating seizure-associated brain damage.

  7. Canine and feline epileptic seizures and the lunar cycle: 2,507 seizures (2000-2008).

    PubMed

    Browand-Stainback, Laura; Levesque, Donald; McBee, Matthew

    2011-01-01

    Epileptic seizures in 211 canine and feline patients diagnosed with idiopathic epilepsy were evaluated for temporal significance in relation to the lunar cycle. Seizure counts were compared among each of the eight individual lunar phases, among each of eight exact lunar phase dates, and by percent of lunar illumination using generalized estimating equations. No statistical significance was found in any of these comparisons excluding a relationship between the onset of epileptic seizures and the phases of the moon. Alteration in anticonvulsant treatment or monitoring of canine and feline patients with idiopathic epilepsy at large was not warranted based on the lunar cycle.

  8. Unsupervised EEG analysis for automated epileptic seizure detection

    NASA Astrophysics Data System (ADS)

    Birjandtalab, Javad; Pouyan, Maziyar Baran; Nourani, Mehrdad

    2016-07-01

    Epilepsy is a neurological disorder which can, if not controlled, potentially cause unexpected death. It is extremely crucial to have accurate automatic pattern recognition and data mining techniques to detect the onset of seizures and inform care-givers to help the patients. EEG signals are the preferred biosignals for diagnosis of epileptic patients. Most of the existing pattern recognition techniques used in EEG analysis leverage the notion of supervised machine learning algorithms. Since seizure data are heavily under-represented, such techniques are not always practical particularly when the labeled data is not sufficiently available or when disease progression is rapid and the corresponding EEG footprint pattern will not be robust. Furthermore, EEG pattern change is highly individual dependent and requires experienced specialists to annotate the seizure and non-seizure events. In this work, we present an unsupervised technique to discriminate seizures and non-seizures events. We employ power spectral density of EEG signals in different frequency bands that are informative features to accurately cluster seizure and non-seizure events. The experimental results tried so far indicate achieving more than 90% accuracy in clustering seizure and non-seizure events without having any prior knowledge on patient's history.

  9. Noninvasive Dynamic Imaging of Seizures in Epileptic Patients

    PubMed Central

    Tyvaert, Louise; LeVan, Pierre; Dubeau, Francois; Gotman, Jean

    2013-01-01

    Epileptic seizures are due to abnormal synchronized neuronal discharges. Techniques measuring electrical changes are commonly used to analyze seizures. Neuronal activity can be also defined by concomitant hemodynamic and metabolic changes. Simultaneous electroencephalogram (EEG)-functional MRI (fMRI) measures noninvasively with a high-spatial resolution BOLD changes during seizures in the whole brain. Until now, only a static image representing the whole seizure was provided. We report in 10 focal epilepsy patients a new approach to dynamic imaging of seizures including the BOLD time course of seizures and the identification of brain structures involved in seizure onset and discharge propagation. The first activation was observed in agreement with the expected location of the focus based on clinical and EEG data (three intracranial recordings), thus providing validity to this approach. The BOLD signal preceded ictal EEG changes in two cases. EEG-fMRI may detect changes in smaller and deeper structures than scalp EEG, which can only record activity form superficial cortical areas. This method allowed us to demonstrate that seizure onset zone was limited to one structure, thus supporting the concept of epileptic focus, but that a complex neuronal network was involved during propagation. Deactivations were also found during seizures, usually appearing after the first activation in areas close or distant to the activated regions. Deactivations may correspond to actively inhibited regions or to functional disconnection from normally active regions. This new noninvasive approach should open the study of seizure generation and propagation mechanisms in the whole brain to groups of patients with focal epilepsies. PMID:19507156

  10. Focal epileptic seizures mimicking sleep paralysis.

    PubMed

    Galimberti, Carlo Andrea; Ossola, Maria; Colnaghi, Silvia; Arbasino, Carla

    2009-03-01

    Sleep paralysis (SP) is a common parasomnia. The diagnostic criteria for SP, as reported in the International Classification of Sleep Disorders, are essentially clinical, as electroencephalography (EEG)-polysomnography (PSG) is not mandatory. We describe a subject whose sleep-related events fulfilled the diagnostic criteria for SP, even though her visual hallucinations were elementary, repetitive and stereotyped, thus differing from those usually reported by patients with SP. Video/EEG-PSG documented the focal epileptic nature of the SP-like episodes.

  11. Epileptic seizures in Neuro-Behcet disease: why some patients develop seizure and others not?

    PubMed

    Kutlu, Gulnihal; Semercioglu, Sencer; Ucler, Serap; Erdal, Abidin; Inan, Levent E

    2015-03-01

    Behcet disease (BD) is a chronic relapsing inflammatory disorder. Neuro BD (NBD) is seen in approximately 5% of all patients. The aim of this study is to investigate the frequency, type and prognosis of epileptic seizures in different forms of NBD. All files of 42 patients with NBD were evaluated between 2006 and 2012, retrospectively. The demographic data, the presentation of NBD, clinical findings including seizures, EEG and neuroimaging findings were reviewed. The mean age of patients was 35.02±8.43 years. Thirty (71.4%) patients were male; the remaining 12 of them were female. Twenty-four patients had brainstem lesions; 16 patients had cerebral venous thrombosis. Spinal cord involvement was seen in two patients. Seven patients had epileptic seizures (six partial onset seizures with or without secondary generalization). Six of them had cerebral sinus thrombosis (CVT). Four patients had a seizure as the first symptom of the thrombosis. One patient had late onset seizure due to chronic venous infarct. The other patient with seizure had brainstem involvement. The remaining was diagnosed as epilepsy before the determination of NBD. CVT seen in BD seems to be the main risk factor for epileptic seizures in patients with NBD. The prognosis is usually good especially in patients with CVT. Epileptic seizures in patients with brainstem involvement may be an indicator for poor prognosis. Superior sagittal thrombosis or cortical infarct would be predictor of seizures occurrence because of the high ratio in patients with seizures. Copyright © 2015 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  12. Detecting and localizing the foci in human epileptic seizures

    NASA Astrophysics Data System (ADS)

    Ben-Jacob, Eshel; Boccaletti, Stefano; Pomyalov, Anna; Procaccia, Itamar; Towle, Vernon L.

    2007-12-01

    We consider the electrical signals recorded from a subdural array of electrodes placed on the pial surface of the brain for chronic evaluation of epileptic patients before surgical resection. A simple and computationally fast method to analyze the interictal phase synchrony between such electrodes is introduced and developed with the aim of detecting and localizing the foci of the epileptic seizures. We evaluate the method by comparing the results of surgery to the localization predicted here. We find an indication of good correspondence between the success or failure in the surgery and the agreement between our identification and the regions actually operated on.

  13. Epileptic seizures and EEG features in juvenile systemic lupus erythematosus.

    PubMed

    Vieira-Karuta, Simone Carreiro; Silva, Izabella Celidônio Bertoldo; Liberalesso, Paulo Breno Noronha; Bandeira, Márcia; Janz, Loris; Löhr, Alfredo

    2008-09-01

    Juvenile systemic lupus erythematosus is more incident in female affecting different systems including the central nervous system. The aim of this study was to check the incidence of seizures and electroencephalographic features in these patients. It was analyzed all patients with juvenile systemic lupus erythematosus referred to the Pequeno Príncipe Hospital in Curitiba, PR, Brazil, in the year of 2007. The patients were submitted to EEG and subdivided into two groups according to the presence or absence of epileptic seizures. Mann-Whitney statistical test was used. Forty-nine cases were included, there were 73.45% female, with an age between 3 and 28 years (micro=17.00 years; s=5.01 years). Seizures (13/26.50%) were the most frequent manifestation followed by headache (13/26.50%) and ischemic stroke (6/12.25%). Cerebral vasculites were the most frequent alteration in neuroimage. The abnormalities of EEG were characterized by asymmetry of the electric cerebral activity, diffuse disorganized background activity, focal epileptiform discharges in the right central-temporal region, generalized paroxysmal of 3 Hz spike-waves, and bursts of theta-delta slowness activity in the right parietal-occiptal region. The statistic analysis showed no significantly difference between age of onset of symptoms and the risk of seizures (p 0.675) as well as between time of the disease and the risk of seizures (p 0.436). Neurologic manifestations, in special epileptic seizures, are frequent in systemic lupus erythematosus. Age of onset of symptoms and the time of disease did not increase the risk of epileptic seizures in this disease.

  14. The quantitative measurement of consciousness during epileptic seizures.

    PubMed

    Nani, Andrea; Cavanna, Andrea E

    2014-01-01

    The assessment of consciousness is a fundamental element in the classification of epileptic seizures. It is, therefore, of great importance for clinical practice to develop instruments that enable an accurate and reliable measurement of the alteration of consciousness during seizures. Over the last few years, three psychometric scales have been specifically proposed to measure ictal consciousness: the Ictal Consciousness Inventory (ICI), the Consciousness Seizure Scale (CSS), and the Responsiveness in Epilepsy Scale--versions I and II (RES-I and RES-II). The ICI is a self-report psychometric instrument which retrospectively assesses ictal consciousness along the dimensions of the level/arousal and contents/awareness. The CSS has been used by clinicians to quantify the impairment of consciousness in order to establish correlations with the brain mechanisms underlying alterations of consciousness during temporal lobe seizures. The most recently developed observer-rated instrument is the RES-I, which has been used to assess responsiveness during epileptic seizures in patients undergoing video-EEG. The implementation of standardized psychometric tools for the assessment of ictal consciousness can complement clinical observations and contribute to improve accuracy in seizure classification. © 2013.

  15. Continuous monitoring of electrodermal activity during epileptic seizures using a wearable sensor.

    PubMed

    Poh, Ming-Zher; Loddenkemper, Tobias; Swenson, Nicholas C; Goyal, Shubhi; Madsen, Joseph R; Picard, Rosalind W

    2010-01-01

    We present a novel method for monitoring sympathetic nervous system activity during epileptic seizures using a wearable sensor measuring electrodermal activity (EDA). The wearable sensor enables long-term, continuous EDA recordings from patients. Preliminary results from our pilot study suggest that epileptic seizures induce a surge in EDA. These changes are greater in generalized tonic-clonic seizures and reflect a massive sympathetic discharge. This paper offers a new approach for investigating the relationship between epileptic seizures and autonomic alterations.

  16. [Diagnosis and treatment of non-triggered single epileptic seizures].

    PubMed

    Martinez-Juarez, I E; Moreno, J; Ladino, L D; Castro, N; Hernandez-Vanegas, L; Burneo, J G; Hernandez-Ronquillo, L; Tellez-Zenteno, J F

    2016-08-16

    Epileptic seizures are one of the main reasons for neurological visits in an emergency department. Convulsions represent a traumatic event for the patient and the family, with significant medical and social consequences. Due to their prevalence and impact, the initial management is of vital importance. Although following the first epileptic seizure, early recurrence diminishes after establishing treatment with antiepileptic drugs, the forecast for developing epilepsy and long-term outcomes are not altered by any early intervention. Detailed questioning based on the symptoms of the convulsions, the patient's medical history and a full electroencephalogram and neuroimaging study make it possible to define the risk of recurrence of the seizure and the possible diagnosis of epilepsy. Epileptic abnormalities, the presence of old or new potentially epileptogenic brain lesions, as well as nocturnal seizures, increase the risk of recurrence. Physicians must assess each patient on an individual basis to determine the most suitable treatment, and explain the risk of not being treated versus the risk that exists if treatment with antiepileptic drugs is established.

  17. First seizure: EEG and neuroimaging following an epileptic seizure.

    PubMed

    Pohlmann-Eden, Bernd; Newton, Mark

    2008-01-01

    An early EEG (within 48 h) and high-resolution magnetic resonance imaging (hr_MRI) are the methods of choice for an accurate diagnosis after a first seizure presentation. Together with a careful history and examination, they will allow definition of the epilepsy syndrome in two-thirds of patients and help assess the individual risk for seizure recurrence, which is determined by the specific syndrome and is highest with focal epileptiform activity on EEG. Despite the heterogeneity of first seizure studies, EEG and etiology are consistently found to be the best predictors for seizure recurrence and prognosis. The additional yield of sleep-deprived EEG and sleep EEG is uncertain; yet MRI is essential for detecting brain tumors and other structural bases for new epilepsy. The rate occurrence of remote symptomatic seizures increases significantly with age and the most common etiology in the elderly with a first seizure is stroke; however, its exact relevance to epileptogenicity is yet to be defined. There is a striking lack of systematic studies using early EEG and hr_MRI in order to better characterize epileptogenic areas and elucidate the mechanisms of seizure provocation.

  18. Cardiac arrhythmias during or after epileptic seizures

    PubMed Central

    van der Lende, Marije; Surges, Rainer; Sander, Josemir W; Thijs, Roland D

    2016-01-01

    Seizure-related cardiac arrhythmias are frequently reported and have been implicated as potential pathomechanisms of Sudden Unexpected Death in Epilepsy (SUDEP). We attempted to identify clinical profiles associated with various (post)ictal cardiac arrhythmias. We conducted a systematic search from the first date available to July 2013 on the combination of two terms: ‘cardiac arrhythmias’ and ‘epilepsy’. The databases searched were PubMed, Embase (OVID version), Web of Science and COCHRANE Library. We attempted to identify all case reports and case series. We identified seven distinct patterns of (post)ictal cardiac arrhythmias: ictal asystole (103 cases), postictal asystole (13 cases), ictal bradycardia (25 cases), ictal atrioventricular (AV)-conduction block (11 cases), postictal AV-conduction block (2 cases), (post)ictal atrial flutter/atrial fibrillation (14 cases) and postictal ventricular fibrillation (3 cases). Ictal asystole had a mean prevalence of 0.318% (95% CI 0.316% to 0.320%) in people with refractory epilepsy who underwent video-EEG monitoring. Ictal asystole, bradycardia and AV-conduction block were self-limiting in all but one of the cases and seen during focal dyscognitive seizures. Seizure onset was mostly temporal (91%) without consistent lateralisation. Postictal arrhythmias were mostly found following convulsive seizures and often associated with (near) SUDEP. The contrasting clinical profiles of ictal and postictal arrhythmias suggest different pathomechanisms. Postictal rather than ictal arrhythmias seem of greater importance to the pathophysiology of SUDEP. PMID:26038597

  19. Cardiac arrhythmias during or after epileptic seizures.

    PubMed

    van der Lende, Marije; Surges, Rainer; Sander, Josemir W; Thijs, Roland D

    2016-01-01

    Seizure-related cardiac arrhythmias are frequently reported and have been implicated as potential pathomechanisms of Sudden Unexpected Death in Epilepsy (SUDEP). We attempted to identify clinical profiles associated with various (post)ictal cardiac arrhythmias. We conducted a systematic search from the first date available to July 2013 on the combination of two terms: 'cardiac arrhythmias' and 'epilepsy'. The databases searched were PubMed, Embase (OVID version), Web of Science and COCHRANE Library. We attempted to identify all case reports and case series. We identified seven distinct patterns of (post)ictal cardiac arrhythmias: ictal asystole (103 cases), postictal asystole (13 cases), ictal bradycardia (25 cases), ictal atrioventricular (AV)-conduction block (11 cases), postictal AV-conduction block (2 cases), (post)ictal atrial flutter/atrial fibrillation (14 cases) and postictal ventricular fibrillation (3 cases). Ictal asystole had a mean prevalence of 0.318% (95% CI 0.316% to 0.320%) in people with refractory epilepsy who underwent video-EEG monitoring. Ictal asystole, bradycardia and AV-conduction block were self-limiting in all but one of the cases and seen during focal dyscognitive seizures. Seizure onset was mostly temporal (91%) without consistent lateralisation. Postictal arrhythmias were mostly found following convulsive seizures and often associated with (near) SUDEP. The contrasting clinical profiles of ictal and postictal arrhythmias suggest different pathomechanisms. Postictal rather than ictal arrhythmias seem of greater importance to the pathophysiology of SUDEP.

  20. Epileptic Seizure Forewarning by Nonlinear Techniques

    SciTech Connect

    Hively, L.M.

    2002-04-19

    This report describes work that was performed under a Cooperative Research and Development Agreement (CRADA) between UT-Battelle, LLC (Contractor) and a commercial participant, VIASYS Healthcare Inc. (formerly Nicolet Biomedical, Inc.). The Contractor has patented technology that forewarns of impending epileptic events via scalp electroencephalograph (EEG) data and successfully demonstrated this technology on 20 datasets from the Participant under pre-CRADA effort. This CRADA sought to bridge the gap between the Contractor's existing research-class software and a prototype medical device for subsequent commercialization by the Participant. The objectives of this CRADA were (1) development of a combination of existing computer hardware and Contractor-patented software into a clinical process for warning of impending epileptic events in human patients, and (2) validation of the epilepsy warning methodology. This work modified the ORNL research-class FORTRAN for forewarning to run under a graphical user interface (GUI). The GUI-FORTRAN software subsequently was installed on desktop computers at five epilepsy monitoring units. The forewarning prototypes have run for more than one year without any hardware or software failures. This work also reported extensive analysis of model and EEG datasets to demonstrate the usefulness of the methodology. However, the Participant recently chose to stop work on the CRADA, due to a change in business priorities. Much work remains to convert the technology into a commercial clinical or ambulatory device for patient use, as discussed in App. H.

  1. Change of seizure frequency in pregnant epileptic women.

    PubMed Central

    Schmidt, D; Canger, R; Avanzini, G; Battino, D; Cusi, C; Beck-Mannagetta, G; Koch, S; Rating, D; Janz, D

    1983-01-01

    The effect of pregnancy on seizure frequency was monitored prospectively in 136 pregnancies of 122 epileptic women. Pregnancy did not influence the seizure frequency in 68 pregnancies (50%). In 50 pregnancies (37%) the number of seizures increased during pregnancy or puerperium. The seizure frequency decreased in 18 pregnancies (13%). In 34 out of 50 pregnancies (68%) the increase was associated with non-compliance with the drug regimen or sleep deprivation. In seven out of 18 pregnancies (39%) improvement was related to correction of non-compliance or sleep deprivation during the pregestational nine months. Insufficiently low plasma concentrations of antiepileptic drugs were found in 47% of the women with uncontrolled epilepsy during pregnancy. The course of epilepsy during pregnancy is primarily influenced by non-compliance, sleep deprivation during pregnancy, and inadequate therapy before and during pregnancy. With good medical attention pregnancy itself seems to have only a minimal influence on the course of epilepsy. PMID:6411866

  2. Convulsive Syncope Induced by Ventricular Arrhythmia Masquerading as Epileptic Seizures: Case Report and Literature Review

    PubMed Central

    Sabu, John; Regeti, Kalyani; Mallappallil, Mary; Kassotis, John; Islam, Hamidul; Zafar, Shoaib; Khan, Rafay; Ibrahim, Hiyam; Kanta, Romana; Sen, Shuvendu; Yousif, Abdalla; Nai, Qiang

    2016-01-01

    It is important but difficult to distinguish convulsive syncope from epileptic seizure in many patients. We report a case of a man who presented to emergency department after several witnessed seizure-like episodes. He had a previous medical history of systolic heart failure and automated implantable converter defibrillator (AICD) in situ. The differential diagnoses raised were epileptic seizures and convulsive syncope secondary to cardiac arrhythmia. Subsequent AICD interrogation revealed ventricular tachycardia and fibrillation (v-tach/fib). Since convulsive syncope and epileptic seizure share many similar clinical features, early diagnosis is critical for choosing the appropriate management and preventing sudden cardiac death in patients with presumed epileptic seizure. PMID:27429683

  3. Epileptic seizures: Quakes of the brain?

    NASA Astrophysics Data System (ADS)

    Osorio, Ivan; Frei, Mark G.; Sornette, Didier; Milton, John; Lai, Ying-Cheng

    2010-08-01

    A dynamical analogy supported by five scale-free statistics (the Gutenberg-Richter distribution of event sizes, the distribution of interevent intervals, the Omori and inverse Omori laws, and the conditional waiting time until the next event) is shown to exist between two classes of seizures (“focal” in humans and generalized in animals) and earthquakes. Increments in excitatory interneuronal coupling in animals expose the system’s dependence on this parameter and its dynamical transmutability: moderate increases lead to power-law behavior of seizure energy and interevent times, while marked ones to scale-free (power-law) coextensive with characteristic scales and events. The coextensivity of power law and characteristic size regimes is predicted by models of coupled heterogeneous threshold oscillators of relaxation and underscores the role of coupling strength in shaping the dynamics of these systems.

  4. Subjective and objective characteristics of altered consciousness during epileptic seizures.

    PubMed

    Campora, Nuria; Kochen, Silvia

    2016-02-01

    Conscious states are inner states and processes of awareness. These states are by definition subjective. We analyzed subjective and objective characteristics of alteration of consciousness (AOC) during epileptic seizures, including its involvement in both the level of awareness and subjective content of consciousness. We evaluated AOC using the Consciousness Seizure Scale, the Ictal Consciousness Inventory, and a new structured survey developed by our group: the Seizure Perception Survey, which incorporates patients' subjective experiences before and after they watch a video-electroencephalographic recording of their own seizure. We included 35 patients (105 seizures) with drug-resistant epilepsy. Most seizures caused profound AOC. The content of consciousness was lower during temporal seizures with profound AOC. We uncovered a correlation between the subjective perception and objective duration of a seizure using the Seizure Perception Survey regarding memory; the patients had a better recall of ictal onset during wakefulness regardless of the epileptogenic zone, laterality, or magnitude of AOC. Nonetheless, the recovery of memory at the end of a seizure took more time in patients who showed greater AOC, less vivid content of consciousness, or a longer seizure. For 85% of the patients, this was the first time they were able to view their own seizures. The majority of the patients requested to view them again because this procedure allowed them to compare the recordings with their own memories and emotions during a seizure and to verify the real duration of the seizure. Alteration of consciousness is one of the most dramatic clinical manifestations of epilepsy. Usually, practitioners or relatives assume that the patients with AOC may not have any knowledge on their seizures. In this study, however, we found that most patients with AOC had a fairly accurate perception of the duration of a seizure and retained their memory of ictal onset. In contrast, for the

  5. [Portable Epileptic Seizure Monitoring Intelligent System Based on Android System].

    PubMed

    Liang, Zhenhu; Wu, Shufeng; Yang, Chunlin; Jiang, Zhenzhou; Yu, Tao; Lu, Chengbiao; Li, Xiaoli

    2016-02-01

    The clinical electroencephalogram (EEG) monitoring systems based on personal computer system can not meet the requirements of portability and home usage. The epilepsy patients have to be monitored in hospital for an extended period of time, which imposes a heavy burden on hospitals. In the present study, we designed a portable 16-lead networked monitoring system based on the Android smart phone. The system uses some technologies including the active electrode, the WiFi wireless transmission, the multi-scale permutation entropy (MPE) algorithm, the back-propagation (BP) neural network algorithm, etc. Moreover, the software of Android mobile application can realize the processing and analysis of EEG data, the display of EEG waveform and the alarm of epileptic seizure. The system has been tested on the mobile phones with Android 2. 3 operating system or higher version and the results showed that this software ran accurately and steadily in the detection of epileptic seizure. In conclusion, this paper provides a portable and reliable solution for epileptic seizure monitoring in clinical and home applications.

  6. Preictal Dynamics of EEG Complexity in Intracranially Recorded Epileptic Seizure

    PubMed Central

    Bob, Petr; Roman, Robert; Svetlak, Miroslav; Kukleta, Miloslav; Chladek, Jan; Brazdil, Milan

    2014-01-01

    Abstract Recent findings suggest that neural complexity reflecting a number of independent processes in the brain may characterize typical changes during epileptic seizures and may enable to describe preictal dynamics. With respect to previously reported findings suggesting specific changes in neural complexity during preictal period, we have used measure of pointwise correlation dimension (PD2) as a sensitive indicator of nonstationary changes in complexity of the electroencephalogram (EEG) signal. Although this measure of complexity in epileptic patients was previously reported by Feucht et al (Applications of correlation dimension and pointwise dimension for non-linear topographical analysis of focal onset seizures. Med Biol Comput. 1999;37:208–217), it was not used to study changes in preictal dynamics. With this aim to study preictal changes of EEG complexity, we have examined signals from 11 multicontact depth (intracerebral) EEG electrodes located in 108 cortical and subcortical brain sites, and from 3 scalp EEG electrodes in a patient with intractable epilepsy, who underwent preoperative evaluation before epilepsy surgery. From those 108 EEG contacts, records related to 44 electrode contacts implanted into lesional structures and white matter were not included into the experimental analysis. The results show that in comparison to interictal period (at about 8–6 minutes before seizure onset), there was a statistically significant decrease in PD2 complexity in the preictal period at about 2 minutes before seizure onset in all 64 intracranial channels localized in various brain sites that were included into the analysis and in 3 scalp EEG channels as well. Presented results suggest that using PD2 in EEG analysis may have significant implications for research of preictal dynamics and prediction of epileptic seizures. PMID:25415671

  7. Aspirin attenuates spontaneous recurrent seizures in the chronically epileptic mice.

    PubMed

    Zhu, Kun; Hu, Ming; Yuan, Bo; Liu, Jian-Xin; Liu, Yong

    2017-08-01

    Neuroinflammatory processes are pathologic hallmarks of both experimental and human epilepsy, and could be implicated in the neuronal hyperexcitability. Aspirin represents one of the non-selective nonsteroidal anti-inflammatory drugs with fewer side effects in long-term application. This study was carried out to assess the anti-epileptic effects of aspirin when administered during the chronic stage of temporal lobe epilepsy [TLE] in mice. The alteration of hippocampal neurogenesis was also examined for raising a possible mechanism underlying the protective effect of anti-inflammatory treatment in the TLE. Two months after pilocarpine-induced status epilepticus, the chronically epileptic mice were treated with aspirin (20 mg, 60 mg or 80 mg/kg) once a day for 10 weeks. Spontaneous recurrent seizures were monitored by video camera for 2 weeks. To evaluate the profile of hippocampal neurogenesis, the newly generated cells in the dentate gyrus were labeled by the proliferation marker BrdU. The newborn neurons that extended axons to CA3 area were visualized by cholera toxin B subunit retrograde tracing. Administration of aspirin with a dosage of 60 mg or 80 mg/kg initiated at 2 months after pilocarpine-induced status epilepticus significantly reduced the frequency and duration of spontaneous recurrent seizures. Aspirin treatment also increased the number of newborn neurons with anatomic integration through improving the survival of the newly generated cells. Aspirin treatment during the chronic stage of TLE could attenuate the spontaneous recurrent seizures in mice. Promotion of hippocampal neurogenesis and inhibition of COX-PGE2 pathway might partly contribute to this anti-epileptic effect. Highlights • Aspirin attenuates spontaneous recurrent seizures of chronically epileptic mice • Aspirin increases neurogenesis of chronically epileptic hippocampus by improving the survival of newly generated cells • Promotion of hippocampal neurogenesis and inhibition

  8. Association of RASgrf1 methylation with epileptic seizures

    PubMed Central

    Fu, Xinwei; Zhou, Ji Xiu; Zhu, Binglin; Luo, Jing; Wang, Xuefeng; Xiao, Zheng

    2017-01-01

    DNA methylation, one of the mechanisms of epigenetic regulation, has been suggested to be related with epilepsy. RASgrf1 is a paternally imprinted gene and has a differentially methylated region (DMR) at the promoter that can silence gene expression. We have previously observed the down-regulation of RASgrf1 in the temporal neocortex of epilepsy patients and in the hippocampus of epileptic animals. Here, we further explored the dynamic change (1-day acute period, 10-day latent period and 45-day chronic phase) of DNA methylation and RASgrf1 expression after acute epileptic seizures in kainic acid (KA)-treated mice, and we observed the impact of N-phthalyl-L-tryptophan (RG108), a DNA methyltransferase (DNMT) inhibitor, on an acute epileptic model by polymerase chain reaction (PCR), western blotting, and bisulfite sequencing PCR (BSP). The results directly showed that the methylation of the RASgrf1 promoter gradually increased and reached a maximal level at the latent period, with subsequent suppression of RASgrf1 mRNA and protein expression levels, which reached a minimum level in the chronic phase. RG108 inhibited the increased methylation of the RASgrf1 gene, with significant inhibition occurring at the latent period, and restored RASgrf1 expression levels in the chronic phase. In addition, we demonstrated that RG108 could suppress acute epileptic seizures in KA-treated mice and epileptic discharges in 4-aminopyridine (4-AP)-treated hippocampal slices. These findings demonstrate that RASgrf1 is closely associated with epilepsy via the aberrant methylation of RASgrf1, and regulating the methylation status of relevant genes might be an intriguing topic in future research on epilepsy. PMID:28611277

  9. Epileptic Seizure, Postictal Hemiparesis, and Hyperleukocytosis

    PubMed Central

    Olivieri, Martin; Kurnik, Karin; Heinen, Florian; Schmid, Irene; Hoffmann, Florian; Reiter, Karl; Gerstl, Lucia

    2016-01-01

    Introduction: Acute ischemic stroke (AIS) is a rare event in infancy. Besides vasculopathy, thrombophilia, or cardiac disorders, cancer and chemotherapy are known predisposing factors for AIS. Leukemia can be associated with different abnormal coagulation parameters, but severe bleeding or thrombosis occurs rarely. Clinical Course: We report the case of a 2-year-old boy who was presented to our emergency ward after a prolonged seizure with right sided postictal hemiparesis. Cranial computed tomography scan revealed a large infarction and edema due to thrombosis of the left carotid artery, the middle cerebral artery, and the anterior cerebral artery. Laboratory workup showed 196 g/L leukocytes with 75% myeloid blast cells. Immediate exchange transfusion, hydration, and chemotherapy with cytarabine were started. During the hospital course intracranial pressure increased and the patient developed a unilateral dilated pupil unresponsive to light. Cranial computed tomography scan revealed a new infarction in the right middle cerebral artery territory. Refractory increased intracranial pressure and brain stem herniation developed, and the child died 3 days after admission to hospital. Conclusion: Seizures with postictal hemiparesis due to cerebral infarction can be a rare manifestation of acute myeloid leukemia. Leukocytosis and cancer-induced coagulopathy are main reasons for thrombosis and/or hemorrhage. High leukocyte counts need immediate interventions with hydration, careful chemotherapy, and perhaps exchange transfusion or leukapharesis. In the presence of thrombosis, anticoagulation must be discussed despite the risk of bleeding due to hyperfibrinolysis and low platelet counts. Mortality may be reduced by awareness of this rare presentation of leukemia and prompt institution of leucoreductive treatment. PMID:28229095

  10. Effect of epileptic seizures on the cerebrospinal fluid--A systematic retrospective analysis.

    PubMed

    Tumani, Hayrettin; Jobs, Catherine; Brettschneider, Johannes; Hoppner, Anselm C; Kerling, Frank; Fauser, Susanne

    2015-08-01

    Analyses of the cerebrospinal fluid (CSF) are obligatory when epileptic seizures manifest for the first time in order to exclude life-threatening causes or treatable diseases such as acute infections or autoimmune encephalitis. However, there are only few systematic investigations on the effect of seizures themselves on CSF parameters and the significance of these parameters in differential diagnosis. CSF samples of 309 patients with epileptic and 10 with psychogenic seizures were retrospectively analyzed. CSF samples were collected between 1999 and 2008. Cell counts, the albumin quotient, lactate and Tau-protein levels were determined. Findings were correlated with seizure types, seizure etiology (symptomatic, cryptogenic, occasional seizure), and seizure duration. Pathological findings were only observed in patients with epileptic but not with psychogenic seizures. The lactate concentration was elevated in 14%, the albumin quotient in 34%, and the Tau protein level in 36% of CSF samples. Cell counts were only slightly elevated in 6% of patients. Different seizure types influenced all parameters except for the cell count: In status epilepticus highest, in simple partial seizures lowest values were seen. Symptomatic partial and generalized epileptic seizures had significantly higher Tau-protein levels than cryptogenic partial seizures. In patients with repetitive and occasional epileptic seizures, higher Tau-protein levels were seen than in those with psychogenic seizures. Duration of epileptic seizures was positively correlated with the albumin quotient, lactate and Tau-protein levels. High variability of investigated CSF parameters within each subgroup rendered a clear separation between epileptic and psychogenic seizures impossible. Elevated cell counts are infrequently observed in patients with epileptic seizures and should therefore not uncritically be interpreted as a postictal phenomenon. However, blood-CSF barrier disruption, increased glucose metabolism

  11. A Computational Study of Stimulus Driven Epileptic Seizure Abatement

    PubMed Central

    Goodfellow, Marc; Dauwels, Justin; Moeller, Friederike; Stephani, Ulrich; Baier, Gerold

    2014-01-01

    Active brain stimulation to abate epileptic seizures has shown mixed success. In spike-wave (SW) seizures, where the seizure and background state were proposed to coexist, single-pulse stimulations have been suggested to be able to terminate the seizure prematurely. However, several factors can impact success in such a bistable setting. The factors contributing to this have not been fully investigated on a theoretical and mechanistic basis. Our aim is to elucidate mechanisms that influence the success of single-pulse stimulation in noise-induced SW seizures. In this work, we study a neural population model of SW seizures that allows the reconstruction of the basin of attraction of the background activity as a four dimensional geometric object. For the deterministic (noise-free) case, we show how the success of response to stimuli depends on the amplitude and phase of the SW cycle, in addition to the direction of the stimulus in state space. In the case of spontaneous noise-induced seizures, the basin becomes probabilistic introducing some degree of uncertainty to the stimulation outcome while maintaining qualitative features of the noise-free case. Additionally, due to the different time scales involved in SW generation, there is substantial variation between SW cycles, implying that there may not be a fixed set of optimal stimulation parameters for SW seizures. In contrast, the model suggests an adaptive approach to find optimal stimulation parameters patient-specifically, based on real-time estimation of the position in state space. We discuss how the modelling work can be exploited to rationally design a successful stimulation protocol for the abatement of SW seizures using real-time SW detection. PMID:25531883

  12. Immune response in the eye following epileptic seizures.

    PubMed

    Ahl, Matilda; Avdic, Una; Skoug, Cecilia; Ali, Idrish; Chugh, Deepti; Johansson, Ulrica Englund; Ekdahl, Christine T

    2016-06-27

    Epileptic seizures are associated with an immune response in the brain. However, it is not known whether it can extend to remote areas of the brain, such as the eyes. Hence, we investigated whether epileptic seizures induce inflammation in the retina. Adult rats underwent electrically induced temporal status epilepticus, and the eyes were studied 6 h, 1, and 7 weeks later with biochemical and immunohistochemical analyses. An additional group of animals received CX3CR1 antibody intracerebroventricularly for 6 weeks after status epilepticus. Biochemical analyses and immunohistochemistry revealed no increased cell death and unaltered expression of several immune-related cytokines and chemokines as well as no microglial activation, 6 h post-status epilepticus compared to non-stimulated controls. At 1 week, again, retinal cytoarchitecture appeared normal and there was no cell death or micro- or macroglial reaction, apart from a small decrease in interleukin-10. However, at 7 weeks, even if the cytoarchitecture remained normal and no ongoing cell death was detected, the numbers of microglia were increased ipsi- and contralateral to the epileptic focus. The microglia remained within the synaptic layers but often in clusters and with more processes extending into the outer nuclear layer. Morphological analyses revealed a decrease in surveying and an increase in activated microglia. In addition, increased levels of the chemokine KC/GRO and cytokine interleukin-1β were found. Furthermore, macroglial activation was noted in the inner retina. No alterations in numbers of phagocytic cells, infiltrating macrophages, or vascular pericytes were observed. Post-synaptic density-95 cluster intensity was reduced in the outer nuclear layer, reflecting seizure-induced synaptic changes without disrupted cytoarchitecture in areas with increased microglial activation. The retinal gliosis was decreased by a CX3CR1 immune modulation known to reduce gliosis within epileptic foci

  13. Epileptic Seizures Induced by a Spontaneous Carotid Cavernous Fistula

    PubMed Central

    Yildirim, Erkan

    2016-01-01

    A 79-year-old woman was admitted to our emergency department with complaints of fainting and loss of consciousness three times during the past month. She was diagnosed with epilepsy and started to be treated with antiepileptic drug. Physical examination showed, in the left eye, chemosis, limited eye movements in all directions, and minimal exophthalmos as unexisting symptoms on admission developed on the sixth day. Orbital magnetic resonance imaging (MRI) and digital subtraction angiography (DSA) imaging revealed a carotid cavernous fistula (CCF). Epileptic attacks and ophthalmic findings previously present but diagnosed during our examinations were determined to ameliorate completely after performing the coil embolization. Based on literature, we present the first case with nontraumatic CCF manifesting with epileptic seizures and intermittent eye symptoms in the present report. PMID:28077946

  14. Patterns of human local cerebral glucose metabolism during epileptic seizures

    SciTech Connect

    Engel, J. Jr.; Kuhl, D.E.; Phelps, M.E.

    1982-10-01

    Ictal patterns of local cerebral metabolic rate have been studied in epileptic patients by positron computed tomography with /sup 18/F-labeled 2-fluoro-2-deoxy-D-glucose. Partial seizures were associated with activation of anatomic structures unique to each patient studied. Ictal increases and decreases in local cerebral metabolism were observed. Scans performed during generalized convulsions induced by electroshock demonstrated a diffuse ictal increase and postictal decrease in cerebral metabolism. Petit mal absences were associated with a diffuse increase in cerebral metabolic rate. The ictal fluorodeoxyglucose patterns obtained from patients do not resemble autoradiographic patterns obtained from common experimental animal models of epilepsy.

  15. Vomiting as an ictal manifestation of epileptic seizures and syndromes.

    PubMed Central

    Panayiotopoulos, C P

    1988-01-01

    Twenty-four out of 900 adult and children patients with epilepsy, were found to have vomiting during an ictus. All the 24 patients were children before puberty with a similar clinical pattern consisting of partial seizures which were mainly nocturnal. Ictal vomiting was always concurrent with other epileptic manifestations, more often deviation of the eyes and impairment of consciousness. The initial part of the ictus was short or prolonged for hours with frequent "marching" to hemi-convulsions and generalised seizures. Seventeen of the 24 children suffered from benign childhood epilepsies (BCE) with complete remission in long follow-up. A significantly higher association was found between ictal vomiting and the syndrome of BCE with occipital spikes (p less than 0.001) but not with centro-temporal spikes (p less than 0.2). The recognition of this association may have important theoretical implications. On clinical grounds, it may prevent unnecessary investigations and undue concern. PMID:3148690

  16. Similarities in precursory features in seismic shocks and epileptic seizures

    NASA Astrophysics Data System (ADS)

    Kapiris, P. G.; Polygiannakis, J.; Li, X.; Yao, X.; Eftaxias, K. A.

    2005-02-01

    Theoretical studies suggest that the final earthquake (EQ) and neural-seizure dynamics should have many similar features and could be analyzed within similar mathematical frameworks. Herein, by monitoring the temporal evolution of the fractal spectral characteristics in EEG time series and pre-seismic electromagnetic (EM) time series we show that many similar distinctive symptoms (including common alterations in associated scaling parameters) emerge as epileptic seizures (ES) and EQs are approaching. These alterations reveal a gradual reduction of complexity as the catastrophic events approach. The transition from anti-persistent to persistent behaviour may indicate that the onset of a severe crisis is imminent. The observations find a unifying explanation within the school of the "Intermittent Criticality".

  17. Chronic alcohol use and first symptomatic epileptic seizures

    PubMed Central

    Leone, M; Tonini, C; Bogliun, G; Monaco, F; Mutani, R; Bottacchi, E; Gambaro, P; Rocci, E; Tassinari, T; Cavestro, C; Beghi, E

    2002-01-01

    Objective: To establish whether chronic alcoholism and alcohol consumption are risk factors for developing a first symptomatic epileptic seizure. Methods: Multicentre case-control study of 293 patients (160 men, 133 women) with a first seizure symptomatic (either acute or remote) of head trauma, stroke, or brain tumour, matched to 444 hospital controls for centre, sex, age (±5 years), and underlying pathology. Results: The risk of first seizure in alcoholics was no higher than in non-alcoholics for men (odds ratio 1.2, 95% confidence interval 0.4 to 3.2) or women (1.5, 0.1 to 54.4). The odds ratio (both sexes) was 1.2 (0.8 to 1.7) for an average intake of absolute alcohol of 1–25 g/day, 0.9 (0.5 to 1.5) for 26–50 g/day, 1.6 (0.8 to 3.0) for 51–100 g/day, and 1.4 (0.5 to 3.5) for >100 g/day. Conclusions: We found no evidence of an association between alcohol use or alcoholism and a first symptomatic seizure. PMID:12397140

  18. Do energy drinks cause epileptic seizure and ischemic stroke?

    PubMed

    Dikici, Suber; Saritas, Ayhan; Besir, Fahri Halit; Tasci, Ahmet Hakan; Kandis, Hayati

    2013-01-01

    Energy drinks are popular among young individuals and marketed to college students, athletes, and active individuals between the ages of 21 and 35 years. We report a case that had ischemic stroke and epileptic seizure after intake of energy drink with alcohol. To the best of our knowledge, the following case is the first report of ischemic stroke after intake of energy drink. A previously healthy 37-year-old man was brought to the emergency department after a witnessed tonic-clonic seizure. According to his wife's testimony, just before loss of consciousness, the patient had been drinking 3 boxes of energy drinks (Redbull, Istanbul, Turkey, 250 mL) with vodka on an empty stomach. He did not have a history of seizures, head trauma, or family history of seizures or another disease. In cranial diffusion magnetic resonance imaging, there were hyperintense signal changes in bilateral occipital area (more pronounced in the left occipital lobe), right temporal lobe, frontal lobe, and posterior parietal lobe. All tests associated with possible etiologic causes of ischemic stroke in young patients were negative. Herein, we want to attract attention to adverse effect of energy drink usage.

  19. Similar semiology of epileptic and psychogenic nonepileptic seizures recorded during stereo-EEG.

    PubMed

    Ostrowsky-Coste, Karine; Montavont, Alexandra; Keo-Kosal, Pascale; Guenot, Marc; Chatillon, Claude-Edouard; Ryvlin, Philippe

    2013-12-01

    We report two adolescents with refractory seizure disorders in whom both epileptic and psychogenic nonepileptic seizures (PNES) were recorded with intracerebral EEG. The ictal phenomenology of epileptic seizures (ES) and PNES, consisting of hypermotor attacks in the first patient and left-sided painful episodes in the second patient, proved remarkably similar in both cases, highlighting the difficulties which can arise with the distinction of epileptic seizures and PNES based on ictal phenomenology alone. Copyright © 2013 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  20. Resetting of brain dynamics: epileptic versus psychogenic nonepileptic seizures.

    PubMed

    Krishnan, Balu; Faith, Aaron; Vlachos, Ioannis; Roth, Austin; Williams, Korwyn; Noe, Katie; Drazkowski, Joe; Tapsell, Lisa; Sirven, Joseph; Iasemidis, Leon

    2011-12-01

    We investigated the possibility of differential diagnosis of patients with epileptic seizures (ES) and patients with psychogenic nonepileptic seizures (PNES) through an advanced analysis of the dynamics of the patients' scalp EEGs. The underlying principle was the presence of resetting of brain's preictal spatiotemporal entrainment following onset of ES and the absence of resetting following PNES. Long-term (days) scalp EEGs recorded from five patients with ES and six patients with PNES were analyzed. It was found that: (1) Preictal entrainment of brain sites was reset at ES (P<0.05) in four of the five patients with ES, and not reset (P=0.28) in the fifth patient. (2) Resetting did not occur (p>0.1) in any of the six patients with PNES. These preliminary results in patients with ES are in agreement with our previous findings from intracranial EEG recordings on resetting of brain dynamics by ES and are expected to constitute the basis for the development of a reliable and supporting tool in the differential diagnosis between ES and PNES. Finally, we believe that these results shed light on the electrophysiology of PNES by showing that occurrence of PNES does not assist patients in overcoming a pathological entrainment of brain dynamics. This article is part of a Supplemental Special Issue entitled The Future of Automated Seizure Detection and Prediction.

  1. [Preditive clinical factors for epileptic seizures after ischemic stroke].

    PubMed

    Fukujima, M M; Cardeal, J O; Lima, J G

    1996-06-01

    Preditive clinical factors for epileptic seizures after ischemic stroke. Clinical features of 35 patients with ischemic stroke who developed epilepsy (Group 1) were compared with those of 35 patients with ischemic stroke without epilepsy (Group 2). The age of the patients did not differ between the groups. There were more men than women and more white than other races in both groups. Diabetes melitus, hypertension, transient ischemic attack, previous stroke, migraine, Chagas disease, cerebral embolism of cardiac origin and use of oral contraceptive did not differ between the groups. Smokers and alcohol users were more frequent in Group 1 (p < 0.05). Most patients of Group 1 presented with hemiparesis; none presented cerebellar or brainstem involvement. Perhaps strokes in smokers have some different aspects, that let them more epileptogenic than in non smokers.

  2. Evaluation of the pentylenetetrazole seizure threshold test in epileptic mice as surrogate model for drug testing against pharmacoresistant seizures.

    PubMed

    Töllner, Kathrin; Twele, Friederike; Löscher, Wolfgang

    2016-04-01

    Resistance to antiepileptic drugs (AEDs) is a major problem in epilepsy therapy, so that development of more effective AEDs is an unmet clinical need. Several rat and mouse models of epilepsy with spontaneous difficult-to-treat seizures exist, but because testing of antiseizure drug efficacy is extremely laborious in such models, they are only rarely used in the development of novel AEDs. Recently, the use of acute seizure tests in epileptic rats or mice has been proposed as a novel strategy for evaluating novel AEDs for increased antiseizure efficacy. In the present study, we compared the effects of five AEDs (valproate, phenobarbital, diazepam, lamotrigine, levetiracetam) on the pentylenetetrazole (PTZ) seizure threshold in mice that were made epileptic by pilocarpine. Experiments were started 6 weeks after a pilocarpine-induced status epilepticus. At this time, control seizure threshold was significantly lower in epileptic than in nonepileptic animals. Unexpectedly, only one AED (valproate) was less effective to increase seizure threshold in epileptic vs. nonepileptic mice, and this difference was restricted to doses of 200 and 300 mg/kg, whereas the difference disappeared at 400mg/kg. All other AEDs exerted similar seizure threshold increases in epileptic and nonepileptic mice. Thus, induction of acute seizures with PTZ in mice pretreated with pilocarpine does not provide an effective and valuable surrogate method to screen drugs for antiseizure efficacy in a model of difficult-to-treat chronic epilepsy as previously suggested from experiments with this approach in rats. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Phase synchronization analysis of voltage-sensitive dye imaging during drug-induced epileptic seizures.

    NASA Astrophysics Data System (ADS)

    Takeshita, Daisuke; Tsytsarev, Vassiliy; Bahar, Sonya

    2008-03-01

    Epileptic seizures are generally held to result from excess and synchronized neural activity. However, recent studies have suggested that this is not necessarily the case. We investigate how the spatiotemporal pattern of synchronization changes during drug-induced in vivo neocortical seizures in rats. Epileptic seizures are caused by the potassium channel blocker 4-aminopyridine, which is often used in experiments to induce epileptic seizures. In our experiments, the neocortex is stained with the voltage-sensitive dye RH-1691. The intensity changes in dye fluorescence are measured by a CCD camera and are consistent with the signal from local field potential recording. We apply phase synchronization analysis to the voltage-sensitive dye signals from pairs of pixels in order to investigate the degree to which synchronization occurs, and how spatial patterns of synchrony may change, during the course of the seizure. Our preliminary results show that two distant pixels are well synchronized during a seizure event.

  4. Juvenile and adult-onset psychogenic non-epileptic seizures.

    PubMed

    Asadi-Pooya, Ali A; Emami, Mehrdad

    2013-09-01

    Psychogenic non-epileptic seizures (PNES) tend to begin in adolescence and young adulthood, although the seizures can occur in a wide range of ages. In the current study, we investigated the age of onset in patients with PNES and tried to determine the correlation between the age of onset and the demographic and clinical characteristics and factors potentially predisposing to PNES. In this cross-sectional study, all patients with a clinical diagnosis of PNES were recruited at the outpatient epilepsy clinic at Shiraz University of Medical Sciences from 2008 to 2012. We dichotomized the patients into two groups; those with age of onset below 18 years (juvenile), and those with age of onset at 18-55 years (adult-onset). We studied the demographic and clinical characteristics and factors potentially predisposing to PNES between these two groups. Statistical analyses were performed using Chi square and Fisher's Exact tests and Mann-Whitney U test. Fifty-seven patients with juvenile and 129 people with adult-onset PNES were studied. Demographic characteristics of these two groups were not different significantly. Seizure characteristics and semiology in these two groups were not significantly different either. However, factors potentially predisposing to PNES were significantly different between these two groups. History of being abused, academic failure, epilepsy or family history of epilepsy were more frequently observed in juvenile PNES, while medical comorbidities were more frequent among patients with adult-onset PNES. Age of onset of PNES is not correlated with the clinical manifestations; however, factors potentially predisposing to PNES are significantly different in patients with juvenile compared to those with adult-onset PNES. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. [THE PROPAGATION AND SEMIOLOGY OF FOCAL EPILEPTIC SEIZURES. CASES CONNECTED TO THE INSULA. THEORETICAL CONSIDERATIONS].

    PubMed

    Balogh, Attila; Balogh, Attila

    2016-01-30

    The developing of diagnostical examinations in epileptology provides new challenges in seizure semiology. On the analysis of seizures it is important to examine the mechanisms of their propagation. The brain connectivity (based on the neuroimaging), the shadowing of the movement of excessive neuronal activity (based on computerized EEG and MEG methods), the cognition of the physiological and pathological brain networks are the footstone of the epileptic seizure propagation. The investigators prove, by means of case demonstrations of the role of the network nodes and the role of the epileptic hubs in the seizure symptomatology. The preoperative, intra and postoperative data are analised of three insular and one parietal epileptic patients in point of view of their seizure symptomes. Complex neuroimaging, noninvasive and invasive electrophysiology, intensive long-term video-EEG monitoring, computerized EEG analysis, fuctional mapping, intraoperative corticography were used. The etiology were confirmed with hystology. It is observed that on seizure semiology our patients plays the insula a double role. In some cases, it is the focus of insular seizures with their symptoms difficult to identify. However, in the majority of cases and as a consequence of its rich neural connections, the insula has a peculiar property in the evolution of the symptomatogenic features of seizures. This observations are developing new relationships between the mechanism of seizure propagation and its semiological consequences. On epileptological point of view there are brain structures which has peculiar role in the "designe" of propagation of the epileptic excitement. The numerous new methods in neuroimaging and neurophysiology allowed the connectomical examination of the epileptic networks. The role of the epileptic diathesis is approachable with the metholdology of the brain connectivity. Theoretically the node of the epileptic network consist of the potential pathes where the localised

  6. Epileptic seizures and headache/migraine: a review of types of association and terminology.

    PubMed

    Cianchetti, Carlo; Pruna, Dario; Ledda, Mariagiuseppina

    2013-11-01

    There are different possible temporal associations between epileptic seizures and headache attacks which have given rise to unclear or controversial terminologies. The classification of the International League Against Epilepsy does not refer to this type of disorder, while the International Classification of Headache Disorders (ICHD-2) defines three kinds of association: (1) migraine-triggered seizure ("migralepsy"), (2) hemicrania epileptica, and (3) post-ictal headache. We performed an extensive review of the literature, not including "post-ictal" and "inter-ictal" headaches. On the basis of well-documented reports, the following clinical entities may be identified: (A) "epileptic headache (EH)" or "ictal epileptic headache (IEH)": in this condition headache (with or without migrainous features) is an epileptic manifestation per se, with onset, and cessation if isolated, coinciding with the scalp or deep EEG pattern of an epileptic seizure. EH maybe followed by other epileptic manifestations (motor/sensory/autonomic); this condition should be differentiated from "pure" or "isolated" EH, in which headache/migraine is the sole epileptic manifestation (requiring differential diagnosis from other headache forms). "Hemicrania epileptica" (if confirmed) is a very rare variant of EH, characterized by ipsilateral location of headache and ictal EEG paroxysms. (B) "Pre-ictal migraine" and "pre-ictal headache": when a headache attack is followed during, or shortly after, by a typical epileptic seizure. The migraine attack may be with or without aura, and its seizure-triggering role ("migraine-triggered seizure") is still a subject of debate. A differentiation from occipital epilepsy is mandatory. The term "migralepsy" has not been used uniformly, and may therefore led to misinterpretation. On the basis of this review we suggest definitions and a terminology which may become the basis of a forthcoming classification of headaches associated with epileptic seizures. Copyright

  7. Persistent neurological damage associated with spontaneous recurrent seizures and atypical aggressive behavior of domoic acid epileptic disease.

    PubMed

    Tiedeken, Jessica A; Ramsdell, John S

    2013-05-01

    The harmful alga Pseudo-nitzschia sp. is the cause of human amnesic shellfish poisoning and the stranding of thousands of sea lions with seizures as a hallmark symptom. A human case study and epidemiological report of hundreds of stranded sea lions found individuals presenting months after recovery with a neurological disease similar to temporal lobe epilepsy. A rat model developed to establish and better predict how epileptic disease results from domoic acid poisoning demonstrated that a single episode of status epilepticus (SE), after a latent period, leads to a progressive state of spontaneous recurrent seizure (SRS) and expression of atypical aggressive behaviors. Structural damage associated with domoic acid-induced SE is prominent in olfactory pathways. Here, we examine structural damage in seven rats that progressed to epileptic disease. Diseased animals show progressive neuronal loss in the piriform cortex and degeneration of terminal fields in these layers and the posteromedial cortical amygdaloid nucleus. Animals that display aggressive behavior had additional neuronal damage to the anterior olfactory cortex. This study provides insight into the structural basis for the progression of domoic acid epileptic disease and relates to the California sea lion, where poisoned animals progress to a disease characterized by SRS and aggressive behaviors.

  8. Epileptic spasms in epilepsy with myoclonic-atonic seizures (Doose syndrome).

    PubMed

    Pittau, Francesca; Korff, Christian M; Nordli, Douglas R

    2016-09-01

    To describe the occurrence of epileptic spasms in epilepsy with myoclonic-atonic seizures (EMAS) or Doose syndrome. Case descriptions of patients with EMAS and epileptic spasms. Diagnosis of EMAS was performed according to the following criteria: (1) onset of myoclonic, myoclonic-atonic, or atonic seizures at between 7 months and 6 years of age; (2) normal development before onset of epilepsy; (3) absence of structural cerebral abnormalities on MRI; (4) presence of generalized spike-waves or polyspike-waves on EEG; and (5) exclusion of other myoclonic epilepsies. Four patients with EMAS were included. For each of them, epileptic spasms were documented by video interpretation, or video-EEG when available. Our description of epileptic spasms in four patients with EMAS enlarges the spectrum of seizures that may be observed in this syndrome, as well as the number of epilepsy syndromes which may involve epileptic spasms. This evidence suggests that the presence of epileptic spasms is consistent with a diagnosis of EMAS; epileptic spasms should therefore not be considered a seizure type that excludes diagnosis of this epilepsy syndrome. The prognostic significance of epileptic spasms associated with EMAS remains unknown.

  9. Diagnostic implications of review-of-systems questionnaires to differentiate epileptic seizures from psychogenic seizures.

    PubMed

    Kerr, Wesley T; Janio, Emily A; Braesch, Chelsea T; Le, Justine M; Hori, Jessica M; Patel, Akash B; Barritt, Sarah E; Gallardo, Norma L; Bauirjan, Janar; Chau, Andrea M; Hwang, Eric S; Davis, Emily C; Torres-Barba, David; Cho, Andrew Y; Engel, Jerome; Cohen, Mark S; Stern, John M

    2017-04-01

    Early and accurate diagnosis of patients with psychogenic nonepileptic seizures (PNES) leads to appropriate treatment and improves long-term seizure prognosis. However, this is complicated by the need to record seizures to make a definitive diagnosis. Suspicion for PNES can be raised through knowledge that patients with PNES have increased somatic sensitivity and report more positive complaints on review-of-systems questionnaires (RoSQs) than patients with epileptic seizures. If the responses on the RoSQ can differentiate PNES from other seizure types, then these forms could be an early screening tool. Our dataset included all patients admitted from January 2006 to June 2016 for video-electroencephalography at UCLA. RoSQs prior to May 2015 were acquired through retrospective chart review (n=405), whereas RoSQs from subsequent patients were acquired prospectively (n=190). Controlling for sex and number of comorbidities, we used binomial regression to compare the total number of symptoms and the frequency of specific symptoms between five mutually exclusive groups of patients: epileptic seizures (ES), PNES, physiologic nonepileptic seizure-like events (PSLE), mixed PNES plus ES, and inconclusive monitoring. To determine the diagnostic utility of RoSQs to differentiate PNES only from ES only, we used multivariate logistic regression, controlling for sex and the number of medical comorbidities. On average, patients with PNES or mixed PNES and ES reported more than twice as many symptoms than patients with isolated ES or PSLE (p<0.001). The prospective accuracy to differentiate PNES from ES was not significantly higher than naïve assumption that all patients had ES (76% vs 70%, p>0.1). This analysis of RoSQs confirms that patients with PNES with and without comorbid ES report more symptoms on a population level than patients with epilepsy or PSLE. While these differences help describe the population of patients with PNES, the consistency of RoSQ responses was neither

  10. CA3 Synaptic Silencing Attenuates Kainic Acid-Induced Seizures and Hippocampal Network Oscillations123

    PubMed Central

    Yu, Lily M. Y.; Wintzer, Marie E.

    2016-01-01

    Abstract Epilepsy is a neurological disorder defined by the presence of seizure activity, manifest both behaviorally and as abnormal activity in neuronal networks. An established model to study the disorder in rodents is the systemic injection of kainic acid, an excitatory neurotoxin that at low doses quickly induces behavioral and electrophysiological seizures. Although the CA3 region of the hippocampus has been suggested to be crucial for kainic acid-induced seizure, because of its strong expression of kainate glutamate receptors and its high degree of recurrent connectivity, the precise role of excitatory transmission in CA3 in the generation of seizure and the accompanying increase in neuronal oscillations remains largely untested. Here we use transgenic mice in which CA3 pyramidal cell synaptic transmission can be inducibly silenced in the adult to demonstrate CA3 excitatory output is required for both the generation of epileptiform oscillatory activity and the progression of behavioral seizures. PMID:27022627

  11. CA3 Synaptic Silencing Attenuates Kainic Acid-Induced Seizures and Hippocampal Network Oscillations.

    PubMed

    Yu, Lily M Y; Polygalov, Denis; Wintzer, Marie E; Chiang, Ming-Ching; McHugh, Thomas J

    2016-01-01

    Epilepsy is a neurological disorder defined by the presence of seizure activity, manifest both behaviorally and as abnormal activity in neuronal networks. An established model to study the disorder in rodents is the systemic injection of kainic acid, an excitatory neurotoxin that at low doses quickly induces behavioral and electrophysiological seizures. Although the CA3 region of the hippocampus has been suggested to be crucial for kainic acid-induced seizure, because of its strong expression of kainate glutamate receptors and its high degree of recurrent connectivity, the precise role of excitatory transmission in CA3 in the generation of seizure and the accompanying increase in neuronal oscillations remains largely untested. Here we use transgenic mice in which CA3 pyramidal cell synaptic transmission can be inducibly silenced in the adult to demonstrate CA3 excitatory output is required for both the generation of epileptiform oscillatory activity and the progression of behavioral seizures.

  12. Epileptic seizure classification of EEG time-series using rational discrete short-time fourier transform.

    PubMed

    Samiee, Kaveh; Kovács, Petér; Gabbouj, Moncef

    2015-02-01

    A system for epileptic seizure detection in electroencephalography (EEG) is described in this paper. One of the challenges is to distinguish rhythmic discharges from nonstationary patterns occurring during seizures. The proposed approach is based on an adaptive and localized time-frequency representation of EEG signals by means of rational functions. The corresponding rational discrete short-time Fourier transform (DSTFT) is a novel feature extraction technique for epileptic EEG data. A multilayer perceptron classifier is fed by the coefficients of the rational DSTFT in order to separate seizure epochs from seizure-free epochs. The effectiveness of the proposed method is compared with several state-of-art feature extraction algorithms used in offline epileptic seizure detection. The results of the comparative evaluations show that the proposed method outperforms competing techniques in terms of classification accuracy. In addition, it provides a compact representation of EEG time-series.

  13. Weather as a risk factor for epileptic seizures: A case-crossover study.

    PubMed

    Rakers, Florian; Walther, Mario; Schiffner, Rene; Rupprecht, Sven; Rasche, Marius; Kockler, Michael; Witte, Otto W; Schlattmann, Peter; Schwab, Matthias

    2017-07-01

    Most epileptic seizures occur unexpectedly and independently of known risk factors. We aimed to evaluate the clinical significance of patients' perception that weather is a risk factor for epileptic seizures. Using a hospital-based, bidirectional case-crossover study, 604 adult patients admitted to a large university hospital in Central Germany for an unprovoked epileptic seizure between 2003 and 2010 were recruited. The effect of atmospheric pressure, relative air humidity, and ambient temperature on the onset of epileptic seizures under temperate climate conditions was estimated. We found a close-to-linear negative correlation between atmospheric pressure and seizure risk. For every 10.7 hPa lower atmospheric pressure, seizure risk increased in the entire study population by 14% (odds ratio [OR] 1.14, 95% confidence interval [CI] 1.01-1.28). In patients with less severe epilepsy treated with one antiepileptic medication, seizure risk increased by 36% (1.36, 1.09-1.67). A high relative air humidity of >80% increased seizure risk in the entire study population by up to 48% (OR 1.48, 95% CI 1.11-1.96) 3 days after exposure in a J-shaped association. High ambient temperatures of >20°C decreased seizure risk by 46% in the overall study population (OR 0.54, 95% CI 0.32-0.90) and in subgroups, with the greatest effects observed in male patients (OR 0.33, 95% CI 0.14-0.74). Low atmospheric pressure and high relative air humidity are associated with an increased risk for epileptic seizures, whereas high ambient temperatures seem to decrease seizure risk. Weather-dependent seizure risk may be accentuated in patients with less severe epilepsy. Our results require further replication across different climate regions and cohorts before reliable clinical recommendations can be made. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.

  14. Medical management of epileptic seizures: challenges and solutions

    PubMed Central

    Sarma, Anand K; Khandker, Nabil; Kurczewski, Lisa; Brophy, Gretchen M

    2016-01-01

    Epilepsy is one of the most common neurologic illnesses. This condition afflicts 2.9 million adults and children in the US, leading to an economic impact amounting to $15.5 billion. Despite the significant burden epilepsy places on the population, it is not very well understood. As this understanding continues to evolve, it is important for clinicians to stay up to date with the latest advances to provide the best care for patients. In the last 20 years, the US Food and Drug Administration has approved 15 new antiepileptic drugs (AEDs), with many more currently in development. Other advances have been achieved in terms of diagnostic modalities like electroencephalography technology, treatment devices like vagal nerve and deep-brain stimulators, novel alternate routes of drug administration, and improvement in surgical techniques. Specific patient populations, such as the pregnant, elderly, those with HIV/AIDS, and those with psychiatric illness, present their own unique challenges, with AED side effects, drug interactions, and medical–psychiatric comorbidities adding to the conundrum. The purpose of this article is to review the latest literature guiding the management of acute epileptic seizures, focusing on the current challenges across different practice settings, and it discusses studies in various patient populations, including the pregnant, geriatric, those with HIV/AIDS, comatose, psychiatric, and “pseudoseizure” patients, and offers possible evidence-based solutions or the expert opinion of the authors. Also included is information on newer AEDs, routes of administration, and significant AED-related drug-interaction tables. This review has tried to address only some of these issues that any practitioner who deals with the acute management of seizures may encounter. The document also highlights the numerous avenues for new research that would help practitioners optimize epilepsy management. PMID:26966367

  15. Ensemble Classifier for Epileptic Seizure Detection for Imperfect EEG Data

    PubMed Central

    Mahmuddin, Massudi; Mohamed, Amr

    2015-01-01

    Brain status information is captured by physiological electroencephalogram (EEG) signals, which are extensively used to study different brain activities. This study investigates the use of a new ensemble classifier to detect an epileptic seizure from compressed and noisy EEG signals. This noise-aware signal combination (NSC) ensemble classifier combines four classification models based on their individual performance. The main objective of the proposed classifier is to enhance the classification accuracy in the presence of noisy and incomplete information while preserving a reasonable amount of complexity. The experimental results show the effectiveness of the NSC technique, which yields higher accuracies of 90% for noiseless data compared with 85%, 85.9%, and 89.5% in other experiments. The accuracy for the proposed method is 80% when SNR = 1 dB, 84% when SNR = 5 dB, and 88% when SNR = 10 dB, while the compression ratio (CR) is 85.35% for all of the datasets mentioned. PMID:25759863

  16. Capparis ovata modulates brain oxidative toxicity and epileptic seizures in pentylentetrazol-induced epileptic rats.

    PubMed

    Nazıroğlu, Mustafa; Akay, Mehmet Berk; Çelik, Ömer; Yıldırım, Muhammed İkbal; Balcı, Erdinç; Yürekli, Vedat Ali

    2013-04-01

    It has been widely suggested that oxidative stress products play an important role in the pathophysiology of epilepsy. Capparis ovata (C. ovata) may useful treatment of epilepsy because it contains antioxidant flavonoids. The current study was designed to determine the effects of C. ovata on lipid peroxidation, antioxidant levels and electroencephalography (EEG) records in pentylentetrazol (PTZ)-induced epileptic rats. Thirty-two rats were randomly divided into four groups. First group was used as control although second group was PTZ group. Oral 100 and 200 mg/kg C. ovata were given to rats constituting the third and fourth groups for 7 days before PTZ administration. Second, third and forth groups received 60 mg/kg PTZ for induction of epilepsy. Three hours after administration of PTZ, EEG records, brain cortex and blood samples were taken all groups. The lipid peroxidation levels of the brain cortex, number of spikes and epileptiform discharges of EEG were higher in PTZ group than in control and C. ovata group whereas they were decreased by C. ovata administration. Vitamin A, vitamin C, vitamin E and β-carotene concentrations of brain cortex and latency to first spike of EEG were decreased by the PTZ administration although the brain cortex and plasma vitamin concentrations, and brain cortex and erythrocyte glutathione and glutathione peroxidase values were increased in PTZ + 100 and PTZ + 200 mg C. ovata groups. In conclusion, C. ovata administration caused protection against the PTZ-induced brain oxidative toxicity by inhibiting free radical and epileptic seizures, and supporting antioxidant redox system.

  17. Protective effect of hispidulin on kainic acid-induced seizures and neurotoxicity in rats.

    PubMed

    Lin, Tzu Yu; Lu, Cheng Wei; Wang, Su Jane; Huang, Shu Kuei

    2015-05-15

    Hispidulin is a flavonoid compound which is an active ingredient in a number of traditional Chinese medicinal herbs, and it has been reported to inhibit glutamate release. The purpose of this study was to investigate whether hispidulin protects against seizures induced by kainic acid, a glutamate analog with excitotoxic properties. The results indicated that intraperitoneally administering hispidulin (10 or 50mg/kg) to rats 30 min before intraperitoneally injecting kainic acid (15 mg/kg) increased seizure latency and decreased seizure score. In addition, hispidulin substantially attenuated kainic acid-induced hippocampal neuronal cell death, and this protective effect was accompanied by the suppression of microglial activation and the production of proinflammatory cytokines such as interleukin-1β, interleukin-6, and tumor necrosis factor-α in the hippocampus. Moreover, hispidulin reduced kainic acid-induced c-Fos expression and the activation of mitogen-activated protein kinases in the hippocampus. These data suggest that hispidulin has considerable antiepileptic, neuroprotective, and antiinflammatory effects on kainic acid-induced seizures in rats.

