Sample records for acidianus two-tailed virus

  1. Crystal Structure of ATVORF273, a New Fold for a Thermo- and Acido-Stable Protein from the Acidianus Two-Tailed Virus

    PubMed Central

    Felisberto-Rodrigues, Catarina; Blangy, Stéphanie; Goulet, Adeline; Vestergaard, Gisle; Cambillau, Christian; Garrett, Roger A.; Ortiz-Lombardía, Miguel


    Acidianus two-tailed virus (ATV) infects crenarchaea of the genus Acidianus living in terrestrial thermal springs at extremely high temperatures and low pH. ATV is a member of the Bicaudaviridae virus family and undergoes extra-cellular development of two tails, a process that is unique in the viral world. To understand this intriguing phenomenon, we have undertaken structural studies of ATV virion proteins and here we present the crystal structure of one of these proteins, ATV. ATV forms tetramers in solution and a molecular envelope is provided for the tetramer, computed from small-angle X-ray scattering (SAXS) data. The crystal structure has properties typical of hyperthermostable proteins, including a relatively high number of salt bridges. However, the protein also exhibits flexible loops and surface pockets. Remarkably, ATV displays a new protein fold, consistent with the absence of homologues of this protein in public sequence databases. PMID:23056221

  2. Chaperone Role for Proteins p618 and p892 in the Extracellular Tail Development of Acidianus Two-Tailed Virus ▿ †

    PubMed Central

    Scheele, Urte; Erdmann, Susanne; Ungewickell, Ernst J.; Felisberto-Rodrigues, Catarina; Ortiz-Lombardía, Miguel; Garrett, Roger A.


    The crenarchaeal Acidianus two-tailed virus (ATV) undergoes a remarkable morphological development, extracellularly and independently of host cells, by growing long tails at each end of a spindle-shaped virus particle. Initial work suggested that an intermediate filament-like protein, p800, is involved in this process. We propose that an additional chaperone system is required, consisting of a MoxR-type AAA ATPase (p618) and a von Willebrand domain A (VWA)-containing cochaperone, p892. Both proteins are absent from the other known bicaudavirus, STSV1, which develops a single tail intracellularly. p618 exhibits ATPase activity and forms a hexameric ring complex that closely resembles the oligomeric complex of the MoxR-like protein RavA (YieN). ATV proteins p387, p653, p800, and p892 interact with p618, and with the exception of p800, all bind to DNA. A model is proposed to rationalize the interactions observed between the different protein and DNA components and to explain their possible structural and functional roles in extracellular tail development. PMID:21367903

  3. Acidianus filamentous virus 1 coat proteins display a helical fold spanning the filamentous archaeal viruses lineage

    PubMed Central

    Goulet, Adeline; Blangy, Stéphanie; Redder, Peter; Prangishvili, David; Felisberto-Rodrigues, Catarina; Forterre, Patrick; Campanacci, Valérie; Cambillau, Christian


    Acidianus filamentous virus 1 (AFV1), a member of the Lipothrixviridae family, infects the hyperthermophilic, acidophilic crenarchaeaon Acidianus hospitalis. The virion, covered with a lipidic outer shell, is 9,100-Å long and contains a 20.8-kb linear dsDNA genome. We have identified the two major coat proteins of the virion (MCPs; 132 and 140 amino acids). They bind DNA and form filaments when incubated with linear dsDNA. A C-terminal domain is identified in their crystal structure with a four-helix-bundle fold. In the topological model of the virion filament core, the genomic dsDNA superhelix wraps around the AFV1–132 basic protein, and the AFV1–140 basic N terminus binds genomic DNA, while its lipophilic C-terminal domain is imbedded in the lipidic outer shell. The four-helix bundle fold of the MCPs from AFV1 is identical to that of the coat protein (CP) of Sulfolobus islandicus rod-shaped virus (SIRV), a member of the Rudiviridae family. Despite low sequence identity between these proteins, their high degree of structural similarity suggests that they could have derived from a common ancestor and could thus define an yet undescribed viral lineage. PMID:19934032

  4. Structure of the Acidianus Filamentous Virus 3 and Comparative Genomics of Related Archaeal Lipothrixviruses▿

    PubMed Central

    Vestergaard, Gisle; Aramayo, Ricardo; Basta, Tamara; Häring, Monika; Peng, Xu; Brügger, Kim; Chen, Lanming; Rachel, Reinhard; Boisset, Nicolas; Garrett, Roger A.; Prangishvili, David


    Four novel filamentous viruses with double-stranded DNA genomes, namely, Acidianus filamentous virus 3 (AFV3), AFV6, AFV7, and AFV8, have been characterized from the hyperthermophilic archaeal genus Acidianus, and they are assigned to the Betalipothrixvirus genus of the family Lipothrixviridae. The structures of the approximately 2-μm-long virions are similar, and one of them, AFV3, was studied in detail. It consists of a cylindrical envelope containing globular subunits arranged in a helical formation that is unique for any known double-stranded DNA virus. The envelope is 3.1 nm thick and encases an inner core with two parallel rows of protein subunits arranged like a zipper. Each end of the virion is tapered and carries three short filaments. Two major structural proteins were identified as being common to all betalipothrixviruses. The viral genomes were sequenced and analyzed, and they reveal a high level of conservation in both gene content and gene order over large regions, with this similarity extending partly to the earlier described betalipothrixvirus Sulfolobus islandicus filamentous virus. A few predicted gene products of each virus, in addition to the structural proteins, could be assigned specific functions, including a putative helicase involved in Holliday junction branch migration, a nuclease, a protein phosphatase, transcriptional regulators, and glycosyltransferases. The AFV7 genome appears to have undergone intergenomic recombination with a large section of an AFV2-like viral genome, apparently resulting in phenotypic changes, as revealed by the presence of AFV2-like termini in the AFV7 virions. Shared features of the genomes include (i) large inverted terminal repeats exhibiting conserved, regularly spaced direct repeats; (ii) a highly conserved operon encoding the two major structural proteins; (iii) multiple overlapping open reading frames, which may be indicative of gene recoding; (iv) putative 12-bp genetic elements; and (v) partial gene

  5. Acidianus Tailed Spindle Virus: a New Archaeal Large Tailed Spindle Virus Discovered by Culture-Independent Methods

    PubMed Central

    Hochstein, Rebecca A.; Amenabar, Maximiliano J.; Munson-McGee, Jacob H.; Boyd, Eric S.


    ABSTRACT The field of viral metagenomics has expanded our understanding of viral diversity from all three domains of life (Archaea, Bacteria, and Eukarya). Traditionally, viral metagenomic studies provide information about viral gene content but rarely provide knowledge about virion morphology and/or cellular host identity. Here we describe a new virus, Acidianus tailed spindle virus (ATSV), initially identified by bioinformatic analysis of viral metagenomic data sets from a high-temperature (80°C) acidic (pH 2) hot spring located in Yellowstone National Park, followed by more detailed characterization using only environmental samples without dependency on culturing. Characterization included the identification of the large tailed spindle virion morphology, determination of the complete 70.8-kb circular double-stranded DNA (dsDNA) viral genome content, and identification of its cellular host. Annotation of the ATSV genome revealed a potential three-domain gene product containing an N-terminal leucine-rich repeat domain, followed by a likely posttranslation regulatory region consisting of high serine and threonine content, and a C-terminal ESCRT-III domain, suggesting interplay with the host ESCRT system. The host of ATSV, which is most closely related to Acidianus hospitalis, was determined by a combination of analysis of cellular clustered regularly interspaced short palindromic repeat (CRISPR)/Cas loci and dual viral and cellular fluorescence in situ hybridization (viral FISH) analysis of environmental samples and confirmed by culture-based infection studies. This work provides an expanded pathway for the discovery, isolation, and characterization of new viruses using culture-independent approaches and provides a platform for predicting and confirming virus hosts. IMPORTANCE Virus discovery and characterization have been traditionally accomplished by using culture-based methods. While a valuable approach, it is limited by the availability of culturable hosts. In

  6. Viral Diversity in Hot Springs of Pozzuoli, Italy, and Characterization of a Unique Archaeal Virus, Acidianus Bottle-Shaped Virus, from a New Family, the Ampullaviridae

    PubMed Central

    Häring, Monika; Rachel, Reinhard; Peng, Xu; Garrett, Roger A.; Prangishvili, David


    Virus-like particles with five different morphotypes were observed in an enriched environmental sample from a hot, acidic spring (87 to 93°C, pH 1.5) in Pozzuoli, Italy. The morphotypes included rigid rods, flexible filaments, and novel, exceptional forms. Particles of each type were isolated, and they were shown to represent viable virions of five novel viruses which infect members of the hyperthermophilic archaeal genus Acidianus. One of these, named the Acidianus bottle-shaped virus, ABV, exhibits a previously unreported morphotype. The bottle-shaped virion carries an envelope which encases a funnel-shaped core. The pointed end of the virion is likely to be involved in adsorption and channeling of viral DNA into host cells. The broad end exhibits 20 (± 2) thin filaments which appear to be inserted into a disk, or ring, and are interconnected at their bases. These filaments are apparently not involved in adsorption. ABV virions contain six proteins in the size range 15 to 80 kDa and a 23.9-kb linear, double-stranded DNA genome. Virus replication does not cause lysis of host cells. On the basis of its unique morphotype and structure, we propose to assign ABV to a new viral family, the Ampullaviridae. PMID:16014951

  7. Crystal structure studies on sulfur oxygenase reductase from Acidianus tengchongensis

    SciTech Connect

    Li Mei; Chen Zhiwei; Zhang Pingfeng; Pan Xiaowei; Jiang Chengying; An Xiaomin; Liu Shuangjiang; Chang Wenrui


    Sulfur oxygenase reductase (SOR) simultaneously catalyzes oxidation and reduction of elemental sulfur to produce sulfite, thiosulfate, and sulfide in the presence of molecular oxygen. In this study, crystal structures of wild type and mutants of SOR from Acidianus tengchongensis (SOR-AT) in two different crystal forms were determined and it was observed that 24 identical SOR monomers form a hollow sphere. Within the icosatetramer sphere, the tetramer and trimer channels were proposed as the paths for the substrate and products, respectively. Moreover, a comparison of SOR-AT with SOR-AA (SOR from Acidianus ambivalens) structures showed that significant differences existed at the active site. Firstly, Cys31 is not persulfurated in SOR-AT structures. Secondly, the iron atom is five-coordinated rather than six-coordinated, since one of the water molecules ligated to the iron atom in the SOR-AA structure is lost. Consequently, the binding sites of substrates and a hypothetical catalytic process of SOR were proposed.

  8. A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus.


    Vestergaard, Gisle; Häring, Monika; Peng, Xu; Rachel, Reinhard; Garrett, Roger A; Prangishvili, David


    Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.

  9. Bioleaching of spent hydrotreating catalyst by acidophilic thermophile Acidianus brierleyi: Leaching mechanism and effect of decoking.


    Bharadwaj, Abhilasha; Ting, Yen-Peng


    Bioleaching of spent hydrotreating catalyst by thermophillic archae Acidianus brierleyi was investigated. The spent catalyst (containing Al, Fe, Ni and Mo as major elements) was characterized, and the effect of pretreatment (decoking) on two-step and spent medium leaching was examined at 1% w/v pulp density. Decoking resulted in removal of carbonaceous deposits and volatile impurities, and affected the solubility of metal compounds through oxidization of the metal sulfides. Nearly 100% extraction was achieved using spent medium leaching for Fe, Ni and Mo, and 67% for Al. Bioleaching reduced nickel concentration in the leachate below the regulated levels for safe waste disposal. Chemical (i.e. abiotic) leaching using equimolar concentration of sulfuric acid produced by the bacteria during two-step process achieved a lower leaching efficiency (by up to 30%). Results indicated that A. brierleyi successfully leached heavy metals from spent catalyst. PMID:23334026

  10. Draft Genome Sequence of the Novel Thermoacidophilic Archaeon Acidianus copahuensis Strain ALE1, Isolated from the Copahue Volcanic Area in Neuquen, Argentina.


    Urbieta, M Sofía; Rascovan, Nicolás; Castro, Camila; Revale, Santiago; Giaveno, M Alejandra; Vazquez, Martín; Donati, Edgardo R


    Acidianus copahuensis is a recently characterized thermoacidophilic archaeon isolated from the Copahue volcanic area in Argentina. Here, we present its draft genome sequence, in which we found genes involved in key metabolic pathways for developing under Copahue's extreme environmental conditions, such as sulfur and iron oxidation, carbon fixation, and metal tolerance.

  11. Biofilm formation and interspecies interactions in mixed cultures of thermo-acidophilic archaea Acidianus spp. and Sulfolobus metallicus.


    Castro, Camila; Zhang, Ruiyong; Liu, Jing; Bellenberg, Sören; Neu, Thomas R; Donati, Edgardo; Sand, Wolfgang; Vera, Mario


    The understanding of biofilm formation by bioleaching microorganisms is of great importance for influencing mineral dissolution rates and to prevent acid mine drainage (AMD). Thermo-acidophilic archaea such as Acidianus, Sulfolobus and Metallosphaera are of special interest due to their ability to perform leaching at high temperatures, thereby enhancing leaching rates. In this work, leaching experiments and visualization by microscopy of cell attachment and biofilm formation patterns of the crenarchaeotes Sulfolobus metallicus DSM 6482(T) and the Acidianus isolates DSM 29038 and DSM 29099 in pure and mixed cultures on sulfur or pyrite were studied. Confocal laser scanning microscopy (CLSM) combined with fluorescent dyes as well as fluorescently labeled lectins were used to visualize different components (e.g. DNA, proteins or glycoconjugates) of the aforementioned species. The data indicate that cell attachment and the subsequently formed biofilms were species- and substrate-dependent. Pyrite leaching experiments coupled with pre-colonization and further inoculation with a second species suggest that both species may negatively influence each other during pyrite leaching with respect to initial attachment and pyrite dissolution rates. In addition, the investigation of binary biofilms on pyrite showed that both species were heterogeneously distributed on pyrite surfaces in the form of individual cells or microcolonies. Physical contact between the two species seems to occur, as revealed by specific lectins able to specifically bind single species within mixed cultures.

  12. Biofilm formation and interspecies interactions in mixed cultures of thermo-acidophilic archaea Acidianus spp. and Sulfolobus metallicus.


    Castro, Camila; Zhang, Ruiyong; Liu, Jing; Bellenberg, Sören; Neu, Thomas R; Donati, Edgardo; Sand, Wolfgang; Vera, Mario


    The understanding of biofilm formation by bioleaching microorganisms is of great importance for influencing mineral dissolution rates and to prevent acid mine drainage (AMD). Thermo-acidophilic archaea such as Acidianus, Sulfolobus and Metallosphaera are of special interest due to their ability to perform leaching at high temperatures, thereby enhancing leaching rates. In this work, leaching experiments and visualization by microscopy of cell attachment and biofilm formation patterns of the crenarchaeotes Sulfolobus metallicus DSM 6482(T) and the Acidianus isolates DSM 29038 and DSM 29099 in pure and mixed cultures on sulfur or pyrite were studied. Confocal laser scanning microscopy (CLSM) combined with fluorescent dyes as well as fluorescently labeled lectins were used to visualize different components (e.g. DNA, proteins or glycoconjugates) of the aforementioned species. The data indicate that cell attachment and the subsequently formed biofilms were species- and substrate-dependent. Pyrite leaching experiments coupled with pre-colonization and further inoculation with a second species suggest that both species may negatively influence each other during pyrite leaching with respect to initial attachment and pyrite dissolution rates. In addition, the investigation of binary biofilms on pyrite showed that both species were heterogeneously distributed on pyrite surfaces in the form of individual cells or microcolonies. Physical contact between the two species seems to occur, as revealed by specific lectins able to specifically bind single species within mixed cultures. PMID:27388200

  13. Distinct symmetry and limited peptide refolding activity of the thermosomes from the acidothermophilic archaea Acidianus tengchongensis S5{sup T}

    SciTech Connect

    Wang, Li; Hu, Zhong-jun; Luo, Yuan-ming; Huo, Yan-wu; Ma, Qing; He, Yong-zhi; Zhang, Yu-ying; Sun, Fei; Dong, Zhi-yang


    Recombinant thermosomes from the Acidianus tengchongensis strain S5{sup T} were purified to homogeneity and assembled in vitro into homo-oligomers (rATcpn{alpha} or rATcpn{beta}) and hetero-oligomers (rATcpn{alpha}{beta}). The symmetries of these complexes were determined by electron microscopy and image analysis. The rATcpn{alpha} homo-oligomer was shown to possess 8-fold symmetry while both rATcpn{beta} and rATcpn{alpha}{beta} oligomers adopted 9-fold symmetry. rATcpn{alpha}{beta} oligomers were shown to contain the {alpha} and {beta} subunits in a 1:2 ratio. All of the complexes prevented the irreversible inactivation of yeast alcohol dehydrogenase at 55 {sup o}C and completely prevented the formation of aggregates during thermal inactivation of citrate synthase at 45 {sup o}C. All rATcpn complexes showed trace ATP hydrolysis activity. Furthermore, rATcpn{beta} sequestered fully chemically denatured substrates (GFP and thermophilic malic dehydrogenase) in vitro without refolding them in an ATP-dependent manner. This property is similar to previously reported properties of chaperonins from Sulfolobus tokodaii and Sulfolobus acidocaldarius. These features are consistent with the slow growth rates of these species of archaea in their native environment.

  14. Differential expression of extracellular thiol groups of moderately thermophilic Sulfobacillus thermosulfidooxidans and extremely thermophilic Acidianus manzaensis grown on S(0) and Fe (2.).


    Liu, Hong-Chang; Xia, Jin-Lan; Nie, Zhen-Yuan; Zhen, Xiang-Jun; Zhang, Li-Juan


    Bio-oxidation of elemental sulfur (S(0)) is very important in bioleaching and sulfur cycle. S(0) was proposed to be first activated by reacting with reactive thiol groups (-SH) of outer membrane proteins, forming -S n H (n ≥ 2) complexes. The differential expression of -SH of moderately thermophilic Sulfobacillus thermosulfidooxidans and extremely thermophilic Acidianus manzaensis grown on Fe(2+) and S(0) was investigated by synchrotron radiation-based scanning transmission X-ray microscopy (STXM) imaging and micro-beam X-ray fluorescence (μ-XRF) mapping. The STXM imaging and μ-XRF mapping of extracellular -SH were based on the analysis of Ca(2+) bound on the cell. By comparing Ca(2+) of the cells with and without labeling by Ca(2+), the distribution and content of thiol groups were obtained. The results showed that, for both S. thermosulfidooxidans and A. manzaensis, the expression of extracellular -SH of S(0)-grown cells was higher than that of Fe(2+)-grown cells. Statistical analysis indicated that the expression of extracellular -SH for S. thermosulfidooxidans and A. manzaensis grown on S(0) was 2.37 times and 2.14 times, respectively, to that on Fe(2+). These results evidently demonstrate that the extracellular thiol groups are most probably involved in elemental sulfur activation and oxidation of the acidophilic sulfur-oxidizing microorganisms.

  15. Interpreting sperm DNA damage in a diverse range of mammalian sperm by means of the two-tailed comet assay

    PubMed Central

    Cortés-Gutiérrez, Elva I.; López-Fernández, Carmen; Fernández, José Luis; Dávila-Rodríguez, Martha I.; Johnston, Stephen D.; Gosálvez, Jaime


    Key Concepts The two-dimensional Two-Tailed Comet assay (TT-comet) protocol is a valuable technique to differentiate between single-stranded (SSBs) and double-stranded DNA breaks (DSBs) on the same sperm cell.Protein lysis inherent with the TT-comet protocol accounts for differences in sperm protamine composition at a species-specific level to produce reliable visualization of sperm DNA damage.Alkaline treatment may break the sugar–phosphate backbone in abasic sites or at sites with deoxyribose damage, transforming these lesions into DNA breaks that are also converted into ssDNA. These lesions are known as Alkali Labile Sites “ALSs.”DBD–FISH permits the in situ visualization of DNA breaks, abasic sites or alkaline-sensitive DNA regions.The alkaline comet single assay reveals that all mammalian species display constitutive ALS related with the requirement of the sperm to undergo transient changes in DNA structure linked with chromatin packing.Sperm DNA damage is associated with fertilization failure, impaired pre-and post- embryo implantation and poor pregnancy outcome.The TT is a valuable tool for identifying SSBs or DSBs in sperm cells with DNA fragmentation and can be therefore used for the purposes of fertility assessment. Sperm DNA damage is associated with fertilization failure, impaired pre-and post- embryo implantation and poor pregnancy outcome. A series of methodologies to assess DNA damage in spermatozoa have been developed but most are unable to differentiate between single-stranded DNA breaks (SSBs) and double-stranded DNA breaks (DSBs) on the same sperm cell. The two-dimensional Two-Tailed Comet assay (TT-comet) protocol highlighted in this review overcomes this limitation and emphasizes the importance in accounting for the difference in sperm protamine composition at a species-specific level for the appropriate preparation of the assay. The TT-comet is a modification of the original comet assay that uses a two dimensional electrophoresis to

  16. Interpreting sperm DNA damage in a diverse range of mammalian sperm by means of the two-tailed comet assay.


    Cortés-Gutiérrez, Elva I; López-Fernández, Carmen; Fernández, José Luis; Dávila-Rodríguez, Martha I; Johnston, Stephen D; Gosálvez, Jaime


    Key ConceptsThe two-dimensional Two-Tailed Comet assay (TT-comet) protocol is a valuable technique to differentiate between single-stranded (SSBs) and double-stranded DNA breaks (DSBs) on the same sperm cell.Protein lysis inherent with the TT-comet protocol accounts for differences in sperm protamine composition at a species-specific level to produce reliable visualization of sperm DNA damage.Alkaline treatment may break the sugar-phosphate backbone in abasic sites or at sites with deoxyribose damage, transforming these lesions into DNA breaks that are also converted into ssDNA. These lesions are known as Alkali Labile Sites "ALSs."DBD-FISH permits the in situ visualization of DNA breaks, abasic sites or alkaline-sensitive DNA regions.The alkaline comet single assay reveals that all mammalian species display constitutive ALS related with the requirement of the sperm to undergo transient changes in DNA structure linked with chromatin packing.Sperm DNA damage is associated with fertilization failure, impaired pre-and post- embryo implantation and poor pregnancy outcome.The TT is a valuable tool for identifying SSBs or DSBs in sperm cells with DNA fragmentation and can be therefore used for the purposes of fertility assessment. Sperm DNA damage is associated with fertilization failure, impaired pre-and post- embryo implantation and poor pregnancy outcome. A series of methodologies to assess DNA damage in spermatozoa have been developed but most are unable to differentiate between single-stranded DNA breaks (SSBs) and double-stranded DNA breaks (DSBs) on the same sperm cell. The two-dimensional Two-Tailed Comet assay (TT-comet) protocol highlighted in this review overcomes this limitation and emphasizes the importance in accounting for the difference in sperm protamine composition at a species-specific level for the appropriate preparation of the assay. The TT-comet is a modification of the original comet assay that uses a two dimensional electrophoresis to allow for

  17. Differential resistance of mammalian sperm chromatin to oxidative stress as assessed by a two-tailed comet assay.


    Enciso, María; Johnston, Stephen D; Gosálvez, Jaime


    Protamines of eutherian species are cysteine-rich molecules that become cross-linked by disulfide bonds during epididymal transit, whereas the protamines of most marsupial species lack cysteine residuals. The present study made use of the differences in protamine structure between eutherian and metatherian mammal spermatozoa to examine the comparative resistance of sperm DNA to oxidative damage in three eutherian species (Mus musculus, Homo sapiens, Sus domesticus) and three metatherian species (Vombatus ursinus, Phascolarctos cinereus, Macropus giganteus). Sperm DNA fragmentation of samples exposed to increasing concentrations of hydrogen peroxide was assessed by means of the two-tailed comet assay. The sperm DNA of the marsupial species studied were significantly more sensitive to oxidative stress than the spermatozoa of eutherian species. Such susceptibility is consistent with the lack of disulfide cross-linking in marsupial sperm chromatin and suggests that the oxidation of thiols to disulfides for chromatin condensation during epididymal transit in eutherian mammals is likely to be important in order to provide stability and protect these cells from the genotoxic effects of adverse environments. PMID:21635811

  18. A multidisciplinary study for mining landscape reclamation: A study case on two tailing ponds in the Region of Murcia (SE Spain)

    NASA Astrophysics Data System (ADS)

    Martínez-Pagán, P.; Faz, A.; Acosta, J. A.; Carmona, D. M.; Martínez-Martínez, S.

    The aim of this work was to evaluate the mobility of Pb, Cu, Zn and Cd in two tailing ponds (Brunita and San Cristobal) from mine activity in the Southeast of Spain before applying reclamation measures for reducing the risk for human and environment. To achieve this objective, five profiles of electrical resistivity imaging (ERI) in Brunita, three profiles in San Cristobal, a drill-hole in each pond and undisturbed columns amended with marble waste for leaching experiments were taken. Results showed that all layers of the two ponds exceed the maximum Pb and Zn concentrations allowed by the selected European legislations. In both ponds, the mixture of tailings with natural soil is the main process involved in soil pollution under the ponds. However, due to high pH in the substrate the metals are precipitated and their solubility reduced, therefore there is not a risk of leaching to groundwater. At Brunita tailing pond electrical resistivity sections displayed some lower electrical resistivity region into the bedrock which has been described as some fault occurrence due to breaking events suffered by the tailing pond. At San Cristobal tailing pond geochemical results were consistent with data obtained by the electrical resistivity imaging (ERI) method where no evidence of faults or cracks into the bedrock and the ponds were observed. Therefore, no preferential pathways of acid mine drainages containing heavy metals were reported. Leaching experiments indicated that, after 11 weeks of leaching, amended and control columns showed comparable values of pH (∼2.3) and similar trends for Cu, Cd and Zn, with a very drastic decrease up to week 3 and thereafter the tendency was to reach near steady-state conditions. In contrast, the evolution of Pb showed that marble amended reduces significantly its concentration over time compared with the control. In accordance with the results, future reclamation action should be based on the reduction of heavy metal mobility by means of

  19. Crystal structure of AFV3-109, a highly conserved protein from crenarchaeal viruses.


    Keller, Jenny; Leulliot, Nicolas; Cambillau, Christian; Campanacci, Valérie; Porciero, Stéphanie; Prangishvili, David; Forterre, Patrick; Cortez, Diego; Quevillon-Cheruel, Sophie; van Tilbeurgh, Herman


    The extraordinary morphologies of viruses infecting hyperthermophilic archaea clearly distinguish them from bacterial and eukaryotic viruses. Moreover, their genomes code for proteins that to a large extend have no related sequences in the extent databases. However, a small pool of genes is shared by overlapping subsets of these viruses, and the most conserved gene, exemplified by the ORF109 of the Acidianus Filamentous Virus 3, AFV3, is present on genomes of members of three viral familes, the Lipothrixviridae, Rudiviridae, and "Bicaudaviridae", as well as of the unclassified Sulfolobus Turreted Icosahedral Virus, STIV. We present here the crystal structure of the protein (Mr = 13.1 kD, 109 residues) encoded by the AFV3 ORF 109 in two different crystal forms at 1.5 and 1.3 A resolution. The structure of AFV3-109 is a five stranded beta-sheet with loops on one side and three helices on the other. It forms a dimer adopting the shape of a cradle that encompasses the best conserved regions of the sequence. No protein with a related fold could be identified except for the ortholog from STIV1, whose structure was deposited at the Protein Data Bank. We could clearly identify a well bound glycerol inside the cradle, contacting exclusively totally conserved residues. This interaction was confirmed in solution by fluorescence titration. Although the function of AFV3-109 cannot be deduced directly from its structure, structural homology with the STIV1 protein, and the size and charge distribution of the cavity suggested it could interact with nucleic acids. Fluorescence quenching titrations also showed that AFV3-109 interacts with dsDNA. Genomic sequence analysis revealed bacterial homologs of AFV3-109 as a part of a putative previously unidentified prophage sequences in some Firmicutes.

  20. Stygiolobus Rod-Shaped Virus and the Interplay of Crenarchaeal Rudiviruses with the CRISPR Antiviral System▿ †

    PubMed Central

    Vestergaard, Gisle; Shah, Shiraz A.; Bize, Ariane; Reitberger, Werner; Reuter, Monika; Phan, Hien; Briegel, Ariane; Rachel, Reinhard; Garrett, Roger A.; Prangishvili, David


    A newly characterized archaeal rudivirus Stygiolobus rod-shaped virus (SRV), which infects a hyperthermophilic Stygiolobus species, was isolated from a hot spring in the Azores, Portugal. Its virions are rod-shaped, 702 (± 50) by 22 (± 3) nm in size, and nonenveloped and carry three tail fibers at each terminus. The linear double-stranded DNA genome contains 28,096 bp and an inverted terminal repeat of 1,030 bp. The SRV shows morphological and genomic similarities to the other characterized rudiviruses Sulfolobus rod-shaped virus 1 (SIRV1), SIRV2, and Acidianus rod-shaped virus 1, isolated from hot acidic springs of Iceland and Italy. The single major rudiviral structural protein is shown to generate long tubular structures in vitro of similar dimensions to those of the virion, and we estimate that the virion constitutes a single, superhelical, double-stranded DNA embedded into such a protein structure. Three additional minor conserved structural proteins are also identified. Ubiquitous rudiviral proteins with assigned functions include glycosyl transferases and a S-adenosylmethionine-dependent methyltransferase, as well as a Holliday junction resolvase, a transcriptionally coupled helicase and nuclease implicated in DNA replication. Analysis of matches between known crenarchaeal chromosomal CRISPR spacer sequences, implicated in a viral defense system, and rudiviral genomes revealed that about 10% of the 3,042 unique acidothermophile spacers yield significant matches to rudiviral genomes, with a bias to highly conserved protein genes, consistent with the widespread presence of rudiviruses in hot acidophilic environments. We propose that the 12-bp indels which are commonly found in conserved rudiviral protein genes may be generated as a reaction to the presence of the host CRISPR defense system. PMID:18723627

  1. Inventing Viruses.


    Summers, William C


    In the nineteenth century, "virus" commonly meant an agent (usually unknown) that caused disease in inoculation experiments. By the 1890s, however, some disease-causing agents were found to pass through filters that retained the common bacteria. Such an agent was called "filterable virus," the best known being the virus that caused tobacco mosaic disease. By the 1920s there were many examples of filterable viruses, but no clear understanding of their nature. However, by the 1930s, the term "filterable virus" was being abandoned in favor of simply "virus," meaning an agent other than bacteria. Visualization of viruses by the electron microscope in the late 1930s finally settled their particulate nature. This article describes the ever-changing concept of "virus" and how virologists talked about viruses. These changes reflected their invention and reinvention of the concept of a virus as it was revised in light of new knowledge, new scientific values and interests, and new hegemonic technologies.

  2. Inventing Viruses.


    Summers, William C


    In the nineteenth century, "virus" commonly meant an agent (usually unknown) that caused disease in inoculation experiments. By the 1890s, however, some disease-causing agents were found to pass through filters that retained the common bacteria. Such an agent was called "filterable virus," the best known being the virus that caused tobacco mosaic disease. By the 1920s there were many examples of filterable viruses, but no clear understanding of their nature. However, by the 1930s, the term "filterable virus" was being abandoned in favor of simply "virus," meaning an agent other than bacteria. Visualization of viruses by the electron microscope in the late 1930s finally settled their particulate nature. This article describes the ever-changing concept of "virus" and how virologists talked about viruses. These changes reflected their invention and reinvention of the concept of a virus as it was revised in light of new knowledge, new scientific values and interests, and new hegemonic technologies. PMID:26958713

  3. Zika Virus


    Zika is a virus that is spread mostly by mosquitoes. A pregnant mother can pass it to ... through blood transfusions. There have been outbreaks of Zika virus in the United States, Africa, Southeast Asia, ...

  4. Zika Virus


    ... Search The CDC Cancel Submit Search The CDC Zika Virus Note: Javascript is disabled or is not supported ... Areas with Zika Countries and territories with active Zika virus transmission... Mosquito Control Prevent mosquito bites, integrated mosquito ...

  5. Chikungunya Virus


    ... traveling to countries with chikungunya virus, use insect repellent, wear long sleeves and pants, and stay in ... Chikungunya Prevention is key! Prevent Infection. Use mosquito repellent. Chikungunya Virus Distribution Chikungunya in the U.S. What's ...