  18. Epileptic seizures as condensed sleep: an analysis of network dynamics from electroencephalogram signals.

    PubMed

    Gast, Heidemarie; Müller, Markus; Rummel, Christian; Roth, Corinne; Mathis, Johannes; Schindler, Kaspar; Bassetti, Claudio L

    2014-06-01

    Both deepening sleep and evolving epileptic seizures are associated with increasing slow-wave activity. Larger-scale functional networks derived from electroencephalogram indicate that in both transitions dramatic changes of communication between brain areas occur. During seizures these changes seem to be 'condensed', because they evolve more rapidly than during deepening sleep. Here we set out to assess quantitatively functional network dynamics derived from electroencephalogram signals during seizures and normal sleep. Functional networks were derived from electroencephalogram signals from wakefulness, light and deep sleep of 12 volunteers, and from pre-seizure, seizure and post-seizure time periods of 10 patients suffering from focal onset pharmaco-resistant epilepsy. Nodes of the functional network represented electrical signals recorded by single electrodes and were linked if there was non-random cross-correlation between the two corresponding electroencephalogram signals. Network dynamics were then characterized by the evolution of global efficiency, which measures ease of information transmission. Global efficiency was compared with relative delta power. Global efficiency significantly decreased both between light and deep sleep, and between pre-seizure, seizure and post-seizure time periods. The decrease of global efficiency was due to a loss of functional links. While global efficiency decreased significantly, relative delta power increased except between the time periods wakefulness and light sleep, and pre-seizure and seizure. Our results demonstrate that both epileptic seizures and deepening sleep are characterized by dramatic fragmentation of larger-scale functional networks, and further support the similarities between sleep and seizures.

  19. How reliable is ictal duration to differentiate psychogenic nonepileptic seizures from epileptic seizures?

    PubMed

    Seneviratne, Udaya; Minato, Erica; Paul, Eldho

    2017-01-01

    We sought to investigate (1) differences in ictal duration between psychogenic nonepileptic seizures (PNES) and epileptic seizures (ES), (2) the odds of being PNES when seizures last ≥5min, and (3) the value of ictal duration as a diagnostic test to differentiate PNES from ES. We retrospectively reviewed video-EEG recordings and tabulated ictal durations of all PNES and ES. We estimated the mean ictal durations of PNES and ES using linear mixed models. The odds of being PNES when seizures last ≥5min were estimated using logistic regression. We used receiver operating characteristics (ROC) curves to study the overall diagnostic accuracy of ictal duration in differentiating PNES from ES. We studied 441 ES and 341 PNES recorded from 138 patients. The mean ictal duration of PNES (148.7s, 95% CI: 115.2-191.8) was significantly longer (p<0.001) than that of ES (47.7s, 95% CI: 37.6-60.6). The odds of being PNES was about 24 times higher (Odds ratio: 23.8, 95% CI: 7.9-71.3) when the ictal duration was ≥5min. The ROC curve yielded an area under the curve of 0.80 (95% CI 0.73-0.88). Youden's index identified 123.5s as the optimal threshold to diagnose PNES with 65% sensitivity and 93% specificity. Our results indicate that ictal duration is a useful test to raise suspicion of PNES. When a seizure lasts ≥5min, it is 24 times more likely to be PNES with the potential risk of misdiagnosis as status epilepticus. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Synchrony in Normal and Focal Epileptic Brain: The Seizure Onset Zone is Functionally Disconnected

    PubMed Central

    Warren, Christopher P.; Hu, Sanqing; Stead, Matt; Brinkmann, Benjamin H.; Bower, Mark R.

    2010-01-01

    Synchronization of local and distributed neuronal assemblies is thought to underlie fundamental brain processes such as perception, learning, and cognition. In neurological disease, neuronal synchrony can be altered and in epilepsy may play an important role in the generation of seizures. Linear cross-correlation and mean phase coherence of local field potentials (LFPs) are commonly used measures of neuronal synchrony and have been studied extensively in epileptic brain. Multiple studies have reported that epileptic brain is characterized by increased neuronal synchrony except possibly prior to seizure onset when synchrony may decrease. Previous studies using intracranial electroencephalography (EEG), however, have been limited to patients with epilepsy. Here we investigate neuronal synchrony in epileptic and control brain using intracranial EEG recordings from patients with medically resistant partial epilepsy and control subjects with intractable facial pain. For both epilepsy and control patients, average LFP synchrony decreases with increasing interelectrode distance. Results in epilepsy patients show lower LFP synchrony between seizure-generating brain and other brain regions. This relative isolation of seizure-generating brain underlies the paradoxical finding that control patients without epilepsy have greater average LFP synchrony than patients with epilepsy. In conclusion, we show that in patients with focal epilepsy, the region of epileptic brain generating seizures is functionally isolated from surrounding brain regions. We further speculate that this functional isolation may contribute to spontaneous seizure generation and may represent a clinically useful electrophysiological signature for mapping epileptic brain. PMID:20926610

  1. Complex phase synchronization in epileptic seizures: Evidence for a devil's staircase

    NASA Astrophysics Data System (ADS)

    Perez Velazquez, J. L.; Garcia Dominguez, L.; Wennberg, R.

    2007-01-01

    We describe multifrequency phase synchronization in epileptic seizures. Using magnetoencephalographic recordings from three patients suffering generalized seizures, the evidence is presented that, in addition to the commonly studied 1:1 frequency locking, there exists complex multifrequency coordination that, in some cases, follows a classical “devil’s staircase.” Within the limitations of observing this phenomenon in a clinical experimental setting, these observations reveal that in pathological brain activity, complex frequency locking can be found similar to that identified in certain pathological cardiac re-entrant arrhythmias. This may suggest the existence of similar re-entrant mechanisms active in cerebral neocortex during epileptic seizures.

  2. [Semiological comparison of spontaneous and bemegride-induced epileptic seizures (author's transl)].

    PubMed

    Micheletti, M; Laroye, M; Coquillat, G; Micheletti, G; Kurtz, D

    1979-01-01

    The authors view an epileptic seizure as a series of symptoms which they can localize on the bases of data taken from stereoelectroencephalography literature. They reconstruct and compare the presumed organization (origin and propagation) of the discharge in 100 epileptic subjects. Both spontaneous and megimide-induced seizures are considered. The results involve 34 subjects with quite similar spontaneous and induced seizures. Comparison of the two critical modalities show that : 1) There is no variation in the chronological relationship of the symptoms. 3) There are differences in the symptomatology. These differences may be interpreted as non-uniform response of involved structures to the source of activation, or as involvement of new structures.

  3. Apparatus and method for epileptic seizure detection using non-linear techniques

    DOEpatents

    Hively, Lee M.; Clapp, Ned E.; Daw, C. Stuart; Lawkins, William F.

    1998-01-01

    Methods and apparatus for automatically detecting epileptic seizures by monitoring and analyzing brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis; obtaining time serial trends in the nonlinear measures; determining that one or more trends in the nonlinear measures indicate a seizure, and providing notification of seizure occurrence.

  4. Apparatus and method for epileptic seizure detection using non-linear techniques

    SciTech Connect

    Hively, L.M.; Clapp, N.E.; Daw, C.S.; Lawkins, W.F.

    1998-04-28

    Methods and apparatus are disclosed for automatically detecting epileptic seizures by monitoring and analyzing brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis; obtaining time serial trends in the nonlinear measures; determining that one or more trends in the nonlinear measures indicate a seizure, and providing notification of seizure occurrence. 76 figs.

  5. Apparatus and method for epileptic seizure detection using non-linear techniques

    DOEpatents

    Hively, L.M.; Clapp, N.E.; Daw, C.S.; Lawkins, W.F.

    1998-04-28

    Methods and apparatus are disclosed for automatically detecting epileptic seizures by monitoring and analyzing brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis; obtaining time serial trends in the nonlinear measures; determining that one or more trends in the nonlinear measures indicate a seizure, and providing notification of seizure occurrence. 76 figs.

  6. Classification of clinical semiology in epileptic seizures in neonates.

    PubMed

    Nagarajan, Lakshmi; Palumbo, Linda; Ghosh, Soumya

    2012-03-01

    The clinical semiology of 61 neonatal seizures with EEG correlates, in 24 babies was analysed. Most seizures (89%) had multiple features during the EEG discharge. The seizures were classified using the prominent clinical feature at onset, and all features seen during the seizure, using an extended classification scheme. Orolingual features occurred most frequently at onset (30%), whereas ocular phenomena occurred most often during the seizure (70%). Orolingual, ocular and autonomic features were seen at onset in 55% of the seizures. Seizure onsets with clonic, tonic and hypomotor features were seen in 20%, 8% and 18% respectively. Clinico-electrical correlations were as follows. The EEG discharge involved both hemispheres in 54% of all seizures, in clonic seizures this was 93%. Focal clonic seizures were associated with EEG seizure onset from the contralateral hemisphere. Majority of the clonic and hypomotor seizures had a left hemisphere ictal EEG onset. Orolingual seizures frequently started from the right hemisphere, whereas ocular and autonomic seizures arose from either hemisphere. There was no significant difference in mortality, morbidity, abnormal neuroimaging and EEG background abnormalities in babies with or without clonic seizures. This study provides insights into neuronal networks that underpin electroclinical seizures, by analysing and classifying the obvious initial clinical features and those during the seizure. Copyright © 2011 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

  7. Neural networks with periodogram and autoregressive spectral analysis methods in detection of epileptic seizure.

    PubMed

    Kiymik, M Kemal; Subasi, Abdulhamit; Ozcalik, H Riza

    2004-12-01

    Approximately 1% of the people in the world suffer from epilepsy. Careful analyses of the electroencephalograph (EEG) records can provide valuable insight and improved understanding of the mechanisms causing epileptic disorders. Predicting the onset of epileptic seizure is an important and difficult biomedical problem, which has attracted substantial attention of the intelligent computing community over the past two decades. The purpose of this work was to investigate the performance of the periodogram and autoregressive (AR) power spectrum methods to extract classifiable features from human electroencephalogram (EEG) by using artificial neural networks (ANN). The feedforward ANN system was trained and tested with the backpropagation algorithm using a large data set of exemplars. We present a method for the automatic comparison of epileptic seizures in EEG, allowing the grouping of seizures having similar overall patterns. Each channel of the EEG is first broken down into segments having relatively stationary characteristics. Features are then calculated for each segment, and all segments of all channels of the seizures of a patient are grouped into clusters of similar morphology. This clustering allows labeling of every EEG segment. Examples from 5 patients with scalp electrodes illustrate the ability of the method to group seizures of similar morphology. It was observed that ANN classification of EEG signals with AR preprocessing gives better results, and these results can also be used for the deduction of epileptic seizure.

  8. Fractal spectral analysis of pre-epileptic seizures in terms of criticality

    NASA Astrophysics Data System (ADS)

    Li, Xiaoli; Polygiannakis, J.; Kapiris, P.; Peratzakis, A.; Eftaxias, K.; Yao, X.

    2005-06-01

    The analysis of pre-epileptic seizure through EEG (electroencephalography) is an important issue for epilepsy diagnosis. Currently, there exist some methods derived from the dynamics to analyse the pre-epileptic EEG data. It is still necessary to create a novel method to better fit and explain the EEG data for making sense of the seizures' predictability. In this paper, a fractal wavelet-based spectral method is proposed and applied to analyse EEG recordings from rat experiments. Three types of patterns are found from the 12 experiments; moreover three typical cases corresponding to the three types of seizures are sorted out and analysed in detail by using the new method. The results indicate that this method can reveal the characteristic signs of an approaching seizure, which includes the emergence of long-range correlation, the decrease of anti-persistence behaviour with time and the decrease of the fractal dimension. The pre-seizure features and their implications are further discussed in the framework of the theory of criticality. We suggest that an epileptic seizure could be considered as a generalized kind of 'critical phenomenon', culminating in a large event that is analogous to a kind of 'critical point'. We also emphasize that epileptic event emergence is a non-repetitive process, so the critical interpretation meets a certain number of cases.

  9. Wavelet-based texture analysis of EEG signal for prediction of epileptic seizure

    NASA Astrophysics Data System (ADS)

    Petrosian, Arthur A.; Homan, Richard; Pemmaraju, Suryalakshmi; Mitra, Sunanda

    1995-09-01

    Electroencephalographic (EEG) signal texture content analysis has been proposed for early warning of an epileptic seizure. This approach was evaluated by investigating the interrelationship between texture features and basic signal informational characteristics, such as Kolmogorov complexity and fractal dimension. The comparison of several traditional techniques, including higher-order FIR digital filtering, chaos, autoregressive and FFT time- frequency analysis was also carried out on the same epileptic EEG recording. The purpose of this study is to investigate whether wavelet transform can be used to further enhance the developed methods for prediction of epileptic seizures. The combined consideration of texture and entropy characteristics extracted from subsignals decomposed by wavelet transform are explored for that purpose. Yet, the novel neuro-fuzzy clustering algorithm is performed on wavelet coefficients to segment given EEG recording into different stages prior to an actual seizure onset.

  10. Control of Synchronization of Brain Dynamics Leads to Control of Epileptic Seizures in Rodents

    PubMed Central

    Good, Levi B.; Sabesan, Shivkumar; Marsh, Steven T.; Tsakalis, Kostas; Treiman, David

    2010-01-01

    We have designed and implemented an automated, just-in-time stimulation, seizure control method using a seizure prediction method from nonlinear dynamics coupled with deep brain stimulation in the centromedial thalamic nuclei in epileptic rats. A comparison to periodic stimulation, with identical stimulation parameters, was also performed. The two schemes were compared in terms of their efficacy in control of seizures, as well as their effect on synchronization of brain dynamics. The automated just-in-time (JIT) stimulation showed reduction of seizure frequency and duration in 5 of the 6 rats, with significant reduction of seizure frequency (>50%) in 33% of the rats. This constituted a significant improvement over the efficacy of the periodic control scheme in the same animals. Actually, periodic stimulation showed an increase of seizure frequency in 50% of the rats, reduction of seizure frequency in 3 rats and significant reduction in 1 rat. Importantly, successful seizure control was highly correlated with desynchronization of brain dynamics. This study provides initial evidence for the use of closed-loop feedback control systems in epileptic seizures combining methods from seizure prediction and deep brain stimulation. PMID:19575507

  11. Emperor Napoleon Bonaparte: did he have seizures? Psychogenic or epileptic or both?

    PubMed

    Hughes, John R

    2003-12-01

    Napoleon Bonaparte was a general in the French army at 24 years of age, later conquering most of Europe. He was one of the greatest military geniuses the world has ever known, but also an extremely intelligent individual. Did he have seizures? The evidence shows that he had both psychogenic and epileptic attacks. The psychogenic attacks were likely related to the tremendous stress in his life, and the epileptic seizures were the result of chronic uremia from a severe urethral stricture caused by gonorrhea that was transmitted from his wife, Empress Josephine.

  12. PRRT2 Mutations Are Related to Febrile Seizures in Epileptic Patients

    PubMed Central

    He, Zheng-Wen; Qu, Jian; Zhang, Ying; Mao, Chen-Xue; Wang, Zhi-Bin; Mao, Xiao-Yuan; Deng, Zhi-Yong; Zhou, Bo-Ting; Yin, Ji-Ye; Long, Hong-Yu; Xiao, Bo; Zhang, Yu; Zhou, Hong-Hao; Liu, Zhao-Qian

    2014-01-01

    Previous studies reported that the proline-rich transmembrane protein 2 (PRRT2) gene was identified to be related to paroxysmal kinesigenic dyskinesia (PKD), infantile convulsions with PKD, PKD with migraine and benign familial infantile epilepsy (BFIE). The present study explores whether the PRRT2 mutation is a potential cause of febrile seizures, including febrile seizures plus (FS+), generalized epilepsy with febrile seizures plus (GEFS+) and Dravet syndrome (DS); thus, it may provide a new drug target for personalized medicine for febrile seizure patients. We screened PRRT2 exons in a cohort of 136 epileptic patients with febrile seizures, including FS+, GEFS+ and DS. PRRT2 genetic mutations were identified in 25 out of 136 (18.4%) febrile seizures in epileptic patients. Five loss-of-function and coding missense mutations were identified: c.649delC (p.R217Efs*12), c.649_650insC (p.R217Pfs*8), c.412C>G (p.Pro138Ala), c.439G>C (p.Asp147His) and c.623C>A (p.Ser208Tyr). PRRT2 variants were probably involved in the etiology of febrile seizures in epileptic patients. PMID:25522171

  13. Multi-Biosignal Analysis for Epileptic Seizure Monitoring.

    PubMed

    Cogan, Diana; Birjandtalab, Javad; Nourani, Mehrdad; Harvey, Jay; Nagaraddi, Venkatesh

    2017-02-01

    Persons who suffer from intractable seizures are safer if attended when seizures strike. Consequently, there is a need for wearable devices capable of detecting both convulsive and nonconvulsive seizures in everyday life. We have developed a three-stage seizure detection methodology based on 339 h of data (26 seizures) collected from 10 patients in an epilepsy monitoring unit. Our intent is to develop a wearable system that will detect seizures, alert a caregiver and record the time of seizure in an electronic diary for the patient's physician. Stage I looks for concurrent activity in heart rate, arterial oxygenation and electrodermal activity, all of which can be monitored by a wrist-worn device and which in combination produce a very low false positive rate. Stage II looks for a specific pattern created by these three biosignals. For the patients whose seizures cannot be detected by Stage II, Stage III detects seizures using limited-channel electroencephalogram (EEG) monitoring with at most three electrodes. Out of 10 patients, Stage I recognized all 11 seizures from seven patients, Stage II detected all 10 seizures from six patients and Stage III detected all of the seizures of two out of the three patients it analyzed.

  14. Rapidly Learned Identification of Epileptic Seizures from Sonified EEG

    PubMed Central

    Loui, Psyche; Koplin-Green, Matan; Frick, Mark; Massone, Michael

    2014-01-01

    Sonification refers to a process by which data are converted into sound, providing an auditory alternative to visual display. Currently, the prevalent method for diagnosing seizures in epilepsy is by visually reading a patient’s electroencephalogram (EEG). However, sonification of the EEG data provides certain advantages due to the nature of human auditory perception. We hypothesized that human listeners will be able to identify seizures from EEGs using the auditory modality alone, and that accuracy of seizure identification will increase after a short training session. Here, we describe an algorithm that we have used to sonify EEGs of both seizure and non-seizure activity, followed by a training study in which subjects listened to short clips of sonified EEGs and determined whether each clip was of seizure or normal activity, both before and after a short training session. Results show that before training subjects performed at chance level in differentiating seizures from non-seizures, but there was a significant improvement of accuracy after the training session. After training, subjects successfully distinguished seizures from non-seizures using the auditory modality alone. Further analyses using signal detection theory demonstrated improvement in sensitivity and reduction in response bias as a result of training. This study demonstrates the potential of sonified EEGs to be used for the detection of seizures. Future studies will attempt to increase accuracy using novel training and sonification modifications, with the goals of managing, predicting, and ultimately controlling seizures using sonification as a possible biofeedback-based intervention for epilepsy. PMID:25352802

  15. Factors associated with epileptic seizure of cavernous malformations in the central nervous system in West China

    PubMed Central

    Huang, Cheng; Chen, Ming-Wan; Si, Yang; Li, Jin-Mei; Zhou, Dong

    2013-01-01

    Objective: To explore the factors associated with preoperative and postoperative epileptic seizure in patients with cavernous malformations (CMs). Methods: A total of 52 consecutive patients from January 2009 to June 2011 who underwent surgical treatment in West China Hospital of Sichuan University due to CMs and confirmed by histopathology were retrospectively reviewed.Patients were divided into two groups (epilepsy-group and non-epilepsy group) according to clinical presentation. Other clinical data, treatment procedure, and follow-up information were collected. Engel classification was used to evaluate seizure outcome. Results: Low birth weight, temporal lobe involvement and cortical lesion showed significant difference between two groups (p=0.017, 0.003 and 0.025 respectively). Cortical lesion highly increased risk for preoperative epileptic seizure (OR=10.48; 95% CI 1.61-68.23). After a mean follow-up of 2.1 years, 77.8% of epileptic patients achieved Engel class I. Temporal lobe involvement, lesion size < 2.5cm and surgery within one year of symptom onset were found associated with better seizure outcome (p=0.016, 0.012 and 0.050). Temporal lobe involvement significantly decreased the risk for postoperative epileptic seizure (OR=0.038; 95% CI 0.002-0.833). Application of ECoG made no significant difference to seizure outcome (p=0.430). Most patients need continuing medication therapy after surgery. Conclusion: Surgical treatment of patient with CMs is satisfactory in most cases and temporal lobe involvement usually predict favourable postoperative seizure outcome whether under the monitoring of ECoG or not. Thus, epileptic patients with CMs should be considered for surgical treatment especially when cortical brain layer or temporal lobe was involved. PMID:24353703

  16. Epileptic seizure in a patient with an implantable cardioverter-defibrillator: Quo vadis right ventricular lead?

    PubMed

    Wedekind, Horst; Rozhnev, Andrey; Kleine-Katthöfer, Peter; Kranig, Wolfgang

    2016-03-01

    The case of a 77-year-old man admitted for suspected epileptic seizure is reported. Patient history showed implantation of a single-chamber implantable cardioverter-defibrillator (ICD) after cardiac arrest in 2007 with replacement in 2012 due to battery depletion; the patient reported no previous syncope, unconsciousness or seizures. Interrogation records of the ICD showed five ventricular tachyarrhythmia episodes that corresponded to the "seizure". Further examination revealed incorrect position of the RV-lead. Diagnosis was a provoked epileptic seizure due to undersensing of ventricular tachycardia because of improper ICD lead implantation in the coronary sinus. Treatment consisted of implantation of a new device with an additional ICD lead into the right ventricle.

  17. Wavelet-based analysis of electroencephalogram (EEG) signals for detection and localization of epileptic seizures

    NASA Astrophysics Data System (ADS)

    Benke, George; Bozek-Kuzmicki, Maribeth; Colella, David; Jacyna, Garry M.; Benedetto, John J.

    1995-04-01

    A wavelet-based technique WISP is used to discriminate normal brain activity from brain activity during epileptic seizures. The WISP technique is used to exploit the noted difference in frequency content during the normal brain state and the seizure brain state so that detection and localization decisions can be made. An AR-Pole statistic technique is used as a comparative measure to base-line the WISP performance.

  18. A tunable support vector machine assembly classifier for epileptic seizure detection.

    PubMed

    Tang, Y; Durand, Dm

    2012-03-01

    Automating the detection of epileptic seizures could reduce the significant human resources necessary for the care of patients suffering from intractable epilepsy and offer improved solutions for closed-loop therapeutic devices such as implantable electrical stimulation systems. While numerous detection algorithms have been published, an effective detector in the clinical setting remains elusive. There are significant challenges facing seizure detection algorithms. The epilepsy EEG morphology can vary widely among the patient population. EEG recordings from the same patient can change over time. EEG recordings can be contaminated with artifacts that often resemble epileptic seizure activity. In order for an epileptic seizure detector to be successful, it must be able to adapt to these different challenges. In this study, a novel detector is proposed based on a support vector machine assembly classifier (SVMA). The SVMA consists of a group of SVMs each trained with a different set of weights between the seizure and non-seizure data and the user can selectively control the output of the SVMA classifier. The algorithm can improve the detection performance compared to traditional methods by providing an effective tuning strategy for specific patients. The proposed algorithm also demonstrates a clear advantage over threshold tuning. When compared with the detection performances reported by other studies using the publicly available epilepsy dataset hosted by the University of BONN, the proposed SVMA detector achieved the best total accuracy of 98.72%. These results demonstrate the efficacy of the proposed SVMA detector and its potential in the clinical setting.

  19. A tunable support vector machine assembly classifier for epileptic seizure detection

    PubMed Central

    Tang, Y; Durand, DM

    2011-01-01

    Automating the detection of epileptic seizures could reduce the significant human resources necessary for the care of patients suffering from intractable epilepsy and offer improved solutions for closed-loop therapeutic devices such as implantable electrical stimulation systems. While numerous detection algorithms have been published, an effective detector in the clinical setting remains elusive. There are significant challenges facing seizure detection algorithms. The epilepsy EEG morphology can vary widely among the patient population. EEG recordings from the same patient can change over time. EEG recordings can be contaminated with artifacts that often resemble epileptic seizure activity. In order for an epileptic seizure detector to be successful, it must be able to adapt to these different challenges. In this study, a novel detector is proposed based on a support vector machine assembly classifier (SVMA). The SVMA consists of a group of SVMs each trained with a different set of weights between the seizure and non-seizure data and the user can selectively control the output of the SVMA classifier. The algorithm can improve the detection performance compared to traditional methods by providing an effective tuning strategy for specific patients. The proposed algorithm also demonstrates a clear advantage over threshold tuning. When compared with the detection performances reported by other studies using the publicly available epilepsy dataset hosted by the University of BONN, the proposed SVMA detector achieved the best total accuracy of 98.72%. These results demonstrate the efficacy of the proposed SVMA detector and its potential in the clinical setting. PMID:22563146

  20. MILD PASSIVE FOCAL COOLING PREVENTS EPILEPTIC SEIZURES AFTER HEAD INJURY IN RATS

    PubMed Central

    D’Ambrosio, Raimondo; Eastman, Clifford L.; Darvas, Felix; Fender, Jason S.; Verley, Derek R.; Farin, Federico M.; Wilkerson, Hui-Wen; Temkin, Nancy R.; Miller, John W.; Ojemann, Jeffrey; Rothman, Steven M.; Smyth, Matthew D.

    2013-01-01

    Objective Posttraumatic epilepsy is prevalent, often difficult to manage, and currently cannot be prevented. While cooling is broadly neuroprotective, cooling-induced prevention of chronic spontaneous recurrent seizures has never been demonstrated. We examined the effect of mild passive focal cooling of the perilesional neocortex on the development of neocortical epileptic seizures after head injury in the rat. Methods Rostral parasagittal fluid percussion injury in rats reliably induces a perilesional, neocortical epileptic focus within weeks after injury. Epileptic seizures were assessed by 5-electrode video-electrocorticography (ECoG) 2–16 weeks post-injury. Focal cooling was induced with ECoG headsets engineered for calibrated passive heat dissipation. Pathophysiology was assessed by GFAP immunostaining, cortical sclerosis, gene expression of inflammatory cytokines IL-1α and IL-1β, and ECoG spectral analysis. All animals were formally randomized to treatment groups and data were analyzed blind. Results Cooling by 0.5–2°C inhibited the onset of epileptic seizures in a dose dependent fashion. The treatment induced no additional pathology or inflammation, and normalized the power spectrum of stage N2 sleep. Cooling by 2°C for 5.5 weeks beginning 3 days after injury virtually abolished ictal activity. This effect persisted through the end of the study, over ten weeks after cessation of cooling. Rare remaining seizures were shorter than in controls. Interpretation These findings demonstrate potent and persistent prevention and modification of epileptic seizures after head injury with a cooling protocol that is neuroprotective, compatible with the care of head-injury patients, and conveniently implemented. The required cooling can be delivered passively without Peltier cells or electrical power. PMID:23225633

  1. Surface acoustic wave probe implant for predicting epileptic seizures

    DOEpatents

    Gopalsami, Nachappa [Naperville, IL; Kulikov, Stanislav [Sarov, RU; Osorio, Ivan [Leawood, KS; Raptis, Apostolos C [Downers Grove, IL

    2012-04-24

    A system and method for predicting and avoiding a seizure in a patient. The system and method includes use of an implanted surface acoustic wave probe and coupled RF antenna to monitor temperature of the patient's brain, critical changes in the temperature characteristic of a precursor to the seizure. The system can activate an implanted cooling unit which can avoid or minimize a seizure in the patient.

  2. Involvement of Thalamus in Initiation of Epileptic Seizures Induced by Pilocarpine in Mice

    PubMed Central

    Li, Yong-Hua; Li, Jia-Jia; Lu, Qin-Chi; Gong, Hai-Qing; Liang, Pei-Ji

    2014-01-01

    Studies have suggested that thalamus is involved in temporal lobe epilepsy, but the role of thalamus is still unclear. We obtained local filed potentials (LFPs) and single-unit activities from CA1 of hippocampus and parafascicular nucleus of thalamus during the development of epileptic seizures induced by pilocarpine in mice. Two measures, redundancy and directionality index, were used to analyze the electrophysiological characters of neuronal activities and the information flow between thalamus and hippocampus. We found that LFPs became more regular during the seizure in both hippocampus and thalamus, and in some cases LFPs showed a transient disorder at seizure onset. The variation tendency of the peak values of cross-correlation function between neurons matched the variation tendency of the redundancy of LFPs. The information tended to flow from thalamus to hippocampus during seizure initiation period no matter what the information flow direction was before the seizure. In some cases the information flow was symmetrically bidirectional, but none was found in which the information flowed from hippocampus to thalamus during the seizure initiation period. In addition, inactivation of thalamus by tetrodotoxin (TTX) resulted in a suppression of seizures. These results suggest that thalamus may play an important role in the initiation of epileptic seizures. PMID:24778885

  3. Topographic movie of intracranial ictal high-frequency oscillations with seizure semiology: epileptic network in Jacksonian seizures.

    PubMed

    Akiyama, Tomoyuki; Chan, Derrick W; Go, Cristina Y; Ochi, Ayako; Elliott, Irene M; Donner, Elizabeth J; Weiss, Shelly K; Snead, O Carter; Rutka, James T; Drake, James M; Otsubo, Hiroshi

    2011-01-01

    We developed a technique to produce images of dynamic changes in ictal high-frequency oscillations (HFOs) >40 Hz recorded on subdural electroencephalography (EEG) that are time-locked to the ictal EEG and ictal semiology video. We applied this technique to Jacksonian seizures to demonstrate ictal HFO propagation along the homunculus in the primary sensory-motor cortex to visualize the underlying epileptic network. We analyzed intracranial ictal EEGs from two patients with intractable Jacksonian seizures who underwent epilepsy surgery. We calculated the degrees of increase in amplitude within 40-80, 80-200, and 200-300 Hz frequency bands compared to the interictal period and converted them into topographic movies projected onto the brain surface picture. We combined these data with the ictal EEGs and video of the patient demonstrating ictal semiology. The ictal HFOs began in the sensory cortex and appeared concomitantly with the sensory aura. They then propagated to the motor cortex at the same time that focal motor symptoms evolved. As the seizure progressed, the ictal HFOs spread or reverberated in the rolandic region. However, even when the seizure became secondarily generalized, the ictal HFOs were confined to the rolandic region. In both cases, there was increased amplitude of higher frequency bands during seizure initiation compared to seizure progression. This combined movie showed the ictal HFO propagation corresponding to the ictal semiology in Jacksonian seizures and revealed the epileptic network involved in seizure initiation and progression. This method may advance understanding of neural network activities relating to clinical seizure generation and propagation. Wiley Periodicals, Inc. © 2010 International League Against Epilepsy.

  4. Towards a Selection Mechanism of Relevant Features for Automatic Epileptic Seizures Detection.

    PubMed

    Mera-Gaona, Maritza; Vargas-Canas, Rubiel; Lopez, Diego M

    2016-01-01

    Epilepsy diagnosis is frequently confirmed using electroencephalogram (EEG) along with clinical data. The main difficulty in the diagnosis is associated with the large amount of data generated by EEG, which must be analyzed by neurologists for identifying abnormalities. One of the main research challenges in this area is the identification of relevant EEG features that allow automatic detection of epileptic seizures, especially when a large number of EEG features are analyzed. The aim of this paper is to analize the accuracy of algorithms typically used in feature selection processes, in order to propose a mechanism to identify a set of relevant features to support automatic epileptic seizures detection. This paper presents a set of 161 features extracted from EEG signals and the relevance analysis of these features in order to identify a reduced set for efficiently classifying EEG signals in two categories: normal o epileptic seizure (abnormal). A public EEG database was used to assess the relevance of the selected features. The results show that the number of features used for classification were reduced by 97.51%. The paper provided an analysis of the accuracy of three algorithms, typically used in feature selection processes, in the selection of a set of relevant features to support the automatic epileptic seizures detection. The Forward Selection algorithm (FSA) produced the best results in the classification process, with an accuracy of 80.77%.

  5. Epileptic Seizure Prediction Using a New Similarity Index for Chaotic Signals

    NASA Astrophysics Data System (ADS)

    Niknazar, Hamid; Nasrabadi, Ali Motie

    Epileptic seizures are generated by abnormal activity of neurons. The prediction of epileptic seizures is an important issue in the field of neurology, since it may improve the quality of life of patients suffering from drug resistant epilepsy. In this study a new similarity index based on symbolic dynamic techniques which can be used for extracting behavior of chaotic time series is presented. Using Freiburg EEG dataset, it is found that the method is able to detect the behavioral changes of the neural activity prior to epileptic seizures, so it can be used for prediction of epileptic seizure. A sensitivity of 63.75% with 0.33 false positive rate (FPR) in all 21 patients and sensitivity of 96.66% with 0.33 FPR in eight patients were achieved using the proposed method. Moreover, the method was evaluated by applying on Logistic and Tent map with different parameters to demonstrate its robustness and ability in determining similarity between two time series with the same chaotic characterization.

  6. Cooling of the epileptic focus suppresses seizures with minimal influence on neurologic functions.

    PubMed

    Fujii, Masami; Inoue, Takao; Nomura, Sadahiro; Maruta, Yuichi; He, Yeting; Koizumi, Hiroyasu; Shirao, Satoshi; Owada, Yuji; Kunitsugu, Ichiro; Yamakawa, Toshitaka; Tokiwa, Tatsuji; Ishizuka, Satoshi; Yamakawa, Takeshi; Suzuki, Michiyasu

    2012-03-01

    Focal brain cooling is effective for suppression of epileptic seizures, but it is unclear if seizures can be suppressed without a substantial influence on normal neurologic function. To address the issue, a thermoelectrically driven cooling system was developed and applied in free-moving rat models of focal seizure and epilepsy. Focal seizures limited to the unilateral forelimb were induced by local application of a penicillin G solution or cobalt powder to the unilateral sensorimotor cortex. A proportional integration and differentiation (PID)-controlled, thermoelectrically driven cooling device (weight of 11 g) and bipolar electrodes were chronically implanted on the eloquent area (on the epileptic focus) and the effects of cooling (20, 15, and 10°C) on electrocorticography, seizure frequency, and neurologic changes were investigated. Cooling was associated with a distinct reduction of the epileptic discharges. In both models, cooling of epileptic foci significantly improved both seizure frequency and neurologic functions from 20°C down to 15°C. Cooling to 10°C also suppressed seizures, but with no further improvement in neurologic function. Subsequent investigation of sensorimotor function revealed significant deterioration in foot-fault tests and the receptive field size at 15°C. Despite the beneficial effects in ictal rats, sensorimotor functions deteriorated at 15°C, thereby suggesting a lower limit for the therapeutic temperature. These results provide important evidence of a therapeutic effect of temperatures from 20 to 15°C using an implantable, hypothermal device for focal epilepsy. Wiley Periodicals, Inc. © 2012 International League Against Epilepsy.

  7. Epileptic seizure detection in EEG signal with GModPCA and support vector machine.

    PubMed

    Jaiswal, Abeg Kumar; Banka, Haider

    2017-01-01

    Epilepsy is one of the most common neurological disorders caused by recurrent seizures. Electroencephalograms (EEGs) record neural activity and can detect epilepsy. Visual inspection of an EEG signal for epileptic seizure detection is a time-consuming process and may lead to human error; therefore, recently, a number of automated seizure detection frameworks were proposed to replace these traditional methods. Feature extraction and classification are two important steps in these procedures. Feature extraction focuses on finding the informative features that could be used for classification and correct decision-making. Therefore, proposing effective feature extraction techniques for seizure detection is of great significance. Principal Component Analysis (PCA) is a dimensionality reduction technique used in different fields of pattern recognition including EEG signal classification. Global modular PCA (GModPCA) is a variation of PCA. In this paper, an effective framework with GModPCA and Support Vector Machine (SVM) is presented for epileptic seizure detection in EEG signals. The feature extraction is performed with GModPCA, whereas SVM trained with radial basis function kernel performed the classification between seizure and nonseizure EEG signals. Seven different experimental cases were conducted on the benchmark epilepsy EEG dataset. The system performance was evaluated using 10-fold cross-validation. In addition, we prove analytically that GModPCA has less time and space complexities as compared to PCA. The experimental results show that EEG signals have strong inter-sub-pattern correlations. GModPCA and SVM have been able to achieve 100% accuracy for the classification between normal and epileptic signals. Along with this, seven different experimental cases were tested. The classification results of the proposed approach were better than were compared the results of some of the existing methods proposed in literature. It is also found that the time and space

  8. Neuroethological approach to frontolimbic epileptic seizures and parasomnias: The same central pattern generators for the same behaviours.

    PubMed

    Tassinari, C A; Cantalupo, G; Högl, B; Cortelli, P; Tassi, L; Francione, S; Nobili, L; Meletti, S; Rubboli, G; Gardella, E

    2009-10-01

    The aim of this report is not to make a differential diagnosis between epileptic nocturnal seizures and non-epileptic sleep-related movement disorders, or parasomnias. On the contrary, our goal is to emphasize the commonly shared semiological features of some epileptic seizures and parasomnias. Such similar features might be explained by the activation of the same neuronal networks (so-called 'central pattern generators' or CPG). These produce the stereotypical rhythmic motor sequences - in other words, behaviours - that are adaptive and species-specific (such as eating/alimentary, attractive/aversive, locomotor and nesting habits). CPG are located at the subcortical level (mainly in the brain stem and spinal cord) and, in humans, are under the control of the phylogenetically more recent neomammalian neocortical structures, according to a simplified Jacksonian model. Based on video-polygraphic recordings of sleep-related epileptic seizures and non-epileptic events (parasomnias), we have documented how a transient "neomammalian brain" dysfunction - whether epileptic or not - can 'release' (disinhibition?) the CPG responsible for involuntary motor behaviours. Thus, in both epileptic seizures and parasomnias, we can observe: (a) oroalimentary automatisms, bruxism and biting; (b) ambulatory behaviours, ranging from the classical bimanual-bipedal activity of 'frontal' hypermotor seizures, epileptic and non-epileptic wanderings, and somnambulism to periodic leg movements (PLM), alternating leg muscle activation (ALMA) and restless legs syndrome (RLS); and (c) various sleep-related events such as ictal fear, sleep terrors, nightmares and violent behaviour.

  9. Seizure-Related Regulation of GABAA Receptors in Spontaneously Epileptic Rats

    PubMed Central

    González, Marco I.; Grabenstatter, Heidi L.; del Rio, Christian Cea; Del Angel, Yasmin Cruz; Carlsen, Jessica; Laoprasert, Rick; White, Andrew M.; Huntsman, Molly M.; Brooks-Kayal, Amy

    2015-01-01

    In this study, we analyzed the impact that spontaneous seizures might have on the plasma membrane expression, composition and function of GABAA receptors (GABAARs). For this, tissue of chronically epileptic rats was collected within 3 hours of seizure occurrence (≤3 hours group) or at least 24 hours after seizure occurrence (≥24 hours group). A retrospective analysis of seizure frequency revealed that selecting animals on the bases of seizure proximity also grouped animals in terms of overall seizure burden with a higher seizure burden observed in the ≤3 hours group. A biochemical analysis showed that although animals with more frequent/recent seizures (≤3 hours group) had similar levels of GABAAR at the plasma membrane they showed deficits in inhibitory neurotransmission. In contrast, tissue obtained from animals experiencing infrequent seizures (≥24 hours group) had increased plasma membrane levels of GABAAR and showed no deficit in inhibitory function. Together, our findings offer an initial insight into the molecular changes that might help to explain how alterations in GABAAR function can be associated with differential seizure burden. Our findings also suggest that increased plasma membrane levels of GABAAR might act as a compensatory mechanism to more effectively maintain inhibitory function, repress hyperexcitability and reduce seizure burden. This study is an initial step towards a fuller characterization of the molecular events that trigger alterations in GABAergic neurotransmission during chronic epilepsy. PMID:25769812

  10. Levetiracetam in the Treatment of Epileptic Seizures After Liver Transplantation.

    PubMed

    Lin, Chih-Hsiang; Chen, Chao-Long; Lin, Tsu-Kung; Chen, Nai-Ching; Tsai, Meng-Han; Chuang, Yao-Chung

    2015-09-01

    After liver transplantation, patients may develop seizures or epilepsy due to a variety of etiologies. The ideal antiepileptic drugs for these patients are those with fewer drug interactions and less hepatic toxicity. In this study, we present patients using levetiracetam to control seizures after liver transplantation. We retrospectively enrolled patients who received levetiracetam for seizure control after liver transplantation. We analyzed the etiology of liver failure that required liver transplantation, etiology of the seizures, outcomes of seizure control, and the condition of the patient after follow-up at the outpatient department. Hematological and biochemical data before and after the use of levetiracetam were also collected. Fifteen patients who received intravenous or oral levetiracetam monotherapy for seizure control after liver transplantation were enrolled into this study. All of the patients remained seizure-free during levetiracetam treatment. Two patients died during the follow-up, and the other 13 patients were alive at the end of the study period and all were seizure-free without neurological sequelae that interfered with their daily activities. No patients experienced liver failure or rejection of the donor liver due to ineffective immunosuppressant medications. The dosage of immunosuppressants did not change before and after levetiracetam treatment, and there were no changes in hematological and biochemical data before and after treatment. Levetiracetam may be a suitable antiepileptic drug for patients who undergo liver transplantation due to fewer drug interactions and a favorable safety profile.

  11. Automatic epileptic seizure detection in EEGs based on line length feature and artificial neural networks.

    PubMed

    Guo, Ling; Rivero, Daniel; Dorado, Julián; Rabuñal, Juan R; Pazos, Alejandro

    2010-08-15

    About 1% of the people in the world suffer from epilepsy. The main characteristic of epilepsy is the recurrent seizures. Careful analysis of the electroencephalogram (EEG) recordings can provide valuable information for understanding the mechanisms behind epileptic disorders. Since epileptic seizures occur irregularly and unpredictably, automatic seizure detection in EEG recordings is highly required. Wavelet transform (WT) is an effective analysis tool for non-stationary signals, such as EEGs. The line length feature reflects the waveform dimensionality changes and is a measure sensitive to variation of the signal amplitude and frequency. This paper presents a novel method for automatic epileptic seizure detection, which uses line length features based on wavelet transform multiresolution decomposition and combines with an artificial neural network (ANN) to classify the EEG signals regarding the existence of seizure or not. To the knowledge of the authors, there exists no similar work in the literature. A famous public dataset was used to evaluate the proposed method. The high accuracy obtained for three different classification problems testified the great success of the method.

  12. Increased number of febrile seizures in children born very preterm: relation of neonatal, febrile and epileptic seizures and neurological dysfunction to seizure outcome at 16 years of age.

    PubMed

    Herrgård, Eila A; Karvonen, Marjo; Luoma, Laila; Saavalainen, Pia; Määttä, Sara; Laukkanen, Eila; Partanen, Juhani

    2006-12-01

    In prematurely born population, a cascade of events from initial injury in the developing brain to morbidity may be followed. The aim of our study was to assess seizures in prematurely born children from birth up to 16 years and to evaluate the contribution of different seizures, and of neurological dysfunction to the seizure outcome. Pre- and neonatal data and data from neurodevelopmental examination at 5 years of 60 prospectively followed children born at or before 32 weeks of gestation, and of 60 matched term controls from the 2 year birth cohort were available from earlier phases of the study. Later seizure data were obtained from questionnaires at 5, 9, and 16 years, and from hospital records and parent interviews. In the preterm group, 16 children (27%) exhibited neonatal seizures, 10 children (17%) had seizures during febrile illness and 5 children had epilepsy. Eight children had only febrile seizures, and 3 of these had both multiple simple and complex febrile seizures and neurodevelopmental dysfunction. None of the 8 children had experienced neonatal seizures, 6 had a positive family history of seizures, but none developed epilepsy. The children with epilepsy had CP and neurocognitive problems, and all but one had experienced neonatal seizures; two of them had also had fever-induced epileptic seizures. In controls 3 children (5%) had simple febrile seizures. Children born very preterm have increased rate of febrile seizures compared to the controls. However, no cascade from initial injury via febrile seizures to epilepsy could be shown during the follow-up of 16 years. Symptomatic epilepsy in prematurely born children is characterised by neonatal seizures, major neurological disabilities and early onset of epilepsy.

  13. Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure.

    PubMed

    Xi, Zhiqin; Deng, Wanni; Wang, Liang; Xiao, Fei; Li, Jie; Wang, Zhihua; Wang, Xin; Mi, Xiujuan; Wang, Na; Wang, Xuefeng

    2015-11-01

    Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6 h to 3 days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.

  14. Alterations of endocannabinoids in cerebrospinal fluid of dogs with epileptic seizure disorder

    PubMed Central

    2013-01-01

    Background Epilepsy is one of the most common chronic neurological disorders in dogs characterized by recurrent seizures. The endocannabinoid (EC) system plays a central role in suppressing pathologic neuronal excitability and in controlling the spread of activity in an epileptic network. Endocannabinoids are released on demand and their dysregulation has been described in several pathological conditions. Recurrent seizures may lead to an adverse reorganization of the EC system and impairment of its protective effect. In the current study, we tested the hypothesis that cerebrospinal fluid (CSF) concentrations of the endocannabinoids anandamide (AEA) and 2-arachidonoyl glycerol (2AG) are altered in epileptic dogs. Concentrations of AEA and total AG (sum of 2AG and 1AG) were measured in 40 dogs with idiopathic epilepsy and in 16 unaffected, healthy control dogs using liquid chromatography combined with tandem mass spectrometry. Results AEA and total AG were measured at 4.94 (3.18 – 9.17) pM and 1.43 (0.90 – 1.92) nM in epileptic dogs and at 3.19 (2.04 – 4.28) pM and 1.76 (1.08 – 2.69) nM in the control group, respectively (median, 25 – 75% percentiles in brackets). The AEA difference between epileptic and healthy dogs was statistically significant (p < 0.05). Values correlated with seizure severity and duration of seizure activity. Dogs with cluster seizures and/or status epilepticus and with seizure activity for more than six months displayed the highest EC concentrations. Conclusion In conclusion, we present the first endocannabinoid measurements in canine CSF and confirm the hypothesis that the EC system is altered in canine idiopathic epilepsy. PMID:24370333

  15. Seizure, Fit or Attack? The Use of Diagnostic Labels by Patients with Epileptic or Non-Epileptic Seizures

    ERIC Educational Resources Information Center

    Plug, Leendert; Sharrack, Basil; Reuber, Markus

    2010-01-01

    We present an analysis of the use of diagnostic labels such as "seizure", "attack", "fit", and "blackout" by patients who experience seizures. While previous research on patients' preferences for diagnostic terminology has relied on questionnaires, we assess patients' own preferences and their responses to a doctor's use of different labels…

  16. Seizure, Fit or Attack? The Use of Diagnostic Labels by Patients with Epileptic or Non-Epileptic Seizures

    ERIC Educational Resources Information Center

    Plug, Leendert; Sharrack, Basil; Reuber, Markus

    2010-01-01

    We present an analysis of the use of diagnostic labels such as "seizure", "attack", "fit", and "blackout" by patients who experience seizures. While previous research on patients' preferences for diagnostic terminology has relied on questionnaires, we assess patients' own preferences and their responses to a doctor's use of different labels…

  17. High performance seizure-monitoring system using a vibration sensor and videotape recording: behavioral analysis of genetically epileptic rats.

    PubMed

    Amano, S; Yokoyama, M; Torii, R; Fukuoka, J; Tanaka, K; Ihara, N; Hazama, F

    1997-06-01

    A new seizure-monitoring apparatus containing a piezoceramic vibration sensor combined with videotape recording was developed. Behavioral analysis of Ihara's genetically epileptic rat (IGER), which is a recently developed novel mutant with spontaneously limbic-like seizures, was performed using this new device. Twenty 8-month-old male IGERs were monitored continuously for 72 h. Abnormal behaviors were detected by use of a vibration recorder, and epileptic seizures were confirmed by videotape recordings taken synchronously with vibration recording. Representative forms of seizures were generalized convulsions and circling seizures. Generalized convulsions were found in 13 rats, and circling seizures in 7 of 20 animals. Two rats had generalized and circling seizures, and two rats did not have seizures. Although there was no apparent circadian rhythm to the generalized seizures, circling seizures occurred mostly between 1800 and 0800 h. A correlation between the sleep-wake cycle and the occurrence of circling seizures seems likely. Without exception, all the seizure actions were recorded by the vibration recorder and the videotape recorder. To eliminate the risk of a false-negative result, investigators scrutinized the information obtained from the vibration sensor and the videotape recorder. The newly developed seizure-monitoring system was found to facilitate detailed analysis of epileptic seizures in rats.

  18. Epileptic seizure detection in EEG signals using tunable-Q factor wavelet transform and bootstrap aggregating.

    PubMed

    Hassan, Ahnaf Rashik; Siuly, Siuly; Zhang, Yanchun

    2016-12-01

    Epileptic seizure detection is traditionally performed by expert clinicians based on visual observation of EEG signals. This process is time-consuming, burdensome, reliant on expensive human resources, and subject to error and bias. In epilepsy research, on the other hand, manual detection is unsuitable for handling large data-sets. A computerized seizure identification scheme can eradicate the aforementioned problems, aid clinicians, and benefit epilepsy research. In this work, a new automated epilepsy diagnosis scheme based on Tunable-Q factor wavelet transform (TQWT) and bootstrap aggregating (Bagging) using Electroencephalogram (EEG) signals is proposed. Until now, this is the first time spectral features in the TQWT domain in conjunction with Bagging are employed for epilepsy seizure identification to the best of the authors' knowledge. At first, we decompose the EEG signal segments into sub-bands using TQWT. We then extract various spectral features from the TQWT sub-bands. The suitability of spectral features in the TQWT domain is established through statistical measures and graphical analyses. Afterwards, Bagging is employed for epileptic seizure classification. The efficacy of Bagging in the proposed detection scheme is also studied in this research. The effects of various TQWT and Bagging parameters are investigated. The optimal choices of these parameters are also determined. The performance of the proposed scheme is studied using a publicly available benchmark EEG database for various classification cases that include inter-ictal (seizure-free interval), ictal (seizure) and healthy; seizure and non-seizure; ictal and inter-ictal; and seizure and healthy. In comparison with the state-of-the-art algorithms, the performance of the proposed method is superior in terms of sensitivity, specificity, and accuracy. The seizure detection method proposed herein therefore can alleviate the burden of medical professionals of analyzing a large bulk of data by visual

  19. Predicting epileptic seizures from scalp EEG based on attractor state analysis.

    PubMed

    Chu, Hyunho; Chung, Chun Kee; Jeong, Woorim; Cho, Kwang-Hyun

    2017-05-01

    Epilepsy is the second most common disease of the brain. Epilepsy makes it difficult for patients to live a normal life because it is difficult to predict when seizures will occur. In this regard, if seizures could be predicted a reasonable period of time before their occurrence, epilepsy patients could take precautions against them and improve their safety and quality of life. In this paper, we investigate a novel seizure precursor based on attractor state analysis for seizure prediction. We analyze the transition process from normal to seizure attractor state and investigate a precursor phenomenon seen before reaching the seizure attractor state. From the result of an analysis, we define a quantified spectral measure in scalp EEG for seizure prediction. From scalp EEG recordings, the Fourier coefficients of six EEG frequency bands are extracted, and the defined spectral measure is computed based on the coefficients for each half-overlapped 20-second-long window. The computed spectral measure is applied to seizure prediction using a low-complexity methodology. Within scalp EEG, we identified an early-warning indicator before an epileptic seizure occurs. Getting closer to the bifurcation point that triggers the transition from normal to seizure state, the power spectral density of low frequency bands of the perturbation of an attractor in the EEG, showed a relative increase. A low-complexity seizure prediction algorithm using this feature was evaluated, using ∼583h of scalp EEG in which 143 seizures in 16 patients were recorded. With the test dataset, the proposed method showed high sensitivity (86.67%) with a false prediction rate of 0.367h(-1) and average prediction time of 45.3min. A novel seizure prediction method using scalp EEG, based on attractor state analysis, shows potential for application with real epilepsy patients. This is the first study in which the seizure-precursor phenomenon of an epileptic seizure is investigated based on attractor

  20. Semiological seizure classification of epileptic seizures in children admitted to video-EEG monitoring unit.

    PubMed

    Alan, Serdar; Yalnızoğlu, Dilek; Turanlı, Güzide; Karlı-Oğuz, Kader; Lay-Ergun, Eser; Söylemezoğlu, Figen; Akalan, Nejat; Topçu, Meral

    2015-01-01

    We aimed to determine seizure characteristics of pediatric patients with epilepsy, and evaluate if Semiological Seizure Classification (SSC) system is applicable in this cohort. We retrospectively studied 183 patients, aged between 3 months-18 years, admitted to the video-EEG monitoring unit (VEMU). Most patients suffered from intractable epilepsy with comorbidities, and had structural lesions. Seizures were classified based on ictal video-EEG recordings by using SSC system; 157 patients had only one seizure type, 26 had more than one seizure types. Overall 211 seizures and 373 semiologies were analyzed; 114 seizures (54%) had more than one semiological subtype. The most frequent semiology was motor seizures (78%), followed by dialeptic seizures (12%). The most common subtypes were simple motor seizures (49%); tonic seizures constituted (28.4%) of all semiologies. We conclude that SSC system is applicable for children with epilepsy admitted to VEMU; complementary EEG and imaging data are required for evaluation of patients with epilepsy.

  1. Oxidative Stress Measurement and Prediction of Epileptic Seizure in Children and Adults With Severe Motor and Intellectual Disabilities

    PubMed Central

    Morimoto, Masahito; Satomura, Shigeko; Hashimoto, Toshiaki; Ito, Etsuro; Kyotani, Shojiro

    2016-01-01

    Background The medical care of severe motor and intellectual disabilities (SMID) depends on the empirical medical care. Epileptic seizure specific to SMID is difficult to suppress using anti-epileptic drugs, and its tendency to persist for long periods poses an issue. The present study was undertaken to evaluate the relationship between epileptic seizure in cases with SMID and oxidative stress in the living body by examining endogenous antioxidants, the degree of oxidation (reactive oxygen metabolites (d-ROMs)), and the biological antioxidant potential (BAP) as indicators. Methods Target patients were 43 SMID epilepsy patients. Blood was sampled before breakfast and medication. As for the specimen, d-ROMs and BAP were measured using the free radical analyzer. Results The present study did not reveal any correlation between endogenous antioxidants (albumin) and the frequency of epileptic seizures. On the other hand, d-ROMs were correlated with the frequency of epileptic seizure. In particular, strong correlations between the frequency of epileptic seizures and the d-ROMs/BAP ratio as well as the BAP/d-ROMs ratio were noted. Conclusions These results indicate that the use of d-ROMs and BAP as biomarkers can provide a tool for predicting the prognosis of epileptic seizures in patients with SMID. PMID:27222671

  2. Gaussian mixture model for the identification of psychogenic non-epileptic seizures using a wearable accelerometer sensor.

    PubMed

    Kusmakar, Shitanshu; Muthuganapathy, Ramanathan; Yan, Bernard; O'Brien, Terence J; Palaniswami, Marimuthu

    2016-08-01

    Any abnormal hypersynchronus activity of neurons can be characterized as an epileptic seizure (ES). A broad class of non-epileptic seizures is comprised of Psychogenic non-epileptic seizures (PNES). PNES are paroxysmal events, which mimics epileptic seizures and pose a diagnostic challenge with epileptic seizures due to their clinical similarities. The diagnosis of PNES is done using video-electroencephalography (VEM) monitoring. VEM being a resource intensive process calls for alternative methods for detection of PNES. There is now an emerging interest in the use of accelerometer based devices for the detection of seizures. In this work, we present an algorithm based on Gaussian mixture model (GMM's) for the identification of PNES, ES and normal movements using a wrist-worn accelerometer device. Features in time, frequency and wavelet domain are extracted from the norm of accelerometry signal. All events are then classified into three classes i.e normal, PNES and ES using a parametric estimate of the multivariate normal probability density function. An algorithm based on GMM's allows us to accurately model the non-epileptic and epileptic movements, thus enhancing the overall predictive accuracy of the system. The new algorithm was tested on data collected from 16 patients and showed an overall detection accuracy of 91% with 25 false alarms.

  3. Development of hypersynchrony in the cortical network during chemoconvulsant-induced epileptic seizures in vivo.

    PubMed

    Cymerblit-Sabba, Adi; Schiller, Yitzhak

    2012-03-01

    The prevailing view of epileptic seizures is that they are caused by increased hypersynchronous activity in the cortical network. However, this view is based mostly on electroencephalography (EEG) recordings that do not directly monitor neuronal synchronization of action potential firing. In this study, we used multielectrode single-unit recordings from the hippocampus to investigate firing of individual CA1 neurons and directly monitor synchronization of action potential firing between neurons during the different ictal phases of chemoconvulsant-induced epileptic seizures in vivo. During the early phase of seizures manifesting as low-amplitude rhythmic β-electrocorticography (ECoG) activity, the firing frequency of most neurons markedly increased. To our surprise, the average overall neuronal synchronization as measured by the cross-correlation function was reduced compared with control conditions with ~60% of neuronal pairs showing no significant correlated firing. However, correlated firing was not uniform and a minority of neuronal pairs showed a high degree of correlated firing. Moreover, during the early phase of seizures, correlated firing between 9.8 ± 5.1% of all stably recorded pairs increased compared with control conditions. As seizures progressed and high-frequency ECoG polyspikes developed, the firing frequency of neurons further increased and enhanced correlated firing was observed between virtually all neuronal pairs. These findings indicated that epileptic seizures represented a hyperactive state with widespread increase in action potential firing. Hypersynchrony also characterized seizures. However, it initially developed in a small subset of neurons and gradually spread to involve the entire cortical network only in the later more intense ictal phases.

  4. X-linked focal epilepsy with reflex bathing seizures: Characterization of a distinct epileptic syndrome.

    PubMed

    Nguyen, Dang Khoa; Rouleau, Isabelle; Sénéchal, Geneviève; Ansaldo, Ana Inés; Gravel, Micheline; Benfenati, Fabio; Cossette, Patrick

    2015-07-01

    We recently reported a Q555X mutation of synapsin 1 (SYN1) on chromosome Xp11-q21 in a family segregating partial epilepsy and autistic spectrum disorder. Herein, we provide a detailed description of the epileptic syndrome in the original family. A total of 34 members from a large French-Canadian family were evaluated. Family members with seizures or epilepsy underwent (when possible) clinical, neuropsychological, electrophysiologic, and neuroimaging assessments. Epilepsy was diagnosed in 10 family members (4 deceased, 6 living). In addition to occasional spontaneous complex partial seizures, seven family members clearly had reflex seizures triggered by bathing or showering. Hippocampal atrophy was found in two of five epileptic family members family members who underwent magnetic resonance (MR) imaging. Video-electroencephalography (EEG) recordings of three triggered seizures in two affected members showed rhythmic theta activity over temporal head regions. Ictal single-photon emission computed tomography (SPECT) showed temporoinsular perfusion changes. Detailed neuropsychological assessments revealed that SYN1 Q555X male mutation carriers showed specific language impairment and mild autistic spectrum disorder. Female carriers also exhibited reading impairments and febrile seizures but no chronic epilepsy. Available evidence suggests that impaired SYN1 function is associated with hyperexcitability of the temporoinsular network and disturbance of high mental functions such as language and social interaction. The presence of reflex bathing seizures, a most peculiar clinical feature, could be helpful in identifying other patients with this syndrome. Wiley Periodicals, Inc. © 2015 International League Against Epilepsy.

  5. Measure profile surrogates: A method to validate the performance of epileptic seizure prediction algorithms

    NASA Astrophysics Data System (ADS)

    Kreuz, Thomas; Andrzejak, Ralph G.; Mormann, Florian; Kraskov, Alexander; Stögbauer, Harald; Elger, Christian E.; Lehnertz, Klaus; Grassberger, Peter

    2004-06-01

    In a growing number of publications it is claimed that epileptic seizures can be predicted by analyzing the electroencephalogram (EEG) with different characterizing measures. However, many of these studies suffer from a severe lack of statistical validation. Only rarely are results passed to a statistical test and verified against some null hypothesis H0 in order to quantify their significance. In this paper we propose a method to statistically validate the performance of measures used to predict epileptic seizures. From measure profiles rendered by applying a moving-window technique to the electroencephalogram we first generate an ensemble of surrogates by a constrained randomization using simulated annealing. Subsequently the seizure prediction algorithm is applied to the original measure profile and to the surrogates. If detectable changes before seizure onset exist, highest performance values should be obtained for the original measure profiles and the null hypothesis. “The measure is not suited for seizure prediction” can be rejected. We demonstrate our method by applying two measures of synchronization to a quasicontinuous EEG recording and by evaluating their predictive performance using a straightforward seizure prediction statistics. We would like to stress that the proposed method is rather universal and can be applied to many other prediction and detection problems.

  6. Epileptic seizure detection in EEGs signals based on the weighted visibility graph entropy.

    PubMed

    Mohammadpoory, Zeynab; Nasrolahzadeh, Mahda; Haddadnia, Javad

    2017-08-01

    Epileptic seizure detection has been a complex task for both researchers and specialist in that the assessment of epilepsy is difficult because, electroencephalogram (EEG) signals are chaotic and non-stationary. This paper proposes a new method based on weighted visibility graph entropy (WVGE) to identify seizure from EEG signals. Single channel EEG signals are mapped onto the WVGs and WVGEs are calculated from these WVGs. Then some features are extracted of WVGEs and given to classifiers to investigate the performance of these features to classify the brain signals into three groups of normal (healthy), seizure free (interictal) and during a seizure (ictal) groups. Four popular classifiers namely Support Vector Machine (SVM), K-Nearest Neighbor (KNN), Decision tree (DT) and, Naïve Bayes (NB) are used in this work. Experimental results show that the proposed method can classify normal, ictal and interictal groups with a high accuracy of 97%. This high accuracy index, which is obtained using just three features, is higher than those obtained by several previous works in which more nonlinear features were employed. Also, our method is fast and easy and may be helpful in different applications of automatic seizure detection such as online epileptic seizure detection. Copyright © 2017 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  7. Effects of linoleic acid on generalized convulsive and nonconvulsive epileptic seizures.

    PubMed

    Ekici, Fatih; Gürol, Gönül; Ateş, Nurbay

    2014-01-01

    To comparatively investigate the effects of linoleic acid on convulsive and nonconvulsive epileptic seizures. Rats were divided into 3 groups: convulsive epileptic rats receiving only pentylentetrazole (PTZ) injections (group 1), convulsive epileptic rats receiving PTZ and linoleic acid (group 2), and Wistar Albino Glaxo rats from Rijswijk with genetic absence epilepsy receiving linoleic acid (group 3). The duration and severity of convulsive activity were determined in groups in which convulsive seizures were induced by PTZ. In group 3, intravenous linoleic acid was administered after 1-h baseline electroencephalography (EEG) recordings. The EEG recordings were analyzed. When groups 1 and 2 were compared, the delay in onset of minor seizures and the decrease in the number of rats developing major seizures were found statistically significant. When the mean spike-wave discharge number and duration values for the rats in group 3 were compared to baseline values, a statistically significant increase was found in the 1st and 6th hours and there was no significant difference in the 24th hour. While our study shows that linoleic acid may be effective in the treatment of generalized convulsive epilepsy along with conventional antiepileptic drugs used in epilepsy treatment, it reports that linoleic acid is not appropriate in the treatment of nonconvulsive epilepsies.

  8. Gap Junctions and Epileptic Seizures – Two Sides of the Same Coin?

    PubMed Central

    Volman, Vladislav; Perc, Matjaž; Bazhenov, Maxim

    2011-01-01

    Electrical synapses (gap junctions) play a pivotal role in the synchronization of neuronal ensembles which also makes them likely agonists of pathological brain activity. Although large body of experimental data and theoretical considerations indicate that coupling neurons by electrical synapses promotes synchronous activity (and thus is potentially epileptogenic), some recent evidence questions the hypothesis of gap junctions being among purely epileptogenic factors. In particular, an expression of inter-neuronal gap junctions is often found to be higher after the experimentally induced seizures than before. Here we used a computational modeling approach to address the role of neuronal gap junctions in shaping the stability of a network to perturbations that are often associated with the onset of epileptic seizures. We show that under some circumstances, the addition of gap junctions can increase the dynamical stability of a network and thus suppress the collective electrical activity associated with seizures. This implies that the experimentally observed post-seizure additions of gap junctions could serve to prevent further escalations, suggesting furthermore that they are a consequence of an adaptive response of the neuronal network to the pathological activity. However, if the seizures are strong and persistent, our model predicts the existence of a critical tipping point after which additional gap junctions no longer suppress but strongly facilitate the escalation of epileptic seizures. Our results thus reveal a complex role of electrical coupling in relation to epileptiform events. Which dynamic scenario (seizure suppression or seizure escalation) is ultimately adopted by the network depends critically on the strength and duration of seizures, in turn emphasizing the importance of temporal and causal aspects when linking gap junctions with epilepsy. PMID:21655239

  9. Epileptic seizure classifications of single-channel scalp EEG data using wavelet-based features and SVM.

    PubMed

    Janjarasjitt, Suparerk

    2017-02-13

    In this study, wavelet-based features of single-channel scalp EEGs recorded from subjects with intractable seizure are examined for epileptic seizure classification. The wavelet-based features extracted from scalp EEGs are simply based on detail and approximation coefficients obtained from the discrete wavelet transform. Support vector machine (SVM), one of the most commonly used classifiers, is applied to classify vectors of wavelet-based features of scalp EEGs into either seizure or non-seizure class. In patient-based epileptic seizure classification, a training data set used to train SVM classifiers is composed of wavelet-based features of scalp EEGs corresponding to the first epileptic seizure event. Overall, the excellent performance on patient-dependent epileptic seizure classification is obtained with the average accuracy, sensitivity, and specificity of, respectively, 0.9687, 0.7299, and 0.9813. The vector composed of two wavelet-based features of scalp EEGs provide the best performance on patient-dependent epileptic seizure classification in most cases, i.e., 19 cases out of 24. The wavelet-based features corresponding to the 32-64, 8-16, and 4-8 Hz subbands of scalp EEGs are the mostly used features providing the best performance on patient-dependent classification. Furthermore, the performance on both patient-dependent and patient-independent epileptic seizure classifications are also validated using tenfold cross-validation. From the patient-independent epileptic seizure classification validated using tenfold cross-validation, it is shown that the best classification performance is achieved using the wavelet-based features corresponding to the 64-128 and 4-8 Hz subbands of scalp EEGs.

  10. Treatment of typical absence seizures and related epileptic syndromes.

    PubMed

    Panayiotopoulos, C P

    2001-01-01

    Typical absences are brief (seconds) generalised seizures of sudden onset and termination. They have 2 essential components: clinically, the impairment of consciousness (absence) and, generalised 3 to 4Hz spike/polyspike and slow wave discharges on electroencephalogram (EEG). They differ fundamentally from other seizures and are pharmacologically unique. Their clinical and EEG manifestations are syndrome-related. Impairment of consciousness may be severe, moderate, mild or inconspicuous. This is often associated with motor manifestations, automatisms and autonomic disturbances. Clonic, tonic and atonic components alone or in combination are motor symptoms; myoclonia, mainly of facial muscles, is the most common. The ictal EEG discharge may be consistently brief (2 to 5 seconds) or long (15 to 30 seconds), continuous or fragmented, with single or multiple spikes associated with the slow wave. The intradischarge frequency may be constant or may vary (2.5 to 5Hz). Typical absences are easily precipitated by hyperventilation in about 90% of untreated patients. They are usually spontaneous, but can be triggered by photic, pattern, video games stimuli, and mental or emotional factors. Typical absences usually start in childhood or adolescence. They occur in around 10 to 15% of adults with epilepsies, often combined with other generalised seizures. They may remit with age or be lifelong. Syndromic diagnosis is important for treatment strategies and prognosis. Absences may be severe and the only seizure type, as in childhood absence epilepsy. They may predominate in other syndromes or be mild and nonpredominant in syndromes such as juvenile myoclonic epilepsy where myoclonic jerks and generalised tonic clonic seizures are the main concern. Typical absence status epilepticus occurs in about 30% of patients and is more common in certain syndromes, e.g. idiopathic generalised epilepsy with perioral myoclonia or phantom absences. Typical absence seizures are often easy to

  11. Network dynamics of the brain and influence of the epileptic seizure onset zone.

    PubMed

    Burns, Samuel P; Santaniello, Sabato; Yaffe, Robert B; Jouny, Christophe C; Crone, Nathan E; Bergey, Gregory K; Anderson, William S; Sarma, Sridevi V

    2014-12-09

    The human brain is a dynamic networked system. Patients with partial epileptic seizures have focal regions that periodically diverge from normal brain network dynamics during seizures. We studied the evolution of brain connectivity before, during, and after seizures with graph-theoretic techniques on continuous electrocorticographic (ECoG) recordings (5.4 ± 1.7 d per patient, mean ± SD) from 12 patients with temporal, occipital, or frontal lobe partial onset seizures. Each electrode was considered a node in a graph, and edges between pairs of nodes were weighted by their coherence within a frequency band. The leading eigenvector of the connectivity matrix, which captures network structure, was tracked over time and clustered to uncover a finite set of brain network states. Across patients, we found that (i) the network connectivity is structured and defines a finite set of brain states, (ii) seizures are characterized by a consistent sequence of states, (iii) a subset of nodes is isolated from the network at seizure onset and becomes more connected with the network toward seizure termination, and (iv) the isolated nodes may identify the seizure onset zone with high specificity and sensitivity. To localize a seizure, clinicians visually inspect seizures recorded from multiple intracranial electrode contacts, a time-consuming process that may not always result in definitive localization. We show that network metrics computed from all ECoG channels capture the dynamics of the seizure onset zone as it diverges from normal overall network structure. This suggests that a state space model can be used to help localize the seizure onset zone in ECoG recordings.