  6. Virus Maturation

    PubMed Central

    Veesler, David; Johnson, John E.


    We examined virus maturation of selected non-enveloped and enveloped ssRNA viruses; retroviruses; bacteriophages and herpes virus. Processes associated with maturation in the RNA viruses range from subtle (noda and picornaviruses) to dramatic (tetraviruses and togaviruses). The elaborate assembly and maturation pathway of HIV is discussed in contrast to the less sophisticated but highly efficient processes associated with togaviruses. Bacteriophage assembly and maturation are discussed in general terms with specific examples chosen for emphasis. Finally the herpes viruses are compared with bacteriophages. The data support divergent evolution of noda, picorna and tetraviruses from a common ancestor and divergent evolution of alpha and flaviviruses from a common ancestor. Likewise, bacteriophages and herpes viruses almost certainly share a common ancestor in their evolution. Comparing all the viruses, we conclude that maturation is a convergent process that is required to solve conflicting requirements in biological dynamics and function. PMID:22404678

  7. Zika virus.



    Essential facts Zika virus disease is caused by a virus that is transmitted by the Aedes mosquito. While it generally causes a mild illness, there is increasing concern that it is harmful in pregnancy and can cause congenital abnormalities in infants born to women infected with the virus. There is no antiviral treatment or vaccine currently available. The best form of prevention is protection against mosquito bites.

  8. Ebola virus.


    Streether, L A


    Ebola virus was first identified as a filovirus in 1976, following epidemics of severe haemorrhagic fever in sub-Saharan Africa. Further outbreaks have occurred since, but, despite extensive and continued investigations, the natural reservoir for the virus remains unknown. The mortality rate is high and there is no cure for Ebola virus infection. Molecular technology is proving useful in extending our knowledge of the virus. Identification of the host reservoir, control and prevention of further outbreaks, rapid diagnosis of infection, and vaccine development remain areas of continued interest in the fight against this biosafety level-four pathogen.

  9. Virus Crystallography

    NASA Astrophysics Data System (ADS)

    Fry, Elizabeth; Logan, Derek; Stuart, David

    Crystallography provides a means of visualizing intact virus particles as well as their isolated constituent proteins and enzymes (1-3) at near-atomic resolution, and is thus an extraordinarily powerful tool in the pursuit of a fuller understanding of the functioning of these simple biological systems. We have already expanded our knowledge of virus evolution, assembly, antigenic variation, and host-cell interactions; further studies will no doubt reveal much more. Although the rewards are enormous, an intact virus structure determination is not a trivial undertaking and entails a significant scaling up in terms of time and resources through all stages of data collection and processing compared to a traditional protein crystallographic structure determination. It is the methodology required for such studies that will be the focus of this chapter. The computational requirements were satisfied in the late 1970s, and when combined with the introduction of phase improvement techniques utilizing the virus symmetry (4,5), the application of crystallography to these massive macromolecular assemblies became feasible. This led to the determination of the first virus structure (the small RNA plant virus, tomato bushy stunt virus), by Harrison and coworkers in 1978 (6). The structures of two other plant viruses followed rapidly (7,8). In the 1980s, a major focus of attention was a family of animal RNA viruses; the Picornaviridae.

  10. Live Virus Smallpox Vaccine


    ... Index SMALLPOX FACT SHEET The Live Virus Smallpox Vaccine The vaccinia virus is the "live virus" used ... cannot cause smallpox. What is a "live virus" vaccine? A "live virus" vaccine is a vaccine that ...

  11. Computer viruses

    NASA Technical Reports Server (NTRS)

    Denning, Peter J.


    The worm, Trojan horse, bacterium, and virus are destructive programs that attack information stored in a computer's memory. Virus programs, which propagate by incorporating copies of themselves into other programs, are a growing menace in the late-1980s world of unprotected, networked workstations and personal computers. Limited immunity is offered by memory protection hardware, digitally authenticated object programs,and antibody programs that kill specific viruses. Additional immunity can be gained from the practice of digital hygiene, primarily the refusal to use software from untrusted sources. Full immunity requires attention in a social dimension, the accountability of programmers.

  12. Hendra virus.


    Middleton, Deborah


    Hendra virus infection of horses occurred sporadically between 1994 and 2010 as a result of spill-over from the viral reservoir in Australian mainland flying-foxes, and occasional onward transmission to people also followed from exposure to affected horses. An unprecedented number of outbreaks were recorded in 2011 leading to heightened community concern. Release of an inactivated subunit vaccine for horses against Hendra virus represents the first commercially available product that is focused on mitigating the impact of a Biosafety Level 4 pathogen. Through preventing the development of acute Hendra virus disease in horses, vaccine use is also expected to reduce the risk of transmission of infection to people.

  13. Hendra virus.


    Middleton, Deborah


    Hendra virus infection of horses occurred sporadically between 1994 and 2010 as a result of spill-over from the viral reservoir in Australian mainland flying-foxes, and occasional onward transmission to people also followed from exposure to affected horses. An unprecedented number of outbreaks were recorded in 2011 leading to heightened community concern. Release of an inactivated subunit vaccine for horses against Hendra virus represents the first commercially available product that is focused on mitigating the impact of a Biosafety Level 4 pathogen. Through preventing the development of acute Hendra virus disease in horses, vaccine use is also expected to reduce the risk of transmission of infection to people. PMID:25281398

  14. A tale of two "tails:" A curiosity revisited.


    Sadashiva, Nishanth; Beniwal, Manish; Shukla, Dhaval; Srinivas, Dwarakanath


    A human tail or a caudal appendage is a rare condition with preconceived notions and stigmata. They could be either true tails or "pseudotails" based on their embryology. Clinically, they are considered as a marker of occult spinal dysraphism. We report two such cases with tethering of cord, one of which was associated with a lipomeningomyelocele. These patients are in need of meticulous evaluation and appropriate management. PMID:27606029

  15. Zika Virus


    ... be at risk for developing fetal complications. Blood, organ and tissue donor screening tests are also needed to assure the safety of transfusion and transplantation in areas of active mosquito-borne virus transmission. ...

  16. Chikungunya virus


    ... first time in the Americas in the Caribbean Islands. In the Americas, local transmission of the disease ... in Florida, Puerto Rico, and the U.S. Virgin Islands. How Chikungunya can spread Mosquitoes spread the virus ...

  17. Zika Virus.


    Phillips, Jennan A; Neyland, Anavernyel


    Zika virus (ZIKV) infections are the latest global public health emergency. Occupational health nurses can protect society by educating workers, women of childbearing age, and others traveling in ZIKV-infected areas about prevention strategies.

  18. Dengue virus.


    Ross, Ted M


    Dengue is the most prevalent arthropod-borne virus affecting humans today. The virus group consists of 4 serotypes that manifest with similar symptoms. Dengue causes a spectrum of disease, ranging from a mild febrile illness to a life-threatening dengue hemorrhagic fever. Breeding sites for the mosquitoes that transmit dengue virus have proliferated, partly because of population growth and uncontrolled urbanization in tropical and subtropical countries. Successful vector control programs have also been eliminated, often because of lack of governmental funding. Dengue viruses have evolved rapidly as they have spread worldwide, and genotypes associated with increased virulence have spread across Asia and the Americas. This article describes the virology, epidemiology, clinical manifestations and outcomes, and treatments/vaccines associated with dengue infection.

  19. Zika Virus.


    Phillips, Jennan A; Neyland, Anavernyel


    Zika virus (ZIKV) infections are the latest global public health emergency. Occupational health nurses can protect society by educating workers, women of childbearing age, and others traveling in ZIKV-infected areas about prevention strategies. PMID:27411846

  20. Computer Viruses. Technology Update.

    ERIC Educational Resources Information Center

    Ponder, Tim, Comp.; Ropog, Marty, Comp.; Keating, Joseph, Comp.

    This document provides general information on computer viruses, how to help protect a computer network from them, measures to take if a computer becomes infected. Highlights include the origins of computer viruses; virus contraction; a description of some common virus types (File Virus, Boot Sector/Partition Table Viruses, Trojan Horses, and…

  1. Parainfluenza Viruses

    PubMed Central

    Henrickson, Kelly J.


    Human parainfluenza viruses (HPIV) were first discovered in the late 1950s. Over the last decade, considerable knowledge about their molecular structure and function has been accumulated. This has led to significant changes in both the nomenclature and taxonomic relationships of these viruses. HPIV is genetically and antigenically divided into types 1 to 4. Further major subtypes of HPIV-4 (A and B) and subgroups/genotypes of HPIV-1 and HPIV-3 have been described. HPIV-1 to HPIV-3 are major causes of lower respiratory infections in infants, young children, the immunocompromised, the chronically ill, and the elderly. Each subtype can cause somewhat unique clinical diseases in different hosts. HPIV are enveloped and of medium size (150 to 250 nm), and their RNA genome is in the negative sense. These viruses belong to the Paramyxoviridae family, one of the largest and most rapidly growing groups of viruses causing significant human and veterinary disease. HPIV are closely related to recently discovered megamyxoviruses (Hendra and Nipah viruses) and metapneumovirus. PMID:12692097

  2. Hendra virus

    PubMed Central

    Middleton, Deborah


    Synopsis Hendra virus infection of horses occurred sporadically between 1994 and 2010 as a result of spill-over from the viral reservoir in Australian mainland flying-foxes, and occasional onward transmission to people also followed from exposure to affected horses. For reasons that are not well understood an unprecedented number of outbreaks were recorded in 2011, including the first recorded field infection of a dog, leading to heightened community concern. Increasingly, pressure mounted to instigate measures for control of flying-fox numbers, and equine health care workers started to leave the industry on account of risk and liability concerns. Release of an inactivated subunit vaccine for horses against Hendra virus represents the first commercially available product that is focused on mitigating the impact of a Biosafety Level 4 pathogen. Through preventing the development of acute Hendra virus disease in horses, vaccine use is also expected to reduce the risk of transmission of infection to people. This approach to emerging infectious disease management focuses on the role of horses as the proximal cause of human Hendra virus disease, and may assist in redirecting community concerns away from the flying-fox reservoirs, keystone species for the ongoing health of Australia’s native forests. PMID:25281398

  3. [Influenza virus].


    Juozapaitis, Mindaugas; Antoniukas, Linas


    Every year, especially during the cold season, many people catch an acute respiratory disease, namely flu. It is easy to catch this disease; therefore, it spreads very rapidly and often becomes an epidemic or a global pandemic. Airway inflammation and other body ailments, which form in a very short period, torment the patient several weeks. After that, the symptoms of the disease usually disappear as quickly as they emerged. The great epidemics of flu have rather unique characteristics; therefore, it is possible to identify descriptions of such epidemics in historic sources. Already in the 4th century bc, Hippocrates himself wrote about one of them. It is known now that flu epidemics emerge rather frequently, but there are no regular intervals between those events. The epidemics can differ in their consequences, but usually they cause an increased mortality of elderly people. The great flu epidemics of the last century took millions of human lives. In 1918-19, during "The Spanish" pandemic of flu, there were around 40-50 millions of deaths all over the world; "Pandemic of Asia" in 1957 took up to one million lives, etc. Influenza virus can cause various disorders of the respiratory system: from mild inflammations of upper airways to acute pneumonia that finally results in the patient's death. Scientist Richard E. Shope, who investigated swine flu in 1920, had a suspicion that the cause of this disease might be a virus. Already in 1933, scientists from the National Institute for Medical Research in London - Wilson Smith, Sir Christopher Andrewes, and Sir Patrick Laidlaw - for the first time isolated the virus, which caused human flu. Then scientific community started the exhaustive research of influenza virus, and the great interest in this virus and its unique features is still active even today.

  4. The Geometry of Viruses.

    ERIC Educational Resources Information Center

    Case, Christine L.


    Presented is an activity in which students make models of viruses, which allows them to visualize the shape of these microorganisms. Included are some background on viruses, the biology and geometry of viruses, directions for building viruses, a comparison of cells and viruses, and questions for students. (KR)

  5. Plant Virus Metagenomics: Advances in Virus Discovery.


    Roossinck, Marilyn J; Martin, Darren P; Roumagnac, Philippe


    In recent years plant viruses have been detected from many environments, including domestic and wild plants and interfaces between these systems-aquatic sources, feces of various animals, and insects. A variety of methods have been employed to study plant virus biodiversity, including enrichment for virus-like particles or virus-specific RNA or DNA, or the extraction of total nucleic acids, followed by next-generation deep sequencing and bioinformatic analyses. All of the methods have some shortcomings, but taken together these studies reveal our surprising lack of knowledge about plant viruses and point to the need for more comprehensive studies. In addition, many new viruses have been discovered, with most virus infections in wild plants appearing asymptomatic, suggesting that virus disease may be a byproduct of domestication. For plant pathologists these studies are providing useful tools to detect viruses, and perhaps to predict future problems that could threaten cultivated plants.

  6. Zika Virus.


    Musso, Didier; Gubler, Duane J


    Zika virus (ZIKV) is an arthropod-borne virus (arbovirus) in the genus Flavivirus and the family Flaviviridae. ZIKV was first isolated from a nonhuman primate in 1947 and from mosquitoes in 1948 in Africa, and ZIKV infections in humans were sporadic for half a century before emerging in the Pacific and the Americas. ZIKV is usually transmitted by the bite of infected mosquitoes. The clinical presentation of Zika fever is nonspecific and can be misdiagnosed as other infectious diseases, especially those due to arboviruses such as dengue and chikungunya. ZIKV infection was associated with only mild illness prior to the large French Polynesian outbreak in 2013 and 2014, when severe neurological complications were reported, and the emergence in Brazil of a dramatic increase in severe congenital malformations (microcephaly) suspected to be associated with ZIKV. Laboratory diagnosis of Zika fever relies on virus isolation or detection of ZIKV-specific RNA. Serological diagnosis is complicated by cross-reactivity among members of the Flavivirus genus. The adaptation of ZIKV to an urban cycle involving humans and domestic mosquito vectors in tropical areas where dengue is endemic suggests that the incidence of ZIKV infections may be underestimated. There is a high potential for ZIKV emergence in urban centers in the tropics that are infested with competent mosquito vectors such as Aedes aegypti and Aedes albopictus.

  7. Zika Virus and Pregnancy


    ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your ...


    EPA Science Inventory

    This chapter describes in detail methods for detecting viruses of bacteria and humans in soil. Methods also are presented for the assay of these viruses. Reference sources are provided for information on viruses of plants.

  9. Hanta virus (image)


    Hanta virus is a distant cousin of Ebola virus, but is found worldwide. The virus is spread by human contact with rodent waste. Dangerous respiratory illness develops. Effective treatment is not yet ...

  10. Ebola Virus Disease


    ... 2014 Fact sheets Features Commentaries 2014 Multimedia Contacts Ebola virus disease Fact sheet Updated January 2016 Key ... for survivors of Ebola virus disease Symptoms of Ebola virus disease The incubation period, that is, the ...

  11. Computer Viruses: An Overview.

    ERIC Educational Resources Information Center

    Marmion, Dan


    Discusses the early history and current proliferation of computer viruses that occur on Macintosh and DOS personal computers, mentions virus detection programs, and offers suggestions for how libraries can protect themselves and their users from damage by computer viruses. (LRW)

  12. Virus Movement Maintains Local Virus Population Diversity

    SciTech Connect

    J. Snyder; B. Wiedenheft; M. Lavin; F. Roberto; J. Spuhler; A. Ortmann; T. Douglas; M. Young


    Viruses are the largest reservoir of genetic material on the planet, yet little is known about the population dynamics of any virus within its natural environment. Over a 2-year period, we monitored the diversity of two archaeal viruses found in hot springs within Yellowstone National Park (YNP). Both temporal phylogeny and neutral biodiversity models reveal that virus diversity in these local environments is not being maintained by mutation but rather by high rates of immigration from a globally distributed metacommunity. These results indicate that geographically isolated hot springs are readily able to exchange viruses. The importance of virus movement is supported by the detection of virus particles in air samples collected over YNP hot springs and by their detection in metacommunity sequencing projects conducted in the Sargasso Sea. Rapid rates of virus movement are not expected to be unique to these archaeal viruses but rather a common feature among virus metacommunities. The finding that virus immigration rather than mutation can dominate community structure has significant implications for understanding virus circulation and the role that viruses play in ecology and evolution by providing a reservoir of mobile genetic material.

  13. Viruses and Virus Diseases of Rubus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rubus species are propagated vegetatively and are subject to infection by viruses during development, propagation and fruit production stages. Reports of initial detection and symptoms of more than 30 viruses, virus-like diseases and phytoplasmas affecting Rubus spp. have been reviewed more than 20 ...

  14. Crystallization of viruses and virus proteins

    NASA Astrophysics Data System (ADS)

    Sehnke, Paul C.; Harrington, Melissa; Hosur, M. V.; Li, Yunge; Usha, R.; Craig Tucker, R.; Bomu, Wu; Stauffacher, Cynthia V.; Johnson, John E.


    Methods for crystallizing six isometric plant and insect viruses are presented. Procedures developed for modifying, purifying and crystallizing coat protein subunits isolated from a virus forming asymmetric, spheroidal particles, stabilized almost exclusively by protein-RNA interactions, are also discussed. The tertiary and quaternary structures of small RNA viruses are compared.

  15. The Tobacco Mosaic Virus.

    ERIC Educational Resources Information Center

    Sulzinski, Michael A.


    Explains how the tobacco mosaic virus can be used to study virology. Presents facts about the virus, procedures to handle the virus in the laboratory, and four laboratory exercises involving the viruses' survival under inactivating conditions, dilution end point, filterability, and microscopy. (MDH)

  16. Viruses of potato.


    Loebenstein, Gad; Gaba, Victor


    Potatoes are an important crop in Mediterranean countries both for local consumption and for export to other countries, mainly during the winter. Many Mediterranean countries import certified seed potato in addition to their own seed production. The local seeds are mainly used for planting in the autumn and winter, while the imported seed are used for early and late spring plantings. Potato virus Y is the most important virus in Mediterranean countries, present mainly in the autumn plantings. The second important virus is Potato leafroll virus, though in recent years its importance seems to be decreasing. Potato virus X, Potato virus A, Potato virus S, Potato virus M, and the viroid, Potato spindle tuber viroid, were also recorded in several Mediterranean countries. For each virus the main strains, transmission, characterization of the virus particle, its genome organization, detection, and control methods including transgenic approaches will be discussed. PMID:22682169

  17. Understanding Ebola Virus Transmission

    PubMed Central

    Judson, Seth; Prescott, Joseph; Munster, Vincent


    An unprecedented number of Ebola virus infections among healthcare workers and patients have raised questions about our understanding of Ebola virus transmission. Here, we explore different routes of Ebola virus transmission between people, summarizing the known epidemiological and experimental data. From this data, we expose important gaps in Ebola virus research pertinent to outbreak situations. We further propose experiments and methods of data collection that will enable scientists to fill these voids in our knowledge about the transmission of Ebola virus. PMID:25654239

  18. Virus-Vectored Influenza Virus Vaccines

    PubMed Central

    Tripp, Ralph A.; Tompkins, S. Mark


    Despite the availability of an inactivated vaccine that has been licensed for >50 years, the influenza virus continues to cause morbidity and mortality worldwide. Constant evolution of circulating influenza virus strains and the emergence of new strains diminishes the effectiveness of annual vaccines that rely on a match with circulating influenza strains. Thus, there is a continued need for new, efficacious vaccines conferring cross-clade protection to avoid the need for biannual reformulation of seasonal influenza vaccines. Recombinant virus-vectored vaccines are an appealing alternative to classical inactivated vaccines because virus vectors enable native expression of influenza antigens, even from virulent influenza viruses, while expressed in the context of the vector that can improve immunogenicity. In addition, a vectored vaccine often enables delivery of the vaccine to sites of inductive immunity such as the respiratory tract enabling protection from influenza virus infection. Moreover, the ability to readily manipulate virus vectors to produce novel influenza vaccines may provide the quickest path toward a universal vaccine protecting against all influenza viruses. This review will discuss experimental virus-vectored vaccines for use in humans, comparing them to licensed vaccines and the hurdles faced for licensure of these next-generation influenza virus vaccines. PMID:25105278

  19. Viruses infecting reptiles.


    Marschang, Rachel E


    A large number of viruses have been described in many different reptiles. These viruses include arboviruses that primarily infect mammals or birds as well as viruses that are specific for reptiles. Interest in arboviruses infecting reptiles has mainly focused on the role reptiles may play in the epidemiology of these viruses, especially over winter. Interest in reptile specific viruses has concentrated on both their importance for reptile medicine as well as virus taxonomy and evolution. The impact of many viral infections on reptile health is not known. Koch's postulates have only been fulfilled for a limited number of reptilian viruses. As diagnostic testing becomes more sensitive, multiple infections with various viruses and other infectious agents are also being detected. In most cases the interactions between these different agents are not known. This review provides an update on viruses described in reptiles, the animal species in which they have been detected, and what is known about their taxonomic positions.

  20. Viruses Infecting Reptiles

    PubMed Central

    Marschang, Rachel E.


    A large number of viruses have been described in many different reptiles. These viruses include arboviruses that primarily infect mammals or birds as well as viruses that are specific for reptiles. Interest in arboviruses infecting reptiles has mainly focused on the role reptiles may play in the epidemiology of these viruses, especially over winter. Interest in reptile specific viruses has concentrated on both their importance for reptile medicine as well as virus taxonomy and evolution. The impact of many viral infections on reptile health is not known. Koch’s postulates have only been fulfilled for a limited number of reptilian viruses. As diagnostic testing becomes more sensitive, multiple infections with various viruses and other infectious agents are also being detected. In most cases the interactions between these different agents are not known. This review provides an update on viruses described in reptiles, the animal species in which they have been detected, and what is known about their taxonomic positions. PMID:22163336

  1. Morphogenesis of Bittner Virus

    PubMed Central

    Gay, Frederick W.; Clarke, John K.; Dermott, Evelyn


    The morphogenesis of Bittner virus (mouse mammary tumor virus) was studied in sectioned mammary tumor cells. Internal components of the virus (type A particles) were seen being assembled in virus factories close to the nucleus and were also seen forming at the plasma membrane. The particles in virus factories became enveloped by budding through the membrane of cytoplasmic vacuoles which were derived from dilated endoplasmic reticulum. Complete virus particles were liberated from these vacuoles by cell lysis. Particles budding at the plasma membrane were released into intercellular spaces. Maturation of enveloped virus occurred after release, but mature internal components were rarely seen in the cytoplasm before envelopment. Direct cell-to-cell transfer of virus by pinocytosis of budding particles by an adjacent cell was observed, and unusual forms of budding virus which participated in this process are illustrated and described. There was evidence that some virus particles contained cytoplasmic constituents, including ribosomes. Certain features of the structure of internal components are discussed in relation to a recently proposed model for the internal component of the mouse leukemia virus. Intracisternal virus-like particles were occasionally seen in tumor cells, but there was no evidence that these structures were developmentally related to Bittner virus. Images PMID:4193837

  2. Morphogenesis of Bittner virus.


    Gay, F W; Clarke, J K; Dermott, E


    The morphogenesis of Bittner virus (mouse mammary tumor virus) was studied in sectioned mammary tumor cells. Internal components of the virus (type A particles) were seen being assembled in virus factories close to the nucleus and were also seen forming at the plasma membrane. The particles in virus factories became enveloped by budding through the membrane of cytoplasmic vacuoles which were derived from dilated endoplasmic reticulum. Complete virus particles were liberated from these vacuoles by cell lysis. Particles budding at the plasma membrane were released into intercellular spaces. Maturation of enveloped virus occurred after release, but mature internal components were rarely seen in the cytoplasm before envelopment. Direct cell-to-cell transfer of virus by pinocytosis of budding particles by an adjacent cell was observed, and unusual forms of budding virus which participated in this process are illustrated and described. There was evidence that some virus particles contained cytoplasmic constituents, including ribosomes. Certain features of the structure of internal components are discussed in relation to a recently proposed model for the internal component of the mouse leukemia virus. Intracisternal virus-like particles were occasionally seen in tumor cells, but there was no evidence that these structures were developmentally related to Bittner virus. PMID:4193837

  3. Respiratory Syncytial Virus Infections


    Respiratory syncytial virus (RSV) causes mild, cold-like symptoms in adults and older healthy children. It can cause serious problems in ... tests can tell if your child has the virus. There is no specific treatment. You should give ...

  4. Viruses and human cancer

    SciTech Connect

    Gallo, R.C.; Haseltine, W.; Klein, G.; Zur Hausen, H.


    This book contains papers on the following topics: Immunology and Epidemiology, Biology and Pathogenesis, Models of Pathogenesis and Treatment, Simian and Bovine Retroviruses, Human Papilloma Viruses, EBV and Herpesvirus, and Hepatitis B Virus.

  5. Densonucleosis virus structural proteins.


    Kelly, D C; Moore, N F; Spilling, C R; Barwise, A H; Walker, I O


    The protein coats of two densonucleosis viruses (types 1 and 2) were examined by a variety of biophysical, biochemical, and serological techniques. The viruses were 24 nm in diameter, contained at least four polypeptides, were remarkably stable to extremes of pH and denaturing agents, and were serologically closely related. The two viruses could, however, be distinguished serologically and by differences in migration of their structural polypeptides. For each virus the "top component" (i.e., the protein coat minus DNA, found occurring naturally in infections) appeared to have a composition identical to that of the coat of the virus and was a more stable structure. Electrometric titration curves of the virus particles and top components demonstrated that the DNA phosphate in densonucleosis virus particles was neutralized by cations other than basic amino acid side chains of the protein coat. Circular dichroism studies showed that there was a conformational difference between the protein coats of top components and virus particles.

  6. Viruses and Breast Cancer

    PubMed Central

    Lawson, James S.; Heng, Benjamin


    Viruses are the accepted cause of many important cancers including cancers of the cervix and anogenital area, the liver, some lymphomas, head and neck cancers and indirectly human immunodeficiency virus associated cancers. For over 50 years, there have been serious attempts to identify viruses which may have a role in breast cancer. Despite these efforts, the establishment of conclusive evidence for such a role has been elusive. However, the development of extremely sophisticated new experimental techniques has allowed the recent development of evidence that human papilloma virus, Epstein-Barr virus, mouse mammary tumor virus and bovine leukemia virus may each have a role in the causation of human breast cancers. This is potentially good news as effective vaccines are already available to prevent infections from carcinogenic strains of human papilloma virus, which causes cancer of the uterine cervix. PMID:24281093

  7. Zika Virus Fact Sheet


    ... 2014 Fact sheets Features Commentaries 2014 Multimedia Contacts Zika virus Fact sheet Updated 6 September 2016 Key facts ... and last for 2-7 days. Complications of Zika virus disease After a comprehensive review of evidence, there ...

  8. Human Parainfluenza Viruses


    ... HPIVs Are Not the Same as Influenza (Flu) Viruses People usually get HPIV infections more often in ... hands, and touching objects or surfaces with the viruses on them then touching your mouth, nose, or ...

  9. Herpes Simplex Virus (HSV)


    ... rashes clinical tools newsletter | contact Share | Herpes Simplex Virus (HSV) A parent's guide to condition and treatment ... skin or mouth sores with the herpes simplex virus (HSV) is called primary herpes. This may be ...

  10. Tumorigenic DNA viruses

    SciTech Connect

    Klein, G.


    The eighth volume of Advances in Viral Oncology focuses on the three major DNA virus groups with a postulated or proven tumorigenic potential: papillomaviruses, animal hepatitis viruses, and the Epstein-Bar virus. In the opening chapters, the contributors analyze the evidence that papillomaviruses and animal hepatitis viruses are involved in tumorigenesis and describe the mechanisms that trigger virus-host cell interactions. A detailed section on the Epstein-Barr virus (EBV) - comprising more than half the book - examines the transcription and mRNA processing patterns of the virus genome; the mechanisms by which EBV infects lymphoid and epithelial cells; the immunological aspects of the virus; the actions of EBV in hosts with Acquired Immune Deficiency Syndrome; and the involvement of EBV in the etiology of Burkitt's lymphoma.

  11. Advances in virus research

    SciTech Connect

    Maramorosch, K. ); Murphy, F.A. ); Shatkin, A.J. )


    This book contains eight chapters. Some of the titles are: Initiation of viral DNA replication; Vaccinia: virus, vector, vaccine; The pre-S region of hepadnavirus envelope proteins; and Archaebacterial viruses.

  12. West Nile virus


    ... believe West Nile virus is spread when a mosquito bites an infected bird and then bites a person. ... avoid getting West Nile virus infection after a mosquito bite. People in good health generally do not develop ...

  13. Virus Assembly and Maturation

    NASA Astrophysics Data System (ADS)

    Johnson, John E.


    We use two techniques to look at three-dimensional virus structure: electron cryomicroscopy (cryoEM) and X-ray crystallography. Figure 1 is a gallery of virus particles whose structures Timothy Baker, one of my former colleagues at Purdue University, used cryoEM to determine. It illustrates the variety of sizes of icosahedral virus particles. The largest virus particle on this slide is the Herpes simplex virus, around 1200Å in diameter; the smallest we examined was around 250Å in diameter. Viruses bear their genomic information either as positive-sense DNA and RNA, double-strand DNA, double-strand RNA, or negative-strand RNA. Viruses utilize the various structure and function "tactics" seen throughout cell biology to replicate at high levels. Many of the biological principles that we consider general were in fact discovered in the context of viruses ...

  14. Avian influenza virus and Newcastle disease virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Avian influenza virus (AIV) and Newcastle disease virus (NDV) severely impact poultry egg production. Decreased egg yield and hatchability, as well as misshapen eggs, are often observed during infection with AIV and NDV, even with low-virulence strains or in vaccinated flocks. Data suggest that in...

  15. Computer Virus Protection

    ERIC Educational Resources Information Center

    Rajala, Judith B.


    A computer virus is a program--a piece of executable code--that has the unique ability to replicate. Like biological viruses, computer viruses can spread quickly and are often difficult to eradicate. They can attach themselves to just about any type of file, and are spread by replicating and being sent from one individual to another. Simply having…

  16. Avian influenza virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Avian influenza virus (AIV) is type A influenza, which is adapted to an avian host. Although avian influenza has been isolated from numerous avian species, the primary natural hosts for the virus are dabbling ducks, shorebirds, and gulls. The virus can be found world-wide in these species and in o...

  17. Respiratory Syncytial Virus


    ... Palsy: Shannon's Story" 5 Things to Know About Zika & Pregnancy Respiratory Syncytial Virus KidsHealth > For Parents > Respiratory Syncytial Virus Print A ... often get it when older kids carry the virus home from school and pass it to ... often happen in epidemics that last from late fall through early spring. ...

  18. Zika virus - an overview.


    Zanluca, Camila; Dos Santos, Claudia Nunes Duarte


    Zika virus (ZIKV) is currently one of the most important emerging viruses in the world. Recently, it has caused outbreaks and epidemics, and has been associated with severe clinical manifestations and congenital malformations. However to date, little is known about the pathogenicity of the virus and the consequences of ZIKV infection. In this paper, we provide an overview of the current knowledge on ZIKV.

  19. The taxonomy of viruses should include viruses.


    Calisher, Charles H


    Having lost sight of its goal, the International Committee on Taxonomy of Viruses has redoubled its efforts. That goal is to arrive at a consensus regarding virus classification, i.e., proper placement of viruses in a hierarchical taxonomic scheme; not an easy task given the wide variety of recognized viruses. Rather than suggesting a continuation of the bureaucratic machinations of the past, this opinion piece is a call for insertion of common sense in sorting out the avalanche of information already, and soon-to-be, accrued data. In this way information about viruses ideally would be taxonomically correct as well as useful to working virologists and journal editors, rather than being lost, minimized, or ignored.

  20. Viruses of asparagus.


    Tomassoli, Laura; Tiberini, Antonio; Vetten, Heinrich-Josef


    The current knowledge on viruses infecting asparagus (Asparagus officinalis) is reviewed. Over half a century, nine virus species belonging to the genera Ilarvirus, Cucumovirus, Nepovirus, Tobamovirus, Potexvirus, and Potyvirus have been found in this crop. The potyvirus Asparagus virus 1 (AV1) and the ilarvirus Asparagus virus 2 (AV2) are widespread and negatively affect the economic life of asparagus crops reducing yield and increasing the susceptibility to biotic and abiotic stress. The main properties and epidemiology of AV1 and AV2 as well as diagnostic techniques for their detection and identification are described. Minor viruses and control are briefly outlined.

  1. Viruses of asparagus.


    Tomassoli, Laura; Tiberini, Antonio; Vetten, Heinrich-Josef


    The current knowledge on viruses infecting asparagus (Asparagus officinalis) is reviewed. Over half a century, nine virus species belonging to the genera Ilarvirus, Cucumovirus, Nepovirus, Tobamovirus, Potexvirus, and Potyvirus have been found in this crop. The potyvirus Asparagus virus 1 (AV1) and the ilarvirus Asparagus virus 2 (AV2) are widespread and negatively affect the economic life of asparagus crops reducing yield and increasing the susceptibility to biotic and abiotic stress. The main properties and epidemiology of AV1 and AV2 as well as diagnostic techniques for their detection and identification are described. Minor viruses and control are briefly outlined. PMID:22682173

  2. Evidence for widespread infection of African bats with Crimean-Congo hemorrhagic fever-like viruses.


    Müller, Marcel A; Devignot, Stéphanie; Lattwein, Erik; Corman, Victor Max; Maganga, Gaël D; Gloza-Rausch, Florian; Binger, Tabea; Vallo, Peter; Emmerich, Petra; Cottontail, Veronika M; Tschapka, Marco; Oppong, Samuel; Drexler, Jan Felix; Weber, Friedemann; Leroy, Eric M; Drosten, Christian


    Crimean Congo hemorrhagic fever virus (CCHFV) is a highly virulent tick-borne pathogen that causes hemorrhagic fever in humans. The geographic range of human CCHF cases largely reflects the presence of ticks. However, highly similar CCHFV lineages occur in geographically distant regions. Tick-infested migratory birds have been suggested, but not confirmed, to contribute to the dispersal. Bats have recently been shown to carry nairoviruses distinct from CCHFV. In order to assess the presence of CCHFV in a wide range of bat species over a wide geographic range, we analyzed 1,135 sera from 16 different bat species collected in Congo, Gabon, Ghana, Germany, and Panama. Using a CCHFV glycoprotein-based indirect immunofluorescence test (IIFT), we identified reactive antibodies in 10.0% (114/1,135) of tested bats, pertaining to 12/16 tested species. Depending on the species, 3.6%-42.9% of cave-dwelling bats and 0.6%-7.1% of foliage-living bats were seropositive (two-tailed t-test, p = 0.0447 cave versus foliage). 11/30 IIFT-reactive sera from 10 different African bat species had neutralizing activity in a virus-like particle assay. Neutralization of full CCHFV was confirmed in 5 of 7 sera. Widespread infection of cave-dwelling bats may indicate a role for bats in the life cycle and geographic dispersal of CCHFV. PMID:27217069

  3. Evidence for widespread infection of African bats with Crimean-Congo hemorrhagic fever-like viruses

    PubMed Central

    Müller, Marcel A.; Devignot, Stéphanie; Lattwein, Erik; Corman, Victor Max; Maganga, Gaël D.; Gloza-Rausch, Florian; Binger, Tabea; Vallo, Peter; Emmerich, Petra; Cottontail, Veronika M.; Tschapka, Marco; Oppong, Samuel; Drexler, Jan Felix; Weber, Friedemann; Leroy, Eric M.; Drosten, Christian


    Crimean Congo hemorrhagic fever virus (CCHFV) is a highly virulent tick-borne pathogen that causes hemorrhagic fever in humans. The geographic range of human CCHF cases largely reflects the presence of ticks. However, highly similar CCHFV lineages occur in geographically distant regions. Tick-infested migratory birds have been suggested, but not confirmed, to contribute to the dispersal. Bats have recently been shown to carry nairoviruses distinct from CCHFV. In order to assess the presence of CCHFV in a wide range of bat species over a wide geographic range, we analyzed 1,135 sera from 16 different bat species collected in Congo, Gabon, Ghana, Germany, and Panama. Using a CCHFV glycoprotein-based indirect immunofluorescence test (IIFT), we identified reactive antibodies in 10.0% (114/1,135) of tested bats, pertaining to 12/16 tested species. Depending on the species, 3.6%–42.9% of cave-dwelling bats and 0.6%–7.1% of foliage-living bats were seropositive (two-tailed t-test, p = 0.0447 cave versus foliage). 11/30 IIFT-reactive sera from 10 different African bat species had neutralizing activity in a virus-like particle assay. Neutralization of full CCHFV was confirmed in 5 of 7 sera. Widespread infection of cave-dwelling bats may indicate a role for bats in the life cycle and geographic dispersal of CCHFV. PMID:27217069

  4. Serodiagnosis for Tumor Viruses

    PubMed Central

    Morrison, Brian J.; Labo, Nazzarena; Miley, Wendell J.; Whitby, Denise


    The known human tumor viruses include the DNA viruses Epstein-Barr virus, Kaposi sarcoma herpesvirus, Merkel cell polyomavirus, human papillomavirus, and hepatitis B virus. RNA tumor viruses include Human T-cell lymphotrophic virus type-1 and hepatitis C virus. The serological identification of antigens/antibodies in plasma serum is a rapidly progressing field with utility for both scientists and clinicians. Serology is useful for conducting seroepidemiology studies and to inform on the pathogenesis and host immune response to a particular viral agent. Clinically, serology is useful for diagnosing current or past infection and for aiding in clinical management decisions. Serology is useful for screening blood donations for infectious agents and for monitoring the outcome of vaccination against these viruses. Serodiagnosis of human tumor viruses has improved in recent years with increased specificity and sensitivity of the assays, as well as reductions in cost and the ability to assess multiple antibody/antigens in single assays. Serodiagnosis of tumor viruses plays an important role in our understanding of the prevalence and transmission of these viruses and ultimately in the ability to develop treatments/preventions for these globally important diseases. PMID:25843726

  5. Discovering novel zoonotic viruses.


    Wang, Lin-Fa


    From the emergence of Hendra virus and Menangle virus in Australia to the global pandemics of severe acute respiratory syndrome and influenza viruses (both H5N1 and H1N1), there has been a surge of zoonotic virus outbreaks in the last two decades. Although the drivers for virus emergence remain poorly understood, the rate of discovery of new viruses is accelerating. This is due to a combination of true emergence of new pathogens and the advance of new technologies making rapid detection and characterisation possible. While molecular approaches will continue to lead the way in virus discovery, other technological platforms are required to increase the chance of success. The lessons learnt in the last 20 years confirm that the One Health approach, involving inclusive collaborations between physicians, veterinarians and other health and environmental professionals, will be the key to combating future zoonotic disease outbreaks.

  6. Inflammatory mediators in dengue virus infection in children: interleukin-8 and its relationship to neutrophil degranulation.


    Juffrie, M; van Der Meer, G M; Hack, C E; Haasnoot, K; Sutaryo; Veerman, A J; Thijs, L G


    The chemokine interleukin-8 (IL-8) has chemoattractant activity for neutrophils and is able to activate and degranulate these cells. We investigated whether IL-8 may exert these effects in children with dengue virus infection. Circulating levels of IL-8, neutrophilic elastase (a constituent of the azurophilic granula of neutrophils), and lactoferrin, released from specific granula, were measured in 186 children with dengue virus infection, 33 healthy children as negative controls and 11 children with bacterial infections as positive controls. Levels of IL-8 on admission were elevated in 71% of the dengue patients, while the elastase and lactoferrin levels were increased in 68 and 17% of patients, respectively. These levels were significantly higher than in healthy children (P < 0.05) for IL-8 and elastase but not for lactoferrin (by the Wilcoxon-Mann-Whitney [WMW] U test). Similar levels of IL-8 were found in patients with bacterial infections. Levels of IL-8 and elastase in patients with shock were significantly higher than in patients without shock (P = 0.02; WMW), but those of lactoferrin were not. IL-8 correlated with elastase and lactoferrin (r = 0.19 and P = 0.009 versus r = 0.24 and P = 0.001, respectively; two-tailed Spearman rank correlation). Thus, IL-8 levels are increased in most patients with dengue virus infection and correlate with degranulation of neutrophils as well as with some clinical and hemodynamic variables. These findings suggest a role for IL-8 in the pathogenesis of dengue virus infection.

  7. Virus-Associated Lymphomagenesis

    PubMed Central

    Tarantul, V. Z.


    At least 2 billion people are affected by viral infections worldwide. The infections induce a lot of various human diseases and are one of the main causes of human mortality. In particular, they can lead to development of various human cancers. Up to 15-20% of human cancer incidence can be attributed to viruses. Although viral infections are very common in the general population, only few of them result in clinically relevant lesions. Certain associations between virus infections and malignancy are strong and irrefutable, the others are still speculative. The criteria most often used for determining the causality are the consistence of the association, either epidemiologic or at the molecular level, and oncogenicity of viruses or particular viral genes in animal models or cell cultures. Due to some ambiguity of such a determination, it is instructive to consider by specific cases what evidence is generally accepted as sufficient to establish a causal relation between virus and cancer. Lymphomas are one of the best studied cancer types closely associated with a small but definite range of viruses. Numerous data show a close interrelation between lymphomagenesis and infection by such viruses as Kaposi’s sarcoma herpesvirus (KSHV), Epstein-Barr virus (EBV), hepatitis C virus (HCV), human T-cell leukemia virus (HTLV), and human immunodeficiency virus (HIV). For instance, experiments on monkeys artificially infected with viruses and data on anti-cancer effect of specific antiviral preparations strongly suggest the involvement of viruses in lymphoma development. The present review is devoted to the association of different viruses with human lymphomas and to viral genes potentially involved in the neoplastic process. The recognition of virus involvement in lymphomagenesis may facilitate new strategies for cancer therapy, diagnosis and screening and can lead to a reduction in the number of individuals at risk of disease. PMID:23674972

  8. [The great virus comeback].


    Forterre, Patrick


    Viruses have been considered for a long time as by-products of biological evolution. This view is changing now as a result of several recent discoveries. Viral ecologists have shown that viral particles are the most abundant biological entities on our planet, whereas metagenomic analyses have revealed an unexpected abundance and diversity of viral genes in the biosphere. Comparative genomics have highlighted the uniqueness of viral sequences, in contradiction with the traditional view of viruses as pickpockets of cellular genes. On the contrary, cellular genomes, especially eukaryotic ones, turned out to be full of genes derived from viruses or related elements (plasmids, transposons, retroelements and so on). The discovery of unusual viruses infecting archaea has shown that the viral world is much more diverse than previously thought, ruining the traditional dichotomy between bacteriophages and viruses. Finally, the discovery of giant viruses has blurred the traditional image of viruses as small entities. Furthermore, essential clues on virus history have been obtained in the last ten years. In particular, structural analyses of capsid proteins have uncovered deeply rooted homologies between viruses infecting different cellular domains, suggesting that viruses originated before the last universal common ancestor (LUCA). These studies have shown that several lineages of viruses originated independently, i.e., viruses are polyphyletic. From the time of LUCA, viruses have coevolved with their hosts, and viral lineages can be viewed as lianas wrapping around the trunk, branches and leaves of the tree of life. Although viruses are very diverse, with genomes encoding from one to more than one thousand proteins, they can all be simply defined as organisms producing virions. Virions themselves can be defined as infectious particles made of at least one protein associated with the viral nucleic acid, endowed with the capability to protect the viral genome and ensure its

  9. Viruses of botrytis.


    Pearson, Michael N; Bailey, Andrew M


    Botrytis cinerea (gray mold) is one of the most widespread and destructive fungal diseases of horticultural crops. Propagation and dispersal is usually by asexual conidia but the sexual stage (Botryotinia fuckeliana (de Bary) Whetzel) also occurs in nature. DsRNAs, indicative of virus infection, are common in B. cinerea, but only four viruses (Botrytis virus F (BVF), Botrytis virus X (BVX), Botrytis cinerea mitovirus 1 (BcMV1), and Botrytis porri RNA virus) have been sequenced. BVF and BVX are unusual mycoviruses being ssRNA flexous rods and have been designated the type species of the genera Mycoflexivirus and Botrexvirus (family Betaflexivirdae), respectively. The reported effects of viruses on Botrytis range from negligible to severe, with Botrytis cinerea mitovirus 1 causing hypovirulence. Little is currently known about the effects of viruses on Botrytis metabolism but recent complete sequencing of the B. cinerea genome now provides an opportunity to investigate the host-pathogen interactions at the molecular level. There is interest in the possible use of mycoviruses as biological controls for Botrytis because of the common problem of fungicide resistance. Unfortunately, hyphal anastomosis is the only known mechanism of horizontal virus transmission and the large number of vegetative incompatibility groups in Botrytis is a potential constraint on the spread of an introduced virus. Although some Botrytis viruses, such as BVF and BVX, are known to have international distribution, there is a distinct lack of epidemiological data and the means of spread are unknown.

  10. RNA Viruses Infecting Pest Insects

    Technology Transfer Automated Retrieval System (TEKTRAN)

    RNA viruses are viruses whose genetic material is ribonucleic acid (RNA). RNA viruses may be double or single-stranded based on the type of RNA they contain. Single-stranded RNA viruses can be further grouped into negative sense or positive-sense viruses according to the polarity of their RNA. Fur...

  11. Postmortem stability of Ebola virus.


    Prescott, Joseph; Bushmaker, Trenton; Fischer, Robert; Miazgowicz, Kerri; Judson, Seth; Munster, Vincent J


    The ongoing Ebola virus outbreak in West Africa has highlighted questions regarding stability of the virus and detection of RNA from corpses. We used Ebola virus-infected macaques to model humans who died of Ebola virus disease. Viable virus was isolated <7 days posteuthanasia; viral RNA was detectable for 10 weeks.

  12. Water system virus detection

    NASA Technical Reports Server (NTRS)

    Fraser, A. S.; Wells, A. F.; Tenoso, H. J. (Inventor)


    The performance of a waste water reclamation system is monitored by introducing a non-pathogenic marker virus, bacteriophage F2, into the waste-water prior to treatment and, thereafter, testing the reclaimed water for the presence of the marker virus. A test sample is first concentrated by absorbing any marker virus onto a cellulose acetate filter in the presence of a trivalent cation at low pH and then flushing the filter with a limited quantity of a glycine buffer solution to desorb any marker virus present on the filter. Photo-optical detection of indirect passive immune agglutination by polystyrene beads indicates the performance of the water reclamation system in removing the marker virus. A closed system provides for concentrating any marker virus, initiating and monitoring the passive immune agglutination reaction, and then flushing the system to prepare for another sample.

  13. Constructing computer virus phylogenies

    SciTech Connect

    Goldberg, L.A.; Goldberg, P.W.; Phillips, C.A.; Sorkin, G.B.


    There has been much recent algorithmic work on the problem of reconstructing the evolutionary history of biological species. Computer virus specialists are interested in finding the evolutionary history of computer viruses--a virus is often written using code fragments from one or more other viruses, which are its immediate ancestors. A phylogeny for a collection of computer viruses is a directed acyclic graph whose nodes are the viruses and whose edges map ancestors to descendants and satisfy the property that each code fragment is ``invented`` only once. To provide a simple explanation for the data, we consider the problem of constructing such a phylogeny with a minimal number of edges. In general, this optimization problem cannot be solved in quasi-polynomial time unless NQP=QP; we present positive and negative results for associated approximated problems. When tree solutions exist, they can be constructed and randomly sampled in polynomial time.

  14. Viruses within animal genomes.


    De Brognier, A; Willems, L


    Viruses and their hosts can co-evolve to reach a fragile equilibrium that allows the survival of both. An excess of pathogenicity in the absence of a reservoir would be detrimental to virus survival. A significant proportion of all animal genomes has been shaped by the insertion of viruses that subsequently became 'fossilised'. Most endogenous viruses have lost the capacity to replicate via an infectious cycle and now replicate passively. The insertion of endogenous viruses has contributed to the evolution of animal genomes, for example in the reproductive biology of mammals. However, spontaneous viral integration still occasionally occurs in a number of virus-host systems. This constitutes a potential risk to host survival but also provides an opportunity for diversification and evolution.

  15. Viruses of lower vertebrates.


    Essbauer, S; Ahne, W


    Viruses of lower vertebrates recently became a field of interest to the public due to increasing epizootics and economic losses of poikilothermic animals. These were reported worldwide from both wildlife and collections of aquatic poikilothermic animals. Several RNA and DNA viruses infecting fish, amphibians and reptiles have been studied intensively during the last 20 years. Many of these viruses induce diseases resulting in important economic losses of lower vertebrates, especially in fish aquaculture. In addition, some of the DNA viruses seem to be emerging pathogens involved in the worldwide decline in wildlife. Irido-, herpes- and polyomavirus infections may be involved in the reduction in the numbers of endangered amphibian and reptile species. In this context the knowledge of several important RNA viruses such as orthomyxo-, paramyxo-, rhabdo-, retro-, corona-, calici-, toga-, picorna-, noda-, reo- and birnaviruses, and DNA viruses such as parvo-, irido-, herpes-, adeno-, polyoma- and poxviruses, is described in this review. PMID:11550762

  16. Viruses in Antarctic lakes

    NASA Technical Reports Server (NTRS)

    Kepner, R. L. Jr; Wharton, R. A. Jr; Suttle, C. A.; Wharton RA, J. r. (Principal Investigator)


    Water samples collected from four perennially ice-covered Antarctic lakes during the austral summer of 1996-1997 contained high densities of extracellular viruses. Many of these viruses were found to be morphologically similar to double-stranded DNA viruses that are known to infect algae and protozoa. These constitute the first observations of viruses in perennially ice-covered polar lakes. The abundance of planktonic viruses and data suggesting substantial production potential (relative to bacteria] secondary and photosynthetic primary production) indicate that viral lysis may be a major factor in the regulation of microbial populations in these extreme environments. Furthermore, we suggest that Antarctic lakes may be a reservoir of previously undescribed viruses that possess novel biological and biochemical characteristics.

  17. The human oncogenic viruses

    SciTech Connect

    Luderer, A.A.; Weetall, H.H


    This book contains eight selections. The titles are: Cytogenetics of the Leukemias and Lymphomas; Cytogenetics of Solid Tumors: Renal Cell Carcinoma, Malignant Melanoma, Retinoblastoma, and Wilms' Tumor; Elucidation of a Normal Function for a Human Proto-Oncogene; Detection of HSV-2 Genes and Gene Products in Cervical Neoplasia; Papillomaviruses in Anogennital Neoplasms; Human Epstein-Barr Virus and Cancer; Hepatitis B Virus and Hepatocellular Carcinoma; and Kaposi's Sarcoma: Acquired Immunodeficiency Syndrome (AIDS) and Associated Viruses.

  18. Water system virus detection

    NASA Technical Reports Server (NTRS)

    Fraser, A. S.; Wells, A. F.; Tenoso, H. J.


    A monitoring system developed to test the capability of a water recovery system to reject the passage of viruses into the recovered water is described. A nonpathogenic marker virus, bacteriophage F2, is fed into the process stream before the recovery unit and the reclaimed water is assayed for its presence. Detection of the marker virus consists of two major components, concentration and isolation of the marker virus, and detection of the marker virus. The concentration system involves adsorption of virus to cellulose acetate filters in the presence of trivalent cations and low pH with subsequent desorption of the virus using volumes of high pH buffer. The detection of the virus is performed by a passive immune agglutination test utilizing specially prepared polystyrene particles. An engineering preliminary design was performed as a parallel effort to the laboratory development of the marker virus test system. Engineering schematics and drawings of a fully functional laboratory prototype capable of zero-G operation are presented. The instrument consists of reagent pump/metering system, reagent storage containers, a filter concentrator, an incubation/detector system, and an electronic readout and control system.

  19. [Zika virus epidemic].


    Kronborg, Gitte; Fomsgaard, Anders


    Zika virus is endemic in several parts of the world. February 1, 2016 Zika virus was declared a public health emergency by the WHO. This declaration is mainly due to a convincing association between Zika virus infection during pregnancy and birth defects, like microcephaly, among some of the newborns. Imported cases of Zika virus infection to North America, Europe and Denmark have been described. The infection in itself is mild and self-limiting. The available diagnostic methods are under development, validation and evaluation. In Denmark, some promising diagnostics are available at Statens Serum Institut.

  20. Equine Arteritis Virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    03. Nidovirales : 03.004. Arteriviridae : 03.004.0. {03.004.0. unknown} : Arterivirus : Equine arteritis virus will be published online. The article details the phenotypic and genotypic makeup of equine arteritis virus (EAV), and summarizes its biological properties....

  1. Virus separation using membranes.


    Grein, Tanja A; Michalsky, Ronald; Czermak, Peter


    Industrial manufacturing of cell culture-derived viruses or virus-like particles for gene therapy or vaccine production are complex multistep processes. In addition to the bioreactor, such processes require a multitude of downstream unit operations for product separation, concentration, or purification. Similarly, before a biopharmaceutical product can enter the market, removal or inactivation of potential viral contamination has to be demonstrated. Given the complexity of biological solutions and the high standards on composition and purity of biopharmaceuticals, downstream processing is the bottleneck in many biotechnological production trains. Membrane-based filtration can be an economically attractive and efficient technology for virus separation. Viral clearance, for instance, of up to seven orders of magnitude has been reported for state of the art polymeric membranes under best conditions.This chapter summarizes the fundamentals of virus ultrafiltration, diafiltration, or purification with adsorptive membranes. In lieu of an impractical universally applicable protocol for virus filtration, application of these principles is demonstrated with two examples. The chapter provides detailed methods for production, concentration, purification, and removal of a rod-shaped baculovirus (Autographa californica M nucleopolyhedrovirus, about 40 × 300 nm in size, a potential vector for gene therapy, and an industrially important protein expression system) or a spherical parvovirus (minute virus of mice, 22-26 nm in size, a model virus for virus clearance validation studies).

  2. Papaya Ringspot Virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The term papaya ringspot virus (PRSV) was coined by Jensen in 1949, to describe a papaya disease in Hawaii. Later work showed that diseases such as papaya mosaic and watermelon mosaic virus-1 were caused by PRSV. The primary host range of PRSV is papaya and cucurbits, with Chenopium amaranticolor ...

  3. Positive reinforcement for viruses

    PubMed Central

    Vigant, Frederic; Jung, Michael; Lee, Benhur


    Summary Virus-cell membrane fusion requires a critical transition from positive to negative membrane curvature. St. Vincent et al., in PNAS (St Vincent, et al., 2010), designed a class of antivirals that targets this transition. These Rigid Amphipathic Fusion Inhibitors are active against an array of enveloped viruses. PMID:21035726

  4. Positive reinforcement for viruses.


    Vigant, Frederic; Jung, Michael; Lee, Benhur


    Virus-cell membrane fusion requires a critical transition from positive to negative membrane curvature. St. Vincent et al. (2010), in PNAS, designed a class of antivirals that targets this transition. These rigid amphipathic fusion inhibitors are active against an array of enveloped viruses.

  5. Rift Valley Fever Virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rift Valley fever virus (RVFV) is a mosquito-transmitted virus or arbovirus that is endemic in sub-Saharan Africa. In the last decade, Rift Valley fever (RVF) outbreaks have resulted in loss of human and animal life, as well as had significant economic impact. The disease in livestock is primarily a...

  6. Papaya ringspot virus (Potyviridae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Papaya ringspot virus, a member of the family Potyviridae, is single stranded RNA plant virus with a monocistronic genome of about 10,326 nucleotides that is expressed via a large polyprotein subsequently cleaved into functional proteins. It causes severe damage on cucurbit crops such as squash and...

  7. Zika Virus Disease.


    Slenczka, Werner


    The history of Zika virus disease serves as a paradigm of a typical emerging viral infection. Zika virus disease, a mosquito-borne flavivirus, was first isolated in 1947 in the Zika forest of Uganda. The same virus was also isolated from jungle-dwelling mosquitoes (Aedes [Stegomyia] africanus). In many areas of Africa and South Asia human infections with Zika virus were detected by both serology and virus isolation. About 80% of infections are asymptomatic, and in 20% a mostly mild disease with fever, rash, arthralgia, and conjunctivitis may occur. Fetal infections with malformations were not recorded in Africa or Asia. Zika virus was imported to northern Brazil possibly during the world soccer championship that was hosted by Brazil in June through July 2014. A cluster of severe fetal malformations with microcephaly and ocular defects was noted in 2015 in the northeast of Brazil, and intrauterine infections with Zika virus were confirmed. The dramatic change in Zika virus pathogenicity upon its introduction to Brazil has remained an enigma.

  8. Zika Virus and Pregnancy.


    Stagg, Denise; Hurst, Helen M


    Recent outbreaks of Zika virus and reports linking infection in pregnant women with microcephaly in newborns have caused concern worldwide. Information has been evolving rapidly. Nurses and other clinicians, especially those who work with women of childbearing age, play a pivotal role in disseminating accurate information and identifying potential cases of Zika virus infection.

  9. Zika Virus and Pregnancy.


    Stagg, Denise; Hurst, Helen M


    Recent outbreaks of Zika virus and reports linking infection in pregnant women with microcephaly in newborns have caused concern worldwide. Information has been evolving rapidly. Nurses and other clinicians, especially those who work with women of childbearing age, play a pivotal role in disseminating accurate information and identifying potential cases of Zika virus infection. PMID:27287356

  10. Zika Virus Disease.


    Slenczka, Werner


    The history of Zika virus disease serves as a paradigm of a typical emerging viral infection. Zika virus disease, a mosquito-borne flavivirus, was first isolated in 1947 in the Zika forest of Uganda. The same virus was also isolated from jungle-dwelling mosquitoes (Aedes [Stegomyia] africanus). In many areas of Africa and South Asia human infections with Zika virus were detected by both serology and virus isolation. About 80% of infections are asymptomatic, and in 20% a mostly mild disease with fever, rash, arthralgia, and conjunctivitis may occur. Fetal infections with malformations were not recorded in Africa or Asia. Zika virus was imported to northern Brazil possibly during the world soccer championship that was hosted by Brazil in June through July 2014. A cluster of severe fetal malformations with microcephaly and ocular defects was noted in 2015 in the northeast of Brazil, and intrauterine infections with Zika virus were confirmed. The dramatic change in Zika virus pathogenicity upon its introduction to Brazil has remained an enigma. PMID:27337468

  11. Influenza A virus reassortment.


    Steel, John; Lowen, Anice C


    Reassortment is the process by which influenza viruses swap gene segments. This genetic exchange is possible due to the segmented nature of the viral genome and occurs when two differing influenza viruses co-infect a cell. The viral diversity generated through reassortment is vast and plays an important role in the evolution of influenza viruses. Herein we review recent insights into the contribution of reassortment to the natural history and epidemiology of influenza A viruses, gained through population scale phylogenic analyses. We describe methods currently used to study reassortment in the laboratory, and we summarize recent progress made using these experimental approaches to further our understanding of influenza virus reassortment and the contexts in which it occurs.

  12. Respiratory viruses and children.


    Heikkinen, Terho


    Respiratory viruses place a great disease burden especially on the youngest children in terms of high rates of infection, bacterial complications and hospitalizations. In developing countries, some viral infections are even associated with substantial mortality in children. The interaction between viruses and bacteria is probably much more common and clinically significant than previously understood. Respiratory viruses frequently initiate the cascade of events that ultimately leads to bacterial infection. Effective antiviral agents can substantially shorten the duration of the viral illness and prevent the development of bacterial complications. Viral vaccines have the potential to not only prevent the viral infection but also decrease the incidence of bacterial complications. At present, antivirals and vaccines are only available against influenza viruses, but new vaccines and antivirals against other viruses, especially for RSV, are being developed. PMID:27177731

  13. Respiratory viruses and children.


    Heikkinen, Terho


    Respiratory viruses place a great disease burden especially on the youngest children in terms of high rates of infection, bacterial complications and hospitalizations. In developing countries, some viral infections are even associated with substantial mortality in children. The interaction between viruses and bacteria is probably much more common and clinically significant than previously understood. Respiratory viruses frequently initiate the cascade of events that ultimately leads to bacterial infection. Effective antiviral agents can substantially shorten the duration of the viral illness and prevent the development of bacterial complications. Viral vaccines have the potential to not only prevent the viral infection but also decrease the incidence of bacterial complications. At present, antivirals and vaccines are only available against influenza viruses, but new vaccines and antivirals against other viruses, especially for RSV, are being developed.

  14. Akabane virus infection.


    Kirkland, P D


    Akabane virus is a Culicoides-borne orthobunyavirus that is teratogenic to the fetus of cattle and small ruminant species. Depending upon the stage of gestation atwhich infection occurs, and the length of gestation of the mammalian host, a range of congenital defects may be observed. The developing central nervous system is usually the most severely affected, with hydranencephaly and arthrogryposis most frequently observed. Less commonly, some strains of Akabane virus can cause encephalitis in the neonate or, rarely, adult cattle. Akabane viruses are known to be widespread in temperate and tropical regions of Australia, Southeast Asia, the Middle East and some African countries. Disease is infrequently observed in regions where this virus is endemic and the presence of the virus remains unrecognised in the absence of serological surveillance. In some Asian countries, vaccines are used to minimise the occurrence of disease. PMID:26601444

  15. Infectious Viral Quantification of Chikungunya Virus-Virus Plaque Assay.


    Kaur, Parveen; Lee, Regina Ching Hua; Chu, Justin Jang Hann


    The plaque assay is an essential method for quantification of infectious virus titer. Cells infected with virus particles are overlaid with a viscous substrate. A suitable incubation period results in the formation of plaques, which can be fixed and stained for visualization. Here, we describe a method for measuring Chikungunya virus (CHIKV) titers via virus plaque assays.

  16. Virus discovery and recent insights into virus diversity in arthropods.


    Junglen, Sandra; Drosten, Christian


    Recent studies on virus discovery have focused mainly on mammalian and avian viruses. Arbovirology with its long tradition of ecologically oriented investigation is now catching up, with important novel insights into the diversity of arthropod-associated viruses. Recent discoveries include taxonomically outlying viruses within the families Flaviviridae, Togaviridae, and Bunyaviridae, and even novel virus families within the order Nidovirales. However, the current focusing of studies on blood-feeding arthropods has restricted the range of arthropod hosts analyzed for viruses so far. Future investigations should include species from other arthropod taxa than Ixodita, Culicidae and Phlebotominae in order to shed light on the true diversity of arthropod viruses.

  17. Realms of the Viruses Online

    ERIC Educational Resources Information Center

    Liu, Dennis


    Viruses have evolved strategies for infecting all taxa, but most viruses are highly specific about their cellular host. In humans, viruses cause diverse diseases, from chronic but benign warts, to acute and deadly hemorrhagic fever. Viruses have entertaining names like Zucchini Yellow Mosaic, Semliki Forest, Coxsackie, and the original terminator,…

  18. Tembusu Virus in Ducks, China

    PubMed Central

    Cao, Zhenzhen; Zhang, Cun; Liu, Yuehuan; Ye, Weicheng; Han, Jingwen; Ma, Guoming; Zhang, Dongdong; Xu, Feng; Gao, Xuhui; Tang, Yi; Shi, Shaohua; Wan, Chunhe; Zhang, Chen; He, Bin; Yang, Mengjie; Lu, Xinhao; Huang, Yu; Diao, Youxiang; Ma, Xuejun


    In China in 2010, a disease outbreak in egg-laying ducks was associated with a flavivirus. The virus was isolated and partially sequenced. The isolate exhibited 87%–91% identity with strains of Tembusu virus, a mosquito-borne flavivirus of the Ntaya virus group. These findings demonstrate emergence of Tembusu virus in ducks. PMID:22000358

  19. Postmortem Stability of Ebola Virus

    PubMed Central

    Prescott, Joseph; Bushmaker, Trenton; Fischer, Robert; Miazgowicz, Kerri; Judson, Seth


    The ongoing Ebola virus outbreak in West Africa has highlighted questions regarding stability of the virus and detection of RNA from corpses. We used Ebola virus–infected macaques to model humans who died of Ebola virus disease. Viable virus was isolated <7 days posteuthanasia; viral RNA was detectable for 10 weeks. PMID:25897646

  20. Virus-PEDOT Biocomposite Films

    PubMed Central

    Donavan, Keith C.; Arter, Jessica A.