  12. Network dynamics of the brain and influence of the epileptic seizure onset zone

    PubMed Central

    Burns, Samuel P.; Santaniello, Sabato; Yaffe, Robert B.; Jouny, Christophe C.; Crone, Nathan E.; Bergey, Gregory K.; Anderson, William S.; Sarma, Sridevi V.

    2014-01-01

    The human brain is a dynamic networked system. Patients with partial epileptic seizures have focal regions that periodically diverge from normal brain network dynamics during seizures. We studied the evolution of brain connectivity before, during, and after seizures with graph-theoretic techniques on continuous electrocorticographic (ECoG) recordings (5.4 ± 1.7 d per patient, mean ± SD) from 12 patients with temporal, occipital, or frontal lobe partial onset seizures. Each electrode was considered a node in a graph, and edges between pairs of nodes were weighted by their coherence within a frequency band. The leading eigenvector of the connectivity matrix, which captures network structure, was tracked over time and clustered to uncover a finite set of brain network states. Across patients, we found that (i) the network connectivity is structured and defines a finite set of brain states, (ii) seizures are characterized by a consistent sequence of states, (iii) a subset of nodes is isolated from the network at seizure onset and becomes more connected with the network toward seizure termination, and (iv) the isolated nodes may identify the seizure onset zone with high specificity and sensitivity. To localize a seizure, clinicians visually inspect seizures recorded from multiple intracranial electrode contacts, a time-consuming process that may not always result in definitive localization. We show that network metrics computed from all ECoG channels capture the dynamics of the seizure onset zone as it diverges from normal overall network structure. This suggests that a state space model can be used to help localize the seizure onset zone in ECoG recordings. PMID:25404339

  13. Detection of epileptic seizures with a modified heart rate variability algorithm based on Lorenz plot.

    PubMed

    Jeppesen, Jesper; Beniczky, Sándor; Johansen, Peter; Sidenius, Per; Fuglsang-Frederiksen, Anders

    2015-01-01

    In order to assess whether focal epileptic seizures can be detected and distinguished from exercise we evaluated four different heart rate variability (HRV) methods with short term moving window analysis of 30, 50 or 100 R-R intervals or seconds per analyzed window. The four methods consisted of: (1) reciprocal high frequency power based on Fast Fourier Transformation, (2) Cardiac Sympathetic Index (CSI), (3) Modified CSI both based on Lorenz plot, and (4) heart rate differential method. Seventeen patients (12 males, 5 females; age 20-55) had 47 seizures (including three secondary generalized tonic-clonic (sGTC)), which were analyzed during their long term video-EEG monitoring of 1-5 days duration. Positive seizure detection was regarded, when the HRV-value during seizures (1min before to 3min after seizure-onset) exceeded 105% of the highest value during exercise and non-seizure sample-periods of the same patient. Modified CSI100 was the most accurate method: it detected all seizures for 13 of the 17 patients within 6s before till 50s after seizure onset time, even though exercise maximum HR of each patient exceeded that of the seizures. The three sGTC seizures were all detected more than half a minute before the tonic-clonic phase. The results indicate a detectable, sudden and inordinate shift toward sympathetic overdrive in the sympathovagal balance of the autonomic nervous system around seizure-onset time, for most patients. The Modified CSI is a promising parameter for a portable ECG-based epilepsy alarm, detecting both focal and sGTC seizures. Copyright © 2014. Published by Elsevier Ltd.

  14. Trichotillomania and Non-Epileptic Seizures as Sleep-Related Dissociative Phenomena

    PubMed Central

    Angulo-Franco, Melina; Bush-Martínez, Alejandra; Nenclares-Portocarrero, Alejandro; Jiménez-Genchi, Alejandro

    2015-01-01

    The occurrence of non-epileptic seizures (NES) and trichotillomania during sleep is rare. We describe the case of an adult woman with a personal history of childhood maltreatment and psychiatric morbidity (major depression, trichotillomania, and conversion disorder), who was referred to the sleep unit because of nocturnal hair-pulling and psychomotor agitation during sleep. An all-night PSG recording with audiovisual monitoring documented seven episodes of trichotillomania and one NES, all of which arose from unequivocal wakefulness. Improvement of nocturnal behaviors was observed after long-term psychotherapy. This case illustrates that nocturnal trichotillomania and NES may be symptoms of a sleep-related dissociative disorder. Citation: Angulo-Franco M, Bush-Martínez A, Nenclares-Portocarrero A, Jiménez-Genchi A. Trichotillomania and non-epileptic seizures as sleep-related dissociative phenomena. J Clin Sleep Med 2015;11(3):271–273. PMID:25515284

  15. Differential diagnosis of epileptic seizures in infancy including the neonatal period.

    PubMed

    Cross, J Helen

    2013-08-01

    It is important to accurately diagnose epileptic seizures in early life to optimise management and prognosis. Conversely, however, many different movements and behaviours may manifest in the neonatal period and infancy that may not have at their root cause a change in electrical activity of the brain. It is important to distinguish them from epileptic seizures to avoid over- and inappropriate treatment. Some are physiological in the normal infant, such as neonatal tremor, benign neonatal sleep myoclonus, and shuddering attacks, whereas others may herald alternative rare neurological diagnoses with differing prognoses such as hyperekplexia, paroxysmal extreme pain disorder and alternating hemiplegia of childhood. Here are highlighted the key clinical features that distinguish some of these disorders, their management and prognosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Hypothalamic hamartoma, precocious puberty and gelastic seizures: a special model of "epileptic" developmental disorder.

    PubMed

    Deonna, T; Ziegler, A L

    2000-03-01

    Based on a review of the literature and a detailed longitudinal single case study of a child with early onset gelastic seizures and hypothalamic hamartoma, the authors review the arguments suggesting that the acquired cognitive and behavioral symptoms seen in the majority of cases of this special epileptic syndrome result from a direct effect of the seizures. The early neurobehavioral profile of the case presented in this paper and that of a previous study is particular and combines features of a pervasive developmental and an attention deficit disorder which are probably closely related to the particular location of the epilepsy and its spread from the hypothalamus.

  17. Quantitative analysis of surface electromyography during epileptic and nonepileptic convulsive seizures.

    PubMed

    Beniczky, Sándor; Conradsen, Isa; Moldovan, Mihai; Jennum, Poul; Fabricius, Martin; Benedek, Krisztina; Andersen, Noémi; Hjalgrim, Helle; Wolf, Peter

    2014-07-01

    To investigate the characteristics of sustained muscle activation during convulsive epileptic and psychogenic nonepileptic seizures (PNES), as compared to voluntary muscle activation. The main goal was to find surface electromyography (EMG) features that can distinguish between convulsive epileptic seizures and convulsive PNES. In this case-control study, surface EMG was recorded from the deltoid muscles during long-term video-electroencephalography (EEG) monitoring in 25 patients and in 21 healthy controls. A total of 46 clinical episodes were recorded: 28 generalized tonic-clonic seizures (GTCS) from 14 patients with epilepsy, and 18 convulsive PNES from 12 patients (one patient had both GTCS and PNES). The healthy controls were simulating GTCS. To quantitatively characterize the signals we calculated the following parameters: root mean square (RMS) of the amplitude, median frequency (MF), coherence, and duration of the seizures, of the clonic EMG discharges, and of the silent periods between the cloni. Based on wavelet analysis, we distinguished between a low-frequency component (LF 2-8 Hz) and a high-frequency component (HF 64-256 Hz). Duration of the seizure, and separation between the tonic and the clonic phases distinguished at group-level but not at individual level between convulsive PNES and GTCS. RMS, temporal dynamics of the HF/LF ratio, and the evolution of the silent periods differentiated between epileptic and nonepileptic convulsive seizures at the individual level. A combination between HF/LF ratio and RMS separated all PNES from the GTCS. A blinded review of the EMG features distinguished correctly between GTCS and convulsive PNES in all cases. The HF/LF ratio and the RMS of the PNES were smaller compared to the simulated seizures. In addition to providing insight into the mechanism of muscle activation during convulsive PNES, these results have diagnostic significance, at the individual level. Surface EMG features can accurately distinguish

  18. [The structural and functional neurovisualization in patients with epileptic seizures in cerebro-vascular diseases].

    PubMed

    Bazilevich, S N; Odinak, M M; Dyskin, D E; Krasakov, I V; Fokin, V A; P'ianov, I V; Dekan, V S; Okol'zin, A V; Pozdniakov, A V; Stanzhevskiĭ, A A

    2008-01-01

    The results of the dynamic study of patients with epileptic seizures in chronic and acute cerebral vascular pathology are presented. Various methods of structural and functional neurovisualization--magnetic resonance tomography using perfusion- and diffusion-weighted imaging, proton magnetic resonance spectroscopy, positron emission tomography, single photon emission computed tomography were used. Based on the results obtained in the study, the authors discuss etiopathogenetic variants of the development of these seizures and new possible approaches to the complex treatment besides the administration of antiepileptic medications.

  19. Brain Inflammation in an Infant With Hemimegalencephaly, Escalating Seizures, and Epileptic Encephalopathy.

    PubMed

    Kim, Se Hee; Millichap, John J; Koh, Sookyong

    2016-01-01

    Hemimegalencephaly, a congenital brain malformation typically characterized by enlargement of one hemisphere, is frequently associated with intractable epilepsy. The authors report a case of a 12-month-old girl with hemimegalencephaly who underwent semiurgent hemispherectomy because of rapidly escalating seizures, arrested development, and associated encephalopathy. The brain tissue was examined and evaluated for neuroinflammation. Immunohistochemical analysis of the brain tissue revealed the presence of abundant activated CD68-positive microglia and reactive astrogliosis. Detection of active inflammatory changes in the brain of a patient with hemimegalencephaly complicated by intractable epilepsy suggests a potential role of ongoing brain inflammation in seizure exacerbation and epileptic encephalopathy.

  20. Brain Inflammation in an Infant With Hemimegalencephaly, Escalating Seizures, and Epileptic Encephalopathy

    PubMed Central

    Kim, Se Hee; Millichap, John J.

    2016-01-01

    Hemimegalencephaly, a congenital brain malformation typically characterized by enlargement of one hemisphere, is frequently associated with intractable epilepsy. The authors report a case of a 12-month-old girl with hemimegalencephaly who underwent semiurgent hemispherectomy because of rapidly escalating seizures, arrested development, and associated encephalopathy. The brain tissue was examined and evaluated for neuroinflammation. Immunohistochemical analysis of the brain tissue revealed the presence of abundant activated CD68-positive microglia and reactive astrogliosis. Detection of active inflammatory changes in the brain of a patient with hemimegalencephaly complicated by intractable epilepsy suggests a potential role of ongoing brain inflammation in seizure exacerbation and epileptic encephalopathy. PMID:28503608

  1. Analysis of epileptic seizure count time series by ensemble state space modelling.

    PubMed

    Galka, Andreas; Boor, Rainer; Doege, Corinna; von Spiczak, Sarah; Stephani, Ulrich; Siniatchkin, Michael

    2015-08-01

    We propose an approach for the analysis of epileptic seizure count time series within a state space framework. Time-dependent dosages of several simultaneously administered anticonvulsants are included as external inputs. The method aims at distinguishing which temporal correlations in the data are due to the medications, and which correspond to an unrelated background signal. Through this method it becomes possible to disentagle the effects of the individual anticonvulsants, i.e., to decide which anticonvulsant in a particular patient decreases or rather increases the number of seizures.

  2. Epileptic seizure classification in EEG signals using second-order difference plot of intrinsic mode functions.

    PubMed

    Pachori, Ram Bilas; Patidar, Shivnarayan

    2014-02-01

    Epilepsy is a neurological disorder which is characterized by transient and unexpected electrical disturbance of the brain. The electroencephalogram (EEG) is a commonly used signal for detection of epileptic seizures. This paper presents a new method for classification of ictal and seizure-free EEG signals. The proposed method is based on the empirical mode decomposition (EMD) and the second-order difference plot (SODP). The EMD method decomposes an EEG signal into a set of symmetric and band-limited signals termed as intrinsic mode functions (IMFs). The SODP of IMFs provides elliptical structure. The 95% confidence ellipse area measured from the SODP of IMFs has been used as a feature in order to discriminate seizure-free EEG signals from the epileptic seizure EEG signals. The feature space obtained from the ellipse area parameters of two IMFs has been used for classification of ictal and seizure-free EEG signals using the artificial neural network (ANN) classifier. It has been shown that the feature space formed using ellipse area parameters of first and second IMFs has given good classification performance. Experimental results on EEG database available by the University of Bonn, Germany, are included to illustrate the effectiveness of the proposed method. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  3. Phase reduction analysis of coupled neural oscillators: application to epileptic seizure dynamics

    NASA Astrophysics Data System (ADS)

    Takeshita, Daisuke; Sato, Yasuomi; Bahar, Sonya

    2006-03-01

    Epileptic seizures are generally held to be result from excess and synchronized neural activity. To investigate how seizures initiate, we develop a model of a neocortical network based on a model suggested by Wilson [1]. We simulate the effect of the potassium channel blocker 4-aminopyridine, which is often used in experiments to induce epileptic seizures, by decreasing the conductance of the potassium channels (gK) in neurons in our model. We applied phase reduction to the Wilson model to study how gK in the model affects the stability of the phase difference. At a normal value of gK, the stable phase difference is small, but the neurons are not exactly in phase. At low gK, in-phase and out-of-phase firing patterns become simultaneously stable. We constructed a network of 20 by 20 neurons. By decreasing gK to zero, a dramatic increase in the amplitude of mean field was observed. This is due to the fact that in-phase firing becomes stable at low gK. The pattern was similar to local field potential in 4-aminopyridine induced seizures. Therefore, it was concluded that the neural activity in drug-induced seizure may be caused by a bifurcation in stable phase differences between neurons. [1] Wilson H.R., J. Theor. Biol. (1999) 200, 375-388 [2] Ermentrout, G.B. and Kopell, N., SIAM J. Math. Anal. (1984), 215-237

  4. An incident case-referent study of epileptic seizures in adults.

    PubMed

    Forsgren, L; Nyström, L

    1990-01-01

    An epidemiological community-based study of incident cases with non-provoked epileptic seizures, using case-referent methodology, was carried out to explore possible risk factors for epileptic seizures. 83 cases, between 17 and 74 years of age, of whom 67.4% had seizures of localized onset, were compared with 2 age- and sex-matched referents. Higher birth weight, movement disabilities, mental retardation, head trauma, brain tumor, depression, a period of unemployment during the previous 6 months and a history of epilepsy in relatives were more common in cases than in referent subjects. No difference was found in the socioeconomic factors investigated, except that the cases belonged to smaller households. Prematurity, home or hospital birth, parents' age at birth of cases or referents, febrile convulsions in relatives, various infections including meningitis and encephalitis, cerebrovascular disease, and alcohol, tobacco, sleep and nutritional habits were not found to be associated with development of seizures. The recent life events investigated, at home or at work, occurred as often in cases as in referents, except that significantly fewer cases had received any increase in salary during the last 6 months. The relationship between depression and development of seizures should be explored further. Moreover, the possibility of false negative results should be considered because of the sample size.

  5. Comparison of fractal dimension estimation algorithms for epileptic seizure onset detection

    NASA Astrophysics Data System (ADS)

    Polychronaki, G. E.; Ktonas, P. Y.; Gatzonis, S.; Siatouni, A.; Asvestas, P. A.; Tsekou, H.; Sakas, D.; Nikita, K. S.

    2010-08-01

    Fractal dimension (FD) is a natural measure of the irregularity of a curve. In this study the performances of three waveform FD estimation algorithms (i.e. Katz's, Higuchi's and the k-nearest neighbour (k-NN) algorithm) were compared in terms of their ability to detect the onset of epileptic seizures in scalp electroencephalogram (EEG). The selection of parameters involved in FD estimation, evaluation of the accuracy of the different algorithms and assessment of their robustness in the presence of noise were performed based on synthetic signals of known FD. When applied to scalp EEG data, Katz's and Higuchi's algorithms were found to be incapable of producing consistent changes of a single type (either a drop or an increase) during seizures. On the other hand, the k-NN algorithm produced a drop, starting close to the seizure onset, in most seizures of all patients. The k-NN algorithm outperformed both Katz's and Higuchi's algorithms in terms of robustness in the presence of noise and seizure onset detection ability. The seizure detection methodology, based on the k-NN algorithm, yielded in the training data set a sensitivity of 100% with 10.10 s mean detection delay and a false positive rate of 0.27 h-1, while the corresponding values in the testing data set were 100%, 8.82 s and 0.42 h-1, respectively. The above detection results compare favourably to those of other seizure onset detection methodologies applied to scalp EEG in the literature. The methodology described, based on the k-NN algorithm, appears to be promising for the detection of the onset of epileptic seizures based on scalp EEG.

  6. Comparison of fractal dimension estimation algorithms for epileptic seizure onset detection.

    PubMed

    Polychronaki, G E; Ktonas, P Y; Gatzonis, S; Siatouni, A; Asvestas, P A; Tsekou, H; Sakas, D; Nikita, K S

    2010-08-01

    Fractal dimension (FD) is a natural measure of the irregularity of a curve. In this study the performances of three waveform FD estimation algorithms (i.e. Katz's, Higuchi's and the k-nearest neighbour (k-NN) algorithm) were compared in terms of their ability to detect the onset of epileptic seizures in scalp electroencephalogram (EEG). The selection of parameters involved in FD estimation, evaluation of the accuracy of the different algorithms and assessment of their robustness in the presence of noise were performed based on synthetic signals of known FD. When applied to scalp EEG data, Katz's and Higuchi's algorithms were found to be incapable of producing consistent changes of a single type (either a drop or an increase) during seizures. On the other hand, the k-NN algorithm produced a drop, starting close to the seizure onset, in most seizures of all patients. The k-NN algorithm outperformed both Katz's and Higuchi's algorithms in terms of robustness in the presence of noise and seizure onset detection ability. The seizure detection methodology, based on the k-NN algorithm, yielded in the training data set a sensitivity of 100% with 10.10 s mean detection delay and a false positive rate of 0.27 h(-1), while the corresponding values in the testing data set were 100%, 8.82 s and 0.42 h(-1), respectively. The above detection results compare favourably to those of other seizure onset detection methodologies applied to scalp EEG in the literature. The methodology described, based on the k-NN algorithm, appears to be promising for the detection of the onset of epileptic seizures based on scalp EEG.

  7. Optimized feature subsets for epileptic seizure prediction studies.

    PubMed

    Direito, Bruno; Ventura, Francisco; Teixeira, César; Dourado, António

    2011-01-01

    The reduction of the number of EEG features to give as inputs to epilepsy seizure predictors is a needed step towards the development of a transportable device for real-time warning. This paper presents a comparative study of three feature selection methods, based on Support Vector Machines. Minimum-Redundancy Maximum-Relevance, Recursive Feature Elimination, Genetic Algorithms, show that, for three patients of the European Database on Epilepsy, the most important univariate features are related to spectral information and statistical moments.

  8. Regularity and Matching Pursuit feature extraction for the detection of epileptic seizures.

    PubMed

    Z-Flores, Emigdio; Trujillo, Leonardo; Sotelo, Arturo; Legrand, Pierrick; Coria, Luis N

    2016-06-15

    The neurological disorder known as epilepsy is characterized by involuntary recurrent seizures that diminish a patient's quality of life. Automatic seizure detection can help improve a patient's interaction with her/his environment, and while many approaches have been proposed the problem is still not trivially solved. In this work, we present a novel methodology for feature extraction on EEG signals that allows us to perform a highly accurate classification of epileptic states. Specifically, Hölderian regularity and the Matching Pursuit algorithm are used as the main feature extraction techniques, and are combined with basic statistical features to construct the final feature sets. These sets are then delivered to a Random Forests classification algorithm to differentiate between epileptic and non-epileptic readings. Several versions of the basic problem are tested and statistically validated producing perfect accuracy in most problems and 97.6% accuracy on the most difficult case. A comparison with recent literature, using a well known database, reveals that our proposal achieves state-of-the-art performance. The experimental results show that epileptic states can be accurately detected by combining features extracted through regularity analysis, the Matching Pursuit algorithm and simple time-domain statistical analysis. Therefore, the proposed method should be considered as a promising approach for automatic EEG analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Temporal seizure focus and status epilepticus are associated with high-sensitive troponin I elevation after epileptic seizures.

    PubMed

    Chatzikonstantinou, Anastasios; Ebert, Anne D; Hennerici, Michael G

    2015-09-01

    Postictal elevation of high-sensitive troponin I (TNI), a highly specific biomarker for myocardial ischemia, has been reported. We aimed at evaluating its association of high-sensitive troponin I (TNI) with seizure type and focus, as well as vascular risk factors. TNI was measured in 247 patients admitted to our clinic via the emergency room with an acute epileptic seizure. TNI control measurements were performed in 61.5% of cases. All patients underwent electroencephalography and cerebral imaging. Seizure focus - when possible - was determined using results from these examinations as well as clinical data. Of 247 patients, 133 (53.8%) were men, the mean age was 59 ± 18 years. 70 (28.3%) patients had focal and 177 (71.7%) generalized seizures. Status epilepticus was present in 38 cases (15.4%). Mean TNI was 0.05 ± 0.17. TNI was elevated in 27 patients (10.9%). Higher age, status epilepticus and temporal seizure focus were significantly associated with TNI elevation in multivariate analysis. In 21 (13.8%) of the patients with TNI control measurement, TNI was continuously elevated. Higher age and temporal seizure focus were significantly associated with continuously high TNI. Coronary heart disease and vascular risk factors were significantly associated with high TNI only in univariate analysis. No patient had a symptomatic myocardial ischemia. Postictal TNI elevation is relatively common in older patients with status epilepticus or temporal seizure focus. These data support the concept of relevant and possibly dangerous ictal effects on cardiac function especially in temporal lobe seizures. Although the risk of manifest postictal myocardial infarction seems to be very low, selected patients could profit from closer monitoring. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. A study of synchronization of nonlinear oscillators: Application to epileptic seizures

    NASA Astrophysics Data System (ADS)

    Takeshita, Daisuke

    This dissertation focuses on several problems in neuroscience from the perspective of nonlinear dynamics and stochastic processes. The first part concerns a method to visualize the idea of the power spectrum of spike trains, which has an educational value to introductory students in biophysics. The next part consists of experimental and computational work on drug-induced epileptic seizures in the rat neocortex. In the experimental part, spatiotemporal patterns of electrical activities in the rat neocortex are measured using voltage-sensitive dye imaging. Epileptic regions show well-synchronized, in-phase activity during epileptic seizures. In the computational part, a network of a Hodgkin-Huxley type neocortical neural model is constructed. Phase reduction, which is a dimension reduction technique for a stable limit cycle, is applied to the system. The results propose a possible mechanism for the initiation of the drug-induced seizure as a result of a bifurcation. In the last part, a theoretical framework is developed to obtain the statistics for the period of oscillations of a stable limit cycle under stochastic perturbation. A stochastic version of phase reduction and first passage time analysis are utilized for this purpose. The method presented here shows a good agreement with numerical results for the weak noise regime.

  11. Time-frequency texture descriptors of EEG signals for efficient detection of epileptic seizure.

    PubMed

    Şengür, Abdulkadir; Guo, Yanhui; Akbulut, Yaman

    2016-06-01

    Detection of epileptic seizure in electroencephalogram (EEG) signals is a challenging task and requires highly skilled neurophysiologists. Therefore, computer-aided detection helps neurophysiologist in interpreting the EEG. In this paper, texture representation of the time-frequency (t-f) image-based epileptic seizure detection is proposed. More specifically, we propose texture descriptor-based features to discriminate normal and epileptic seizure in t-f domain. To this end, three popular texture descriptors are employed, namely gray-level co-occurrence matrix (GLCM), texture feature coding method (TFCM), and local binary pattern (LBP). The features that are obtained on the GLCM are contrast, correlation, energy, and homogeneity. Moreover, in the TFCM method, several statistical features are calculated. In addition, for the LBP, the histogram is used as a feature. In the classification stage, a support vector machine classifier is employed. We evaluate our proposal with extensive experiments. According to the evaluated terms, our method produces successful results. 100 % accuracy is obtained with LIBLINEAR. We also compare our method with other published methods and the results show the superiority of our proposed method.

  12. [Thermal trauma sustained during epileptic seizures--analysis of 33 cases].

    PubMed

    Aust, M; Guggenheim, M; Gohritz, A; Künzi, W; Handschin, A; Vogt, P; Giovanoli, P

    2008-12-01

    Burn injuries are a serious threat to individuals with altered consciousness during epilepsy. The objective of this study detailing 33 individuals who sustained scalds or burn injuries during an epileptic seizure, was to clarify typical injury mechanisms, extent, therapy and sequelae of these injuries and thus identify potential preventive measures to protect this special population from thermal trauma. Overall, 16 women and 17 men with a mean age of 39.6 (range: 21 - 76) years were included in this retrospective review. The burned body area averaged 16 % (maximum: 51 %), 30 of the 33 patients (91 %) required burn wound excision and skin grafting. The mean ABSI score was 5.5 (range: 3 to 11) points. Thermal trauma mostly occurred as hot water scalds (n = 19) during showering or bathing in a tub (n = 15), followed by falls during cooking or into open fire. None of our patients was informed about the risk of experiencing severe thermal injuries during epileptic seizures. The length of intensive care averaged 33 days (maximum: 79 days), all patients survived. The estimated treatment costs were at least 50,000 Euros per patient. In conclusion, epileptic seizures can cause severe and deep thermal trauma. Our data shows that most of these injuries happen at home and may be easily prevented by simple safety devices, such as water thermo-regulators or the avoidance of high-risk situations, it seems advisable to inform patients with epilepsy and their families and care-givers of this specific danger.

  13. Preictal dynamics of EEG complexity in intracranially recorded epileptic seizure: a case report.

    PubMed

    Bob, Petr; Roman, Robert; Svetlak, Miroslav; Kukleta, Miloslav; Chladek, Jan; Brazdil, Milan

    2014-11-01

    Recent findings suggest that neural complexity reflecting a number of independent processes in the brain may characterize typical changes during epileptic seizures and may enable to describe preictal dynamics. With respect to previously reported findings suggesting specific changes in neural complexity during preictal period, we have used measure of pointwise correlation dimension (PD2) as a sensitive indicator of nonstationary changes in complexity of the electroencephalogram (EEG) signal. Although this measure of complexity in epileptic patients was previously reported by Feucht et al (Applications of correlation dimension and pointwise dimension for non-linear topographical analysis of focal onset seizures. Med Biol Comput. 1999;37:208-217), it was not used to study changes in preictal dynamics. With this aim to study preictal changes of EEG complexity, we have examined signals from 11 multicontact depth (intracerebral) EEG electrodes located in 108 cortical and subcortical brain sites, and from 3 scalp EEG electrodes in a patient with intractable epilepsy, who underwent preoperative evaluation before epilepsy surgery. From those 108 EEG contacts, records related to 44 electrode contacts implanted into lesional structures and white matter were not included into the experimental analysis.The results show that in comparison to interictal period (at about 8-6 minutes before seizure onset), there was a statistically significant decrease in PD2 complexity in the preictal period at about 2 minutes before seizure onset in all 64 intracranial channels localized in various brain sites that were included into the analysis and in 3 scalp EEG channels as well. Presented results suggest that using PD2 in EEG analysis may have significant implications for research of preictal dynamics and prediction of epileptic seizures.

  14. Scaling Effects and Spatio-Temporal Multilevel Dynamics in Epileptic Seizures

    PubMed Central

    2012-01-01

    Epileptic seizures are one of the most well-known dysfunctions of the nervous system. During a seizure, a highly synchronized behavior of neural activity is observed that can cause symptoms ranging from mild sensual malfunctions to the complete loss of body control. In this paper, we aim to contribute towards a better understanding of the dynamical systems phenomena that cause seizures. Based on data analysis and modelling, seizure dynamics can be identified to possess multiple spatial scales and on each spatial scale also multiple time scales. At each scale, we reach several novel insights. On the smallest spatial scale we consider single model neurons and investigate early-warning signs of spiking. This introduces the theory of critical transitions to excitable systems. For clusters of neurons (or neuronal regions) we use patient data and find oscillatory behavior and new scaling laws near the seizure onset. These scalings lead to substantiate the conjecture obtained from mean-field models that a Hopf bifurcation could be involved near seizure onset. On the largest spatial scale we introduce a measure based on phase-locking intervals and wavelets into seizure modelling. It is used to resolve synchronization between different regions in the brain and identifies time-shifted scaling laws at different wavelet scales. We also compare our wavelet-based multiscale approach with maximum linear cross-correlation and mean-phase coherence measures. PMID:22363431

  15. Epileptic discharges specifically affect intrinsic connectivity networks during absence seizures.

    PubMed

    Zhang, Zhiqiang; Liao, Wei; Wang, Zhengge; Xu, Qiang; Yang, Fang; Mantini, Dante; Jiao, Qing; Tian, Lei; Liu, Yijun; Lu, Guangming

    2014-01-15

    Intrinsic connectivity network (ICN) technique provides a feasible way for evaluating cognitive impairments in epilepsy. This EEG-fMRI study aims to comprehensively assess the alterations of ICNs affected by generalized spike-and-wave discharge (GSWD) during absence seizure (AS). Twelve fMRI sessions with GSWD, and individually paired non-GSWD sessions were acquired from 16 patients with AS. Ten ICNs corresponding to seizure origination and cognitive processes were extracted using independent component analysis. Intra- and inter-network connectivity alterations of the ICNs were observed through comparisons between GSWD and non-GSWD sessions. Sequential correlation analysis between GSWD and the ICN time courses addressed the immediate effects of GSWD on ICNs during AS. GSWD-related increase of intra-network connectivity was found only in the thalamus, and extensive decreases were found in the ICNs corresponding to higher-order cognitive processes including the default-mode network, dorsal attention network, central executive network and salience network. The perceptive networks and motor network were less affected by GSWD. Sequential correlation analysis further demonstrated different responses of the ICNs to GSWD. In addition to GSWD-related functional excitation in the thalamus and functional suspension in the default-mode network, this study revealed extensive inhibitions in the other ICNs corresponding to higher-order cognitive processes, and spared perceptive and motor processes in AS. GSWD elevated synchronization of brain network activity and sequentially affected the ICNs. © 2013. Published by Elsevier B.V. All rights reserved.

  16. Dysprosody during epileptic seizures lateralizes to the nondominant hemisphere.

    PubMed

    Peters, A S; Rémi, J; Vollmar, C; Gonzalez-Victores, J A; Cunha, J P S; Noachtar, S

    2011-10-11

    In human speech, the changes in intonation, rhythm, or stress reflect emotions or intentions and are called prosody. Dysprosody is the impairment of prosody and has been described in stroke and neurodegenerative disorders. Reports in epilepsy patients are limited to case reports. We assessed prosody qualitatively and quantitatively in 967 focal epilepsy patients. The qualitative assessment was performed by 2 native German speakers, and the quantitative frequency analysis used linguistic software tools. For the quantitative analysis, the formant F0 (a frequency peak, which is an approximation of pitch) and the further spectral frequency peaks of our patients' voices were analyzed. We found 26 patients with ictal dysprosody through qualitative analysis (2.7% of all focal epilepsies). The qualitative changes affected mostly the pitch and the loss of melody. The seizure patterns at the time of ictal dysprosody were always in the nondominant hemisphere (100%) and were mostly right temporal (n = 22; 84.6%). Quantitative analysis of 15 audio samples (11 patients) showed a change in the frequency of formant F0 of several patients and a reduction of frequency variation during ictal speech, expressed as the SD of formant F0 (ictal 14.1 vs interictal 27.2). Ictal dysprosody localizes seizure onset or propagation to the nondominant temporal lobe. This information can be used in the evaluation of patients considered for resective epilepsy surgery.

  17. Increased hair cortisol and antecedent somatic complaints in children with a first epileptic seizure.

    PubMed

    Stavropoulos, Ioannis; Pervanidou, Panagiota; Gnardellis, Charalampos; Loli, Nomiki; Theodorou, Virginia; Mantzou, Aimilia; Soukou, Faye; Sinani, Olga; Chrousos, George P

    2017-03-01

    Stress is the most frequent seizure-precipitating factor reported by patients with epilepsy, while stressful life events may increase seizure susceptibility in humans. In this study, we investigated the relations between both biological and behavioral measures of stress in children with a first epileptic seizure (hereafter called seizure). We hypothesized that hair cortisol, a biomarker of chronic stress reflecting approximately 3months of preceding exposure, might be increased in children with a first seizure. We also employed standardized questionnaires to examine presence of stress-related behavioral markers. This was a cross-sectional clinical study investigating stress-related parameters in children with a first seizure (First Epileptic Seizure Group (FESG), n=22) in comparison to healthy children without seizures (Control Group, n=29). Within 24h after a first seizure, hair samples were collected from children for the determination of cortisol. In parallel, perceived stress and anxiety and depressive symptoms were examined with appropriate self- and parent-completed questionnaires, and history of stressful life events during the past year was recorded. Emotional and behavioral problems were also assessed by parent-reported validated and widely-used questionnaires. Higher hair cortisol measurements were observed in the FESG than control children (7.5 versus 5.0pg/mg respectively, p=0.001). The former were more likely to complain of somatic problems than the latter (59.8 vs. 55.4 according to DSM-oriented Scale, p=0.021); however, there were no differences in perceived stress and anxiety or depressive symptoms between the two groups. Using ROC analysis of hair cortisol measurements for predicting disease status, the maximum sensitivity and specificity were observed for a cut-off point of 5.25pg/mg. Increased hair cortisol indicates chronic hyperactivity of the hypothalamic-pituitary-adrenal (HPA) axis prior to the first seizure. This might have contributed to

  18. Can hyper-synchrony in meditation lead to seizures? Similarities in meditative and epileptic brain states.

    PubMed

    Lindsay, Shane

    2014-10-01

    Meditation is used worldwide by millions of people for relaxation and stress relief. Given sufficient practice, meditators may also experience a variety of altered states of consciousness. These states can lead to a variety of unusual experiences, including physical, emotional and psychic disturbances. This paper highlights the correspondences between brain states associated with these experiences and the symptoms and neurophysiology of epileptic simple partial seizures. Seizures, like meditation practice, can result in both positive and negative experiences. The neurophysiology and chemistry underlying simple partial seizures are characterised by a high degree of excitability and high levels of neuronal synchrony in gamma-band brain activity. Following a survey of the literature that shows that meditation practice is also linked to high power gamma activity, an account of how meditation could cause such activity is provided. This paper discusses the diagnostic challenges for the claim that meditation practices lead to brain states similar to those found in epileptic seizures, and seeks to develop our understanding of the range of pathological and non-pathological states that result from a hyper-excited and hyper-synchronous brain.

  19. Recurrent prolonged fugue states as the sole manifestation of epileptic seizures.

    PubMed

    Khwaja, Geeta A; Duggal, Ashish; Kulkarni, Amit; Chaudhry, Neera; Gupta, Meena; Chowdhury, Debashish; Bohra, Vikram

    2013-10-01

    A fugue state is defined as an altered state of consciousness with varying degrees of motor activity and amnesia for the event. It may last for hours to days and may be psychogenic or organic in nature. Epileptic fugue states can be encountered in patients with absence or complex partial nonconvulsive status epilepticus or may occur as a postictal phenomenon in patients with generalized seizures. "absence status epilepticus" (AS) is rare and seen in only 2.6% of the cases with "childhood absence epilepsy" (CAE). The diagnosis of AS can be elusive, but sudden onset and termination of the fugue state, classical electroencephalogram (EEG) features, and response to a therapeutic trial of benzodiazepines helps in confirming the diagnosis and differentiating it from nonepileptic fugue states. We report a childhood onset case, with a 10 years history of recurrent episodes of prolonged fugue state lasting for up to 24 h, as the sole manifestation of epileptic seizures. The EEG features were suggestive of an AS, but there was no history of typical absences, myoclonus, or generalized tonic clonic seizures. This unusual and rare case cannot be categorized into one of the defined epilepsy syndromes like CAE but belongs to a recently identified syndrome of idiopathic generalized epilepsy known as "Absence status epilepsy" in which AS is the sole or the predominant seizure type.

  20. Drug interaction between valproic acid and carbapenems in patients with epileptic seizures.

    PubMed

    Huang, Chi-Ren; Lin, Chih-Hsiang; Hsiao, Shu-Chen; Chen, Nai-Ching; Tsai, Wan-Chen; Chen, Shang-Der; Lu, Yan-Ting; Chuang, Yao-Chung

    2017-03-01

    Valproic acid (VPA) is a widely used antiepileptic drug (AED). When carbapenems are concomitantly used with VPA, the serum levels of VPA may decrease and aggravate seizures. The aim of this study was to evaluate the risk factors associated with decreased serum VPA levels and clinical outcome in patients being treated with a combination of carbapenems and VPA. Fifty-four adult patients who were treated with VPA for epileptic seizures concomitant with carbapenems for the treatment of infections were evaluated in this study. Serum VPA levels were measured before and during combination therapy with VPA and carbapenems, and the change in serum VPA levels was calculated. The risk factors related to the decrease in serum VPA levels and clinical outcomes were evaluated. Our results show that VPA concentrations were reduced to subtherapeutic levels after the introduction of carbapenems. The reduction in VPA concentrations was found within 24 hours of the start of treatment with carbapenems. VPA levels continuously declined while the combination of treatments was used, which aggravated epileptic seizures in 48% of the patients. Renal disease and enzyme-inducing AEDs were risk factors that contributed to the severity of reduced serum VPA levels during combined treatment with carbapenems. This study suggests that clinicians need to be aware of the reduction of VPA concentrations to subtherapeutic levels and the aggravation of seizures while patients are treated with a combination of carbapenems and VPA. Copyright © 2017. Published by Elsevier Taiwan.

  1. Budget impact analysis of adjunctive therapy with lacosamide for partial-onset epileptic seizures in Belgium.

    PubMed

    Simoens, Steven

    2011-01-01

    This study aims to compute the budget impact of lacosamide, a new adjunctive therapy for partial-onset seizures in epilepsy patients from 16 years of age who are uncontrolled and having previously used at least three anti-epileptic drugs from a Belgian healthcare payer perspective. The budget impact analysis compared the 'world with lacosamide' to the 'world without lacosamide' and calculated how a change in the mix of anti-epileptic drugs used to treat uncontrolled epilepsy would impact drug spending from 2008 to 2013. Data on the number of patients and on the market shares of anti-epileptic drugs were taken from Belgian sources and from the literature. Unit costs of anti-epileptic drugs originated from Belgian sources. The budget impact was calculated from two scenarios about the market uptake of lacosamide. The Belgian target population is expected to increase from 5333 patients in 2008 to 5522 patients in 2013. Assuming that the market share of lacosamide increases linearly over time and is taken evenly from all other anti-epileptic drugs (AEDs), the budget impact of adopting adjunctive therapy with lacosamide increases from €5249 (0.1% of reference drug budget) in 2008 to €242,700 (4.7% of reference drug budget) in 2013. Assuming that 10% of patients use standard AED therapy plus lacosamide, the budget impact of adopting adjunctive therapy with lacosamide is around €800,000-900,000 per year (or 16.7% of the reference drug budget). Adjunctive therapy with lacosamide would raise drug spending for this patient population by as much as 16.7% per year. However, this budget impact analysis did not consider the fact that lacosamide reduces costs of seizure management and withdrawal. The literature suggests that, if savings in other healthcare costs are taken into account, adjunctive therapy with lacosamide may be cost saving.

  2. [Memory disorders in epileptic children with temporal psychomotor seizures].

    PubMed

    Madorskiĭ, V A; Shestakova, T B

    1975-01-01

    The authors demonstrate the results of experimental psychological examination of memory in 57 patients with epilepsy in psychomotor temporal seizures. It was possible to show that in such cases there was a total decline of short-time memory. In bilateral foci and a long-term development of the disease there was a formation of an amnestic syndrome. The most distinct changes were seen in a delayed reproduction. In an electrostimulation of the structures of the temporal lobe by means of implanted electrodes the experiments displayed an intactness of direct reproduction during a stimulation of the neocortex, a moderate decrease in a stimulation of the hypocampus and a grave -- when stimulating the amygdalar complex.

  3. Quantifying limb movements in epileptic seizures through color-based video analysis.

    PubMed

    Lu, Haiping; Pan, Yaozhang; Mandal, Bappaditya; Eng, How-Lung; Guan, Cuntai; Chan, Derrick W S

    2013-02-01

    This paper proposes a color-based video analytic system for quantifying limb movements in epileptic seizure monitoring. The system utilizes colored pyjamas to facilitate limb segmentation and tracking. Thus, it is unobtrusive and requires no sensor/marker attached to patient's body. We employ Gaussian mixture models in background/foreground modeling and detect limbs through a coarse-to-fine paradigm with graph-cut-based segmentation. Next, we estimate limb parameters with domain knowledge guidance and extract displacement and oscillation features from movement trajectories for seizure detection/analysis. We report studies on sequences captured in an epilepsy monitoring unit. Experimental evaluations show that the proposed system has achieved comparable performance to EEG-based systems in detecting motor seizures.

  4. [Epileptic seizures during childbirth in a patient with idiopathic generalised epilepsy].

    PubMed

    Voermans, N C; Zwarts, M J; Renier, W O; Bloem, B R

    2005-06-18

    During her first pregnancy, a 37-year-old woman with idiopathic generalised epilepsy that was adequately controlled with lamotrigine experienced a series of epileptic seizures following an elective caesarean section. The attacks were terminated with diazepam. The following day, she developed EEG-confirmed status epilepticus, for which midazolam was administered intravenously. No further attacks were observed and the patient was later discharged in good condition with a healthy newborn son. She remained on lamotrigine therapy. At the end of her second pregnancy, the patient again experienced tonic-clonic seizures. The dosage of lamotrigine was increased and the patient received clonazepam intravenously, but a new seizure quickly occurred. Following an emergency caesarean section with midazolam treatment, a healthy daughter was born. No further attacks were observed. This case history illustrates the occurrence of adult idiopathic generalised epilepsy and highlights the problems that can arise late in pregnancy and during childbirth.

  5. Self-induction of epileptic seizures by eyeclosure: incidence and recognition.

    PubMed Central

    Binnie, C D; Darby, C E; De Korte, R A; Wilkins, A J

    1980-01-01

    Self-induction of epileptic seizures is generally regarded as a rarity, chiefly observed in patients of subnormal intelligence. During EEG recordings with open eyes in a consecutive series of 48 photosensitive patients, however, 13 subjects induced paroxysmal activity of seizures by eyeclosure with forced upward deviation of the eyes. Eyeclosure on command produced a different type of oculographic artefact and induced paroxysmal activity in only one subject. Two patients were of subnormal intelligence but all displayed psychiatric or psychosocial problems. The incidence of induced paroxysmal activity was reduced by reduction of ambient lighting. Eight patients admitted self-induction of seizures. We conclude that this phenomenon occurs more often than was previously supposed and can be recongnized by the recording in photosensitive patients of prolonged EEGs with eyes open and in a brightly lit environment. Images PMID:7420087

  6. Auricular Acupuncture May Suppress Epileptic Seizures via Activating the Parasympathetic Nervous System: A Hypothesis Based on Innovative Methods

    PubMed Central

    He, Wei; Rong, Pei-Jing; Li, Liang; Ben, Hui; Zhu, Bing; Litscher, Gerhard

    2012-01-01

    Auricular acupuncture is a diagnostic and treatment system based on normalizing the body's dysfunction. An increasing number of studies have demonstrated that auricular acupuncture has a significant effect on inducing parasympathetic tone. Epilepsy is a neurological disorder consisting of recurrent seizures resulting from excessive, uncontrolled electrical activity in the brain. Autonomic imbalance demonstrating an increased sympathetic activity and a reduced parasympathetic activation is involved in the development and progress of epileptic seizures. Activation of the parasympathetic nervous system such as vagus nerve stimulation has been used for the treatment of intractable epilepsy. Here, we propose that auricular acupuncture may suppress epileptic seizures via activating the parasympathetic nervous system. PMID:22461842

  7. Automatic identification of epileptic seizures from EEG signals using linear programming boosting.

    PubMed

    Hassan, Ahnaf Rashik; Subasi, Abdulhamit

    2016-11-01

    Computerized epileptic seizure detection is essential for expediting epilepsy diagnosis and research and for assisting medical professionals. Moreover, the implementation of an epilepsy monitoring device that has low power and is portable requires a reliable and successful seizure detection scheme. In this work, the problem of automated epilepsy seizure detection using singe-channel EEG signals has been addressed. At first, segments of EEG signals are decomposed using a newly proposed signal processing scheme, namely complete ensemble empirical mode decomposition with adaptive noise (CEEMDAN). Six spectral moments are extracted from the CEEMDAN mode functions and train and test matrices are formed afterward. These matrices are fed into the classifier to identify epileptic seizures from EEG signal segments. In this work, we implement an ensemble learning based machine learning algorithm, namely linear programming boosting (LPBoost) to perform classification. The efficacy of spectral features in the CEEMDAN domain is validated by graphical and statistical analyses. The performance of CEEMDAN is compared to those of its predecessors to further inspect its suitability. The effectiveness and the appropriateness of LPBoost are demonstrated as opposed to the commonly used classification models. Resubstitution and 10 fold cross-validation error analyses confirm the superior algorithm performance of the proposed scheme. The algorithmic performance of our epilepsy seizure identification scheme is also evaluated against state-of-the-art works in the literature. Experimental outcomes manifest that the proposed seizure detection scheme performs better than the existing works in terms of accuracy, sensitivity, specificity, and Cohen's Kappa coefficient. It can be anticipated that owing to its use of only one channel of EEG signal, the proposed method will be suitable for device implementation, eliminate the onus of clinicians for analyzing a large bulk of data manually, and

  8. Detection of epileptic seizure in EEG signals using linear least squares preprocessing.

    PubMed

    Roshan Zamir, Z

    2016-09-01

    An epileptic seizure is a transient event of abnormal excessive neuronal discharge in the brain. This unwanted event can be obstructed by detection of electrical changes in the brain that happen before the seizure takes place. The automatic detection of seizures is necessary since the visual screening of EEG recordings is a time consuming task and requires experts to improve the diagnosis. Much of the prior research in detection of seizures has been developed based on artificial neural network, genetic programming, and wavelet transforms. Although the highest achieved accuracy for classification is 100%, there are drawbacks, such as the existence of unbalanced datasets and the lack of investigations in performances consistency. To address these, four linear least squares-based preprocessing models are proposed to extract key features of an EEG signal in order to detect seizures. The first two models are newly developed. The original signal (EEG) is approximated by a sinusoidal curve. Its amplitude is formed by a polynomial function and compared with the predeveloped spline function. Different statistical measures, namely classification accuracy, true positive and negative rates, false positive and negative rates and precision, are utilised to assess the performance of the proposed models. These metrics are derived from confusion matrices obtained from classifiers. Different classifiers are used over the original dataset and the set of extracted features. The proposed models significantly reduce the dimension of the classification problem and the computational time while the classification accuracy is improved in most cases. The first and third models are promising feature extraction methods with the classification accuracy of 100%. Logistic, LazyIB1, LazyIB5, and J48 are the best classifiers. Their true positive and negative rates are 1 while false positive and negative rates are 0 and the corresponding precision values are 1. Numerical results suggest that these

  9. Dynamical analogy between epileptic seizures and seismogenic electromagnetic emissions by means of nonextensive statistical mechanics

    NASA Astrophysics Data System (ADS)

    Eftaxias, Konstantinos; Minadakis, George; Potirakis, Stelios. M.; Balasis, Georgios

    2013-02-01

    The field of study of complex systems considers that the dynamics of complex systems are founded on universal principles that may be used to describe a great variety of scientific and technological approaches of different types of natural, artificial, and social systems. Several authors have suggested that earthquake dynamics and neurodynamics can be analyzed within similar mathematical frameworks. Recently, authors have shown that a dynamical analogy supported by scale-free statistics exists between seizures and earthquakes, analyzing populations of different seizures and earthquakes, respectively. The purpose of this paper is to suggest a shift in emphasis from the large to the small scale: our analyses focus on a single epileptic seizure generation and the activation of a single fault (earthquake) and not on the statistics of sequences of different seizures and earthquakes. We apply the concepts of the nonextensive statistical physics to support the suggestion that a dynamical analogy exists between the two different extreme events, seizures and earthquakes. We also investigate the existence of such an analogy by means of scale-free statistics (the Gutenberg-Richter distribution of event sizes and the distribution of the waiting time until the next event). The performed analysis confirms the existence of a dynamic analogy between earthquakes and seizures, which moreover follow the dynamics of magnetic storms and solar flares.

  10. Electroencephalographic evaluation of gold wire implants inserted in acupuncture points in dogs with epileptic seizures.

    PubMed

    Goiz-Marquez, G; Caballero, S; Solis, H; Rodriguez, C; Sumano, H

    2009-02-01

    The purpose of this study was to evaluate both, clinically and with electroencephalographic (EEG) recordings, the effect of gold wire implants in acupuncture points in dogs with uncontrolled idiopathic epileptic seizures. Fifteen dogs with such diagnosis were enrolled in the study. A first EEG recording was performed in all dogs under anaesthesia with xylazine (1mg/kg) and propofol (6 mg/kg) before the treatment protocol, and a second EEG was performed 15 weeks later. Relative frequency power, intrahemispheric coherence available through EEG, number of seizures and seizure severity were compared before and after treatment using a Wilcoxon signed-rank test. There were no significant statistical differences before and after treatment in relative power or in intrahemispheric coherence in the EEG recording. However, there was a significant mean difference in seizure frequency and seizure severity between control and treatment periods. After treatment, nine of the 15 dogs (60%) had at least a 50% reduction in seizures frequency during the 15 weeks established as follow-up of this treatment.

  11. Epileptic Seizure Detection in Eeg Signals Using Multifractal Analysis and Wavelet Transform

    NASA Astrophysics Data System (ADS)

    Uthayakumar, R.; Easwaramoorthy, D.

    2013-06-01

    This paper explores the three different methods to explicitly recognize the healthy and epileptic EEG signals: Modified, Improved, and Advanced forms of Generalized Fractal Dimensions (GFD). The newly proposed scheme is based on GFD and the discrete wavelet transform (DWT) for analyzing the EEG signals. First EEG signals are decomposed into approximation and detail coefficients using DWT and then GFD values of the original EEGs, approximation and detail coefficients are computed. Significant differences are observed among the GFD values of the healthy and epileptic EEGs allowing us to classify seizures with high accuracy. It is shown that the classification rate is very less accurate without DWT as a preprocessing step. The proposed idea is illustrated through the graphical and statistical tools. The EEG data is further tested for linearity by using normal probability plot and we proved that epileptic EEG had significant nonlinearity whereas healthy EEG distributed normally and similar to Gaussian linear process. Therefore, we conclude that the GFD and the wavelet decomposition through DWT are the strong indicators of the state of illness of epileptic patients.

  12. Predictors of 6-month and 3-year outcomes after psychological intervention for psychogenic non epileptic seizures.

    PubMed

    Duncan, Roderick; Anderson, James; Cullen, Breda; Meldrum, Steven

    2016-03-01

    To determine outcome and its predictors following psychological intervention in people with Psychogenic Non-Epileptic Seizures (PNES) METHODS: Prospective audit of 89 consecutive patients. PNES were recorded at baseline (initial psychology appointment), at 6 months and 3 years post the initial appointment. Six-month data was obtained by face-to-face interview, while 3-year data was obtained by contacting general practitioners and by postal survey. Eight patients had stopped having PNES at the first appointment and were discharged. At 6-month follow up 43/81 patients (53.1%) were free of seizures. Predictors of cessation of seizures were: patient employed (OR 4.48, p=0.004), short waiting time for intervention (OR 0.94, p=0.018), the patient feeling they had some control over the seizures (OR 3.30, p=0.021), and an internal locus of control ((OR 7.46, p=0.001). Outcomes at 3 years based on patient report were available in 32/81 patients (36%). 11/32 patients reported being free of seizures. 50/65 patients were not accessing any healthcare for seizures. There were no significant predictors of either outcome among the variables collected. Just over half of our patients reported being free of seizures following intervention. Being employed predicted good outcome, but the best predictor of being seizure free at 6 months was having an internal locus of control. This may be useful practically and requires further study. No good predictors of long-term outcome were found, possibly because of loss to follow up. Copyright © 2016 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  13. The cognitive effects of interictal epileptiform EEG discharges and short nonconvulsive epileptic seizures.

    PubMed

    Nicolai, Joost; Ebus, Saskia; Biemans, Danielle P L J J G; Arends, Johan; Hendriksen, Jos; Vles, Johan S H; Aldenkamp, Albert P

    2012-06-01

    Educational difficulties or even severe cognitive deterioration is seen in many childhood epilepsy syndromes. Many of those cognitive deficits are related directly to the brain disorder underlying the epilepsy syndrome. However, in other types of epilepsy, the epileptic seizures and/or epileptiform activity can be the dominant factor. This is especially unknown for the more "subtle" short nonconvulsive seizure types. For this reason, we analyzed a new cohort of children. A cross-sectional study of 188 children with epilepsy. Electroencephalography (EEG)-video recordings and cognitive testing were performed simultaneously. The results of children with short nonconvulsive seizures during a 2-h testing session were compared with all children with epilepsy without seizures during the 2-h cognitive testing session and with controls without epilepsy. In a second analysis the cognitive effects of frequency of epileptiform EEG discharges were analyzed. The cognitive effects of short nonconvulsive seizures were large, ranging from 0.5 to 1 standard deviation and concerned global cognitive function, speed of central information processing, and memory function. In children without seizures during cognitive testing, the occurrence of frequent epileptiform discharges showed more subtle effects. These effects were independent from the occurrence of short nonconvulsive seizures. We concluded that although the effect is less pronounced in number of areas involved and magnitude, the type of association between frequent epileptiform activity (>1% of the time) and cognitive function in children with epilepsy is comparable to the association between short nonconvulsive seizures and cognitive function. Wiley Periodicals, Inc. © 2012 International League Against Epilepsy.

  14. Ecstatic Epileptic Seizures: A Glimpse into the Multiple Roles of the Insula

    PubMed Central

    Gschwind, Markus; Picard, Fabienne

    2016-01-01

    Ecstatic epileptic seizures are a rare but compelling epileptic entity. During the first seconds of these seizures, ecstatic auras provoke feelings of well-being, intense serenity, bliss, and “enhanced self-awareness.” They are associated with the impression of time dilation, and can be described as a mystic experience by some patients. The functional neuroanatomy of ecstatic seizures is still debated. During recent years several patients presenting with ecstatic auras have been reported by others and us (in total n = 52); a few of them in the setting of presurgical evaluation including electrical brain stimulation. According to the recently recognized functions of the insula, and the results of nuclear brain imaging and electrical stimulation, the ecstatic symptoms in these patients seem to localize to a functional network centered around the anterior insular cortex, where we thus propose to locate this rare ictal phenomenon. Here we summarize the role of the multiple sensory, autonomic, affective, and cognitive functions of the insular cortex, which are integrated into the creation of self-awareness, and we suggest how this system may become dysfunctional on several levels during ecstatic aura. PMID:26924970

  15. Dynamic Causal Modelling of epileptic seizure propagation pathways: a combined EEG-fMRI study.

    PubMed

    Murta, Teresa; Leal, Alberto; Garrido, Marta I; Figueiredo, Patrícia

    2012-09-01

    Simultaneous EEG-fMRI offers the possibility of non-invasively studying the spatiotemporal dynamics of epileptic activity propagation from the focus towards an extended brain network, through the identification of the haemodynamic correlates of ictal electrical discharges. In epilepsy associated with hypothalamic hamartomas (HH), seizures are known to originate in the HH but different propagation pathways have been proposed. Here, Dynamic Causal Modelling (DCM) was employed to estimate the seizure propagation pathway from fMRI data recorded in a HH patient, by testing a set of clinically plausible network connectivity models of discharge propagation. The model consistent with early propagation from the HH to the temporal-occipital lobe followed by the frontal lobe was selected as the most likely model to explain the data. Our results demonstrate the applicability of DCM to investigate patient-specific effective connectivity in epileptic networks identified with EEG-fMRI. In this way, it is possible to study the propagation pathway of seizure activity, which has potentially great impact in the decision of the surgical approach for epilepsy treatment.

  16. The spectrum of psychogenic non-epileptic seizures and comorbidities seen in an epilepsy monitoring unit.

    PubMed

    Seneviratne, Udaya; Briggs, Belinda; Lowenstern, David; D'Souza, Wendyl

    2011-03-01

    We sought to study characteristics of patients presenting with psychogenic non-epileptic seizures (PNES), with and without major psychiatric comorbidity. A total of 39 patients who were diagnosed with PNES in a tertiary care setting were studied, and those patients with and without axis I psychiatric disorders in the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) were compared. The mean time in confirming the diagnosis was 9 years. More than half the patients were taking anti-epileptic medications when they presented for video-electroencephalographic monitoring. The mean monitoring time required to capture a PNES was 0.6 days. Comorbid chronic medical conditions were found in 38.5% and axis I-psychiatric diagnoses in 48.7%. There were no significant differences in characteristics between those with and without major psychiatric comorbidities.

  17. Ethical Dilemmas in Pediatric and Adolescent Psychogenic Non-Epileptic Seizures

    PubMed Central

    Cole, Cristie M.; Falcone, Tatiana; Caplan, Rochelle; Timmons-Mitchell, Jane; Jares, Kristine; Ford, Paul J.

    2014-01-01

    To date only a very narrow window of ethical dilemmas in psychogenic non-epileptic seizures (PNES) have been explored. Numerous distinct ethical dilemmas arise in diagnosing and treating pediatric and adolescent patients with PNES. Important ethical values at stake include trust, transparency, confidentiality, professionalism, autonomy of all stakeholders and justice. In order to further elucidate the ethical challenges in caring for this population, an ethical analysis of the special challenges faced in four specific domains is undertaken: (1) conducting and communicating a diagnosis of PNES; (2) advising patients about full transparency and disclosure to community including patients’ peers; (3) responding to requests to continue anti-epileptic drugs; and (4) managing challenges arising from school policy and procedure. An analysis of these ethical issues is essential for the advancement of best care practices that promote the overall well-being of patients and their families. PMID:25022823

  18. The influence of hubs in the structure of a neuronal network during an epileptic seizure

    NASA Astrophysics Data System (ADS)

    Cardoso Rodrigues, Abner; Cerdeira, Hilda A.; Soares Machado, Birajara

    2016-02-01

    In this work, we propose changes in the structure of a neuronal network with the intention to provoke strong synchronization to simulate episodes of epileptic seizure. Starting with a network of Izhikevich neurons we slowly increase the number of connections in selected nodes in a controlled way, to produce (or not) hubs. We study how these structures alter the synchronization on the spike firings interval, on individual neurons as well as on mean values, as a function of the concentration of connections for random and non-random (hubs) distribution. We also analyze how the post-ictal signal varies for the different distributions. We conclude that a network with hubs is more appropriate to represent an epileptic state.

  19. [Psychogenic non-epileptic seizures in the post-anesthesia recovery unit].

    PubMed

    Ramos, Juan A; Brull, Sorin J

    2016-01-01

    Psychogenic non-epileptic seizures (PNES or "pseudoseizures") remain an obscure topic in the peri-operative setting. They are sudden and time-limited motor and cognitive disturbances, which mimic epileptic seizures, but are psychogenically mediated. Pseudoseizures occur more frequently than epilepsy in the peri-operative setting. Early diagnosis and management may prevent iatrogenic injury. 48 year-old female with a history of depression and "seizures" presented for gynecologic surgery. She described her seizure history as "controlled" without anticonvulsant therapy. The patient underwent uneventful general anesthesia and recovered neurologically intact. During the first two postoperative hours, the patient experienced 3 episodes of seizure-like activity with generalized shaking of extremities and pelvic thrusting; her eyes were firmly closed. No tongue biting or incontinence was noted. The episodes lasted approximately 3min each, one of which resolved spontaneously and the other two following intravenous lorazepam. During these episodes, the patient had stable hemodynamics and adequate ventilation such that endotracheal intubation was deemed unwarranted. Post-ictally, the patient was neurologically intact. Computed axial tomography of the head, metabolic assay, and electroencephalogram showed no abnormalities. A presumptive diagnosis of PNES was made. Psychogenic non-epileptic seizures mimic shivering, and should be considered early in the differential diagnosis of postoperative shaking, as they may be more likely than epilepsy in this setting. Pseudoseizure patterns include asynchronous convulsive episodes lasting more than 90s, forced eye closure with resistance to opening, and retained pupillary responses. Autonomic manifestations such as tachycardia, cyanosis and incontinence are usually absent. A psychiatric background is common. Knowledge and correct diagnosis of pseudoseizures is of great importance for anesthesiologists to prevent morbidity and iatrogenic

  20. Psychogenic non-epileptic seizures in the post-anesthesia recovery unit.

    PubMed

    Ramos, Juan A; Brull, Sorin J

    2016-01-01

    Psychogenic non-epileptic seizures (PNES or "pseudoseizures") remain an obscure topic in the peri-operative setting. They are sudden and time-limited motor and cognitive disturbances, which mimic epileptic seizures, but are psychogenically mediated. Pseudoseizures occur more frequently than epilepsy in the peri-operative setting. Early diagnosis and management may prevent iatrogenic injury. 48 year-old female with a history of depression and "seizures" presented for gynecologic surgery. She described her seizure history as "controlled" without anticonvulsant therapy. The patient underwent uneventful general anesthesia and recovered neurologically intact. During the first two postoperative hours, the patient experienced 3 episodes of seizure-like activity with generalized shaking of extremities and pelvic thrusting; her eyes were firmly closed. No tongue biting or incontinence was noted. The episodes lasted approximately 3min each, one of which resolved spontaneously and the other two following intravenous lorazepam. During these episodes, the patient had stable hemodynamics and adequate ventilation such that endotracheal intubation was deemed unwarranted. Post-ictally, the patient was neurologically intact. Computed axial tomography of the head, metabolic assay, and electroencephalogram showed no abnormalities. A presumptive diagnosis of PNES was made. Psychogenic non-epileptic seizures mimic shivering, and should be considered early in the differential diagnosis of postoperative shaking, as they may be more likely than epilepsy in this setting. Pseudoseizure patterns include asynchronous convulsive episodes lasting more than 90s, forced eye closure with resistance to opening, and retained pupillary responses. Autonomic manifestations such as tachycardia, cyanosis and incontinence are usually absent. A psychiatric background is common. Knowledge and correct diagnosis of pseudoseizures is of great importance for anesthesiologists to prevent morbidity and iatrogenic

  1. Signal complexity and synchrony of epileptic seizures: is there an identifiable preictal period?

    PubMed

    Jouny, Christophe C; Franaszczuk, Piotr J; Bergey, Gregory K

    2005-03-01

    Epileptic seizures are characterized by increases in synchronized activity and increased signal complexity. Prediction of seizures depends upon detectable preictal changes before the actual ictal event. The studies reported here test whether two methods designed to detect changes in synchrony and complexity can identify any changes in a preictal period before visual EEG changes or clinical manifestations. Two methods are used to characterize different, but linked, properties of the signal-complexity and synchrony. The Gabor atom density (GAD) method allows for quantification of the time-frequency components of the EEG and characterizes the complexity of the EEG signal. The measure S, based on the goodness of fit of a multivariable autoregressive model, allows for characterization of the degree of synchrony of the EEG signal. Complex partial seizures produce very specific patterns of increased signal complexity and subsequent postictal low complexity states. The measure S shows increased synchronization later including a prolonged period of increased synchrony in the postictal period. No significant preictal changes were seen unless contaminated by residual postictal changes in closely clustered seizures. Both GAD and S measures reveal ictal and prolonged postictal changes; however, there were no significant preictal changes in either complexity or synchrony. Any application of methods to detect preictal changes must be tested on seizures sufficiently separated to avoid residual postictal changes in the potential preictal period.

  2. Epileptic Seizure Prediction by a System of Particle Filter Associated with a Neural Network

    NASA Astrophysics Data System (ADS)

    Liu, Derong; Pang, Zhongyu; Wang, Zhuo

    2009-12-01

    None of the current epileptic seizure prediction methods can widely be accepted, due to their poor consistency in performance. In this work, we have developed a novel approach to analyze intracranial EEG data. The energy of the frequency band of 4-12 Hz is obtained by wavelet transform. A dynamic model is introduced to describe the process and a hidden variable is included. The hidden variable can be considered as indicator of seizure activities. The method of particle filter associated with a neural network is used to calculate the hidden variable. Six patients' intracranial EEG data are used to test our algorithm including 39 hours of ictal EEG with 22 seizures and 70 hours of normal EEG recordings. The minimum least square error algorithm is applied to determine optimal parameters in the model adaptively. The results show that our algorithm can successfully predict 15 out of 16 seizures and the average prediction time is 38.5 minutes before seizure onset. The sensitivity is about 93.75% and the specificity (false prediction rate) is approximately 0.09 FP/h. A random predictor is used to calculate the sensitivity under significance level of 5%. Compared to the random predictor, our method achieved much better performance.

  3. An Automatic Prediction of Epileptic Seizures Using Cloud Computing and Wireless Sensor Networks.

    PubMed

    Sareen, Sanjay; Sood, Sandeep K; Gupta, Sunil Kumar

    2016-11-01

    Epilepsy is one of the most common neurological disorders which is characterized by the spontaneous and unforeseeable occurrence of seizures. An automatic prediction of seizure can protect the patients from accidents and save their life. In this article, we proposed a mobile-based framework that automatically predict seizures using the information contained in electroencephalography (EEG) signals. The wireless sensor technology is used to capture the EEG signals of patients. The cloud-based services are used to collect and analyze the EEG data from the patient's mobile phone. The features from the EEG signal are extracted using the fast Walsh-Hadamard transform (FWHT). The Higher Order Spectral Analysis (HOSA) is applied to FWHT coefficients in order to select the features set relevant to normal, preictal and ictal states of seizure. We subsequently exploit the selected features as input to a k-means classifier to detect epileptic seizure states in a reasonable time. The performance of the proposed model is tested on Amazon EC2 cloud and compared in terms of execution time and accuracy. The findings show that with selected HOS based features, we were able to achieve a classification accuracy of 94.6 %.

  4. State of the Art Approach to the Classification of Epileptic Seizures and Epilepsies

    PubMed Central

    BARÇIN, Ebru; AKTEKİN, Berrin

    2014-01-01

    In the light of the latest knowledge acquired from clinical and laboratory research dealing with genetic, molecular biology and neuroimaging, existing classifications were successively revised by the International League Against Epilepsy (ILAE) in 2001, 2006, and 2010. In the latest classification established in 2010, proposals articulated radical changes in terms of concepts and definitions of the previously published classifications and put forward new classifications for epileptic seizures, epilepsies and electroclinical syndromes. This review refers to the changes of the new classification with their reasons and criticisms.

  5. Brain network dynamics characterization in epileptic seizures. Joint directed graph and pairwise synchronization measures

    NASA Astrophysics Data System (ADS)

    Rodrigues, A. C.; Machado, B. S.; Florence, G.; Hamad, A. P.; Sakamoto, A. C.; Fujita, A.; Baccalá, L. A.; Amaro, E.; Sameshima, K.