    Virus-poly(3,4-ethylenedioxythiophene) (virus-PEDOT) biocomposite films are prepared by electropolymerizing 3,4-ethylenedioxythiophene (EDOT) in aqueous electrolytes containing 12 mM LiClO4 and the bacteriophage M13. The concentration of virus in these solutions, [virus]soln, is varied from 3 nM to 15 nM. A quartz crystal microbalance is used to directly measure the total mass of the biocomposite film during its electrodeposition. In combination with a measurement of the electrodeposition charge, the mass of the virus incorporated into the film is calculated. These data show that concentration of the M13 within the electropolymerized film, [virus]film, increases linearly with [virus]soln. The incorporation of virus particles into the PEDOT film from solution is efficient, resulting in a concentration ratio: [virus]film:[virus]soln ≈450. Virus incorporation into the PEDOT causes roughening of the film topography that is observed using scanning electron microscopy and atomic force microscopy (AFM). The electrical conductivity of the virus-PEDOT film, measured perpendicular to the plane of the film using conductive tip AFM, decreases linearly with virus loading, from 270 μS/cm for pure PE-DOT films to 50 μS/cm for films containing 100 μM virus. The presence on the virus surface of displayed affinity peptides did not significantly influence the efficiency of incorporation into virus-PEDOT biocomposite films. PMID:22856875

  1. A Virus in Turbo Pascal.

    ERIC Educational Resources Information Center

    Teleky, Heidi Ann; And Others


    Addresses why the authors feel it is not inappropriate to teach about viruses in the how-to, hands-on fashion. Identifies the special features of Turbo Pascal that have to be used for the creation of an effective virus. Defines virus, derives its structure, and from this structure is derived the implemented virus. (PR)

  2. Computer Viruses: Pathology and Detection.

    ERIC Educational Resources Information Center

    Maxwell, John R.; Lamon, William E.


    Explains how computer viruses were originally created, how a computer can become infected by a virus, how viruses operate, symptoms that indicate a computer is infected, how to detect and remove viruses, and how to prevent a reinfection. A sidebar lists eight antivirus resources. (four references) (LRW)

  3. Viruses of Chelonia.


    Ahne, W


    Viruses occurring in turtles and tortoises are hetergeneous but according to ecologic characteristics and pathogenic properties they can be divided in two major groups: 1. Arboviruses (toga-, flavi-, rhabdo- and bunyaviruses) transmitted by arthropods cause severe diseases in homoiothermic vertebrates. The viruses are of great epidemiological interest in human and veterinary medicine. Chelonia and other reptiles infected by bites of vectors e.g. Aedes, Anopheles, Culex develop cyclic viremia without injury. The ectothermic animals maintain inapparent arbovirus infections during hibernation and they play role as reservoirs for these viruses. 2. Viruses of Chelonia origin (papova-, herpes-, irido- and paramyxoviruses) associated with diseases of infected turtles and tortoises have been described frequently during the last 20 years. Several viruses or virus-like particles could be demonstrated in affected reptiles mainly by electron microscopy. Especially herpesviruses seem to attack Chelonia and epizootics due to infections with these viruses were reported in several reptiles in collections. However, the etiological role of the agents detected is not well documented yet. PMID:8456570

  4. Ocular Tropism of Respiratory Viruses

    PubMed Central

    Rota, Paul A.; Tumpey, Terrence M.


    SUMMARY Respiratory viruses (including adenovirus, influenza virus, respiratory syncytial virus, coronavirus, and rhinovirus) cause a broad spectrum of disease in humans, ranging from mild influenza-like symptoms to acute respiratory failure. While species D adenoviruses and subtype H7 influenza viruses are known to possess an ocular tropism, documented human ocular disease has been reported following infection with all principal respiratory viruses. In this review, we describe the anatomical proximity and cellular receptor distribution between ocular and respiratory tissues. All major respiratory viruses and their association with human ocular disease are discussed. Research utilizing in vitro and in vivo models to study the ability of respiratory viruses to use the eye as a portal of entry as well as a primary site of virus replication is highlighted. Identification of shared receptor-binding preferences, host responses, and laboratory modeling protocols among these viruses provides a needed bridge between clinical and laboratory studies of virus tropism. PMID:23471620

  5. Genome of horsepox virus.


    Tulman, E R; Delhon, G; Afonso, C L; Lu, Z; Zsak, L; Sandybaev, N T; Kerembekova, U Z; Zaitsev, V L; Kutish, G F; Rock, D L


    Here we present the genomic sequence of horsepox virus (HSPV) isolate MNR-76, an orthopoxvirus (OPV) isolated in 1976 from diseased Mongolian horses. The 212-kbp genome contained 7.5-kbp inverted terminal repeats and lacked extensive terminal tandem repetition. HSPV contained 236 open reading frames (ORFs) with similarity to those in other OPVs, with those in the central 100-kbp region most conserved relative to other OPVs. Phylogenetic analysis of the conserved region indicated that HSPV is closely related to sequenced isolates of vaccinia virus (VACV) and rabbitpox virus, clearly grouping together these VACV-like viruses. Fifty-four HSPV ORFs likely represented fragments of 25 orthologous OPV genes, including in the central region the only known fragmented form of an OPV ribonucleotide reductase large subunit gene. In terminal genomic regions, HSPV lacked full-length homologues of genes variably fragmented in other VACV-like viruses but was unique in fragmentation of the homologue of VACV strain Copenhagen B6R, a gene intact in other known VACV-like viruses. Notably, HSPV contained in terminal genomic regions 17 kbp of OPV-like sequence absent in known VACV-like viruses, including fragments of genes intact in other OPVs and approximately 1.4 kb of sequence present only in cowpox virus (CPXV). HSPV also contained seven full-length genes fragmented or missing in other VACV-like viruses, including intact homologues of the CPXV strain GRI-90 D2L/I4R CrmB and D13L CD30-like tumor necrosis factor receptors, D3L/I3R and C1L ankyrin repeat proteins, B19R kelch-like protein, D7L BTB/POZ domain protein, and B22R variola virus B22R-like protein. These results indicated that HSPV contains unique genomic features likely contributing to a unique virulence/host range phenotype. They also indicated that while closely related to known VACV-like viruses, HSPV contains additional, potentially ancestral sequences absent in other VACV-like viruses.

  6. Viruses in reptiles

    PubMed Central


    The etiology of reptilian viral diseases can be attributed to a wide range of viruses occurring across different genera and families. Thirty to forty years ago, studies of viruses in reptiles focused mainly on the zoonotic potential of arboviruses in reptiles and much effort went into surveys and challenge trials of a range of reptiles with eastern and western equine encephalitis as well as Japanese encephalitis viruses. In the past decade, outbreaks of infection with West Nile virus in human populations and in farmed alligators in the USA has seen the research emphasis placed on the issue of reptiles, particularly crocodiles and alligators, being susceptible to, and reservoirs for, this serious zoonotic disease. Although there are many recognised reptilian viruses, the evidence for those being primary pathogens is relatively limited. Transmission studies establishing pathogenicity and cofactors are likewise scarce, possibly due to the relatively low commercial importance of reptiles, difficulties with the availability of animals and permits for statistically sound experiments, difficulties with housing of reptiles in an experimental setting or the inability to propagate some viruses in cell culture to sufficient titres for transmission studies. Viruses as causes of direct loss of threatened species, such as the chelonid fibropapilloma associated herpesvirus and ranaviruses in farmed and wild tortoises and turtles, have re-focused attention back to the characterisation of the viruses as well as diagnosis and pathogenesis in the host itself. 1. Introduction 2. Methods for working with reptilian viruses 3. Reptilian viruses described by virus families 3.1. Herpesviridae 3.2. Iridoviridae 3.2.1 Ranavirus 3.2.2 Erythrocytic virus 3.2.3 Iridovirus 3.3. Poxviridae 3.4. Adenoviridae 3.5. Papillomaviridae 3.6. Parvoviridae 3.7. Reoviridae 3.8. Retroviridae and inclusion body disease of Boid snakes 3.9. Arboviruses 3.9.1. Flaviviridae 3.9.2. Togaviridae 3.10. Caliciviridae

  7. [Ebola virus disease].


    Nazimek, Katarzyna; Bociaga-Jasik, Monika; Bryniarski, Krzysztof; Gałas, Aleksander; Garlicki, Aleksander; Gawda, Anna; Gawlik, Grzegorz; Gil, Krzysztof; Kosz-Vnenchak, Magdalena; Mrozek-Budzyn, Dorota; Olszanecki, Rafał; Piatek, Anna; Zawilińska, Barbara; Marcinkiewicz, Janusz


    Ebola is one of the most virulent zoonotic RNA viruses causing in humans haemorrhagic fever with fatality ratio reaching 90%. During the outbreak of 2014 the number of deaths exceeded 8.000. The "imported" cases reported in Western Europe and USA highlighted the extreme risk of Ebola virus spreading outside the African countries. Thus, haemorrhagic fever outbreak is an international epidemiological problem, also due to the lack of approved prevention and therapeutic strategies. The editorial review article briefly summarizes current knowledge on Ebola virus disease epidemiology, etiology, pathogenesis, clinical presentation, diagnosis as well as possible prevention and treatment.

  8. Hepatitis B virus (image)


    Hepatitis B is also known as serum hepatitis and is spread through blood and sexual contact. It is ... population. This photograph is an electronmicroscopic image of hepatitis B virus particles. (Image courtesy of the Centers for ...

  9. [Zika, a neurotropic virus?].


    Del Carpio-Orantes, Luis


    In this paper, the neurotropism potential Zika virus is discussed, by comparison with viruses both RNA and DNA are neurotropic known, also it is said that compared with the new viruses that have affected the Americas, as the chikungunya, Zika has shown great affinity by brain tissue, manifested by a high incidence of acute neurological conditions, such as Guillain-Barré syndrome, among others, as well as the reported incidence of microcephaly that is abnormally high compared with the previous incidence, which, in a stillborn subject necropsied significant alterations demonstrated in brain tissue, identifying viral material and live virus in the fetoplacental complex, and demonstrating the impact both white matter and gray matter as well as basal ganglia, corpus callosum, ventricles and spinal cord, which could explain the microcephaly that concerns him. Although not a direct cause-effect relationship is demonstrated, however current evidence supports that relationship, hoping to be supported scientifically.

  10. The dengue viruses.

    PubMed Central

    Henchal, E A; Putnak, J R


    Dengue, a major public health problem throughout subtropical and tropical regions, is an acute infectious disease characterized by biphasic fever, headache, pain in various parts of the body, prostration, rash, lymphadenopathy, and leukopenia. In more severe or complicated dengue, patients present with a severe febrile illness characterized by abnormalities of hemostasis and increased vascular permeability, which in some instances results in a hypovolemic shock. Four distinct serotypes of the dengue virus (dengue-1, dengue-2, dengue-3, and dengue-4) exist, with numerous virus strains found worldwide. Molecular cloning methods have led to a greater understanding of the structure of the RNA genome and definition of virus-specific structural and nonstructural proteins. Progress towards producing safe, effective dengue virus vaccines, a goal for over 45 years, has been made. Images PMID:2224837

  11. VIRUS instrument enclosures

    NASA Astrophysics Data System (ADS)

    Prochaska, T.; Allen, R.; Mondrik, N.; Rheault, J. P.; Sauseda, M.; Boster, E.; James, M.; Rodriguez-Patino, M.; Torres, G.; Ham, J.; Cook, E.; Baker, D.; DePoy, Darren L.; Marshall, Jennifer L.; Hill, G. J.; Perry, D.; Savage, R. D.; Good, J. M.; Vattiat, Brian L.


    The Visible Integral-Field Replicable Unit Spectrograph (VIRUS) instrument will be installed at the Hobby-Eberly Telescope† in the near future. The instrument will be housed in two enclosures that are mounted adjacent to the telescope, via the VIRUS Support Structure (VSS). We have designed the enclosures to support and protect the instrument, to enable servicing of the instrument, and to cool the instrument appropriately while not adversely affecting the dome environment. The system uses simple HVAC air handling techniques in conjunction with thermoelectric and standard glycol heat exchangers to provide efficient heat removal. The enclosures also provide power and data transfer to and from each VIRUS unit, liquid nitrogen cooling to the detectors, and environmental monitoring of the instrument and dome environments. In this paper, we describe the design and fabrication of the VIRUS enclosures and their subsystems.

  12. Respiratory syncytial virus (RSV)


    ... RSV often spreads quickly in crowded households and day care centers. The virus can live for a half ... The following increase the risk for RSV: Attending day care Being near tobacco smoke Having school-aged brothers ...

  13. West Nile Virus


    ... to human beings through their bites. Credit: CDC Biology, Genetics, & Clinical Research NIAID conducts and funds basic and clinical research on WNV biology and viral structure, ways the virus causes human ...

  14. What's West Nile Virus?


    ... is caused by a bite from an infected mosquito that's already carrying the virus, but it's important ... the risk of being bitten by an infected mosquito is greatest from July to early September. But ...

  15. Avoiding Computer Viruses.

    ERIC Educational Resources Information Center

    Rowe, Joyce; And Others


    The threat of computer sabotage is a real concern to business teachers and others responsible for academic computer facilities. Teachers can minimize the possibility. Eight suggestions for avoiding computer viruses are given. (JOW)

  16. West Nile Virus


    ... appeared in the United States in 1999. Infected mosquitoes spread the virus that causes it. People who ... barrels Stay indoors between dusk and dawn, when mosquitoes are most active Use screens on windows to ...

  17. The dengue viruses.


    Henchal, E A; Putnak, J R


    Dengue, a major public health problem throughout subtropical and tropical regions, is an acute infectious disease characterized by biphasic fever, headache, pain in various parts of the body, prostration, rash, lymphadenopathy, and leukopenia. In more severe or complicated dengue, patients present with a severe febrile illness characterized by abnormalities of hemostasis and increased vascular permeability, which in some instances results in a hypovolemic shock. Four distinct serotypes of the dengue virus (dengue-1, dengue-2, dengue-3, and dengue-4) exist, with numerous virus strains found worldwide. Molecular cloning methods have led to a greater understanding of the structure of the RNA genome and definition of virus-specific structural and nonstructural proteins. Progress towards producing safe, effective dengue virus vaccines, a goal for over 45 years, has been made. PMID:2224837

  18. Why do some immobilized N-alkylated polyethylenimines far surpass others in inactivating influenza viruses?


    Liu, Harris; Elkin, Igor; Chen, Jianzhu; Klibanov, Alexander M


    A number of N-alkylated polyethylenimines (PEIs) were covalently attached to glass-slide surfaces, and their virucidal efficacies against three different strains of influenza viruses were examined quantitatively. The anti-influenza activities of the modified surfaces varied widely, with the most potent, immobilized N,N-hexyl,methyl-PEI and N,N-dodecyl,methyl-PEI, reducing the viral titer by over three logs (i.e., >99.9%). While the virucidal activities of the glass surfaces derivatized with N-alkylated PEIs displayed no discernible correlation with such surface properties as hydrophobicity, charge, protein affinity, roughness, adhesive interactions, and polymer-chain extension lengths, they exhibited a marginal correlation with the surface density of the quaternary ammonium group, as titrated by means of fluorescein binding. However, this correlation markedly improved (to the correlation coefficient of 0.97 with a two-tailed p value of 0.044) when the titration was instead carried out using a macromolecular conjugate, the dye coupled to the protein lysozyme, suggesting that the critical determinant of the virucidal activity is the density of the immobilized quaternary ammonium groups accessible to influenza virions.

  19. Viruses and Multiple Sclerosis

    PubMed Central

    Virtanen, Jussi Oskari; Jacobson, Steve


    Multiple sclerosis (MS) is a heterogeneous disease that develops as an interplay between the immune system and environmental stimuli in genetically susceptible individuals. There is increasing evidence that viruses may play a role in MS pathogenesis acting as these environmental triggers. However, it is not known if any single virus is causal, or rather several viruses can act as triggers in disease development. Here, we review the association of different viruses to MS with an emphasis on two herpesviruses, Epstein-Barr virus (EBV) and human herpesvirus 6 (HHV-6). These two agents have generated the most impact during recent years as possible co-factors in MS disease development. The strongest argument for association of EBV with MS comes from the link between symptomatic infectious mononucleosis and MS and from seroepidemiological studies. In contrast to EBV, HHV-6 has been found significantly more often in MS plaques than in MS normal appearing white matter or non-MS brains and HHV-6 re-activation has been reported during MS clinical relapses. In this review we also suggest new strategies, including the development of new infectious animal models of MS and antiviral MS clinical trials, to elucidate roles of different viruses in the pathogenesis of this disease. Furthermore, we introduce the idea of using unbiased sequence-independent pathogen discovery methodologies, such as next generation sequencing, to study MS brain tissue or body fluids for detection of known viral sequences or potential novel viral agents. PMID:22583435

  20. Human Influenza Virus Infections.


    Peteranderl, Christin; Herold, Susanne; Schmoldt, Carole


    Seasonal and pandemic influenza are the two faces of respiratory infections caused by influenza viruses in humans. As seasonal influenza occurs on an annual basis, the circulating virus strains are closely monitored and a yearly updated vaccination is provided, especially to identified risk populations. Nonetheless, influenza virus infection may result in pneumonia and acute respiratory failure, frequently complicated by bacterial coinfection. Pandemics are, in contrary, unexpected rare events related to the emergence of a reassorted human-pathogenic influenza A virus (IAV) strains that often causes increased morbidity and spreads extremely rapidly in the immunologically naive human population, with huge clinical and economic impact. Accordingly, particular efforts are made to advance our knowledge on the disease biology and pathology and recent studies have brought new insights into IAV adaptation mechanisms to the human host, as well as into the key players in disease pathogenesis on the host side. Current antiviral strategies are only efficient at the early stages of the disease and are challenged by the genomic instability of the virus, highlighting the need for novel antiviral therapies targeting the pulmonary host response to improve viral clearance, reduce the risk of bacterial coinfection, and prevent or attenuate acute lung injury. This review article summarizes our current knowledge on the molecular basis of influenza infection and disease progression, the key players in pathogenesis driving severe disease and progression to lung failure, as well as available and envisioned prevention and treatment strategies against influenza virus infection. PMID:27486731

  1. Virus templated metallic nanoparticles

    NASA Astrophysics Data System (ADS)

    Aljabali, Alaa A. A.; Barclay, J. Elaine; Lomonossoff, George P.; Evans, David J.


    Plant viruses are considered as nanobuilding blocks that can be used as synthons or templates for novel materials. Cowpea mosaic virus (CPMV) particles have been shown to template the fabrication of metallic nanoparticles by an electroless deposition metallization process. Palladium ions were electrostatically bound to the virus capsid and, when reduced, acted as nucleation sites for the subsequent metal deposition from solution. The method, although simple, produced highly monodisperse metallic nanoparticles with a diameter of ca. <=35 nm. CPMV-templated particles were prepared with cobalt, nickel, iron, platinum, cobalt-platinum and nickel-iron.Plant viruses are considered as nanobuilding blocks that can be used as synthons or templates for novel materials. Cowpea mosaic virus (CPMV) particles have been shown to template the fabrication of metallic nanoparticles by an electroless deposition metallization process. Palladium ions were electrostatically bound to the virus capsid and, when reduced, acted as nucleation sites for the subsequent metal deposition from solution. The method, although simple, produced highly monodisperse metallic nanoparticles with a diameter of ca. <=35 nm. CPMV-templated particles were prepared with cobalt, nickel, iron, platinum, cobalt-platinum and nickel-iron. Electronic supplementary information (ESI) available: Additional experimental detail, agarose gel electrophoresis results, energy dispersive X-ray spectra, ζ-potential measurements, dynamic light scattering data, nanoparticle tracking analysis and an atomic force microscopy image of Ni-CPMV. See DOI: 10.1039/c0nr00525h

  2. Human Influenza Virus Infections.


    Peteranderl, Christin; Herold, Susanne; Schmoldt, Carole


    Seasonal and pandemic influenza are the two faces of respiratory infections caused by influenza viruses in humans. As seasonal influenza occurs on an annual basis, the circulating virus strains are closely monitored and a yearly updated vaccination is provided, especially to identified risk populations. Nonetheless, influenza virus infection may result in pneumonia and acute respiratory failure, frequently complicated by bacterial coinfection. Pandemics are, in contrary, unexpected rare events related to the emergence of a reassorted human-pathogenic influenza A virus (IAV) strains that often causes increased morbidity and spreads extremely rapidly in the immunologically naive human population, with huge clinical and economic impact. Accordingly, particular efforts are made to advance our knowledge on the disease biology and pathology and recent studies have brought new insights into IAV adaptation mechanisms to the human host, as well as into the key players in disease pathogenesis on the host side. Current antiviral strategies are only efficient at the early stages of the disease and are challenged by the genomic instability of the virus, highlighting the need for novel antiviral therapies targeting the pulmonary host response to improve viral clearance, reduce the risk of bacterial coinfection, and prevent or attenuate acute lung injury. This review article summarizes our current knowledge on the molecular basis of influenza infection and disease progression, the key players in pathogenesis driving severe disease and progression to lung failure, as well as available and envisioned prevention and treatment strategies against influenza virus infection.

  3. Transmission of influenza A viruses.


    Neumann, Gabriele; Kawaoka, Yoshihiro


    Influenza A viruses cause respiratory infections that range from asymptomatic to deadly in humans. Widespread outbreaks (pandemics) are attributable to 'novel' viruses that possess a viral hemagglutinin (HA) gene to which humans lack immunity. After a pandemic, these novel viruses form stable virus lineages in humans and circulate until they are replaced by other novel viruses. The factors and mechanisms that facilitate virus transmission among hosts and the establishment of novel lineages are not completely understood, but the HA and basic polymerase 2 (PB2) proteins are thought to play essential roles in these processes by enabling avian influenza viruses to infect mammals and replicate efficiently in their new host. Here, we summarize our current knowledge of the contributions of HA, PB2, and other viral components to virus transmission and the formation of new virus lineages. PMID:25812763

  4. Transmission of Influenza A Viruses

    PubMed Central

    Neumann, Gabriele; Kawaoka, Yoshihiro


    Influenza A viruses cause respiratory infections that range from asymptomatic to deadly in humans. Widespread outbreaks (pandemics) are attributable to ‘novel’ viruses that possess a viral hemagglutinin (HA) gene to which humans lack immunity. After a pandemic, these novel viruses form stable virus lineages in humans and circulate until they are replaced by other novel viruses. The factors and mechanisms that facilitate virus transmission among hosts and the establishment of novel lineages are not completely understood, but the HA and basic polymerase 2 (PB2) proteins are thought to play essential roles in these processes by enabling avian influenza viruses to infect mammals and replicate efficiently in their new host. Here, we summarize our current knowledge of the contributions of HA, PB2, and other viral components to virus transmission and the formation of new virus lineages. PMID:25812763

  5. Smaller Fleas: Viruses of Microorganisms

    PubMed Central

    Hyman, Paul; Abedon, Stephen T.


    Life forms can be roughly differentiated into those that are microscopic versus those that are not as well as those that are multicellular and those that, instead, are unicellular. Cellular organisms seem generally able to host viruses, and this propensity carries over to those that are both microscopic and less than truly multicellular. These viruses of microorganisms, or VoMs, in fact exist as the world's most abundant somewhat autonomous genetic entities and include the viruses of domain Bacteria (bacteriophages), the viruses of domain Archaea (archaeal viruses), the viruses of protists, the viruses of microscopic fungi such as yeasts (mycoviruses), and even the viruses of other viruses (satellite viruses). In this paper we provide an introduction to the concept of viruses of microorganisms, a.k.a., viruses of microbes. We provide broad discussion particularly of VoM diversity. VoM diversity currently spans, in total, at least three-dozen virus families. This is roughly ten families per category—bacterial, archaeal, fungal, and protist—with some virus families infecting more than one of these microorganism major taxa. Such estimations, however, will vary with further discovery and taxon assignment and also are dependent upon what forms of life one includes among microorganisms. PMID:24278736

  6. Smaller fleas: viruses of microorganisms.


    Hyman, Paul; Abedon, Stephen T


    Life forms can be roughly differentiated into those that are microscopic versus those that are not as well as those that are multicellular and those that, instead, are unicellular. Cellular organisms seem generally able to host viruses, and this propensity carries over to those that are both microscopic and less than truly multicellular. These viruses of microorganisms, or VoMs, in fact exist as the world's most abundant somewhat autonomous genetic entities and include the viruses of domain Bacteria (bacteriophages), the viruses of domain Archaea (archaeal viruses), the viruses of protists, the viruses of microscopic fungi such as yeasts (mycoviruses), and even the viruses of other viruses (satellite viruses). In this paper we provide an introduction to the concept of viruses of microorganisms, a.k.a., viruses of microbes. We provide broad discussion particularly of VoM diversity. VoM diversity currently spans, in total, at least three-dozen virus families. This is roughly ten families per category-bacterial, archaeal, fungal, and protist-with some virus families infecting more than one of these microorganism major taxa. Such estimations, however, will vary with further discovery and taxon assignment and also are dependent upon what forms of life one includes among microorganisms.

  7. [Zika virus infection during pregnancy].


    Picone, O; Vauloup-Fellous, C; D'Ortenzio, E; Huissoud, C; Carles, G; Benachi, A; Faye, A; Luton, D; Paty, M-C; Ayoubi, J-M; Yazdanpanah, Y; Mandelbrot, L; Matheron, S


    A Zika virus epidemic is currently ongoing in the Americas. This virus is linked to congenital infections with potential severe neurodevelopmental dysfunction. However, incidence of fetal infection and whether this virus is responsible of other fetal complications are still unknown. National and international public health authorities recommend caution and several prevention measures. Declaration of Zika virus infection is now mandatory in France. Given the available knowledge on Zika virus, we suggest here a review of the current recommendations for management of pregnancy in case of suspicious or infection by Zika virus in a pregnant woman. PMID:27079865

  8. [Zika virus infection during pregnancy].


    Picone, O; Vauloup-Fellous, C; D'Ortenzio, E; Huissoud, C; Carles, G; Benachi, A; Faye, A; Luton, D; Paty, M-C; Ayoubi, J-M; Yazdanpanah, Y; Mandelbrot, L; Matheron, S


    A Zika virus epidemic is currently ongoing in the Americas. This virus is linked to congenital infections with potential severe neurodevelopmental dysfunction. However, incidence of fetal infection and whether this virus is responsible of other fetal complications are still unknown. National and international public health authorities recommend caution and several prevention measures. Declaration of Zika virus infection is now mandatory in France. Given the available knowledge on Zika virus, we suggest here a review of the current recommendations for management of pregnancy in case of suspicious or infection by Zika virus in a pregnant woman.

  9. Recombinant Vaccinia Virus: Immunization against Multiple Pathogens

    NASA Astrophysics Data System (ADS)

    Perkus, Marion E.; Piccini, Antonia; Lipinskas, Bernard R.; Paoletti, Enzo


    The coding sequences for the hepatitis B virus surface antigen, the herpes simplex virus glycoprotein D, and the influenza virus hemagglutinin were inserted into a single vaccinia virus genome. Rabbits inoculated intravenously or intradermally with this polyvalent vaccinia virus recombinant produced antibodies reactive to all three authentic foreign antigens. In addition, the feasibility of multiple rounds of vaccination with recombinant vaccinia virus was demonstrated.

  10. Two African viruses serologically and morphologically related to rabies virus.


    Shope, R E; Murphy, F A; Harrison, A K; Causey, O R; Kemp, G E; Simpson, D I; Moore, D L


    Lagos bat virus and an isolate from shrews (IbAn 27377), both from Nigeria, were found to be bullet-shaped and to mature intracytoplasmically in association with a distinct matrix. They were related to, but readily distinguishable from, rabies virus and each other by complement fixation and neutralization tests. The three viruses, including rabies, form a subgrouping within the rhabdoviruses. PMID:5530013

  11. [Viruses and civilization].


    Chastel, C


    A few million years ago, when primates moved from the east African forest to the savannah, they were already infected with endogenous viruses and occultly transmitted them to the prime Homo species. However it was much later with the building of the first large cities in Mesopotamia that interhuman viral transmission began in earnest. Spreading was further enhanced with the organization of the Egyptian, Greek, Roman, and Arab empires around the Mediterranean. Discovery of the New World in 1492 led to an unprecedented clash of civilizations and the destruction of pre-Columbian Indian civilizations. It also led to a rapid spread of viruses across the Atlantic Ocean with the emergence of yellow fever and appearance of smallpox and measles throughout the world. However the greatest opportunities for worldwide viral development have been created by our present, modern civilization. This fact is illustrated by epidemic outbreaks of human immunodeficiency virus, Venezuela hemorrhagic fever, Rift valley fever virus, and monkey pox virus. Close analysis underscores the major role of human intervention in producing these events.

  12. Viruses and Multiple Sclerosis

    PubMed Central

    Owens, Gregory P.; Gilden, Don; Burgoon, Mark P.; Yu, Xiaoli; Bennett, Jeffrey L.


    Multiple sclerosis (MS) is a chronic demyelinating disorder of unknown etiology, possibly caused by a virus or virus-triggered immunopathology. The virus might reactivate after years of latency and lyse oligodendrocytes, as in progressive multifocal leukoencephalopathy, or initiate immunopathological demyelination, as in animals infected with Theiler’s murine encephalomyelitis virus or coronaviruses. The argument for a viral cause of MS is supported by epidemiological analyses and studies of MS in identical twins, indicating that disease is acquired. However, the most important evidence is the presence of bands of oligoclonal IgG (OCBs) in MS brain and CSF that persist throughout the lifetime of the patient. OCBs are found almost exclusively in infectious CNS disorders, and antigenic targets of OCBs represent the agent that causes disease. Here, the authors review past attempts to identify an infectious agent in MS brain cells and discuss the promise of using recombinant antibodies generated from clonally expanded plasma cells in brain and CSF to identify disease-relevant antigens. They show how this strategy has been used successfully to analyze antigen specificity in subacute sclerosing panencephalitis, a chronic encephalitis caused by measles virus, and in neuromyelitis optica, a chronic autoimmune demyelinating disease produced by antibodies directed against the aquaporin-4 water channel. PMID:22130640

  13. Viruses and multiple sclerosis.


    Owens, Gregory P; Gilden, Don; Burgoon, Mark P; Yu, Xiaoli; Bennett, Jeffrey L


    Multiple sclerosis (MS) is a chronic demyelinating disorder of unknown etiology, possibly caused by a virus or virus-triggered immunopathology. The virus might reactivate after years of latency and lyse oligodendrocytes, as in progressive multifocal leukoencephalopathy, or initiate immunopathological demyelination, as in animals infected with Theiler's murine encephalomyelitis virus or coronaviruses. The argument for a viral cause of MS is supported by epidemiological analyses and studies of MS in identical twins, indicating that disease is acquired. However, the most important evidence is the presence of bands of oligoclonal IgG (OCBs) in MS brain and CSF that persist throughout the lifetime of the patient. OCBs are found almost exclusively in infectious CNS disorders, and antigenic targets of OCBs represent the agent that causes disease. Here, the authors review past attempts to identify an infectious agent in MS brain cells and discuss the promise of using recombinant antibodies generated from clonally expanded plasma cells in brain and CSF to identify disease-relevant antigens. They show how this strategy has been used successfully to analyze antigen specificity in subacute sclerosing panencephalitis, a chronic encephalitis caused by measles virus, and in neuromyelitis optica, a chronic autoimmune demyelinating disease produced by antibodies directed against the aquaporin-4 water channel. PMID:22130640

  14. Attenuation of Vaccinia Virus.


    Yakubitskiy, S N; Kolosova, I V; Maksyutov, R A; Shchelkunov, S N


    Since 1980, in the post-smallpox vaccination era the human population has become increasingly susceptible compared to a generation ago to not only the variola (smallpox) virus, but also other zoonotic orthopoxviruses. The need for safer vaccines against orthopoxviruses is even greater now. The Lister vaccine strain (LIVP) of vaccinia virus was used as a parental virus for generating a recombinant 1421ABJCN clone defective in five virulence genes encoding hemagglutinin (A56R), the IFN-γ-binding protein (B8R), thymidine kinase (J2R), the complement-binding protein (C3L), and the Bcl-2-like inhibitor of apoptosis (N1L). We found that disruption of these loci does not affect replication in mammalian cell cultures. The isogenic recombinant strain 1421ABJCN exhibits a reduced inflammatory response and attenuated neurovirulence relative to LIVP. Virus titers of 1421ABJCN were 3 lg lower versus the parent VACV LIVP when administered by the intracerebral route in new-born mice. In a subcutaneous mouse model, 1421ABJCN displayed levels of VACV-neutralizing antibodies comparable to those of LIVP and conferred protective immunity against lethal challenge by the ectromelia virus. The VACV mutant holds promise as a safe live vaccine strain for preventing smallpox and other orthopoxvirus infections. PMID:26798498

  15. [Markers of hepatitis virus].