    2014-12-01

    Here we propose and evaluate a new approach to analyse multichannel mesial temporal lobe epilepsy EEG data from eight patients through complex network and synchronization theories. The method employs a Granger causality test to infer the directed connectivity graphs and a wavelet transform based phase synchronization measure whose characteristics allow studying dynamical transitions during epileptic seizures. We present a new combined graph measure that quantifies the level of network hub formation, called network hub out-degree, which closely reflects the level of synchronization observed during the ictus.

  6. Drug therapy of epileptic seizures among adult epileptic outpatients of University of Gondar Referral and Teaching Hospital, Gondar, North West Ethiopia

    PubMed Central

    Birru, Eshetie Melese; Shafi, Miftah; Geta, Mestayet

    2016-01-01

    Objective The aim of this study was to assess the practice of pharmacotherapy of epilepsy and its treatment outcomes in adult epileptic outpatients at the University of Gondar Referral and Teaching Hospital, Gondar, North West Ethiopia. Methods An institution based, retrospective cross-sectional study was conducted from the medical charts of 336 adult epileptic patients at the outpatient epileptic clinic of Neurology Department of University of Gondar Teaching Hospital from May 2014 to April 2015. Reviewing follow-up information from the medical charts was used to evaluate antiepileptic drug (AED) prescribing patterns and treatment outcome. Data were collected by using data collection format and analyzed using SPSS software version 16. Results The most common type of seizure diagnosed was generalized tonic–clonic seizure (n=245, 72.91%). Monotherapy with an AED accounted for 80.35% of the cases, whereas dual therapy and polytherapy with three AED combinations accounted for 16.37% and 3.28%, respectively. The most frequently prescribed AED was phenobarbitone (62.47%) followed by carbamazepine (17.91%). From the total epileptic cases, 277 (82.4%) had well-controlled seizure status in the last three consecutive months. Conclusion Most of the patients were maintained by monotherapy, and largely this was by the older antiepileptic drug, phenobarbitone. Considering the development of pharmacotherapy of epilepsy and other patient related factors, the standard treatment guideline for Ethiopia needs to be revised periodically. PMID:28053533

  7. The role of stress as a trigger for epileptic seizures: a narrative review of evidence from human and animal studies.

    PubMed

    Novakova, Barbora; Harris, Peter R; Ponnusamy, Athi; Reuber, Markus

    2013-11-01

    Stress is one of the most frequently self-identified seizure triggers in patients with epilepsy; however, most previous publications on stress and epilepsy have focused on the role of stress in the initial development of epilepsy. This narrative review explores the causal role of stress in triggering seizures in patients with existing epilepsy. Findings from human studies of psychological stress, as well as of physiologic stress responses in humans and animals, and evidence from nonpharmacologic interventions for epilepsy are considered. The evidence from human studies for stress as a trigger of epileptic seizures is inconclusive. Although retrospective self-report studies show that stress is the most common patient-perceived seizure precipitant, prospective studies have yielded mixed results and studies of life events suggest that stressful experiences only trigger seizures in certain individuals. There is limited evidence suggesting that autonomic arousal can precede seizures. Interventions designed to improve coping with stress reduce seizures in some individuals. Studies of physiologic stress using animal epilepsy models provide more convincing evidence. Exposure to exogenous and endogenous stress mediators has been found to increase epileptic activity in the brain and trigger overt seizures, especially after repeated exposure. In conclusion, stress is likely to exacerbate the susceptibility to epileptic seizures in a subgroup of individuals with epilepsy and may play a role in triggering "spontaneous" seizures. However, there is currently no strong evidence for a close link between stress and seizures in the majority of people with epilepsy, although animal research suggests that such links are likely. Further research is needed into the relationship between stress and seizures and into interventions designed to reduce perceived stress and improve quality of life with epilepsy. Wiley Periodicals, Inc. © 2013 International League Against Epilepsy.

  8. Aberrant gamma band cortical sources and functional connectivity in adolescents with psychogenic non-epileptic seizures: A preliminary report.

    PubMed

    Umesh, Shreekantiah; Tikka, Sai Krishna; Goyal, Nishant; Sinha, Vinod Kumar; Nizamie, Shamshul Haque

    2017-01-01

    Psychogenic non-epileptic seizures (PNES) resemble epileptic seizures, but lack clinically evident abnormal electrical activity in the brain. We aimed to assess resting gamma spectral power, current source distribution and functional connectivity in adolescents with PNES. Interictal, 32 channels electroencephalographic recording of 15 adolescents with PNES was compared with 10 matched healthy controls. Spectral power, current source distribution and lagged linear coherence were assessed. Statistically significant gamma spectral power, cortical sources and connectivity pattern was found in some brain areas. Region specific aberrant gamma activity and its relationship to psychopathology are discussed. Copyright © 2016. Published by Elsevier Ireland Ltd.

  9. Effects of conventional anticonvulsant drugs on generalized tonic-clonic seizures in Noda epileptic rats.

    PubMed

    Inoue, Maki; Yamamoto, Ayaka; Kaneko, Yuka; Noda, Atsushi; Naito, Hiroyuki

    2014-09-01

    Noda epileptic rats (NERs) present with clinico-pathological manifestations reminiscent of human generalized tonic-clonic epilepsy. Thus, this strain of rat has been a model of primary, generalized, tonic-clonic epilepsy. However, the infrequency of seizures in these rats makes the assessment of antiepileptic drugs (AEDs) difficult. Therefore, traditional AEDs have only been tested in NERs against audiogenic seizures evoked by weekly acoustic priming from 3 to 22 weeks of age or by using the kindling procedure in adult animals. Adult NERs are susceptible to changes in their environment, such as bedding replacement or unpleasant sensory stimuli. In the present study, traditional AEDs-phenobarbital (PB) and sodium valproate (VPA)-were evaluated against seizures evoked by strong environmental stimuli in mature NERs that had not been previously primed. The number of animals presenting with seizures decreased in a dose-dependent manner following administration of either PB (dose range 1.0-5.0mg/kg) or VPA (50 and 100mg/kg). Consequently, the utility of NERs as a model of generalized tonic-clonic epilepsy was confirmed. This type of protocol can be used to further evaluate AEDs and test effects of chronic administration of AEDs. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Epileptic seizures, coma and EEG burst-suppression from suicidal bupropion intoxication.

    PubMed

    Noda, Anna Hiro; Schu, Ulrich; Maier, Tanja; Knake, Susanne; Rosenow, Felix

    2017-03-01

    Bupropion, an amphetamine-like dual mechanism drug, is approved and increasingly used for the treatment of major depression, and its use is associated with a dose-dependent risk of epileptic seizures. Suicide attempts are frequent in major depression and often an overdose of the drugs available is ingested. Therefore, it is important to be aware of the clinical course, including EEG and neurological symptoms, as well as treatment and prognosis of bupropion intoxication. We report on the clinical and EEG course of a women who ingested 27 g of bupropion in a suicide attempt. Myoclonic seizures were followed by generalized tonic-clonic seizures and coma associated with EEG burst-suppression and brief tonic seizures. Active carbon and neuro-intensive care treatment, including respiratory support, were given. Within three days, the patient returned to a stable clinical condition with a mildly encephalopathic EEG. In conclusion, bupropion intoxication requires acute intensive care treatment and usually has a good prognosis, however, misinterpretation of the clinical and EEG presentation may lead to errors in management.

  11. Epileptic Seizure Detection with Log-Euclidean Gaussian Kernel-Based Sparse Representation.

    PubMed

    Yuan, Shasha; Zhou, Weidong; Wu, Qi; Zhang, Yanli

    2016-05-01

    Epileptic seizure detection plays an important role in the diagnosis of epilepsy and reducing the massive workload of reviewing electroencephalography (EEG) recordings. In this work, a novel algorithm is developed to detect seizures employing log-Euclidean Gaussian kernel-based sparse representation (SR) in long-term EEG recordings. Unlike the traditional SR for vector data in Euclidean space, the log-Euclidean Gaussian kernel-based SR framework is proposed for seizure detection in the space of the symmetric positive definite (SPD) matrices, which form a Riemannian manifold. Since the Riemannian manifold is nonlinear, the log-Euclidean Gaussian kernel function is applied to embed it into a reproducing kernel Hilbert space (RKHS) for performing SR. The EEG signals of all channels are divided into epochs and the SPD matrices representing EEG epochs are generated by covariance descriptors. Then, the testing samples are sparsely coded over the dictionary composed by training samples utilizing log-Euclidean Gaussian kernel-based SR. The classification of testing samples is achieved by computing the minimal reconstructed residuals. The proposed method is evaluated on the Freiburg EEG dataset of 21 patients and shows its notable performance on both epoch-based and event-based assessments. Moreover, this method handles multiple channels of EEG recordings synchronously which is more speedy and efficient than traditional seizure detection methods.

  12. Up-to-date Critical Review of the Classification of Epilepsies and Epileptic Seizures

    PubMed Central

    AKTEKİN, Berrin

    2015-01-01

    The classification of epileptic seizures and epilepsies is a subject of interest in various medical disciplines (such as neurology, pediatric neurology, molecular biology and genetics, neurosurgery, pharmacology, radiology, histopathology), and each of them requires a different approach in their practice. In last 15 years, enormous amount of debate in which irrelevant to actual level of knowledge, were ongoing in the literature. Epilepsy classification is a fundamental tool that impacts not only daily clinical practice but also research era and education. The current lack of consensus in this field causes a serious obstacle in patient management, student and resident education, and information sharing among different scientific interest groups. The comparison of different classification proposals by means of positive and negative aspects is beyond the scope of discussion in this article; therefore, I will try to give a brief summary of our current level of understanding. Main issues regarding the classifications proposal are as follows: Concepts of epileptic seizure/epilepsy/syndromeFocal & generalized epilepsy conceptIdiopathic, genetic, cryptogenic, and symptomatic (structural/metabolic) concepts

  13. Advantages of respiratory monitoring during video-EEG evaluation to differentiate epileptic seizures from other events

    PubMed Central

    Pavlova, Milena; Abdennadher, Myriam; Singh, Kanwaljit; Katz, Eliot; Llewellyn, Nichelle; Zarowsly, Marcin; White, David P.; Dworetzky, Barbara A.; Kothare, Sanjeev V.

    2014-01-01

    Distinction between epileptic (ES) and seizure-like events of non-epileptic nature(SLNE) is often difficult using descriptions of seizure semiology. Cardiopulmonary dysfunction is frequent in ES but has not been objectively examined in relationship to SLNE. Our purpose was to compare cardiopulmonary dysfunction between ES and SLNE. We prospectively recorded cardio-pulmonary function using pulse-oximetry, EKG and respiratory inductance plethysmography (RIP) in 52 ES and 22 SLNE. Comparison of cardiopulmonary complications between ES and SLNE was done using two-sample t-tests and logistic regression. Ictal bradypnea and pre-ictal bradycardia were more frequent in ES than SLNE (p<0.05). Desaturation was found in 57% of ES and 0% SLNE (p<0.0001). Oxygen saturation nadir was significantly lower in ES vs. SLNE (p<0.0001). Ictal-apnea was present in 31% ES and 9% SLNE (p=0.06). Pre-ictal, ictal and post-ictal tachycardia did not significantly differ between ES and SLNE (p>1.0). Cardio-respiratory dysfunction, specifically bradypnea, apnea, pre-ictal bradycardia, and oxygen desaturation, is more frequently seen in ES than in SLNE. Tachycardia was not discriminant between ES and SLNE. PMID:24561659

  14. Psychological interventions for psychogenic non-epileptic seizures: A meta-analysis.

    PubMed

    Carlson, Perri; Nicholson Perry, Kathryn

    2017-02-01

    The aim of this meta-analysis is to evaluate and synthesize the available evidence from the previous 20 years regarding the utility of psychological interventions in the management of psychogenic non-epileptic seizures (PNES). Studies were retrieved from MEDLINE via OvidSP and PsychINFO. Selection criteria included controlled and before-after non-controlled studies including case series, using seizure frequency as an outcome measurement. Studies were required to assess one or more types of psychological intervention for the treatment of PNES in adults. Data from 13 eligible studies was pooled to examine the effectiveness of psychological interventions in treating PNES on two primary outcomes: seizure reduction of 50% or more and seizure freedom. A meta-analysis was conducted with data extracted from 228 participants with PNES. Interventions reviewed in the analysis included CBT, psychodynamic therapy, paradoxical intention therapy, mindfulness and psychoeducation and eclectic interventions. Meta-analysis synthesized data from 13 studies with a total of 228 participants with PNES, of varied gender and age. Results showed 47% of people with PNES are seizure free upon completion of a psychological intervention. Additional meta-analysis synthesized data from 10 studies with a total of 137 participants with PNES. This analysis found 82% of people with PNES who complete psychological treatment experience a reduction in seizures of at least 50%. The studies identified for this analysis were diverse in nature and quality. The findings highlight the potential for psychological interventions as a favorable alternative to the current lack of treatment options offered to people with PNES. Copyright © 2016 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  15. Distinct behavioral and epileptic phenotype differences in 129/P mice compared to C57BL/6 mice subject to intraamygdala kainic acid-induced status epilepticus.

    PubMed

    Almeida Silva, Luiz Fernando; Engel, Tobias; Reschke, Cristina R; Conroy, Ronan M; Langa, Elena; Henshall, David C

    2016-11-01

    Animal models of status epilepticus are important tools to understand the pathogenesis of epileptic brain injury and evaluate potential seizure-suppressive, neuroprotective, and antiepileptogenic treatments. Focal elicitation of status epilepticus by intraamygdala kainic acid in mice produces unilateral hippocampal damage and the emergence of spontaneous recurrent seizures after a short latent period. The model has been characterized in C57BL/6, BALB/c, and SJL mice where strain-specific differences were found in the extent of hippocampal damage. 129/P mice are a common background strain for genetic models and may display unique characteristics in this model. We therefore compared responses to intraamygdala kainic acid between 129/P and C57BL/6 mice. Racine scale-scored convulsive behavior during status epilepticus was substantially lower in 129/P mice compared with that in C57BL/6 mice. Analysis of surface-recorded electroencephalogram (EEG) showed differences between strains in several frequency bands; EEG total power was greater during ictal episodes while duration of seizures was slightly shorter in 129/P mice. Histological analysis revealed similar hippocampal injury between strains, with neuronal death mainly confined to the ipsilateral CA3 subfield. Expression of genes associated with gliosis and neuroinflammatory responses was also similar between strains after seizures. Video-EEG telemetry recordings showed that 129/P mice first display spontaneous seizures within a few days of status epilepticus similar to C57BL/6 mice. However, high mortality in 129/P mice prevented a quantitative comparison of the epileptic seizure phenotypes between strains. This study defined behavioral, EEG, and histopathologic features of this mouse strain in a model increasingly useful for the study of the genetic contribution to acquired epilepsy. Intraamygdala kainic acid in 129/P mice could serve as a model of nonconvulsive status epilepticus, but long-term assessments will

  16. The relative influence of epileptic EEG discharges, short nonconvulsive seizures, and type of epilepsy on cognitive function.

    PubMed

    Aldenkamp, Albert; Arends, Johan

    2004-01-01

    This study addressed whether cognitive impairment in children with epilepsy is caused by disease-related stable factors, such as the type of epilepsy, or by acute effects of paroxysmal epileptic activity such as epileptic EEG discharges. We studied a nonselected group with short nonconvulsive seizures, as these seizures may elude detection and may therefore persist over a longer period. In this group, the diagnostic issue is to differentiate between the combined effects of several epilepsy-related factors on cognition. All children were assessed with 32-channel EEG, synchronized with a computerized cognitive test system and a video-monitoring system. Recording time was 2 h. The primary inclusion criteria were unclear seizures and fluctuations in cognitive performance and/or frequent epileptic EEG discharges in a recent EEG. One hundred fifty-two patients met the inclusion criteria; 31 patients appeared not to have a diagnosis of epilepsy and were used as a nonepilepsy control group. Our results show that type of epilepsy has an impact on stable cognitive functions, such as educational achievement. Paroxysmal epileptic activity (acute effects of seizures and epileptic EEG discharges) affects primarily transient mechanistic cognitive processes (alertness, mental speed). These results suggest that the effects of paroxysmal epileptic activity on transient cognitive mechanisms may accumulate over time and consequently affect the more stable aspects of cognitive function such as educational achievement. The clinical relevance is that early detection of the cognitive impact of seizure-related activity and subsequent treatment may prevent its detrimental impact on cognitive and educational development.

  17. Non-intrusive head movement analysis of videotaped seizures of epileptic origin.

    PubMed

    Mandal, Bappaditya; Eng, How-Lung; Lu, Haiping; Chan, Derrick W S; Ng, Yen-Ling

    2012-01-01

    In this work we propose a non-intrusive video analytic system for patient's body parts movement analysis in Epilepsy Monitoring Unit. The system utilizes skin color modeling, head/face pose template matching and face detection to analyze and quantify the head movements. Epileptic patients' heads are analyzed holistically to infer seizure and normal random movements. The patient does not require to wear any special clothing, markers or sensors, hence it is totally non-intrusive. The user initializes the person-specific skin color and selects few face/head poses in the initial few frames. The system then tracks the head/face and extracts spatio-temporal features. Support vector machines are then used on these features to classify seizure-like movements from normal random movements. Experiments are performed on numerous long hour video sequences captured in an Epilepsy Monitoring Unit at a local hospital. The results demonstrate the feasibility of the proposed system in pediatric epilepsy monitoring and seizure detection.

  18. Dynamic Electrical Source Imaging (DESI) of Seizures and Interictal Epileptic Discharges Without Ensemble Averaging

    PubMed Central

    Erem, Burak; Hyde, Damon E.; Peters, Jurriaan M.; Duffy, Frank H.; Warfield, Simon K.

    2016-01-01

    We propose an algorithm for electrical source imaging of epileptic discharges that takes a data-driven approach to regularizing the dynamics of solutions. The method is based on linear system identification on short time segments, combined with a classical inverse solution approach. Whereas ensemble averaging of segments or epochs discards inter-segment variations by averaging across them, our approach explicitly models them. Indeed, it may even be possible to avoid the need for the time-consuming process of marking epochs containing discharges altogether. We demonstrate that this approach can produce both stable and accurate inverse solutions in experiments using simulated data and real data from epilepsy patients. In an illustrative example, we show that we are able to image propagation using this approach. We show that when applied to imaging seizure data, our approach reproducibly localized frequent seizure activity to within the margins of surgeries that led to patients’ seizure freedom. The same approach could be used in the planning of epilepsy surgeries, as a way to localize potentially epileptogenic tissue that should be resected. PMID:27479957

  19. All together now: Analogies between chimera state collapses and epileptic seizures

    PubMed Central

    Andrzejak, Ralph G.; Rummel, Christian; Mormann, Florian; Schindler, Kaspar

    2016-01-01

    Conceptually and structurally simple mathematical models of coupled oscillator networks can show a rich variety of complex dynamics, providing fundamental insights into many real-world phenomena. A recent and not yet fully understood example is the collapse of coexisting synchronous and asynchronous oscillations into a globally synchronous motion found in networks of identical oscillators. Here we show that this sudden collapse is promoted by a further decrease of synchronization, rather than by critically high synchronization. This strikingly counterintuitive mechanism can be found also in nature, as we demonstrate on epileptic seizures in humans. Analyzing spatiotemporal correlation profiles derived from intracranial electroencephalographic recordings (EEG) of seizures in epilepsy patients, we found a pronounced decrease of correlation at the seizure onsets. Applying our findings in a closed-loop control scheme to models of coupled oscillators in chimera states, we succeed in both provoking and preventing outbreaks of global synchronization. Our findings not only advance the understanding of networks of coupled dynamics but can open new ways to control them, thus offering a vast range of potential new applications. PMID:26957324

  20. All together now: Analogies between chimera state collapses and epileptic seizures

    NASA Astrophysics Data System (ADS)

    Andrzejak, Ralph G.; Rummel, Christian; Mormann, Florian; Schindler, Kaspar

    2016-03-01

    Conceptually and structurally simple mathematical models of coupled oscillator networks can show a rich variety of complex dynamics, providing fundamental insights into many real-world phenomena. A recent and not yet fully understood example is the collapse of coexisting synchronous and asynchronous oscillations into a globally synchronous motion found in networks of identical oscillators. Here we show that this sudden collapse is promoted by a further decrease of synchronization, rather than by critically high synchronization. This strikingly counterintuitive mechanism can be found also in nature, as we demonstrate on epileptic seizures in humans. Analyzing spatiotemporal correlation profiles derived from intracranial electroencephalographic recordings (EEG) of seizures in epilepsy patients, we found a pronounced decrease of correlation at the seizure onsets. Applying our findings in a closed-loop control scheme to models of coupled oscillators in chimera states, we succeed in both provoking and preventing outbreaks of global synchronization. Our findings not only advance the understanding of networks of coupled dynamics but can open new ways to control them, thus offering a vast range of potential new applications.

  1. Hyperpolarization-activated cyclic nucleotide gated channels: a potential molecular link between epileptic seizures and Aβ generation in Alzheimer's disease.

    PubMed

    Saito, Yuhki; Inoue, Tsuyoshi; Zhu, Gang; Kimura, Naoki; Okada, Motohiro; Nishimura, Masaki; Kimura, Nobuyuki; Murayama, Shigeo; Kaneko, Sunao; Shigemoto, Ryuichi; Imoto, Keiji; Suzuki, Toshiharu

    2012-10-03

    One of the best-characterized causative factors of Alzheimer's disease (AD) is the generation of amyloid-β peptide (Aβ). AD subjects are at high risk of epileptic seizures accompanied by aberrant neuronal excitability, which in itself enhances Aβ generation. However, the molecular linkage between epileptic seizures and Aβ generation in AD remains unclear. X11 and X11-like (X11L) gene knockout mice suffered from epileptic seizures, along with a malfunction of hyperpolarization-activated cyclic nucleotide gated (HCN) channels. Genetic ablation of HCN1 in mice and HCN1 channel blockage in cultured Neuro2a (N2a) cells enhanced Aβ generation. Interestingly, HCN1 levels dramatically decreased in the temporal lobe of cynomolgus monkeys (Macaca fascicularis) during aging and were significantly diminished in the temporal lobe of sporadic AD patients. Because HCN1 associates with amyloid-β precursor protein (APP) and X11/X11L in the brain, genetic deficiency of X11/X11L may induce aberrant HCN1 distribution along with epilepsy. Moreover, the reduction in HCN1 levels in aged primates may contribute to augmented Aβ generation. Taken together, HCN1 is proposed to play an important role in the molecular linkage between epileptic seizures and Aβ generation, and in the aggravation of sporadic AD.

  2. Chronic Trigeminal Nerve Stimulation Protects Against Seizures, Cognitive Impairments, Hippocampal Apoptosis, and Inflammatory Responses in Epileptic Rats.

    PubMed

    Wang, Qian-Qian; Zhu, Li-Jun; Wang, Xian-Hong; Zuo, Jian; He, Hui-Yan; Tian, Miao-Miao; Wang, Lei; Liang, Gui-Ling; Wang, Yu

    2016-05-01

    Trigeminal nerve stimulation (TNS) has recently been demonstrated effective in the treatment of epilepsy and mood disorders. Here, we aim to determine the effects of TNS on epileptogenesis, cognitive function, and the associated hippocampal apoptosis and inflammatory responses. Rats were injected with pilocarpine to produce status epilepticus (SE) and the following chronic epilepsy. After SE induction, TNS treatment was conducted for 4 consecutive weeks. A pilocarpine re-injection was then used to induce a seizure in the epileptic rats. The hippocampal neuronal apoptosis induced by seizure was assessed by TUNEL staining and inflammatory responses by immunohistochemistry and enzyme-linked immunosorbent assay (ELISA). The spontaneous recurrent seizure (SRS) number was counted through video monitoring, and the cognitive function assessed through Morris Water Maze (MWM) test. TNS treatment attenuated the SRS attacks and improved the cognitive impairment in epileptic rats. A pilocarpine re-injection resulted in less hippocampal neuronal apoptosis and reduced level of interleukin-1 beta (IL-1β), tumor necrosis factor-α (TNF-α), and microglial activation in epileptic rats with TNS treatment in comparison to the epileptic rats without TNS treatment. It is concluded that TNS treatment shortly after SE not only protected against the chronic spontaneous seizures but also improved cognitive impairments. These antiepileptic properties of TNS may be related to its attenuating effects on hippocampal apoptosis and pro-inflammatory responses.

  3. Refractory epileptic seizures due to vitamin B6 deficiency in a patient with Parkinson's disease under duodopa® therapy.

    PubMed

    Skodda, Sabine; Müller, Thomas

    2013-02-01

    Levodopa/carbidopa intestinal gel (LCIG) infusion for the treatment of advanced Parkinson's disease (PD) has been suspected to provoke polyneuropathy in conjunction with vitamin B6, B12 and folate deficiency and elevated homocysteine levels. We describe a PD patient under LCIG therapy developing refractory epileptic seizures obviously promoted by vitamin B6 deficiency.

  4. Focal seizures and epileptic spasms in a child with Down syndrome from a family with a PRRT2 mutation.

    PubMed

    Igarashi, Ayuko; Okumura, Akihisa; Shimojima, Keiko; Abe, Shinpei; Ikeno, Mitsuru; Shimizu, Toshiaki; Yamamoto, Toshiyuki

    2016-06-01

    We describe a girl with Down syndrome who experienced focal seizures and epileptic spasms during infancy. The patient was diagnosed as having trisomy 21 during the neonatal period. She had focal seizures at five months of age, which were controlled with phenobarbital. However, epileptic spasms appeared at seven months of age in association with hypsarrhythmia. Upon treatment with adrenocorticotropic hormone, her epileptic spasms disappeared. Her younger brother also had focal seizures at five months of age. His development and interictal electroencephalogram were normal. The patient's father had had infantile epilepsy and paroxysmal kinesigenic dyskinesia. We performed a mutation analysis of the PRRT2 gene and found a c.841T>C mutation in the present patient, her father, and in her younger brother. We hypothesized that the focal seizures in our patient were caused by the PRRT2 mutation, whereas the epileptic spasms were attributable to trisomy 21. Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  5. Are psychogenic non-epileptic seizures just another symptom of conversion disorder?

    PubMed

    Kanaan, Richard A A; Duncan, Roderick; Goldstein, Laura H; Jankovic, Joseph; Cavanna, Andrea E

    2017-05-01

    Psychogenic non-epileptic seizures (PNES) are classified with other functional neurological symptoms as 'Conversion Disorder', but there are reasons to wonder whether this symptomatology constitutes a distinct entity. We reviewed the literature comparing PNES with other functional neurological symptoms. We find eight studies that directly examined this question. Though all but one found significant differences-notably in presenting age, trauma history, and dissociation-they were divided on whether these differences represented an important distinction. We argue that the aetiological and mechanistic distinctions they support, particularly when bolstered by additional data, give reason to sustain a separation between these conditions. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  6. [Tetraplegia, resuscitation and epileptic seizures after partial colon resection in a 41-year-old woman].

    PubMed

    Wagner, W

    2014-01-01

    A 41-year-old woman, suffering from continuous abdominal pain, only presented a non-specific inflammation of the whole colon and an unclaryfied hyponatriaemia; in spite of the only doubtful explanation by an enormous elongation of the colon, it was partially resected. Thereafter, the patient's decline, hypaesthesia, areflexia and tetraparesis required intensive care. Despite immunoglobulin therapy, assuming a Guillain-Barré syndrome, the patient needed resuscitation, followed by signs of severe hypoxia (high level of neuron-specific enolase, hippocampal lesions). The abdominal pain, hyponatriaemia, persistent tachycardia, sensory deficits, tetraplegia, circulation arrest, later epileptic seizures and unusual urine color were finally explained by an acute intermittent porphyria (AIP). Although the symptoms were classic, the disease was recognized only very late. Indeed, it is so rare that most physicians will never be confronted with an AIP or only once or twice.

  7. Controlled test for predictive power of Lyapunov exponents: their inability to predict epileptic seizures.

    PubMed

    Lai, Ying-Cheng; Harrison, Mary Ann F; Frei, Mark G; Osorio, Ivan

    2004-09-01

    Lyapunov exponents are a set of fundamental dynamical invariants characterizing a system's sensitive dependence on initial conditions. For more than a decade, it has been claimed that the exponents computed from electroencephalogram (EEG) or electrocorticogram (ECoG) signals can be used for prediction of epileptic seizures minutes or even tens of minutes in advance. The purpose of this paper is to examine the predictive power of Lyapunov exponents. Three approaches are employed. (1) We present qualitative arguments suggesting that the Lyapunov exponents generally are not useful for seizure prediction. (2) We construct a two-dimensional, nonstationary chaotic map with a parameter slowly varying in a range containing a crisis, and test whether this critical event can be predicted by monitoring the evolution of finite-time Lyapunov exponents. This can thus be regarded as a "control test" for the claimed predictive power of the exponents for seizure. We find that two major obstacles arise in this application: statistical fluctuations of the Lyapunov exponents due to finite time computation and noise from the time series. We show that increasing the amount of data in a moving window will not improve the exponents' detective power for characteristic system changes, and that the presence of small noise can ruin completely the predictive power of the exponents. (3) We report negative results obtained from ECoG signals recorded from patients with epilepsy. All these indicate firmly that, the use of Lyapunov exponents for seizure prediction is practically impossible as the brain dynamical system generating the ECoG signals is more complicated than low-dimensional chaotic systems, and is noisy. Copyright 2004 American Institute of Physics

  8. Controlled test for predictive power of Lyapunov exponents: Their inability to predict epileptic seizures

    NASA Astrophysics Data System (ADS)

    Lai, Ying-Cheng; Harrison, Mary Ann F.; Frei, Mark G.; Osorio, Ivan

    2004-09-01

    Lyapunov exponents are a set of fundamental dynamical invariants characterizing a system's sensitive dependence on initial conditions. For more than a decade, it has been claimed that the exponents computed from electroencephalogram (EEG) or electrocorticogram (ECoG) signals can be used for prediction of epileptic seizures minutes or even tens of minutes in advance. The purpose of this paper is to examine the predictive power of Lyapunov exponents. Three approaches are employed. (1) We present qualitative arguments suggesting that the Lyapunov exponents generally are not useful for seizure prediction. (2) We construct a two-dimensional, nonstationary chaotic map with a parameter slowly varying in a range containing a crisis, and test whether this critical event can be predicted by monitoring the evolution of finite-time Lyapunov exponents. This can thus be regarded as a "control test" for the claimed predictive power of the exponents for seizure. We find that two major obstacles arise in this application: statistical fluctuations of the Lyapunov exponents due to finite time computation and noise from the time series. We show that increasing the amount of data in a moving window will not improve the exponents' detective power for characteristic system changes, and that the presence of small noise can ruin completely the predictive power of the exponents. (3) We report negative results obtained from ECoG signals recorded from patients with epilepsy. All these indicate firmly that, the use of Lyapunov exponents for seizure prediction is practically impossible as the brain dynamical system generating the ECoG signals is more complicated than low-dimensional chaotic systems, and is noisy.

  9. Ngram-derived pattern recognition for the detection and prediction of epileptic seizures.

    PubMed

    Eftekhar, Amir; Juffali, Walid; El-Imad, Jamil; Constandinou, Timothy G; Toumazou, Christofer

    2014-01-01

    This work presents a new method that combines symbol dynamics methodologies with an Ngram algorithm for the detection and prediction of epileptic seizures. The presented approach specifically applies Ngram-based pattern recognition, after data pre-processing, with similarity metrics, including the Hamming distance and Needlman-Wunsch algorithm, for identifying unique patterns within epochs of time. Pattern counts within each epoch are used as measures to determine seizure detection and prediction markers. Using 623 hours of intracranial electrocorticogram recordings from 21 patients containing a total of 87 seizures, the sensitivity and false prediction/detection rates of this method are quantified. Results are quantified using individual seizures within each case for training of thresholds and prediction time windows. The statistical significance of the predictive power is further investigated. We show that the method presented herein, has significant predictive power in up to 100% of temporal lobe cases, with sensitivities of up to 70-100% and low false predictions (dependant on training procedure). The cases of highest false predictions are found in the frontal origin with 0.31-0.61 false predictions per hour and with significance in 18 out of 21 cases. On average, a prediction sensitivity of 93.81% and false prediction rate of approximately 0.06 false predictions per hour are achieved in the best case scenario. This compares to previous work utilising the same data set that has shown sensitivities of up to 40-50% for a false prediction rate of less than 0.15/hour.

  10. Pre-seizure architecture of the local connections of the epileptic focus examined via graph-theory.

    PubMed

    Vecchio, Fabrizio; Miraglia, Francesca; Vollono, Catello; Fuggetta, Filomena; Bramanti, Placido; Cioni, Beatrice; Rossini, Paolo Maria

    2016-10-01

    Epilepsy is characterized by unpredictable and sudden paroxysmal neuronal firing occurrences and sometimes evolving in clinically evident seizure. To predict seizure event, small-world characteristic in nine minutes before seizure, divided in three 3-min periods (T0, T1, T2) were investigated. Intracerebral recordings were obtained from 10 patients with drug resistant focal epilepsy examined by means of stereotactically implanted electrodes; analysis was focused in a period of low spiking (Baseline) and during two seizures. Networks' architecture is undirected and weighted. Electrodes' contacts close to epileptic focus are the vertices, edges are weighted by mscohere (=magnitude squared coherence). Differences were observed between Baseline and T1 and between Baseline and T2 in theta band; and between Baseline and T1, Baseline and T2, and near-significant difference between T0 and T2 in Alpha 2 band. Moreover, an intra-band index was computed for small worldness as difference between Theta and Alpha 2. It was found a growing index trend from Baseline to T2. Cortical network features a specific pre-seizure architecture which could predict the incoming epileptic seizure. Through this study future researches could investigate brain connectivity modifications approximating a clinical seizure also in order to address a preventive therapy. Copyright © 2016 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

  11. Occurrence of menstrual cycle related seizure patterns among epileptic women attending the tertiary neurology clinics of the National Hospital of Sri Lanka.

    PubMed

    Kariyawasam, S H; Mannapperuma, U; Jayasuriya, W J A B N; Weerathunga, J; Munasinghe, K

    2009-04-01

    Female sex hormones estrogen and progesterone have effects on seizure activity. Patterns of seizure exacerbations associated with the menstrual cycle have been described as catamenial epilepsy. This study was done to investigate the menstrual cycle related seizure occurrence among female epileptics using seizure-menstrual calendars and sex hormonal assays. Frequency and the patterns of seizure occurrence within the menstrual cycles were determined analyzing seizure-menstrual calendars. Luteal phase serum estradiol and progesterone were determined in those with menstrual cycle related seizure patterns to be compared with that of healthy women. Out of 349 epileptics, 6% showed occurrence of perimenstrual, periovulatory or perimenstrual+periovulatory seizure patterns on analysis of seizure-menstrual calendars. These women showed significantly higher luteal serum estradiol concentrations in comparison to age-matched healthy volunteers. There was no significant difference in the luteal serum progesterone concentrations. This study showed menstrual cycle related patterns of seizure occurrence in a minority of Sri Lankan epileptic women, similar to catamenial epilepsy patterns described by previous studies. These seizure patterns may be due to altered hypothalamo-pituitary-gonadal axis function playing a role in the pathophysiology of epilepsy. We suggest the importance of maintaining seizure-menstrual calendars and hormonal studies in all epileptic women to establish the role of hypothalamo-pituitary-gonadal axis in epilepsy and to achieve efficient control of epilepsy in women of childbearing age.

  12. An 81.6 μW FastICA processor for epileptic seizure detection.

    PubMed

    Yang, Chia-Hsiang; Shih, Yi-Hsin; Chiueh, Herming

    2015-02-01

    To improve the performance of epileptic seizure detection, independent component analysis (ICA) is applied to multi-channel signals to separate artifacts and signals of interest. FastICA is an efficient algorithm to compute ICA. To reduce the energy dissipation, eigenvalue decomposition (EVD) is utilized in the preprocessing stage to reduce the convergence time of iterative calculation of ICA components. EVD is computed efficiently through an array structure of processing elements running in parallel. Area-efficient EVD architecture is realized by leveraging the approximate Jacobi algorithm, leading to a 77.2% area reduction. By choosing proper memory element and reduced wordlength, the power and area of storage memory are reduced by 95.6% and 51.7%, respectively. The chip area is minimized through fixed-point implementation and architectural transformations. Given a latency constraint of 0.1 s, an 86.5% area reduction is achieved compared to the direct-mapped architecture. Fabricated in 90 nm CMOS, the core area of the chip is 0.40 mm(2). The FastICA processor, part of an integrated epileptic control SoC, dissipates 81.6 μW at 0.32 V. The computation delay of a frame of 256 samples for 8 channels is 84.2 ms. Compared to prior work, 0.5% power dissipation, 26.7% silicon area, and 3.4 × computation speedup are achieved. The performance of the chip was verified by human dataset.

  13. Nonrandom connectivity of the epileptic dentate gyrus predicts a major role for neuronal hubs in seizures

    PubMed Central

    Morgan, Robert J.; Soltesz, Ivan

    2008-01-01

    Many complex neuronal circuits have been shown to display nonrandom features in their connectivity. However, the functional impact of nonrandom network topologies in neurological diseases is not well understood. The dentate gyrus is an excellent circuit in which to study such functional implications because proepileptic insults cause its structure to undergo a number of specific changes in both humans and animals, including the formation of previously nonexistent granule cell-to-granule cell recurrent excitatory connections. Here, we use a large-scale, biophysically realistic model of the epileptic rat dentate gyrus to reconnect the aberrant recurrent granule cell network in four biologically plausible ways to determine how nonrandom connectivity promotes hyperexcitability after injury. We find that network activity of the dentate gyrus is quite robust in the face of many major alterations in granule cell-to-granule cell connectivity. However, the incorporation of a small number of highly interconnected granule cell hubs greatly increases network activity, resulting in a hyperexcitable, potentially seizure-prone circuit. Our findings demonstrate the functional relevance of nonrandom microcircuits in epileptic brain networks, and they provide a mechanism that could explain the role of granule cells with hilar basal dendrites in contributing to hyperexcitability in the pathological dentate gyrus. PMID:18375756

  14. Efficient feature selection using a hybrid algorithm for the task of epileptic seizure detection

    NASA Astrophysics Data System (ADS)

    Lai, Kee Huong; Zainuddin, Zarita; Ong, Pauline

    2014-07-01

    Feature selection is a very important aspect in the field of machine learning. It entails the search of an optimal subset from a very large data set with high dimensional feature space. Apart from eliminating redundant features and reducing computational cost, a good selection of feature also leads to higher prediction and classification accuracy. In this paper, an efficient feature selection technique is introduced in the task of epileptic seizure detection. The raw data are electroencephalography (EEG) signals. Using discrete wavelet transform, the biomedical signals were decomposed into several sets of wavelet coefficients. To reduce the dimension of these wavelet coefficients, a feature selection method that combines the strength of both filter and wrapper methods is proposed. Principal component analysis (PCA) is used as part of the filter method. As for wrapper method, the evolutionary harmony search (HS) algorithm is employed. This metaheuristic method aims at finding the best discriminating set of features from the original data. The obtained features were then used as input for an automated classifier, namely wavelet neural networks (WNNs). The WNNs model was trained to perform a binary classification task, that is, to determine whether a given EEG signal was normal or epileptic. For comparison purposes, different sets of features were also used as input. Simulation results showed that the WNNs that used the features chosen by the hybrid algorithm achieved the highest overall classification accuracy.

  15. Driving regulations and psychogenic non-epileptic seizures: perspectives from the United Kingdom.

    PubMed

    Morrison, Ian; Razvi, Saif S M

    2011-03-01

    The Driver and Vehicle Licensing Agency (DVLA) in the United Kingdom provides guidance on fitness to drive for patients with a number of medical illnesses, including epilepsy and psychogenic non-epileptic seizures (PNES). The Association of British Neurologists circulates a monthly electronic newsletter to its membership by email. We used this newsletter to survey its recipients on the driving advice they offer patients with PNES, and their awareness of current DVLA guidelines. 54 replies were received (19/54 were epilepsy specialists). 11/54 respondents were unaware of any DVLA guidance regarding PNES. Of 43/54 aware of DVLA guidance, only 7% felt that it was sufficient. 40% of respondents did not recommend any driving restriction. 68% of epilepsy specialists recommended driving restriction as compared to 54% of non-epilepsy specialists. 2 respondents reported patients with PNES who had an accident as a consequence of a non-epileptic attack. The risk of motor vehicle accidents in patients with PNES needs further study. Until the establishment of evidence-based guidelines, there is a need to seek consensus and provide sufficient guidance regarding driving for both patients with PNES and their clinicians.

  16. Resting cortical PET metabolic changes in psychogenic non-epileptic seizures (PNES).

    PubMed

    Arthuis, M; Micoulaud-Franchi, J A; Bartolomei, F; McGonigal, Aileen; Guedj, E

    2015-10-01

    The pathophysiology of psychogenic non-epileptic seizures (PNES) is poorly understood. Functional neuroimaging data in various functional neurological disorders increasingly support specific neurobiological dysfunction. However, to date, no studies have been reported of positron emission tomography (PET) in patients presenting with PNES. Sixteen patients being evaluated in a specialist epilepsy centre underwent PET with 2-deoxy-2-[fluorine-18]fluoro-d-glucose ((18)FDG-PET) because of suspected intractable epileptic seizures. However, in all patients, the diagnosis was subsequently confirmed to be PNES with no coexisting epilepsy. (18)FDG-PET was also performed in 16 healthy controls. A voxel by voxel intergroup analysis was performed to look for significant differences in interictal (resting state) cerebral metabolism. In addition, metabolic connectivity was studied using voxel-wise inter-regional correlation analysis. In comparison to group analysis of healthy participants, the group analysis of patients with PNES exhibited significant PET hypometabolism within the right inferior parietal and central region, and within the bilateral anterior cingulate cortex. A significant increase in metabolic correlation was found in patients with PNES, in comparison to healthy participants, between the right inferior parietal/central region and the bilateral cerebellum, and between the bilateral anterior cingulate cortex and the left parahippocampal gyrus. To the best of our knowledge, this is the first study describing FDG-PET alterations in patients with PNES. Although we cannot exclude that our data reflect changes due to comorbidities, they may indicate a dysfunction of neural systems in patients with PNES. Hypometabolism regions might relate to two of the pathophysiological mechanisms that may be involved in PNES, that is, emotional dysregulation (anterior cingulate hypometabolism) and dysfunctional processes underlying the consciousness of the self and the environment

  17. Psychogenic non-epileptic seizures in children and adolescents. Part I: Diagnostic formulations.

    PubMed

    Kozlowska, Kasia; Chudleigh, Catherine; Cruz, Catherine; Lim, Melissa; McClure, Georgia; Savage, Blanche; Shah, Ubaid; Cook, Averil; Scher, Stephen; Carrive, Pascal; Gill, Deepak

    2017-09-01

    Psychogenic non-epileptic seizures (PNES) are a nonspecific, umbrella category that is used to collect together a range of atypical neurophysiological responses to emotional distress, physiological stressors and danger. Because PNES mimic epileptic seizures, children and adolescents with PNES usually present to neurologists or to epilepsy monitoring units. After a comprehensive neurological evaluation and a diagnosis of PNES, the patient is referred to mental health services for treatment. This study documents the diagnostic formulations - the clinical formulations about the probable neurophysiological mechanisms - that were constructed for 60 consecutive children and adolescents with PNES who were referred to our Mind-Body Rehabilitation Programme for treatment. As a heuristic framework, we used a contemporary reworking of Janet's dissociation model: PNES occur in the context of a destabilized neural system and reflect a release of prewired motor programmes following a functional failure in cognitive-emotional executive control circuitry. Using this framework, we clustered the 60 patients into six different subgroups: (1) dissociative PNES (23/60; 38%), (2) dissociative PNES triggered by hyperventilation (32/60; 53%), (3) innate defence responses presenting as PNES (6/60; 10%), (4) PNES triggered by vocal cord adduction (1/60; 2%), (5) PNES triggered by activation of the valsalva manoeuvre (1/60; 1.5%) and (6) PNES triggered by reflex activation of the vagus (2/60; 3%). As described in the companion article, these diagnostic formulations were used, in turn, both to inform the explanations of PNES that we gave to families and to design clinical interventions for helping the children and adolescents gain control of their PNES.

  18. Automatic epileptic seizure detection in EEGs using MF-DFA, SVM based on cloud computing.

    PubMed

    Zhang, Zhongnan; Wen, Tingxi; Huang, Wei; Wang, Meihong; Li, Chunfeng

    2017-01-01

    Epilepsy is a chronic disease with transient brain dysfunction that results from the sudden abnormal discharge of neurons in the brain. Since electroencephalogram (EEG) is a harmless and noninvasive detection method, it plays an important role in the detection of neurological diseases. However, the process of analyzing EEG to detect neurological diseases is often difficult because the brain electrical signals are random, non-stationary and nonlinear. In order to overcome such difficulty, this study aims to develop a new computer-aided scheme for automatic epileptic seizure detection in EEGs based on multi-fractal detrended fluctuation analysis (MF-DFA) and support vector machine (SVM). New scheme first extracts features from EEG by MF-DFA during the first stage. Then, the scheme applies a genetic algorithm (GA) to calculate parameters used in SVM and classify the training data according to the selected features using SVM. Finally, the trained SVM classifier is exploited to detect neurological diseases. The algorithm utilizes MLlib from library of SPARK and runs on cloud platform. Applying to a public dataset for experiment, the study results show that the new feature extraction method and scheme can detect signals with less features and the accuracy of the classification reached up to 99%. MF-DFA is a promising approach to extract features for analyzing EEG, because of its simple algorithm procedure and less parameters. The features obtained by MF-DFA can represent samples as well as traditional wavelet transform and Lyapunov exponents. GA can always find useful parameters for SVM with enough execution time. The results illustrate that the classification model can achieve comparable accuracy, which means that it is effective in epileptic seizure detection.

  19. Effects of A1 receptor agonist/antagonist on spontaneous seizures in pilocarpine-induced epileptic rats.

    PubMed

    Amorim, Beatriz Oliveira; Hamani, Clement; Ferreira, Elenn; Miranda, Maísa Ferreira; Fernandes, Maria José S; Rodrigues, Antonio M; de Almeida, Antônio-Carlos G; Covolan, Luciene

    2016-08-01

    Adenosine is an endogenous anticonvulsant that activates pre- and postsynaptic adenosine A1 receptors. A1 receptor agonists increase the latency for the development of seizures and status epilepticus following pilocarpine administration. Although hippocampal adenosine is increased in the chronic phase of the pilocarpine model, it is not known whether the modulation of A1 receptors may influence the frequency of spontaneous recurrent seizures (SRS). Here, we tested the hypothesis that the A1 receptor agonist RPia ([R]-N-phenylisopropyladenosine) and the A1 antagonist DPCPX (8-Cyclopentyl-1,3-dipropylxanthine) administered to chronic pilocarpine epileptic rats would respectively decrease and increase the frequency of SRS and hippocampal excitability. Four months after Pilo-induced SE, chronic epileptic rats were video-monitored for the recording of SRS before (basal) and after a 2-week treatment with RPia (25μg/kg) or DPCPX (50μg/kg). Following sacrifice, brain slices were studied with electrophysiology. We found that rats given RPia had a 93% nonsignificant reduction in the frequency of seizures compared with their own pretreatment baseline. In contrast, the administration of DPCPX resulted in an 87% significant increase in seizure rate. Nontreated epileptic rats had a similar frequency of seizures along the study. Corroborating our behavioral data, in vitro recordings showed that slices from animals previously given DPCPX had a shorter latency to develop epileptiform activity, longer and higher DC shifts, and higher spike amplitude compared with slices from nontreated Pilo controls. In contrast, smaller spike amplitude was recorded in slices from animals given RPia. In summary, the administration of A1 agonists reduced hippocampal excitability but not the frequency of spontaneous recurrent seizures in chronic epileptic rats, whereas A1 receptor antagonists increased both.

  20. Simultaneous fMRI and local field potential measurements during epileptic seizures in medetomidine sedated rats using RASER pulse sequence

    PubMed Central

    Airaksinen, Antti M; Niskanen, Juha-Pekka; Chamberlain, Ryan; Huttunen, Joanna K; Nissinen, Jari; Garwood, Michael; Pitkänen, Asla; Gröhn, Olli

    2010-01-01

    Simultaneous electrophysiological and functional magnetic resonance imaging (fMRI) measurements of animal models of epilepsy are methodologically challenging, but essential to better understand abnormal brain activity and hemodynamics during seizures. In the present study, fMRI of medetomidine sedated rats was performed using novel Rapid Acquisition by Sequential Excitation and Refocusing (RASER) fast imaging pulse sequence and simultaneous local field potential (LFP) measurements during kainic acid (KA) induced seizures. The image distortion caused by the hippocampal measuring electrode was clearly seen in echo planar imaging (EPI) images, whereas no artifact was seen in RASER images. Robust blood oxygenation level dependent (BOLD) responses were observed in the hippocampus during KA induced seizures. The recurrent epileptic seizures were detected in the LFP signal after KA injection. The presented combination of deep electrode LFP measurements and fMRI under medetomidine anesthesia, that does not significantly suppress KA induced seizures, provides a unique tool for studying abnormal brain activity in rats. PMID:20725933

  1. A coupled ordinary differential equation lattice model for the simulation of epileptic seizures

    NASA Astrophysics Data System (ADS)

    Larter, Raima; Speelman, Brent; Worth, Robert M.

    1999-09-01

    A coupled ordinary differential equation lattice model for the CA3 region of the hippocampus (a common location of the epileptic focus) is developed. This model consists of a hexagonal lattice of nodes, each describing a subnetwork consisting of a group of prototypical excitatory pyramidal cells and a group of prototypical inhibitory interneurons connected via on/off excitatory and inhibitory synapses. The nodes communicate using simple rules to simulate the diffusion of extracellular potassium. Both the integration time over which a node's trajectory is integrated before the diffusional event is allowed to occur and the level of inhibition in each node were found to be important parameters. Shorter integration times lead to total synchronization of the lattice (similar to synchronous neural activity occurring during a seizure) whereas longer times cause more random spatiotemporal behavior. Moderately diminished levels of inhibition lead to simple nodal oscillatory behavior. It is postulated that both the lack of inhibition and an alteration in conduction time may be necessary for the development of a behaviorally manifest seizure.

  2. Repeat interruptions in spinocerebellar ataxia type 10 expansions are strongly associated with epileptic seizures.

    PubMed

    McFarland, Karen N; Liu, Jilin; Landrian, Ivette; Zeng, Desmond; Raskin, Salmo; Moscovich, Mariana; Gatto, Emilia M; Ochoa, Adriana; Teive, Hélio A G; Rasmussen, Astrid; Ashizawa, Tetsuo

    2014-03-01

    Spinocerebellar ataxia type 10 (SCA10), an autosomal dominant neurodegenerative disorder, is the result of a non-coding, pentanucleotide repeat expansion within intron 9 of the Ataxin 10 gene. SCA10 patients present with pure cerebellar ataxia; yet, some families also have a high incidence of epilepsy. SCA10 expansions containing penta- and heptanucleotide interruption motifs, termed "ATCCT interruptions," experience large contractions during germline transmission, particularly in paternal lineages. At the same time, these alleles confer an earlier age at onset which contradicts traditional rules of genetic anticipation in repeat expansions. Previously, ATCCT interruptions have been associated with a higher prevalence of epileptic seizures in one Mexican-American SCA10 family. In a large cohort of SCA10 families, we analyzed whether ATCCT interruptions confer a greater risk for developing seizures in these families. Notably, we find that the presence of repeat interruptions within the SCA10 expansion confers a 6.3-fold increase in the risk of an SCA10 patient developing epilepsy (6.2-fold when considering patients of Mexican ancestry only) and a 13.7-fold increase in having a positive family history of epilepsy (10.5-fold when considering patients of Mexican ancestry only). We conclude that the presence of repeat interruptions in SCA10 repeat expansion indicates a significant risk for the epilepsy phenotype and should be considered during genetic counseling.

  3. A coupled ordinary differential equation lattice model for the simulation of epileptic seizures.

    PubMed

    Larter, Raima; Speelman, Brent; Worth, Robert M.

    1999-09-01

    A coupled ordinary differential equation lattice model for the CA3 region of the hippocampus (a common location of the epileptic focus) is developed. This model consists of a hexagonal lattice of nodes, each describing a subnetwork consisting of a group of prototypical excitatory pyramidal cells and a group of prototypical inhibitory interneurons connected via on/off excitatory and inhibitory synapses. The nodes communicate using simple rules to simulate the diffusion of extracellular potassium. Both the integration time over which a node's trajectory is integrated before the diffusional event is allowed to occur and the level of inhibition in each node were found to be important parameters. Shorter integration times lead to total synchronization of the lattice (similar to synchronous neural activity occurring during a seizure) whereas longer times cause more random spatiotemporal behavior. Moderately diminished levels of inhibition lead to simple nodal oscillatory behavior. It is postulated that both the lack of inhibition and an alteration in conduction time may be necessary for the development of a behaviorally manifest seizure. (c) 1999 American Institute of Physics.

  4. TLR4, ATF-3 and IL8 inflammation mediator expression correlates with seizure frequency in human epileptic brain tissue.

    PubMed

    Pernhorst, Katharina; Herms, Stefan; Hoffmann, Per; Cichon, Sven; Schulz, Herbert; Sander, Thomas; Schoch, Susanne; Becker, Albert J; Grote, Alexander

    2013-10-01

    Data from animal models has nicely shown that inflammatory processes in the central nervous system (CNS) can modulate seizure frequency. However, a potential relationship between the modulation of seizure frequency and gene expression of key inflammatory factors in human epileptic tissue is still unresolved. Brain tissue from pharmacoresistant patients with mesial temporal lobe epilepsy (mTLE) provides a unique prerequisite for clinico-neuropathological correlations. Here, we have concentrated on gene expression of the human key inflammatory mediators, TLR4, ATF-3 and IL8, in correlation to seizure frequency and additional clinical parameters in human epileptic brain tissue of pharmacoresistant mTLE patients. Furthermore, we characterized the cell types expressing the respective proteins in epileptic hippocampi. Total RNAs were isolated from n=26 hippocampi of pharmacoresistant mTLE patients using AllPrep DNA/RNA Mini Kit. cRNA was used for hybridization on Human HT-12 v3 Expression BeadChips with Illumina Direct Hybridization Assay Kit and resulting gene expression data was normalized based on the Illumina BeadStudio software suite by means of quantile normalization with background subtraction. Corresponding human hippocampal sections for immunohistochemistry were probed with antibodies against TLR4, ATF-3, IL8 and glial fibrillary acidic protein (GFAP), neuronal nuclear protein (NeuN) and the microglial marker HLA-DR. We observed abundant TLR4 gene expression to relate to seizure frequency per month. For ATF-3, we found an inverse correlation of expression to seizure frequency. Lower expression of IL8 was significantly associated with high seizure frequency. Further, we detected TLR4 expression in neurons and GFAP-positive astrocytes of pharmacoresistant mTLE patients. Only neurons of human epileptic hippocampi express ATF-3. IL8 was expressed in microglia and reactive astrocytes. Our results suggest a differential correlation of key inflammatory factor

  5. Epileptic Seizure Prediction based on Ratio and Differential Linear Univariate Features

    PubMed Central

    Rasekhi, Jalil; Mollaei, Mohammad Reza Karami; Bandarabadi, Mojtaba; Teixeira, César A.; Dourado, António

    2015-01-01

    Bivariate features, obtained from multichannel electroencephalogram recordings, quantify the relation between different brain regions. Studies based on bivariate features have shown optimistic results for tackling epileptic seizure prediction problem in patients suffering from refractory epilepsy. A new bivariate approach using univariate features is proposed here. Differences and ratios of 22 linear univariate features were calculated using pairwise combination of 6 electroencephalograms channels, to create 330 differential, and 330 relative features. The feature subsets were classified using support vector machines separately, as one of the two classes of preictal and nonpreictal. Furthermore, minimum Redundancy Maximum Relevance feature reduction method is employed to improve the predictions and reduce the number of false alarms. The studies were carried out on features obtained from 10 patients. For reduced subset of 30 features and using differential approach, the seizures were on average predicted in 60.9% of the cases (28 out of 46 in 737.9 h of test data), with a low false prediction rate of 0.11 h−1. Results of bivariate approaches were compared with those achieved from original linear univariate features, extracted from 6 channels. The advantage of proposed bivariate features is the smaller number of false predictions in comparison to the original 22 univariate features. In addition, reduction in feature dimension could provide a less complex and the more cost-effective algorithm. Results indicate that applying machine learning methods on a multidimensional feature space resulting from relative/differential pairwise combination of 22 univariate features could predict seizure onsets with high performance. PMID:25709936

  6. Lipopolysaccharide enhances glutaric acid-induced seizure susceptibility in rat pups: behavioral and electroencephalographic approach.

    PubMed

    Magni, Danieli Valnes; Souza, Mauren Assis; Oliveira, Ana Paula Ferreira; Furian, Ana Flávia; Oliveira, Mauro Schneider; Ferreira, Juliano; Santos, Adair Roberto Soares; Mello, Carlos Fernando; Royes, Luiz Fernando Freire; Fighera, Michele Rechia

    2011-02-01

    Glutaric acidemia type I (GA-I) is an inherited metabolic disease characterized by accumulation of glutaric acid (GA) and seizures. Considering that seizures are precipitated by common infections in children with GA-I, we investigated whether lipopolysaccharide (LPS) modifies GA-induced electrographic and neurochemical alterations in 21 days-old rats. The effect of LPS on convulsive behavior and electroencephalographic (EEG) alterations induced by GA (0.13; 0.4; 1.3 μmol/striatum) was determined in freely moving rats. After EEG recordings, we measured the levels of interleukin 1β (IL-1β) in GA-injected striatum. The injection of LPS (2mg/kg; i.p.) 6h before of GA administration, reduced the latency and increased the duration of seizures induced by GA (1.3 μmol/site). In addition, LPS administration increased IL-1β striatal levels, which positively correlated with total time in seizures. The intrastriatal injection of an IL-1β antibody (200 ng/2 μl) prevented the facilitation of GA-induced seizures by LPS. These data suggest that inflammatory processes during critical periods of development may decrease GA-induced seizure threshold. Copyright © 2010 Elsevier B.V. All rights reserved.

  7. Three-dimensional optical tomographic brain imaging during kainic-acid-induced seizures in rats

    NASA Astrophysics Data System (ADS)

    Bluestone, Avraham Y.; Sakamoto, Kenichi; Hielscher, Andreas H.; Stewart, Mark

    2005-04-01

    In this study, we explored the potential of diffuse optical tomography for brain oximetry and describe our efforts towards imaging hemodynamic changes in rat brains during kainic-acid (KA) induced seizures. Using electrophysiological techniques we first showed that KA induces a pronounced transient hypotension in urethane anesthetized rats that is coincident with seizure activity beginning in ventral and spreading to dorsal hippocampus. We observed sustained increases in vagus and sympathetic activity during generalized limbic seizure activity, which alters blood pressure regulation and heart rhythms. Subsequently, we used optical tomographic methods to study KA induced seizures in anesthetized animals to better define the hemodynamic cerebral vascular response. We observed a lateralized increase in deoxyhemoglobin after KA injection at the time when the blood pressure (BP) was decreased. By contrast, injection of phenylephrine produced a symmetric global increase in total hemoglobin. These findings indicate that our instrument is sensitive to the local hemodynamics, both in response to a global increase in blood pressure (phenylephrine injection) and a lateralized decrease in oxyhemoglobin produced by an asymmetric response to KA; a response that may be critically important for severe autonomic nervous system alterations during seizures. The results of this study provide the impetus for combining complimentary modalities, imaging and electrophysiological, to ultimately gain a better understanding of the underlying physiology of seizure activity in the rat.

  8. Parcel-based connectivity analysis of fMRI data for the study of epileptic seizure propagation.

    PubMed

    Tana, Maria Gabriella; Bianchi, Anna Maria; Sclocco, Roberta; Franchin, Tiziana; Cerutti, Sergio; Leal, Alberto

    2012-10-01

    The aim of this work is to improve fMRI Granger Causality Analysis (GCA) by proposing and comparing two strategies for defining the topology of the networks among which cerebral connectivity is measured and to apply fMRI GCA for studying epileptic seizure propagation. The first proposed method is based on information derived from anatomical atlas only; the other one is based on functional information and employs an algorithm of hierarchical clustering applied to fMRI data directly. Both methods were applied to signals recorded during seizures on a group of epileptic subjects and two connectivity matrices were obtained for each patient. The performances of the different parcellation strategies were evaluated in terms of their capability to recover information about the source and the sink of the network (i.e., the starting and the ending point of the seizure propagation). The first method allows to clearly identify the seizure onset in all patients, whereas the network sources are not so immediately recognizable when the second method was used. Nevertheless, results obtained using functional clustering do not contradict those obtained with the anatomical atlas and are able to individuate the main pattern of propagation. In conclusion, the way nodes are defined can influence the easiness of identification of the epileptogenic focus but does not produce contradictory results showing the effectiveness of proposed approach to formulate hypothesis about seizure propagation at least in the early phase of investigation.

  9. A comparative study of mismatch negativity (MMN) in epilepsy and non-epileptic seizures.

    PubMed

    Gene-Cos, Nuri; Pottinger, Richard; Barrett, Geoff; Trimble, Michael R; Ring, Howard A

    2005-12-01

    This study investigated mismatch negativity (MMN) differences between subjects with non-epileptic seizures (NES), subjects with epilepsy, and healthy controls. Event-related potentials (ERPs) were obtained from 14 patients with NES, 15 patients with epilepsy and 16 healthy control subjects. A conventional MMN procedure was used with a random sequence of 12% deviant tones (922 Hz) and 88% standard tones (1000 Hz). Subjects were instructed to ignore the tones delivered through headphones whilst reading a book. Significant differences in distribution of the mismatch negativity (MMN) in patients with NES compared to controls were obtained (F3, p

  10. Catastrophe theory enables moves to be detected towards and away from self-organization: the example of epileptic seizure onset.

    PubMed

    Cerf, Roger

    2006-06-01

    Macroscopic systems with many interacting subunits, when driven far from equilibrium, exhibit self-organization, for example when a pathological rhythm appears suddenly in an epileptic patient. Sudden changes occurring while conditions vary smoothly have, in cases of interest, underlying mathematics that are the subject of Thom's catastrophe theory. The assumption made herein that the system's state variables, akin to order parameters, reduce in practice to only one single real variable, ensures that the system derives from a potential function, and warrants recourse to the catastrophe theory. The order parameter is, furthermore, interpreted as a measure of the electropathophysiological activity in the brain, increasing monotonously with the degree of neuronal synchronism. With two neuronal influences, excitatory and inhibitory, as control parameters, the catastrophe is the archetypal cusp. Implementation of catastrophe theory leads to equations showing that fluctuations in a system's dynamics may be utilised for signalling steps precursory to oncoming catastrophes. Pre-seizure dynamics in epileptic patients exhibit steps towards and away from catastrophe; the steps away are interpreted in terms of homeostatic feedback, consequent on changing patterns of neuronal activity. A number of characteristics of epileptic seizures of differing types merely follow from the geometry of the cusp equilibrium surface. In particular, types of seizures are distinguished by their angle of final approach to onset in parameter space. The measurable parameters by which approach to catastrophe is characterized, may be of use in investigations of the organism's plasticity in epileptic patients, and in tests of therapeutic means for preventing seizures. There is no need to resort to a model, in the usual sense of the word, and therefore no differential equation needs to be set up.

  11. [Multicystic encephalopathy with frontal lobe-originated gelastic seizure, ipsilateral oculogyric crisis, and horizontal epileptic nystagmus: an autopsy case].

    PubMed

    Ohara, K; Morita, Y; Takauchi, S; Takeda, T; Hayashi, S

    1996-08-01

    Attacks of gelastic (laughing) seizure are usually reported as complex partial seizures of temporal lobe epilepsy and seizures associated with hypothalamic hamartomas, but are rarely reported as complex partial seizures of frontal lobe origin. We recently encountered a 29-year-old woman who had gelastic seizure attacks from age 17. She had shown severe mental retardation with cerebral palsy at 7 months, and entered precocious puberty at age 7. Attacks of gelastic seizure with ipsilateral adversive seizures, ipsilateral oculogyric crisis, and horizontal epileptic nystagmus were observed until her death at age 29. Each gelastic seizure lasted 1 to 10 minutes. Her laughing was very strong and loud. Interictal spikes were observed over the right fronto-parietal lobe, but no ictal spike was detected. The neuropathological examinations of her brain revealed no hypothalamic lesions such as hamartomas, gliosis, and distinct neuronal loss. Her brain was severely affected with multicystic encephalopathy, and the bilateral temporal lobe tissues were almost replaced by the cystic changes. The right frontal lobe and occipital lobe were not cystic. From the clinicopathological examinations, the focus of her gelastic seizure was considered to be of the right frontal origin. The hippocampus and parahippocampal gyrus are major components of the limbic system, which is involved in affective emotions. Although the right hippocampus and parahippocampal gyrus were completely lost, and those of the left hemisphere were almost completely lost, by the multicystic replacements in this case, the gelastic seizure attacks were evoked from right frontal origin. The frontal lobe may play an important role in motor expressions of laughing. The motor expressions of the loud and strong laughing may be one of the characteristic features of frontal lobe-originated gelastic seizure of this case.

  12. Chronic activity wheel running reduces the severity of kainic acid-induced seizures in the rat: possible role of galanin.

    PubMed

    Reiss, J I; Dishman, R K; Boyd, H E; Robinson, J K; Holmes, P V

    2009-04-17

    Studies in both humans and rodents suggest that exercise can be neuroprotective, but the mechanisms by which this occurs are still poorly understood. Three weeks of voluntary, physical activity in rats upregulates prepro-galanin messenger RNA levels in the locus coeruleus. Galanin is a neuropeptide extensively coexisting with norepinephrine that decreases neuronal hyperexcitability both in vivo and in vitro. Thus, exercise may diminish neural hyperexcitability through a galaninergic mechanism. The current experiments tested whether voluntary activity wheel running would protect against kainic acid-evoked seizures and whether galaninergic signaling is a necessary factor in this protection. In experiment 1, rats were given access to running wheels or remained sedentary for three weeks. After this period, rats received an intraperitoneal (i.p.) injection of 0, 7, 10 or 14 mg/kg kainic acid. Exercise decreased the severity of or eliminated seizure behaviors and hippocampal c-fos expression induced by kainic acid. In experiment 2, exercising or sedentary rats were injected intracerebroventricularly (i.c.v.) with 0.2 or 0.4 microg of kainic acid following either an injection of M-40 (a galanin receptor antagonist) or saline. Exercise decreased kainic acid-induced seizures at the 0.2 microg dose, and M-40 (6 nmol) decreased this effect. In contrast, there were no detectable differences between exercising and sedentary rats in behavior at the 0.4 microg dose. The results suggest that the protective effects of exercise against seizures are at least partially mediated by regulation of neural excitability through a process involving galanin.

  13. Weakened functional connectivity in patients with psychogenic non-epileptic seizures (PNES) converges on basal ganglia.

    PubMed

    Barzegaran, Elham; Carmeli, Cristian; Rossetti, Andrea O; Frackowiak, Richard S; Knyazeva, Maria G

    2016-03-01

    Psychogenic non-epileptic seizures (PNES) are involuntary paroxysmal events that are unaccompanied by epileptiform EEG discharges. We hypothesised that PNES are a disorder of distributed brain networks resulting from their functional disconnection.The disconnection may underlie a dissociation mechanism that weakens the influence of unconsciously presented traumatising information but exerts maladaptive effects leading to episodic failures of behavioural control manifested by psychogenic 'seizures'. To test this hypothesis, we compared functional connectivity (FC) derived from resting state high-density EEGs of 18 patients with PNES and 18 age-matched and gender-matched controls. To this end, the EEGs were transformed into source space using the local autoregressive average inverse solution. FC was estimated with a multivariate measure of lagged synchronisation in the θ, α and β frequency bands for 66 brain sites clustered into 18 regions. A multiple comparison permutation test was applied to deduce significant between-group differences in inter-regional and intraregional FC. The significant effect of PNES-a decrease in lagged FC between the basal ganglia and limbic, prefrontal, temporal, parietal and occipital regions-was found in the α band. We believe that this finding reveals a possible neurobiological substrate of PNES, which explains both attenuation of the effect of potentially disturbing mental representations and the occurrence of PNES episodes. By improving understanding of the aetiology of this condition, our results suggest a potential refinement of diagnostic criteria and management principles. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  14. Large-Scale Modeling of Epileptic Seizures: Scaling Properties of Two Parallel Neuronal Network Simulation Algorithms

    PubMed Central

    Pesce, Lorenzo L.; Lee, Hyong C.; Stevens, Rick L.

    2013-01-01

    Our limited understanding of the relationship between the behavior of individual neurons and large neuronal networks is an important limitation in current epilepsy research and may be one of the main causes of our inadequate ability to treat it. Addressing this problem directly via experiments is impossibly complex; thus, we have been developing and studying medium-large-scale simulations of detailed neuronal networks to guide us. Flexibility in the connection schemas and a complete description of the cortical tissue seem necessary for this purpose. In this paper we examine some of the basic issues encountered in these multiscale simulations. We have determined the detailed behavior of two such simulators on parallel computer systems. The observed memory and computation-time scaling behavior for a distributed memory implementation were very good over the range studied, both in terms of network sizes (2,000 to 400,000 neurons) and processor pool sizes (1 to 256 processors). Our simulations required between a few megabytes and about 150 gigabytes of RAM and lasted between a few minutes and about a week, well within the capability of most multinode clusters. Therefore, simulations of epileptic seizures on networks with millions of cells should be feasible on current supercomputers. PMID:24416069

  15. Psychogenic non-epileptic seizures: so-called psychiatric comorbidity and underlying defense mechanisms

    PubMed Central

    Beghi, Massimiliano; Negrini, Paola Beffa; Perin, Cecilia; Peroni, Federica; Magaudda, Adriana; Cerri, Cesare; Cornaggia, Cesare Maria

    2015-01-01

    In Diagnostic and Statistical Manual of Mental Disorders, fifth edition, psychogenic non-epileptic seizures (PNES) do not have a unique classification as they can be found within different categories: conversion, dissociative, and somatization disorders. The ICD-10, instead, considers PNES within dissociative disorders, merging the dissociative disorders and conversion disorders, although the underlying defense mechanisms are different. The literature data show that PNES are associated with cluster B (mainly borderline) personality disorders and/or to people with depressive or anxiety disorders. Defense mechanisms in patients with PNES with a prevalence of anxious/depressive symptoms are of “neurotic” type; their goal is to lead to a “split”, either vertical (dissociation) or horizontal (repression). The majority of patients with this type of PNES have alexithymia traits, meaning that they had difficulties in feeling or perceiving emotions. In subjects where PNES are associated with a borderline personality, in which the symbolic function is lost, the defense mechanisms are of a more archaic nature (denial). PNES with different underlying defense mechanisms have different prognoses (despite similar severity of PNES) and need usually a different treatment (pharmacological or psychological). Thus, it appears superfluous to talk about psychiatric comorbidity, since PNES are a different symptomatic expression of specific psychiatric disorders. PMID:26491330

  16. Identification of compounds with anti-convulsant properties in a zebrafish model of epileptic seizures

    PubMed Central

    Baxendale, Sarah; Holdsworth, Celia J.; Meza Santoscoy, Paola L.; Harrison, Michael R. M.; Fox, James; Parkin, Caroline A.; Ingham, Philip W.; Cunliffe, Vincent T.

    2012-01-01

    SUMMARY The availability of animal models of epileptic seizures provides opportunities to identify novel anticonvulsants for the treatment of people with epilepsy. We found that exposure of 2-day-old zebrafish embryos to the convulsant agent pentylenetetrazole (PTZ) rapidly induces the expression of synaptic-activity-regulated genes in the CNS, and elicited vigorous episodes of calcium (Ca2+) flux in muscle cells as well as intense locomotor activity. We then screened a library of ∼2000 known bioactive small molecules and identified 46 compounds that suppressed PTZ-inducedtranscription of the synaptic-activity-regulated gene fos in 2-day-old (2 dpf) zebrafish embryos. Further analysis of a subset of these compounds, which included compounds with known and newly identified anticonvulsant properties, revealed that they exhibited concentration-dependent inhibition of both locomotor activity and PTZ-induced fos transcription, confirming their anticonvulsant characteristics. We conclude that this in situ hybridisation assay for fos transcription in the zebrafish embryonic CNS is a robust, high-throughput in vivo indicator of the neural response to convulsant treatment and lends itself well to chemical screening applications. Moreover, our results demonstrate that suppression of PTZ-induced fos expression provides a sensitive means of identifying compounds with anticonvulsant activities. PMID:22730455

  17. Large-Scale Modeling of Epileptic Seizures: Scaling Properties of Two Parallel Neuronal Network Simulation Algorithms

    DOE PAGES

    Pesce, Lorenzo L.; Lee, Hyong C.; Hereld, Mark; ...

    2013-01-01

    Our limited understanding of the relationship between the behavior of individual neurons and large neuronal networks is an important limitation in current epilepsy research and may be one of the main causes of our inadequate ability to treat it. Addressing this problem directly via experiments is impossibly complex; thus, we have been developing and studying medium-large-scale simulations of detailed neuronal networks to guide us. Flexibility in the connection schemas and a complete description of the cortical tissue seem necessary for this purpose. In this paper we examine some of the basic issues encountered in these multiscale simulations. We have determinedmore » the detailed behavior of two such simulators on parallel computer systems. The observed memory and computation-time scaling behavior for a distributed memory implementation were very good over the range studied, both in terms of network sizes (2,000 to 400,000 neurons) and processor pool sizes (1 to 256 processors). Our simulations required between a few megabytes and about 150 gigabytes of RAM and lasted between a few minutes and about a week, well within the capability of most multinode clusters. Therefore, simulations of epileptic seizures on networks with millions of cells should be feasible on current supercomputers.« less

  18. Psychological and psychiatric aspects of psychogenic non-epileptic seizures (PNES): A systematic review.

    PubMed

    Brown, Richard J; Reuber, Markus

    2016-04-01

    Psychogenic non-epileptic seizures (PNES) are common in neurological settings and often associated with considerable distress and disability. The psychological mechanisms underlying PNES are poorly understood and there is a lack of well-established, evidence-based treatments. This paper advances our understanding of PNES by providing a comprehensive systematic review of the evidence pertaining to the main theoretical models of this phenomenon. Methodological quality appraisal and effect size calculation were conducted on one hundred forty empirical studies on the following aspects of PNES: life adversity, dissociation, anxiety, suggestibility, attentional dysfunction, family/relationship problems, insecure attachment, defence mechanisms, somatization/conversion, coping, emotion regulation, alexithymia, emotional processing, symptom modelling, learning and expectancy. Although most of the studies were only of low to moderate quality, some findings are sufficiently consistent to warrant tentative conclusions: (i) physical symptom reporting is elevated in patients with PNES; (ii) trait dissociation and exposure to traumatic events are common but not inevitable correlates of PNES; (iii) there is a mismatch between subjective reports of anxiety and physical arousal during PNES; and (iv) inconsistent findings in this area are likely to be attributable to the heterogeneity of patients with PNES. Empirical, theoretical and clinical implications are discussed.

  19. Fuzzy topological digital space and digital fuzzy spline of electroencephalography during epileptic seizures

    NASA Astrophysics Data System (ADS)

    Shah, Mazlina Muzafar; Wahab, Abdul Fatah

    2017-08-01

    Epilepsy disease occurs because of there is a temporary electrical disturbance in a group of brain cells (nurons). The recording of electrical signals come from the human brain which can be collected from the scalp of the head is called Electroencephalography (EEG). EEG then considered in digital format and in fuzzy form makes it a fuzzy digital space data form. The purpose of research is to identify the area (curve and surface) in fuzzy digital space affected by inside epilepsy seizure in epileptic patient's brain. The main focus for this research is to generalize fuzzy topological digital space, definition and basic operation also the properties by using digital fuzzy set and the operations. By using fuzzy digital space, the theory of digital fuzzy spline can be introduced to replace grid data that has been use previously to get better result. As a result, the flat of EEG can be fuzzy topological digital space and this type of data can be use to interpolate the digital fuzzy spline.

  20. Concurrent administration of the MMPI-2 and PAI in a sample of patients with epileptic or non-epileptic seizures: implications for an inpatient epilepsy monitoring unit.

    PubMed

    Gale, Shawn D; Hill, Stacy W

    2012-10-01

    The Minnesota Multiphasic Personality Inventory-second edition (MMPI-2) and the Personality Assessment Inventory (PAI) are commonly used in the epilepsy monitoring unit (EMU) to evaluate personality characteristics and mood-related symptoms in those individuals being evaluated for epileptic seizures (ES) or psychogenic non-epileptic seizures (PNES). A direct comparison of these measures through concurrent administration to the same group has not been carried out. Both measures were administered to 40 patients (17 ES and 23 PNES). Logistic regression suggested the optimal predictive model for EMU discharge diagnosis included subscales from each measure, which outperformed either measure separately. Combining the conversion (SOM-C) and health concerns (SOM-H) subscales from the PAI and the hysteria subscale (Hy) from the MMPI-2 resulted in 85% overall classification accuracy, 86.7% sensitivity, and 82.4% specificity. Variability in the literature regarding the predictive utility of these measures may stem from the possibility that they measure different aspects of PNES. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Enhanced seizures and hippocampal neurodegeneration following kainic acid-induced seizures in metallothionein-I + II-deficient mice.

    PubMed

    Carrasco, J; Penkowa, M; Hadberg, H; Molinero, A; Hidalgo, J

    2000-07-01

    Metallothioneins (MTs) are major zinc binding proteins in the CNS that could be involved in the control of zinc metabolism as well as in protection against oxidative stress. Mice lacking MT-I and MT-II (MT-I + II deficient) because of targeted gene inactivation were injected with kainic acid (KA), a potent convulsive agent, to examine the neurobiological importance of these MT isoforms. At 35 mg/kg KA, MT-I + II deficient male mice showed a higher number of convulsions and a longer convulsion time than control mice. Three days later, KA-injected mice showed gliosis and neuronal injury in the hippocampus. MT-I + II deficiency decreased both astrogliosis and microgliosis and potentiated neuronal injury and apoptosis as shown by terminal deoxynucleotidyl transferase-mediated in situ end labelling (TUNEL), detection of single stranded DNA (ssDNA) and by increased interleukin-1beta-converting enzyme (ICE) and caspase-3 levels. Histochemically reactive zinc in the hippocampus was increased by KA to a greater extent in MT-I + II-deficient compared with control mice. KA-induced seizures also caused increased oxidative stress, as suggested by the malondialdehyde (MDA) and protein tyrosine nitration (NITT) levels and by the expression of MT-I + II, nuclear factor-kappaB (NF-kappaB), and Cu/Zn-superoxide dismutase (Cu/Zn-SOD). MT-I + II deficiency potentiated the oxidative stress caused by KA. Both KA and MT-I + II deficiency significantly affected the expression of MT-III, granulocyte-macrophage colony stimulating factor (GM-CSF) and its receptor (GM-CSFr). The present results indicate MT-I + II as important for neuron survival during KA-induced seizures, and suggest that both impaired zinc regulation and compromised antioxidant activity contribute to the observed neuropathology of the MT-I + II-deficient mice.

  2. Classification of epileptic seizures using wavelet packet log energy and norm entropies with recurrent Elman neural network classifier.

    PubMed

    Raghu, S; Sriraam, N; Kumar, G Pradeep

    2017-02-01

    Electroencephalogram shortly termed as EEG is considered as the fundamental segment for the assessment of the neural activities in the brain. In cognitive neuroscience domain, EEG-based assessment method is found to be superior due to its non-invasive ability to detect deep brain structure while exhibiting superior spatial resolutions. Especially for studying the neurodynamic behavior of epileptic seizures, EEG recordings reflect the neuronal activity of the brain and thus provide required clinical diagnostic information for the neurologist. This specific proposed study makes use of wavelet packet based log and norm entropies with a recurrent Elman neural network (REN) for the automated detection of epileptic seizures. Three conditions, normal, pre-ictal and epileptic EEG recordings were considered for the proposed study. An adaptive Weiner filter was initially applied to remove the power line noise of 50 Hz from raw EEG recordings. Raw EEGs were segmented into 1 s patterns to ensure stationarity of the signal. Then wavelet packet using Haar wavelet with a five level decomposition was introduced and two entropies, log and norm were estimated and were applied to REN classifier to perform binary classification. The non-linear Wilcoxon statistical test was applied to observe the variation in the features under these conditions. The effect of log energy entropy (without wavelets) was also studied. It was found from the simulation results that the wavelet packet log entropy with REN classifier yielded a classification accuracy of 99.70 % for normal-pre-ictal, 99.70 % for normal-epileptic and 99.85 % for pre-ictal-epileptic.

  3. [Differences in the management of epileptic seizures between the elderly and younger adults treated in an emergency department].

    PubMed

    Fernandez-Alonso, C; Matias-Guiu, J A; Castillo, C; Fuentes-Ferrer, M E; Gonzalez-Del Castillo, J; Martin-Sanchez, F J

    2014-09-16

    To study the differences in the management and short-term outcomes of adult patients treated in an emergency service for epileptic seizures, depending on whether they are elderly or not. This observational retrospective cohort study included all the patients over 15 years of age who were treated for epileptic seizures in the hospital emergency department of a tertiary and university hospital between 1 September and 31 December 2011. The variables collected were acute treatment and follow-up at 30 days after the index event in the emergency department. Altogether the sample included 114 patients with a mean age of 46.4 years (interquartile range: 32.6-74.3 years), of whom 34 (29.8%) were aged 65 years or over. The group of elderly persons presented a first epileptic episode (p = 0.001), with unknown precipitating factor (p = 0.02), structural causation (p < 0.001), a computerised tomography scan carried out in the emergency department (p < 0.001), establishment of preventive antiepileptic drug regime in the emergency department (p = 0.001) and a prolonged hospital stay (p = 0.002) more frequently than the younger adults. Following a multivariable analysis, being elderly was an independent factor associated to a greater need for specific complementary tests (odds ratio = 3.7; 95% confidence interval = 1.3-10.3) and pharmacological intervention in the emergency department (odds ratio = 3.3; 95% confidence interval = 1.4-8.1). There were no statistically significant differences in the results between the two groups at 30 days in terms of return visits (p = 0.316) and mortality (p = 0.087). The treatment of epileptic seizures in the elderly in the emergency department is complex, if compared with younger adults, thereby making it necessary to use a greater amount of hospital resources.

  4. Similarities and differences of acute nonconvulsive seizures and other epileptic activities following penetrating and ischemic brain injuries in rats.

    PubMed

    Lu, Xi-Chun May; Mountney, Andrea; Chen, Zhiyong; Wei, Guo; Cao, Ying; Leung, Lai Yee; Khatri, Vivek; Cunningham, Tracy; Tortella, Frank C

    2013-04-01

    The similarities and differences between acute nonconvulsive seizures (NCS) and other epileptic events, for example, periodic epileptiform discharges (PED) and intermittent rhythmic delta activities (IRDA), were characterized in rat models of penetrating and ischemic brain injuries. The NCS were spontaneously induced by either unilateral frontal penetrating ballistic-like brain injury (PBBI) or permanent middle cerebral artery occlusion (pMCAO), and were detected by continuous electroencephalogram (EEG) monitoring begun immediately after the injury and continued for 72 h or 24 h, respectively. Analysis of NCS profiles (incidence, frequency, duration, and time distribution) revealed a high NCS incidence in both injury models. The EEG waveform expressions of NCS and PED exhibited intrinsic variations that resembled human electrographic manifestations of post-traumatic and post-ischemic ictal and inter-ictal events, but these waveform variations were not distinguishable between the two types of brain injury. However, the NCS after pMCAO occurred more acutely and intensely (latency=0.6 h, frequency=25 episodes/rat) compared with the PBBI-induced NCS (latency=24 h, frequency=10 episodes/rat), such that the most salient features differentiating post-traumatic and post-ischemic NCS were the intensity and time distribution of the NCS profiles. After pMCAO, nearly 50% of the seizures occurred within the first 2 h of injury, whereas after PBBI, NCS occurred sporadically (0-5%/h) throughout the 72 h recording period. The PED were episodically associated with NCS. By contrast, the IRDA appeared to be independent of other epileptic events. This study provided comprehensive comparisons of post-traumatic and post-ischemic epileptic profiles. The identification of the similarities and differences across a broad spectrum of epileptic events may lead to differential strategies for post-traumatic and post-stroke seizure interventions.

  5. Epileptic seizures and spirit possession in Haitian culture: report of four cases and review of the literature.

    PubMed

    Cavanna, A E; Cavanna, S; Cavanna, A

    2010-09-01

    Epileptic seizures have historically been associated with religious beliefs in spirit possession. These attitudes and misconceptions about epilepsy still flourish in developing countries as byproducts of specific sociocultural environments. This article presents a case series of four Haitian patients with epilepsy whose seizures were initially attributed to Voodoo spirit possession. All patients reported ictal experiential phenomena (epigastric aura, ictal fear, depersonalization, and derealization symptoms) followed by complete loss of consciousness. Electroclinical investigations revealed a temporal lobe focus. We review the existing literature on attitudes toward seizures within the Haitian culture and discuss the link between religion and epilepsy, highlighting the possible detrimental influence of specific traditional belief systems on the appropriate diagnosis and treatment of patients with epilepsy. Copyright © 2010 Elsevier Inc. All rights reserved.

  6. [Neurogenesis of dentate granule cells following kainic acid induced seizures in immature rats].

    PubMed

    Wang, Yan-Ling; Sun, Ruo-Peng; Lei, Ge-Fei; Wang, Ji-Wen; Guo, Shu-Hua

    2004-08-01

    Data accumulated over the past years have led to widespread recognition that neurogenesis, the emergence of new neurons, persists in the hippocampal dentate gyrus of the adult mammalian brain, and can be increased by seizures in multiple models. Also, aberrant reorganization of dentate granule cell axons, the mossy fiber sprouting, occurs in human temporal lobe epilepsy and rodent epilepsy models. However a number of studies suggest that the immature brain is less vulnerable to the morphologic alteration of hippocampus after seizures. The goal of this study was to determine whether the seizures can induce dentate granule cell neurogenesis and mossy fiber sprouting in the immature rat. Seizures was elicited by unilateral microinfusion of kainic acid (KA, 1 micro g) into the amygdula at postnatal day 15 (P15). Rat pups were given bromodeoxyuridine (BrdU) intraperitoneally on day 5 after KA administration and killed 7 d or 21 d later. The brains were processed for BrdU mitotic labeling combined with double-label immunohistochemistry using neuron-specific, early differentiation marker TuJ1 (betaIII tubulin) or granule-specific marker CaBP (calcium-binding protein calbindin D28k) as well as glia-specific marker GFAP (glial fibrillary acidic protein). Mossy fiber sprouting in intermolecular layer and CA3 subfield was assessed in Timm-stained sections both 1 month and 3 months after KA administration by using a rating scale and density measurement. The dentate BrdU-immunoreactive cells of the KA-treated rats increased significantly compared with those of control rats on day 7 and 21 after BrdU administration (7 d: 244 +/- 15 vs. 190 +/- 10; 21 d: 218 +/- 19 vs. 133 +/- 12, P < 0.05). Approximately 80.2% and 78.7% of BrdU-labeled cells coexpressed TuJ1 in KA-treated rats and control rats on day 7 after BrdU respectively (P > 0.05). On 21 d after BrdU, 60.2% and 58.2% of dentate BrdU-labeled cells coexpressed GaBP in KA-treated rats and control rats respectively (P > 0

  7. [Consensus clinical practice guidelines of the Andalusian Epilepsy Society: therapeutic recommendations when dealing with a first epileptic seizure and in epileptic status].

    PubMed

    Mercadé-Cerda, J M; Sánchez-Alvarez, J C; Galán-Barranco, J M; Moreno-Alegre, V; Serrano-Castro, P J; Cañadillas-Hidalgo, F M

    Most epileptic seizures are brief and self-limiting, but sometimes they can last longer than expected and this entails (in the case of generalised seizures) a high risk of morbidity and mortality, which increases as they get longer. This severity justifies the need to draw up a set of consensus-based practice guidelines based on implicit evidence, to use Liberati's nomenclature, concerning aspects related to the recommended therapeutic management of a patient with prolonged seizures who is being attended in an emergency department. A selective search was conducted on PubMed-Medline for scientific information related to the subject using scientific evidence filters. This search was completed in other scientific evidence search engines, such as Tripdatabase, Biblioteca Cochrane Plus or DARE. The selected references were analysed and discussed by the authors, and the available evidence and any recommendations that could be drawn from it were collected. The search revealed the existence of 33 primary documents and six practice guidelines or protocols related with the topic under study. The recommendations were inserted in the text explicitly. The therapeutic protocol must be started when faced with any seizures that last more than five minutes. First, steps must be taken to ensure proper respiratory and cardiocirculatory functioning, and then fast-acting antiepileptic drugs are administered intravenously and in high doses until the cause is identified and controlled. Due to their lower level of morbidity and mortality, prolonged non-convulsive seizures do not generally require therapy that is so vigorous and with such a high risk of complications.

  8. Resting-state networks and dissociation in psychogenic non-epileptic seizures.

    PubMed

    van der Kruijs, Sylvie J M; Jagannathan, Sridhar R; Bodde, Nynke M G; Besseling, René M H; Lazeron, Richard H C; Vonck, Kristl E J; Boon, Paul A J M; Cluitmans, Pierre J M; Hofman, Paul A M; Backes, Walter H; Aldenkamp, Albert P; Jansen, Jacobus F A

    2014-07-01

    Psychogenic non-epileptic seizures (PNES) are epilepsy-like episodes which have an emotional rather than organic origin. Although PNES have often been related to the process of dissociation, the psychopathology is still poorly understood. To elucidate underlying mechanisms, the current study applied independent component analysis (ICA) on resting-state fMRI to investigate alterations within four relevant networks, associated with executive, fronto-parietal, sensorimotor, and default mode activation, and within a visual network to examine specificity of between-group differences. Twenty-one patients with PNES without psychiatric or neurologic comorbidities and twenty-seven healthy controls underwent resting-state functional MR imaging at 3.0T (Philips Achieva). Additional neuropsychological testing included Raven's Matrices test and dissociation questionnaires. ICA with dual regression was used to identify resting-state networks in all participants, and spatial maps of the networks of interest were compared between patients and healthy controls. Patients displayed higher dissociation scores, lower cognitive performance and increased contribution of the orbitofrontal, insular and subcallosal cortex in the fronto-parietal network; the cingulate and insular cortex in the executive control network; the cingulate gyrus, superior parietal lobe, pre- and postcentral gyri and supplemental motor cortex in the sensorimotor network; and the precuneus and (para-) cingulate gyri in the default-mode network. The connectivity strengths within these regions of interest significantly correlated with dissociation scores. No between-group differences were found within the visual network, which was examined to determine specificity of between-group differences. PNES patients displayed abnormalities in several resting-state networks that provide neuronal correlates for an underlying dissociation mechanism. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Psychogenic non-epileptic seizures and functional motor symptoms: A common phenomenology?

    PubMed

    Demartini, Benedetta; Goeta, Diana; Barbieri, Valentina; Ricciardi, Lucia; Canevini, Maria Paola; Turner, Katherine; D'Agostino, Armando; Romito, Luigi; Gambini, Orsola

    2016-09-15

    Recent studies have attempted to compare patients affected by psychogenic non-epileptic seizures (PNES) to patients affected by functional motor symptoms (FMS) from a demographic, clinical and psychological perspective. Nevertheless, results are quite controversial and significant conclusions have not been drawn. The aim of our study was to evaluate the phenomenology of psychology of the two groups assessing levels of dissociation and its subcomponents, alexithymia and interoceptive sensitivity in patients with PNES and in patients with FMS. We conducted a cross-sectional study recruiting 20 patients with PNES, 20 patients with FMS and 20 healthy subjects as a control group. All subjects underwent: Dissociative Experience Scale (DES), Somatoform Dissociation Questionnaire (SDQ-20), Cambridge Depersonalization Scale (CDS), Toronto Alexithymia Scale (TAS-20), Hamilton Rating Scale for Depression (HAM-D), Hamilton Rating Scale for anxiety (HAM-A), heart beat detection task. Our data suggest that PNES group scored significantly higher than the healthy control group on a measure of detachment (CDS). Also at the DES, a measure of psychoform dissociation, PNES patients scored significantly higher than healthy subjects. On the other hand patients affected by FMS scored significantly higher than the healthy control group on the SDQ but they did not report more experiences of detachment on the CDS. Patients affected by PNES and FMS were significantly more alexithymic than healthy controls, with a third of them scoring >61 on the TAS-20. Our data show different psychological mechanisms underlying patients with PNES and patients with FMS. This might lead also to potential implications for treatment. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Hidden focal EEG seizures during prolonged suppressions and high-amplitude bursts in early infantile epileptic encephalopathy.

    PubMed

    Al-Futaisi, Amna; Banwell, Brenda; Ochi, Ayako; Hew, Justine; Chu, Bill; Oishi, Makoto; Otsubo, Hiroshi

    2005-05-01

    We report on a 27-month-old female with atypical early infantile epileptic encephalopathy (EIEE), who developed tonic spasms, partial seizures and myoclonic jerks along with episodic bradycardia at 5 days. We recorded digital electroencephalography (EEG) using either an 11-channel neonatal montage or 19 channel scalp electrodes, at 200 Hz sampling rate, and a single reference for a minimum of 30 min. At 18 days EEG showed suppression-burst (SB) patterns during wakefulness and sleep. Tonic spasms concomitant with bursts recorded as brief, low-amplitude fast waves. EEG at 8 months showed increased amplitude of bursts to 1 mV and extension of suppression periods to 65 s. By increasing recording sensitivity, we detected focal epileptiform discharges of slow rhythmic sharp and slow waves building to 30 microV during suppression periods. Status epilepticus occurred at 16 months. EEG at 27 months returned to the previous SB pattern with rare partial seizures. This report is the first to demonstrate clinically silent focal EEG seizures during prolonged suppression periods in atypical EIEE by off-line digital EEG. Digital EEG sensitivity can reveal covert electrical activity during suppression periods in epileptic neonates and infants.

  11. Effects of Vitamin E on seizure frequency, electroencephalogram findings, and oxidative stress status of refractory epileptic patients.

    PubMed

    Mehvari, Jafar; Motlagh, Fataneh Gholami; Najafi, Mohamad; Ghazvini, Mohammad Reza Aghaye; Naeini, Amirmansour Alavi; Zare, Mohamad

    2016-01-01

    Oxidative stress has been a frequent finding in epileptic patients receiving antiepileptic drugs (AEDs). In this study, the influence of Vitamin E on the antiseizure activity and redox state of patients treated with carbamazepine, sodium valproate, and levetiracetam has been investigated. This double-blind, placebo-controlled trial was carried out on 65 epileptic patients with chronic antiepileptic intake. The subjects received 400 IU/day of Vitamin E or placebo for 6 months. Seizure frequency, electroencephalogram (EEG), and redox state markers were measured monthly through the study. Total antioxidant capacity, catalase and glutathione were significantly higher in Vitamin E received group compared with controls (P < 0.05) whereas malodialdehyde levels did not differ between two groups (P < 0.07). Vitamin E administration also caused a significant decrease in the frequency of seizures (P < 0.001) and improved EEG findings (P = 0.001). Of 32 patients in case group, the positive EEG decreased in 16 patients (50%) whereas among 33 patients in control group only 4 patients (12.1%) showed decreased positive EEG. The results of this preliminary study indicate that coadministration of antioxidant Vitamin E with AEDs improves seizure control and reduces oxidative stress.

  12. Effects of Vitamin E on seizure frequency, electroencephalogram findings, and oxidative stress status of refractory epileptic patients

    PubMed Central

    Mehvari, Jafar; Motlagh, Fataneh Gholami; Najafi, Mohamad; Ghazvini, Mohammad Reza Aghaye; Naeini, Amirmansour Alavi; Zare, Mohamad

    2016-01-01

    Background: Oxidative stress has been a frequent finding in epileptic patients receiving antiepileptic drugs (AEDs). In this study, the influence of Vitamin E on the antiseizure activity and redox state of patients treated with carbamazepine, sodium valproate, and levetiracetam has been investigated. Materials and Methods: This double-blind, placebo-controlled trial was carried out on 65 epileptic patients with chronic antiepileptic intake. The subjects received 400 IU/day of Vitamin E or placebo for 6 months. Seizure frequency, electroencephalogram (EEG), and redox state markers were measured monthly through the study. Results: Total antioxidant capacity, catalase and glutathione were significantly higher in Vitamin E received group compared with controls (P < 0.05) whereas malodialdehyde levels did not differ between two groups (P < 0.07). Vitamin E administration also caused a significant decrease in the frequency of seizures (P < 0.001) and improved EEG findings (P = 0.001). Of 32 patients in case group, the positive EEG decreased in 16 patients (50%) whereas among 33 patients in control group only 4 patients (12.1%) showed decreased positive EEG. Conclusion: The results of this preliminary study indicate that coadministration of antioxidant Vitamin E with AEDs improves seizure control and reduces oxidative stress. PMID:27099849

  13. Combined effects of epileptic seizure and phenobarbital induced overexpression of P-glycoprotein in brain of chemically kindled rats

    PubMed Central

    Jing, Xinyue; Liu, Xiang; Wen, Tao; Xie, Shanshan; Yao, Dan; Liu, Xiaodong; Wang, Guangji; Xie, Lin

    2010-01-01

    Background and purpose: The multidrug resistance of epilepsy may result from the overexpression of P-glycoprotein, but the mechanisms are unclear. We investigated whether the overexpression of P-glycoprotein in the brains of subjects with pharmacoresistant epilepsy resulted from both drug effects and seizure activity. Experimental approach: Kindled rats were developed by injecting a subconvulsive dose of pentylenetetrazole (33 mg·kg−1·day−1, i.p.) for 28 days. Groups were then treated with an oral dose of phenobarbital (45 mg·kg−1·day−1) for 40 days. In accord with behavioural observations, P-glycoprotein activity in brain was assessed using brain-to-plasma concentration ratios of rhodamine 123. P-glycoprotein levels in the brain regions were further evaluated using RT-PCR and Western blot analysis. The distribution of phenobarbital in the brain was assessed by measuring phenobarbital concentrations 1 h following its oral administration. Key results: The kindling significantly increased P-glycoprotein activity and expression. Good associations were found among P-glycoprotein activity, expression and phenobarbital concentration in the hippocampus. Short-term treatment with phenobarbital showed good anti-epileptic effect; the maximum effect occurred on day 14 when overexpression of P-glycoprotein was reversed. Continuous treatment with phenobarbital had a gradually reduced anti-epileptic effect and on day 40, phenobarbital exhibited no anti-epileptic effect; this was accompanied by both a re-enhancement of P-glycoprotein expression and decreased phenobarbital concentration in the hippocampus. P-glycoprotein function and expression were also increased in age-matched normal rats treated with phenobarbital. Conclusions and implications: The overexpression of P-glycoprotein in the brain of subjects with pharmacoresistant epilepsy is due to a combination of drug effects and epileptic seizures. PMID:20233212

  14. Anterior thalamic nuclei deep brain stimulation reduces disruption of the blood-brain barrier, albumin extravasation, inflammation and apoptosis in kainic acid-induced epileptic rats.

    PubMed

    Chen, Ying-Chuan; Zhu, Guan-Yu; Wang, Xiu; Shi, Lin; Du, Ting-Ting; Liu, De-Feng; Liu, Yu-Ye; Jiang, Yin; Zhang, Xin; Zhang, Jian-Guo

    2017-09-18

    Objective The therapeutic efficacy of anterior thalamic nuclei deep brain stimulation (ATN-DBS) against seizures has been largely accepted; however, the effects of ATN-DBS on disruption of the blood-brain barrier (BBB), albumin extravasation, inflammation and apoptosis still remain unclear. Methods Rats were distributed into four treatment groups: physiological saline (PS, N = 12), kainic acid (KA, N = 12), KA-sham-DBS (N = 12) and KA-DBS (N = 12). Seizures were monitored using video-electroencephalogram (EEG). One day after surgery, all rats were sacrificed. Then, samples were prepared for quantitative real-time PCR (qPCR), western blot, immunofluorescence (IF) staining, and transmission electron microscopy to evaluate the disruption of the BBB, albumin extravasation, inflammation, and apoptosis. Result Because of the KA injection, the disruption of the BBB, albumin extravasation, inflammation and apoptosis were more severe in the KA and the KA-sham-DBS groups compared to the PS group (all Ps < 0.05 or < 0.01). The ideal outcomes were observed in the KA-DBS group. ATN-DBS produced a 46.3% reduction in seizure frequency and alleviated the disruption of the BBB, albumin extravasation, inflammatory reaction and apoptosis in comparison to the KA-sham-DBS group (all Ps < 0.05 or < 0.01). Conclusion (1) Seizures can be reduced using ATN-DBS in the epileptogenic stage. (2) ATN-DBS can reduce the disruption of the BBB and albumin extravasation. (3) ATN-DBS has an anti-inflammatory effect in epileptic models.

  15. Counterpoint to “What Is an Epileptic Seizure?” By D’Ambrosio and Miller

    PubMed Central

    Dudek, F Edward; Bertram, Edward H

    2010-01-01

    D’Ambrosio and Miller argue that brief (i.e., one to a few seconds), rhythmic electrographic events accompanied by behavioral arrest, which they have observed in rats after lateral fluid percussion (i.e., in an animal model of traumatic brain injury), should be considered seizures in this model of posttraumatic epilepsy (1). A counter argument is that these events are not characteristic of the seizures seen clinically in posttraumatic epilepsy or in other forms of acquired epilepsy. Furthermore, several types of brief, rhythmic activity can be recorded in the electroencephalogram (EEG) of animals and humans without epilepsy. One cannot exclude the possibility that such events represent normal electrical activity, which may (or even may not) occur more often after brain injury. Thus, caution is required. In this counterpoint to “What Is an Epileptic Seizure?” by D’Ambrosio and Miller, the assertion is made that experimental studies on animal models of acquired epilepsy that claim electrographic events to be seizures, when the possibility exists that they may not be seizures characteristic of human acquired epilepsy, could be counterproductive, since research resources could be focused on animal models that may not actually demonstrate acquired epilepsy. PMID:20697504

  16. Optogenetic activation of VGLUT2-expressing excitatory neurons blocks epileptic seizure-like activity in the mouse entorhinal cortex

    PubMed Central

    Yekhlef, Latefa; Breschi, Gian Luca; Taverna, Stefano

    2017-01-01

    We investigated whether an anti-epileptic effect is obtained by selectively activating excitatory neurons expressing ChR2 under the promoter for the synaptic vesicular glutamate transporter 2 (VGLUT2). VGLUT2-expressing cells were optically stimulated while local field potential and whole-cell patch-clamp recordings were performed in mouse entorhinal cortical slices perfused with the proconvulsive compound 4-aminopyridine (4-AP). In control conditions, blue light flashes directly depolarized the majority of putative glutamatergic cells, which in turn synaptically excited GABAergic interneurons. During bath perfusion with 4-AP, photostimuli triggered a fast EPSP-IPSP sequence which was often followed by tonic-clonic seizure-like activity closely resembling spontaneous ictal discharges. The GABAA-receptor antagonist gabazine blocked the progression of both light-induced and spontaneous seizures. Surprisingly, prolonged photostimuli delivered during ongoing seizures caused a robust interruption of synchronous discharges. Such break was correlated with a membrane potential depolarization block in principal cells, while putative GABAergic interneurons changed their firing activity from a burst-like to an irregular single-spike pattern. These data suggest that photostimulation of glutamatergic neurons triggers seizure-like activity only in the presence of an intact GABAergic transmission and that selectively activating the same glutamatergic cells robustly interrupts ongoing seizures by inducing a strong depolarization block, resulting in the disruption of paroxysmal burst-like firing. PMID:28230208

  17. Independent Neuronal Origin of Seizures and Behavioral Comorbidities in an Animal Model of a Severe Childhood Genetic Epileptic Encephalopathy

    PubMed Central

    Asinof, Samuel K.; Sukoff Rizzo, Stacey J.; Buckley, Alexandra R.; Beyer, Barbara J.; Letts, Verity A.; Frankel, Wayne N.; Boumil, Rebecca M.

    2015-01-01

    The childhood epileptic encephalopathies (EE’s) are seizure disorders that broadly impact development including cognitive, sensory and motor progress with severe consequences and comorbidities. Recently, mutations in DNM1 (dynamin 1) have been implicated in two EE syndromes, Lennox-Gastaut Syndrome and Infantile Spasms. Dnm1 encodes dynamin 1, a large multimeric GTPase necessary for activity-dependent membrane recycling in neurons, including synaptic vesicle endocytosis. Dnm1Ftfl or “fitful” mice carry a spontaneous mutation in the mouse ortholog of DNM1 and recapitulate many of the disease features associated with human DNM1 patients, providing a relevant disease model of human EE’s. In order to examine the cellular etiology of seizures and behavioral and neurological comorbidities, we engineered a conditional Dnm1Ftfl mouse model of DNM1 EE. Observations of Dnm1 Ftfl/flox mice in combination with various neuronal subpopulation specific cre strains demonstrate unique seizure phenotypes and clear separation of major neurobehavioral comorbidities from severe seizures associated with the germline model. This demonstration of pleiotropy suggests that treating seizures per se may not prevent severe comorbidity observed in EE associated with dynamin-1 mutations, and is likely to have implications for other genetic forms of EE. PMID:26125563

  18. Total corpus callosotomy for epileptic spasms after acute encephalopathy with biphasic seizures and late reduced diffusion (AESD) in a case with tuberous sclerosis complex.

    PubMed

    Okanishi, Tohru; Fujimoto, Ayataka; Motoi, Hirotaka; Kanai, Sotaro; Nishimura, Mitsuyo; Yamazoe, Tomohiro; Takagi, Atsushi; Yamamoto, Takamichi; Enoki, Hideo

    2016-12-03

    Corpus callosotomy is a palliative therapy for refractory epilepsy, including West syndrome, without a resectable epileptic focus. The surgical outcome of corpus callosotomy is relatively favorable in cryptogenic (non-lesional) West syndrome. Tuberous sclerosis complex (TSC) is a disorder that frequently leads to the development of refractory seizures by multiple cortical tubers. The multiple cortical tubers cause multiple or wide epileptic networks in these cases. Most of West syndrome cases in TSC with multiple tubers need additional resective surgery after corpus callosotomy. We describe a case of TSC in a boy aged 4years and 8months. He had multiple cortical tubers on his brain and developed epileptic spasms. The seizures were controlled with valproate. At the age of 1year and 4months, he presented with acute encephalopathy with biphasic seizures and late reduced diffusion (AESD), and had relapsed epileptic spasms one month after the onset of the encephalopathy. The seizures were refractory to multiple antiepileptic drugs. A total corpus callosotomy was performed at the age of 3years and 8months. The patient did not show any seizures after the surgery. During 12months of the follow-up, the patient was free from any seizures. Even in cases of symptomatic WS with multiple lesions, total corpus callosotomy may be a good strategy if the patients have secondary diffuse brain insults.

  19. Influence analysis for high-dimensional time series with an application to epileptic seizure onset zone detection

    PubMed Central

    Flamm, Christoph; Graef, Andreas; Pirker, Susanne; Baumgartner, Christoph; Deistler, Manfred

    2013-01-01

    Granger causality is a useful concept for studying causal relations in networks. However, numerical problems occur when applying the corresponding methodology to high-dimensional time series showing co-movement, e.g. EEG recordings or economic data. In order to deal with these shortcomings, we propose a novel method for the causal analysis of such multivariate time series based on Granger causality and factor models. We present the theoretical background, successfully assess our methodology with the help of simulated data and show a potential application in EEG analysis of epileptic seizures. PMID:23354014

  20. AMPA Receptor antagonist NBQX attenuates later-life epileptic seizures and autistic-like social deficits following neonatal seizures

    PubMed Central

    Lippman-Bell, Jocelyn J.; Rakhade, Sanjay N.; Klein, Peter M.; Obeid, Makram; Jackson, Michele C.; Joseph, Annelise; Jensen, Frances E.

    2013-01-01

    Summary Purpose To determine whether AMPA receptor (AMPAR) antagonist NBQX can prevent early mTOR pathway activation and long-term sequelae following neonatal seizures in rats, including later-life spontaneous recurrent seizures, CA3 mossy fiber sprouting, and autistic-like social deficits. Methods Long-Evans rats experienced hypoxia-induced neonatal seizures (HS) at postnatal day (P)10. NBQX (20 mg/kg) was administered immediately following HS (every 12h x 4 doses). 12h post-HS, we assessed mTOR activation marker phosphorylated p70-S6 kinase (p-p70S6K) in hippocampus and cortex of vehicle (HS+V) or NBQX-treated post-HS rats (HS+N) versus littermate controls (C+V). Spontaneous seizure activity was compared between groups by epidural cortical electroencephalography (EEG) at P70-100. Aberrant mossy fiber sprouting was measured using Timm staining. Finally, we assessed behavior between P30-38. Key findings Post-seizure NBQX treatment significantly attenuated seizure-induced increases in p-P70S6K in the hippocampus (p<0.01) and cortex (p<0.001). While spontaneous recurrent seizures increased in adulthood in HS+V rats compared to controls (3.22±1seizures/hour; p=0.03), NBQX significantly attenuated later-life seizures (0.14±0.1 seizures/hour; p=0.046). HS+N rats showed less aberrant mossy fiber sprouting (115±8.0%) than vehicle-treated post-HS rats (174±10%, p=0.004), compared to controls (normalized to 100%). Finally, NBQX treatment prevented alterations in later-life social behavior; post-HS rats showed significantly decreased preference for a novel over a familiar rat (71.0±12 sec) compared to controls (99.0±15.6 sec; p<0.01), while HS+N rats showed social novelty preference similar to controls (114.3±14.1 sec). Significance Brief NBQX administration during the 48 hours post-seizure in P10 Long-Evans rats suppresses transient mTOR pathway activation and attenuates spontaneous recurrent seizures, social preference deficits and mossy fiber sprouting observed in

  1. The similarities between the hallucinations associated with the partial epileptic seizures of the occipital lobe and ball lightning observations

    NASA Astrophysics Data System (ADS)

    Cooray, G. K.; Cooray, V.

    2007-12-01

    Ball Lightning was seen and described since antiquity and recorded in many places. Ball lightning is usually observed during thunderstorms but large number of ball lightning observations is also reported during fine weather without any connection to thunderstorms or lightning. However, so far no one has managed to generate them in the laboratory. It is photographed very rarely and in many cases the authenticity of them is questionable. It is possible that many different phenomena are grouped together and categorized simply as ball lightning. Indeed, the visual hallucinations associated with simple partial epileptic seizures, during which the patient remains conscious, may also be categorized by a patient unaware of his or her condition as ball lightning observation. Such visual hallucinations may occur as a result of an epileptic seizure in the occipital, temporo-occipital or temporal lobes of the cerebrum [1,2,3]. In some cases the hallucination is perceived as a coloured ball moving horizontally from the periphery to the centre of the vision. The ball may appear to be rotating or spinning. The colour of the ball can be red, yellow, blue or green. Sometimes, the ball may appear to have a solid structure surrounded by a thin glow or in other cases the ball appears to generate spark like phenomena. When the ball is moving towards the centre of the vision it may increase its intensity and when it reaches the centre it can 'explode' illuminating the whole field of vision. During the hallucinations the vision is obscured only in the area occupied by the apparent object. The hallucinations may last for 5 to 30 seconds and rarely up to a minute. Occipital seizures may spread into other regions of the brain giving auditory, olfactory and sensory sensations. These sensations could be buzzing sounds, the smell of burning rubber, pain with thermal perception especially in the arms and the face, and numbness and tingling sensation. In some cases a person may experience only

  2. Epilepsy and weather: A significant correlation between the onset of epileptic seizures and specific atmospherics — a pilot study

    NASA Astrophysics Data System (ADS)

    Ruhenstroth-Bauer, G.; Baumer, H.; Kugler, J.; Spatz, R.; Sönning, W.; Filipiak, B.

    1984-12-01

    The possibility of connections between weather and the onset of epileptic seizures has long been suggested (see, for example, the Hammurabi Codex 1600 BC). Work in the 20th Century points to a probability that the onset of both local and generalised epilepsy is significantly influenced by an interaction between genetic and extrinsic factors. In an attempt to clarify the situation a detailed study of the history of 315 attacks from 1 Jan. to 31 July 1981 suffered by a small number of patients in Munich has been undertaken. Although linkages between “classical” meteorological parameters and the onset of seizures are very weak, links with more generalised indexes (e.g. passage of fronts and disturbances) are more promising. However, the correlation between onsets and “atmospherics” of 28 KHz (positive) and 10 KHz (negative) impulses, are significant and call for urgent study.

  3. Dynamics of regional brain activity in epilepsy: a cross-disciplinary study on both intracranial and scalp-recorded epileptic seizures.

    PubMed

    Minadakis, George; Ventouras, Errikos; Gatzonis, Stylianos D; Siatouni, Anna; Tsekou, Hara; Kalatzis, Ioannis; Sakas, Damianos E; Stonham, John

    2014-04-01

    Recent cross-disciplinary literature suggests a dynamical analogy between earthquakes and epileptic seizures. This study extends the focus of inquiry for the applicability of models for earthquake dynamics to examine both scalp-recorded and intracranial electroencephalogram recordings related to epileptic seizures. First, we provide an updated definition of the electric event in terms of magnitude and we focus on the applicability of (i) a model for earthquake dynamics, rooted in a nonextensive Tsallis framework, (ii) the traditional Gutenberg and Richter law and (iii) an alternative method for the magnitude-frequency relation for earthquakes. Second, we apply spatiotemporal analysis in terms of nonextensive statistical physics and we further examine the behavior of the parameters included in the nonextensive formula for both types of electroencephalogram recordings under study. We confirm the previously observed power-law distribution, showing that the nonextensive formula can adequately describe the sequences of electric events included in both types of electroencephalogram recordings. We also show the intermittent behavior of the epileptic seizure cycle which is analogous to the earthquake cycles and we provide evidence of self-affinity of the regional electroencephalogram epileptic seizure activity. This study may provide a framework for the analysis and interpretation of epileptic brain activity and other biological phenomena with similar underlying dynamical mechanisms.

  4. Dynamics of regional brain activity in epilepsy: a cross-disciplinary study on both intracranial and scalp-recorded epileptic seizures

    NASA Astrophysics Data System (ADS)

    Minadakis, George; Ventouras, Errikos; Gatzonis, Stylianos D.; Siatouni, Anna; Tsekou, Hara; Kalatzis, Ioannis; Sakas, Damianos E.; Stonham, John

    2014-04-01

    Objective. Recent cross-disciplinary literature suggests a dynamical analogy between earthquakes and epileptic seizures. This study extends the focus of inquiry for the applicability of models for earthquake dynamics to examine both scalp-recorded and intracranial electroencephalogram recordings related to epileptic seizures. Approach. First, we provide an updated definition of the electric event in terms of magnitude and we focus on the applicability of (i) a model for earthquake dynamics, rooted in a nonextensive Tsallis framework, (ii) the traditional Gutenberg and Richter law and (iii) an alternative method for the magnitude-frequency relation for earthquakes. Second, we apply spatiotemporal analysis in terms of nonextensive statistical physics and we further examine the behavior of the parameters included in the nonextensive formula for both types of electroencephalogram recordings under study. Main results. We confirm the previously observed power-law distribution, showing that the nonextensive formula can adequately describe the sequences of electric events included in both types of electroencephalogram recordings. We also show the intermittent behavior of the epileptic seizure cycle which is analogous to the earthquake cycles and we provide evidence of self-affinity of the regional electroencephalogram epileptic seizure activity. Significance. This study may provide a framework for the analysis and interpretation of epileptic brain activity and other biological phenomena with similar underlying dynamical mechanisms.

  5. A low-power configurable neural recording system for epileptic seizure detection.

    PubMed

    Qian, Chengliang; Shi, Jess; Parramon, Jordi; Sánchez-Sinencio, Edgar

    2013-08-01

    This paper describes a low-power configurable neural recording system capable of capturing and digitizing both neural action-potential (AP) and fast-ripple (FR) signals. It demonstrates the functionality of epileptic seizure detection through FR recording. This system features a fixed-gain, variable-bandwidth (BW) front-end circuit and a sigma-delta ADC with scalable bandwidth and power consumption. The ADC employs a 2nd-order single-bit sigma-delta modulator (SDM) followed by a low-power decimation filter. Direct impulse-response implementation of a sinc(3) filter and 8-cycle data pipelining in an IIR filter are proposed for the decimation filter design to improve the power and area efficiency. In measurements, the front end exhibits 39.6-dB DC gain, 0.8 Hz to 5.2 kHz of BW, 5.86- μVrms input-referred noise, and 2.4- μW power consumption in AP mode, while showing 38.5-dB DC gain, 250 to 486 Hz of BW, 2.48- μVrms noise, and 4.5- μW power consumption in FR mode. The noise efficiency factor (NEF) is 2.93 and 7.6 for the AP and FR modes, respectively. At 77-dB dynamic range (DR), the ADC has a peak SNR and SNDR of 75.9 dB and 67 dB, respectively, while consuming 2.75-mW power in AP mode. It achieves 78-dB DR, 76.2-dB peak SNR, 73.2-dB peak SNDR, and 588- μW power consumption in FR mode. Both analog and digital power supply voltages are 2.8 V. The chip is fabricated in a standard 0.6- μm CMOS process. The die size is 11.25 mm(2).

  6. Descriptive Analysis of Epileptic Seizures and Problem Behavior in Adults with Developmental Disabilities

    ERIC Educational Resources Information Center

    Roberts, Celeste; Yoder, Paul J.; Kennedy, Craig H.

    2006-01-01

    We studied possible relations between seizures and problem behavior in 3 adults with developmental disabilities. Each person was observed for between 56 and 92 days to record occurrences of seizures and problem behavior. Results of our descriptive analysis indicated an association between seizures and problem behavior for each participant. For…

  7. The UWIMONA Pediatric Epileptic Seizure Screening Questionnaire was equivalent to clinical assessment in identifying children with epilepsy.

    PubMed

    Melbourne-Chambers, Roxanne; Clarke, Dave; Gordon-Strachan, Georgiana; Tapper, Judy; Tulloch-Reid, Marshall K

    2015-09-01

    To assess the validity and reliability of a screening questionnaire administered to parents/caregivers to detect behaviors suggestive of epileptic seizures in children. We developed a 10-item questionnaire, which was administered to 120 parents/caregivers of children attending hospital-based clinics/pediatric neurologists' offices. Receiver operating characteristic (ROC) curve analysis was used to assess the discriminant ability of the questionnaire and determine cutoff points. Questionnaire sensitivity and specificity were compared with clinical assessment by a pediatrician and pediatric neurologist. The questionnaire was readministered to 25 parents/caregivers after 1 month to assess reliability. The 120 children had the following characteristics: 58% with epilepsy, 55% male, mean (standard deviation) age 8.1 (3.2) years. A positive response to ≥1 item had the highest sensitivity (89%) and specificity (91%), with a ROC area under curve of 0.91 (95% confidence interval: 0.86, 0.97). The validity of the questionnaire was similar to the clinical evaluation by the pediatric neurologist and pediatrician. The Spearman correlation coefficient for the total score from repeat administration of the questionnaire was 0.95 (P < 0.01). The UWIMONA Pediatric Epileptic Seizure Screening Questionnaire is a valid and reliable screening instrument and performed similarly when compared with evaluation by an experienced clinician. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Phenobarbital administration every eight hours: improvement of seizure management in idiopathic epileptic dogs with decreased phenobarbital elimination half-life.

    PubMed

    Stabile, F; Barnett, C R; De Risio, L

    2017-02-18

    Estimated prevalence of canine idiopathic epilepsy is 0.6 per cent in the first-opinion canine population in the UK. Phenobarbital monotherapy has been reported to reduce/eradicate seizure activity in 60-93 per cent of idiopathic epileptic dogs (IEDs). The objective of this study was to evaluate safety and efficacy of the administration of phenobarbital orally every eight hours in IEDs with phenobarbital elimination half-life less than 20 hours. Medical records of 10 IEDs in which steady state trough serum phenobarbital levels were within the reference range and phenobarbital elimination half-life had become less than 20 hours following prolonged administration every 12 hours were reviewed. Side effects and seizure frequency when phenobarbital was administered every 12 hours or 8 hours were compared. In all dogs the side effects of the antiepileptic medication treatment improved. When phenobarbital was administered every eight hours, 9/10 dogs experienced improvement in seizure frequency and 8/10 dogs maintained seizure freedom for a period three times longer than the longest interictal interval period previously recorded. Reduction in the severity and number of clusters of seizures was recorded in one of the remaining two dogs. The administration of phenobarbital orally every eight hours in IEDs with decreased phenobarbital elimination half-life appears safe and can improve seizure management. The results of this study were presented in abstract form (poster) for the 28th symposium of the European Society of Veterinary Neurology - European College of Veterinary Neurology (ESVN), September 18-19, 2015, Amsterdam, Netherlands.

  9. Comparison of the health-related quality of life between epileptic patients with partial and generalized seizure

    PubMed Central

    Ashjazadeh, Nahid; Yadollahikhales, Golnaz; Ayoobzadehshirazi, Anaheed; Sadraii, Nazanin; Hadi, Negin

    2014-01-01

    Background: Epilepsy is defined as recurrent unprovoked febrile seizures, which cause disability in patients. This study aims to assess the health-related quality-of-life (QOL) in epileptic patients in Fars Province, southern Iran. Methods:One-hundred epileptic patients, above 18 years, referred to Shiraz University of Medical Sciences affiliated clinics, were included. The QOL of patients with generalized and partial seizure were assessed using the Iranian valid and reliable Sf-36 questionnaire. Patients’ socio-demographic and their disease features were also compared with each other using a questionnaire. Results: In partial epilepsy group (n = 24), the married patients in social functioning (SF) aspect of QOL (64.42 ± 14.29) (P = 0.024), the patients on antiepileptic drugs (AEDs) monotherapy in both physical functioning (PF) (88.75 ± 11.57) (P = 0.030) and SF (75.00 ± 6.68) (P = 0.022) aspects, the employed patients in PF aspect of QOL (P = 0.023) (91.87 ± 8.83) and those with high income in mental health aspect of QOL (P = 0.036 and correlation coefficient = 0.413) got better scores compared with the partial epileptic patients who were single, on polytherapy, unemployed and had low to moderate income. In generalized epilepsy group (n = 76), patients on AEDs monotherapy in PF aspect of QOL (P = 0.025) (78.33 ± 24.36) and employed patients in vitality aspect (P = 0.023) (57.00 ± 28.25) had better scores. Data were analyzed using SPSS for windows. Conclusion: Epilepsy can affect patient’s life in a number of ways such as their lives, marriage, occupation, and education. We can encourage patients to find a partner, continue higher education and try to find a job. PMID:25295153

  10. Nonseizure SUDEP: Sudden unexpected death in epilepsy without preceding epileptic seizures.

    PubMed

    Lhatoo, Samden D; Nei, Maromi; Raghavan, Manoj; Sperling, Michael; Zonjy, Bilal; Lacuey, Nuria; Devinsky, Orrin

    2016-07-01

    To describe the phenomenology of monitored sudden unexpected death in epilepsy (SUDEP) occurring in the interictal period where death occurs without a seizure preceding it. We report a case series of monitored definite and probable SUDEP where no electroclinical evidence of underlying seizures was found preceding death. Three patients (two definite and one probable) had SUDEP. They had a typical high SUDEP risk profile with longstanding intractable epilepsy and frequent generalized tonic-clonic seizures (GTCS). All patients had varying patterns of respiratory and bradyarrhythmic cardiac dysfunction with profound electroencephalography (EEG) suppression. In two patients, patterns of cardiorespiratory failure were similar to those seen in some patients in the Mortality in Epilepsy Monitoring Units Study (MORTEMUS). SUDEP almost always occur postictally, after GTCS and less commonly after a partial seizure. Monitored SUDEP or near-SUDEP cases without a seizure have not yet been reported in literature. When nonmonitored SUDEP occurs in an ambulatory setting without an overt seizure, the absence of EEG information prevents the exclusion of a subtle seizure. These cases confirm the existence of nonseizure SUDEP; such deaths may not be prevented by seizure detection-based devices. SUDEP risk in patients with epilepsy may constitute a spectrum of susceptibility wherein some are relatively immune, death occurs in others with frequent GTCS with one episode of seizure ultimately proving fatal, while in others still, death may occur even in the absence of a seizure. We emphasize the heterogeneity of SUDEP phenomena. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  11. Plic-1, a new target in repressing epileptic seizure by regulation of GABAAR function in patients and a rat model of epilepsy.

    PubMed

    Zhang, Yujiao; Li, Zengyou; Gu, Juan; Zhang, Yanke; Wang, Wei; Shen, Hui; Chen, Guojun; Wang, Xuefeng

    2015-12-01

    Dysfunction of γ-aminobutyric acid A (GABAA) receptors (GABAARs) is a prominent factor affecting intractable epilepsy. Plic-1, an ubiquitin-like protein enriched in the inhibitory synapses connecting GABAARs and the ubiquitin protease system (UPS), plays a key role in the modification of GABAAR functions. However, the relationship between Plic-1 and epileptogenesis is not known. In the present study, we aimed to investigate Plic-1 levels in patients with temporal lobe epilepsy, as well as the role of Plic-1 in regulating onset and progression of epilepsy in animal models. We found that Plic-1 expression was significantly decreased in patients with epilepsy as well as pilocarpine- and pentylenetetrazol (PTZ)-induced rat epileptic models. Intrahippocampal injection of the PePα peptide, which disrupts Plic-1 binding to GABAARs, significantly shortened the latency of seizure onset, and increased the seizure severity and duration in these two epileptic models. Overexpressed Plic-1 through lentivirus transfection into a PTZ model resulted in a reduction in both seizure severity and generalized tonic-clonic seizure duration. Whole-cell clamp recordings revealed that the PePα peptide decreased miniature inhibitory postsynaptic currents (mIPSCs) whereas overexpressed Plic-1 increased mIPSCs in the pyramidal neurons of the hippocampus. These effects can be blocked by picrotoxin, a GABAAR inhibitor. Our results indicate that Plic-1 plays an important role in managing epileptic seizures by enhancing seizure inhibition through regulation of GABAARs at synaptic sites.

  12. Altered expression of adrenocorticotropic hormone in the epileptic gerbil hippocampus following spontaneous seizure.

    PubMed

    Oh, Yun-Jung; Kim, Heung-No; Jeong, Ji-Heon; Park, Dae-Kyoon; Park, Kyung-Ho; Ko, Jeong-Sik; Kim, Duk-Soo

    2013-02-01

    We investigated the temporal alterations of adrenocorticotropic hormone (ACTH) immunoreactivity in the hippocampus after seizure onset. Expression of ACTH was observed within interneurons in the pre-seizure group of seizure sensitive gerbils, whereas its immunoreactivities were rarely detected in seizure resistant gerbil. Three hr after the seizure, ACTH immunoreactivity was significantly increased in interneurons within all hippocampal regions. On the basis of their localization and morphology through immunofluorescence staining, these cells were identified as GABAA α1-containing interneurons. At the 12 hr postictal period, ACTH expression in these regions was down-regulated, in a similar manner to the pre-seizure group of gerbils. These findings support the increase in ACTH synthesis that contributes to a reduction of corticotrophin-releasing factor via the negative feedback system which in turn provides an opportunity to enhance the excitability of GABAergic interneurons. Therefore, ACTH may play an important role in the reduction of excitotoxicity in all hippocampal regions.

  13. NeuroKinect: A Novel Low-Cost 3Dvideo-EEG System for Epileptic Seizure Motion Quantification.

    PubMed

    Cunha, João Paulo Silva; Choupina, Hugo Miguel Pereira; Rocha, Ana Patrícia; Fernandes, José Maria; Achilles, Felix; Loesch, Anna Mira; Vollmar, Christian; Hartl, Elisabeth; Noachtar, Soheyl

    2016-01-01

    motion trajectories when compared to a 2D frame by frame tracking procedure. We conclude that this new approach provides a more comfortable (both for patients and clinical professionals), simpler, faster and lower-cost procedure than previous approaches, therefore providing a reliable tool to quantitatively analyze MOI patterns of epileptic seizures in the routine of EMUs around the world. We hope this study encourages other EMUs to adopt similar approaches so that more quantitative information is used to improve epilepsy diagnosis.

  14. [Effect of citicoline on the development of chronic epileptization of the brain (pentylenetetrazole kindling) and acute seizures reaction of kindled mice C57Bl/6].

    PubMed

    Kuznetzova, L V; Karpova, M N; Zinkovsky, K A; Klishina, N V

    2014-01-01

    In experiments on mice C57Bl/6 was studied effects of citicoline (500 mg/kg, i.p.) on development of chronically epileptization of the brain--pentylenetetrazole (PTZ) kindling (30 mg/kg PTZ, i.p. during 24 days) and on acute generalized seizures (i.v., 1% solution of PTZ with the speed of 0.01 ml/s). It was shown that daily injection of citicoline an hour before the introduction of PTZ had no effect on development of chronically epileptization of the brain --PTZ-kindling (the latency of seizures appearance and their severity). However, citicoIine posses anticonvulsive effects on acute seizures in kindled mice. In animals with increased seizure susceptibility of the brain caused by kindling and severity of seizures 2-3 points injection citicoline after 14 days of kindling had anticonvulsive effect, increasing the threshold clonic seizures. Injection of citicoline during 24 days of kindled animals and severity of seizures 3-5 points caused the increase of thresholds as clonic and tonic phase of seizures with lethal outcome. Thus, the anticonvulsant effect of citicoline more pronounced in the long-term use.

  15. Imag(in)ing seizure propagation: MEG-guided interpretation of epileptic activity from a deep source.

    PubMed

    Wang, Zhong I; Jin, Kazutaka; Kakisaka, Yosuke; Mosher, John C; Bingaman, William E; Kotagal, Prakash; Burgess, Richard C; Najm, Imad M; Alexopoulos, Andreas V

    2012-12-01

    Identification and accurate localization of seizure foci is vital in patients with medically-intractable focal epilepsy, who may be candidates for potentially curative resective epilepsy surgery. We present a patient with difficult-to-control seizures associated with an occult focal cortical dysplasia residing within the deeper left parietal operculum and underlying posterior insula, which was not detected by conventional MRI analysis. Propagated activities from this deeper generator produced misleading EEG patterns both on surface and subdural electrode recordings suggesting initial activation of the perirolandic and mesial frontal regions. However, careful spatio-temporal analysis of stereotyped interictal activities recorded during MEG, using sequential dipole modeling, revealed a consistent pattern of epileptic propagation originating from the deeper source and propagating within few milliseconds to the dorsal convexity. In this instance, careful dissection of noninvasive investigations (interictal MEG along with ictal SPECT findings) allowed clinicians to dismiss the inaccurate and misleading findings of the traditional "gold-standard" intracranial EEG. In fact, this multimodal noninvasive approach uncovered a subtle dysplastic lesion, resection of which rendered the patient seizure-free. This case highlights the potential benefits of dynamic analysis of interictal MEG in the appropriate clinical context. Pathways of interictal spike propagation may help elucidate essential neural networks underlying focal epilepsy. Copyright © 2011 Wiley Periodicals, Inc.

  16. Gap Junctions as Common Cause of High-Frequency Oscillations and Epileptic Seizures in a Computational Cascade of Neuronal Mass and Compartmental Modeling.

    PubMed

    Helling, Robert M; Koppert, Marc M J; Visser, Gerhard H; Kalitzin, Stiliyan N

    2015-09-01

    High frequency oscillations (HFO) appear to be a promising marker for delineating the seizure onset zone (SOZ) in patients with localization related epilepsy. It remains, however, a purely observational phenomenon and no common mechanism has been proposed to relate HFOs and seizure generation. In this work we show that a cascade of two computational models, one on detailed compartmental scale and a second one on neural mass scale can explain both the autonomous generation of HFOs and the presence of epileptic seizures as emergent properties. To this end we introduce axonal-axonal gap junctions on a microscopic level and explore their impact on the higher level neural mass model (NMM). We show that the addition of gap junctions can generate HFOs and simultaneously shift the operational point of the NMM from a steady state network into bistable behavior that can autonomously generate epileptic seizures. The epileptic properties of the system, or the probability to generate epileptic type of activity, increases gradually with the increase of the density of axonal-axonal gap junctions. We further demonstrate that ad hoc HFO detectors used in previous studies are applicable to our simulated data.

  17. Epileptic Seizure Detection and Prediction Based on Continuous Cerebral Blood Flow Monitoring--a Review.

    PubMed

    Tewolde, Senay; Oommen, Kalarickal; Lie, Donald Y C; Zhang, Yuanlin; Chyu, Ming-Chien

    2015-01-01

    Epilepsy is the third most common neurological illness, affecting 1% of the world's population. Despite advances in medicine, about 25 to 30% of the patients do not respond to or cannot tolerate the severe side effects of medical treatment, and surgery is not an option for the majority of patients with epilepsy. The objective of this article is to review the current state of research on seizure detection based on cerebral blood flow (CBF) data acquired by thermal diffusion flowmetry (TDF), and CBF-based seizure prediction. A discussion is provided on the applications, advantages, and disadvantages of TDF in detecting and localizing seizure foci, as well as its role in seizure prediction. Also presented are an overview of the present challenges and possible future research directions (along with methodological guidelines) of the CBF-based seizure detection and prediction methods.

  18. NeuroKinect: A Novel Low-Cost 3Dvideo-EEG System for Epileptic Seizure Motion Quantification

    PubMed Central

    Cunha, João Paulo Silva; Choupina, Hugo Miguel Pereira; Rocha, Ana Patrícia; Fernandes, José Maria; Achilles, Felix; Loesch, Anna Mira; Vollmar, Christian; Hartl, Elisabeth; Noachtar, Soheyl

    2016-01-01

    body motion trajectories when compared to a 2D frame by frame tracking procedure. We conclude that this new approach provides a more comfortable (both for patients and clinical professionals), simpler, faster and lower-cost procedure than previous approaches, therefore providing a reliable tool to quantitatively analyze MOI patterns of epileptic seizures in the routine of EMUs around the world. We hope this study encourages other EMUs to adopt similar approaches so that more quantitative information is used to improve epilepsy diagnosis. PMID:26799795

  19. Continuous administration of antisense oligonucleotides to c-fos reduced the development of seizure susceptibility after ethacrynic acid-induced seizure in mice.

    PubMed

    Suzukawa, Junko; Omori, Kyoko; Yang, Li; Inagaki, Chiyoko

    2003-09-25

    We previously demonstrated that seizure susceptibility developed by the 14th day post-ethacrynic acid (EA)-induced seizure in mice, with a prolonged increase in the expression of c-fos mRNA in the brain during days 10-14. To examine whether such c-fos increase contributes to the development of seizure susceptibility, we administered antisense oligodeoxynucleotide to c-fos by continuous infusion into the lateral ventricle of mice that had shown a moderate stage of EA seizure, and evaluated the seizure susceptibility to kainic acid (10 mg/kg) on the 14th day. Antisense-infused mice displayed significant reduction of the c-Fos level in the hippocampus and cerebral cortex on the 7th and 14th days, and a significant decrease in seizure severity. These findings suggest that the prolonged increase in c-fos expression after EA seizure may lead to the development of seizure susceptibility.

  20. Cannabidiol Post-Treatment Alleviates Rat Epileptic-Related Behaviors and Activates Hippocampal Cell Autophagy Pathway Along with Antioxidant Defense in Chronic Phase of Pilocarpine-Induced Seizure.