    Suzuki, Fumitaka


    Hepatitis B virus (HBV) and hepatitis C virus (HCV) are the major viruses known to cause viral hepatitis. Serological markers are commonly used as diagnostic and/or prognostic indicators of acute or chronic HBV or HCV infection. The ability to detect HBV DNA in serum has been reported to have prognostic value for the outcome of chronic HBV infection. A rapid and sustained drop in HBV DNA or HCV RNA levels in patients under therapy has been shown to be a predictive factor for a favourable treatment outcome. Various techniques for detecting HBV DNA or HCV RNA have already been described; however, there are various problems with the sensitivity or detection range of those methods. New virus measuring methods have recently been reported and used. The Cobas Taq Man HCV Test is a new method to detect HBV DNA and HCV RNA with higher sensitivity and a broader range of quantitation than conventional methods. Some reports have shown that these methods improve therapy monitoring and the management of HBV or HCV infection. Moreover, hepatitis E virus (HEV) infection has been reported in Japan. The clinical features and viral markers of HEV have also been described. PMID:19086457

  16. Special Issue: Honey Bee Viruses.


    Gisder, Sebastian; Genersch, Elke


    Pollination of flowering plants is an important ecosystem service provided by wild insect pollinators and managed honey bees. Hence, losses and declines of pollinating insect species threaten human food security and are of major concern not only for apiculture or agriculture but for human society in general. Honey bee colony losses and bumblebee declines have attracted intensive research interest over the last decade and although the problem is far from being solved we now know that viruses are among the key players of many of these bee losses and bumblebee declines. With this special issue on bee viruses we, therefore, aimed to collect high quality original papers reflecting the current state of bee virus research. To this end, we focused on newly discovered viruses (Lake Sinai viruses, bee macula-like virus), or a so far neglected virus species (Apis mellifera filamentous virus), and cutting edge technologies (mass spectrometry, RNAi approach) applied in the field.

  17. Chlorella viruses isolated in China

    SciTech Connect

    Zhang, Y.; Burbank, D.E.; Van Etten, J.L. )


    Plaque-forming viruses of the unicellular, eukaryotic, exsymbiotic, Chlorella-like green algae strain NC64A, which are common in the United States, were also present in fresh water collected in the People's Republic of China. Seven of the Chinese viruses were examined in detail and compared with the Chlorella viruses previously isolated in the United States. Like the American viruses, the Chinese viruses were large polyhedra and sensitive to chloroform. They contained numerous structural proteins and large double-stranded DNA genomes of at least 300 kilobase pairs. Each of the DNAs from the Chinese viruses contained 5-methyldeoxycytosine, which varied from 12.6 to 46.7% of the deoxycytosine, and N{sup 6}-methyldeoxyadenosine, which varied from 2.2 to 28.3% of the deoxyadenosine. Four of the Chinese virus DNAs hybridized extensively with {sup 32}P-labeled DNA from the American virus PBCV-1, and three hybridized poorly.

  18. Special Issue: Honey Bee Viruses

    PubMed Central

    Gisder, Sebastian; Genersch, Elke


    Pollination of flowering plants is an important ecosystem service provided by wild insect pollinators and managed honey bees. Hence, losses and declines of pollinating insect species threaten human food security and are of major concern not only for apiculture or agriculture but for human society in general. Honey bee colony losses and bumblebee declines have attracted intensive research interest over the last decade and although the problem is far from being solved we now know that viruses are among the key players of many of these bee losses and bumblebee declines. With this special issue on bee viruses we, therefore, aimed to collect high quality original papers reflecting the current state of bee virus research. To this end, we focused on newly discovered viruses (Lake Sinai viruses, bee macula-like virus), or a so far neglected virus species (Apis mellifera filamentous virus), and cutting edge technologies (mass spectrometry, RNAi approach) applied in the field. PMID:26702462

  19. Testing for Human Immunodeficiency Virus


    ... incisions made in the mother’s abdomen and uterus. Human Immunodeficiency Virus (HIV): A virus that attacks certain cells of the body’s immune system and causes acquired immunodeficiency syndrome (AIDS). Immune System: ...

  20. Emerging issues in virus taxonomy.


    van Regenmortel, Marc H V; Mahy, Brian W J


    Viruses occupy a unique position in biology. Although they possess some of the properties of living systems such as having a genome, they are actually nonliving infectious entities and should not be considered microorganisms. A clear distinction should be drawn between the terms virus, virion, and virus species. Species is the most fundamental taxonomic category used in all biological classification. In 1991, the International Committee on Taxonomy of Viruses (ICTV) decided that the category of virus species should be used in virus classification together with the categories of genus and family. More than 50 ICTV study groups were given the task of demarcating the 1,550 viral species that were recognized in the 7th ICTV report, which was published in 2000. We briefly describe the changes in virus classification that were introduced in that report. We also discuss recent proposals to introduce a nonlatinized binomial nomenclature for virus species. PMID:15078590

  1. Special Issue: Honey Bee Viruses.


    Gisder, Sebastian; Genersch, Elke


    Pollination of flowering plants is an important ecosystem service provided by wild insect pollinators and managed honey bees. Hence, losses and declines of pollinating insect species threaten human food security and are of major concern not only for apiculture or agriculture but for human society in general. Honey bee colony losses and bumblebee declines have attracted intensive research interest over the last decade and although the problem is far from being solved we now know that viruses are among the key players of many of these bee losses and bumblebee declines. With this special issue on bee viruses we, therefore, aimed to collect high quality original papers reflecting the current state of bee virus research. To this end, we focused on newly discovered viruses (Lake Sinai viruses, bee macula-like virus), or a so far neglected virus species (Apis mellifera filamentous virus), and cutting edge technologies (mass spectrometry, RNAi approach) applied in the field. PMID:26702462

  2. Ebola (Ebola Virus Disease): Prevention


    ... Search The CDC Cancel Submit Search The CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is ... message, please visit this page: About . Ebola (Ebola Virus Disease) About Ebola Questions & Answers 2014 ...

  3. Ebola (Ebola Virus Disease): Transmission


    ... Search The CDC Cancel Submit Search The CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is ... message, please visit this page: About . Ebola (Ebola Virus Disease) About Ebola Questions & Answers 2014 ...

  4. Ebola (Ebola Virus Disease): Treatment


    ... Search The CDC Cancel Submit Search The CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is ... message, please visit this page: About . Ebola (Ebola Virus Disease) About Ebola Questions & Answers 2014 ...

  5. Ebola (Ebola Virus Disease): Diagnosis


    ... Search The CDC Cancel Submit Search The CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is ... message, please visit this page: About . Ebola (Ebola Virus Disease) About Ebola Questions & Answers 2014 ...

  6. Production of virus resistant plants


    Dougherty, W.G.; Lindbo, J.A.


    A method of suppressing virus gene expression in plants using untranslatable plus sense RNA is disclosed. The method is useful for the production of plants that are resistant to virus infection. 9 figs.

  7. Zika Virus Infection and Microcephaly.


    Millichap, J Gordon


    A Task Force established by the Brazil Ministry of Health investigated the possible association of microcephaly with Zika virus infection during pregnancy and a registry for microcephaly cases among women suspected to have had Zika virus infection during pregnancy.

  8. Chlorella viruses isolated in China.

    PubMed Central

    Zhang, Y P; Burbank, D E; Van Etten, J L


    Plaque-forming viruses of the unicellular, eucaryotic, exsymbiotic, Chlorella-like green algae strain NC64A, which are common in the United States, were also present in fresh water collected in the People's Republic of China. Seven of the Chinese viruses were examined in detail and compared with the Chlorella viruses previously isolated in the United States. Like the American viruses, the Chinese viruses were large polyhedra and sensitive to chloroform. They contained numerous structural proteins and large double-stranded DNA genomes of at least 300 kilobase pairs. Each of the DNAs from the Chinese viruses contained 5-methyldeoxycytosine, which varied from 12.6 to 46.7% of the deoxycytosine, and N6-methyldeoxyadenosine, which varied from 2.2 to 28.3% of the deoxyadenosine. Four of the Chinese virus DNAs hybridized extensively with DNA from the American virus PBCV-1, and three hybridized poorly. Images PMID:2847652

  9. 9 CFR 113.215 - Bovine Virus Diarrhea Vaccine, Killed Virus.

    Code of Federal Regulations, 2012 CFR


    ... 9 Animals and Animal Products 1 2012-01-01 2012-01-01 false Bovine Virus Diarrhea Vaccine, Killed... REQUIREMENTS Killed Virus Vaccines § 113.215 Bovine Virus Diarrhea Vaccine, Killed Virus. Bovine Virus Diarrhea Vaccine, Killed Virus, shall be prepared from virus-bearing cell culture fluids. Only Master Seed...

  10. 9 CFR 113.215 - Bovine Virus Diarrhea Vaccine, Killed Virus.

    Code of Federal Regulations, 2011 CFR


    ... 9 Animals and Animal Products 1 2011-01-01 2011-01-01 false Bovine Virus Diarrhea Vaccine, Killed... REQUIREMENTS Killed Virus Vaccines § 113.215 Bovine Virus Diarrhea Vaccine, Killed Virus. Bovine Virus Diarrhea Vaccine, Killed Virus, shall be prepared from virus-bearing cell culture fluids. Only Master Seed...

  11. 9 CFR 113.215 - Bovine Virus Diarrhea Vaccine, Killed Virus.

    Code of Federal Regulations, 2014 CFR


    ... 9 Animals and Animal Products 1 2014-01-01 2014-01-01 false Bovine Virus Diarrhea Vaccine, Killed... REQUIREMENTS Killed Virus Vaccines § 113.215 Bovine Virus Diarrhea Vaccine, Killed Virus. Bovine Virus Diarrhea Vaccine, Killed Virus, shall be prepared from virus-bearing cell culture fluids. Only Master Seed...

  12. 9 CFR 113.215 - Bovine Virus Diarrhea Vaccine, Killed Virus.

    Code of Federal Regulations, 2013 CFR


    ... 9 Animals and Animal Products 1 2013-01-01 2013-01-01 false Bovine Virus Diarrhea Vaccine, Killed... REQUIREMENTS Killed Virus Vaccines § 113.215 Bovine Virus Diarrhea Vaccine, Killed Virus. Bovine Virus Diarrhea Vaccine, Killed Virus, shall be prepared from virus-bearing cell culture fluids. Only Master Seed...

  13. RNA-Seq reveals virus-virus and virus-plant interactions in nature.


    Kamitani, Mari; Nagano, Atsushi J; Honjo, Mie N; Kudoh, Hiroshi


    As research on plant viruses has focused mainly on crop diseases, little is known about these viruses in natural environments. To understand the ecology of viruses in natural systems, comprehensive information on virus-virus and virus-host interactions is required. We applied RNA-Seq to plants from a natural population of Arabidopsis halleri subsp. gemmifera to simultaneously determine the presence/absence of all sequence-reported viruses, identify novel viruses and quantify the host transcriptome. By introducing the criteria of read number and genome coverage, we detected infections by Turnip mosaic virus (TuMV), Cucumber mosaic virus and Brassica yellows virus Active TuMV replication was observed by ultramicroscopy. De novo assembly further identified a novel partitivirus, Arabidopsis halleri partitivirus 1 Interestingly, virus reads reached a maximum level that was equivalent to that of the host's total mRNA, although asymptomatic infection was common. AhgAGO2, a key gene in host defence systems, was upregulated in TuMV-infected plants. Multiple infection was frequent in TuMV-infected leaves, suggesting that TuMV facilitates multiple infection, probably by suppressing host RNA silencing. Revealing hidden plant-virus interactions in nature can enhance our understanding of biological interactions and may have agricultural applications. PMID:27549115

  14. Deformed wing virus.


    de Miranda, Joachim R; Genersch, Elke


    Deformed wing virus (DWV; Iflaviridae) is one of many viruses infecting honeybees and one of the most heavily investigated due to its close association with honeybee colony collapse induced by Varroadestructor. In the absence of V.destructor DWV infection does not result in visible symptoms or any apparent negative impact on host fitness. However, for reasons that are still not fully understood, the transmission of DWV by V.destructor to the developing pupae causes clinical symptoms, including pupal death and adult bees emerging with deformed wings, a bloated, shortened abdomen and discolouration. These bees are not viable and die soon after emergence. In this review we will summarize the historical and recent data on DWV and its relatives, covering the genetics, pathobiology, and transmission of this important viral honeybee pathogen, and discuss these within the wider theoretical concepts relating to the genetic variability and population structure of RNA viruses, the evolution of virulence and the development of disease symptoms.

  15. Oncolytic viruses: finally delivering

    PubMed Central

    Seymour, Leonard W; Fisher, Kerry D


    Oncolytic viruses can be found at the confluence of virology, genetic engineering and pharmacology where versatile platforms for molecularly targeted anticancer agents can be designed and optimised. Oncolytic viruses offer several important advantages over traditional approaches, including the following. (1) Amplification of the active agent (infectious virus particles) within the tumour. This avoids unnecessary exposure to normal tissues experienced during delivery of traditional stoichiometric chemotherapy and maximises the therapeutic index. (2) The active cell-killing mechanisms, often independent of programmed death mechanisms, should decrease the emergence of acquired drug resistance. (3) Lytic death of cancer cells provides a pro-inflammatory microenvironment and the potential for induction of an anticancer vaccine response. (4) Tumour-selective expression and secretion of encoded anticancer biologics, providing a new realm of potent and cost-effective-targeted therapeutics. PMID:26766734

  16. Viruses and Asthma

    PubMed Central

    Dulek, Daniel E.; Peebles, R. Stokes


    Background Viral respiratory infection has long been known to influence the occurrence of asthma exacerbations. Over the last twenty years much effort has been put into clarifying the role that viral respiratory infections play in the eventual development of asthma. Scope of Review In this review we give a general background of the role of viruses in the processes of asthma exacerbation and asthma induction. We review recent additions to the literature in the last three years with particular focus on clinical and epidemiologic investigations of influenza, rhinovirus, bocavirus, respiratory syncytial virus, and metapneumovirus. Major Conclusions The development of asthma emerges from a complex interaction of genetic predisposition and environmental factors with viral infection likely playing a significant role in the effect of environment on asthma inception. General Significance Further understanding of the role that viruses play in asthma exacerbation and inception will contribute to decreased asthma morbidity in the future. PMID:21291960

  17. Hendra virus and Nipah virus animal vaccines.


    Broder, Christopher C; Weir, Dawn L; Reid, Peter A


    Hendra virus (HeV) and Nipah virus (NiV) are zoonotic viruses that emerged in the mid to late 1990s causing disease outbreaks in livestock and people. HeV appeared in Queensland, Australia in 1994 causing a severe respiratory disease in horses along with a human case fatality. NiV emerged a few years later in Malaysia and Singapore in 1998-1999 causing a large outbreak of encephalitis with high mortality in people and also respiratory disease in pigs which served as amplifying hosts. The key pathological elements of HeV and NiV infection in several species of mammals, and also in people, are a severe systemic and often fatal neurologic and/or respiratory disease. In people, both HeV and NiV are also capable of causing relapsed encephalitis following recovery from an acute infection. The known reservoir hosts of HeV and NiV are several species of pteropid fruit bats. Spillovers of HeV into horses continue to occur in Australia and NiV has caused outbreaks in people in Bangladesh and India nearly annually since 2001, making HeV and NiV important transboundary biological threats. NiV in particular possesses several features that underscore its potential as a pandemic threat, including its ability to infect humans directly from natural reservoirs or indirectly from other susceptible animals, along with a capacity of limited human-to-human transmission. Several HeV and NiV animal challenge models have been developed which have facilitated an understanding of pathogenesis and allowed for the successful development of both active and passive immunization countermeasures.

  18. Hendra virus and Nipah virus animal vaccines.


    Broder, Christopher C; Weir, Dawn L; Reid, Peter A


    Hendra virus (HeV) and Nipah virus (NiV) are zoonotic viruses that emerged in the mid to late 1990s causing disease outbreaks in livestock and people. HeV appeared in Queensland, Australia in 1994 causing a severe respiratory disease in horses along with a human case fatality. NiV emerged a few years later in Malaysia and Singapore in 1998-1999 causing a large outbreak of encephalitis with high mortality in people and also respiratory disease in pigs which served as amplifying hosts. The key pathological elements of HeV and NiV infection in several species of mammals, and also in people, are a severe systemic and often fatal neurologic and/or respiratory disease. In people, both HeV and NiV are also capable of causing relapsed encephalitis following recovery from an acute infection. The known reservoir hosts of HeV and NiV are several species of pteropid fruit bats. Spillovers of HeV into horses continue to occur in Australia and NiV has caused outbreaks in people in Bangladesh and India nearly annually since 2001, making HeV and NiV important transboundary biological threats. NiV in particular possesses several features that underscore its potential as a pandemic threat, including its ability to infect humans directly from natural reservoirs or indirectly from other susceptible animals, along with a capacity of limited human-to-human transmission. Several HeV and NiV animal challenge models have been developed which have facilitated an understanding of pathogenesis and allowed for the successful development of both active and passive immunization countermeasures. PMID:27154393

  19. Protecting Your Computer from Viruses

    ERIC Educational Resources Information Center

    Descy, Don E.


    A computer virus is defined as a software program capable of reproducing itself and usually capable of causing great harm to files or other programs on the same computer. The existence of computer viruses--or the necessity of avoiding viruses--is part of using a computer. With the advent of the Internet, the door was opened wide for these…

  20. Avian influenza virus RNA extraction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The efficient extraction and purification of viral RNA is critical for down-stream molecular applications whether it is the sensitive and specific detection of virus in clinical samples, virus gene cloning and expression, or quantification of avian influenza (AI) virus by molecular methods from expe...

  1. Ipomoviruses: Squash vein yellowing virus, Cucumber vein yellowing virus, Cassava brown streak virus, and Ugandan cassava brown streak virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ipomoviruses including Squash vein yellowing virus, Cucumber vein yellowing virus and Cassava brown streak virus are currently causing significant economic impact on crop production in several regions of the world. Only recently have results of detailed characterization of their whitefly transmissi...

  2. Computer Bytes, Viruses and Vaccines.

    ERIC Educational Resources Information Center

    Palmore, Teddy B.


    Presents a history of computer viruses, explains various types of viruses and how they affect software or computer operating systems, and describes examples of specific viruses. Available vaccines are explained, and precautions for protecting programs and disks are given. (nine references) (LRW)

  3. An introduction to computer viruses

    SciTech Connect

    Brown, D.R.


    This report on computer viruses is based upon a thesis written for the Master of Science degree in Computer Science from the University of Tennessee in December 1989 by David R. Brown. This thesis is entitled An Analysis of Computer Virus Construction, Proliferation, and Control and is available through the University of Tennessee Library. This paper contains an overview of the computer virus arena that can help the reader to evaluate the threat that computer viruses pose. The extent of this threat can only be determined by evaluating many different factors. These factors include the relative ease with which a computer virus can be written, the motivation involved in writing a computer virus, the damage and overhead incurred by infected systems, and the legal implications of computer viruses, among others. Based upon the research, the development of a computer virus seems to require more persistence than technical expertise. This is a frightening proclamation to the computing community. The education of computer professionals to the dangers that viruses pose to the welfare of the computing industry as a whole is stressed as a means of inhibiting the current proliferation of computer virus programs. Recommendations are made to assist computer users in preventing infection by computer viruses. These recommendations support solid general computer security practices as a means of combating computer viruses.

  4. Ecology of prokaryotic viruses.


    Weinbauer, Markus G


    The finding that total viral abundance is higher than total prokaryotic abundance and that a significant fraction of the prokaryotic community is infected with phages in aquatic systems has stimulated research on the ecology of prokaryotic viruses and their role in ecosystems. This review treats the ecology of prokaryotic viruses ('phages') in marine, freshwater and soil systems from a 'virus point of view'. The abundance of viruses varies strongly in different environments and is related to bacterial abundance or activity suggesting that the majority of the viruses found in the environment are typically phages. Data on phage diversity are sparse but indicate that phages are extremely diverse in natural systems. Lytic phages are predators of prokaryotes, whereas lysogenic and chronic infections represent a parasitic interaction. Some forms of lysogeny might be described best as mutualism. The little existing ecological data on phage populations indicate a large variety of environmental niches and survival strategies. The host cell is the main resource for phages and the resource quality, i.e., the metabolic state of the host cell, is a critical factor in all steps of the phage life cycle. Virus-induced mortality of prokaryotes varies strongly on a temporal and spatial scale and shows that phages can be important predators of bacterioplankton. This mortality and the release of cell lysis products into the environment can strongly influence microbial food web processes and biogeochemical cycles. Phages can also affect host diversity, e.g., by 'killing the winner' and keeping in check competitively dominant species or populations. Moreover, they mediate gene transfer between prokaryotes, but this remains largely unknown in the environment. Genomics or proteomics are providing us now with powerful tools in phage ecology, but final testing will have to be performed in the environment. PMID:15109783

  5. Ecology of prokaryotic viruses.


    Weinbauer, Markus G


    The finding that total viral abundance is higher than total prokaryotic abundance and that a significant fraction of the prokaryotic community is infected with phages in aquatic systems has stimulated research on the ecology of prokaryotic viruses and their role in ecosystems. This review treats the ecology of prokaryotic viruses ('phages') in marine, freshwater and soil systems from a 'virus point of view'. The abundance of viruses varies strongly in different environments and is related to bacterial abundance or activity suggesting that the majority of the viruses found in the environment are typically phages. Data on phage diversity are sparse but indicate that phages are extremely diverse in natural systems. Lytic phages are predators of prokaryotes, whereas lysogenic and chronic infections represent a parasitic interaction. Some forms of lysogeny might be described best as mutualism. The little existing ecological data on phage populations indicate a large variety of environmental niches and survival strategies. The host cell is the main resource for phages and the resource quality, i.e., the metabolic state of the host cell, is a critical factor in all steps of the phage life cycle. Virus-induced mortality of prokaryotes varies strongly on a temporal and spatial scale and shows that phages can be important predators of bacterioplankton. This mortality and the release of cell lysis products into the environment can strongly influence microbial food web processes and biogeochemical cycles. Phages can also affect host diversity, e.g., by 'killing the winner' and keeping in check competitively dominant species or populations. Moreover, they mediate gene transfer between prokaryotes, but this remains largely unknown in the environment. Genomics or proteomics are providing us now with powerful tools in phage ecology, but final testing will have to be performed in the environment.

  6. Bagaza virus and Israel turkey meningoencephalomyelitis virus are a single virus species.


    Fernández-Pinero, Jovita; Davidson, Irit; Elizalde, Maia; Perk, Shimon; Khinich, Yevgeny; Jiménez-Clavero, Miguel Angel


    Bagaza virus (BAGV) and Israel turkey meningoencephalomyelitis virus (ITV) are classified in the genus Flavivirus of the family Flaviviridae. Serologically, they are closely related, belonging to the Ntaya serocomplex. Nucleotide sequences available to date consist of several complete sequences of BAGV isolates, but only partial sequences of ITV isolates. Sequence comparisons of partial envelope (E) and NS5 regions reveal a close genetic relationship between these viruses. Despite this, BAGV and ITV are considered as separate virus species in the database of the International Committee on Taxonomy of Viruses. In this work, complete nucleotide sequences for five ITV isolates are provided, thereby permitting a phylogenetic comparison with other complete sequences of flaviviruses in the Ntaya serogroup. We conclude that BAGV and ITV are the same virus species and propose that both viruses be designated by a new unified name: Avian meningoencephalomyelitis virus.



    Velev, V


    This review summarizes the knowledge of the scientific community for Zika-virus infection. It became popular because of severe congenital damage causes of CNS in newborns whose mothers are infected during pregnancy, as well as the risk of pandemic distribution. Discusses the peculiarities of the biology and ecology of vectors--blood-sucking mosquitoes Aedes; stages in the spread of infection and practical problems which caused during pregnancy. Attention is paid to the recommendations that allow leading national and international medical organizations to deal with the threat Zika-virus infection. PMID:27509655

  8. Zika virus: Indian perspectives.


    Mourya, Devendra T; Shil, Pratip; Sapkal, Gajanan N; Yadav, Pragya D


    The emergence of Zika virus (ZiV), a mosquito borne Flavivirus like dengue (DEN) and chikungunya (CHIK), in Brazil in 2014 and its spread to various countries have led to a global health emergency. Aedes aegypti is the major vector for ZiV. Fast dissemination of this virus in different geographical areas posses a major threat especially to regions where the population lacks herd immunity against the ZiV and there is abundance of Aedes mosquitoes. In this review, we focus on current global scenario, epidemiology, biology, diagnostic challenges and remedial measures for ZiVconsidering the Indian perspective.

  9. Zika Virus Outside Africa

    PubMed Central


    Zika virus (ZIKV) is a flavivirus related to yellow fever, dengue, West Nile, and Japanese encephalitis viruses. In 2007 ZIKV caused an outbreak of relatively mild disease characterized by rash, arthralgia, and conjunctivitis on Yap Island in the southwestern Pacific Ocean. This was the first time that ZIKV was detected outside of Africa and Asia. The history, transmission dynamics, virology, and clinical manifestations of ZIKV disease are discussed, along with the possibility for diagnostic confusion between ZIKV illness and dengue.The emergence of ZIKV outside of its previously known geographic range should prompt awareness of the potential for ZIKV to spread to other Pacific islands and the Americas. PMID:19788800

  10. Genome packaging in viruses.


    Sun, Siyang; Rao, Venigalla B; Rossmann, Michael G


    Genome packaging is a fundamental process in a viral life cycle. Many viruses assemble preformed capsids into which the genomic material is subsequently packaged. These viruses use a packaging motor protein that is driven by the hydrolysis of ATP to condense the nucleic acids into a confined space. How these motor proteins package viral genomes had been poorly understood until recently, when a few X-ray crystal structures and cryo-electron microscopy (cryo-EM) structures became available. Here we discuss various aspects of genome packaging and compare the mechanisms proposed for packaging motors on the basis of structural information. PMID:20060706



    Velev, V


    This review summarizes the knowledge of the scientific community for Zika-virus infection. It became popular because of severe congenital damage causes of CNS in newborns whose mothers are infected during pregnancy, as well as the risk of pandemic distribution. Discusses the peculiarities of the biology and ecology of vectors--blood-sucking mosquitoes Aedes; stages in the spread of infection and practical problems which caused during pregnancy. Attention is paid to the recommendations that allow leading national and international medical organizations to deal with the threat Zika-virus infection.

  12. Virus diseases of fish

    USGS Publications Warehouse

    Watson, Stanley W.


    The degenerative or non-neoplastic diseases of possible virus origin give the fish-culturist the most concern because of the severe mortalities resulting from infection. Epizootics of this nature have been reported in carp (Cyprinus carpio) and rainbow trout (Salmo gairdneri) in Europe, in acara (Geophagus brasiliensis) in South America, in kokanee, (Oncorhynchus nerka kennerlyi) and in sockeye salmon (Oncorhynchus nerka nerka) in the State of Washington. It has been demonstrated that each epizootic was caused by an infectious filterable agent, probably a virus.

  13. Schmallenberg virus infection.


    Wernike, K; Elbers, A; Beer, M


    Since Schmallenberg virus, an orthobunyavirus of the Simbu serogroup, was identified near the German-Dutch border for the first time in late 2011 it has spread extremely quickly and caused a large epidemic in European livestock. The virus, which is transmitted by Culicoides biting midges, infects domestic and wild ruminants. Adult animals show only mild clinical symptoms or none at all, whereas an infection during a critical period of gestation can lead to abortion, stillbirth or the birth of severely malformed offspring. The impact of the disease is usually greater in sheep than in cattle. Vaccination could be an important aspect of disease control. PMID:26601441

  14. Zika virus outside Africa.


    Hayes, Edward B


    Zika virus (ZIKV) is a flavivirus related to yellow fever, dengue, West Nile, and Japanese encephalitis viruses. In 2007 ZIKV caused an outbreak of relatively mild disease characterized by rash, arthralgia, and conjunctivitis on Yap Island in the southwestern Pacific Ocean. This was the first time that ZIKV was detected outside of Africa and Asia. The history, transmission dynamics, virology, and clinical manifestations of ZIKV disease are discussed, along with the possibility for diagnostic confusion between ZIKV illness and dengue.The emergence of ZIKV outside of its previously known geographic range should prompt awareness of the potential for ZIKV to spread to other Pacific islands and the Americas.

  15. Viruses and viral proteins

    PubMed Central

    Verdaguer, Nuria; Ferrero, Diego; Murthy, Mathur R. N.


    For more than 30 years X-ray crystallography has been by far the most powerful approach for determining the structures of viruses and viral proteins at atomic resolution. The information provided by these structures, which covers many important aspects of the viral life cycle such as cell-receptor recognition, viral entry, nucleic acid transfer and genome replication, has extensively enriched our vision of the virus world. Many of the structures available correspond to potential targets for antiviral drugs against important human pathogens. This article provides an overview of the current knowledge of different structural aspects of the above-mentioned processes. PMID:25485129

  16. Zika virus: Indian perspectives

    PubMed Central

    Mourya, Devendra T.; Shil, Pratip; Sapkal, Gajanan N.; Yadav, Pragya D.


    The emergence of Zika virus (ZiV), a mosquito borne Flavivirus like dengue (DEN) and chikungunya (CHIK), in Brazil in 2014 and its spread to various countries have led to a global health emergency. Aedes aegypti is the major vector for ZiV. Fast dissemination of this virus in different geographical areas posses a major threat especially to regions where the population lacks herd immunity against the ZiV and there is abundance of Aedes mosquitoes. In this review, we focus on current global scenario, epidemiology, biology, diagnostic challenges and remedial measures for ZiVconsidering the Indian perspective. PMID:27487998

  17. Human Immunodeficiency Virus Prevention.


    Davis, Teaniese Latham; DiClemente, Ralph


    Human immunodeficiency virus (HIV) is the virus that causes AIDS. Surveillance data from 2012 indicate an estimated 1.2 million people aged 13 years and older were living with HIV infection in the United States, and 12.8% do not know their status. There are approximately 50,000 new HIV infections annually. With no available cure for HIV, primary prevention to reduce incident cases of HIV is essential. Strategies to prevent HIV transmission include reducing sexual risk behavior and needle sharing. The Centers for Disease Control and Prevention has multiple resources available for primary and secondary prevention to reduce disease transmission and severity. PMID:26980130

  18. Zika virus: Indian perspectives.


    Mourya, Devendra T; Shil, Pratip; Sapkal, Gajanan N; Yadav, Pragya D


    The emergence of Zika virus (ZiV), a mosquito borne Flavivirus like dengue (DEN) and chikungunya (CHIK), in Brazil in 2014 and its spread to various countries have led to a global health emergency. Aedes aegypti is the major vector for ZiV. Fast dissemination of this virus in different geographical areas posses a major threat especially to regions where the population lacks herd immunity against the ZiV and there is abundance of Aedes mosquitoes. In this review, we focus on current global scenario, epidemiology, biology, diagnostic challenges and remedial measures for ZiVconsidering the Indian perspective. PMID:27487998

  19. Research on computer virus database management system

    NASA Astrophysics Data System (ADS)

    Qi, Guoquan


    The growing proliferation of computer viruses becomes the lethal threat and research focus of the security of network information. While new virus is emerging, the number of viruses is growing, virus classification increasing complex. Virus naming because of agencies' capture time differences can not be unified. Although each agency has its own virus database, the communication between each other lacks, or virus information is incomplete, or a small number of sample information. This paper introduces the current construction status of the virus database at home and abroad, analyzes how to standardize and complete description of virus characteristics, and then gives the information integrity, storage security and manageable computer virus database design scheme.