    PubMed

    Hosseinzadeh, Mahshid; Nikseresht, Sara; Khodagholi, Fariba; Naderi, Nima; Maghsoudi, Nader

    2016-04-01

    Abnormal and sometimes severe behavioral and molecular symptoms are usually observed in epileptic humans and animals. To address this issue, we examined the behavioral and molecular aspects of seizure evoked by pilocarpine. Autophagy can promote both cell survival and death, but there are controversial reports about the neuroprotective or neurodegenerative effects of autophagy in seizure. Cannabidiol has anticonvulsant properties in some animal models when used as a pretreatment. In this study, we investigated alteration of seizure scores, autophagy pathway proteins, and antioxidant status in hippocampal cells during the chronic phase of pilocarpine-induced epilepsy after treatment with cannabidiol. Cannabidiol (100 ng, intracerebroventricular injection) delayed the chronic phase of epilepsy. Single administration of cannabidiol during the chronic phase of seizure significantly diminished seizure scores such as mouth clonus, head nodding, monolateral and bilateral forelimb clonus and increased the activity of catalase enzyme and reduced glutathione content. Such a protective effect in the behavioral scores of epileptic rats was also observed after repeated administrations of cannabidiol at the onset of the silent phase. Moreover, the amount of Atg7, conjugation of Atg5/12, Atg12, and LC3II/LC3I ratio increased significantly in epileptic rats treated with repeated injections of cannabidiol. In short, our results suggest that post-treatment of Cannabidiol could enhance the induction of autophagy pathway and antioxidant defense in the chronic phase of epilepsy, which could be considered as the protective mechanisms of cannabidiol in a temporal lobe epilepsy model.

  1. TNF-Overexpression in Borna Disease Virus-Infected Mouse Brains Triggers Inflammatory Reaction and Epileptic Seizures

    PubMed Central

    Eisel, Ulrich L. M.; Herzog, Sibylle; Richt, Jürgen A.; Baumgärtner, Wolfgang; Herden, Christiane

    2012-01-01

    Proinflammatory state of the brain increases the risk for seizure development. Neonatal Borna disease virus (BDV)-infection of mice with neuronal overexpression of tumor necrosis factor-α (TNF) was used to investigate the complex relationship between enhanced cytokine levels, neurotropic virus infection and reaction pattern of brain cells focusing on its role for seizure induction. Viral antigen and glial markers were visualized by immunohistochemistry. Different levels of TNF in the CNS were provided by the use of heterozygous and homozygous TNF overexpressing mice. Transgenic TNF, total TNF (native and transgenic), TNF-receptor (TNFR1, TNFR2), IL-1 and N-methyl-D-aspartate (NMDA)-receptor subunit 2B (NR2B) mRNA values were measured by real time RT-PCR. BDV-infection of TNF-transgenic mice resulted in non-purulent meningoencephalitis accompanied by epileptic seizures with a higher frequency in homozygous animals. This correlated with lower weight gain, stronger degree and progression of encephalitis and early, strong microglia activation in the TNF-transgenic mice, most obviously in homozygous animals. Activation of astroglia could be more intense and associated with an unusual hypertrophy in the transgenic mice. BDV-antigen distribution and infectivity in the CNS was comparable in TNF-transgenic and wild-type animals. Transgenic TNF mRNA-expression was restricted to forebrain regions as the transgene construct comprised the promoter of NMDA-receptor subunit2B and induced up-regulation of native TNF mRNA. Total TNF mRNA levels did not increase significantly after BDV-infection in the brain of transgenic mice but TNFR1, TNFR2 and IL-1 mRNA values, mainly in the TNF overexpressing brain areas. NR2B mRNA levels were not influenced by transgene expression or BDV-infection. Neuronal TNF-overexpression combined with BDV-infection leads to cytokine up-regulation, CNS inflammation and glial cell activation and confirmed the presensitizing effect of elevated cytokine

  2. Loss of p53 results in protracted electrographic seizures and development of an aggravated epileptic phenotype following status epilepticus

    PubMed Central

    Engel, T; Tanaka, K; Jimenez-Mateos, E M; Caballero-Caballero, A; Prehn, J H M; Henshall, D C

    2010-01-01

    The p53 tumor suppressor is a multifunctional protein, which regulates cell cycle, differentiation, DNA repair and apoptosis. Experimental seizures up-regulate p53 in the brain, and acute seizure-induced neuronal death can be reduced by genetic deletion or pharmacologic inhibition of p53. However, few long-term functional consequences of p53 deficiency have been explored. Here, we investigated the development of epilepsy triggered by status epilepticus in wild-type and p53-deficient mice. Analysis of electroencephalogram (EEG) recordings during status epilepticus induced by intra-amygdala kainic acid (KA) showed that seizures lasted significantly longer in p53-deficient mice compared with wild-type animals. Nevertheless, neuronal death in the hippocampal CA3 subfield and the neocortex was significantly reduced at 72 h in p53-deficient mice. Long-term continuous EEG telemetry recordings after status epilepticus determined that the sum duration of spontaneous seizures was significantly longer in p53-deficient compared with wild-type mice. Hippocampal damage and neuropeptide Y distribution at the end of chronic recordings was found to be similar between p53-deficient and wild-type mice. The present study identifies protracted KA-induced electrographic status as a novel outcome of p53 deficiency and shows that the absence of p53 leads to an exacerbated epileptic phenotype. Accordingly, targeting p53 to protect against status epilepticus or related neurologic insults may be offset by deleterious consequences of reduced p53 function during epileptogenesis or in chronic epilepsy. PMID:21368852

  3. Attachment style, relationship quality, and psychological distress in patients with psychogenic non-epileptic seizures versus epilepsy.

    PubMed

    Green, Becky; Norman, Paul; Reuber, Markus

    2017-01-01

    Psychopathology levels are elevated in patients with psychogenic non-epileptic seizures (PNES) and those with epilepsy. However, patients with PNES report higher rates of trauma and neglect, poorer health-related quality of life (HRQoL), and an increased prevalence of insecure attachment. We examined to what extent attachment style and relationship quality with their main informal carer impact on levels of HRQoL, depression, and anxiety in patients with PNES versus those with epilepsy. Consecutive patients with PNES (N=23) and epilepsy (N=72) completed questionnaires about attachment style, quality of their relationship with their main informal carer, seizure severity, HRQoL, depression, and anxiety. Patients with PNES reported higher levels of anxiety and depression and lower HRQoL than those with epilepsy. PNES: No significant correlations were found with HRQoL but depression correlated positively with attachment avoidance, attachment anxiety, and relationship conflict. Anxiety correlated positively with attachment avoidance, attachment anxiety, and relationship conflict, and negatively with relationship depth and support. Epilepsy: HRQoL correlated negatively with seizure severity, depression, anxiety, attachment avoidance, and attachment anxiety. Depression correlated positively with attachment avoidance, attachment anxiety, and relationship conflict. Anxiety correlated positively with seizure severity, attachment avoidance, and attachment anxiety. Correlations between measures of relationship quality and anxiety were stronger in patients with PNES versus those with epilepsy (zs=2.66 to 2.97, ps<0.004). Attachment style and relationship quality explained larger amounts of variance in depression (45%) and anxiety (60%) in the patients with PNES than those with epilepsy (16% and 13%). Levels of anxiety and depression were higher in patients with PNES than those with epilepsy. Interpersonal problems were much more closely associated with anxiety and depression in

  4. Which Brain Regions are Important for Seizure Dynamics in Epileptic Networks? Influence of Link Identification and EEG Recording Montage on Node Centralities.

    PubMed

    Geier, Christian; Lehnertz, Klaus

    2017-02-01

    Nodes in large-scale epileptic networks that are crucial for seizure facilitation and termination can be regarded as potential targets for individualized focal therapies. Graph-theoretical approaches based on centrality concepts can help to identify such important nodes, however, they may be influenced by the way networks are derived from empirical data. Here we investigate evolving functional epileptic brain networks during 82 focal seizures with different anatomical onset locations that we derive from multichannel intracranial electroencephalographic recordings from 51 patients. We demonstrate how the various methodological steps (from the recording montage via node and link inference to the assessment of node centralities) affect importance estimation and discuss their impact on the interpretability of findings in the context of pathophysiological aspects of seizure dynamics.

  5. Effects of cell phone radiation on lipid peroxidation, glutathione and nitric oxide levels in mouse brain during epileptic seizure.

    PubMed

    Esmekaya, Meric Arda; Tuysuz, Mehmet Zahid; Tomruk, Arın; Canseven, Ayse G; Yücel, Engin; Aktuna, Zuhal; Keskil, Semih; Seyhan, Nesrin

    2016-09-01

    The objective of the this study was to evaluate the effects of cellular phone radiation on oxidative stress parameters and oxide levels in mouse brain during pentylenetetrazole (PTZ) induced epileptic seizure. Eight weeks old mice were used in the study. Animals were distributed in the following groups: Group I: Control group treated with PTZ, Group II: 15min cellular phone radiation+PTZ treatment+30min cellular phone radiation, Group III: 30min cellular phone radiation+PTZ treatment+30min cellular phone radiation. The RF radiation was produced by a 900MHz cellular phone. Lipid peroxidation, which is the indicator of oxidative stress was quantified by measuring the formation of thiobarbituric acid reactive substances (TBARS). The glutathione (GSH) levels were determined by the Ellman method. Tissue total nitric oxide (NOx) levels were obtained using the Griess assay. Lipid peroxidation and NOx levels of brain tissue increased significantly in group II and III compared to group I. On the contrary, GSH levels were significantly lower in group II and III than group I. However, no statistically significant alterations in any of the endpoints were noted between group II and Group III. Overall, the experimental findings demonstrated that cellular phone radiation may increase the oxidative damage and NOx level during epileptic activity in mouse brain. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Rat epileptic seizures evoked by BmK {alpha}IV and its possible mechanisms involved in sodium channels

    SciTech Connect

    Chai Zhifang; Bai Zhantao; Zhang Xuying; Liu Tong; Pang Xueyan; Ji Yonghua . E-mail: yhji@server.shcnc.ac.cn

    2007-05-01

    This study showed that rat unilateral intracerebroventricular injection of BmK {alpha}IV, a sodium channel modulator derived from scorpion Buthus martensi Karsch, induced clusters of spikes, epileptic discharges and convulsion-related behavioral changes. BmK {alpha}IV potently promoted the release of endogenous glutamate from rat cerebrocortical synaptosomes. In vitro examination of the effect of BmK {alpha}IV on intrasynaptosomal free calcium concentration [Ca{sup 2+}]{sub i} and sodium concentration [Na{sup +}]{sub i} revealed that BmK {alpha}IV-evoked glutamate release from synaptosomes was associated with an increase in Ca{sup 2+} and Na{sup +} influx. Moreover, BmK {alpha}IV-mediated glutamate release and ion influx was completely blocked by tetrodotoxin, a blocker of sodium channel. Together, these results suggest that the induction of BmK {alpha}IV-evoked epileptic seizures may be involved in the modulation of BmK {alpha}IV on tetrodotoxin-sensitive sodium channels located on the nerve terminal, which subsequently enhances the Ca{sup 2+} influx to cause an increase of glutamate release. These findings may provide some insight regarding the mechanism of neuronal action of BmK {alpha}IV in the central nervous system for understanding epileptogenesis involved in sodium channels.

  7. Baccoside A suppresses epileptic-like seizure/convulsion in Caenorhabditis elegans.

    PubMed

    Pandey, Rakesh; Gupta, Shipra; Tandon, Sudeep; Wolkenhauer, Olaf; Vera, Julio; Gupta, Shailendra K

    2010-09-01

    The 1 mm long Caenorhabditis elegans is one of the prime research tools to study different human neurodegenerative diseases. We have considered the case in which increase in the surrounding temperature of this multicellular model leads to abnormal bursts of neuronal cells that can be linked to seizure or convulsion. The induction of such seizure/convulsion mechanism was done by gradually increasing the temperature with 1x buffer (100 mM NaCl, 50 mM MgCl(2)) in adult C. elegans. In the present experiment it is demonstrated that Baccoside A can significantly reduce the seizure/convulsion in C. elegans at higher temperatures (26-28+/-1 degrees C). Furthermore, in T-type Ca(2+) channel cca-1 mutant worms, no convulsion was recorded. Our experimental results suggest that plant molecules from Bacopa monnieri may be useful in suppressing the seizure/convulsion in worms.

  8. Role of GluK1 Kainate Receptors in Seizures, Epileptic Discharges, and Epileptogenesis

    PubMed Central

    Fritsch, Brita; Reis, Janine; Gasior, Maciej; Kaminski, Rafal M.

    2014-01-01

    Kainate receptors containing the GluK1 subunit have an impact on excitatory and inhibitory neurotransmission in brain regions, such as the amygdala and hippocampus, which are relevant to seizures and epilepsy. Here we used 2-amino-3-(3-hydroxy-5-tert-butylisoxazol-4-yl) propanoic acid (ATPA), a potent and selective agonist of kainate receptors that include the GluK1 subunit, in conjunction with mice deficient in GluK1 and GluK2 kainate receptor subunits to assess the role of GluK1 kainate receptors in provoking seizures and in kindling epileptogenesis. We found that systemic ATPA, acting specifically via GluK1 kainate receptors, causes locomotor arrest and forelimb extension (a unique behavioral characteristic of GluK1 activation) and induces myoclonic behavioral seizures and electrographic seizure discharges in the BLA and hippocampus. In contrast, the proconvulsant activity of systemic AMPA, kainate, and pentylenetetrazol is not mediated by GluK1 kainate receptors, and deletion of these receptors does not elevate the threshold for seizures in the 6 Hz model. ATPA also specifically activates epileptiform discharges in BLA slices in vitro via GluK1 kainate receptors. Olfactory bulb kindling developed similarly in wild-type, GluK1, and GluK2 knock-out mice, demonstrating that GluK1 kainate receptors are not required for epileptogenesis or seizure expression in this model. We conclude that selective activation of kainate receptors containing the GluK1 subunit can trigger seizures, but these receptors are not necessary for seizure generation in models commonly used to identify therapeutic agents for the treatment of epilepsy. PMID:24760837

  9. Altered expression of adrenocorticotropic hormone in the epileptic gerbil hippocampus following spontaneous seizure

    PubMed Central

    Oh, Yun-Jung; Kim, Heung-No; Jeong, Ji-Heon; Park, Dae-Kyoon; Park, Kyung-Ho; Ko, Jeong-Sik; Kim, Duk-Soo

    2013-01-01

    We investigated the temporal alterations of adrenocorticotropic hormone (ACTH) immunoreactivity in the hippocampus after seizure onset. Expression of ACTH was observed within interneurons in the pre-seizure group of seizure sensitive gerbils, whereas its immunoreactivities were rarely detected in seizure resistant gerbil. Three hr after the seizure, ACTH immunoreactivity was significantly increased in interneurons within all hippocampal regions. On the basis of their localization and morphology through immunofluorescence staining, these cells were identified as GABAA α1-containing interneurons. At the 12 hr postictal period, ACTH expression in these regions was down-regulated, in a similar manner to the pre-seizure group of gerbils. These findings support the increase in ACTH synthesis that contributes to a reduction of corticotrophin-releasing factor via the negative feedback system which in turn provides an opportunity to enhance the excitability of GABAergic interneurons. Therefore, ACTH may play an important role in the reduction of excitotoxicity in all hippocampal regions. [BMB Reports 2013; 46(2): 80-85] PMID:23433109

  10. Development of a body sensor network to detect motor patterns of epileptic seizures.

    PubMed

    Dalton, Anthony; Patel, Shyamal; Chowdhury, Atanu Roy; Welsh, Matt; Pang, Trudy; Schachter, Steven; OLaighin, Gearóid; Bonato, Paolo

    2012-11-01

    The objective of this study was the development of a remote monitoring system to monitor and detect simple motor seizures. Using accelerometer-based kinematic sensors, data were gathered from subjects undergoing medication titration at the Beth Israel Deaconess Medical Center. Over the course of the study, subjects repeatedly performed a predefined set of instrumental activities of daily living (iADLs). During the monitoring sessions, EEG and video data were also recorded and provided the gold standard for seizure detection. To distinguish seizure events from iADLs, we developed a template matching algorithm. Considering the unique signature of seizure events and the inherent temporal variability of seizure types across subjects, we incorporated a customized mass-spring template into the dynamic time warping algorithm. We then ported this algorithm onto a commercially available internet tablet and developed our body sensor network on the Mercury platform. We designed several policies on this platform to compare the tradeoffs between feature calculation, raw data transmission, and battery lifetime. From a dataset of 21 seizures, the sensitivity for our template matching algorithm was found to be 0.91 and specificity of 0.84. We achieved a battery lifetime of 10.5 h on the Mercury platform.

  11. [Clinical practice guidelines of the Andalusian Epilepsy Society on prophylaxis and treatment of acute symptomatic epileptic seizures].

    PubMed

    Mercadé-Cerdá, J M; Gascón-Jiménez, F J; Ramos-Lizana, J; Sánchez-Alvarez, J C; Serrano-Castro, P J

    Antiepileptic drugs (AED) have traditionally been used empirically to prevent the presentation of epileptic seizures in patients with acute brain disorders during the early or late phase. However, AED are not free of serious drawbacks, which means that their use should be based on solid scientific foundations. Our aim is to produce a set of practice guidelines based on explicit evidence about when prophylactic treatment with AED is indicated and the length of time it should be continued in acute symptomatic seizures (ASS). A selective search for quality scientific information on the subject was conducted on PubMed-Medline, Tripdatabase and the Biblioteca Cochrane Plus. The authors discussed and analysed the references that were selected and any recommendations that could be drawn from them were collected. A total of 14 primary documents and eight practice guidelines, protocols or experts' recommendations were identified. Our recommendations were explicitly included at the end of the document. The Andalusian Epilepsy Society makes the following recommendations: a) AED must only be used for the primary prevention of ASS in severe traumatic brain injury and as secondary prevention of new ASS due to other causes of acute brain damage; b) duration of treatment of ASS must not exceed the time needed to resolve the cause that gave rise to them; and c) benzodiazepines are the preferred drugs for use in the treatment of ASS due to alcohol withdrawal and magnesium sulphate for the ASS of eclampsia.

  12. Epileptic fast intracerebral EEG activity: evidence for spatial decorrelation at seizure onset

    PubMed Central

    Wendling, Fabrice; Bartolomei, Fabrice; Bellanger, Jean-Jacques; Bourien, Jérôme; Chauvel, Patrick

    2003-01-01

    Low-voltage rapid discharges (or fast EEG ictal activity) constitute a characteristic electrophysiological pattern in focal seizures of human epilepsy. They are characterized by a decrease of signal voltage with a marked increase of signal frequency (typically beyond 25 Hz). They have long been observed in stereoelectroencephalographic (SEEG) signals recorded with intra-cerebral electrodes, generally occurring at seizure onset and simultaneously involving distinct brain regions. Spectral properties of rapid ictal discharges as well as spatial correlations measured between SEEG signals generated from distant sites before, during and after these discharges were studied. Cross-correlation estimates within typical EEG sub-bands and statistical tests performed in ten patients suffering from partial epilepsy (frontal, temporal or fronto-temporal) reveal that SEEG signals are significantly de-correlated during the discharge period compared to periods that precede and follow this discharge. These results can be interpreted as a functional decoupling of distant brain sites at seizure onset followed by an abnormally high re-coupling when the seizure develops. They lead to the concept of “disruption” that is complementary of that of “activation” (revealed by significantly high correlations between signals recorded during seizures), both giving insights into our understanding of pathophysiological processes involved in human partial epilepsies as well as in the interpretation of clinical semiology. PMID:12764064

  13. Environmental enrichment restores CA1 hippocampal LTP and reduces severity of seizures in epileptic mice.

    PubMed

    Morelli, Emanuela; Ghiglieri, Veronica; Pendolino, Valentina; Bagetta, Vincenza; Pignataro, Annabella; Fejtova, Anna; Costa, Cinzia; Ammassari-Teule, Martine; Gundelfinger, Eckart D; Picconi, Barbara; Calabresi, Paolo

    2014-11-01

    We have analyzed the effects of environmental enrichment (EE) in a seizure-prone mouse model in which the genetic disruption of the presynaptic protein Bassoon leads to structural and functional alterations in the hippocampus and causes early spontaneous seizures mimicking human neurodevelopmental disorders. One-month EE starting at P21 reduced seizure severity, preserved long-term potentiation (LTP) and paired-pulse synaptic responses in the hippocampal CA1 neuronal population and prevented the reduction of spine density and dendrite branching of pyramidal neurons. These data demonstrate that EE exerts its therapeutic effect by normalizing multiple aspects of hippocampal function and provide experimental support for its use in the optimization of existent treatments. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. BAD-Dependent Regulation of Fuel Metabolism and KATP Channel Activity Confers Resistance to Epileptic Seizures

    PubMed Central

    Giménez-Cassina, Alfredo; Martínez-François, Juan Ramón; Fisher, Jill K.; Szlyk, Benjamin; Polak, Klaudia; Wiwczar, Jessica; Tanner, Geoffrey R.; Lutas, Andrew; Yellen, Gary; Danial, Nika N.

    2012-01-01

    Summary Neuronal excitation can be substantially modulated by alterations in metabolism, as evident from the anticonvulsant effect of diets that reduce glucose utilization and promote ketone body metabolism. We provide genetic evidence that BAD, a protein with dual functions in apoptosis and glucose metabolism, imparts reciprocal effects on metabolism of glucose and ketone bodies in brain cells. These effects involve phospho-regulation of BAD and are independent of its apoptotic function. BAD modifications that reduce glucose metabolism produce a marked increase in the activity of metabolically sensitive KATP channels in neurons, as well as resistance to behavioral and electrographic seizures in vivo. Seizure resistance is reversed by genetic ablation of the KATP channel, implicating the BAD-KATP axis in metabolic control of neuronal excitation and seizure responses. PMID:22632729

  15. Critical dynamics of Hopf bifurcations in the corticothalamic system: Transitions from normal arousal states to epileptic seizures

    NASA Astrophysics Data System (ADS)

    Yang, Dong-Ping; Robinson, P. A.

    2017-04-01

    A physiologically based corticothalamic model of large-scale brain activity is used to analyze critical dynamics of transitions from normal arousal states to epileptic seizures, which correspond to Hopf bifurcations. This relates an abstract normal form quantitatively to underlying physiology that includes neural dynamics, axonal propagation, and time delays. Thus, a bridge is constructed that enables normal forms to be used to interpret quantitative data. The normal form of the Hopf bifurcations with delays is derived using Hale's theory, the center manifold theorem, and normal form analysis, and it is found to be explicitly expressed in terms of transfer functions and the sensitivity matrix of a reduced open-loop system. It can be applied to understand the effect of each physiological parameter on the critical dynamics and determine whether the Hopf bifurcation is supercritical or subcritical in instabilities that lead to absence and tonic-clonic seizures. Furthermore, the effects of thalamic and cortical nonlinearities on the bifurcation type are investigated, with implications for the roles of underlying physiology. The theoretical predictions about the bifurcation type and the onset dynamics are confirmed by numerical simulations and provide physiologically based criteria for determining bifurcation types from first principles. The results are consistent with experimental data from previous studies, imply that new regimes of seizure transitions may exist in clinical settings, and provide a simplified basis for control-systems interventions. Using the normal form, and the full equations from which it is derived, more complex dynamics, such as quasiperiodic cycles and saddle cycles, are discovered near the critical points of the subcritical Hopf bifurcations.

  16. Emotion processing and psychogenic non-epileptic seizures: A cross-sectional comparison of patients and healthy controls.

    PubMed

    Novakova, Barbora; Howlett, Stephanie; Baker, Roger; Reuber, Markus

    2015-07-01

    This exploratory study aimed to examine emotion-processing styles in patients with psychogenic non-epileptic seizures (PNES), compared to healthy individuals, and to explore associations of emotion processing with other psychological measures and seizure frequency, using the new Emotional Processing Scale (EPS-25), which had not previously been used in this patient group. Fifty consecutive patients with PNES referred for psychotherapy completed a set of self-report questionnaires, including the Emotional Processing Scale (EPS-25), Clinical Outcome in Routine Evaluation (CORE-10), Short Form-36 (SF-36), Patient Health Questionnaire (PHQ-15), and Brief Illness Perception Questionnaire (BIPQ). Responses on the EPS-25 were compared to data from 224 healthy controls. Patients with PNES had greater emotion processing deficits across all dimensions of the EPS-25 than healthy individuals (suppression/unprocessed emotion/unregulated emotion/avoidance/impoverished emotional experience). Impaired emotion processing was highly correlated with psychological distress, more frequent and severe somatic symptoms, and a more threatening understanding of the symptoms. Emotion processing problems were also associated with reduced health-related quality of life on the mental health (but not the physical health) component of the SF-36. The unregulated emotions sub-scale of the EPS was associated with lower seizure frequency. The results showed clear impairments of emotion processing in patients with PNES compared to healthy individuals, which were associated with greater psychological distress and reduced mental health functioning. These findings seem to support the face validity of the EPS-25 as a measure for PNES patients and its potential as a tool to assess the effectiveness of psychological interventions. Copyright © 2015 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  17. Automated Video Detection of Epileptic Convulsion Slowing as a Precursor for Post-Seizure Neuronal Collapse.

    PubMed

    Kalitzin, Stiliyan N; Bauer, Prisca R; Lamberts, Robert J; Velis, Demetrios N; Thijs, Roland D; Lopes Da Silva, Fernando H

    2016-12-01

    Automated monitoring and alerting for adverse events in people with epilepsy can provide higher security and quality of life for those who suffer from this debilitating condition. Recently, we found a relation between clonic slowing at the end of a convulsive seizure (CS) and the occurrence and duration of a subsequent period of postictal generalized EEG suppression (PGES). Prolonged periods of PGES can be predicted by the amount of progressive increase of interclonic intervals (ICIs) during the seizure. The purpose of the present study is to develop an automated, remote video sensing-based algorithm for real-time detection of significant clonic slowing that can be used to alert for PGES. This may help preventing sudden unexpected death in epilepsy (SUDEP). The technique is based on our previously published optical flow video sequence processing paradigm that was applied for automated detection of major motor seizures. Here, we introduce an integral Radon-like transformation on the time-frequency wavelet spectrum to detect log-linear frequency changes during the seizure. We validate the automated detection and quantification of the ICI increase by comparison to the results from manually processed electroencephalography (EEG) traces as "gold standard". We studied 48 cases of convulsive seizures for which synchronized EEG-video recordings were available. In most cases, the spectral ridges obtained from Gabor-wavelet transformations of the optical flow group velocities were in close proximity to the ICI traces detected manually from EEG data during the seizure. The quantification of the slowing-down effect measured by the dominant angle in the Radon transformed spectrum was significantly correlated with the exponential ICI increase factors obtained from manual detection. If this effect is validated as a reliable precursor of PGES periods that lead to or increase the probability of SUDEP, the proposed method would provide an efficient alerting device.

  18. Automatic Epileptic Seizure Detection Using Scalp EEG and Advanced Artificial Intelligence Techniques

    PubMed Central

    2015-01-01

    The epilepsies are a heterogeneous group of neurological disorders and syndromes characterised by recurrent, involuntary, paroxysmal seizure activity, which is often associated with a clinicoelectrical correlate on the electroencephalogram. The diagnosis of epilepsy is usually made by a neurologist but can be difficult to be made in the early stages. Supporting paraclinical evidence obtained from magnetic resonance imaging and electroencephalography may enable clinicians to make a diagnosis of epilepsy and investigate treatment earlier. However, electroencephalogram capture and interpretation are time consuming and can be expensive due to the need for trained specialists to perform the interpretation. Automated detection of correlates of seizure activity may be a solution. In this paper, we present a supervised machine learning approach that classifies seizure and nonseizure records using an open dataset containing 342 records. Our results show an improvement on existing studies by as much as 10% in most cases with a sensitivity of 93%, specificity of 94%, and area under the curve of 98% with a 6% global error using a k-class nearest neighbour classifier. We propose that such an approach could have clinical applications in the investigation of patients with suspected seizure disorders. PMID:25710040

  19. Efficient epileptic seizure detection by a combined IMF-VoE feature.

    PubMed

    Qi, Yu; Wang, Yueming; Zheng, Xiaoxiang; Zhang, Jianmin; Zhu, Junming; Guo, Jianping

    2012-01-01

    Automatic seizure detection from the electroen-cephalogram (EEG) plays an important role in an on-demand closed-loop therapeutic system. A new feature, called IMF-VoE, is proposed to predict the occurrence of seizures. The IMF-VoE feature combines three intrinsic mode functions (IMFs) from the empirical mode decomposition of a EEG signal and the variance of the range between the upper and lower envelopes (VoE) of the signal. These multiple cues encode the intrinsic characteristics of seizure states, thus are able to distinguish them from the background. The feature is tested on 80.4 hours of EEG data with 10 seizures of 4 patients. The sensitivity of 100% is obtained with a low false detection rate of 0.16 per hour. Average time delays are 19.4s, 13.2s, and 10.7s at the false detection rates of 0.16 per hour, 0.27 per hour, and 0.41 per hour respectively, when different thresholds are used. The result is competitive among recent studies. In addition, since the IMF-VoE is compact, the detection system is of high computational efficiency and able to run in real time.

  20. Aspartame has no effect on seizures or epileptiform discharges in epileptic children.

    PubMed

    Shaywitz, B A; Anderson, G M; Novotny, E J; Ebersole, J S; Sullivan, C M; Gillespie, S M

    1994-01-01

    The effects of aspartame (L-aspartyl-L-phenylalanine methyl ester; APM) on the neurological status of children with well-documented seizures were examined in a randomized, double-blind, placebo-controlled, crossover study. We report on 10 children (5 boys, 5 girls, ages 5-13 yr) who were tested for 2 weeks each on APM and placebo (single morning dose, 34 mg/kg). Seven children had generalized convulsions with 4 also having absence episodes. One child had absence seizures and 2 had complex partial seizures only. On each arm of the study, children were admitted to the hospital for a standard 21-lead electroencephalogram (EEG), continuous 24-hour cassette EEG, and determination of biochemical variables in plasma and urine. Subjects completed the Subjects Treatment Emergent Symptoms Scale (STESS) and parents the Conners Behavior Rating Scale. There were no significant differences between APM and placebo in the standard EEG or 24-hour EEG. No differences were noted for the STESS or the Conners ratings, and no differences were noted for any of the biochemical measures (except for expected increases in phenylalanine and tyrosine after APM). Our findings indicate that, in this group of vulnerable children, APM does not provoke seizures.

  1. Children with convulsive epileptic seizures presenting to padua pediatric emergency department: the first retrospective population-based descriptive study in an Italian Health District.

    PubMed

    Bergamo, Silvia; Parata, Francesca; Nosadini, Margherita; Boniver, Clementina; Toldo, Irene; Suppiej, Agnese; Vecchi, Marilena; Amigoni, Angela; Da Dalt, Liviana; Zanconato, Stefania; Perilongo, Giorgio; Sartori, Stefano

    2015-03-01

    Convulsive epileptic seizures in children represent a common cause of admission to pediatric emergency department. Data about incidence, etiology, and outcome are still lacking in literature. We retrospectively reviewed medical records of children presenting to our pediatric emergency department with convulsive seizures during a 12-month period and collected their diagnoses over the following year. In all, 182 children met the inclusion criteria, for a total of 214 visits (1.2% of all attendances, n = 24 864). Seizures lasted less than 5 minutes in 76%, 5 to 30 minutes in 20%, 30 to 60 minutes in 2%, and over 60 minutes in 2% visits ("early," "established," "refractory," convulsive status epilepticus, respectively). Incidence of "early" (seizure lasting 5-30 minutes) and "established" (seizure lasting 30-60 minutes) status epilepticus was 52/100 000/year and 7/100 000/year respectively. Most common causes were febrile seizures (56%) and remote symptomatic seizures (19%). Knowing the epidemiology of convulsive seizures in children is important to guide appropriate management and individualized follow-up.

  2. Chronic metformin treatment facilitates seizure termination.

    PubMed

    Yang, Yong; Zhu, Binglin; Zheng, Fangshuo; Li, Yun; Zhang, Yanke; Hu, Yida; Wang, Xuefeng

    2017-03-04

    The AMP-activated protein kinase (AMPK) is a key energy sensor. Its activator metformin could suppress epileptogenesis in the pentylenetetrazol (PTZ) kindling model. However, the effect of metformin on the acute and chronic seizures has not been studied. We first detected the expression of AMPK in the brain tissue of human and mice with chronic seizures, as well as in mice with acute seizures. Second, using behavioral assay and local filed potentials (LFPs) recording, we investigated the effect of chronic metformin treatment on seizures in a acute seizure model and a chronic seizure model. Our results showed that AMPK was expressed in neurons in the epileptic brain. The expression level was decreased in the brain tissue that experienced chronic and acute seizures. In PTZ-induced acute seizures model, behavioral assay showed that chronic metformin treatment decreased the mortality, and LFPs recording showed that chronic metformin treatment shortened the duration of generalized tonic-clonic seizures and prolonged the duration of postictal depression. Moreover, in kainic acid-induced chronic seizures model, LFPs recording showed that chronic metformin treatment shortened the duration of epileptic activity. Our study suggests that chronic metformin treatment could facilitate seizure termination. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Detection of signs of brain dysfunction in epileptic children by recognition of transient changes in the correlation of seizure-free EEG.

    PubMed

    Righi, Marco; Barcaro, Umberto; Starita, Antonina; Karakonstantaki, Eleni; Micheloyannis, Sifis

    2008-09-01

    Seizure-free EEG signals recorded from epileptic children were compared with EEG signals recorded from normal children. The comparison was based on the detection of transient events characterized by decrease in the correlation between different traces. For this purpose, a conceptually and mathematically simple method was applied. Two clear and remarkable phenomena, able to quantitatively discriminate between the two groups of subjects, were evidenced, with high statistical significance. In fact, it was observed that: (a) The number of events for the epileptic group was larger; (b) Applying restrictive criteria for event definition, the number of subjects in the epileptic group presenting events was larger. The results support the hypothesis of a decrease in brain correlation in children with epilepsy under treatment. This confirms the efficacy of the EEG signal in evaluating cortical functional differences not visible by visual inspection, independently of the cause (epilepsy or drugs), and demonstrate the specific effectiveness of the analysis method applied.

  4. [A case of a pediatric patient with tuberous sclerosis (Bourneville-Pringle disease) and frequent epileptic seizure for intensive dental treatment under general anesthesia].

    PubMed

    Mimura, Shinichiro; Kikura, Mutsuhito; Itagaki, Taiga; Inokuma, Mie; Iwamoto, Tatsuaki; Kawakubo, Atsushi; Hirano, Kazuhiro; Sato, Shigehito

    2006-04-01

    Tuberous sclerosis (Bourneville-Pringle disease) is a rare disease with a triad of mental retardation, epilepsy, and facial spot. Management of the patients with tuberous sclerosis under general anesthesia has been previously reported. However, there are few case reports about management under general anesthesia of a pediatric patient with tuberous sclerosis with frequent epileptic seizure. Here, we report a case of a pediatric patient with tuberous sclerosis and frequent epileptic seizure who underwent intensive dental treatment under general anesthesia with careful management of epilepsy. The patient was discharged on the day of surgery without any complications. In this case report, we discussed the appropriate assessment of the complications of tuberous sclerosis; such as, of central nervous, circulatory, respiratory, endocrine, and urinary systems including the management of general anesthesia.

  5. Analysis of resting noise characteristics of three EIT systems in order to compare suitability for time difference imaging with scalp electrodes during epileptic seizures.

    PubMed

    Fabrizi, L; McEwan, A; Woo, E; Holder, D S

    2007-07-01

    Electrical impedance tomography measurements in clinical applications are limited by an undesired noise component. We have investigated the noise in three systems suitable for imaging epileptic seizures, the UCH Mark1b, UCH Mark2.5 and KHU Mark1 16 channel, at applied frequencies in three steps from 1 to 100 kHz, by varying load impedance, single terminal or multiplexed measurements, and in test objects of increasing complexity from a resistor to a saline filled tank and human volunteer. The noise was white, and increased from about 0.03% rms on the resistor to 0.08% on the human; it increased with load but was independent of use of the multiplexer. The KHU Mark1 delivered the best performance with noise spectra of about 0.02%, which could be further reduced by averaging to a level where reliable imaging of changes of about 0.1% estimated during epileptic seizures appears plausible.

  6. Seizures

    MedlinePlus

    ... Your 1- to 2-Year-Old First Aid: Seizures KidsHealth > For Parents > First Aid: Seizures Print A A A en español Folleto de instructiones: Convulsiones (Seizures) Although seizures can be frightening, many last only ...

  7. Epileptic Seizure Detection Using Lacunarity and Bayesian Linear Discriminant Analysis in Intracranial EEG.

    PubMed

    Zhou, Weidong; Liu, Yinxia; Yuan, Qi; Li, Xueli

    2013-12-01

    Automatic seizure detection plays an important role in long-term epilepsy monitoring, and seizure detection algorithms have been intensively investigated over the years. This paper proposes an algorithm for seizure detection using lacunarity and Bayesian linear discriminant analysis (BLDA) in long-term intracranial EEG. Lacunarity is a measure of heterogeneity for a fractal. The proposed method first conducts wavelet decomposition on EEGs with five scales, and selects the wavelet coefficients at scale 3, 4, and 5 for subsequent processing. Effective features including lacunarity and fluctuation index are extracted from the selected three scales, and then sent into the BLDA for training and classification. Finally, postprocessing which includes smoothing, threshold judgment, multichannels integration, and collar technique is applied to obtain high sensitivity and low false detection rate. The proposed algorithm is evaluated on 289.14 h intracranial EEG data from 21-patient Freiburg dataset and yields a sensitivity of 96.25% and a false detection rate of 0.13/h with a mean delay time of 13.8 s.

  8. Epileptic seizures in a population of 6000. II: Treatment and prognosis.

    PubMed Central

    Goodridge, D M; Shorvon, S D

    1983-01-01

    Treatment and prognosis were studied in 122 patients with non-febrile seizures in a population of 6000. Phenytoin and phenobarbitone were the most commonly prescribed drugs, although the popularity of phenobarbitone had declined over time. The average duration of treatment was relatively short, and most patients received single drug treatment. Treatment patterns were erratic, and the surveillance and audit of treatment generally poor. Recurrence after a first attack was found in four fifths of the patients. Generally the total number of seizures suffered by each patient was small, the period of active epilepsy short, and remission when it occurred was usually permanent. The cumulative probability of continuing activity fell and the proportion of patients in remission rose over time. Patients with partial or mixed seizure types had a poorer overall prognosis. The course of the epilepsy in the early years of treatment proved to be a useful guide to the long term prognosis, and the possibility that effective treatment might influence long term prognosis is raised. PMID:6411264

  9. Evaluating the role of astrocytes on β-estradiol effect on seizures of Pilocarpine epileptic model.

    PubMed

    Sarfi, Masoumeh; Elahdadi Salmani, Mahmoud; Goudarzi, Iran; Lashkar Boluki, Taghi; Abrari, Kataneh

    2017-02-15

    Epilepsy with periodic and unpredictable seizures is associated with hippocampal glutamate toxicity and tissue reorganization. Astrocytes play an important role in mediating the neuroprotective effects of estradiol and reducing seizure severity. Accordingly, the protective effects of low and high doses of estradiol on behavioral, astrocytic involvement and neuronal survival aspects of Pilocarpine-induced epilepsy were investigated. Lithium- Pilocarpine (30mg/kg) model was used to provoke epilepsy. Βeta-estradiol (2,40μg/µl) was injected subcutaneously from 48 before to 48h after seizure induction. Behavioral convulsions were then monitored and recorded on the day of induction. Four weeks later, glutamine synthetase (GS) activity and the astrocyte transporter GLT-1 expression of the hippocampus were measured. Moreover, hippocampal glutamate and GABA were evaluated to study excitability changes. Finally, neuronal counting in the hippocampus was also performed using Nissl staining. The latency for generalized clonic (GC) convulsions significantly increased while the rate of GC and death significantly reduced due to β-estradiol treatment. GS activity and GLT-1 expression increased in the groups receiving the high dose of β-estradiol and Pilocarpine. Furthermore, the amount of both GABA and glutamate content decreased due to high dose of estradiol, while only GABA increased in Pilocarpine treated rats. Finally, administration of β-estradiol with low and high doses increased and improved the density of nerve cells. It is concluded that chronic administration β-estradiol has anticonvulsant and neuroprotective properties which are plausibly linked to astrocytic activity.

  10. Dynamics of large-scale brain activity in normal arousal states and epileptic seizures

    NASA Astrophysics Data System (ADS)

    Robinson, P. A.; Rennie, C. J.; Rowe, D. L.

    2002-04-01

    Links between electroencephalograms (EEGs) and underlying aspects of neurophysiology and anatomy are poorly understood. Here a nonlinear continuum model of large-scale brain electrical activity is used to analyze arousal states and their stability and nonlinear dynamics for physiologically realistic parameters. A simple ordered arousal sequence in a reduced parameter space is inferred and found to be consistent with experimentally determined parameters of waking states. Instabilities arise at spectral peaks of the major clinically observed EEG rhythms-mainly slow wave, delta, theta, alpha, and sleep spindle-with each instability zone lying near its most common experimental precursor arousal states in the reduced space. Theta, alpha, and spindle instabilities evolve toward low-dimensional nonlinear limit cycles that correspond closely to EEGs of petit mal seizures for theta instability, and grand mal seizures for the other types. Nonlinear stimulus-induced entrainment and seizures are also seen, EEG spectra and potentials evoked by stimuli are reproduced, and numerous other points of experimental agreement are found. Inverse modeling enables physiological parameters underlying observed EEGs to be determined by a new, noninvasive route. This model thus provides a single, powerful framework for quantitative understanding of a wide variety of brain phenomena.

  11. Encapsulated galanin-producing cells attenuate focal epileptic seizures in the hippocampus.

    PubMed

    Nikitidou, Litsa; Torp, Malene; Fjord-Larsen, Lone; Kusk, Philip; Wahlberg, Lars U; Kokaia, Mérab

    2014-01-01

    Encapsulated cell biodelivery (ECB) is a relatively safe approach, since the devices can be removed in the event of adverse effects. The main objectives of the present study were to evaluate whether ECB could be a viable alternative of cell therapy for epilepsy. We therefore developed a human cell line producing galanin, a neuropeptide that has been shown to exert inhibitory effects on seizures, most likely acting via decreasing glutamate release from excitatory synapses. To explore whether ECB of genetically modified galanin-producing human cell line could provide seizure-suppressant effects, and test possible translational prospect for clinical application, we implanted ECB devices bilaterally into the hippocampus of rats subjected to rapid kindling, a model for recurrent temporal lobe seizures. Two clones from a genetically modified human cell line secreting different levels of galanin were tested. Electroencephalography (EEG) recordings and stimulations were performed by electrodes implanted into the hippocampus at the same surgical session as ECB devices. One week after the surgery, rapid kindling stimulations were initiated. Enzyme-linked immunosorbent assay (ELISA) measurements prior to device implantation showed a release of galanin on average of 8.3 ng/mL/24 h per device for the low-releasing clone and 12.6 ng/mL/24 h per device for the high-releasing clone. High-releasing galanin-producing ECB devices moderately decreased stimulation-induced focal afterdischarge duration, whereas low-releasing ECB devices had no significant effect. Our study shows that galanin-releasing ECB devices moderately suppress focal stimulation-induced recurrent seizures. Despite this moderate effect, the study provides conceptual proof that ECB could be a viable alternative approach to cell therapy in humans, with the advantage that the treatment could be terminated by removing these devices from the brain. Thereby, this strategy provides a higher level of safety for future

  12. Health related quality of life in patients admitted for video-electroencephalography monitoring diagnosed with epilepsy or psychogenic non-epileptic seizures.

    PubMed

    Yerdelen, Deniz; Altintas, Ebru

    2016-01-01

    To determine the health related quality of life (HRQOL) in patients with epilepsy or psychogenic non-epileptic seizures (PNES). This cross-sectional study was carried out between December 2010 and December 2014 in the Department of Neurology and Psychiatry, Faculty of Medicine, Baskent University, Adana, Turkey. Patients who were admitted for video-electroencephalography monitoring and diagnosed of epileptic seizures or PNES were asked to complete a questionnaire from the World Health Organization Quality of Life, and psychiatric comorbidities were diagnosed using the structured clinical interview for Diagnostic and Statistical Manual of Mental Disorders Fourth Edition. Patients with epilepsy and PNES were found to have similar HRQOL in physical, psychological, social, and environmental domains. However, the percentage of comorbid psychiatric disorders were higher in patients with PNES than patients with epilepsy. Patients with epilepsy and PNES have similar HRQOL, and PNES are resistant to the standard medical therapies used for the treatment of epileptic seizures. The direct lifetime cost of undiagnosed PNES may be of equal with intractable epilepsy. A better understanding of the impact of PNES manifestations and epilepsy would help to provide appropriate clinical, psychological and social care.

  13. Epileptic Encephalopathies.

    PubMed

    Germain, Blair; Maria, Bernard L

    2017-01-01

    Epileptic encephalopathies encompass a heterogeneous group of epilepsy syndromes that manifest with cognitive, behavioral, and neurologic deficits, seizures that are often intractable and multiform, aggressive electroencephalographic paroxysmal activity, and sometimes early death. As more is learned about the etiologies and manifestations of epileptic encephalopathies, progress has been made toward better treatment options. However, there is still a great need for further randomized controlled trials and research to help create clinically effective therapies. The 2015 Neurobiology of Disease in Children symposium, held in conjunction with the 44th annual meeting of the Child Neurology Society, aimed to (1) describe the clinical concerns involving diagnosis and treatment, (2) review the current status of understanding in the pathogenesis of epileptic encephalopathy, (3) discuss clinical management and therapies for epileptic encephalopathy, and (4) define future directions of research. This article summarizes the presentations and includes an edited transcript of question-and-answer sessions.

  14. Wavelet Jensen Shannon divergence as a tool for studying the dynamics of frequency band components in EEG epileptic seizures

    NASA Astrophysics Data System (ADS)

    Pereyra, M. E.; Lamberti, P. W.; Rosso, O. A.

    2007-06-01

    We develop a quantitative method of analysis of EEG records. The method is based on the wavelet analysis of the record and on the capability of the Jensen-Shannon divergence (JSD) to identify dynamical changes in a time series. The JSD is a measure of distance between probability distributions. Therefore for its evaluation it is necessary to define a (time dependent) probability distribution along the record. We define this probability distribution from the wavelet decomposition of the associated time series. The wavelet JSD provides information about dynamical changes in the scales and can be considered a complementary methodology reported earlier [O.A. Rosso, S. Blanco, A. Rabinowicz, Signal Processing 86 (2003) 1275; O.A. Rosso, S. Blanco, J. Yordanova, V. Kolev, A. Figliola, M. Schürmann, E. Başar, J. Neurosci. Methods 105 (2001) 65; O.A. Rosso, M.T. Martin, A. Figliola, K. Keller, A. Plastino, J. Neurosci. Methods 153 (2006) 163]. In the present study we have demonstrated it by analyzing EEG signal of tonic-clonic epileptic seizures applying the JSD method. The display of the JSD curves enables easy comparison of frequency band component dynamics. This would, in turn, promise easy and successful comparison of the EEG records from various scalp locations of the brain.

  15. Vagal stimulation for control of complex partial seizures in medically refractory epileptic patients.

    PubMed

    Wilder, B J; Uthman, B M; Hammond, E J

    1991-01-01

    Chronic intermittent stimulation of the vagus nerve is a new method currently being tested for the treatment of medically intractable complex partial seizures (CPS). We have studied the effects of vagal stimulation in nine patients with CPS for 4-16 months to determine its safety and efficacy. With the patients maintained on constant dosages of antiepileptic drugs, we recorded the electroencephalogram and electrocardiogram, and performed clinical laboratory tests and gastric analysis over a 6-week baseline period. The neurocybernetic prosthesis (NCP) was then implanted and connected to two spiral electrodes wound around the left vagus nerve. After a 4-week placebo period, vagal stimulation was started. Stimulation parameters were increased stepwise at monthly intervals until patients were being stimulated for 30-second periods at 20-50 Hz with 1-2 mA of current at 250-500 microseconds pulses. A second 4-week placebo period was added 3 months after the implantation. Thereafter, vagal stimulation was resumed and self-stimulation with magnetic activation was allowed for a 1-minute period at the onset of an aura. Six patients had a significant reduction in the frequency, intensity, or duration of seizures. All patients tolerated the implantation and stimulation well and none reported pain, discomfort, or important changes in their daily activities, sleep habits, eating, swallowing, or breathing. There were no remarkable changes in blood pressure or heart rate.

  16. Overtightening of halo pins resulting in intracranial penetration, pneumocephalus, and epileptic seizure.

    PubMed

    Glover, Alexander W; Zakaria, Rasheed; May, Paul; Barrett, Chris

    2013-01-01

    A 60-year-old man sustained an undisplaced type III odontoid fracture following a fall down a full flight of stairs. His medical history was remarkable for a partial pancreatectomy and splenectomy in 2006 for chronic pancreatitis. This had rendered him diabetic, on insulin, and he required long-term administration of penicillin V. The fracture was treated with a halo vest, and, unknowing of its potentially serious consequences, the patient continued to tighten the halo pins himself. He presented 1 month later following a witnessed seizure. A computed tomography scan was performed, which demonstrated 2 cranial perforations, with the halo pins penetrating the cranium and resultant pneumocephalus. He was started on antiepileptic medication and was placed in a pinless halo system. He had no further seizures and has made an uneventful neurological recovery. This paper serves to highlight the potential complications which may arise from the use of a halo vest. Proper patient education is essential to avoid these serious yet avoidable events, and patients with low bone density and the immunosuppressed should be monitored closely.

  17. Can cortical silent period and motor threshold be practical parameters in the comparison of patients with generalized epilepsy and patients with psychogenic non-epileptic seizures?.

    PubMed

    İpekdal, İlker H; Karadaş, Ömer; Ulaş, Ümit H; Vural, Okay

    2013-01-01

    This study aimed to compare the cortical excitability of patients with generalized tonic-clonic seizures (GTCSs) and that of patients with psychogenic non-epileptic seizures (PNESs). Patients were classified into groups according to their electroencephalogram (EEG) findings and seizure types: group 1 = GTCS with an abnormal EEG, group 2 = GTCS with a normal EEG and group 3 = PNES with a normal EEG. The control group included healthy volunteers with normal EEGs. Cortical silent period (CSP) and motor threshold (MT) were measured for all groups and the results were compared. CSPs were significantly prolonged in groups 1 and 2 when compared with group 3 and the control group. No differences were found between the MT measurements of all groups. The prolongation of CSP may demonstrate the differences between the pathophysiological mechanisms of GTCS and those of PNES. Copyright © 2012 S. Karger AG, Basel.

  18. Tonicity-responsive enhancer binding protein haplodeficiency attenuates seizure severity and NF-κB-mediated neuroinflammation in kainic acid-induced seizures

    PubMed Central

    Shin, H J; Kim, H; Heo, R W; Kim, H J; Choi, W S; Kwon, H M; Roh, G S

    2014-01-01

    Kainic acid (KA)-induced seizures followed by neuronal death are associated with neuroinflammation and blood–brain barrier (BBB) leakage. Tonicity-responsive enhancer binding protein (TonEBP) is known as a transcriptional factor activating osmoprotective genes, and in brain, it is expressed in neuronal nuclei. Thus dysregulation of TonEBP may be involved in the pathology of KA-induced seizures. Here we used TonEBP heterozygote (+/−) mice to study the roles of TonEBP. Electroencephalographic study showed that TonEBP (+/−) mice reduced seizure frequency and severity compared with wild type during KA-induced status epilepticus. Immunohistochemistry and western blotting analysis showed that KA-induced neuroinflammation and BBB leakage were dramatically reduced in TonEBP (+/−) mice. Similarly, TonEBP-specific siRNA reduced glutamate-induced death in HT22 hippocampal neuronal cells. TonEBP haplodeficiency prevented KA-induced nuclear translocation of NF-κB p65 and attenuated inflammation. Our findings identify TonEBP as a critical regulator of neuroinflammation and BBB leakage in KA-induced seizures, which suggests TonEBP as a good therapeutic target. PMID:24608792

  19. Tonicity-responsive enhancer binding protein haplodeficiency attenuates seizure severity and NF-κB-mediated neuroinflammation in kainic acid-induced seizures.

    PubMed

    Shin, H J; Kim, H; Heo, R W; Kim, H J; Choi, W S; Kwon, H M; Roh, G S

    2014-07-01

    Kainic acid (KA)-induced seizures followed by neuronal death are associated with neuroinflammation and blood-brain barrier (BBB) leakage. Tonicity-responsive enhancer binding protein (TonEBP) is known as a transcriptional factor activating osmoprotective genes, and in brain, it is expressed in neuronal nuclei. Thus dysregulation of TonEBP may be involved in the pathology of KA-induced seizures. Here we used TonEBP heterozygote (+/-) mice to study the roles of TonEBP. Electroencephalographic study showed that TonEBP (+/-) mice reduced seizure frequency and severity compared with wild type during KA-induced status epilepticus. Immunohistochemistry and western blotting analysis showed that KA-induced neuroinflammation and BBB leakage were dramatically reduced in TonEBP (+/-) mice. Similarly, TonEBP-specific siRNA reduced glutamate-induced death in HT22 hippocampal neuronal cells. TonEBP haplodeficiency prevented KA-induced nuclear translocation of NF-κB p65 and attenuated inflammation. Our findings identify TonEBP as a critical regulator of neuroinflammation and BBB leakage in KA-induced seizures, which suggests TonEBP as a good therapeutic target.

  20. Mutations in SLC13A5 Cause Autosomal-Recessive Epileptic Encephalopathy with Seizure Onset in the First Days of Life

    PubMed Central

    Thevenon, Julien; Milh, Mathieu; Feillet, François; St-Onge, Judith; Duffourd, Yannis; Jugé, Clara; Roubertie, Agathe; Héron, Delphine; Mignot, Cyril; Raffo, Emmanuel; Isidor, Bertrand; Wahlen, Sandra; Sanlaville, Damien; Villeneuve, Nathalie; Darmency-Stamboul, Véronique; Toutain, Annick; Lefebvre, Mathilde; Chouchane, Mondher; Huet, Frédéric; Lafon, Arnaud; de Saint Martin, Anne; Lesca, Gaetan; El Chehadeh, Salima; Thauvin-Robinet, Christel; Masurel-Paulet, Alice; Odent, Sylvie; Villard, Laurent; Philippe, Christophe; Faivre, Laurence; Rivière, Jean-Baptiste

    2014-01-01

    Epileptic encephalopathy (EE) refers to a clinically and genetically heterogeneous group of severe disorders characterized by seizures, abnormal interictal electro-encephalogram, psychomotor delay, and/or cognitive deterioration. We ascertained two multiplex families (including one consanguineous family) consistent with an autosomal-recessive inheritance pattern of EE. All seven affected individuals developed subclinical seizures as early as the first day of life, severe epileptic disease, and profound developmental delay with no facial dysmorphism. Given the similarity in clinical presentation in the two families, we hypothesized that the observed phenotype was due to mutations in the same gene, and we performed exome sequencing in three affected individuals. Analysis of rare variants in genes consistent with an autosomal-recessive mode of inheritance led to identification of mutations in SLC13A5, which encodes the cytoplasmic sodium-dependent citrate carrier, notably expressed in neurons. Disease association was confirmed by cosegregation analysis in additional family members. Screening of 68 additional unrelated individuals with early-onset epileptic encephalopathy for SLC13A5 mutations led to identification of one additional subject with compound heterozygous mutations of SLC13A5 and a similar clinical presentation as the index subjects. Mutations affected key residues for sodium binding, which is critical for citrate transport. These findings underline the value of careful clinical characterization for genetic investigations in highly heterogeneous conditions such as EE and further highlight the role of citrate metabolism in epilepsy. PMID:24995870

  1. Mutations in SLC13A5 cause autosomal-recessive epileptic encephalopathy with seizure onset in the first days of life.

    PubMed

    Thevenon, Julien; Milh, Mathieu; Feillet, François; St-Onge, Judith; Duffourd, Yannis; Jugé, Clara; Roubertie, Agathe; Héron, Delphine; Mignot, Cyril; Raffo, Emmanuel; Isidor, Bertrand; Wahlen, Sandra; Sanlaville, Damien; Villeneuve, Nathalie; Darmency-Stamboul, Véronique; Toutain, Annick; Lefebvre, Mathilde; Chouchane, Mondher; Huet, Frédéric; Lafon, Arnaud; de Saint Martin, Anne; Lesca, Gaetan; El Chehadeh, Salima; Thauvin-Robinet, Christel; Masurel-Paulet, Alice; Odent, Sylvie; Villard, Laurent; Philippe, Christophe; Faivre, Laurence; Rivière, Jean-Baptiste

    2014-07-03

    Epileptic encephalopathy (EE) refers to a clinically and genetically heterogeneous group of severe disorders characterized by seizures, abnormal interictal electro-encephalogram, psychomotor delay, and/or cognitive deterioration. We ascertained two multiplex families (including one consanguineous family) consistent with an autosomal-recessive inheritance pattern of EE. All seven affected individuals developed subclinical seizures as early as the first day of life, severe epileptic disease, and profound developmental delay with no facial dysmorphism. Given the similarity in clinical presentation in the two families, we hypothesized that the observed phenotype was due to mutations in the same gene, and we performed exome sequencing in three affected individuals. Analysis of rare variants in genes consistent with an autosomal-recessive mode of inheritance led to identification of mutations in SLC13A5, which encodes the cytoplasmic sodium-dependent citrate carrier, notably expressed in neurons. Disease association was confirmed by cosegregation analysis in additional family members. Screening of 68 additional unrelated individuals with early-onset epileptic encephalopathy for SLC13A5 mutations led to identification of one additional subject with compound heterozygous mutations of SLC13A5 and a similar clinical presentation as the index subjects. Mutations affected key residues for sodium binding, which is critical for citrate transport. These findings underline the value of careful clinical characterization for genetic investigations in highly heterogeneous conditions such as EE and further highlight the role of citrate metabolism in epilepsy.

  2. Counselling the Epileptic Patient

    PubMed Central

    Jones, Barry

    1983-01-01

    Today, most epileptics can participate freely in a wide range of activities. However, their epilepsy does create some special problems. The degree to which they participate in sports is governed by their degree of seizure control, as are their employment opportunities and driving privileges. Epilepsy does not appear to be a major stress factor in marriage as long as the spouse is knowledgeable about the condition. Epileptic women usually have normal pregnancies though their relative risks are perhaps double those for the non-epileptic population. Children of epileptic women have about four times the general population's risk of seizure but the absolute level of risk is not high. PMID:21286585

  3. Effect of different mild hypoxia manipulations on kainic acid-induced seizures in the hippocampus of rats.

    PubMed

    Yang, Yang; Chen, Jianhua; Li, Li; Gao, Yusong; Chen, Jun; Fei, Zhou; Liu, Weiping

    2013-01-01

    The protective effect of the mild hypoxia to the epilepsy has been widely tested. Although it is found that the hypoxia protects the brain by up-regulation of hypoxia-inducible factor-1α, few focused on systematic comparisons between different mild hypoxia manipulations and their effects. The male Sprague-Dawley rats were observed following exposure to hypoxia before and after epilepsy for 3 days with 90 min per day. The effects of different mild hypoxia manipulations on kainic acid-induced epilepsy were compared from the perspective of morphology, molecular biology and behavioral test. Results showed that different mild hypoxia manipulations could inhibit the cell apoptosis of kainic acid-induced rat hippocampus and improve their physiological functions. The effect of preconditioning group was better than that of postconditioning group and that of preconditioning and postconditioning with mild hypoxia group was the best among all the groups. The result showed that the preconditioning and postconditioning of mild hypoxia was recommended pre- and post-epilepsy and exposure to mild hypoxia should be prolonged. These findings might provide new ideas and methods for the clinical treatment of epilepsy.

  4. An Integrative Neurocircuit Perspective on Psychogenic Non-Epileptic Seizures and Functional Movement Disorders: Neural Functional Unawareness

    PubMed Central

    Perez, DL; Dworetzky, BA; Dickerson, BC; Leung, L; Cohn, R; Baslet, G; Silbersweig, DA

    2014-01-01

    Functional Neurological Disorder (conversion disorder) is a neurobehavioral condition frequently encountered by neurologists. Psychogenic Non-Epileptic Seizure (PNES) and Functional Movement Disorder (FMD) patients present to epileptologists and movement disorder specialists respectively, yet neurologists lack a neurobiological perspective through which to understand these enigmatic groups. Observational research studies suggest that PNES and FMD may represent variants of similar (or the same) conditions given that both groups exhibit a female predominance, have increased prevalence of mood-anxiety disorders, frequently endorse prior abuse, and share phenotypic characteristics. In this perspective article, neuroimaging studies in PNES and FMD are reviewed, and discussed using studies of emotional dysregulation, dissociation and psychological trauma in the context of motor control. Convergent neuroimaging findings implicate alterations in brain circuits mediating emotional expression, regulation and awareness (anterior cingulate and ventromedial prefrontal cortices, insula, amygdala, vermis), cognitive control and motor inhibition (dorsal anterior cingulate, dorsolateral prefrontal, inferior frontal cortices), self-referential processing and perceptual awareness (posterior parietal cortex, temporoparietal junction), and motor planning and coordination (supplementary motor area, cerebellum). Striatal-thalamic components of prefrontal-parietal networks may also play a role in pathophysiology. Aberrant medial prefrontal and amygdalar neuroplastic changes mediated by chronic stress may facilitate the development of functional neurological symptoms in a subset of patients. Improved biological understanding of PNES and FMD will likely reduce stigma and aid the identification of neuroimaging biomarkers guiding treatment development, selection and prognosis. Additional research should investigate neurocircuit abnormalities within and across functional neurological disorder

  5. Calcification of the pineal gland: relationship to laterality of the epileptic foci in patients with complex partial seizures.

    PubMed

    Sandyk, R

    1992-01-01

    The right and left temporal lobes differ from each other with respect to the rate of intrauterine growth, the timing of maturation, rate of aging, anatomical organization, neurochemistry, metabolic rate, electroencephalographic measures, and function. These functional differences between the temporal lobes underlies the different patterns of psychopathology and endocrine reproductive disturbances noted in patients with temporolimbic epilepsy. The right hemisphere has greater limbic and reticular connections than the left. Since the pineal gland receives direct innervation from the limbic system and the secretion of melatonin is influenced by an input from the reticular system, I propose that lesions in the right temporal lobe have a greater impact on pineal melatonin functions as opposed to those in the left dominant temporal lobe. Consequently, since calcification of the pineal gland is thought to reflect past secretory activity of the gland, I predicted a higher prevalence of pineal calcification (PC) in epileptic patients with right temporal lobe as opposed to those with left temporal lobe foci. To investigate this hypothesis, the prevalence of PC on CT scan was studied in a sample of 70 patients (43 men, 27 women, mean age: 29.2 years, range 9-58; SD = 10.1) with complex partial seizures, of whom 49 (70.0%) had a right temporal lobe focus. PC was present in 51 patients (72.8%) and was unrelated to any of the historical and demographic data surveyed. In the patients with a focus in the right temporal lobe, PC was present in 46 cases (93.8%) as compared to 5 of 21 patients (23.8%) with left temporal lobe foci.(ABSTRACT TRUNCATED AT 250 WORDS)

  6. Phase-Amplitude Coupling Is Elevated in Deep Sleep and in the Onset Zone of Focal Epileptic Seizures

    PubMed Central

    Amiri, Mina; Frauscher, Birgit; Gotman, Jean

    2016-01-01

    The interactions between different EEG frequency bands have been widely investigated in normal and pathologic brain activity. Phase-amplitude coupling (PAC) is one of the important forms of this interaction where the amplitude of higher frequency oscillations is modulated by the phase of lower frequency activity. Here, we studied the dynamic variations of PAC of high (gamma and ripple) and low (delta, theta, alpha, and beta) frequency bands in patients with focal epilepsy in different sleep stages during the interictal period, in an attempt to see if coupling is different in more or less epileptogenic regions. Sharp activities were excluded to avoid their effect on the PAC. The results revealed that the coupling intensity was generally the highest in stage N3 of sleep and the lowest in rapid eye movement sleep. We also compared the coupling strength in different regions [seizure onset zone (SOZ), exclusively irritative zone, and normal zone]. PAC between high and low frequency rhythms was found to be significantly stronger in the SOZ compared to normal regions. Also, the coupling was generally more elevated in spiking channels outside the SOZ than in normal regions. We also examined how the power in the delta band correlates to the PAC, and found a mild but statistically significant correlation between slower background activity in epileptic channels and the elevated coupling in these channels. The results suggest that an elevated PAC may reflect some fundamental abnormality, even after exclusion of sharp activities and even in the interictal period. PAC may therefore contribute to understanding the underlying dynamics of epileptogenic brain regions. PMID:27536227

  7. Seizure freedom is not adversely affected by early discontinuation of concomitant anti-epileptic drugs in the EULEV cohort of levetiracetam users.

    PubMed

    Droz-Perroteau, Cécile; Marchal, Cécile; Dureau-Pournin, Caroline; Lassalle, Régis; Jové, Jérémy; Robinson, Philip; Lavernhe, Gilles; Vespignani, Hervé; Moore, Nicholas; Fourrier-Réglat, Annie

    2012-11-01

    Fear of discontinuing concomitant anti-epileptic drugs (AEDs) may lead to potentially unnecessary and perhaps unsafe polypharmacy. The effect of withdrawing concomitant AEDs on epilepsy control was therefore studied in long-term users of levetiracetam. The EULEV cohort followed patients initiating levetiracetam in France in 2005 or 2006 for one year. In those maintaining levetiracetam throughout the study period, the association of a reduction in the number of concomitant AEDs during the first six months with seizure-freedom during the last six months of follow-up was investigated using logistic regression. Of the 356 patients continuing levetiracetam for at least 1 year, 140 (39.3%) were seizure-free during the last six months of follow-up. Partial symptomatic or generalised idiopathic epilepsy were associated with greater seizure-freedom than partial cryptogenic disease. Factors associated with seizures were: longer disease duration, initial incapacity, increased number of seizures in the six months preceding levetiracetam initiation, and number of consultations for epilepsy in the six months preceding levetiracetam initiation. There was a trend for the association between the early reduction in the number of concomitant AEDs and seizure-free status later during follow-up, which however did not reach statistical significance in the final propensity score-adjusted multivariate model (OR = 1.8, 95%CI [0.8;4.0]). Taking into account the various risk factors for seizures, the early reduction of concomitant AEDs was not associated with worse seizure rates during follow-up in real-life users of levetiracetam. Copyright © 2012 John Wiley & Sons, Ltd.

  8. Optimized Seizure Detection Algorithm: A Fast Approach for Onset of Epileptic in EEG Signals Using GT Discriminant Analysis and K-NN Classifier

    PubMed Central

    Rezaee, Kh.; Azizi, E.; Haddadnia, J.

    2016-01-01

    Background Epilepsy is a severe disorder of the central nervous system that predisposes the person to recurrent seizures. Fifty million people worldwide suffer from epilepsy; after Alzheimer’s and stroke, it is the third widespread nervous disorder. Objective In this paper, an algorithm to detect the onset of epileptic seizures based on the analysis of brain electrical signals (EEG) has been proposed. 844 hours of EEG were recorded form 23 pediatric patients consecutively with 163 occurrences of seizures. Signals had been collected from Children’s Hospital Boston with a sampling frequency of 256 Hz through 18 channels in order to assess epilepsy surgery. By selecting effective features from seizure and non-seizure signals of each individual and putting them into two categories, the proposed algorithm detects the onset of seizures quickly and with high sensitivity. Method In this algorithm, L-sec epochs of signals are displayed in form of a third-order tensor in spatial, spectral and temporal spaces by applying wavelet transform. Then, after applying general tensor discriminant analysis (GTDA) on tensors and calculating mapping matrix, feature vectors are extracted. GTDA increases the sensitivity of the algorithm by storing data without deleting them. Finally, K-Nearest neighbors (KNN) is used to classify the selected features. Results The results of simulating algorithm on algorithm standard dataset shows that the algorithm is capable of detecting 98 percent of seizures with an average delay of 4.7 seconds and the average error rate detection of three errors in 24 hours. Conclusion Today, the lack of an automated system to detect or predict the seizure onset is strongly felt. PMID:27672628

  9. The impact of conveying the diagnosis when using a biopsychosocial approach: A qualitative study among adolescents and young adults with NES (non-epileptic seizures).