  20. A tale of two tails: exploring stellar populations in the tidal tails of NGC 3256

    NASA Astrophysics Data System (ADS)

    Rodruck, Michael; Konstantopoulos, Iraklis; Knierman, Karen; Fedotov, Konstantin; Mullan, Brendan; Gallagher, Sarah; Durrell, Patrick; Ciardullo, Robin; Gronwall, Caryl; Charlton, Jane


    We have developed an observing programme using deep, multiband imaging to probe the chaotic regions of tidal tails in search of an underlying stellar population, using NGC 3256's 400 Myr twin tidal tails as a case study. These tails have different colours of u - g = 1.05 ± 0.07 and r - i = 0.13 ± 0.07 for NGC 3256W, and u - g = 1.26 ± 0.07 and r - i = 0.26 ± 0.07 for NGC 3256E, indicating different stellar populations. These colours correspond to simple stellar population ages of 288^{+11}_{-54} and 841^{+125}_{-157} Myr for NGC 3256W and NGC 3256E, respectively, suggesting that NGC 3256W's diffuse light is dominated by stars formed after the interaction, while light in NGC 3256E is primarily from stars that originated in the host galaxy. Using a mixed stellar population model, we break our diffuse light into two populations: one at 10 Gyr, representing stars pulled from the host galaxies, and a younger component, whose age is determined by fitting the model to the data. We find similar ages for the young populations of both tails (195^{-13}_{+0} and 170^{-70}_{+44} Myr for NGC 3256W and NGC 3256E, respectively), but a larger percentage of mass in the 10 Gyr population for NGC 3256E (98^{+1}_{-3} per cent versus 90^{+5}_{-6} per cent). Additionally, we detect 31 star cluster candidates in NGC 3256W and 19 in NGC 2356E, with median ages of 141 and 91 Myr, respectively. NGC 3256E contains several young (<10 Myr), low-mass objects with strong nebular emission, indicating a small, recent burst of star formation.

  1. The Entropic Collapse of an Extended Polymer: A Tale of Two Tails

    NASA Astrophysics Data System (ADS)

    Bakajin, Ogica; Duke, Thomas; Austin, Robert


    The electrophoresis of long polyelectrolytes such as DNA is both a fascinating execise in polymers dynamics and is of great practical importance for fractionating polymers as a function of length or comformation. The large electric fields used in the interest of minimizing run times in gels result in the elongation of the polymers as they drape over and slide off gel fibers. This effect is particular clear in synthetic lattices consisting of ``posts''. The elongation and collapse of the polymers as they slide off posts is extremely important to understand since the classical biased reptation model used to explain the We will not consider the elongation of a gaussian coil polymer as it collides with a post, a subject which is under active numercial study by Sevick and Williams. Rather, we consider here the equally important question of the collapse time of a highly extended polymer after sliding off a post. We will assume that the entropic collapse of the polymer occurs in an obstacle free region of space, although our studies indicate that at least for the case of a synthetic array of posts that the dynamics in an array are relatively unchanged from no obstacles at all.

  2. A Tale of Two Tails: Exploring Stellar Populations in the Tidal Tails of NGC 3256

    NASA Astrophysics Data System (ADS)

    Rodruck, Michael; Charlton, Jane C.; Konstantopoulos, Iraklis


    Galaxy interactions can inject material into the intergalactic medium via violent gravitational dynamics, often visualized in tidal tails. The composition of these tails has remained a mystery, as previous studies have focused on detecting tidal features, rather than the composite material itself. We have developed an observing program using deep, multiband imaging to probe the chaotic regions of tidal tails in search for an underlying stellar population. NGC 3256's twin tidal tails serve as a case study for this new technique. Our results show color values of u - g = 1.15 and r - i = 0.08 for the Western tail, and u - g = 1.33 and r - i = 0.22 for the Eastern tail, corresponding to discrepant ages between the tails of approximately 320 Myr and 785 Myr, respectively. With the interaction age of the system measured at 400 Myr, we find the stellar light in Western tail to be dominated by disrupted star clusters formed during and after the interaction, whereas the light from the Eastern tail is dominated by a 10 Gyr population originating from the host galaxies. We fit the Eastern tail color to a Mixed Stellar Population (MSP) model comprised 94% by mass of a 10 Gyr stellar population, and 6% of a 309 Myr population. We find 52% of the bolometric flux originating from this 10 Gyr population. We also detect a blue to red color gradient in each tail, running from galactic center to tail tip. In addition to tidal tail light, we detect 29 star cluster candidates (SCCs) in the Western tail and 19 in the Eastern, with mean ages of 282 Myr and 98 Myr respectively. Interestingly, we find an excess of very blue SCCs in the Eastern tail as compared to the Western tail, marking a recent, small episode of star formation.

  3. Two Tails Are Better Than One: The Logic of "The Bell Curve."

    ERIC Educational Resources Information Center

    Connors, John B.


    Reviews controversies over intelligence and intelligence testing, focusing on impacts on Canadian society in the past century. Discusses eugenics movements and related immigration policies. Suggests that both "tails" of "The Bell Curve" (cognitive elite and underclass) are influenced by inaccurate methods, and that the middle of the curve must…

  4. The Tale of the Two Tails of the Oldish PSR J2055+2539

    NASA Astrophysics Data System (ADS)

    Marelli, Martino; Pizzocaro, Daniele; De Luca, Andrea; Gastaldello, Fabio; Caraveo, Patrizia; Saz Parkinson, Pablo


    We analyzed a deep XMM-Newton observation of the radio-quiet γ-ray PSR J2055+2539. The spectrum of the X-ray counterpart is nonthermal, with a photon index of Γ = 2.36 ± 0.14 (1σ confidence). We detected X-ray pulsations with a pulsed fraction of 25% ± 3% and a sinusoidal shape. Taking into account considerations on the γ-ray efficiency of the pulsar and on its X-ray spectrum, we can infer a pulsar distance ranging from 450 to 750 pc. We found two different nebular features associated with PSR J2055+2539 and protruding from it. The angle between the two nebular main axes is ∼162.°8 ± 0.°7. The main, brighter feature is 12‧ long and <20″ thick, characterized by an asymmetry with respect to the main axis that evolves with the distance from the pulsar, possibly forming a helical pattern. The secondary feature is 250″ × 30″. Both nebulae present an almost flat brightness profile with a sudden decrease at the end. The nebulae can be fitted by either a power-law model or a thermal bremsstrahlung model. A plausible interpretation of the brighter nebula is in terms of a collimated ballistic jet. The secondary nebula is most likely a classical synchrotron-emitting tail.

  5. Epidemiology of hemorrhagic fever viruses.


    LeDuc, J W


    Twelve distinct viruses associated with hemorrhagic fever in humans are classified among four families: Arenaviridae, which includes Lassa, Junin, and Machupo viruses; Bunyaviridae, which includes Rift Valley fever, Crimean-Congo hemorrhagic fever, and Hantaan viruses; Filoviridae, which includes Marburg and Ebola viruses; and Flaviviridae, which includes yellow fever, dengue, Kyasanur Forest disease, and Omsk viruses. Most hemorrhagic fever viruses are zoonoses, with the possible exception of the four dengue viruses, which may continually circulate among humans. Hemorrhagic fever viruses are found in both temperate and tropical habitats and generally infect both sexes and all ages, although the age and sex of those infected are frequently influenced by the possibility of occupational exposure. Transmission to humans is frequently by bite of an infected tick or mosquito or via aerosol from infected rodent hosts. Aerosol and nosocomial transmission are especially important with Lassa, Junin, Machupo, Crimean-Congo hemorrhagic fever, Marburg, and Ebola viruses. Seasonality of hemorrhagic fever among humans is influenced for the most part by the dynamics of infected arthropod or vertebrate hosts. Mammals, especially rodents, appear to be important natural hosts for many hemorrhagic fever viruses. The transmission cycle for each hemorrhagic fever virus is distinct and is dependent upon the characteristics of the primary vector species and the possibility for its contact with humans.

  6. Turnip Yellow Mosaic Virus

    NASA Technical Reports Server (NTRS)


    The bumpy exterior of the turnip yellow mosaic virus (TYMV) protein coat, or capsid, was defined in detail by Dr. Alexander McPherson of the University of California, Irvin using proteins crystallized in space for analysis on Earth. TYMV is an icosahedral virus constructed from 180 copies of the same protein arranged into 12 clusters of five proteins (pentamers), and 20 clusters of six proteins (hexamers). The final TYMV structure led to the unexpected hypothesis that the virus releases its RNA by essentially chemical-mechanical means. Most viruses have fairly flat coats, but in TYNV, the fold in each protein, called the jellyroll, is clustered at the points where the protein pentamers and hexamers join. The jellyrolls are almost standing on end, producing a bumpy surface with knobs at all of the pentamers and hexamers. At the inside surface of the pentamers is a void that is not present at the hexamers. The coating had been seen in early stuties of TYMV, but McPherson's atomic structure shows much more detail. The inside surface is strikingly, and unexpectedly, different than the outside. While the pentamers contain a central void on the inside, the hexameric units contain peptides linked to each other, forming a ring or, more accurately, rings to fill the void. Credit: Dr. Alexander McPherson, University of California, Irvine

  7. From Shakespeare to Viruses


    Sung-Hou Kim


    Berkeley Lab scientists have created a unique new tool for analyzing and comparing long sets of data, be it the genomes of mammals or viruses, or the works of Shakespeare. The results of the Shakespeare analysis surprised scholars with their accuracy

  8. Viruses of haloarchaea.


    Luk, Alison W S; Williams, Timothy J; Erdmann, Susanne; Papke, R Thane; Cavicchioli, Ricardo


    In hypersaline environments, haloarchaea (halophilic members of the Archaea) are the dominant organisms, and the viruses that infect them, haloarchaeoviruses are at least ten times more abundant. Since their discovery in 1974, described haloarchaeoviruses include head-tailed, pleomorphic, spherical and spindle-shaped morphologies, representing Myoviridae, Siphoviridae, Podoviridae, Pleolipoviridae, Sphaerolipoviridae and Fuselloviridae families. This review overviews current knowledge of haloarchaeoviruses, providing information about classification, morphotypes, macromolecules, life cycles, genetic manipulation and gene regulation, and host-virus responses. In so doing, the review incorporates knowledge from laboratory studies of isolated viruses, field-based studies of environmental samples, and both genomic and metagenomic analyses of haloarchaeoviruses. What emerges is that some haloarchaeoviruses possess unique morphological and life cycle properties, while others share features with other viruses (e.g., bacteriophages). Their interactions with hosts influence community structure and evolution of populations that exist in hypersaline environments as diverse as seawater evaporation ponds, to hot desert or Antarctic lakes. The discoveries of their wide-ranging and important roles in the ecology and evolution of hypersaline communities serves as a strong motivator for future investigations of both laboratory-model and environmental systems. PMID:25402735

  9. From Shakespeare to Viruses

    SciTech Connect

    Sung-Hou Kim


    Berkeley Lab scientists have created a unique new tool for analyzing and comparing long sets of data, be it the genomes of mammals or viruses, or the works of Shakespeare. The results of the Shakespeare analysis surprised scholars with their accuracy

  10. From Shakespeare to Viruses


    Kim, Sung-Hou


    Berkeley Lab scientists have created a unique new tool for analyzing and comparing long sets of data, be it the genomes of mammals or viruses, or the works of Shakespeare. The results of the Shakespeare analysis surprised scholars with their accuracy.

  11. Human Viruses and Cancer

    PubMed Central

    Morales-Sánchez, Abigail; Fuentes-Pananá, Ezequiel M.


    The first human tumor virus was discovered in the middle of the last century by Anthony Epstein, Bert Achong and Yvonne Barr in African pediatric patients with Burkitt’s lymphoma. To date, seven viruses -EBV, KSHV, high-risk HPV, MCPV, HBV, HCV and HTLV1- have been consistently linked to different types of human cancer, and infections are estimated to account for up to 20% of all cancer cases worldwide. Viral oncogenic mechanisms generally include: generation of genomic instability, increase in the rate of cell proliferation, resistance to apoptosis, alterations in DNA repair mechanisms and cell polarity changes, which often coexist with evasion mechanisms of the antiviral immune response. Viral agents also indirectly contribute to the development of cancer mainly through immunosuppression or chronic inflammation, but also through chronic antigenic stimulation. There is also evidence that viruses can modulate the malignant properties of an established tumor. In the present work, causation criteria for viruses and cancer will be described, as well as the viral agents that comply with these criteria in human tumors, their epidemiological and biological characteristics, the molecular mechanisms by which they induce cellular transformation and their associated cancers. PMID:25341666

  12. From Shakespeare to Viruses

    SciTech Connect

    Kim, Sung-Hou


    Berkeley Lab scientists have created a unique new tool for analyzing and comparing long sets of data, be it the genomes of mammals or viruses, or the works of Shakespeare. The results of the Shakespeare analysis surprised scholars with their accuracy.

  13. Cold Facts about Viruses.

    ERIC Educational Resources Information Center

    Pea, Celeste; Sterling, Donna R.


    Provides ways for students to demonstrate their understanding of scientific concepts and skills. Describes a mini-unit around the cold in which students can relate humans to viruses. Includes activities and a modified simulation that provides questions to guide students. Discusses ways that allows students to apply prior knowledge, take ownership…

  14. Viruses of Haloarchaea

    PubMed Central

    Luk, Alison W. S.; Williams, Timothy J.; Erdmann, Susanne; Papke, R. Thane; Cavicchioli, Ricardo


    In hypersaline environments, haloarchaea (halophilic members of the Archaea) are the dominant organisms, and the viruses that infect them, haloarchaeoviruses are at least ten times more abundant. Since their discovery in 1974, described haloarchaeoviruses include head-tailed, pleomorphic, spherical and spindle-shaped morphologies, representing Myoviridae, Siphoviridae, Podoviridae, Pleolipoviridae, Sphaerolipoviridae and Fuselloviridae families. This review overviews current knowledge of haloarchaeoviruses, providing information about classification, morphotypes, macromolecules, life cycles, genetic manipulation and gene regulation, and host-virus responses. In so doing, the review incorporates knowledge from laboratory studies of isolated viruses, field-based studies of environmental samples, and both genomic and metagenomic analyses of haloarchaeoviruses. What emerges is that some haloarchaeoviruses possess unique morphological and life cycle properties, while others share features with other viruses (e.g., bacteriophages). Their interactions with hosts influence community structure and evolution of populations that exist in hypersaline environments as diverse as seawater evaporation ponds, to hot desert or Antarctic lakes. The discoveries of their wide-ranging and important roles in the ecology and evolution of hypersaline communities serves as a strong motivator for future investigations of both laboratory-model and environmental systems. PMID:25402735

  15. Satellite RNAs and Satellite Viruses.


    Palukaitis, Peter


    Satellite RNAs and satellite viruses are extraviral components that can affect either the pathogenicity, the accumulation, or both of their associated viruses while themselves being dependent on the associated viruses as helper viruses for their infection. Most of these satellite RNAs are noncoding RNAs, and in many cases, have been shown to alter the interaction of their helper viruses with their hosts. In only a few cases have the functions of these satellite RNAs in such interactions been studied in detail. In particular, work on the satellite RNAs of Cucumber mosaic virus and Turnip crinkle virus have provided novel insights into RNAs functioning as noncoding RNAs. These effects are described and potential roles for satellite RNAs in the processes involved in symptom intensification or attenuation are discussed. In most cases, models describing these roles involve some aspect of RNA silencing or its suppression, either directly or indirectly involving the particular satellite RNA.

  16. Bat flight and zoonotic viruses

    USGS Publications Warehouse

    O'Shea, Thomas; Cryan, Paul M.; Cunningham, Andrew A.; Fooks, Anthony R.; Hayman, David T.S.; Luis, Angela D.; Peel, Alison J.; Plowright, Raina K.; Wood, James L.N.


    Bats are sources of high viral diversity and high-profile zoonotic viruses worldwide. Although apparently not pathogenic in their reservoir hosts, some viruses from bats severely affect other mammals, including humans. Examples include severe acute respiratory syndrome coronaviruses, Ebola and Marburg viruses, and Nipah and Hendra viruses. Factors underlying high viral diversity in bats are the subject of speculation. We hypothesize that flight, a factor common to all bats but to no other mammals, provides an intensive selective force for coexistence with viral parasites through a daily cycle that elevates metabolism and body temperature analogous to the febrile response in other mammals. On an evolutionary scale, this host–virus interaction might have resulted in the large diversity of zoonotic viruses in bats, possibly through bat viruses adapting to be more tolerant of the fever response and less virulent to their natural hosts.

  17. Bat flight and zoonotic viruses.


    O'Shea, Thomas J; Cryan, Paul M; Cunningham, Andrew A; Fooks, Anthony R; Hayman, David T S; Luis, Angela D; Peel, Alison J; Plowright, Raina K; Wood, James L N


    Bats are sources of high viral diversity and high-profile zoonotic viruses worldwide. Although apparently not pathogenic in their reservoir hosts, some viruses from bats severely affect other mammals, including humans. Examples include severe acute respiratory syndrome coronaviruses, Ebola and Marburg viruses, and Nipah and Hendra viruses. Factors underlying high viral diversity in bats are the subject of speculation. We hypothesize that flight, a factor common to all bats but to no other mammals, provides an intensive selective force for coexistence with viral parasites through a daily cycle that elevates metabolism and body temperature analogous to the febrile response in other mammals. On an evolutionary scale, this host-virus interaction might have resulted in the large diversity of zoonotic viruses in bats, possibly through bat viruses adapting to be more tolerant of the fever response and less virulent to their natural hosts.

  18. A vaccinia virus renaissance

    PubMed Central

    Verardi, Paulo H.; Titong, Allison; Hagen, Caitlin J.


    In 1796, Edward Jenner introduced the concept of vaccination with cowpox virus, an Orthopoxvirus within the family Poxviridae that elicits cross protective immunity against related orthopoxviruses, including smallpox virus (variola virus). Over time, vaccinia virus (VACV) replaced cowpox virus as the smallpox vaccine, and vaccination efforts eventually led to the successful global eradication of smallpox in 1979. VACV has many characteristics that make it an excellent vaccine and that were crucial for the successful eradication of smallpox, including (1) its exceptional thermal stability (a very important but uncommon characteristic in live vaccines), (2) its ability to elicit strong humoral and cell-mediated immune responses, (3) the fact that it is easy to propagate, and (4) that it is not oncogenic, given that VACV replication occurs exclusively within the host cell cytoplasm and there is no evidence that the viral genome integrates into the host genome. Since the eradication of smallpox, VACV has experienced a renaissance of interest as a viral vector for the development of recombinant vaccines, immunotherapies, and oncolytic therapies, as well as the development of next-generation smallpox vaccines. This revival is mainly due to the successful use and extensive characterization of VACV as a vaccine during the smallpox eradication campaign, along with the ability to genetically manipulate its large dsDNA genome while retaining infectivity and immunogenicity, its wide mammalian host range, and its natural tropism for tumor cells that allows its use as an oncolytic vector. This review provides an overview of new uses of VACV that are currently being explored for the development of vaccines, immunotherapeutics, and oncolytic virotherapies. PMID:22777090

  19. Molecular epidemiology of respiratory viruses in virus-induced asthma

    PubMed Central

    Ishioka, Taisei; Noda, Masahiro; Kozawa, Kunihisa; Kimura, Hirokazu


    Acute respiratory illness (ARI) due to various viruses is not only the most common cause of upper respiratory infection in humans but is also a major cause of morbidity and mortality, leading to diseases such as bronchiolitis and pneumonia. Previous studies have shown that respiratory syncytial virus (RSV), human rhinovirus (HRV), human metapneumovirus (HMPV), human parainfluenza virus (HPIV), and human enterovirus infections may be associated with virus-induced asthma. For example, it has been suggested that HRV infection is detected in the acute exacerbation of asthma and infection is prolonged. Thus it is believed that the main etiological cause of asthma is ARI viruses. Furthermore, the number of asthma patients in most industrial countries has greatly increased, resulting in a morbidity rate of around 10-15% of the population. However, the relationships between viral infections, host immune response, and host factors in the pathophysiology of asthma remain unclear. To gain a better understanding of the epidemiology of virus-induced asthma, it is important to assess both the characteristics of the viruses and the host defense mechanisms. Molecular epidemiology enables us to understand the pathogenesis of microorganisms by identifying specific pathways, molecules, and genes that influence the risk of developing a disease. However, the epidemiology of various respiratory viruses associated with virus-induced asthma is not fully understood. Therefore, in this article, we review molecular epidemiological studies of RSV, HRV, HPIV, and HMPV infection associated with virus-induced asthma. PMID:24062735

  20. Neuroteratogenic Viruses and Lessons for Zika Virus Models.


    Kim, Kenneth; Shresta, Sujan


    The Centers for Disease Control and Prevention has confirmed that Zika virus (ZIKV) causes congenital microcephaly. ZIKV now joins five other neuroteratogenic (NT) viruses in humans and ZIKV research is in its infancy. In addition, there is only one other NT human arbovirus (Venezuelan equine encephalitis virus), which is also poorly understood. But further insight into ZIKV can be found by evaluating arboviruses in domestic animals, of which there are at least seven NT viruses, three of which have been well studied. Here we review two key anatomical structures involved in modeling transplacental NT virus transmission: the placenta and the fetal blood-brain barrier. We then survey major research findings regarding transmission of NT viruses for guidance in establishing a mouse model of Zika disease that is crucial for a better understanding of ZIKV transmission and pathogenesis. PMID:27387029

  1. Neuroteratogenic Viruses and Lessons for Zika Virus Models.


    Kim, Kenneth; Shresta, Sujan


    The Centers for Disease Control and Prevention has confirmed that Zika virus (ZIKV) causes congenital microcephaly. ZIKV now joins five other neuroteratogenic (NT) viruses in humans and ZIKV research is in its infancy. In addition, there is only one other NT human arbovirus (Venezuelan equine encephalitis virus), which is also poorly understood. But further insight into ZIKV can be found by evaluating arboviruses in domestic animals, of which there are at least seven NT viruses, three of which have been well studied. Here we review two key anatomical structures involved in modeling transplacental NT virus transmission: the placenta and the fetal blood-brain barrier. We then survey major research findings regarding transmission of NT viruses for guidance in establishing a mouse model of Zika disease that is crucial for a better understanding of ZIKV transmission and pathogenesis.

  2. Single Virus Genomics: A New Tool for Virus Discovery

    PubMed Central

    Allen, Lisa Zeigler; Ishoey, Thomas; Novotny, Mark A.; McLean, Jeffrey S.; Lasken, Roger S.; Williamson, Shannon J.


    Whole genome amplification and sequencing of single microbial cells has significantly influenced genomics and microbial ecology by facilitating direct recovery of reference genome data. However, viral genomics continues to suffer due to difficulties related to the isolation and characterization of uncultivated viruses. We report here on a new approach called ‘Single Virus Genomics’, which enabled the isolation and complete genome sequencing of the first single virus particle. A mixed assemblage comprised of two known viruses; E. coli bacteriophages lambda and T4, were sorted using flow cytometric methods and subsequently immobilized in an agarose matrix. Genome amplification was then achieved in situ via multiple displacement amplification (MDA). The complete lambda phage genome was recovered with an average depth of coverage of approximately 437X. The isolation and genome sequencing of uncultivated viruses using Single Virus Genomics approaches will enable researchers to address questions about viral diversity, evolution, adaptation and ecology that were previously unattainable. PMID:21436882

  3. Detection of sweet potato viruses in Yunnan and genetic diversity analysis of the common viruses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Two hundred seventy-nine samples with virus-like symptoms collected from 16 regions in Yunnan Province were tested by RT-PCR/PCR using virus-specific primers for 8 sweet potato viruses. Six viruses, Sweet potato chlorotic fleck virus (SPCFV), Sweet Potato feathery mottle virus (SPFMV), Sweet potato ...

  4. Discrete virus infection model of hepatitis B virus.


    Zhang, Pengfei; Min, Lequan; Pian, Jianwei


    In 1996 Nowak and his colleagues proposed a differential equation virus infection model, which has been widely applied in the study for the dynamics of hepatitis B virus (HBV) infection. Biological dynamics may be described more practically by discrete events rather than continuous ones. Using discrete systems to describe biological dynamics should be reasonable. Based on one revised Nowak et al's virus infection model, this study introduces a discrete virus infection model (DVIM). Two equilibriums of this model, E1 and E2, represents infection free and infection persistent, respectively. Similar to the case of the basic virus infection model, this study deduces a basic virus reproductive number R0 independing on the number of total cells of an infected target organ. A proposed theorem proves that if the basic virus reproductive number R0<1 then the virus free equilibrium E1 is locally stable. The DVIM is more reasonable than an abstract discrete susceptible-infected-recovered model (SIRS) whose basic virus reproductive number R0 is relevant to the number of total cells of the infected target organ. As an application, this study models the clinic HBV DNA data of a patient who was accepted via anti-HBV infection therapy with drug lamivudine. The results show that the numerical simulation is good in agreement with the clinic data.

  5. Hetdex: Virus Instrument

    NASA Astrophysics Data System (ADS)

    Lee, Hanshin; Hill, G. J.; DePoy, D. L.; Tuttle, S.; Marshall, J. L.; Vattiat, B. L.; Prochaska, T.; Chonis, T. S.; Allen, R.; HETDEX Collaboration


    The Visible Integral-field-unit Replicable Unit Spectrograph (VIRUS) instrument is made up of 150+ individually compact and identical spectrographs, each fed by a fiber integral-field unit. The instrument provides integral field spectroscopy at wavelengths between 350nm and 550nm of over 33,600 spatial elements per observation, each 1.8 sq. arcsec on the sky, at R 700. The instrument will be fed by a new wide-field corrector (WFC) of the Hobby-Eberly Telescope (HET) with increased science field of view as large as 22arcmin diameter and telescope aperture of 10m. This will enable the HETDEX, a large area blind survey of Lyman-alpha emitting galaxies at redshift z < 3.5. The status of VIRUS instrument construction is summarized.

  6. Mechanisms of Virus Assembly

    PubMed Central

    Perlmutter, Jason D.; Hagan, Michael F.


    Viruses are nanoscale entities containing a nucleic acid genome encased in a protein shell called a capsid, and in some cases surrounded by a lipid bilayer membrane. This review summarizes the physics that govern the processes by which capsids assembles within their host cells and in vitro. We describe the thermodynamics and kinetics for assembly of protein subunits into icosahedral capsid shells, and how these are modified in cases where the capsid assembles around a nucleic acid or on a lipid bilayer. We present experimental and theoretical techniques that have been used to characterize capsid assembly, and we highlight aspects of virus assembly which are likely to receive significant attention in the near future. PMID:25532951

  7. The encephalomyocarditis virus

    PubMed Central

    Carocci, Margot; Bakkali-Kassimi, Labib


    The encephalomyocarditis virus (EMCV) is a small non-enveloped single-strand RNA virus, the causative agent of not only myocarditis and encephalitis, but also neurological diseases, reproductive disorders and diabetes in many mammalian species. EMCV pathogenesis appears to be viral strain- and host-specific, and a better understanding of EMCV virulence factors is increasingly required. Indeed, EMCV is often used as a model for diabetes and viral myocarditis, and is also widely used in immunology as a double-stranded RNA stimulus in the study of Toll-like as well as cytosolic receptors. However, EMCV virulence and properties have often been neglected. Moreover, EMCV is able to infect humans albeit with a low morbidity. Progress on xenografts, such as pig heart transplantation in humans, has raised safety concerns that need to be explored. In this review we will highlight the biology of EMCV and all known and potential virulence factors. PMID:22722247

  8. Cytomegalovirus: the stealth virus.


    Robinson, Sharon


    Cytomegalovirus (CMV) is an infection, part of the herpes family of viruses which, if contracted during pregnancy, cancause devastating effects on the newborn baby. This article is written by the trustee of a volunteer-based charity, mostly run by mothers of CMV children, who are striving to raise awareness of this infection, which is more common than Down's syndrome, listeria and toxoplasmosis, and is theprimary preventable cause of childhood hearing loss.

  9. VIRUS instrument collimator assembly

    NASA Astrophysics Data System (ADS)

    Marshall, Jennifer L.; DePoy, Darren L.; Prochaska, Travis; Allen, Richard D.; Williams, Patrick; Rheault, Jean-Philippe; Li, Ting; Nagasawa, Daniel Q.; Akers, Christopher; Baker, David; Boster, Emily; Campbell, Caitlin; Cook, Erika; Elder, Alison; Gary, Alex; Glover, Joseph; James, Michael; Martin, Emily; Meador, Will; Mondrik, Nicholas; Rodriguez-Patino, Marisela; Villanueva, Steven; Hill, Gary J.; Tuttle, Sarah; Vattiat, Brian; Lee, Hanshin; Chonis, Taylor S.; Dalton, Gavin B.; Tacon, Mike


    The Visual Integral-Field Replicable Unit Spectrograph (VIRUS) instrument is a baseline array 150 identical fiber fed optical spectrographs designed to support observations for the Hobby-Eberly Telescope Dark Energy Experiment (HETDEX). The collimator subassemblies of the instrument have been assembled in a production line and are now complete. Here we review the design choices and assembly practices used to produce a suite of identical low-cost spectrographs in a timely fashion using primarily unskilled labor.

  10. Hepatitis C Virus.


    Kim, Arthur


    This issue provides a clinical overview of hepatitis C virus, focusing on transmission, prevention, screening, diagnosis, evaluation, and treatment. The content of In the Clinic is drawn from the clinical information and education resources of the American College of Physicians (ACP), including MKSAP (Medical Knowledge and Self-Assessment Program). Annals of Internal Medicine editors develop In the Clinic in collaboration with the ACP's Medical Education and Publishing divisions and with the assistance of additional science writers and physician writers. PMID:27595226

  11. Physical Studies on Pox Viruses

    PubMed Central

    McCrea, J. F.; Preiss, John W.; O'Loughlin, Jean


    Vaccinia virus was irradiated in vacuo with low-voltage electrons of restricted ranges. It was found that the pock-forming ability of the virus was not decreased after bombardment with electrons penetrating 100 A beneath the virus surface. There was very slight reduction in titer with large doses of electrons penetrating 330 A, but a sudden marked drop in infectivity occurred after exposure to electrons penetrating 500 to 700 A. Electrons of higher energies, including those capable of penetrating the virus particle completely, did not produce significant further fall in infectivity titer. It is concluded that a highly radiation-sensitive unit essential for pock formation is situated 500 to 700 A beneath the surface of the virus particle, possibly in the form of a shell. The relation of this finding to the known structure of the virus and to other radiation data on the dimensions of the infectious unit is discussed. PMID:13773839

  12. Proteorhodopsin genes in giant viruses.


    Yutin, Natalya; Koonin, Eugene V


    Viruses with large genomes encode numerous proteins that do not directly participate in virus biogenesis but rather modify key functional systems of infected cells. We report that a distinct group of giant viruses infecting unicellular eukaryotes that includes Organic Lake Phycodnaviruses and Phaeocystis globosa virus encode predicted proteorhodopsins that have not been previously detected in viruses. Search of metagenomic sequence data shows that putative viral proteorhodopsins are extremely abundant in marine environments. Phylogenetic analysis suggests that giant viruses acquired proteorhodopsins via horizontal gene transfer from proteorhodopsin-encoding protists although the actual donor(s) could not be presently identified. The pattern of conservation of the predicted functionally important amino acid residues suggests that viral proteorhodopsin homologs function as sensory rhodopsins. We hypothesize that viral rhodopsins modulate light-dependent signaling, in particular phototaxis, in infected protists.