    PubMed

    Karterud, Hilde Nordahl; Risør, Mette Bech; Haavet, Ole Rikard

    2015-01-01

    This qualitative study explored the impact of using a biopsychosocial approach to explain the diagnosis of non-epileptic seizures (NES). Semi-structured interviews of eleven adolescents and young adults who had participated in an inpatient follow-up stay of the diagnosis were used. The interviews were taped, transcribed, and analysed using systematic text condensation. Three key themes were identified:1."Threatened self-image": Patients initially perceived their diagnosis as being purely psychological. As they did not accept that they had mental disorders, they interpreted this as frightening and threatening, and resisted the diagnosis.2."Being believed and belief in oneself": Participants had many experiences of being suspected by healthcare providers of staging their seizures. Some had even begun to have doubts themselves as to whether the attacks were voluntary or not. Explaining that unconscious processes are involved in NES contributed towards increasing patients' feelings of being believed, and thereby acceptance of the diagnosis.3."Getting an explanation that makes sense": Some participants identified connections between their personal histories and their seizures and became seizure-free. Others found that the explanatory models gave personal meaning, but did not become seizure-free, while a few continued to doubt whether NES was the correct diagnosis. Being believed was the most elemental factor for coping with the condition. Using a biopsychosocial approach to explain the diagnosis may facilitate identification with the explanatory models, and thus acceptance of the diagnosis. Copyright © 2014 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  10. Protective effects of bupivacaine against kainic acid-induced seizure and neuronal cell death in the rat hippocampus.

    PubMed

    Chiu, Kuan Ming; Wu, Chia Chan; Wang, Ming Jiuh; Lee, Ming Yi; Wang, Su Jane

    2015-01-01

    The excessive release of glutamate is a critical element in the neuropathology of epilepsy, and bupivacaine, a local anesthetic agent, has been shown to inhibit the release of glutamate in rat cerebrocortical nerve terminals. This study investigated whether bupivacaine produces antiseizure and antiexcitotoxic effects using a kainic acid (KA) rat model, an animal model used for temporal lobe epilepsy, and excitotoxic neurodegeneration experiments. The results showed that administering bupivacaine (0.4 mg/kg or 2 mg/kg) intraperitoneally to rats 30 min before intraperitoneal injection of KA (15 mg/kg) increased seizure latency and reduced the seizure score. In addition, bupivacaine attenuated KA-induced hippocampal neuronal cell death, and this protective effect was accompanied by the inhibition of microglial activation and production of proinflammatory cytokines such as interleukin (IL)-1β, IL-6, and tumor necrosis factor-α in the hippocampus. Moreover, bupivacaine shortened the latency of escaping onto the platform in the Morris water maze learning performance test. Collectively, these data suggest that bupivacaine has therapeutic potential for treating epilepsy.

  11. Domoic acid-induced seizures in California sea lions (Zalophus californianus) are associated with neuroinflammatory brain injury.

    PubMed

    Kirkley, Kelly S; Madl, James E; Duncan, Colleen; Gulland, Frances M; Tjalkens, Ronald B

    2014-11-01

    California sea lions (CSLs) exposed to the marine biotoxin domoic acid (DA) develop an acute or chronic toxicosis marked by seizures and act as sentinels of the disease. Experimental evidence suggests that oxidative stress and neuroinflammation are important mechanisms underlying the seizurogenic potential of environmental toxicants but these pathways are relatively unstudied in CSLs. In the current study, we investigated the role of glutamate-glutamine changes and gliosis in DA-exposed CSLs to better understand the neurotoxic mechanisms occurring during DA toxicity. Sections from archived hippocampi from control and CSLs diagnosed with DA toxicosis were immunofluorescently stained for markers of gliosis, oxidative/nitrative stress and changes in glutamine synthetase (GS). Quantitative assessment revealed increasing loss of microtubule associated protein-2 positive neurons with elevations in 4-hydroxynonenal correlating with chronicity of exposure, whereas the pattern of activated glia expressing nitric oxide synthase 2 and tumor necrosis factor followed pathological severity. There was no significant change in the amount of GS positive cells but there was increased 3-nitrotyrosine in GS expressing cells and in neurons, particularly in animals with chronic DA toxicosis. These changes were consistently seen in the dentate gyrus and in the cornu ammonis (CA) sectors CA3, CA4, and CA1. The results of this study indicate that gliosis and resultant changes in GS are likely important mechanisms in DA-induced seizure that need to be further explored as potential therapies in treating exposed wildlife.

  12. Prolonged exposure therapy for the treatment of patients diagnosed with psychogenic non-epileptic seizures (PNES) and post-traumatic stress disorder (PTSD).

    PubMed

    Myers, Lorna; Vaidya-Mathur, Urmi; Lancman, Marcelo

    2017-01-01

    Although there is general consensus that psychogenic non-epileptic seizures (PNES) are treated with psychotherapy, the effectiveness of most psychotherapeutic modalities remains understudied. In this treatment series of 16 patients dually diagnosed with PNES and post-traumatic stress disorder (PTSD), we evaluated the effect of prolonged exposure therapy (PE) on reduction of PNES. Secondary measures included Beck Depression Inventory (BDI-II) and Post-Traumatic Disorder Diagnostic Scale (PDS). Subjects diagnosed with video EEG-confirmed PNES and PTSD confirmed through neuropsychological testing and clinical interview were treated with traditional PE psychotherapy with certain modifications for the PNES. Treatment was conducted over the course of 12-15 weekly sessions. Seizure frequency was noted in each session by examining the patients' seizure logs, and mood and PTSD symptomatology was assessed at baseline and on the final session. Eighteen subjects enrolled, and 16 (88.8%) completed the course of treatment. Thirteen of the 16 (81.25%) therapy completers reported no seizures by their final PE session, and the other three reported a decline in seizure frequency (Z=-3.233, p=0.001). Mean scores on scales of depression (M=-13.56, SD=12.27; t (15)=-4.420, p<0,001) and PTSD symptoms (M=-17.1875, SD=13.01; t (15)=-5.281, p<0.001) showed significant improvement from baseline to final session. Longitudinal seizure follow up in 14 patients revealed that gains made on the final session were maintained at follow-up (Z=-1.069 p=0.285). Prolonged exposure therapy for patients dually diagnosed with PNES and PTSD reduced the number of PNES and improved mood and post traumatic symptomatology. Follow-up revealed that gains made in seizure control on the last day of treatment were maintained over time. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Video-ambulatory EEG in a secondary care center: A retrospective evaluation of utility in the diagnosis of epileptic and nonepileptic seizures.

    PubMed

    Lawley, Andrew; Manfredonia, Francesco; Cavanna, Andrea E

    2016-04-01

    The development and optimization of protocols using simultaneous video recording alongside long-term electroencephalography (EEG), such as ambulatory EEG (AEEG), expanded the range of available techniques for the investigation of paroxysmal clinical events. In particular, video-AEEG has received increasing attention over the last few years because of its potential to further improve diagnostic utility in the differential diagnosis between epileptic and nonepileptic seizures. We retrospectively evaluated 88 video-AEEG studies in order to assess the diagnostic utility of video-AEEG in 87 patients consecutively referred to a neurophysiology department. Typical clinical events occurred during 55 studies (62.5%). In 26 of these, at least one event was also clearly seen on video recording, contributing to a confident diagnosis. Clinical events were classified according to three diagnostic categories: epileptic seizures (6 studies, 6.8%), physiologic nonepileptic events (13 studies, 14.8%), or psychogenic nonepileptic seizures (36 studies, 40.9%). Of the studies with an event not recorded on video, a confident diagnosis could be reached in 55.2% of cases. The main reason for unsuccessful video recording was failure to activate the camcorder by the patient or carer. We found an overall diagnostic utility of 67.0%, which confirms the findings of previous reports evaluating the diagnostic yield of AEEG. Implementation of video-AEEG protocols in a secondary care center appears to have high diagnostic utility, particularly for patients with psychogenic nonepileptic seizures. Our findings prompt further research into the potential applications of video-AEEG, in consideration of important implications for successful patient management and healthcare resource allocation.

  14. Seizures

    MedlinePlus

    ... often with a loss of or change in consciousness. Seizures can be frightening, but most last only ... unusual sensations, uncontrollable muscle spasms, and loss of consciousness. Some seizures may be due to another medical ...

  15. Changes in the cannabinoid (CB1) receptor expression level and G-protein activation in kainic acid induced seizures.

    PubMed

    Bojnik, Engin; Turunç, Ezgi; Armağan, Güliz; Kanıt, Lütfiye; Benyhe, Sándor; Yalçın, Ayfer; Borsodi, Anna

    2012-03-01

    It has been known for centuries that exogenous cannabinoids, such as tetrahydrocannabinol have anticonvulsant activity. Recent studies have advanced our understanding of the endogenous cannabinoid system and renewed the interest in cannabinoids as a potential treatment for epilepsy. The endogenous cannabinoid system is rapidly activated after seizure activity but still little is known about the molecular mechanisms underlying the role of the cannabinoid system in epilepsy. In this study epileptiform activity was induced by kainic acid (KA) and effects of the CB1 receptor agonists N-(2-Chloroethyl)-5Z,8Z,11Z,14Z-eicosatetraenamide (ACEA) on G-protein signaling using the agonist-stimulated [(35)S]GTPγS binding assay were evaluated. Control and KA treated rat hippocampus and cortex membranes were used. Our results showed that the ACEA displayed a high potency and efficacy in stimulating the G-proteins and when compared to the control animals, significant enhancements were observed in tissues from the KA treated animals. Potency and efficacy values were in particular increased in the hippocampus tissues. Furthermore, gene expression levels of the cannabinoid receptor 1 (CB1) receptor and cannabinoid receptor interacting protein 1 (CRIP1) were measured by RT-PCR, where both CB1 and CRIP1 expressions were found to be elevated in the KA treated animals. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Seizures

    MedlinePlus

    ... because of sudden, abnormal electrical activity in the brain. When people think of seizures, they often think of convulsions in which a person's body shakes rapidly and uncontrollably. Not all seizures ... part of the brain. Generalized seizures are a result of abnormal activity ...

  17. The body comes to family therapy: Treatment of a school-aged boy with hyperventilation-induced non-epileptic seizures.

    PubMed

    Kozlowska, Kasia; Chudleigh, Catherine; Elliott, Bronwen; Landini, Andrea

    2016-10-01

    We present the case of a 10-year-old boy, Evan, where a knock to the head activated memories of past bullying, causing intense distress, activation of the body's stress-regulation systems and recurrent hospital presentations with hyperventilation-induced non-epileptic seizures. We describe the initial assessment session that enabled Evan and his family to understand the context for Evan's non-epileptic seizures, to engage with the therapeutic team and to collaborate in the implementation of a mind-body multimodal family-based intervention. Once the physical symptoms had been addressed therapeutically, we explored possible dangers within the family and school systems and we worked with Evan and his family to increase his ability to access comfort and protection from his parents. Our short hospital intervention highlighted the importance of ongoing therapeutic work with Evan and the family and laid the foundation stones for the next part of the family's therapeutic journey. © The Author(s) 2015.

  18. Bumetanide, an NKCC1 antagonist, does not prevent formation of epileptogenic focus but blocks epileptic focus seizures in immature rat hippocampus.

    PubMed

    Nardou, Romain; Ben-Ari, Yehezkel; Khalilov, Ilgam

    2009-06-01

    Excitatory GABA action induced by high [Cl(-)](i) is thought to contribute to seizure generation in neonatal neurons although the mechanism of this effect remains unclear. We report that bumetanide, a NKCC1 antagonist, reduces driving force of GABA-mediated currents (DF(GABA)) in neonatal hippocampal neurons and blocks the giant depolarizing potentials (GDPs), a spontaneous pattern of network activity. In the preparation composed of two intact interconnected hippocampi, bumetanide did not prevent generation of kainate-induced seizures, their propagation to the contralateral hippocampus, and formation of an epileptogenic mirror focus. However, in the isolated mirror focus, bumetanide effectively blocked spontaneous epileptiform activity transforming it to the GDP-like activity pattern. Bumetanide partially reduced DF(GABA) and therefore the excitatory action of GABA in epileptic neurons. Therefore bumetanide is a potent anticonvulsive agent although it cannot prevent formation of the epileptogenic mirror focus. We suggest that an additional mechanism other than NKCC1-mediated contributes to the persistent increase of DF(GABA) in epileptic neurons.

  19. Diurnal patterns and relationships between physiological and self-reported stress in patients with epilepsy and psychogenic non-epileptic seizures.

    PubMed

    Novakova, Barbora; Harris, Peter R; Reuber, Markus

    2017-05-01

    Patients with epilepsy and those with psychogenic non-epileptic seizures (PNES) experience high levels of stress and stress is one of the most frequently self-identified seizure precipitants. Although stress is a multifaceted phenomenon, few studies have systematically examined its different components in patients with seizures. The aim of this study was therefore to describe diurnal patterns of psychological and physiological measures of stress in patients with epilepsy and patients with PNES, and explore their relationships to each other in order to improve our understanding of the mechanisms underlying stress and seizure occurrence in these patients. A range of stress markers including self-reported stress, salivary cortisol, and heart rate variability (HRV) were explored in adult patients with refractory epilepsy (N=22) and those with PNES (N=23) undergoing three- to five-day video-telemetry. A diurnal pattern was observed in the physiological measures, characterized by higher levels of physiological arousal in the mornings and lower levels at night in both patients with epilepsy and PNES. The physiological measures (cortisol and HRV) were associated with each other in patients with epilepsy; no close relationship was found with self-reported stress in either of the two patient groups. The findings contribute to and expand on previous studies of the patterns of stress in patients with seizures. The results also indicate a discrepancy between patients' physiological responses and their subjective stress perceptions, suggesting that simple self-reports cannot be used as a proxy of physiological arousal in patients with seizures and stress. Stress in these patient groups should be studied using a combination of complementary measures. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Parvalbumin interneurons and calretinin fibers arising from the thalamic nucleus reuniens degenerate in the subiculum after kainic acid-induced seizures.

    PubMed

    Drexel, M; Preidt, A P; Kirchmair, E; Sperk, G

    2011-08-25

    The subiculum is the major output area of the hippocampus. It is closely interconnected with the entorhinal cortex and other parahippocampal areas. In animal models of temporal lobe epilepsy (TLE) and in TLE patients it exerts increased network excitability and may crucially contribute to the propagation of limbic seizures. Using immunohistochemistry and in situ-hybridization we now investigated neuropathological changes affecting parvalbumin and calretinin containing neurons in the subiculum and other parahippocampal areas after kainic acid-induced status epilepticus. We observed prominent losses in parvalbumin containing interneurons in the subiculum and entorhinal cortex, and in the principal cell layers of the pre- and parasubiculum. Degeneration of parvalbumin-positive neurons was associated with significant precipitation of parvalbumin-immunoreactive debris 24 h after kainic acid injection. In the subiculum the superficial portion of the pyramidal cell layer was more severely affected than its deep part. In the entorhinal cortex, the deep layers were more severely affected than the superficial ones. The decrease in number of parvalbumin-positive neurons in the subiculum and entorhinal cortex correlated with the number of spontaneous seizures subsequently experienced by the rats. The loss of parvalbumin neurons thus may contribute to the development of spontaneous seizures. On the other hand, surviving parvalbumin neurons revealed markedly increased expression of parvalbumin mRNA notably in the pyramidal cell layer of the subiculum and in all layers of the entorhinal cortex. This indicates increased activity of these neurons aiming to compensate for the partial loss of this functionally important neuron population. Furthermore, calretinin-positive fibers terminating in the molecular layer of the subiculum, in sector CA1 of the hippocampus proper and in the entorhinal cortex degenerated together with their presumed perikarya in the thalamic nucleus reuniens. In

  1. Does transcranial stimulation for motor evoked potentials (TcMEP) worsen seizures in epileptic patients following spinal deformity surgery?

    PubMed

    Salem, Khalid M I; Goodger, Laura; Bowyer, Katherine; Shafafy, Masood; Grevitt, Michael P

    2016-10-01

    To investigate the effect of Transcranial Motor Evoked Potentials (TcMEP) in increasing the severity or frequency of post-operative seizures in patients undergoing deformity corrective spine surgery with a known history of seizures pre-operatively. The information on all patients with history of epilepsy/seizures who underwent spinal TcMEP cord monitoring for deformity correction surgery was retrospectively collected through a review of the hospital notes. The benefits of TcMEP in the early detection of potential cord ischemia were deemed by the operating surgeon to outweigh the increased risks of seizures, tongue biting, etc. Data on age, gender, pre-operative diagnosis, curve type, intra-operative monitoring alerts, duration of hospital stay, and post-operative in-hospital seizures were collected. Additionally, the patients were contacted following discharge and data on any change in the frequency of the seizures or an alteration in seizure-related medication post-operatively was also collected. The records of 449 consecutively monitored patients were reviewed and 12 (2.7 %) patients with a history of seizures pre-operatively were identified. The mean age was 23 (9-59) years, 7 females, 11 scoliosis corrections (4 neuromuscular, 1 degenerative, 6 idiopathic adolescent), and one sagittal balance correction surgery. Intra-operatively, all patients had TcMEP monitoring, were catheterised, and had no neuromonitoring alerts or record of tongue biting or laceration. Post-operatively, the mean hospital stay was 12 (4-25) days with no recorded seizures. At a mean of 23 (12-49) months post-discharge, none of the patients reported a worsening of seizures (pattern or frequency) or required an alteration in the seizure-related medications. TcMEP does not appear to trigger intra-operative or post-operative seizures and is not associated with deterioration in the seizure control of patients suffering seizures pre-operatively.

  2. Low distribution of synaptic vesicle protein 2A and synaptotagimin-1 in the cerebral cortex and hippocampus of spontaneously epileptic rats exhibiting both tonic convulsion and absence seizure.

    PubMed

    Hanaya, R; Hosoyama, H; Sugata, S; Tokudome, M; Hirano, H; Tokimura, H; Kurisu, K; Serikawa, T; Sasa, M; Arita, K

    2012-09-27

    The spontaneously epileptic rat (SER) is a double mutant (zi/zi, tm/tm) which begins to exhibit tonic convulsions and absence seizures after 6 weeks of age, and repetitive tonic seizures over time induce sclerosis-like changes in SER hippocampus with high brain-derived neurotrophic factor (BDNF) expression. Levetiracetam, which binds to synaptic vesicle protein 2A (SV2A), inhibited both tonic convulsions and absence seizures in SERs. We studied SER brains histologically and immunohistochemically after verification by electroencephalography (EEG), as SERs exhibit seizure-related alterations in the cerebral cortex and hippocampus. SERs did not show interictal abnormal spikes and slow waves typical of focal epilepsy or symptomatic generalized epilepsy. The difference in neuronal density of the cerebral cortex was insignificant between SER and Wistar rats, and apoptotic neurons did not appear in SERs. BDNF distributions portrayed higher values in the entorhinal and piriform cortices which would relate with hippocampal sclerosis-like changes. Similar synaptophysin expression in the cerebral cortex and hippocampus was found in both animals. Low and diffuse SV2A distribution portrayed in the cerebral cortex and hippocampus of SERs was significantly less than that of all cerebral lobes and inner molecular layer (IML) of the dentate gyrus (DG) of Wistar rats. The extent of low SV2A expression/distribution in SERs was particularly remarkable in the frontal (51% of control) and entorhinal cortices (47%). Lower synaptotagmin-1 expression (vs Wistar rats) was located in the frontal (31%), piriform (13%) and entorhinal (39%) cortices, and IML of the DG (38%) in SER. Focal low distribution of synaptotagmin-1 accompanying low SV2A expression may contribute to epileptogenesis and seizure propagation in SER.

  3. Human Fetal Brain-Derived Neural Stem/Progenitor Cells Grafted into the Adult Epileptic Brain Restrain Seizures in Rat Models of Temporal Lobe Epilepsy

    PubMed Central

    Lee, Haejin; Yun, Seokhwan; Kim, Il-Sun; Lee, Il-Shin; Shin, Jeong Eun; Park, Soo Chul; Kim, Won-Joo; Park, Kook In

    2014-01-01

    Cell transplantation has been suggested as an alternative therapy for temporal lobe epilepsy (TLE) because this can suppress spontaneous recurrent seizures in animal models. To evaluate the therapeutic potential of human neural stem/progenitor cells (huNSPCs) for treating TLE, we transplanted huNSPCs, derived from an aborted fetal telencephalon at 13 weeks of gestation and expanded in culture as neurospheres over a long time period, into the epileptic hippocampus of fully kindled and pilocarpine-treated adult rats exhibiting TLE. In vitro, huNSPCs not only produced all three central nervous system neural cell types, but also differentiated into ganglionic eminences-derived γ-aminobutyric acid (GABA)-ergic interneurons and released GABA in response to the depolarization induced by a high K+ medium. NSPC grafting reduced behavioral seizure duration, afterdischarge duration on electroencephalograms, and seizure stage in the kindling model, as well as the frequency and the duration of spontaneous recurrent motor seizures in pilocarpine-induced animals. However, NSPC grafting neither improved spatial learning or memory function in pilocarpine-treated animals. Following transplantation, grafted cells showed extensive migration around the injection site, robust engraftment, and long-term survival, along with differentiation into β-tubulin III+ neurons (∼34%), APC-CC1+ oligodendrocytes (∼28%), and GFAP+ astrocytes (∼8%). Furthermore, among donor-derived cells, ∼24% produced GABA. Additionally, to explain the effect of seizure suppression after NSPC grafting, we examined the anticonvulsant glial cell-derived neurotrophic factor (GDNF) levels in host hippocampal astrocytes and mossy fiber sprouting into the supragranular layer of the dentate gyrus in the epileptic brain. Grafted cells restored the expression of GDNF in host astrocytes but did not reverse the mossy fiber sprouting, eliminating the latter as potential mechanism. These results suggest that human fetal

  4. Human fetal brain-derived neural stem/progenitor cells grafted into the adult epileptic brain restrain seizures in rat models of temporal lobe epilepsy.

    PubMed

    Lee, Haejin; Yun, Seokhwan; Kim, Il-Sun; Lee, Il-Shin; Shin, Jeong Eun; Park, Soo Chul; Kim, Won-Joo; Park, Kook In

    2014-01-01

    Cell transplantation has been suggested as an alternative therapy for temporal lobe epilepsy (TLE) because this can suppress spontaneous recurrent seizures in animal models. To evaluate the therapeutic potential of human neural stem/progenitor cells (huNSPCs) for treating TLE, we transplanted huNSPCs, derived from an aborted fetal telencephalon at 13 weeks of gestation and expanded in culture as neurospheres over a long time period, into the epileptic hippocampus of fully kindled and pilocarpine-treated adult rats exhibiting TLE. In vitro, huNSPCs not only produced all three central nervous system neural cell types, but also differentiated into ganglionic eminences-derived γ-aminobutyric acid (GABA)-ergic interneurons and released GABA in response to the depolarization induced by a high K+ medium. NSPC grafting reduced behavioral seizure duration, afterdischarge duration on electroencephalograms, and seizure stage in the kindling model, as well as the frequency and the duration of spontaneous recurrent motor seizures in pilocarpine-induced animals. However, NSPC grafting neither improved spatial learning or memory function in pilocarpine-treated animals. Following transplantation, grafted cells showed extensive migration around the injection site, robust engraftment, and long-term survival, along with differentiation into β-tubulin III+ neurons (∼34%), APC-CC1+ oligodendrocytes (∼28%), and GFAP+ astrocytes (∼8%). Furthermore, among donor-derived cells, ∼24% produced GABA. Additionally, to explain the effect of seizure suppression after NSPC grafting, we examined the anticonvulsant glial cell-derived neurotrophic factor (GDNF) levels in host hippocampal astrocytes and mossy fiber sprouting into the supragranular layer of the dentate gyrus in the epileptic brain. Grafted cells restored the expression of GDNF in host astrocytes but did not reverse the mossy fiber sprouting, eliminating the latter as potential mechanism. These results suggest that human fetal

  5. Fractal analysis of electroencephalographic signals intracerebrally recorded during 35 epileptic seizures: evaluation of a new method for synoptic visualisation of ictal events.

    PubMed

    Bullmore, E T; Brammer, M J; Bourlon, P; Alarcon, G; Polkey, C E; Elwes, R; Binnie, C D

    1994-11-01

    Traditional electroencephalography (EEG) produces a large volume display of brain electrical activity, which creates problems particularly in assessment of long periods of intracranial, stereoelectroencephalographic (SEEG) recording. A method for fractal analysis that describes 100 SEEG data points in terms of a single estimate of fractal dimension (1 < FD < 2) is reported; the central processing unit time costs amount to approximately 2 min/Mbyte of input signal (using a Sun SPARCstation LX). The diagnostic sensitivity of this method, applied to quantification and synoptic visualisation of SEEG signals recorded during 35 epileptic seizures in 7 patients, is evaluated. It is found that the method consistently defines ictal onset in terms of rapid relative increase in FD across several channels. Clinically severe seizures are characterised by more intense and generalised ictal changes in FD than clinically less severe events. For all 7 patients, and for 75% of individual seizures, "fractal diagnoses" of anatomically defined ictal onset zone coincided closely with ictal onset zone independently determined by inspection of traditional EEG displays of the same data. We conclude that the method is a computationally feasible way to achieve substantial reduction in the volume of SEEG data without undue loss of diagnostically important information in the primary signal.

  6. Inhibitory effect of group II mGluR agonist 2R, 4R-APDC on cell proliferation in dentate gyrus in rats with epileptic seizure.

    PubMed

    Yao, H; Feng, Y-B; Pang, Y-J; Xu, J-J; Yu, B-X; Liu, X-P

    2015-08-01

    Epileptic seizure can increase the cell proliferation in dentate gyrus in brain, but the mechanism remains unclear. In this study, using systemic bromodeoxyuridine (BrdU) to label the dividing cells, the inhibitory effect of group II metabotropic glutamate receptor (mGluR) agonist 2R, 4R-4-aminopyrrolidine-2, 4-dicarboxylate (2R, 4R-APDC) on cell proliferation in dentate gyrus in rats after pilocarpine-induced status epilepticus (SE) was investigated. Results found that, 2R, 4R-APDC could significantly inhibit the behavioral seizure and block the seizure-induced increase of BrdU-positive cells in dentate gyrus, especially in hilus. Double-label immunofluorescence staining showed that, 2R, 4R-APDC did not affect the ability of newborn cells to differentiate into neurons or astrocytes. 2R, 4R-APDC not only has anticonvulsant effect on adult rats with pilocarpine-induced SE, but also has neuroprotective effect by reducing the abnormal regeneration of nerves.

  7. The incidence of unprovoked seizures and occurrence of neurodevelopmental comorbidities in children at the time of their first epileptic seizure and during the subsequent six months.

    PubMed

    Åndell, Eva; Tomson, Torbjörn; Carlsson, Sofia; Hellebro, Eva; Andersson, Tomas; Adelöw, Cecilia; Åmark, Per

    2015-07-01

    To evaluate the incidence of unprovoked seizures in children and the prevalence of related neurodevelopmental comorbidities at the time of the presumed first seizure and six months thereafter. The medical records of all children (0-18 years of age) seeking medical attention as the result of a first unprovoked seizure between September 1, 2001 and December 31, 2006, and registered in the population-based Stockholm Incidence Registry of Epilepsy (SIRE) were reviewed. Neurodevelopmental comorbidities were evaluated on the basis of the medical records from this first visit and from other healthcare during the following six months. The incidence of unprovoked seizures was between 30 and 204/100,000 person years (n=766) in the different age groups. It was highest among the youngest children and lowest among the 18-year-olds with small gender differences. The most common neurodevelopment comorbidities were developmental delay (22%, CI: 19-25%), speech/language and learning difficulties (23%, CI: 20-26%) and intellectual disability (16%, CI: 13-18%). The types of neurodevelopmental comorbidity varied by age at the time of seizure onset, with cerebral palsy being more common among the 0-5-year-olds, attention deficits among the 6-16-year-olds, and autism and psychiatric diagnosis among the older children. An associated neurodevelopmental comorbidity was more common among those experiencing recurrent than single seizures during follow-up six months from the index seizure (42% versus 66%). In 68% (CI: 64-71%) of the children there was no known or suspected neurodevelopmental comorbidity. The incidence of unprovoked, non-febrile seizures among 0-18-year-olds included in the SIRE was 67/100,000 person-years. Neurodevelopmental comorbidities were common already at the time of onset of the seizure disorder, indicating that neither seizure treatment nor seizures were the underlying cause of other neurodevelopmental symptoms in these patients during the period studied. Copyright

  8. Repeated citalopram administration counteracts kainic acid-induced spreading of PSA-NCAM-immunoreactive cells and loss of reelin in the adult mouse hippocampus.

    PubMed

    Jaako, Külli; Aonurm-Helm, Anu; Kalda, Anti; Anier, Kaili; Zharkovsky, Tamara; Shastin, Dmitri; Zharkovsky, Alexander

    2011-09-01

    Systemic or intracerebral administration of kainic acid in rodents induces neuronal death followed by a cascade of neuroplastic changes in the hippocampus. Kainic acid-induced neuroplasticity is evidenced by alterations in hippocampal neurogenesis, dispersion of the granule cell layer and re-organisation of mossy fibres. Similar abnormalities are observed in patients with temporal lobe epilepsy and, therefore, kainic acid-induced hippocampal neuroplasticity might mimic pathological mechanisms leading to the formation of 'epileptic brain' in patients with temporal lobe epilepsy. Previous studies have demonstrated that selective serotonin re-uptake inhibitor antidepressants might reduce the severity of seizures in epileptic patients and reduce neuronal death in laboratory animal models of kainic acid-induced neurotoxicity. In the present study, we investigated whether kainic acid-induced neuroplasticity in mice is modulated by the repeated administration of citalopram, a selective serotonin reuptake inhibitor. We found that at the histopathological level, repeated citalopram treatment counteracted the kainic acid-induced neuronal loss and dispersion of young granule neurons expressing the polysialylated neural cell adhesion molecule within the granule cell layer of the hippocampus. Citalopram also counteracted the downregulation of reelin on both mRNA and protein levels induced by kainic acid administration. Our findings indicate that repeated administration of citalopram is able to prevent kainic acid-induced abnormal brain plasticity and thereby prevent the formation of an epileptic phenotype.

  9. Towards prognostic biomarkers from BOLD fluctuations to differentiate a first epileptic seizure from new-onset epilepsy.

    PubMed

    Gupta, Lalit; Janssens, Rick; Vlooswijk, Mariëlle C G; Rouhl, Rob P W; de Louw, Anton; Aldenkamp, Albert P; Ulman, Shrutin; Besseling, René M H; Hofman, Paul A M; van Kranen-Mastenbroek, Vivianne H; Hilkman, Danny M; Jansen, Jacobus F A; Backes, Walter H

    2017-03-01

    The diagnosis of epilepsy cannot be reliably made prior to a patient's second seizure in most cases. Therefore, adequate diagnostic tools are needed to differentiate subjects with a first seizure from those with a seizure preceding the onset of epilepsy. The objective was to explore spontaneous blood oxygen level-dependent (BOLD) fluctuations in subjects with a first-ever seizure and patients with new-onset epilepsy (NOE), and to find characteristic biomarkers for seizure recurrence after the first seizure. We examined 17 first-seizure subjects, 19 patients with new-onset epilepsy (NOE), and 18 healthy controls. All subjects underwent clinical investigation and received electroencephalography and resting-state functional magnetic resonance imaging (MRI). The BOLD time series were analyzed in terms of regional homogeneity (ReHo) and fractional amplitude of low-frequency fluctuations (fALFFs). We found significantly stronger amplitudes (higher fALFFs) in patients with NOE relative to first-seizure subjects and healthy controls. The frequency range of 73-198 mHz (slow-3 subband) appeared most useful for discriminating patients with NOE from first-seizure subjects. The ReHo measure did not show any significant differences. The fALFF appears to be a noninvasive measure that characterizes spontaneous BOLD fluctuations and shows stronger amplitudes in the slow-3 subband of patients with NOE relative first-seizure subjects and healthy controls. A larger study population with follow-up is required to determine whether fALFF holds promise as a potential biomarker for identifying subjects at increased risk to develop epilepsy. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.

  10. Smell and taste acuity in epileptic syndromes.

    PubMed

    Campanella, G; Filla, A; De Michele, G

    1978-01-01

    Taste and smell acuity were determined in 50 normal subjects and 48 epileptic patients by means of Henkin's method. Smell detection thresholds are greatly reduced in epileptic patients, mainly those suffering from partial seizures with complex symptomatology. Epileptic patients show also a reduced threshold for sweet and bitter taste. Age, sex and antiepileptic drugs do not affect taste and smell acuity. The significance of these findings in the pathogenesis of epileptic seizures is discussed.

  11. [Consensus clinical practice guidelines of the Sociedad Andaluza de Epilepsia for the diagnosis and treatment of patients with their first epileptic seizure in emergencies].

    PubMed

    Serrano-Castro, P J; Sánchez-Alvarez, J C; Cañadillas-Hidalgo, F M; Galán-Barranco, J M; Moreno-Alegre, V; Mercadé-Cerdá, J M

    Epileptic seizures are the cause of between 0.3 and 1.2% of all visits to hospital emergency departments. Twenty-five per cent of patients visit after having their first seizure. Such an impact seems to justify the development of a health care protocol. Our proposal is to draw up a set of implicit evidence-based consensus practice guidelines, to use Liberati's nomenclature, concerning aspects related to the diagnostic procedure and recommended therapeutic management of patients with a first seizure who are being attended in an emergency department. A selective search was conducted on PubMed-Medline for quality scientific information on the subject using scientific evidence filters. This search was completed in other scientific evidence search engines, such as Tripdatabase, Biblioteca Cochrane Plus or DARE. The selected references were analysed and discussed by the authors, and the available evidence and any recommendations that could be drawn from it were collected. A total of 47 primary documents and 10 practice guidelines or protocols related with the proposed topic were identified. The recommendations were inserted in the text explicitly. The diagnostic and therapeutic protocol for all paroxysmal phenomena in emergencies consists of three successive phases: diagnosis of the cause of the epilepsy, integration of the significance of the seizure within the clinical context, and designing the therapeutic scheme. Each phase will depend on the outcomes of the previous one as a decision algorithm. The fundamental tools in each phase are: patient record and examination (phase 1), and complementary tests (phase 2). They are then used to produce a therapeutic decision scheme.

  12. Increased odds and predictive rates of MMPI-2-RF scale elevations in patients with psychogenic non-epileptic seizures and observed sex differences.

    PubMed

    Del Bene, Victor A; Arce Rentería, Miguel; Maiman, Moshe; Slugh, Mitch; Gazzola, Deana M; Nadkarni, Siddhartha S; Barr, William B

    2017-07-01

    The Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF) is a self-report instrument, previously shown to differentiate patients with epileptic seizures (ES) and psychogenic non-epileptic seizures (PNES). At present, the odds of MMPI-2-RF scale elevations in PNES patients, as well as the diagnostic predictive value of such scale elevations, remain largely unexplored. This can be of clinical utility, particularly when a diagnosis is uncertain. After looking at mean group differences, we applied contingency table derived odds ratios to a sample of ES (n=92) and PNES (n=77) patients from a video EEG (vEEG) monitoring unit. We also looked at the positive and negative predictive values (PPV, NPV), as well as the false discovery rate (FDR) and false omission rate (FOR) for scales found to have increased odds of elevation in PNES patients. This was completed for the overall sample, as well as the sample stratified by sex. The odds of elevations related to somatic concerns, negative mood, and suicidal ideation in the PNES sample ranged from 2 to 5 times more likely. Female PNES patients had 3-6 times greater odds of such scale elevations, while male PNES patients had odds of 5-15 times more likely. PPV rates ranged from 53.66% to 84.62%, while NPV rates ranged from 47.52% to 90.91%. FDR across scales ranged from 15.38% to 50%, while the FOR ranged from 9.09% to 52.47%. Consistent with prior research, PNES patients have greater odds of MMPI-2-RF scale elevations, particularly related to somatic concerns and mood disturbance. Female PNES patients endorsed greater emotional distress, including endorsement of suicide related items. Elevations of these scales could aid in differentiating PNES from ES patients, although caution is warranted due to the possibility of both false positives and the incorrect omissions of PNES cases. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Can Seizure-Alert Dogs predict seizures?

    PubMed

    Brown, Stephen W; Goldstein, Laura H

    2011-12-01

    An index observation where a dog was trained to alert to, as well as respond to, human tonic-clonic seizures led to further research and refinement of training techniques. This was followed by anecdotal reports of pet dogs spontaneously anticipating human epileptic seizures. An industry has since developed training Seizure-Alert Dogs (SADs) to give humans warnings of their seizures. In some cases this has been accompanied by a reduction in seizure frequency. SADs may be trained along with the person with epilepsy, responding specifically to that person's seizures, or may be trained separately. Recent sceptical reports of non-epileptic seizures in some people with SADs have cast doubt on dogs' ability to anticipate true epileptic seizures. This may reflect selection criteria for training programmes as well as training methods used, but does not necessarily indicate that SADs might not be able to predict epileptic seizures. Whether the seizures are epileptic or non-epileptic, it is speculated that SADs probably alert to subtle pre-ictal human behaviour changes, but may also be sensitive to heart rate or olfactory cues. As yet, however, no rigorous data exist as to whether seizure prediction by SADS is better than chance, and what false positive and negative prediction rates might be.

  14. Seizures

    MedlinePlus

    ... entire body Sudden falling Tasting a bitter or metallic flavor Teeth clenching Temporary stop in breathing Uncontrollable ... Causes of seizures can include: Abnormal levels of sodium or glucose in the blood Brain infection, including ...

  15. Mean daily plasma concentrations of beta-endorphin, leu-enkephalin, ACTH, cortisol, and DHEAS in epileptic patients with complex partial seizures evolving to generalized tonic-clonic seizures.

    PubMed

    Marek, Bogdan; Kajdaniuk, Dariusz; Kos-Kudła, Beata; Kapustecki, Janusz; Swietochowska, Elzbieta; Ostrowska, Zofia; Siemińska, Lucyna; Nowak, Mariusz; Głogowska-Szelag, Joanna; Borgiel-Marek, Halina; Ciesielska-Kopacz, Nelly; Foltyn, Wanda; Pierzchała, Krystyna; Krysiak, Robert; Bienek, Radosław

    2010-01-01

    A multitude of mechanisms have been implicated in the pathophysiology of epilepsy. To assess mean daily plasma concentrations of ACTH, cortisol, DHEAS, leu-enkephalin, and beta-endorphin in epileptic patients with complex partial seizures evolving to tonic-clonic in relation to frequency of seizure occurrence (groups with seizure occurrences - several per week and several per year) and duration of the disease (groups less than and more than 10 years). We decided to analyse mean daily values of beta-endorphin and leu-enkephalin because of significant differences in concentrations of these substances in blood during the day. The study was performed on 17 patients (14 males + 3 females; mean age 31.8 yrs) treated with carbamazepine (300-1800 mg/day). The control group consisted of six age-matched healthy volunteers. Blood was collected at 8 a.m., 2 p.m., 8 p.m., and 2 a.m. Intergroup analysis was performed with the use of ANOVA Kruskal-Wallis test. Mean daily concentrations of ACTH and cortisol in the blood of the patients with epilepsy were higher in comparison with those of the healthy volunteers, independently of the frequency of seizures and duration of the disease. Mean daily concentrations of beta-endorphin in the blood of the patients with epilepsy were higher in the groups of patients with more severe clinical course of disease (with more frequently occurring epilepsy seizures and longer duration of the disease) in comparison with healthy subjects. Mean daily concentrations of leu-enkephalin in the blood of the patients with epilepsy were higher in the group of patients with short duration of the disease in comparison with the group with long duration of the disease. 1. Pituitary-adrenal axis hyperactivity is observed in patients with clinically active epilepsy, independently of the frequency of seizures and duration of the disease. 2. Changes in endogenous opioid system activity are related to the clinical activity of epilepsy - beta-endorphin concentrations

  16. Nitric Oxide-induced Activation of the Type 1 Ryanodine Receptor Is Critical for Epileptic Seizure-induced Neuronal Cell Death.

    PubMed

    Mikami, Yoshinori; Kanemaru, Kazunori; Okubo, Yohei; Nakaune, Takuya; Suzuki, Junji; Shibata, Kazuki; Sugiyama, Hiroki; Koyama, Ryuta; Murayama, Takashi; Ito, Akihiro; Yamazawa, Toshiko; Ikegaya, Yuji; Sakurai, Takashi; Saito, Nobuhito; Kakizawa, Sho; Iino, Masamitsu

    2016-09-01

    Status epilepticus (SE) is a life-threatening emergency that can cause neurodegeneration with debilitating neurological disorders. However, the mechanism by which convulsive SE results in neurodegeneration is not fully understood. It has been shown that epileptic seizures produce markedly increased levels of nitric oxide (NO) in the brain, and that NO induces Ca(2+) release from the endoplasmic reticulum via the type 1 ryanodine receptor (RyR1), which occurs through S-nitrosylation of the intracellular Ca(2+) release channel. Here, we show that through genetic silencing of NO-induced activation of the RyR1 intracellular Ca(2+) release channel, neurons were rescued from seizure-dependent cell death. Furthermore, dantrolene, an inhibitor of RyR1, was protective against neurodegeneration caused by SE. These results demonstrate that NO-induced Ca(2+) release via RyR is involved in SE-induced neurodegeneration, and provide a rationale for the use of RyR1 inhibitors for the prevention of brain damage following SE.

  17. Effects of single-dose neuropeptide Y on levels of hippocampal BDNF, MDA, GSH, and NO in a rat model of pentylenetetrazole-induced epileptic seizure

    PubMed Central

    Kir, Hale Maral; Şahin, Deniz; Öztaş, Berrin; Musul, Mert; Kuskay, Sevinc

    2013-01-01

    Epilepsy is one of the most common neurological disorders, characterized by recurrent seizures, which may increase the content of reactive oxygen and nitrogen species. The objective of this study was to investigate the effects of Neuropeptide Y on oxidative and nitrosative balance and brain-derived neurotrophic factor levels induced by pentylenetetrazole (a standard convulsant drug) in the hippocampus of Wistar rats. Three groups of seven rats were treated intraperitoneally as follows: group 1 (saline + saline) 1 ml saline, group 2 (salin + Pentylenetetrazole) 1 ml saline 30 min before Pentylenetetrazole; and group 3 (Neuropeptide Y + Pentylenetetrazole) 60 μg/kg Neuropeptide Y 30 min before 60 mg/kg Pentylenetetrazole. After 24 h, the animals were euthanized by decapitation. Hippocampus were isolated to evaluate the malondi-aldehyde, glutathione, nitric oxide, and brain-derived neurotrophic factor levels in three rat groups. The results of this study demonstrated that while intraperitoneally administered neuropeptide Y did not result in a statistically significant difference in BDNF levels, its administration caused a statistically significant decrease in malondialdehyde and nitric oxide levels and an increase in glutathione levels in rats with pentylenetetrazole-induced epileptic seizure. Neuropeptide Y were able to reduce nitroxidative damage induced by pentylenetetrazole in the hippocampus of Wistar rats. PMID:24289760

  18. Shift-back of right into left hemisphere language dominance after control of epileptic seizures: evidence for epilepsy driven functional cerebral organization.

    PubMed

    Helmstaedter, C; Fritz, N E; González Pérez, P A; Elger, C E; Weber, B

    2006-08-01

    Atypical, i.e. right hemisphere language dominance is frequently observed in early onset left hemisphere epilepsies. In left mesial temporal lobe epilepsy, where eloquent cortex is not directly involved, it is a matter of debate, to which degree atypical language dominance is driven not only by morphological lesions but also by epileptic dysfunction, and whether atypical dominance is hardwired or not. Taking this as the background this study evaluated the hypothesis that epilepsy driven atypical dominancy might be reversible when seizures are successfully controlled. This was evaluated in patients with left mesial temporal lobe epilepsy, who were atypically language dominant by means of language fMRI before surgery, and became seizure free after left selective amygdalo-hippocampectomy. Three out of 53 consecutive atypically dominant patients with chronic epilepsy fulfilled these criteria. Postoperative follow-up language fMRI indicated reversal of right into left dominance in one patient going along with unexpected losses in verbal memory performance. The two other patients experienced unchanged or even enhancement of the pre-existing dominance pattern, going along with consistent postoperative performance changes in cognition. The data thus provide supporting evidence that atypical language dominance can indeed be functionally driven and moreover that in at least some patients, right hemispheric language can shift-back to the left hemisphere when the driving factor, i.e. seizures, becomes successfully controlled. The results have clinical implications for outcome prediction after brain surgery in atypically dominant patients with epilepsy. However, further research in larger groups of atypically dominant patients is required to identify the conditions under which atypical dominance becomes hardwired and when not.

  19. Validity of the clinical and content scales of the Multiphasic Personality Inventory Minnesota 2 for the diagnosis of psychogenic non-epileptic seizures.

    PubMed

    del Barrio, A; Jiménez-Huete, A; Toledano, R; García-Morales, I; Gil-Nagel, A

    2016-03-01

    The use of the Multiphasic Personality Inventory Minnesota 2 (MMPI-2) for the diagnosis of psychogenic non-epileptic seizures (PNES) is controversial. This study examines the validity of the clinical scales and, unlike previous works, the content scales. Cross-sectional study of 209 patients treated in the epilepsy unit. We performed a logistic regression analysis, taking video-electroencephalography as the reference test, and as predictor variables age, sex, IQ and clinical (model A) or content scales (model B) of the MMPI-2. The models were selected according to the Aikake index and compared using the DeLong test. We analyzed 37 patients with PNES alone, or combined with seizures, and 172 patients with seizures only. The model consisting of sex, Hs (hypochondriasis) and Pa (paranoia) showed a sensitivity of 77.1%, a specificity of 76.8%, a percentage of correct classification of 76.8%, and an area under the curve (AUC) of 0.836 for diagnosing CNEP. Model B, consisting of sex, HEA (health concerns) and FRS (fears), showed a sensitivity of 65.7%, a specificity of 78.0%, a percentage of correct classification of 75.9% and an AUC of 0.840. DeLong's test did not detect significant differences. The MMPI-2 has a moderate validity for the diagnosis of PNES in patients referred to an epilepsy unit. Using content scales does not significantly improve results from the clinical scales. Copyright © 2013 Sociedad Española de Neurología. Published by Elsevier España, S.L.U. All rights reserved.

  20. Long-Term Seizure Suppression and Optogenetic Analyses of Synaptic Connectivity in Epileptic Mice with Hippocampal Grafts of GABAergic Interneurons

    PubMed Central

    Henderson, Katharine W.; Gupta, Jyoti; Tagliatela, Stephanie; Litvina, Elizabeth; Zheng, XiaoTing; Van Zandt, Meghan A.; Woods, Nicholas; Grund, Ethan; Lin, Diana; Royston, Sara; Yanagawa, Yuchio; Aaron, Gloster B.

    2014-01-01

    Studies in rodent epilepsy models suggest that GABAergic interneuron progenitor grafts can reduce hyperexcitability and seizures in temporal lobe epilepsy (TLE). Although integration of the transplanted cells has been proposed as the underlying mechanism for these disease-modifying effects, prior studies have not explicitly examined cell types and synaptic mechanisms for long-term seizure suppression. To address this gap, we transplanted medial ganglionic eminence (MGE) cells from embryonic day 13.5 VGAT-Venus or VGAT-ChR2-EYFP transgenic embryos into the dentate gyrus (DG) of adult mice 2 weeks after induction of TLE with pilocarpine. Beginning 3–4 weeks after status epilepticus, we conducted continuous video-electroencephalographic recording until 90–100 d. TLE mice with bilateral MGE cell grafts in the DG had significantly fewer and milder electrographic seizures, compared with TLE controls. Immunohistochemical studies showed that the transplants contained multiple neuropeptide or calcium-binding protein-expressing interneuron types and these cells established dense terminal arborizations onto the somas, apical dendrites, and axon initial segments of dentate granule cells (GCs). A majority of the synaptic terminals formed by the transplanted cells were apposed to large postsynaptic clusters of gephyrin, indicative of mature inhibitory synaptic complexes. Functionality of these new inhibitory synapses was demonstrated by optogenetically activating VGAT-ChR2-EYFP-expressing transplanted neurons, which generated robust hyperpolarizations in GCs. These findings suggest that fetal GABAergic interneuron grafts may suppress pharmacoresistant seizures by enhancing synaptic inhibition in DG neural circuits. PMID:25274826

  1. [PI 3 K/Akt signaling pathway contributed to the protective effect of acupuncture intervention on epileptic seizure-induced injury of hippocampal pyramidal cells in epilepsy rats].

    PubMed

    Yang, Fan; Ang, Wen-Ping; Shen, De-Kai; Liu, Xiang-Guo; Yang, Yong-Qing; Ma, Yun

    2013-02-01

    To observe the protective effect of acupuncture stimulation on pyramidal cells in hippocampal CA 1 and CA 3 regions and to analyze the involvement of phosphatidy linositol-3-kinase (PI 3 K)/protein kinase B(PKB or Akt) signaling pathway in the acupuncture effect in epilepsy rats. A total of 120 SD rats were randomly divided into normal control group, model group, LY 294002 (a specific antagonist for PI 3 K/Akt signaling) group, acupuncture+ LY 294002 group and acupuncture group (n = 24 in each group, 12 for H. E. staining, and 12 for electron microscope observation). Epilepsy model was established by intraperitoneal injection of pentylenetetrazol (PTZ, 5 microL). Manual acupuncture stimulation was applied to "Baihui" (GV 20) and "Dazhui" (GV 14) once daily for 5 days. Dimethyl Sulfoxide (DMSO, 5 microL, a control solvent) was given to rats of the normal, model and acupuncture groups, and LY294002 (5 microL, dissolved in DMSO) given to rats of the LY 294002 and acupuncture+ LY 294002 groups by lateral ventricular injection. Four hours and 24 h after modeling, the hippocampus tissues were sampled for observing pathological changes of CA 1 and CA 3 regions after H. E. staining under light microscope and for checkin ultrastructural changes of the pyramidal cells under transmission electron microscope. In comparison with the normal control group, the numbers of pyramidal cells of hippocampal CA 3 region in the model group were decreased significantly 4 h and 24 h after epileptic seizure (P < 0.01). While compared to the model group, the pyramidal cells of hippocampal CA 3 region in the acupuncture group were increased considerably in the number at both 4 h and 24 h after seizure (P < 0.01). No significant differences were found between the LY 294002 and model groups, and between the acupuncture+ LY 294002 and model groups in the numbers of pyramidal cells at 4 h and 24 h after seizure (P > 0.05). Findings of the light microscope and electron microscope showed that the

  2. Fibromyalgia and seizures.

    PubMed

    Tatum, William O; Langston, Michael E; Acton, Emily K

    2016-06-01

    The purpose of this case-matched study was to determine how frequently fibromyalgia is associated with different paroxysmal neurological disorders and explore the utility of fibromyalgia as a predictor for the diagnosis of psychogenic non-epileptic seizures. The billing diagnosis codes of 1,730 new, non-selected patient encounters were reviewed over a three-year period for an epileptologist in a neurology clinic to identify all patients with historical diagnoses of fibromyalgia. The frequency with which epileptic seizures, psychogenic non-epileptic seizures, and physiological non-epileptic events were comorbid with fibromyalgia was assessed. Age and gender case-matched controls were used for a between-group comparison. Wilcoxon tests were used to analyse interval data, and Chi-square was used to analyse categorical data (p<0.05). Fibromyalgia was retrospectively identified in 95/1,730 (5.5%) patients in this cohort. Females represented 95% of the fibromyalgia sample (age: 53 years; 95% CI: 57, 51). Forty-three percent of those with fibromyalgia had a non-paroxysmal, neurological primary clinical diagnosis, most commonly chronic pain. Paroxysmal events were present in 57% of fibromyalgia patients and 54% of case-matched controls. Among patients with fibromyalgia and paroxysmal disorders, 11% had epileptic seizures, 74% had psychogenic non-epileptic seizures, and 15% had physiological non-epileptic events, compared to case-matched controls with 37% epileptic seizures, 51% psychogenic non-epileptic events, and 12% physiological non-epileptic events (p = 0.009). Fibromyalgia was shown to be a predictor for the diagnosis of psychogenic non-epileptic seizures in patients with undifferentiated paroxysmal spells. However, our results suggest that the specificity and sensitivity of fibromyalgia as a marker for psychogenic non-epileptic seizures in a mixed general neurological population of patients is less than previously described.

  3. Synaptic plasticity in neuronal network models can explain patterns of bursting activity seen in temporal lobe epileptic seizures.

    PubMed

    Kudela, Pawel; Franszczuk, Piotr J; Bergey, Gregory K

    2004-01-01

    High-resolution time-frequency analyses of ictal EEG allow for identification and characterization of ictal patterns. These patterns reflect alterations in the brain network synchrony. It is not clear why seizures undergo these dynamical changes and what mechanisms contribute to or cause these changes. In this work we use neural modeling studies to address these issues. We investigate the role of synaptic plasticity and nonsynaptic neuronal plasticity (firing frequency adaptation) in regulating pattern of neuronal network synchrony. We show that nonsynaptic neuronal plasticity (i.e. calcium dependent afterhyperpolarization in neurons) can regulate the frequency of the dominant rhythm in EEG while synaptic potentiation may be responsible for irregular bursting prior to seizure termination.

  4. Profile of SB-204269, a mechanistically novel anticonvulsant drug, in rat models of focal and generalized epileptic seizures

    PubMed Central

    Upton, Neil; Blackburn, Tom P; Campbell, Colin A; Cooper, Duncan; Evans, Martyn L; Herdon, Hugh J; King, Penny D; Ray, Alison M; Stean, Tania O; Chan, Wai N; Evans, John M; Thompson, Mervyn

    1997-01-01

    Earlier optimization of structure-activity relationships in a novel series of 4-(benzoylamino)-benzopyrans, led to the discovery of SB-204269 (trans-(+)-6-acetyl-4S-(4-fluorobenzoylamino)-3,4-dihydro-2,2-dimethyl-2H-benzo[b]pyran-3R-ol, hemihydrate), a potent orally-active anticonvulsant in the mouse maximal electroshock seizure threshold (MEST) test. Studies have now been undertaken to determine the effects of SB-204269 in a range of seizure models and tests of neurological deficits in rats. In addition, the compound has been evaluated in a series of in vitro mechanistic assays. SB-204269 proved to be an orally-effective anticonvulsant agent, at doses (0.1–30 mg kg−1) devoid of overt behavioural depressant properties, in models of both electrically (MEST and maximal electroshock (MES)) and chemically (i.v. pentylenetetrazol (PTZ) infusion)-evoked tonic extension seizures. However, the compound did not inhibit PTZ-induced myoclonic seizures at doses up to 30 mg kg−1, p.o. SB-204269 also selectively reduced focal electrographic seizure activity in an in vitro elevated K+ rat hippocampal slice model at concentrations (0.1–10 μM) that had no effect on normal synaptic activity and neuronal excitability. In all of these seizure models, SB-204269 was equivalent or better than the clinically established antiepileptic drugs carbamazepine and lamotrigine, in terms of anticonvulsant potency and efficacy. Unlike SB-204269, the corresponding trans 3S,4R enantiomer, SB-204268, did not produce marked anticonvulsant effects, an observation in accord with previous findings for other related pairs of trans enantiomers in the benzopyran series. In the rat accelerating rotarod test, a sensitive paradigm for the detection of neurological deficits such as sedation and motor incoordination, SB-204269 was inactive even at doses as high as 200 mg kg−1, p.o. This was reflected in the excellent therapeutic index (minimum significantly effective dose in the rotarod

  5. Updated ILAE evidence review of antiepileptic drug efficacy and effectiveness as initial monotherapy for epileptic seizures and syndromes.

    PubMed

    Glauser, Tracy; Ben-Menachem, Elinor; Bourgeois, Blaise; Cnaan, Avital; Guerreiro, Carlos; Kälviäinen, Reetta; Mattson, Richard; French, Jacqueline A; Perucca, Emilio; Tomson, Torbjorn

    2013-03-01

    The purpose of this report was to update the 2006 International League Against Epilepsy (ILAE) report and identify the level of evidence for long-term efficacy or effectiveness for antiepileptic drugs (AEDs) as initial monotherapy for patients with newly diagnosed or untreated epilepsy. All applicable articles from July 2005 until March 2012 were identified, evaluated, and combined with the previous analysis (Glauser et al., 2006) to provide a comprehensive update. The prior analysis methodology was utilized with three modifications: (1) the detectable noninferiority boundary approach was dropped and both failed superiority studies and prespecified noninferiority studies were analyzed using a noninferiority approach, (2) the definition of an adequate comparator was clarified and now includes an absolute minimum point estimate for efficacy/effectiveness, and (3) the relationship table between clinical trial ratings, level of evidence, and conclusions no longer includes a recommendation column to reinforce that this review of efficacy/evidence for specific seizure types does not imply treatment recommendations. This evidence review contains one clarification: The commission has determined that class I superiority studies can be designed to detect up to a 20% absolute (rather than relative) difference in the point estimate of efficacy/effectiveness between study treatment and comparator using an intent-to-treat analysis. Since July, 2005, three class I randomized controlled trials (RCT) and 11 class III RCTs have been published. The combined analysis (1940-2012) now includes a total of 64 RCTs (7 with class I evidence, 2 with class II evidence) and 11 meta-analyses. New efficacy/effectiveness findings include the following: levetiracetam and zonisamide have level A evidence in adults with partial onset seizures and both ethosuximide and valproic acid have level A evidence in children with childhood absence epilepsy. There are no major changes in the level of evidence

  6. Epileptic Encephalopathies in Adults and Childhood

    PubMed Central

    Kural, Zekiye; Ozer, Ali Fahir

    2012-01-01

    Epileptic encephalopathies are motor-mental retardations or cognitive disorders secondary to epileptic seizures or epileptiform activities. Encephalopaties due to brain damage, medications, or systemic diseases are generally not in the scope of this definition, but they may rarely accompany the condition. Appropriate differential diagnosis of epileptic seizures as well as subclinical electroencephalographic discharges are crucial for management of seizures and epileptiform discharges and relative regression of cognitive deterioration in long-term followup. Proper antiepileptic drug, hormonal treatment, or i.v. immunoglobulin choice play major role in prognosis. In this paper, we evaluated the current treatment approaches by reviewing clinical electrophysiological characteristics of epileptic encephalopathies. PMID:23056934

  7. Nuclear Factor-Kappa B Activity Regulates Brain Expression of P-Glycoprotein in the Kainic Acid-Induced Seizure Rats

    PubMed Central

    Yu, Nian; Di, Qing; Liu, Hao; Hu, Yong; Jiang, Ying; Yan, Yu-kui; Zhang, Yan-fang; Zhang, Ying-dong

    2011-01-01

    This study was aimed to investigate the effect of NF-κB activity on the seizure susceptibility, brain damage, and P-gp expression in kainic acid- (KA-) induced seizure rats. Male SD rats were divided into saline control group (NS group), KA induced epilepsy group (EP group), and epilepsy group intervened with NF-κB inhibitor-pyrrolidine dithiocarbamate salt (PDTC group) or with dexamethasone (DEX group). No seizures were observed in the rats of NS group. Compared with NS group, increased P-gp expression and NF-κB activation in the rat brain of the EP group were observed after KA micro-injection. Both PDTC and DEX pre-treatment significantly increased the latency to grade III or V seizure onset compared to EP group but failed to show neuron-protective effect as the number of survival neurons didn't significantly differ from that in EP group. Furthermore, PDTC pre-treatment significantly decreased P-gp expression along with NF-κB activation in the hippocampus CA3 area and amygdala complex of rats compared with the EP group, implying that NF-κB activation involved in the seizure susceptibility and seizure induced brain P-gp over-expression. Additionally, DEX pre-treatment only decreased P-gp expression level without inhibition of NF-κB activation, suggesting NF-κB independent pathway may also participate in regulating seizure induced P-gp over-expression. PMID:21403895

  8. Nuclear factor-kappa B activity regulates brain expression of P-glycoprotein in the kainic acid-induced seizure rats.

    PubMed

    Yu, Nian; Di, Qing; Liu, Hao; Hu, Yong; Jiang, Ying; Yan, Yu-kui; Zhang, Yan-fang; Zhang, Ying-dong

    2011-01-01

    This study was aimed to investigate the effect of NF-κB activity on the seizure susceptibility, brain damage, and P-gp expression in kainic acid- (KA-) induced seizure rats. Male SD rats were divided into saline control group (NS group), KA induced epilepsy group (EP group), and epilepsy group intervened with NF-κB inhibitor-pyrrolidine dithiocarbamate salt (PDTC group) or with dexamethasone (DEX group). No seizures were observed in the rats of NS group. Compared with NS group, increased P-gp expression and NF-κB activation in the rat brain of the EP group were observed after KA micro-injection. Both PDTC and DEX pre-treatment significantly increased the latency to grade III or V seizure onset compared to EP group but failed to show neuron-protective effect as the number of survival neurons didn't significantly differ from that in EP group. Furthermore, PDTC pre-treatment significantly decreased P-gp expression along with NF-κB activation in the hippocampus CA3 area and amygdala complex of rats compared with the EP group, implying that NF-κB activation involved in the seizure susceptibility and seizure induced brain P-gp over-expression. Additionally, DEX pre-treatment only decreased P-gp expression level without inhibition of NF-κB activation, suggesting NF-κB independent pathway may also participate in regulating seizure induced P-gp over-expression.

  9. Time distribution of epileptic seizures during video-EEG monitoring. Implications for health insurance systems in developing countries.

    PubMed

    Quiroga, R C; Pirra, L; Podestá, C; Leiguarda, R C; Rabinowicz, A L

    1997-12-01

    An attempt was made to identify guidelines to help establish epilepsy monitoring units in developing countries. We assessed the time distribution of seizures during video-EEG monitoring and we also estimated the minimum time required for such a procedure and the impact of these variables upon the health insurance system. Mean time for recording five stereotyped clinical events was 72 hours, with a significant number of events recorded between midnight and 0600 hours (P < 0.05). This pilot study may help to establish local policies that will warrant an adequate work-up for our patients.

  10. Pro-Brain-Derived Neurotrophic Factor (proBDNF)-Mediated p75NTR Activation Promotes Depolarizing Actions of GABA and Increases Susceptibility to Epileptic Seizures.

    PubMed

    Riffault, Baptiste; Kourdougli, Nazim; Dumon, Camille; Ferrand, Nadine; Buhler, Emmanuelle; Schaller, Fabienne; Chambon, Caroline; Rivera, Claudio; Gaiarsa, Jean-Luc; Porcher, Christophe

    2016-12-01

    The brain-derived neurotrophic factor (BDNF) is synthesized as a precursor, namely proBDNF, which can be processed into mature BDNF (mBDNF). Evidences suggest that proBDNF signaling through p75(NTR) may account for the emergence of neurological disorders. These findings support the view that the relative availability of mBDNF and proBDNF forms is an important mechanism underlying brain circuit formation and cognitive functions. Here we describe novel insights into the proBDNF/p75(NTR) mechanisms and function in vivo in modulating neuronal circuit and synaptic plasticity during the first postnatal weeks in rats. Our results showed that increased proBDNF/p75(NTR) signaling during development maintains a depolarizing γ-aminobutyric acid (GABA) response in a KCC2-dependent manner in mature neuronal cells. This resulted in altered excitation/inhibition balance and enhanced neuronal network activity. The enhanced proBDNF/p75(NTR) signaling ultimately led to increased seizure susceptibility that was abolished by in vivo injection of function blocking p75(NTR) antibody. Altogether, our study shed new light on how proBDNF/p75(NTR) signaling can orchestrate the GABA excitatory/inhibitory developmental sequence leading to depolarizing and excitatory actions of GABA in adulthood and subsequent epileptic disorders.

  11. Synchrotron X-ray microtransections: a non invasive approach for epileptic seizures arising from eloquent cortical areas.

    PubMed

    Pouyatos, B; Nemoz, C; Chabrol, T; Potez, M; Bräuer, E; Renaud, L; Pernet-Gallay, K; Estève, F; David, O; Kahane, P; Laissue, J A; Depaulis, A; Serduc, R

    2016-06-06

    Synchrotron-generated X-ray (SRX) microbeams deposit high radiation doses to submillimetric targets whilst minimizing irradiation of neighboring healthy tissue. We developed a new radiosurgical method which demonstrably transects cortical brain tissue without affecting adjacent regions. We made such image-guided SRX microtransections in the left somatosensory cortex in a rat model of generalized epilepsy using high radiation doses (820 Gy) in thin (200 μm) parallel slices of tissue. This procedure, targeting the brain volume from which seizures arose, altered the abnormal neuronal activities for at least 9 weeks, as evidenced by a decrease of seizure power and coherence between tissue slices in comparison to the contralateral cortex. The brain tissue located between transections stayed histologically normal, while the irradiated micro-slices remained devoid of myelin and neurons two months after irradiation. This pre-clinical proof of concept highlights the translational potential of non-invasive SRX transections for treating epilepsies that are not eligible for resective surgery.

  12. Synchrotron X-ray microtransections: a non invasive approach for epileptic seizures arising from eloquent cortical areas

    NASA Astrophysics Data System (ADS)

    Pouyatos, B.; Nemoz, C.; Chabrol, T.; Potez, M.; Bräuer, E.; Renaud, L.; Pernet-Gallay, K.; Estève, F.; David, O.; Kahane, P.; Laissue, J. A.; Depaulis, A.; Serduc, R.

    2016-06-01

    Synchrotron-generated X-ray (SRX) microbeams deposit high radiation doses to submillimetric targets whilst minimizing irradiation of neighboring healthy tissue. We developed a new radiosurgical method which demonstrably transects cortical brain tissue without affecting adjacent regions. We made such image-guided SRX microtransections in the left somatosensory cortex in a rat model of generalized epilepsy using high radiation doses (820 Gy) in thin (200 μm) parallel slices of tissue. This procedure, targeting the brain volume from which seizures arose, altered the abnormal neuronal activities for at least 9 weeks, as evidenced by a decrease of seizure power and coherence between tissue slices in comparison to the contralateral cortex. The brain tissue located between transections stayed histologically normal, while the irradiated micro-slices remained devoid of myelin and neurons two months after irradiation. This pre-clinical proof of concept highlights the translational potential of non-invasive SRX transections for treating epilepsies that are not eligible for resective surgery.

  13. Intracerebroventricular administration of inosine is anticonvulsant against quinolinic acid-induced seizures in mice: an effect independent of benzodiazepine and adenosine receptors.

    PubMed

    Ganzella, Marcelo; Faraco, Rafael Berger; Almeida, Roberto Farina; Fernandes, Vinícius Fornari; Souza, Diogo Onofre

    2011-12-01

    Inosine (INO) has an anticonvulsant effect against seizures induced by antagonists of GABAergic system. Quinolinic acid (QA) is an agonist NMDA receptors implicated in the neurobiology of seizures. In the present study, we investigated the anticonvulsant effect of intracerebroventricular (i.c.v.) INO administration against QA-induced seizures in adult mice. We also investigated whether the benzodiazepines (BZ) or adenosine (ADO) receptors were involved in the INO effects. Animals were pretreated with an i.c.v. injection of either vehicle or INO before an i.c.v. administration of 4 μl QA (36.8 nmol). All animals pretreated with vehicle followed by QA presented seizures. INO protected against QA-induced seizures in a time and dose dependent manner (up to 60% at 400 nmol, 5 min before QA injection). Diazepam (DZ) and ADO (i.c.v.) also exhibited anticonvulsant effect against QA induced seizures. Additionally, i.p. administration of either flumazenil, a BZ receptor antagonist, or caffeine, an ADO receptor antagonist, did not change the anticonvulsant potency of INO i.c.v. injection, but completely abolished the DZ and ADO anticonvulsant effects, respectively. In conclusion, this study demonstrated that INO exert anticonvulsant effect against hyperactivity of the glutamatergic system independently of BZ or ADO receptors activation.

  14. The effects of quercetin on the gene expression of the GABAA receptor α5 subunit gene in a mouse model of kainic acid-induced seizure.

    PubMed

    Moghbelinejad, Sahar; Alizadeh, Safar; Mohammadi, Ghazaleh; Khodabandehloo, Fatemeh; Rashvand, Zahra; Najafipour, Reza; Nassiri-Asl, Marjan

    2017-03-01

    The flavonoid quercetin has recently been reported to have neuroprotective effects, and the role of the gamma-aminobutyric acid A alpha 5 subunit (GABAA α5) receptor has been determined in some nervous system disorders. The aim of this study was to identify the molecular mechanism of the effect of quercetin administered at anticonvulsive doses on the expression of the GABAA α5 receptor gene in kainic acid (KA)-induced seizures in mice. The experimental animals were divided into four groups: control, KA, and KA + quercetin at 50 or 100 mg/kg, respectively. The results showed a dose-dependent reduction in the behavioral seizure score with quercetin pre-treatment in the KA mouse model. Two hours after the end of the 7-day treatment regimen, expression of the GABAA α5 receptor gene in the hippocampus was found to be increased in the KA group, but this increase was reduced in the KA + quercetin 50 or 100 mg/kg treatment groups. These results suggest that expression of the GABAA α5 receptor could be a mechanism for reducing seizure severity or may be a marker of seizure severity. Further studies are necessary to clarify quercetin's mechanism of action and the relation of GABAA α5 receptor gene expression to seizure severity.