  13. Principles of Virus Structural Organization

    PubMed Central

    Prasad, B.V. Venkataram; Schmid, Michael F


    Viruses, the molecular nanomachines infecting hosts ranging from prokaryotes to eukaryotes, come in different sizes, shapes and symmetries. Questions such as what principles govern their structural organization, what factors guide their assembly, how these viruses integrate multifarious functions into one unique structure have enamored researchers for years. In the last five decades, following Caspar and Klug's elegant conceptualization of how viruses are constructed, high resolution structural studies using X-ray crystallography and more recently cryo-EM techniques have provided a wealth of information on structures of variety of viruses. These studies have significantly furthered our understanding of the principles that underlie structural organization in viruses. Such an understanding has practical impact in providing a rational basis for the design and development of antiviral strategies. In this chapter, we review principles underlying capsid formation in a variety of viruses, emphasizing the recent developments along with some historical perspective. PMID:22297509

  14. Ebola Virus Disease

    PubMed Central

    Kourtis, Athena P.; Appelgren, Kristie; Chevalier, Michelle S.; McElroy, Anita


    Ebola virus is one of the most deadly pathogens known to infect humans. The current Ebola outbreak in West Africa is unprecedented in magnitude and duration and, as of November 30, 2014, shows no signs of abating. For the first time, cases of Ebola virus disease have been diagnosed in the US, originating from patients who traveled during the incubation period. The outbreak has generated worldwide concern. It is clear that U.S. physicians need to be aware of this disease, know when to consider Ebola and how to care for the patient as well as protect themselves. Children comprise a small percentage of all cases globally, likely because of their lower risk of exposure given social and cultural practices. Limited evidence is available on pediatric disease course and prognosis. In this article, we present an overview of the pathogen, its epidemiology and transmission, clinical and laboratory manifestations, treatment and infection control procedures, with an emphasis on what is known about Ebola virus disease in the pediatric population. PMID:25831417

  15. Detection of dengue virus.


    Tripathi, Nagesh K; Shrivastava, Ambuj; Dash, Paban K; Jana, Asha M


    Global incidence of dengue has increased considerably over the past decade. Dengue fever (DF) is a self-limiting disease; however, dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS) are fatal. Since there is no therapy and vaccine against dengue, timely diagnosis is therefore necessary for patient management. Laboratory diagnosis is carried out by virus isolation, demonstration of viral antigen, presence of viral nucleic acid, and antibodies. Further, recombinant dengue envelope protein can be used to detect specific antibodies, both IgG and IgM against all four serotypes of virus using an E. coli vector. The purified protein can then be used for detection of dengue specific IgG or IgM antibodies in patient serum with higher sensitivity and specificity, than that of traditional assays. Molecular detection can be accomplished by a one-step, single-tube, rapid, multiplex, RT-PCR for serotype determination. Despite many advantages of the modern techniques, isolation of virus is still considered as "gold-standard" in dengue diagnosis.

  16. Parainfluenza Virus Infection.


    Branche, Angela R; Falsey, Ann R


    Human parainfluenza viruses (HPIVs) are single-stranded, enveloped RNA viruses of the Paramyoviridaie family. There are four serotypes which cause respiratory illnesses in children and adults. HPIVs bind and replicate in the ciliated epithelial cells of the upper and lower respiratory tract and the extent of the infection correlates with the location involved. Seasonal HPIV epidemics result in a significant burden of disease in children and account for 40% of pediatric hospitalizations for lower respiratory tract illnesses (LRTIs) and 75% of croup cases. Parainfluenza viruses are associated with a wide spectrum of illnesses which include otitis media, pharyngitis, conjunctivitis, croup, tracheobronchitis, and pneumonia. Uncommon respiratory manifestations include apnea, bradycardia, parotitis, and respiratory distress syndrome and rarely disseminated infection. Immunity resulting from disease in childhood is incomplete and reinfection with HPIV accounts for 15% of respiratory illnesses in adults. Severe disease and fatal pneumonia may occur in elderly and immunocompromised adults. HPIV pneumonia in recipients of hematopoietic stem cell transplant (HSCT) is associated with 50% acute mortality and 75% mortality at 6 months. Though sensitive molecular diagnostics are available to rapidly diagnose HPIV infection, effective antiviral therapies are not available. Currently, treatment for HPIV infection is supportive with the exception of croup where the use of corticosteroids has been found to be beneficial. Several novel drugs including DAS181 appear promising in efforts to treat severe disease in immunocompromised patients, and vaccines to decrease the burden of disease in young children are in development. PMID:27486735

  17. Photoreactivation of a Cytoplasmic Virus

    PubMed Central

    Pfefferkorn, E. R.; Boyle, Mary K.


    Ultraviolet light-inactivated frog virus 3 is efficiently photoreactivated by chick embryo cells. A cellular enzyme is presumably responsible for this repair of viral deoxyribonucleic acid, for the phenomenon is insensitive to an inhibitor of protein synthesis and is not seen in mammalian cells that are known to lack photoreactivating enzyme. Since frog virus 3 is a cytoplasmic virus, functionally significant amounts of photoreactivating enzyme are probably present in the cytoplasm of chick embryo cells. PMID:5062749

  18. [Hemorrhagic fever viruses in Madagascar].


    Fontenille, D; Mathiot, C; Coulanges, P


    The authors remind, what are the viral haemorrhagic fevers, and explain the situation in Madagascar. The viruses of Crimée-Congo haemorrhagic fever, Rift valley fever and haemorrhagic fever with renal syndrome are present in Madagascar. There is no real proof about the presence of Dengue viruses. The yellow fever viruses have never been stown off. It seems that there was not diagnosed outbreak of haemorrhagic fever, since the beginning of our century.

  19. Viruses manipulate the marine environment.


    Rohwer, Forest; Thurber, Rebecca Vega


    Marine viruses affect Bacteria, Archaea and eukaryotic organisms and are major components of the marine food web. Most studies have focused on their role as predators and parasites, but many of the interactions between marine viruses and their hosts are much more complicated. A series of recent studies has shown that viruses have the ability to manipulate the life histories and evolution of their hosts in remarkable ways, challenging our understanding of this almost invisible world.

  20. Introducing Virological Concepts Using an Insect Virus.

    ERIC Educational Resources Information Center

    Sheppard, Roger F.


    A technique is presented which utilizes wax moth larvae in a laboratory investigation of an insect virus. Describes how an insect virus can be used to introduce undergraduate biology students to laboratory work on viruses and several virological concepts. (SA)

  1. Selecting Viruses for the Seasonal Influenza Vaccine


    ... which viruses are selected for use in vaccine production? The influenza viruses in the seasonal flu vaccine ... to get a good vaccine virus for vaccine production? There are a number of factors that can ...

  2. Variant (Swine Origin) Influenza Viruses in Humans


    ... What's this? Submit Button Past Newsletters Variant Influenza Viruses: Background and CDC Risk Assessment and Reporting Language: ... Background CDC Assessment Reporting Background On Variant Influenza Viruses Swine flu viruses do not normally infect humans. ...

  3. Dengue Virus May Bolster Zika's Attack


    ... dengue fever virus may increase the severity of Zika virus, a new study says. Early stage laboratory findings ... Services, or federal policy. More Health News on: Zika Virus Recent Health News Related MedlinePlus Health Topics Dengue ...

  4. Human Immunodeficiency Virus (HIV) Primary Infection


    ... rashes clinical tools newsletter | contact Share | Human Immunodeficiency Virus (HIV) Primary Infection Information for adults A A ... weeks following exposure to HIV (the human immunodeficiency virus). Chronic infection with this virus can cause AIDS ( ...

  5. Emergence of influenza A viruses.

    PubMed Central

    Webby, R J; Webster, R G


    Pandemic influenza in humans is a zoonotic disease caused by the transfer of influenza A viruses or virus gene segments from animal reservoirs. Influenza A viruses have been isolated from avian and mammalian hosts, although the primary reservoirs are the aquatic bird populations of the world. In the aquatic birds, influenza is asymptomatic, and the viruses are in evolutionary stasis. The aquatic bird viruses do not replicate well in humans, and these viruses need to reassort or adapt in an intermediate host before they emerge in human populations. Pigs can serve as a host for avian and human viruses and are logical candidates for the role of intermediate host. The transmission of avian H5N1 and H9N2 viruses directly to humans during the late 1990s showed that land-based poultry also can serve between aquatic birds and humans as intermediate hosts of influenza viruses. That these transmission events took place in Hong Kong and China adds further support to the hypothesis that Asia is an epicentre for influenza and stresses the importance of surveillance of pigs and live-bird markets in this area. PMID:11779380

  6. Nuclear entry of DNA viruses

    PubMed Central

    Fay, Nikta; Panté, Nelly


    DNA viruses undertake their replication within the cell nucleus, and therefore they must first deliver their genome into the nucleus of their host cells. Thus, trafficking across the nuclear envelope is at the basis of DNA virus infections. Nuclear transport of molecules with diameters up to 39 nm is a tightly regulated process that occurs through the nuclear pore complex (NPC). Due to the enormous diversity of virus size and structure, each virus has developed its own strategy for entering the nucleus of their host cells, with no two strategies alike. For example, baculoviruses target their DNA-containing capsid to the NPC and subsequently enter the nucleus intact, while the hepatitis B virus capsid crosses the NPC but disassembles at the nuclear side of the NPC. For other viruses such as herpes simplex virus and adenovirus, although both dock at the NPC, they have each developed a distinct mechanism for the subsequent delivery of their genome into the nucleus. Remarkably, other DNA viruses, such as parvoviruses and human papillomaviruses, access the nucleus through an NPC-independent mechanism. This review discusses our current understanding of the mechanisms used by DNA viruses to deliver their genome into the nucleus, and further presents the experimental evidence for such mechanisms. PMID:26029198

  7. Review: influenza virus in pigs.


    Crisci, Elisa; Mussá, Tufária; Fraile, Lorenzo; Montoya, Maria


    Influenza virus disease still remains one of the major threats to human health, involving a wide range of animal species and pigs play an important role in influenza ecology. Pigs were labeled as "mixing vessels" since they are susceptible to infection with avian, human and swine influenza viruses and genetic reassortment between these viruses can occur. After the H1N1 influenza pandemic of 2009 with a swine origin virus, the most recent research in "influenzology" is directed at improving knowledge of porcine influenza virus infection. This tendency is probably due to the fact that domestic pigs are closely related to humans and represent an excellent animal model to study various microbial infectious diseases. In spite of the role of the pig in influenza virus ecology, swine immune responses against influenza viruses are not fully understood. Considering these premises, the aim of this review is to focus on the in vitro studies performed with porcine cells and influenza virus and on the immune responses of pigs against human, avian and swine influenza viruses in vivo. The increased acceptance of pigs as suitable and valuable models in the scientific community may stimulate the development of new tools to assess porcine immune responses, paving the way for their consideration as the future "gold standard" large-animal model in immunology.

  8. RECOVIR Software for Identifying Viruses

    NASA Technical Reports Server (NTRS)

    Chakravarty, Sugoto; Fox, George E.; Zhu, Dianhui


    Most single-stranded RNA (ssRNA) viruses mutate rapidly to generate a large number of strains with highly divergent capsid sequences. Determining the capsid residues or nucleotides that uniquely characterize these strains is critical in understanding the strain diversity of these viruses. RECOVIR (an acronym for "recognize viruses") software predicts the strains of some ssRNA viruses from their limited sequence data. Novel phylogenetic-tree-based databases of protein or nucleic acid residues that uniquely characterize these virus strains are created. Strains of input virus sequences (partial or complete) are predicted through residue-wise comparisons with the databases. RECOVIR uses unique characterizing residues to identify automatically strains of partial or complete capsid sequences of picorna and caliciviruses, two of the most highly diverse ssRNA virus families. Partition-wise comparisons of the database residues with the corresponding residues of more than 300 complete and partial sequences of these viruses resulted in correct strain identification for all of these sequences. This study shows the feasibility of creating databases of hitherto unknown residues uniquely characterizing the capsid sequences of two of the most highly divergent ssRNA virus families. These databases enable automated strain identification from partial or complete capsid sequences of these human and animal pathogens.

  9. Semliki Forest virus and Sindbis virus, but not vaccinia virus, require glycolysis for optimal replication.


    Findlay, James S; Ulaeto, David


    Viruses are obligate intracellular pathogens which rely on the cell's machinery to produce the energy and macromolecules required for replication. Infection is associated with a modified metabolic profile and one pathway which can be modified is glycolysis. In this study, we investigated if the glycolysis pathway is required for alphavirus replication. Pre-treatment of Vero cells with three different glycolysis inhibitors (2-deoxyglucose, lonidamine and oxamate) resulted in a significant reduction (but not abrogation) of Semliki Forest virus and Sindbis virus replication, but not of the unrelated virus, vaccinia virus. Reduced virus yield was not associated with any significant cytotoxic effect and delayed treatment up to 3 h post-infection still resulted in a significant reduction. This suggested that glycolysis is required for optimal replication of alphaviruses by supporting post-entry life cycle steps.

  10. Structure of Flexible Filamentous Plant Viruses

    SciTech Connect

    Kendall, Amy; McDonald, Michele; Bian, Wen; Bowles, Timothy; Baumgarten, Sarah C.; Shi, Jian; Stewart, Phoebe L.; Bullitt, Esther; Gore, David; Irving, Thomas C.; Havens, Wendy M.; Ghabrial, Said A.; Wall, Joseph S.; Stubbs, Gerald


    Flexible filamentous viruses make up a large fraction of the known plant viruses, but in comparison with those of other viruses, very little is known about their structures. We have used fiber diffraction, cryo-electron microscopy, and scanning transmission electron microscopy to determine the symmetry of a potyvirus, soybean mosaic virus; to confirm the symmetry of a potexvirus, potato virus X; and to determine the low-resolution structures of both viruses. We conclude that these viruses and, by implication, most or all flexible filamentous plant viruses share a common coat protein fold and helical symmetry, with slightly less than 9 subunits per helical turn.

  11. Computer virus information update CIAC-2301

    SciTech Connect

    Orvis, W.J.


    While CIAC periodically issues bulletins about specific computer viruses, these bulletins do not cover all the computer viruses that affect desktop computers. The purpose of this document is to identify most of the known viruses for the MS-DOS and Macintosh platforms and give an overview of the effects of each virus. The authors also include information on some windows, Atari, and Amiga viruses. This document is revised periodically as new virus information becomes available. This document replaces all earlier versions of the CIAC Computer virus Information Update. The date on the front cover indicates date on which the information in this document was extracted from CIAC`s Virus database.

  12. Zika virus: epidemiology, clinical features and host-virus interactions.


    Hamel, Rodolphe; Liégeois, Florian; Wichit, Sineewanlaya; Pompon, Julien; Diop, Fodé; Talignani, Loïc; Thomas, Frédéric; Desprès, Philippe; Yssel, Hans; Missé, Dorothée


    Very recently, Zika virus (ZIKV) has gained a medical importance following the large-scale epidemics in South Pacific and Latin America. This paper reviews information on the epidemiology and clinical features of Zika disease with a particular emphasis on the host-virus interactions that contribute to the pathogenicity of ZIKV in humans.

  13. Structure and Genome Organization of AFV2, a Novel Archaeal Lipothrixvirus with Unusual Terminal and Core Structures†

    PubMed Central

    Häring, Monika; Vestergaard, Gisle; Brügger, Kim; Rachel, Reinhard; Garrett, Roger A.; Prangishvili, David


    A novel filamentous virus, AFV2, from the hyperthermophilic archaeal genus Acidianus shows structural similarity to lipothrixviruses but differs from them in its unusual terminal and core structures. The double-stranded DNA genome contains 31,787 bp and carries eight open reading frames homologous to those of other lipothrixviruses, a single tRNALys gene containing a 12-bp archaeal intron, and a 1,008-bp repeat-rich region near the center of the genome. PMID:15901711

  14. Uukuniemi Virus as a Tick-Borne Virus Model

    PubMed Central

    Mazelier, Magalie; Rouxel, Ronan Nicolas; Zumstein, Michael; Mancini, Roberta; Bell-Sakyi, Lesley


    ABSTRACT In the last decade, novel tick-borne pathogenic phleboviruses in the family Bunyaviridae, all closely related to Uukuniemi virus (UUKV), have emerged on different continents. To reproduce the tick-mammal switch in vitro, we first established a reverse genetics system to rescue UUKV with a genome close to that of the authentic virus isolated from the Ixodes ricinus tick reservoir. The IRE/CTVM19 and IRE/CTVM20 cell lines, both derived from I. ricinus, were susceptible to the virus rescued from plasmid DNAs and supported production of the virus over many weeks, indicating that infection was persistent. The glycoprotein GC was mainly highly mannosylated on tick cell-derived viral progeny. The second envelope viral protein, GN, carried mostly N-glycans not recognized by the classical glycosidases peptide-N-glycosidase F (PNGase F) and endoglycosidase H (Endo H). Treatment with β-mercaptoethanol did not impact the apparent molecular weight of GN. On viruses originating from mammalian BHK-21 cells, GN glycosylations were exclusively sensitive to PNGase F, and the electrophoretic mobility of the protein was substantially slower after the reduction of disulfide bonds. Furthermore, the amount of viral nucleoprotein per focus forming unit differed markedly whether viruses were produced in tick or BHK-21 cells, suggesting a higher infectivity for tick cell-derived viruses. Together, our results indicate that UUKV particles derived from vector tick cells have glycosylation and structural specificities that may influence the initial infection in mammalian hosts. This study also highlights the importance of working with viruses originating from arthropod vector cells in investigations of the cell biology of arbovirus transmission and entry into mammalian hosts. IMPORTANCE Tick-borne phleboviruses represent a growing threat to humans globally. Although ticks are important vectors of infectious emerging diseases, previous studies have mainly involved virus stocks

  15. Virioplankton: Viruses in Aquatic Ecosystems†

    PubMed Central

    Wommack, K. Eric; Colwell, Rita R.


    The discovery that viruses may be the most abundant organisms in natural waters, surpassing the number of bacteria by an order of magnitude, has inspired a resurgence of interest in viruses in the aquatic environment. Surprisingly little was known of the interaction of viruses and their hosts in nature. In the decade since the reports of extraordinarily large virus populations were published, enumeration of viruses in aquatic environments has demonstrated that the virioplankton are dynamic components of the plankton, changing dramatically in number with geographical location and season. The evidence to date suggests that virioplankton communities are composed principally of bacteriophages and, to a lesser extent, eukaryotic algal viruses. The influence of viral infection and lysis on bacterial and phytoplankton host communities was measurable after new methods were developed and prior knowledge of bacteriophage biology was incorporated into concepts of parasite and host community interactions. The new methods have yielded data showing that viral infection can have a significant impact on bacteria and unicellular algae populations and supporting the hypothesis that viruses play a significant role in microbial food webs. Besides predation limiting bacteria and phytoplankton populations, the specific nature of virus-host interaction raises the intriguing possibility that viral infection influences the structure and diversity of aquatic microbial communities. Novel applications of molecular genetic techniques have provided good evidence that viral infection can significantly influence the composition and diversity of aquatic microbial communities. PMID:10704475

  16. Emerging tomato viruses in Florida

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tomato spotted wilt virus (TSWV) causes crop losses worldwide. This tospovirus is well-known for disease epidemics in vegetable, ornamental and peanut crops in the southeastern U.S. Two other tospoviruses have recently emerged in south Florida. Groundnut ringspot virus (GRSV) was first detected in ...

  17. Tobacco ringspot virus in Rubus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tobacco ringspot virus (TRSV) has a broad host range among woody and perennial plants and has been reported from blackberry but not from red or black raspberry. The virus has been detected in blackberry in the southeastern United States with a single report from blackberry in British Columbia, Cana...


    EPA Science Inventory

    This chapter describes a quantal method for assaying culturable human enteric viruses from water matrices. The assay differs from the plaque assay described in Chapter 10 (December 1987 Revision) in that it is based upon the direct microscopic viewing of cells for virus-induced ...

  19. Defining life: the virus viewpoint.


    Forterre, Patrick


    Are viruses alive? Until very recently, answering this question was often negative and viruses were not considered in discussions on the origin and definition of life. This situation is rapidly changing, following several discoveries that have modified our vision of viruses. It has been recognized that viruses have played (and still play) a major innovative role in the evolution of cellular organisms. New definitions of viruses have been proposed and their position in the universal tree of life is actively discussed. Viruses are no more confused with their virions, but can be viewed as complex living entities that transform the infected cell into a novel organism-the virus-producing virions. I suggest here to define life (an historical process) as the mode of existence of ribosome encoding organisms (cells) and capsid encoding organisms (viruses) and their ancestors. I propose to define an organism as an ensemble of integrated organs (molecular or cellular) producing individuals evolving through natural selection. The origin of life on our planet would correspond to the establishment of the first organism corresponding to this definition.

  20. Ebola Virus-Related Encephalitis.


    de Greslan, Thierry; Billhot, Magali; Rousseau, Claire; Mac Nab, Christine; Karkowski, Ludovic; Cournac, Jean-Marie; Bordes, Julien; Gagnon, Nicolas; Dubrous, Philippe; Duron, Sandrine; Moroge, Sophie; Quentin, Benoit; Koulibaly, Fassou; Bompaire, Flavie; Renard, Jean-Luc; Cellarier, Gilles


    Ebola patients frequently exhibit behavioral modifications with ideation slowing and aggressiveness, sometimes contrasting with mild severity of Ebola disease. We performed lumbar punctures in 3 patients with this presentation and found Ebola virus in all cerebrospinal fluid samples. This discovery helps to discuss the concept of a specific Ebola virus encephalitis. PMID:27418576

  1. Swine Influenza Virus: Emerging Understandings

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Introduction: In March-April 2009, a novel pandemic H1N1 emerged in the human population in North America [1]. The gene constellation of the emerging virus was demonstrated to be a combination of genes from swine influenza A viruses (SIV) of North American and Eurasian lineages that had never before...

  2. Paper Models Illustrating Virus Symmetry.

    ERIC Educational Resources Information Center

    McCarthy, D. A.


    Instructions are given for constructing two models, one to illustrate the general principles of symmetry in T=1, T=3, and T=4 viruses, and the other to illustrate the disposition of protein subunits in the T=3 plant viruses and the picornaviruses. (Author/CW)

  3. Oncolytic virus therapy for cancer.


    Goldufsky, Joe; Sivendran, Shanthi; Harcharik, Sara; Pan, Michael; Bernardo, Sebastian; Stern, Richard H; Friedlander, Philip; Ruby, Carl E; Saenger, Yvonne; Kaufman, Howard L


    The use of oncolytic viruses to treat cancer is based on the selection of tropic tumor viruses or the generation of replication selective vectors that can either directly kill infected tumor cells or increase their susceptibility to cell death and apoptosis through additional exposure to radiation or chemotherapy. In addition, viral vectors can be modified to promote more potent tumor cell death, improve the toxicity profile, and/or generate host antitumor immunity. A variety of viruses have been developed as oncolytic therapeutics, including adenovirus, vaccinia virus, herpesvirus, coxsackie A virus, Newcastle disease virus, and reovirus. The clinical development of oncolytic viral therapy has accelerated in the last few years, with several vectors entering clinical trials for a variety of cancers. In this review, current strategies to optimize the therapeutic effectiveness and safety of the major oncolytic viruses are discussed, and a summary of current clinical trials is provided. Further investigation is needed to characterize better the clinical impact of oncolytic viruses, but there are increasing data demonstrating the potential promise of this approach for the treatment of human and animal cancers.

  4. Oncolytic virus therapy for cancer

    PubMed Central

    Goldufsky, Joe; Sivendran, Shanthi; Harcharik, Sara; Pan, Michael; Bernardo, Sebastian; Stern, Richard H; Friedlander, Philip; Ruby, Carl E; Saenger, Yvonne; Kaufman, Howard L


    The use of oncolytic viruses to treat cancer is based on the selection of tropic tumor viruses or the generation of replication selective vectors that can either directly kill infected tumor cells or increase their susceptibility to cell death and apoptosis through additional exposure to radiation or chemotherapy. In addition, viral vectors can be modified to promote more potent tumor cell death, improve the toxicity profile, and/or generate host antitumor immunity. A variety of viruses have been developed as oncolytic therapeutics, including adenovirus, vaccinia virus, herpesvirus, coxsackie A virus, Newcastle disease virus, and reovirus. The clinical development of oncolytic viral therapy has accelerated in the last few years, with several vectors entering clinical trials for a variety of cancers. In this review, current strategies to optimize the therapeutic effectiveness and safety of the major oncolytic viruses are discussed, and a summary of current clinical trials is provided. Further investigation is needed to characterize better the clinical impact of oncolytic viruses, but there are increasing data demonstrating the potential promise of this approach for the treatment of human and animal cancers. PMID:27512656

  5. Group 2 vaccinia virus, Brazil.


    Assis, Felipe Lopes; Borges, Iara Apolinario; Ferreira, Paulo César Peregrino; Bonjardim, Cláudio Antônio; Trindade, Giliane de Souza; Lobato, Zélia Inês Portela; Guedes, Maria Isabel Maldonado; Mesquita, Vaz; Kroon, Erna Geessien; Abrahão, Jônatas Santos


    In 2011, vaccinia virus caused an outbreak of bovine vaccinia, affecting dairy cattle and dairy workers in Brazil. Genetic and phenotypic analyses identified this isolate as distinct from others recently identified, thereby reinforcing the hypothesis that different vaccinia virus strains co-circulate in Brazil.

  6. West Nile virus vaccine.


    Monath, T P; Arroyo, J; Miller, C; Guirakhoo, F


    Within the past 5 years, West Nile encephalitis has emerged as an important disease of humans and horses in Europe. In 1999, the disease appeared for the first time in the northeastern United States. West Nile virus (a mosquito-borne flavivirus) has flourished in the North American ecosystem and is expected to expand its geographic range. In this review, the rationale for a human and veterinary vaccine is presented and a novel approach for rapid development of a molecularly-defined, live, attenuated vaccine is described. The technology (ChimeriVax) is applicable to the development of vaccines against all flaviviruses, and products against Japanese encephalitis (a close relative of West Nile) and dengue are in or are nearing clinical trials, respectively. ChimeriVax vaccines utilize the safe and effective vaccine against the prototype flavivirus -yellow fever 17D- as a live vector. Infectious clone technology is used to replace the genes encoding the pre-membrane (prM) and envelope (E) protein of yellow fever 17D vaccine with the corresponding genes of the target virus (e.g., West Nile). The resulting chimeric virus contains the antigens responsible for protection against West Nile but retains the replication efficiency of yellow fever 17D. The ChimeriVax technology is well-suited to the rapid development of a West Nile vaccine, and clinical trials could begin as early as mid-2002. Other approaches to vaccine development are briefly reviewed. The aim of this brief review is to describe the features of West Nile encephalitis, a newly introduced infectious disease affecting humans, horses and wildlife in the United States; the rationale for rapid development of vaccines; and approaches to the development of vaccines against the disease.

  7. New aspects of influenza viruses.

    PubMed Central

    Shaw, M W; Arden, N H; Maassab, H F


    Influenza virus infections continue to cause substantial morbidity and mortality with a worldwide social and economic impact. The past five years have seen dramatic advances in our understanding of viral replication, evolution, and antigenic variation. Genetic analyses have clarified relationships between human and animal influenza virus strains, demonstrating the potential for the appearance of new pandemic reassortants as hemagglutinin and neuraminidase genes are exchanged in an intermediate host. Clinical trials of candidate live attenuated influenza virus vaccines have shown the cold-adapted reassortants to be a promising alternative to the currently available inactivated virus preparations. Modern molecular techniques have allowed serious consideration of new approaches to the development of antiviral agents and vaccines as the functions of the viral genes and proteins are further elucidated. The development of techniques whereby the genes of influenza viruses can be specifically altered to investigate those functions will undoubtedly accelerate the pace at which our knowledge expands. PMID:1310439

  8. Nonlytic spread of naked viruses.


    Bird, Sara W; Kirkegaard, Karla


    How do viruses spread from cell to cell? Enveloped viruses acquire their surrounding membranes by budding: either through the plasma membrane or an internal membrane of infected cells. Thus, a newly budded enveloped virus finds itself either in the extracellular milieu or in a lumenal compartment from which it can exit the cell by conventional secretion. On the other hand, naked viruses such as poliovirus, nodavirus, adenovirus, and SV40 lack an external membrane. They are simply protein-nucleic acid complexes within the cytoplasm or nucleus of the infected cell, and thus would seem to have no other exit route than cell lysis. We have presented the first documentation of nonlytic spread of a naked virus, and showed the interconnections between this event and the process or components of the autophagy pathway. PMID:25680079

  9. Nonlytic spread of naked viruses

    PubMed Central

    Bird, Sara W; Kirkegaard, Karla


    How do viruses spread from cell to cell? Enveloped viruses acquire their surrounding membranes by budding: either through the plasma membrane or an internal membrane of infected cells. Thus, a newly budded enveloped virus finds itself either in the extracellular milieu or in a lumenal compartment from which it can exit the cell by conventional secretion. On the other hand, naked viruses such as poliovirus, nodavirus, adenovirus, and SV40 lack an external membrane. They are simply protein-nucleic acid complexes within the cytoplasm or nucleus of the infected cell, and thus would seem to have no other exit route than cell lysis. We have presented the first documentation of nonlytic spread of a naked virus, and showed the interconnections between this event and the process or components of the autophagy pathway. PMID:25680079

  10. Movement of Viruses between Biomes

    PubMed Central

    Sano, Emiko; Carlson, Suzanne; Wegley, Linda; Rohwer, Forest


    Viruses are abundant in all known ecosystems. In the present study, we tested the possibility that viruses from one biome can successfully propagate in another. Viral concentrates were prepared from different near-shore marine sites, lake water, marine sediments, and soil. The concentrates were added to microcosms containing dissolved organic matter as a food source (after filtration to allow 100-kDa particles to pass through) and a 3% (vol/vol) microbial inoculum from a marine water sample (after filtration through a 0.45-μm-pore-size filter). Virus-like particle abundances were then monitored using direct counting. Viral populations from lake water, marine sediments, and soil were able to replicate when they were incubated with the marine microbes, showing that viruses can move between different ecosystems and propagate. These results imply that viruses can laterally transfer DNA between microbes in different biomes. PMID:15466522

  11. The ecology of Ebola virus.


    Groseth, Allison; Feldmann, Heinz; Strong, James E


    Since Ebola virus was first identified more than 30 years ago, tremendous progress has been made in understanding the molecular biology and pathogenesis of this virus. However, the means by which Ebola virus is maintained and transmitted in nature remains unclear despite dedicated efforts to answer these questions. Recent work has provided new evidence that fruit bats might have a role as a reservoir species, but it is not clear whether other species are also involved or how transmission to humans or apes takes place. Two opposing hypotheses for Ebola emergence have surfaced; one of long-term local persistence in a cryptic and infrequently contacted reservoir, versus another of a more recent introduction of the virus and directional spread through susceptible populations. Nevertheless, with the increasing frequency of human filovirus outbreaks and the tremendous impact of infection on the already threatened great ape populations, there is an urgent need to better understand the ecology of Ebola virus in nature. PMID:17698361

  12. Biosensing with Virus Electrode Hybrids

    PubMed Central

    Mohan, Kritika; Penner, Reginald M.; Weiss, Gregory A.


    Virus electrodes address two major challenges associated with biosensing. First, the surface of the viruses can be readily tailored for specific, high affinity binding to targeted biomarkers. Second, the viruses are entrapped in a conducting polymer for electrical resistance-based, quantitative measurement of biomarker concentration. To further enhance device sensitivity, two different ligands can be attached to the virus surface, and increase the apparent affinity for the biomarker. In the example presented here, the two ligands bind to the analyte in a bidentate binding mode with chelate-based avidity effect, and result in an 100 pM experimentally observed limit of detection for the cancer biomarker prostate-specific membrane antigen. The approach does not require enzymatic amplification, and allows reagent-free, real-time measurements. This article presents general protocols for the development of such biosensors with modified viruses for the enhanced detection of arbitrary target proteins. PMID:26344233

  13. [Classification of viruses by computer].


    Ageeva, O N; Andzhaparidze, O G; Kibardin, V M; Nazarova, G M; Pleteneva, E A


    The study used the information mass containing information on 83 viruses characterized by 41 markers. The suitability of one of the variants of cluster analysis for virus classification was demonstrated. It was established that certain stages of automatic allotment of viruses into groups by the degree of similarity of their properties end the formation of groups which consist of viruses sufficiently close to each other by their properties and are sufficiently isolated. Comparison of these groups with the classification proposed by the ICVT established their correspondence to individual families. Analysis of the obtained classification system permits sufficiently grounded conclusions to be drawn with regard to the classification position of certain viruses, the classification of which has not yet been completed by the ICVT.

  14. Marine Viruses: Truth or Dare

    NASA Astrophysics Data System (ADS)

    Breitbart, Mya


    Over the past two decades, marine virology has progressed from a curiosity to an intensely studied topic of critical importance to oceanography. At concentrations of approximately 10 million viruses per milliliter of surface seawater, viruses are the most abundant biological entities in the oceans. The majority of these viruses are phages (viruses that infect bacteria). Through lysing their bacterial hosts, marine phages control bacterial abundance, affect community composition, and impact global biogeochemical cycles. In addition, phages influence their hosts through selection for resistance, horizontal gene transfer, and manipulation of bacterial metabolism. Recent work has also demonstrated that marine phages are extremely diverse and can carry a variety of auxiliary metabolic genes encoding critical ecological functions. This review is structured as a scientific "truth or dare," revealing several well-established "truths" about marine viruses and presenting a few "dares" for the research community to undertake in future studies.