  15. Changes in brain glucose use and extracellular ions associated with kainic acid-induced seizures: (/sup 14/C)-2-deoxyglucose and intracranial

    SciTech Connect

    Chastain, J.E Jr.

    1986-01-01

    The effect of kainic acid (KA) on brain glucose use with coadministration of diazepam, and the effect of KA on brain extracellular (K/sup +/), Ca/sup 2 +/), and (Na/sup +/) was investigated in rats by means of (/sup 14/C)-2-deoxyglucose (2-DG) and intracranial microdialysis, respectively. Also, the impact of intracranial microdialysis on brain regional metabolic function was studied. Co-treatment with KA and diazepam attenuated KA-induced 3 hr increases and prevented 48 hr decreases in glucose use within all structures measured, particularly the piriform cortex and amygdala. Hippocampal CA/sub 3/, CA/sub 4/, and CA/sub 1/-ventral were least affected by diazepam. The results suggest that diazepam suppresses KA seizure spread from its focus, proposed to be CA/sub 3/. KA-induced ions changes were studied by intracranial microdialysis. Dialysis fibers were implanted within the hippocampus or piriform cortex and perfused 24 hr later. Samples, collected before and after KA, were analyzed for (K/sup +/), (Ca/sup 2 +/), and (Na/sup +/). KA caused an early and prolonged increase in extracellular (K/sup +/) and a negligible decrease in (Ca/sup 2 +/) within the hippocampus. In the piriform cortex, both (K/sup +/) and (Na/sup +/) increase during a period of early seizure signs. The results indicate that ion homostatic control of ion levels is better maintained during parenteral KA-induced seizures than when the brain is activated locally or during ischemia/hypoxia. The effect of intracranial microdialysis was studied by means of 2-DG in control state and KA-induced seizure state. The results indicate that intracranial microdialysis alters brain metabolic function during KA-induced seizures, but not in the control state. At 3 hr post KA, seizure metabolic activity was enhanced within the piriform cortex, and attenuated within the hippocampus.

  16. Anti-Epileptic Drug Combination Efficacy in an In Vitro Seizure Model – Phenytoin and Valproate, Lamotrigine and Valproate

    PubMed Central

    O’Brien, Terence J.; Williams, David A.; French, Chris R.

    2017-01-01

    In this study, we investigated the relative efficacy of different classes of commonly used anti-epileptic drugs (AEDs) with different mechanisms of action, individually and in combination, to suppress epileptiform discharges in an in vitro model. Extracellular field potential were recorded in 450 μm thick transverse hippocampal slices prepared from juvenile Wistar rats, in which “epileptiform discharges” (ED’s) were produced with a high-K+ (8.5 mM) bicarbonate-buffered saline solution. Single and dual recordings in stratum pyramidale of CA1 and CA3 regions were performed with 3–5 MΩ glass microelectrodes. All drugs—lamotrigine (LTG), phenytoin (PHT) and valproate (VPA)—were applied to the slice by superfusion at a rate of 2 ml/min at 32°C. Effects upon frequency of ED’s were assessed for LTG, PHT and VPA applied at different concentrations, in isolation and in combination. We demonstrated that high-K+ induced ED frequency was reversibly reduced by LTG, PHT and VPA, at concentrations corresponding to human therapeutic blood plasma concentrations. With a protocol using several applications of drugs to the same slice, PHT and VPA in combination displayed additivity of effect with 50μM PHT and 350μM VPA reducing SLD frequency by 44% and 24% individually (n = 19), and together reducing SLD frequency by 66% (n = 19). 20μM LTG reduced SLD frequency by 32% and 350μM VPA by 16% (n = 18). However, in combination there was a supra-linear suppression of ED’s of 64% (n = 18). In another independent set of experiments, similar results of drug combination responses were also found. In conclusion, a combination of conventional AEDs with different mechanisms of action, PHT and VPA, displayed linear additivity of effect on epileptiform activity. More intriguingly, a combination of LTG and VPA considered particularly efficacious clinically showed a supra-additive suppression of ED’s. This approach may be useful as an in vitro platform for assessing drug

  17. A method for removing artefacts from continuous EEG recordings during functional electrical impedance tomography for the detection of epileptic seizures.

    PubMed

    Fabrizi, L; Yerworth, R; McEwan, A; Gilad, O; Bayford, R; Holder, D S

    2010-08-01

    Electrical impedance tomography (EIT) is a portable, non-invasive medical imaging method, which could be employed to image the seizure onset in subjects undergoing assessment prior to epilepsy surgery. Each image is obtained from impedance measurements conducted with imperceptible current at tens of kHz. For concurrent imaging with video electroencephalogram (EEG), the EIT introduces a substantial artefact into the EEG due to current switching at frequencies in the EEG band. We present here a method for its removal, so that EIT and the EEG could be acquired simultaneously. A low-pass analogue filter for EEG channels (-6 dB at 48 Hz) and a high-pass filter (-3 dB at 72 Hz) for EIT channels reduced the artefact from 2-3 mV to 50-300 microV, but still left a periodic artefact at about 3 Hz. This was reduced to less than 10 microV with a software filter, which subtracted an artefact template from the EEG raw traces. The EEG was made clinically acceptable at four times its acquisition speed. This method could enable EIT to become a technique for imaging on telemetry units alongside EEG, without interfering with routine EEG reporting.

  18. Comparisons of childhood trauma, alexithymia, and defensive styles in patients with psychogenic non-epileptic seizures vs. epilepsy: Implications for the etiology of conversion disorder.

    PubMed

    Kaplan, Marcia J; Dwivedi, Alok K; Privitera, Michael D; Isaacs, Kelly; Hughes, Cynthia; Bowman, Michelle

    2013-08-01

    It has been theorized that conversion disorder is the result of emotion that cannot be experienced consciously as feeling states or put into words (i.e., alexithymia), but there is little confirming empirical evidence. We sought to characterize subjects with conversion disorder compared to subjects with a distinct medical illness, using the model of psychogenic non-epileptic seizures (PNES) vs. epilepsy (ES), on measures of childhood traumatic experience, alexithymia and maturity of psychological defensive strategies. All subjects admitted to the Epilepsy Monitoring Unit of the University of Cincinnati Medical Center were offered self-report questionnaires (Childhood Trauma Questionnaire, Toronto Alexithymia Scale-20 and Response Evaluation Measure-71) at the outset of evaluation. Diagnosis of each subject was confirmed by video-EEG and we compared subjects with PNES to those with ES on these measures. 82 subjects had ES AND 96 had PNES. Those with PNES were significantly more likely to have experienced childhood trauma in all domains (p=.005 to p=.05), and were significantly more likely to have alexithymia (p=.0267). There was a significant difference in the capacity to identify feelings, and a trend towards significance in capacity to describe feelings. There were no differences in defensive styles between the two groups. PNES diagnosis was associated with female sex, higher alexithymia scores and higher rates of childhood trauma, but not with differences in defensive styles compared to ES. These findings add empirical evidence for theories regarding the cause of conversion disorder and may aid in the design of prospective treatment trials in patients with conversion disorder. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. A 1.83 μJ/Classification, 8-Channel, Patient-Specific Epileptic Seizure Classification SoC Using a Non-Linear Support Vector Machine.

    PubMed

    Bin Altaf, Muhammad Awais; Yoo, Jerald

    2016-02-01

    A non-linear support vector machine (NLSVM) seizure classification SoC with 8-channel EEG data acquisition and storage for epileptic patients is presented. The proposed SoC is the first work in literature that integrates a feature extraction (FE) engine, patient specific hardware-efficient NLSVM classification engine, 96 KB SRAM for EEG data storage and low-noise, high dynamic range readout circuits. To achieve on-chip integration of the NLSVM classification engine with minimum area and energy consumption, the FE engine utilizes time division multiplexing (TDM)-BPF architecture. The implemented log-linear Gaussian basis function (LL-GBF) NLSVM classifier exploits the linearization to achieve energy consumption of 0.39 μ J/operation and reduces the area by 28.2% compared to conventional GBF implementation. The readout circuits incorporate a chopper-stabilized DC servo loop to minimize the noise level elevation and achieve noise RTI of 0.81 μ Vrms for 0.5-100 Hz bandwidth with an NEF of 4.0. The 5 × 5 mm (2) SoC is implemented in a 0.18 μm 1P6M CMOS process consuming 1.83 μ J/classification for 8-channel operation. SoC verification has been done with the Children's Hospital Boston-MIT EEG database, as well as with a specific rapid eye-blink pattern detection test, which results in an average detection rate, average false alarm rate and latency of 95.1%, 0.94% (0.27 false alarms/hour) and 2 s, respectively.

  20. Self-esteem and psychiatric features of Turkish adolescents with psychogenic non-epileptic seizures: a comparative study with epilepsy and healthy control groups.

    PubMed

    Say, Gokçe N; Tasdemir, Haydar A; Akbas, Seher; Yüce, Murat; Karabekiroglu, Koray

    2014-01-01

    Children and adolescents with psychogenic non-epileptic seizures (PNES) and epilepsy are known to have psychosocial problems. The aim of the present study was to compare the psychosocial difficulties, history of stressful life events/abuse, psychiatric diagnosis, and self-esteem of adolescents with PNES to the ones with epilepsy and healthy controls at a tertiary care center in Turkey. Thirty-four adolescents with PNES diagnosed by video-EEG were compared with 23 adolescents that have epilepsy and 35 healthy volunteers. Comorbid psychiatric diagnoses of participants were examined by semi-structured interviews using Schedule for Affective Disorders and Schizophrenia for School Age Children-Present and Lifetime Version (KSADS-PL). Self-esteem of adolescents was evaluated by Rosenberg Self Esteem Scale (RSES). No differences in sociodemographic features were observed between the groups. The PNES group showed significantly higher rates of parental conflicts, difficulties in relationship with siblings/peers, school under-achievement, and history of stressful events/abuse. The rates of comorbid psychiatric disorders were 64.7% in PNES and 47.8% in epilepsy group. The most common disorders in both groups were attention deficit hyperactivity disorder (ADHD) and depressive disorder. The rate of posttraumatic stress disorder (PTSD) was significantly increased in the PNES group. Additionally, adolescents with PNES displayed significantly lower levels of self-esteem than the other groups. It could be concluded that both disorders involved a high risk for developing psychiatric disorders; additionally, adolescents with PNES have higher rates of stressors and lower levels of self-esteem. Findings from this investigation point to the importance of psychiatric interventions in pediatric PNES and also epilepsy.

  1. Sequel of spontaneous seizures after kainic acid-induced status epilepticus and associated neuropathological changes in the subiculum and entorhinal cortex

    PubMed Central

    Drexel, Meinrad; Preidt, Adrian Patrick; Sperk, Günther

    2012-01-01

    Injection of the seaweed toxin kainic acid (KA) in rats induces a severe status epilepticus initiating complex neuropathological changes in limbic brain areas and subsequently spontaneous recurrent seizures. Although neuropathological changes have been intensively investigated in the hippocampus proper and the dentate gyrus in various seizure models, much less is known about changes in parahippocampal areas. We now established telemetric EEG recordings combined with continuous video monitoring to characterize the development of spontaneous seizures after KA-induced status epilepticus, and investigated associated neurodegenerative changes, astrocyte and microglia proliferation in the subiculum and other parahippocampal brain areas. The onset of spontaneous seizures was heterogeneous, with an average latency of 15 ± 1.4 days (range 3–36 days) to the initial status epilepticus. The frequency of late spontaneous seizures was higher in rats in which the initial status epilepticus was recurrent after its interruption with diazepam compared to rats in which this treatment was more efficient. Seizure-induced neuropathological changes were assessed in the subiculum by losses in NeuN-positive neurons and by Fluoro-Jade C staining of degenerating neurons. Neuronal loss was already prominent 24 h after KA injection and only modestly progressed at the later intervals. It was most severe in the proximal subiculum and in layer III of the medial entorhinal cortex and distinct Fluoro-Jade C labeling was observed there in 75% of rats even after 3 months. Glutamatergic neurons, labeled by in situ hybridization for the vesicular glutamate transporter 1 followed a similar pattern of cell losses, except for the medial entorhinal cortex and the proximal subiculum that appeared more vulnerable. Glutamate decarboxylase65 (GAD65) mRNA expressing neurons were generally less vulnerable than glutamate neurons. Reactive astrocytes and microglia were present after 24 h, however, became

  2. Ischemia-induced degeneration of CA1 pyramidal cells decreases seizure severity in a subgroup of epileptic gerbils and affects parvalbumin immunoreactivity of CA1 interneurons.

    PubMed

    Winkler, D T; Scotti, A L; Nitsch, C

    2001-04-01

    Mongolian gerbils are epilepsy-prone animals. In adult gerbils two major groups can be differentiated according to their seizure behavior: Highly seizure-sensitive gerbils exhibit facial and forelimb clonus or generalized tonic-clonic seizures from the first test on, while kindled-like gerbils are seizure free for the first three to six consecutive tests, later develop forelimb myoclonus, and eventually progress to generalized tonic-clonic seizures. In the hippocampus, seizure history of the individual animal is mirrored in the intensity in which GABAergic neurons are immunostained for the calcium-binding protein parvalbumin: they lose parvalbumin with increasing seizure incidence. In a first step to clarify the influence of hippocampal projection neurons on spontaneous seizure behavior and related parvalbumin expression, we induced degeneration of the CA1 pyramidal cells by transient forebrain ischemia. This results in a decreased seizure sensitivity in highly seizure-sensitive gerbils. The kindling-like process, however, is not permanently blocked by the ischemic nerve cell loss, suggesting that an intact CA1 field is not a prerequisite for the development of seizure behavior. The seizure-induced loss of parvalbumin from the ischemia-resistant interneurons recovers after ischemia. Thus, changes in parvalbumin content brought about by repeated seizures are not permanent but can rather be modulated by novel stimuli.

  3. Cortical silent period following transcranial magnetic stimulation in epileptic patients.

    PubMed

    Ertaş, N K; Gül, G; Altunhalka, A; Kirbas, D

    2000-09-01

    Cortical silent period (SP) following transcranial magnetic stimulation is mainly due to cortical inhibitory mechanisms. SP may have a value for detecting inhibitory mechanisms in epileptic patients with or without treatment. The aim of this study was to evaluate the effect of both the epilepsy and the antiepileptic medication on these inhibitory mechanisms. The subgroups studied consisted of (a) normal subjects, (b) unmedicated epileptic patients, (c) epileptic patients with uncontrolled seizures under medication, (d) epileptic patients with controlled seizures under medication. SP following transcranial magnetic stimulation was measured in all subjects. The SP values from shortest to the longest were in the following order: 1) normal subjects; 2) epileptic patients with controlled seizures under medication; 3) unmedicated epileptic patients; 4) epileptic patients with uncontrolled seizures under medication. Our findings probably indicate the enhanced interictal inhibitory mechanisms in epilepsy which is resistant to antiepileptic medication.

  4. Favorable outcome of epileptic blindness in children.

    PubMed

    Shahar, Eli; Barak, Shai

    2003-01-01

    Acute blindness is a rare presentation of epileptic seizures, referring to loss of sight without loss of consciousness associated with electroencephalographic (EEG) epileptic discharges, mainly representing an ictal phase but also either pre- or postictal. We report a series of 14 children with documented epileptic blindness, describing the accompanying fits and thereafter the response to therapy to resolve the blindness and control associated seizures. All patients experienced episodes of acute complete visual obscuration lasting for 1 to 10 minutes. Seven patients hadaccompanying generalized seizures, with a photosensitive response recorded in three of them. All of these seven children were treated with valproic acid, regaining full vision, and six of them became seizure free. Three patients with acute blindness who had accompanying focal motor seizures and unilateral temporooccipital posterior epileptic discharges were treated with carbamazepine regained full vision and complete seizure control. Four additional children had the constellation of migrainous headaches, focal motor phenomena, and complete blindness, along with occipital discharges compatible with Gastaut syndrome, benign childhood epilepsy with occipital paroxysms. All four patients were started on carbamazepine and became asymptomatic. Our overall experience suggests that epileptic blindness in children is associated with a favorable outcome when promptly diagnosed and treated appropriately, resulting in complete resolution of blindness in all children and satisfactory control of seizures in most of them. We therefore recommend performing a prompt EEG in any child presenting with acute visual obscuration, even in the absence of other epileptic phenomena.

  5. Pathophysiology of epileptic encephalopathies.

    PubMed

    Lado, Fred A; Rubboli, Guido; Capovilla, Giuseppe; Capovilla, Pippo; Avanzini, Giuliano; Moshé, Solomon L

    2013-11-01

    The application of metabolic imaging and genetic analysis, and now the development of appropriate animal models, has generated critical insights into the pathogenesis of epileptic encephalopathies. In this article we present ideas intended to move from the lesions associated with epileptic encephalopathies toward understanding the effects of these lesions on the functioning of the brain, specifically of the cortex. We argue that the effects of focal lesions may be magnified through the interaction between cortical and subcortical structures, and that disruption of subcortical arousal centers that regulate cortex early in life may lead to alterations of intracortical synapses that affect a critical period of cognitive development. Impairment of interneuronal function globally through the action of a genetic lesion similarly causes widespread cortical dysfunction manifesting as increased delta slow waves on electroencephalography (EEG) and as developmental delay or arrest clinically. Finally, prolonged focal epileptic activity during sleep (as occurring in the syndrome of continuous spike-wave in slow sleep, or CSWSS) might interfere with local slow wave activity at the site of the epileptic focus, thereby impairing the neural processes and, possibly, the local plastic changes associated with learning and other cognitive functions. Seizures may certainly add to these pathologic processes, but they are likely not necessary for the development of the cognitive pathology. Nevertheless, although seizures may be either a consequence or symptom of the underlying lesion, their effective treatment can improve outcomes as both clinical and experimental studies may suggest. Understanding their substrates may lead to novel, effective treatments for all aspects of the epileptic encephalopathy phenotype.

  6. [The effects of intra-cerebroventricular administered rocuronium on the central nervous system of rats and determination of its epileptic seizure-inducing dose].

    PubMed

    Baykal, Mehmet; Gökmen, Necati; Doğan, Alper; Erbayraktar, Serhat; Yılmaz, Osman; Ocmen, Elvan; Erdost, Hale Aksu; Arkan, Atalay

    The aim of this study was to investigate the effects of intracerebroventricularly administered rocuronium bromide on the central nervous system, determine the seizure threshold dose of rocuronium bromide in rats, and investigate the effects of rocuronium on the central nervous system at 1/5, 1/10, and 1/100 dilutions of the determined seizure threshold dose. A permanent cannula was placed in the lateral cerebral ventricle of the animals. The study was designed in two phases. In the first phase, the seizure threshold dose of rocuronium bromide was determined. In the second phase, Group R 1/5 (n=6), Group 1/10 (n=6), and Group 1/100 (n=6) were formed using doses of 1/5, 1/10, and 1/100, respectively, of the obtained rocuronium bromide seizure threshold dose. The rocuronium bromide seizure threshold value was found to be 0.056±0.009μmoL. The seizure threshold, as a function of the body weight of rats, was calculated as 0.286μmoL/kg(-1). A dose of 1/5 of the seizure threshold dose primarily caused splayed limbs, posturing, and tremors of the entire body, whereas the dose of 1/10 of the seizure threshold dose caused agitation and shivering. A dose of 1/100 of the seizure threshold dose was associated with decreased locomotor activity. This study showed that rocuronium bromide has dose-related deleterious effects on the central nervous system and can produce dose-dependent excitatory effects and seizures. Publicado por Elsevier Editora Ltda.

  7. Intermittent phase synchronization in human epileptic brain

    NASA Astrophysics Data System (ADS)

    Moskalenko, Olga I.; Koloskova, Anastasya D.; Zhuravlev, Maksim O.; Koronovskii, Alexey A.; Hramov, Alexander E.

    2017-03-01

    We found the intermittent phase synchronization in human epileptic brain. We show that the phases of the synchronous behavior are observed both during the epileptic seizures and in the fields of the background activity of the brain. We estimate the degree of intermittent phase synchronization in both considered cases and found that the epileptic seizures are characterized by the higher degree of synchronization in comparison with the fields of background activity. For estimation of synchronization degree the modification of the method for estimation of zero conditional Lyapunov exponent from time series proposed in [PRE 92 (2015) 012913] has been used.

  8. Treatment of epileptic encephalopathies.

    PubMed

    McTague, Amy; Cross, J Helen

    2013-03-01

    Epileptic encephalopathy is defined as a condition where the epileptic activity itself may contribute to the severe neurological and cognitive impairment seen, over and above that which would be expected from the underlying pathology alone. The epilepsy syndromes at high risk of this are a disparate group of conditions characterized by epileptic seizures that are difficult to treat and developmental delay. In this review, we discuss the ongoing debate regarding the significance of inter-ictal discharges and the impact of the seizures themselves on the cognitive delay or regression that is a common feature of these syndromes. The syndromes also differ in many ways and we provide a summary of the key features of the early-onset epileptic encephalopathies including Ohtahara and West syndromes in addition to later childhood-onset syndromes such as Lennox Gastaut and Doose syndromes. An understanding of the various severe epilepsy syndromes is vital to understanding the rationale for treatment. For example, the resolution of hypsarrhythmia in West syndrome is associated with an improvement in cognitive outcome and drives treatment choice, but the same cannot be applied to frequent inter-ictal discharges in Lennox Gastaut syndrome. We discuss the evidence base for treatment where it is available and describe current practice where it is not. For example, in West syndrome there is some evidence for preference of hormonal treatments over vigabatrin, although the choice and duration of hormonal treatment remains unclear. We describe the use of conventional and newer anti-epileptic medications in the various syndromes and discuss which medications should be avoided. Older possibly forgotten treatments such as sulthiame and potassium bromide also have a role in the severe epilepsies of childhood. We discuss hormonal treatment with particular focus on the treatment of West syndrome, continuous spike wave in slow wave sleep (CSWS)/electrical status epilepticus in slow wave

  9. [ECG characteristics in epilepsy of homo- and heterospecific hereditary origin and schizophrenia with latent epileptic predisposition].

    PubMed

    Dvirskiĭ, A G; Shevtsov, A G; Glasner, A K; Dubrovin, Iu B; Krut'ko, Iu A; Svaĭdan, S

    1991-01-01

    The EEG data were compared among 260 epileptic patients, including 94 patients loaded with schizophrenia, 71 patients loaded with epilepsy, 95 patients without revealed hereditary loading with mental diseases, and among 32 schizophrenics in whom epileptic seizures could be seen during insulin therapy. Hereditary loading with epilepsy or schizophrenia in epileptic patients together with latent epileptic schizophrenia ++predisposition influence the characteristics of the electroencephalogram.

  10. Clinical review of genetic epileptic encephalopathies

    PubMed Central

    Noh, Grace J.; Asher, Y. Jane Tavyev; Graham, John M.

    2012-01-01

    Seizures are a frequently encountered finding in patients seen for clinical genetics evaluations. The differential diagnosis for the cause of seizures is quite diverse and complex, and more than half of all epilepsies have been attributed to a genetic cause. Given the complexity of such evaluations, we highlight the more common causes of genetic epileptic encephalopathies and emphasize the usefulness of recent technological advances. The purpose of this review is to serve as a practical guide for clinical geneticists in the evaluation and counseling of patients with genetic epileptic encephalopathies. Common syndromes will be discussed, in addition to specific seizure phenotypes, many of which are refractory to anti-epileptic agents. Divided by etiology, we overview the more common causes of infantile epileptic encephalopathies, channelopathies, syndromic, metabolic, and chromosomal entities. For each condition, we will outline the diagnostic evaluation and discuss effective treatment strategies that should be considered. PMID:22342633

  11. Frontal lobe nonconvulsive status epilepticus: a case of epileptic stuttering, aphemia, and aphasia--not a sign of psychogenic nonepileptic seizures.

    PubMed

    Kaplan, Peter W; Stagg, Ryan

    2011-06-01

    Stuttering is a repetitive, iterative disfluency of speech, and is usually seen as a developmental problem in childhood. Acquired causes in adults include strokes and medications. When stuttering occurs with seizure-like events, it is usually attributed to psychogenic nonepileptic seizures. We describe an elderly man who experienced personality change and bouts of stuttering, followed by anarthria with preserved writing and then aphasia affecting written and uttered language, and ending with confusion. EEG recordings showed nonconvulsive status epilepticus (NCSE) with focality in the left frontal region followed by bifrontal NCSE. This case enlarges our understanding of the behavioral correlates of focal frontal seizures to include simple partial seizures with speech and then language output disturbances (aphemia, then aphasia), progressing to complex partial phenomenology in the setting of frontal NCSE.

  12. [Therapeutic Drug Monitoring of Valproic Acid in Children: A Prospective Study of The Effect of The Compliance and The Economic Level on the Trough Plasmatic Concentrations and Epileptic Seizures].

    PubMed

    Charfi, Rim; Lakhal, Mohamed; Klouz, Anis; Trabelsi, Sameh; Salouage, Issam

    2015-01-01

    Valproic acid (VA) is a widely used antiepileptic drug. Because of its pharmacokinetic variability and the influence of intrinsic and extrinsic factors such as the treatment compliance, VA therapeutic drug monitoring (TDM) is recommended in children. The aim of this study is to evaluate the effect of treatment compliance and the economic level on VA tough plasmatic concentration (TPC) and epileptic rhythm in children. A one-year prospective study (August 2008-August 2009) concerning children (age≤5 years) regularly treated by VA who had a VA TDM. So, 276 plasmatic samples from 238 children were collected. The children were divided in two groups as following: the group 1 (G1) presenting a good compliance and a reliable questioning and the group 2 (G2) presenting a bad compliance and a non reliable questioning. We evaluated the interindividual variability by correlating the TPC to the dose. Then, we divided the hole group in function of their economic levels (low-medium-high). Sex ratio male/female was 1.3. Median age was 5 years+/-3,9. The mean TPC was 62 µg/mL [0.12-131 µg/mL]. VA TPC were in the therapeutic range (TR) in 62%. Adverse drug reactions were noted in 4.2% of the children. G1 represented 70% of the children and G2, 30%. The TPC were in the TR in 67% of G1 and 51% of G2 (p=0.02). There was a significant difference between the TPC in G1 and G2 (p=0.02).There was no significative difference in the TPC in function of the economic levels. There was no correlation between TPC and the administered doses. The epileptic seizures were more spaced in children with therapeutic TPC than those with TPC in the TR (p=0.002) and in G1 than in G2 (p=0.03). Compliance should be appropriate in order to optimize the TDM rule. A good compliance and a therapeutic TPC allow a better control of epileptic seizures. © 2015 Société Française de Pharmacologie et de Thérapeutique.

  13. [Gelastic seizures: etiology, semiology, therapeutic perspectives].

    PubMed

    Usacheva, E L; Mukhin, K Iu; Prityko, A G; Aĭvazian, S O; Kharlamov, L A; Shorina, M Iu

    2003-01-01

    Gelastic seizures (laughing seizures) are a rare type of epileptic seizure in which laugh in a main and dominating manifestation of the seizure. As a rule, the seizures are caused by organic cerebral pathology and are often reported as a specific epilepsy marker related to hypothalamic hamartoma. The interictal EEG frequently shows a focal activity. Based on examination of 2 patients with gelastic seizures and hypothalamic hamartoma, clinical features, EEG characteristics and therapeutic perspectives for the disorder are discussed.

  14. Classification of seizures and epilepsy.

    PubMed

    Riviello, James J

    2003-07-01

    The management of seizures and epilepsy begins with forming a differential diagnosis, making the diagnosis, and then classifying seizure type and epileptic syndrome. Classification guides treatment, including ancillary testing, management, prognosis, and if needed, selection of the appropriate antiepileptic drug (AED). Many AEDs are available, and certain seizure types or epilepsy syndromes respond to specific AEDs. The identification of the genetics, molecular basis, and pathophysiologic mechanisms of epilepsy has resulted from classification of specific epileptic syndromes. The classification system used by the International League Against Epilepsy is periodically revised. The proposed revision changes the classification emphasis from the anatomic origin of seizures (focal vs generalized) to seizure semiology (ie, the signs or clinical manifestations). Modified systems have been developed for specific circumstances (eg, neonatal seizures, infantile seizures, status epilepticus, and epilepsy surgery). This article reviews seizure and epilepsy classification, emphasizing new data.

  15. [Video electroencephalographic diagnosis of epileptic and non-epileptic paroxysmal episodes in infants and children at the pre-school age].

    PubMed

    Pérez-Jiménez, Angeles; García-Fernández, Marta; Santiago, M del Mar; Fournier-Del Castillo, M Concepción

    2012-05-21

    The main usefulness of video electroencephalographic (video-EEG) monitoring lies in the fact that it allows proper classification of the type of epileptic seizure and epileptic syndrome, identification of minor seizures, location of the epileptogenic zone and differentiation between epileptic seizures and non-epileptic paroxysmal manifestations (NEPM). In infants and pre-school age children, the clinical signs with which epileptic seizures are expressed differ to those of older children, seizures with bilateral motor signs such as epileptic spasms, tonic and myoclonic seizures predominate, and seizures with interruption of activity or hypomotor seizures, and no prominent automatisms are observed. In children with focal epilepsies, focal and generalised signs are often superposed, both clinically and in the EEG. NEPM may be benign transitory disorders or they can be episodic symptoms of different neurological or psychopathological disorders. NEPM are often observed in children with mental retardation, neurological compromise or autism spectrum disorders, who present epileptic seizures and epileptiform abnormalities in the baseline EEG. It then becomes necessary to determine which episodes correspond to epileptic seizures and which do not. The NEPM that are most frequently registered in the video-EEG in infants and pre-school age children are unexpected sudden motor contractions ('spasms'), introspective tendencies, motor stereotypic movements and paroxysmal sleep disorders.

  16. [Clinical approach to the first epileptic crisis in adults].

    PubMed

    Espinosa-Jovel, Camilo Alfonso; Sobrino-Mejía, Fidel Ernesto

    2014-04-16

    Seizures are one of the main reasons for visits to emergency and neurology. Represent a traumatic event with potential medical and social consequences. A first epileptic seizure, can be the initial manifestation of malignancy, systemic disorder or infection, but can also be the first manifestation of epilepsy. The misdiagnosis of symptomatic seizures and unprovoked seizure, significantly affects prognosis and patient outcomes. The aim of this review is to examine the general concepts that enable successful diagnostic and therapeutic approach to the patient presenting with a first epileptic seizure.

  17. Management of seizures in children.

    PubMed

    El-Radhi, A Sahib

    Seizures are common events in children and up to 10% of all children experience at least one seizure during their childhood. They can be triggered by many conditions such as fever, medications or injury. Febrile seizures are the most common types of seizures, affecting 3-4% of children. While epilepsy is typically recurrent and unprovoked, a single, isolated seizure is not epilepsy. Taking a detailed history of the seizure description helps establish the diagnosis. A video recording of the event can also support the diagnosis and rule out non-epileptic seizures that resemble seizures, such as pseudo-seizure. Seeing a child having a seizure, particularly if it is the first one, is usually frightening and distressing for the parents. First seizure should always be evaluated by health professionals because of a possible serious underlying cause. If the seizure occurs at home, the child should be placed in the recovery side position to prevent the swallowing of any vomit. The care of a child who does have epilepsy is best achieved by a community or hospital epilepsy specialist nurse. These nurses play a pivotal role in providing a close link between the epileptic children and their families. Such a nurse is also in an ideal position to establish a link between the doctor and affected families, offering valuable advice and support, and visiting the epileptic child at home.

  18. Astrocytes in the epileptic brain.

    PubMed

    Wetherington, Jonathon; Serrano, Geidy; Dingledine, Ray

    2008-04-24

    The roles that astrocytes play in the evolution of abnormal network excitability in chronic neurological disorders involving brain injury, such as acquired epilepsy, are receiving renewed attention due to improved understanding of the molecular events underpinning the physiological functions of astrocytes. In epileptic tissue, evidence is pointing to enhanced chemical signaling and disrupted linkage between water and potassium balance by reactive astrocytes, which together conspire to enhance local synchrony in hippocampal microcircuits. Reactive astrocytes in epileptic tissue both promote and oppose seizure development through a variety of specific mechanisms; the new findings suggest several novel astrocyte-related targets for drug development.

  19. Astrocytes in the Epileptic Brain

    PubMed Central

    Wetherington, Jonathon; Serrano, Geidy; Dingledine, Ray

    2014-01-01

    The roles that astrocytes play in the evolution of abnormal network excitability in chronic neurological disorders involving brain injury, such as acquired epilepsy, are receiving renewed attention due to improved understanding of the molecular events underpinning the physiological functions of astrocytes. In epileptic tissue, evidence is pointing to enhanced chemical signaling and disrupted linkage between water and potassium balance by reactive astrocytes, which together conspire to enhance local synchrony in hippocampal microcircuits. Reactive astrocytes in epileptic tissue both promote and oppose seizure development through a variety of specific mechanisms; the new findings suggest several novel astrocyte-related targets for drug development. PMID:18439402

  20. Seizure Recognition and Observation: A Guide for Allied Health Professionals.

    ERIC Educational Resources Information Center

    Epilepsy Foundation of America, Landover, MD.

    Intended for allied health professionals, this guide provides information on seizure recognition and classification to help them assist the patient, the family, and the treating physician in obtaining control of epileptic seizures. A section on seizure recognition describes epilepsy and seizures, covering seizure classification and the causes of…

  1. Transient epileptic amnesia.

    PubMed

    Zeman, Adam; Butler, Christopher

    2010-12-01

    Case reports over the past 100 years have raised the possibility that epilepsy can manifest itself in episodes of amnesia. Recent research has established that this is indeed the case, and indicates that characteristic varieties of interictal memory disturbance co-occur with this form of epilepsy. Transient epileptic amnesia is a distinctive syndrome of temporal lobe epilepsy principally affecting middle-aged people, giving rise to recurrent, brief attacks of amnesia, often occurring on waking. It is associated with novel forms of interictal memory disturbance: accelerated long-term forgetting, remote memory impairment, especially affecting autobiographical memory, and topographical memory impairment. The seizure focus lies in the medial temporal lobes. The seizures respond promptly to treatment, whereas the interictal impairments generally persist. Further work is required to establish whether the interictal memory impairment is due to physiological or structural disturbance. Transient epileptic amnesia is an under-recognized but treatable cause of transient memory impairment. Accelerated long-term forgetting and autobiographical amnesia, which are invisible to standard memory tests, help to explain the discrepancy between normal test performance and prominent memory complaints among patients with epilepsy. Further investigation of these forms of memory impairment promises to shed light on processes of human memory.

  2. [Ictus emeticus. Vomiting as epileptic manifestation].

    PubMed

    Nakken, K O

    1996-01-30

    Autonomic and visceral phenomena are well-known manifestations of epileptic seizures, but recurrent vomiting as ictal epileptic events are less known. Three patients with ictus emeticus, i.e. with nausea and vomiting as their main ictal symptoms, are described. Vomiting is a complex symptom preceded by several phenomena in the gastrointestinal tract and transmitted by the vagal nerve to the vomiting centre in the lateral reticular formation of the medulla oblongata. This autonomic centre in the brain stem is influenced by several cerebral structures. There is both experimental and clinical evidence to support the hypothesis that epileptic disturbances in the insula and the mesial temporal structures are responsible for ictus emeticus.

  3. Epileptic phenomena in bismuth toxic encephalopathy.

    PubMed Central

    Buge, A; Supino-Viterbo, V; Rancurel, G; Pontes, C

    1981-01-01

    Seventy patients admitted to hospital with bismuth encephalopathy had repeated clinical and EEG examinations. All the patients exhibited myoclonic jerks, but no paroxysmal features ever appeared on EEG. Computed tomography showed cortical hyperdensities. Seizures were observed in 22 patients, but epileptic EEG patterns appeared only when the bismuth blood level was below 1500 microgram/1. It is suggested that a high cortical intracellular bismuth concentration induces a "cortical inhibition" which causes suppression of physiological electrical brain activity, the absence of EEG paroxysmal phenomena during myoclonic jerks, and explains the rarity of epileptic seizures. Images PMID:7205307

  4. Spread of epileptic activity in human brain

    NASA Astrophysics Data System (ADS)

    Milton, John

    1997-03-01

    For many patients with medically refractory epilepsy surgical resection of the site of seizure onset (epileptic focus) offers the best hope for cure. Determination of the nature of seizure propagation should lead to improved methods for locating the epileptic focus (and hence reduce patient morbidity) and possibly to new treatment modalities directed at blocking seizure spread. Theoretical studies of neural networks emphasize the role of traveling waves for the propagation of activity. However, the nature of seizure propagation in human brain remains poorly characterized. The spread of epileptic activity in patients undergoing presurgical evaluation for epilepsy surgery was measured by placing subdural grids of electrodes (interelectrode spacings of 3-10 mm) over the frontal and temporal lobes. The exact location of each electrode relative to the surface of the brain was determined using 3--D MRI imaging techniques. Thus it is possible to monitor the spread of epileptic activity in both space and time. The observations are discussed in light of models for seizure propagation.

  5. eEF2K/eEF2 Pathway Controls the Excitation/Inhibition Balance and Susceptibility to Epileptic Seizures.

    PubMed

    Heise, Christopher; Taha, Elham; Murru, Luca; Ponzoni, Luisa; Cattaneo, Angela; Guarnieri, Fabrizia C; Montani, Caterina; Mossa, Adele; Vezzoli, Elena; Ippolito, Giulio; Zapata, Jonathan; Barrera, Iliana; Ryazanov, Alexey G; Cook, James; Poe, Michael; Stephen, Michael Rajesh; Kopanitsa, Maksym; Benfante, Roberta; Rusconi, Francesco; Braida, Daniela; Francolini, Maura; Proud, Christopher G; Valtorta, Flavia; Passafaro, Maria; Sala, Mariaelvina; Bachi, Angela; Verpelli, Chiara; Rosenblum, Kobi; Sala, Carlo

    2017-03-01

    Alterations in the balance of inhibitory and excitatory synaptic transmission have been implicated in the pathogenesis of neurological disorders such as epilepsy. Eukaryotic elongation factor 2 kinase (eEF2K) is a highly regulated, ubiquitous kinase involved in the control of protein translation. Here, we show that eEF2K activity negatively regulates GABAergic synaptic transmission. Indeed, loss of eEF2K increases GABAergic synaptic transmission by upregulating the presynaptic protein Synapsin 2b and α5-containing GABAA receptors and thus interferes with the excitation/inhibition balance. This cellular phenotype is accompanied by an increased resistance to epilepsy and an impairment of only a specific hippocampal-dependent fear conditioning. From a clinical perspective, our results identify eEF2K as a potential novel target for antiepileptic drugs, since pharmacological and genetic inhibition of eEF2K can revert the epileptic phenotype in a mouse model of human epilepsy. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. Diagnosis and Management of Epileptic Encephalopathies in Children

    PubMed Central

    Jain, Puneet; Tripathi, Manjari

    2013-01-01

    Epileptic encephalopathies refer to a group of disorders in which the unremitting epileptic activity contributes to severe cognitive and behavioral impairments above and beyond what might be expected from the underlying pathology alone, and these can worsen over time leading to progressive cerebral dysfunction. Several syndromes have been described based on their electroclinical features (age of onset, seizure type, and EEG pattern). This review briefly describes the clinical evaluation and management of commonly encountered epileptic encephalopathies in children. PMID:23970964

  7. Prosthetic management of an epileptic patient.

    PubMed

    Akeredolu, P A; Temisanren, O T; Danesi, M A

    2005-12-01

    This case report illustrates the problems of tooth loss in an epileptic patient. The patient presented with a broken denture following a seizure. She gave a history of breaking and swallowing her dentures during seizures. Before presentation she had worn five upper removable partial dentures. An upper removable partial denture with increased thickness of the acrylic palatal was fabricated and fitted satisfactorily. The patient was taught how to insert and remove the prosthesis as quickly as possible. Epileptic patients can use dentures but run the risk of frequently breaking and swallowing them during seizures. The risk can be reduced if patients and relatives are taught how to remove the dentures prior to or during seizures.

  8. [Childhood-onset epileptic blindness--clinical correlates and outcomes].

    PubMed

    Shahar, Eli; Ravid, Sarit; Andraus, Jameel

    2004-01-01

    Acute blindness is a rare presentation of epileptic disorders referring to loss of sight without loss of consciousness corroborating with epileptic discharges recorded on the EEG. We summarized the pertinent literature on childhood-onset epileptic blindness. We also report on our overall experience with 26 children having developed epileptic amaurosis. This includes descriptions of the associated seizures. EEG abnormalities and reports on the response to anti-epileptic therapy as regards to resolution of blindness and control of associated seizures. Our data for children with epileptic blindness is similar to previous reports regarding the reported duration of blindness and associated seizures, as well as the overall response to therapy and outcome. In our study, 25 children experienced acute episodes of complete visual obscuration lasting for 1-10 minutes and one 4-month-old infant had blindness from birth, representing status epilepticus amauroticus. Ten patients had accompanying generalized seizures, with a photosensitive response recorded in three cases. All of these children were treated with valproic acid regaining full vision and eight became seizure free. Ten children had accompanying focal motor seizures and unilateral temporo-posterior epileptic discharges recorded on EEG and two additional cases had isolated blindness and focal discharges. All 12 children were treated with carbamazepine, regaining full vision and complete seizure control in eleven. One infant with status epilepticus amauroticus since birth, secondary to a persistent epileptic focus over the right central-posterior areas, regained full vision following resection of an area of cortical dysplasia at the age of 8 months. Four additional children had the constellation of migraine headaches, focal motor seizures and complete blindness along with occipital EEG discharges, compatible with the syndrome of late-onset benign childhood epilepsy with occipital paroxysms (Gastaut syndrome). They were

  9. Psychogenic gelastic seizures in a patient with hypothalamic hamartoma.

    PubMed

    Scarella, Timothy; Macken, Michael P; Gerard, Elizabeth; Schuele, Stephan U

    2012-06-01

    Gelastic seizures are classically associated with hypothalamic hamartoma. The most effective treatment for gelastic epilepsy is surgery, although confirming that a hypothalamic hamartoma is an epileptic lesion prior to surgical intervention is challenging. Here, we report the case of a patient with a hypothalamic hamartoma who was diagnosed with psychogenic non-epileptic gelastic seizures using video-EEG monitoring. [Published with video sequences].

  10. Attention Deficit Hyperactivity Disorder in Epileptic Children

    PubMed Central

    Kim, Gun-Ha; Kim, Ji Yeon; Byeon, Jung Hye; Eun, Baik-Lin; Rhie, Young Jun; Seo, Won Hee

    2012-01-01

    It is well-known that the prevalence of attention deficit hyperactivity disorder (ADHD) is higher in epileptic children than in the general pediatric population. The aim of this study was to compare the accompaniment of ADHD in epileptic children with well-controlled seizures and no significant intellectual disability with that in healthy controls. We included epileptic children between the ages of 6 and 12 yr visiting our clinic for six consecutive months and controls without significant medical or psychiatric illnesses. We excluded patients with intellectual disability or persistent seizures during the recent three months. The diagnosis of ADHD was based on the criteria of the Diagnostic and Statistical Manual of Mental Disorders-IV (DSM-IV). After exclusion of 84 patients, we enrolled 102 (54.8%) children (mean age, 9.4 ± 2.0 yr). Seven (7 of 102, 6.9%) were diagnosed with ADHD. As compared to control group (4 of 110, 3.6%), there was no difference in ADHD accompaniment (P = 0.29). No difference was observed in ADHD accompaniment according to seizure type and epilepsy syndrome. In conclusion, the accompaniment of ADHD in epileptic children with well-controlled seizures and no intellectual disability may not differ from that of the general pediatric population. PMID:23091322

  11. Postnatal disruption of the disintegrin/metalloproteinase ADAM10 in brain causes epileptic seizures, learning deficits, altered spine morphology, and defective synaptic functions.

    PubMed

    Prox, Johannes; Bernreuther, Christian; Altmeppen, Hermann; Grendel, Jasper; Glatzel, Markus; D'Hooge, Rudi; Stroobants, Stijn; Ahmed, Tariq; Balschun, Detlef; Willem, Michael; Lammich, Sven; Isbrandt, Dirk; Schweizer, Michaela; Horré, Katrien; De Strooper, Bart; Saftig, Paul

    2013-08-07

    The metalloproteinase ADAM10 is of importance for Notch-dependent cortical brain development. The protease is tightly linked with α-secretase activity toward the amyloid precursor protein (APP) substrate. Increasing ADAM10 activity is suggested as a therapy to prevent the production of the neurotoxic amyloid β (Aβ) peptide in Alzheimer's disease. To investigate the function of ADAM10 in postnatal brain, we generated Adam10 conditional knock-out (A10cKO) mice using a CaMKIIα-Cre deleter strain. The lack of ADAM10 protein expression was evident in the brain cortex leading to a reduced generation of sAPPα and increased levels of sAPPβ and endogenous Aβ peptides. The A10cKO mice are characterized by weight loss and increased mortality after weaning associated with seizures. Behavioral comparison of adult mice revealed that the loss of ADAM10 in the A10cKO mice resulted in decreased neuromotor abilities and reduced learning performance, which were associated with altered in vivo network activities in the hippocampal CA1 region and impaired synaptic function. Histological and ultrastructural analysis of ADAM10-depleted brain revealed astrogliosis, microglia activation, and impaired number and altered morphology of postsynaptic spine structures. A defect in spine morphology was further supported by a reduction of the expression of NMDA receptors subunit 2A and 2B. The reduced shedding of essential postsynaptic cell adhesion proteins such as N-Cadherin, Nectin-1, and APP may explain the postsynaptic defects and the impaired learning, altered network activity, and synaptic plasticity of the A10cKO mice. Our study reveals that ADAM10 is instrumental for synaptic and neuronal network function in the adult murine brain.

  12. Long-lasting c-fos and NGF mRNA expressions and loss of perikaryal parvalbumin immunoreactivity in the development of epileptogenesis after ethacrynic acid-induced seizure.

    PubMed

    Suzukawa, J; Omori, K; Okugawa, G; Fujiseki, Y; Heizmann, C W; Inagaki, C

    1999-07-10

    A single cerebroventricular injection of ethacrynic acid (EA), a Cl(-)-ATPase inhibitor, induces generalized tonic-clonic convulsions in mice. To clarify whether such convulsive stimulus triggers a long-lasting rearrangement of the neural circuitry culminating in seizure susceptibility, we examined molecular, cellular and behavioral changes following the EA-induced seizure. The expression of immediate early gene c-fos mRNA as an index for cellular activation increased biphasically, with an early transient increase at 60 min and a late prolonged increase on the 10th to 14th day post-EA administration, most remarkably in the hippocampus and pyriform cortex. On the 14th day post-EA seizure, subconvulsive dose of kainic acid (5-17.5 mg/kg) caused severe (stage 5) seizure in 77% of the mice, with 70% mortality. In addition, the expression of nerve growth factor (NGF) also showed biphasic increases with close spatiotemporal correlation with c-fos expression. Moreover, the number of cell somata and the density of axon fibers of parvalbumin (PARV)-positive cells, a subpopulation of GABAergic interneurons, decreased in area dentata, CA1 and CA3 on the 7th and 14th day post-EA seizure. In area dentata and CA1, the density of glutamic acid decarboxylase (GAD)-positive cells also decreased on the 14th day. Thus, the transient EA-induced seizures appear to develop seizure susceptibility by causing damage of a subpopulation of inhibitory interneurons along with increases in the expression of c-fos and NGF in limbic structures.

  13. [Reflex seizures, cinema and television].

    PubMed

    Olivares-Romero, Jesús

    2015-12-16

    In movies and television series are few references to seizures or reflex epilepsy even though in real life are an important subgroup of total epileptic syndromes. It has performed a search on the topic, identified 25 films in which they appear reflex seizures. Most seizures observed are tonic-clonic and visual stimuli are the most numerous, corresponding all with flashing lights. The emotions are the main stimuli in higher level processes. In most cases it is not possible to know if a character suffers a reflex epilepsy or suffer reflex seizures in the context of another epileptic syndrome. The main conclusion is that, in the movies, the reflex seizures are merely a visual reinforcing and anecdotal element without significant influence on the plot.

  14. [Paroxysmal disorders and episodic non-epileptic symptoms].

    PubMed

    Nieto-Barrera, M

    Non epileptic paroxysmal events (NEPE) are clinical disorders of usually sudden appearance, brief and originated by a cerebral disfunction of diverse causes with a common character to be no epileptic. The non epileptic paroxysmal events are more frequent than epileptic events. The 10% of the children have NEPE. The NEPE can to be confounded with epileptic fits. Careful and detailed history and wise valuation of the circumstances of occurrence and the characteristics and duration of the seizures are determined. The history include developmental milestones and search for possible causes of seizure disorders. A complete clinical examination and EEG are essentials in the differential diagnosis. More sophisticated techniques--polygraphy and video EEG monitoring--are of great value in selected and difficult cases. The NEPE are categorized: anoxic/hypoxia paroxysmal disorders, psychogenic paroxysmal events, paroxysmal events occurring during sleep, paroxysmal events of movements and other episodic symptoms.

  15. Causative factors for suicide attempts by overdose in epileptics.

    PubMed

    Mendez, M F; Lanska, D J; Manon-Espaillat, R; Burnstine, T H

    1989-10-01

    We investigated possible causative factors for the high epileptic suicide rate by reviewing the cases of 22 patients with idiopathic epilepsy found among 711 patients hospitalized for a suicide attempt by overdose. Suicide attempts occurred with increased seizure activity in one epileptic; otherwise, no relationships were found with seizure-related variables. When matched by age, sex, and race with 44 nonepileptic controls from the same population, the epileptics had more borderline personality disorders with multiple impulsive suicide attempts (45.5% vs 13.6%), more psychotic disturbances, including command hallucinations (31.8% vs 9.1%), fewer adjustment disorders (18.2% vs 45.5%), and a comparable frequency of depression (13.6% vs 25%). We conclude that suicide attempts in epileptics are primarily associated with interictal psychopathologic factors, such as borderline personality disorder and psychosis, rather than with specific psychosocial stressors, seizure variables, or anticonvulsant medications.

  16. Progress in autoimmune epileptic encephalitis

    PubMed Central

    Wright, S.; Vincent, A.

    2016-01-01

    Purpose of review Autoimmune epileptic encephalopathy is a potentially treatable neurological syndrome characterized by the coexistence of a neuronal antibody in the CSF and serum. Patients present with combinations of seizures, neuropsychiatric features, movement disorder and cognitive decline, but some patients have isolated seizures either at first presentation or during their illness. This review summarises our current understanding of the roles of specific neuronal antibodies in epilepsy-related syndromes and aims to aid the clinician in diagnosis and treatment. Recent findings Antigen discovery methods in three neuroimmunology centres independently identified antibodies to different subunits of the GABAA receptor; high levels of these antibodies were found mainly in patients with severe refractory seizures. These and other antibodies were also found in a proportion (<10%) of children and adults with epilepsy. A clinical study comparing immunotherapy in patients with autoantibodies or without an identified target antigen found neuroinflammatory features were predictive of a therapeutic response. New in-vitro and in-vivo studies, and spontaneous animal models, have confirmed the pathogenicity and epileptogenicity of neuronal antibodies and their relevance to other mammals. Summary Neuronal antibodies are an important cause of autoimmune epileptic encephalopathy, early recognition is important as there may be an underlying tumour, and early treatment is associated with a better outcome. In the absence of an antibody, the clinician should adopt a pragmatic approach and consider a trial of immunotherapy when other causes have been excluded. PMID:26886357

  17. Transient epileptic amnesia: clinical report of a cohort of patients.

    PubMed

    Lapenta, Leonardo; Brunetti, Valerio; Losurdo, Anna; Testani, Elisa; Giannantoni, Nadia Mariagrazia; Quaranta, Davide; Di Lazzaro, Vincenzo; Della Marca, Giacomo

    2014-07-01

    Transient epileptic amnesia is a seizure disorder, usually with onset in the middle-elderly and good response to low dosages of antiepileptic drugs. We describe the clinical, electroencephalography (EEG), and neuroimaging features of 11 patients with a temporal lobe epilepsy characterized by amnesic seizures as the sole or the main symptom. We outline the relevance of a detailed clinical history to recognize amnesic seizures and to avoid the more frequent misdiagnoses. Moreover, the response to monotherapy was usually good, although the epileptic disorder was symptomatic of acquired lesions in the majority of patients.

  18. [Simple febrile seizure, complex seizure, generalized epilepsy with febrile seizure plus, FIRES and new syndromes].

    PubMed

    Moreno de Flagge, Noris

    2013-01-01

    Febrile seizures are the most common seizures in childhood. They have been observed in 2-5% of children before the age of 5, but in some populations this figure may increase to 15%. It is a common cause of pediatric hospital admissions and cause of anxiety for parents. Febrile seizures could be the first manifestation of epilepsy. About 13% of epileptic patients have a history of febrile seizure, and 30% have had recurrent febrile seizures. Their phenotypic characteristics allow, in the majority of cases, a classification of the seizure, an elaboration of a prognosis and to assume a specific therapeutic attitude. It is possible to describe a spectrum according to their severity, from the benign simple seizure to the more complex, febrile seizure plus, Dravet'syndrome, and FIRES. During the past decade, molecular genetic studies have contributed to the identification of genetic factors involved in febrile seizure and related disorders, making the necessity of a careful follow up of these patients in order to detect risk factors earlier. We have reviewed the medical literature to update current knowledge of febrile seizures, their prognosis and their relation to new epileptic syndromes.

  19. Frequency interactions in human epileptic brain.

    PubMed

    Cotic, Marija; Zalay, Osbert; Valiante, Taufik; Carlen, Peter L; Bardakjian, Berj L

    2011-01-01

    We have used two algorithms, wavelet phase coherence (WPC) and modulation index (MI) analysis to study frequency interactions in the human epileptic brain. Quantitative analyses were performed on intracranial electroencephalographic (iEEG) segments from three patients with neocortical epilepsy. Interelectrode coherence was measured using WPC and intraelectrode frequency interactions were analyzed using MI. WPC was performed on electrode pairings and the temporal evolution of phase couplings in the following frequency ranges: 1-4 Hz, 4-8 Hz, 8-13 Hz, 13-30 Hz and 30-100 Hz was studied. WPC was strongest in the 1-4 Hz frequency range during both seizure and non-seizure activities; however, WPC values varied minimally between electrode pairings. The 13-30 Hz band showed the lowest WPC values during seizure activity. MI analysis yielded two prominent patterns of frequency-specific activity, during seizure and non-seizure activities, which were present across all patients.

  20. Factors associated with hopelessness in epileptic patients

    PubMed Central

    Pompili, Maurizio; Serafini, Gianluca; Innamorati, Marco; Montebovi, Franco; Lamis, Dorian A; Milelli, Mariantonietta; Giuliani, Manuela; Caporro, Matteo; Tisei, Paolo; Lester, David; Amore, Mario; Girardi, Paolo; Buttinelli, Carla

    2014-01-01

    AIM: To investigate factors related to hopelessness in a sample of epileptic patients, including measures of depression and quality of life (QOL). METHODS: Sixty-nine participants were administered the following psychometric instruments: Beck Depression Inventory-II, Beck Hopelessness Scale (BHS), and QOL in Epilepsy (QOLIE)-89. Patients were dichotomized into two categories: those affected by epilepsy with generalized tonic-clonic seizures vs those having epilepsy with partial seizures. RESULTS: The groups differed on the QOLIE Role Limitation/Emotional dimension. Patients with generalized seizures reported more limitations in common social/role activities related to emotional problems than patients with other types of epilepsy (89.57 ± 25.49 vs 72.86 ± 36.38; t63 = -2.16; P < 0.05). All of the respondents reported moderate to severe depression, and 21.7% of patients with generalized seizures and 28.6% of patients with other diagnoses had BHS total scores ≥ 9 indicating a higher suicidal risk. The study did not control for years of the illness. CONCLUSION: Patients with generalized seizures reported more limitations in common social/role activities related to emotional problems compared to patients with other types of seizures. Patients at increased suicide risk as evaluated by the BHS were older than those who had a lower suicidal risk. Future studies are required to further investigate the impact of hopelessness on the outcome of epileptic patients. PMID:25540729

  1. Epileptic and nonepileptic features in patients with early onset epileptic encephalopathy and STXBP1 mutations.

    PubMed

    Milh, Mathieu; Villeneuve, Nathalie; Chouchane, Mondher; Kaminska, Anna; Laroche, Cécile; Barthez, Marie Anne; Gitiaux, Cyril; Bartoli, Céline; Borges-Correia, Ana; Cacciagli, Pierre; Mignon-Ravix, Cécile; Cuberos, Hélène; Chabrol, Brigitte; Villard, Laurent

    2011-10-01

    STXBP1 (MUNC18-1) mutations have been associated with various types of epilepsies, mostly beginning early in life. To refine the phenotype associated with STXBP1 aberrations in early onset epileptic syndromes, we studied this gene in a cohort of patients with early onset epileptic encephalopathy. STXBP1 was screened in a multicenter cohort of 52 patients with early onset epilepsy (first seizure observed before the age of 3 months), no cortical malformation on brain magnetic resonance imaging (MRI), and negative metabolic screening. Three groups of patients could be distinguished in this cohort: (1) Ohtahara syndromes (n = 38); (2) early myoclonic encephalopathies (n = 7); and (3) early onset epileptic encephalopathies that did not match any familiar syndrome (n = 7). None of the patients displayed any cortical malformation on brain MRI and all were screened through multiple video-electroencephalography (EEG) recordings for a time period spanning from birth to their sixth postnatal month. Subsequently, patients had standard EEG or video-EEG recordings. We found five novel STXBP1 mutations in patients for whom video-EEG recordings could be sampled from the beginning of the disease. All patients with a mutation displayed Ohtahara syndrome, since most early seizures could be classified as epileptic spasms and since the silent EEG periods were on average shorter than bursts. However, each patient in addition displayed a particular clinical and EEG feature: In two patients, early seizures were clonic, with very early EEG studies exhibiting relatively low amplitude bursts of activity before progressing into a typical suppression-burst pattern, whereas the three other patients displayed epileptic spasms associated with typical suppression-burst patterns starting from the early recordings. Epilepsy dramatically improved after 6 months and finally disappeared before the end of the first year of life for four patients; the remaining one patient had few seizures until 18

  2. Increased excitability and metabolism in pilocarpine induced epileptic rats: effect of Bacopa monnieri.

    PubMed

    Mathew, Jobin; Paul, Jes; Nandhu, M S; Paulose, C S

    2010-09-01

    We have evaluated the acetylcholine esterase and malate dehydrogenase activity in the muscle, epinephrine, norepinephrine, insulin and T3 content in the serum of epileptic rats. Acetylcholine esterase and malate dehydrogenase activity increased in the muscle and decreased in the heart of the epileptic rats compared to control. Insulin and T3 content were increased significantly in the serum of the epileptic rats. Our results suggest that repetitive seizures resulted in increased metabolism and excitability in epileptic rats. Bacopa monnieri and Bacoside-A treatment prevents the occurrence of seizures there by reducing the impairment on peripheral nervous system.

  3. Seizure characteristics of epilepsy in childhood after acute encephalopathy with biphasic seizures and late reduced diffusion.

    PubMed

    Ito, Yuji; Natsume, Jun; Kidokoro, Hiroyuki; Ishihara, Naoko; Azuma, Yoshiteru; Tsuji, Takeshi; Okumura, Akihisa; Kubota, Tetsuo; Ando, Naoki; Saitoh, Shinji; Miura, Kiyokuni; Negoro, Tamiko; Watanabe, Kazuyoshi; Kojima, Seiji

    2015-08-01

    The aim of this study was to clarify characteristics of post-encephalopathic epilepsy (PEE) in children after acute encephalopathy with biphasic seizures and late reduced diffusion (AESD), paying particular attention to precise diagnosis of seizure types. Among 262 children with acute encephalopathy/encephalitis registered in a database of the Tokai Pediatric Neurology Society between 2005 and 2012, 44 were diagnosed with AESD according to the clinical course and magnetic resonance imaging (MRI) findings and were included in this study. Medical records were reviewed to investigate clinical data, MRI findings, neurologic outcomes, and presence or absence of PEE. Seizure types of PEE were determined by both clinical observation by pediatric neurologists and ictal video-electroencephalography (EEG) recordings. Of the 44 patients after AESD, 10 (23%) had PEE. The period between the onset of encephalopathy and PEE ranged from 2 to 39 months (median 8.5 months). Cognitive impairment was more severe in patients with PEE than in those without. Biphasic seizures and status epilepticus during the acute phase of encephalopathy did not influence the risk of PEE. The most common seizure type of PEE on clinical observation was focal seizures (n = 5), followed by epileptic spasms (n = 4), myoclonic seizures (n = 3), and tonic seizures (n = 2). In six patients with PEE, seizures were induced by sudden unexpected sounds. Seizure types confirmed by ictal video-EEG recordings were epileptic spasms and focal seizures with frontal onset, and all focal seizures were startle seizures induced by sudden acoustic stimulation. Intractable daily seizures remain in six patients with PEE. We demonstrate seizure characteristics of PEE in children after AESD. Epileptic spasms and startle focal seizures are common seizure types. The specific seizure types may be determined by the pattern of diffuse subcortical white matter injury in AESD and age-dependent reorganization of the brain

  4. [Epileptic seizures complicated by Takotsubo syndrome].

    PubMed

    Garea Garcia-Malvar, M J; Gonzalez-Silva, Y; Epureanu-Epureanu, V

    2014-11-01

    Introduccion. El sindrome de takotsubo es un trastorno caracterizado por disfuncion ventricular reversible, dolor precordial de tipo anginoso y cambios electrocardiograficos sin evidencia de obstruccion coronaria en coronariografia. Se desencadena por estres, y es frecuente tras crisis epilepticas. Presentamos el caso de una paciente que inicia esta miocardiopatia tras una crisis epileptica al finalizar su sesion de hemodialisis. Caso clinico. Mujer de 55 años en hemodialisis por insuficiencia renal cronica, con epilepsia secundaria a lesion residual frontoparietal derecha por un hematoma que preciso evacuacion quirurgica. Tras una sesion de hemodialisis experimenta una crisis epileptica focal con generalizacion secundaria y, horas despues de esta, dolor centrotoracico. En seriacion enzimatica se objetiva elevacion de troponina I y, electrocardiograficamente, ondas T negativas en derivaciones precordiales (V2-V6). Se realiza coronariografia, cuyo resultado es normal, y se demuestran alteraciones de la contractilidad, confirmadas como de caracter transitorio en un estudio ecocardiografico seriado. Todos los datos anteriores hacen sospechar el diagnostico de sindrome de takotsubo. Conclusion. Las complicaciones cardiacas son una de las causas de morbimortalidad en la epilepsia, y entre ellas se encuentra el sindrome de takotsubo. La incidencia real de dicho sindrome se desconoce, pero dada su implicacion en la mortalidad de causa cardiaca en la epilepsia es importante sospecharlo ante la presencia de disfuncion cardiaca tras una crisis epileptica.

  5. Inflammation in Epileptic Encephalopathies.

    PubMed

    Shandra, Oleksii; Moshé, Solomon L; Galanopoulou, Aristea S

    2017-01-01

    West syndrome (WS) is an infantile epileptic encephalopathy that manifests with infantile spasms (IS), hypsarrhythmia (in ~60% of infants), and poor neurodevelopmental outcomes. The etiologies of WS can be structural-metabolic pathologies (~60%), genetic (12%-15%), or of unknown origin. The current treatment options include hormonal treatment (adrenocorticotropic hormone and high-dose steroids) and the GABA aminotransferase inhibitor vigabatrin, while ketogenic diet can be given as add-on treatment in refractory IS. There is a need to identify new therapeutic targets and more effective treatments for WS. Theories about the role of inflammatory pathways in the pathogenesis and treatment of WS have emerged, being supported by both clinical and preclinical data from animal models of WS. Ongoing advances in genetics have revealed numerous genes involved in the pathogenesis of WS, including genes directly or indirectly involved in inflammation. Inflammatory pathways also interact with other signaling pathways implicated in WS, such as the neuroendocrine pathway. Furthermore, seizures may also activate proinflammatory pathways raising the possibility that inflammation can be a consequence of seizures and epileptogenic processes. With this targeted review, we plan to discuss the evidence pro and against the following key questions. Does activation of inflammatory pathways in the brain cause epilepsy in WS and does it contribute to the associated comorbidities and progression? Can activation of certain inflammatory pathways be a compensatory or protective event? Are there interactions between inflammation and the neuroendocrine system that contribute to the pathogenesis of WS? Does activation of brain inflammatory signaling pathways contribute to the transition of WS to Lennox-Gastaut syndrome? Are there any lead candidates or unexplored targets for future therapy development for WS targeting inflammation? © 2017 Elsevier Inc. All rights reserved.

  6. Analyzing reliability of seizure diagnosis based on semiology.

    PubMed

    Jin, Bo; Wu, Han; Xu, Jiahui; Yan, Jianwei; Ding, Yao; Wang, Z Irene; Guo, Yi; Wang, Zhongjin; Shen, Chunhong; Chen, Zhong; Ding, Meiping; Wang, Shuang

    2014-12-01

    This study aimed to determine the accuracy of seizure diagnosis by semiological analysis and to assess the factors that affect diagnostic reliability. A total of 150 video clips of seizures from 50 patients (each with three seizures of the same type) were observed by eight epileptologists, 12 neurologists, and 20 physicians (internists). The videos included 37 series of epileptic seizures, eight series of physiologic nonepileptic events (PNEEs), and five series of psychogenic nonepileptic seizures (PNESs). After observing each video, the doctors chose the diagnosis of epileptic seizures or nonepileptic events for the patient; if the latter was chosen, they further chose the diagnosis of PNESs or PNEEs. The overall diagnostic accuracy rate for epileptic seizures and nonepileptic events increased from 0.614 to 0.660 after observations of all three seizures (p < 0.001). The diagnostic sensitivity and specificity of epileptic seizures were 0.770 and 0.808, respectively, for the epileptologists. These values were significantly higher than those for the neurologists (0.660 and 0.699) and physicians (0.588 and 0.658). A wide range of diagnostic accuracy was found across the various seizures types. An accuracy rate of 0.895 for generalized tonic-clonic seizures was the highest, followed by 0.800 for dialeptic seizures and then 0.760 for automotor seizures. The accuracy rates for myoclonic seizures (0.530), hypermotor seizures (0.481), gelastic/dacrystic seizures (0.438), and PNESs (0.430) were poor. The reliability of semiological diagnosis of seizures is greatly affected by the seizure type as well as the doctor's experience. Although the overall reliability is limited, it can be improved by observing more seizures.

  7. Biotelemetry system for Epilepsy Seizure Control

    SciTech Connect

    Smith, LaCurtise; Bohnert, George W.

    2009-07-02

    The Biotelemetry System for Epilepsy Seizure Control Project developed and tested an automated telemetry system for use in an epileptic seizure prevention device that precisely controls localized brain temperature. This project was a result of a Department of Energy (DOE) Global Initiatives for Proliferation Prevention (GIPP) grant to the Kansas City Plant (KCP), Argonne National Laboratory (ANL), and Pacific Northwest National Laboratory (PNNL) to partner with Flint Hills Scientific, LLC, Lawrence, KS and Biophysical Laboratory Ltd (BIOFIL), Sarov, Russia to develop a method to help control epileptic seizures.

  8. Metabolic Causes of Epileptic Encephalopathy

    PubMed Central

    Pearl, Phillip L.

    2013-01-01

    Epileptic encephalopathy can be induced by inborn metabolic defects that may be rare individually but in aggregate represent a substantial clinical portion of child neurology. These may present with various epilepsy phenotypes including refractory neonatal seizures, early myoclonic encephalopathy, early infantile epileptic encephalopathy, infantile spasms, and generalized epilepsies which in particular include myoclonic seizures. There are varying degrees of treatability, but the outcome if untreated can often be catastrophic. The importance of early recognition cannot be overemphasized. This paper provides an overview of