  15. Virus assembly, allostery, and antivirals

    PubMed Central

    Zlotnick, Adam; Mukhopadhyay, Suchetana


    Assembly of virus capsids and surface proteins must be regulated to ensure that the resulting complex is an infectious virion. Here we examine assembly of virus capsids, focusing on hepatitis B virus and bacteriophage MS2, and formation of glycoproteins in the alphaviruses. These systems are structurally and biochemically well-characterized and are simplest-case paradigms of self-assembly. Published data suggest that capsid and glycoprotein assembly is subject to allosteric regulation, that is, regulation at the level of conformational change. The hypothesis that allostery is a common theme in viruses suggests that deregulation of capsid and glycoprotein assembly by small molecule effectors will be an attractive antiviral strategy, as has been demonstrated with hepatitis B virus. PMID:21163649

  16. The Acute bee paralysis virus-Kashmir bee virus-Israeli acute paralysis virus complex.


    de Miranda, Joachim R; Cordoni, Guido; Budge, Giles


    Acute bee paralysis virus (ABPV), Kashmir bee virus (KBV) and Israeli acute paralysis virus (IAPV) are part of a complex of closely related viruses from the Family Dicistroviridae. These viruses have a widespread prevalence in honey bee (Apis mellifera) colonies and a predominantly sub-clinical etiology that contrasts sharply with the extremely virulent pathology encountered at elevated titres, either artificially induced or encountered naturally. These viruses are frequently implicated in honey bee colony losses, especially when the colonies are infested with the parasitic mite Varroa destructor. Here we review the historical and recent literature of this virus complex, covering history and origins; the geographic, host and tissue distribution; pathology and transmission; genetics and variation; diagnostics, and discuss these within the context of the molecular and biological similarities and differences between the viruses. We also briefly discuss three recent developments relating specifically to IAPV, concerning its association with Colony Collapse Disorder, treatment of IAPV infection with siRNA and possible honey bee resistance to IAPV.

  17. Hepatitis E Virus Infection

    PubMed Central

    Dalton, Harry R.; Abravanel, Florence; Izopet, Jacques


    SUMMARY Hepatitis E virus (HEV) infection is a worldwide disease. An improved understanding of the natural history of HEV infection has been achieved within the last decade. Several reservoirs and transmission modes have been identified. Hepatitis E is an underdiagnosed disease, in part due to the use of serological assays with low sensitivity. However, diagnostic tools, including nucleic acid-based tests, have been improved. The epidemiology and clinical features of hepatitis E differ between developing and developed countries. HEV infection is usually an acute self-limiting disease, but in developed countries it causes chronic infection with rapidly progressive cirrhosis in organ transplant recipients, patients with hematological malignancy requiring chemotherapy, and individuals with HIV. HEV also causes extrahepatic manifestations, including a number of neurological syndromes and renal injury. Acute infection usually requires no treatment, but chronic infection should be treated by reducing immunosuppression in transplant patients and/or the use of antiviral therapy. In this comprehensive review, we summarize the current knowledge about the virus itself, as well as the epidemiology, diagnostics, natural history, and management of HEV infection in developing and developed countries. PMID:24396139

  18. Chikungunya virus infection.


    Sam, I-C; AbuBakar, S


    Chikungunya virus (CHIKV) is a mosquito-borne alphavirus which causes epidemic fever, rash and polyarthralgia in Africa and Asia. Two outbreaks have been reported in Malaysia, in Klang, Selangor (1998) and Bagan Panchor, Perak (2006). It is not known if the outbreaks were caused by the recent introduction of CHIKV, or if the virus was already circulating in Malaysia. Seroprevalence studies from the 1960s suggested previous disease activity in certain parts of the country. In Asia, CHIKV is thought to be transmitted by the same mosquitoes as dengue, Aedes aegypti and Ae. albopictus. Due to similarities in clinical presentation with dengue, limited awareness, and a lack of laboratory diagnostic capability, CHIKV is probably often underdiagnosed or misdiagnosed as dengue. Treatment is supportive. The prognosis is generally good, although some patients experience chronic arthritis. With no vaccine or antiviral available, prevention and control depends on surveillance, early identification of outbreaks, and vector control. CHIKV should be borne in mind in sporadic cases, and in patients epidemiologically linked to ongoing local or international outbreaks or endemic areas.

  19. Dengue virus vaccine development.


    Yauch, Lauren E; Shresta, Sujan


    Dengue virus (DENV) is a significant cause of morbidity and mortality in tropical and subtropical regions, causing hundreds of millions of infections each year. Infections range from asymptomatic to a self-limited febrile illness, dengue fever (DF), to the life-threatening dengue hemorrhagic fever/dengue shock syndrome (DHF/DSS). The expanding of the habitat of DENV-transmitting mosquitoes has resulted in dramatic increases in the number of cases over the past 50 years, and recent outbreaks have occurred in the United States. Developing a dengue vaccine is a global health priority. DENV vaccine development is challenging due to the existence of four serotypes of the virus (DENV1-4), which a vaccine must protect against. Additionally, the adaptive immune response to DENV may be both protective and pathogenic upon subsequent infection, and the precise features of protective versus pathogenic immune responses to DENV are unknown, complicating vaccine development. Numerous vaccine candidates, including live attenuated, inactivated, recombinant subunit, DNA, and viral vectored vaccines, are in various stages of clinical development, from preclinical to phase 3. This review will discuss the adaptive immune response to DENV, dengue vaccine challenges, animal models used to test dengue vaccine candidates, and historical and current dengue vaccine approaches.

  20. Hepatitis E virus infection.


    Kamar, Nassim; Dalton, Harry R; Abravanel, Florence; Izopet, Jacques


    Hepatitis E virus (HEV) infection is a worldwide disease. An improved understanding of the natural history of HEV infection has been achieved within the last decade. Several reservoirs and transmission modes have been identified. Hepatitis E is an underdiagnosed disease, in part due to the use of serological assays with low sensitivity. However, diagnostic tools, including nucleic acid-based tests, have been improved. The epidemiology and clinical features of hepatitis E differ between developing and developed countries. HEV infection is usually an acute self-limiting disease, but in developed countries it causes chronic infection with rapidly progressive cirrhosis in organ transplant recipients, patients with hematological malignancy requiring chemotherapy, and individuals with HIV. HEV also causes extrahepatic manifestations, including a number of neurological syndromes and renal injury. Acute infection usually requires no treatment, but chronic infection should be treated by reducing immunosuppression in transplant patients and/or the use of antiviral therapy. In this comprehensive review, we summarize the current knowledge about the virus itself, as well as the epidemiology, diagnostics, natural history, and management of HEV infection in developing and developed countries. PMID:24396139

  1. Comparison of Immunohistochemistry and Virus Isolation for Diagnosis of West Nile Virus

    PubMed Central

    Ellis, Angela E.; Mead, Daniel G.; Allison, Andrew B.; Gibbs, Samantha E. J.; Gottdenker, Nicole L.; Stallknecht, David E.; Howerth, Elizabeth W.


    Immunohistochemistry and virus isolation were performed on 1,057 birds. Immunohistochemistry, virus isolation, or both found 325 birds to be West Nile virus positive. Of these, 271 were positive by both methods. These results indicate that virus isolation and immunohistochemistry are approximately equal in their ability to detect West Nile virus. PMID:15956415

  2. Genome Sequence of Bivens Arm Virus, a Tibrovirus Belonging to the Species Tibrogargan virus (Mononegavirales: Rhabdoviridae)

    PubMed Central

    Hensley, Lisa E.


    The new rhabdoviral genus Tibrovirus currently has two members, Coastal Plains virus and Tibrogargan virus. Here, we report the coding-complete genome sequence of a putative member of this genus, Bivens Arm virus. A genomic comparison reveals Bivens Arm virus to be closely related to, but distinct from, Tibrogargan virus. PMID:25792044

  3. A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Virus-host interactions drive a remarkable diversity of immune responses and countermeasures. While investigating virus-invertebrate host interactions we found that two RNA viruses with broad host ranges, vesicular stomatitis virus (VSV) and Sindbis virus (SINV), were unable to infect certain Lepido...

  4. Infectious vaccinia virus recombinants that express hepatitis B virus surface antigen

    NASA Astrophysics Data System (ADS)

    Smith, Geoffrey L.; Mackett, Michael; Moss, Bernard


    Potential live vaccines against hepatitis B virus have been produced. The coding sequence for hepatitis B virus surface antigen (HBsAg) has been inserted into the vaccinia virus genome under control of vaccinia virus early promoters. Cells infected with these vaccinia virus recombinants synthesize and excrete HBsAg and vaccinated rabbits rapidly produce antibodies to HBsAg.

  5. Influenza: a virus of our times

    PubMed Central

    McCaughey, Conall


    Viruses are successful and omnipresent. Influenza A is a particularly important virus of humans. The article reviews the 2009 emergence of the pandemic influenza A virus, focusing on the potential origin of the virus and the distinctive clinical and epidemiological impact of the 2009 pandemic. PMID:21116418

  6. Safe Computing: An Overview of Viruses.

    ERIC Educational Resources Information Center

    Wodarz, Nan


    A computer virus is a program that replicates itself, in conjunction with an additional program that can harm a computer system. Common viruses include boot-sector, macro, companion, overwriting, and multipartite. Viruses can be fast, slow, stealthy, and polymorphic. Anti-virus products are described. (MLH)

  7. The IFITMs Inhibit Zika Virus Replication.


    Savidis, George; Perreira, Jill M; Portmann, Jocelyn M; Meraner, Paul; Guo, Zhiru; Green, Sharone; Brass, Abraham L


    Zika virus has emerged as a severe health threat with a rapidly expanding range. The IFITM family of restriction factors inhibits the replication of a broad range of viruses, including the closely related flaviruses West Nile virus and dengue virus. Here, we show that IFITM1 and IFITM3 inhibit Zika virus infection early in the viral life cycle. Moreover, IFITM3 can prevent Zika-virus-induced cell death. These results suggest that strategies to boost the actions and/or levels of the IFITMs might be useful for inhibiting a broad range of emerging viruses.

  8. Defining Life: The Virus Viewpoint

    NASA Astrophysics Data System (ADS)

    Forterre, Patrick


    Are viruses alive? Until very recently, answering this question was often negative and viruses were not considered in discussions on the origin and definition of life. This situation is rapidly changing, following several discoveries that have modified our vision of viruses. It has been recognized that viruses have played (and still play) a major innovative role in the evolution of cellular organisms. New definitions of viruses have been proposed and their position in the universal tree of life is actively discussed. Viruses are no more confused with their virions, but can be viewed as complex living entities that transform the infected cell into a novel organism—the virus—producing virions. I suggest here to define life (an historical process) as the mode of existence of ribosome encoding organisms (cells) and capsid encoding organisms (viruses) and their ancestors. I propose to define an organism as an ensemble of integrated organs (molecular or cellular) producing individuals evolving through natural selection. The origin of life on our planet would correspond to the establishment of the first organism corresponding to this definition.

  9. Viruses and interactomes in translation.


    Meyniel-Schicklin, Laurène; de Chassey, Benoît; André, Patrice; Lotteau, Vincent


    A decade of high-throughput screenings for intraviral and virus-host protein-protein interactions led to the accumulation of data and to the development of theories on laws governing interactome organization for many viruses. We present here a computational analysis of intraviral protein networks (EBV, FLUAV, HCV, HSV-1, KSHV, SARS-CoV, VACV, and VZV) and virus-host protein networks (DENV, EBV, FLUAV, HCV, and VACV) from up-to-date interaction data, using various mathematical approaches. If intraviral networks seem to behave similarly, they are clearly different from the human interactome. Viral proteins target highly central human proteins, which are precisely the Achilles' heel of the human interactome. The intrinsic structural disorder is a distinctive feature of viral hubs in virus-host interactomes. Overlaps between virus-host data sets identify a core of human proteins involved in the cellular response to viral infection and in the viral capacity to hijack the cell machinery for viral replication. Host proteins that are strongly targeted by a virus seem to be particularly attractive for other viruses. Such protein-protein interaction networks and their analysis represent a powerful resource from a therapeutic perspective.

  10. Virus infection and knee injury.

    PubMed Central

    Driscoll, P; Venner, R; Clements, G B


    Serological evidence of virus infection was sought in 31 consecutive patients presenting with knee swelling and compared with age/sex-matched controls. In a normal age/sex-matched control group, 42% of patients had evidence of recent or past infection with Coxsackie B virus, emphasising the care required in the evaluation of the significance of Coxsackie B neutralization titres in individual patients. Of 12 patients presenting with knee swelling and a history of a twisting injury, eight had serological evidence of recent or past infection with Coxsackie B virus, and one had evidence of a current adenovirus infection. PMID:2825728

  11. Marburg Virus Reverse Genetics Systems

    PubMed Central

    Schmidt, Kristina Maria; Mühlberger, Elke


    The highly pathogenic Marburg virus (MARV) is a member of the Filoviridae family and belongs to the group of nonsegmented negative-strand RNA viruses. Reverse genetics systems established for MARV have been used to study various aspects of the viral replication cycle, analyze host responses, image viral infection, and screen for antivirals. This article provides an overview of the currently established MARV reverse genetic systems based on minigenomes, infectious virus-like particles and full-length clones, and the research that has been conducted using these systems. PMID:27338448

  12. Xenotropic Murine Leukemia Virus-related Virus (XMRV) Backgrounder

    Researchers have not found evidence that XMRV causes any diseases in humans or in animals. The presence of an infectious agent, such as a virus, in diseased tissue does not mean that the agent causes the disease.

  13. Capillary electrophoresis of viruses, subviral particles and virus complexes.


    Kremser, Leopold; Bilek, Gerhard; Blaas, Dieter; Kenndler, Ernst


    CZE and CIEF were so far applied to the analysis of tobacco mosaic virus, Semliki forest virus, human rhinovirus, adenovirus, norovirus and the bacteriophages T5 and MS2. The concentration of viral or subviral particles, of capsid proteins and viral genomes were determined, their electrophoretic mobilities and pI values were measured and bioaffinity reactions between viruses and antibodies, antibody fragments and receptor fragments were assessed. The role of detergents added to the BGE to obtain reproducible electrophoretic conditions was elucidated. The analytes were detected via their UV-absorbance or via fluorescence after derivatization of the viral capsid, the nucleic acid, or both. A new dimension to the detection is added by the possibility of making use of the viral infectivity. At least in theory, this allows for the unequivocal identification of a single infectious virus particle after collection at the capillary outlet. This review summarizes the 25 papers so far published on this topic.

  14. Virus isolation for diagnosing dengue virus infections in returning travelers.


    Teichmann, D; Göbels, K; Niedrig, M; Sim-Brandenburg, J-W; Làge-Stehr, J; Grobusch, M P


    Dengue fever is recognized as one of the most frequent imported acute febrile illnesses affecting European tourists returning from the tropics. In order to assess the value of virus isolation for the diagnosis of dengue fever, 70 cases of dengue fever confirmed in German travelers during the period 1993-2001 were analyzed retrospectively. In 26 patients who had developed acute febrile illness within 2 weeks following their return from a trip to a dengue-endemic area, 9 of 13 attempts to isolate the virus were successful in sera drawn 1-5 days and 2 of 13 sera drawn 6-10 days after the onset of illness. DEN-1 was the most frequent serotype isolated. If performed early, virus isolation is a reliable tool for detecting dengue virus in returning travelers.

  15. Antiviral Drugs for Viruses Other Than Human Immunodeficiency Virus

    PubMed Central

    Razonable, Raymund R.


    Most viral diseases, with the exception of those caused by human immunodeficiency virus, are self-limited illnesses that do not require specific antiviral therapy. The currently available antiviral drugs target 3 main groups of viruses: herpes, hepatitis, and influenza viruses. With the exception of the antisense molecule fomivirsen, all antiherpes drugs inhibit viral replication by serving as competitive substrates for viral DNA polymerase. Drugs for the treatment of influenza inhibit the ion channel M2 protein or the enzyme neuraminidase. Combination therapy with Interferon-α and ribavirin remains the backbone treatment for chronic hepatitis C; the addition of serine protease inhibitors improves the treatment outcome of patients infected with hepatitis C virus genotype 1. Chronic hepatitis B can be treated with interferon or a combination of nucleos(t)ide analogues. Notably, almost all the nucleos(t) ide analogues for the treatment of chronic hepatitis B possess anti–human immunodeficiency virus properties, and they inhibit replication of hepatitis B virus by serving as competitive substrates for its DNA polymerase. Some antiviral drugs possess multiple potential clinical applications, such as ribavirin for the treatment of chronic hepatitis C and respiratory syncytial virus and cidofovir for the treatment of cytomegalovirus and other DNA viruses. Drug resistance is an emerging threat to the clinical utility of antiviral drugs. The major mechanisms for drug resistance are mutations in the viral DNA polymerase gene or in genes that encode for the viral kinases required for the activation of certain drugs such as acyclovir and ganciclovir. Widespread antiviral resistance has limited the clinical utility of M2 inhibitors for the prevention and treatment of influenza infections. This article provides an overview of clinically available antiviral drugs for the primary care physician, with a special focus on pharmacology, clinical uses, and adverse effects. PMID

  16. Cucumber mosaic virus, a model for RNA virus evolution.


    Roossinck, M J


    Summary Taxonomic relationships: Cucumber mosaic virus (CMV) is the type member of the Cucumovirus genus, in the family Bromoviridae. Additional members of the genus are Peanut stunt virus (PSV) and Tomato aspermy virus (TAV). The RNAs 3 of all members of the genus can be exchanged and still yield a viable virus, while the RNAs 1 and 2 can only be exchanged within a species. Physical properties: The virus particles are about 29 nm in diameter, and are composed of 180 subunits (T = 3 icosahedral symmetry). The particles sediment with an s value of approximately 98. The virions contain 18% RNA, and are highly labile, relying on RNA-protein interactions for their integrity. The three genomic RNAs, designated RNA 1 (3.3 kb in length), RNA 2 (3.0 kb) and RNA 3 (2.2 kb) are packaged in individual particles; a subgenomic RNA, RNA 4 (1.0 kb), is packaged with the genomic RNA 3, making all the particles roughly equivalent in composition. In some strains an additional subgenomic RNA, RNA 4A is also encapsidated at low levels. The genomic RNAs are single stranded, plus sense RNAs with 5' cap structures, and 3' conserved regions that can be folded into tRNA-like structures. Satellite RNAs: CMV can harbour molecular parasites known as satellite RNAs (satRNAs) that can dramatically alter the symptom phenotype induced by the virus. The CMV satRNAs do not encode any proteins but rely on the RNA for their biological activity. Hosts: CMV infects over 1000 species of hosts, including members of 85 plant families, making it the broadest host range virus known. The virus is transmitted from host to host by aphid vectors, in a nonpersistent manner. Useful web sites: (structure); (general information).

  17. Characterization of Sepik and Entebbe bat viruses closely related to yellow fever virus.


    Kuno, Goro; Chang, Gwong-Jen J


    Yellow fever virus has a special place in medical history as the first animal virus isolated and as the prototype virus in the genus Flavivirus, which contains many serious human pathogens. Only recently, its closely related viruses within the group were identified phylogenetically. In this study, we obtained complete or near complete genome sequences of two viruses most closely related to yellow fever virus: Sepik virus of Papua New Guinea and Entebbe bat virus of Africa. Based on full-genomic characterization and genomic traits among related viruses, we identified Sepik virus to be most closely related to yellow fever virus and analyzed the pattern of repeat and conserved sequence motifs in the 3'-noncoding region among the members of yellow fever virus cluster. We also discuss the geographic dispersal as a part of ecological traits of this lineage of flaviviruses.

  18. Zika virus infections.


    de Laval, F; Leparc-Goffart, I; Meynard, J-B; Daubigny, H; Simon, F; Briolant, S


    Since its discovery in 1947 in Uganda, the Zika virus (ZIKV) remained in the shadows emerging in 2007 in Micronesia, where hundreds of dengue-like syndromes were reported. Then, in 2013-2014, it was rife in French Polynesia, where the first neurological effects were observed. More recently, its arrival in Brazil was accompanied by an unusually high number of children with microcephaly born to mothers infected with ZIKV during the first trimester of pregnancy. In 2016, the World Health Organization declared ZIKV infection to be a public health emergency and now talks about a ZIKV pandemic. This review aims to summarize the current knowledge about ZIKV infection, successively addressing its transmission, epidemiology, clinical aspects, diagnosis, treatment, and prevention before discussing some perspectives. PMID:27412976

  19. West Nile virus meningoencephalitis

    PubMed Central

    DeBiasi, Roberta L.; Tyler, Kenneth L.


    SUMMARY Since its first appearance in the US in 1999, West Nile virus (WNV) has emerged as the most common cause of epidemic meningoencephalitis in North America. In the 6 years following the 1999 outbreak, the geographic range and burden of the disease in birds, mosquitoes and humans has greatly expanded to include the 48 contiguous US and 7 Canadian provinces, as well as Mexico, the Caribbean islands and Colombia. WNV has shown an increasing propensity for neuroinvasive disease over the past decade, with varied presentations including meningitis, encephalitis and acute flaccid paralysis. Although neuroinvasive disease occurs in less than 1% of infected individuals, it is associated with high mortality. From 1999–2005, more than 8,000 cases of neuroinvasive WNV disease were reported in the US, resulting in over 780 deaths. In this review, we discuss epidemiology, risk factors, clinical features, diagnosis and prognosis of WNV meningoencephalitis, along with potential treatments. PMID:16932563

  20. Junin virus structural proteins.

    PubMed Central

    De Martínez Segovia, Z M; De Mitri, M I


    Polyacrylamide gel electrophoresis of purified Junin virus revealed six distinct structural polypeptides, two major and four minor ones. Four of these polypeptides appeared to be covalently linked with carbohydrate. The molecular weights of the six proteins, estimated by coelectrophoresis with marker proteins, ranged from 25,000 to 91,000. One of the two major components (number 3) was identified as a nucleoprotein and had a molecular weight of 64,000. It was the most prominent protein and was nonglycosylated. The other major protein (number 5), with a molecular weight of 38,000, was a glucoprotein and a component of the viral envelope. The location on the virion of three additional glycopeptides with molecular weights of 91,000, 72,000, and 52,000, together with a protein with a molecular weight of 25,000, was not well defined. PMID:189088

  1. Zika virus infections.


    de Laval, F; Leparc-Goffart, I; Meynard, J-B; Daubigny, H; Simon, F; Briolant, S


    Since its discovery in 1947 in Uganda, the Zika virus (ZIKV) remained in the shadows emerging in 2007 in Micronesia, where hundreds of dengue-like syndromes were reported. Then, in 2013-2014, it was rife in French Polynesia, where the first neurological effects were observed. More recently, its arrival in Brazil was accompanied by an unusually high number of children with microcephaly born to mothers infected with ZIKV during the first trimester of pregnancy. In 2016, the World Health Organization declared ZIKV infection to be a public health emergency and now talks about a ZIKV pandemic. This review aims to summarize the current knowledge about ZIKV infection, successively addressing its transmission, epidemiology, clinical aspects, diagnosis, treatment, and prevention before discussing some perspectives.

  2. Varicella-zoster virus.

    PubMed Central

    Arvin, A M


    Varicella-zoster virus (VZV) is a ubiquitous human alphaherpesvirus that causes varicella (chicken pox) and herpes zoster (shingles). Varicella is a common childhood illness, characterized by fever, viremia, and scattered vesicular lesions of the skin. As is characteristic of the alphaherpesviruses, VZV establishes latency in cells of the dorsal root ganglia. Herpes zoster, caused by VZV reactivation, is a localized, painful, vesicular rash involving one or adjacent dermatomes. The incidence of herpes zoster increases with age or immunosuppression. The VZV virion consists of a nucleocapsid surrounding a core that contains the linear, double-stranded DNA genome; a protein tegument separates the capsid from the lipid envelope, which incorporates the major viral glycoproteins. VZV is found in a worldwide geographic distribution but is more prevalent in temperate climates. Primary VZV infection elicits immunoglobulin G (IgG), IgM, and IgA antibodies, which bind to many classes of viral proteins. Virus-specific cellular immunity is critical for controlling viral replication in healthy and immunocompromised patients with primary or recurrent VZV infections. Rapid laboratory confirmation of the diagnosis of varicella or herpes zoster, which can be accomplished by detecting viral proteins or DNA, is important to determine the need for antiviral therapy. Acyclovir is licensed for treatment of varicella and herpes zoster, and acyclovir, valacyclovir, and famciclovir are approved for herpes zoster. Passive antibody prophylaxis with varicella-zoster immune globulin is indicated for susceptible high-risk patients exposed to varicella. A live attenuated varicella vaccine (Oka/Merck strain) is now recommended for routine childhood immunization. PMID:8809466

  3. Novel vaccines against influenza viruses

    PubMed Central

    Kang, Sang-Moo; Song, Jae-Min; Compans, Richard W.


    Killed and live attenuated influenza virus vaccines are effective in preventing and curbing the spread of influenza epidemics when the strains present in the vaccines are closely matched with the predicted epidemic strains. These vaccines are primarily targeted to induce immunity to the variable major target antigen, hemagglutinin (HA) of influenza virus. However, current vaccines are not effective in preventing the emergence of new pandemic or highly virulent viruses. New approaches are being investigated to develop universal influenza virus vaccines as well as to apply more effective vaccine delivery methods. Conserved vaccine targets including the influenza M2 ion channel protein and HA stalk domains are being developed using recombinant technologies to improve the level of cross protection. In addition, recent studies provide evidence that vaccine supplements can provide avenues to further improve current vaccination. PMID:21968298

  4. Zika virus: An international emergency?


    Palomo, Adolfo Martinez


    This Viewpoint discusses the World Health Organization's Declaration on 1 February 2016 that the epidemic infection caused by the Zika virus is a public health emergency of international concern - the basis of the decision and controversy surrounding it.

  5. About Human Parainfluenza Viruses (HPIVs)


    ... Overview Laboratory Diagnosis HPIV Seasons Resources & References About Human Parainfluenza Viruses (HPIVs) Recommend on Facebook Tweet Share ... 6348 Email CDC-INFO U.S. Department of Health & Human Services HHS/Open Top

  6. Viruses of eukaryotice green algae

    SciTech Connect

    Van Etten, J.L.


    The primary objective of our research was to develop the Chlorella-PBCV-1 virus system so that it can be used as a model system for studying gene expression in a photosynthetic eukaryote. We have made considerable progress and have learned much about PBCV-1 and its replication cycle. In addition, several significant discoveries were made in the last 3 to 4 years. These discoveries include: (i) the finding that morphologically similar, plaque forming, dsDNA containing viruses are common in nature and can be isolated readily from fresh water, (ii) the finding that all of these Chlorella viruses contain methylated bases which range in concentration from 0.1% to 47.5% m{sup 5}dC and 0 to 37% m{sup 6}dA and (iii) the discovery that infection with at least some of these viruses induces the appearance of DNA modification/restriction systems. 26 refs.

  7. Herpes Simplex Virus (Cold Sores)


    ... the skin, eyes, and mouth. This is a life-threatening infection that can lead to permanent brain damage or even death. Herpes simplex viruses also cause encephalitis, an infection of the brain. ...

  8. Arthropod viruses and small RNAs.


    Vijayendran, Diveena; Airs, Paul M; Dolezal, Kelly; Bonning, Bryony C


    The recently characterized small RNAs provide a new paradigm for physiological studies. These molecules have been shown to be integral players in processes as diverse as development and innate immunity against bacteria and viruses in eukaryotes. Several of the well-characterized small RNAs including small interfering RNAs, microRNAs and PIWI-interacting RNAs are emerging as important players in mediating arthropod host-virus interactions. Understanding the role of small RNAs in arthropod host-virus molecular interactions will facilitate manipulation of these pathways for both management of arthropod pests of agricultural and medical importance, and for protection of beneficial arthropods such as honey bees and shrimp. This review highlights recent research on the role of small RNAs in arthropod host-virus interactions with reference to other host-pathogen systems. PMID:23932976

  9. Peste des Petits Ruminants Virus.


    Baron, M D; Diallo, A; Lancelot, R; Libeau, G


    Peste des petits ruminants virus (PPRV) causes a severe contagious disease of sheep and goats and has spread extensively through the developing world. Because of its disproportionately large impact on the livelihoods of low-income livestock keepers, and the availability of effective vaccines and good diagnostics, the virus is being targeted for global control and eventual eradication. In this review we examine the origin of the virus and its current distribution, and the factors that have led international organizations to conclude that it is eradicable. We also review recent progress in the molecular and cellular biology of the virus and consider areas where further research is required to support the efforts being made by national, regional, and international bodies to tackle this growing threat. PMID:27112279

  10. Incidence and prevalence of hepatitis B and hepatitis C viruses in hemodialysis patients in Lebanon

    PubMed Central

    Abou Rached, Antoine; El Khoury, Lara; El Imad, Talal; Geara, Abdallah S; Jreijiry, Josette; Ammar, Walid


    AIM: To determine the incidence and the prevalence of hepatitis B and C viral infections in patients on hemodialysis (HD) across Lebanon. METHODS: We reviewed the data registry at the Lebanese Ministry of Public Health where records of monthly hepatitis B surface antigen (HBsAg) and hepatitis C virus (HCV) serology are reported from 60 affiliated HD centers across Lebanon. All patients who were on HD or who started HD between October 2010 and July 2012 were included in the study. Patients from seven HD centers were excluded due to inadequate and incomplete results reporting. During the selected period, HBsAg and HCV serology were available for 3769 patients from 53 HD centers distributed at all Lebanese governorates. The prevalence was calculated by dividing the number of patients with positive HBsAg or HCV serology to the total number of patients. The Incidence was calculated by dividing the number of newly acquired infection to number of patients-years (p-y). Incidence rates at different governorates were compared to each other using two tailed Z test and a P value of < 0.05 was considered significant. RESULTS: Sixty out of 3769 HD patients were found to have positive HBS Ag and 177 out of 3769 were positive for HCV Antibodies. The prevalence of hepatitis B virus (HBV) and HCV in HD patients across Lebanon was 1.6%, and 4.7%, respectively. The comparison of prevalence according to geographic distribution could not be done accurately due to the frequent shift of patients between dialysis centers at different governorates. The incidence rate was 0.27 per 100 p-y for HBV and 0.37 per 100 p-y for HCV. There was no significant difference concerning the incidence of HBV between HD centers at different governorates (all P values > 0.1), but this difference was highly significant concerning the incidence rates of HCV which occurred predominantly in the southern centers (1.47 per 100 p-y) with a P value of 0.00068 and 0.00374 when compared to Mount Lebanon (0.21 per 100 p

  11. An overview of Chikungunya virus.


    Busch, Mitchell; Erickson, Gerald


    Chikungunya fever is a viral infection caused by the Chikungunya virus that causes abrupt onset of fever, debilitating arthralgias and myalgias, and some rare but serious atypical presentations in infected patients. This mosquito-borne virus may not be familiar to North American healthcare providers. This article describes the causes, epidemiology, pathophysiology, clinical presentation, diagnostic and screening measures, management guidelines, and future research prospects for Chikungunya infection.

  12. A DNA Virus of Drosophila

    PubMed Central

    Unckless, Robert L.


    Little is known about the viruses infecting most species. Even in groups as well-studied as Drosophila, only a handful of viruses have been well-characterized. A viral metagenomic approach was used to explore viral diversity in 83 wild-caught Drosophila innubila, a mushroom feeding member of the quinaria group. A single fly that was injected with, and died from, Drosophila C Virus (DCV) was added to the sample as a control. Two-thirds of reads in the infected sample had DCV as the best BLAST hit, suggesting that the protocol developed is highly sensitive. In addition to the DCV hits, several sequences had Oryctes rhinoceros Nudivirus, a double-stranded DNA virus, as a best BLAST hit. The virus associated with these sequences was termed Drosophila innubila Nudivirus (DiNV). PCR screens of natural populations showed that DiNV was both common and widespread taxonomically and geographically. Electron microscopy confirms the presence of virions in fly fecal material similar in structure to other described Nudiviruses. In 2 species, D. innubila and D. falleni, the virus is associated with a severe (∼80–90%) loss of fecundity and significantly decreased lifespan. PMID:22053195

  13. Another really, really big virus.


    Van Etten, James L


    Viruses with genomes larger than 300 kb and up to 1.2 Mb, which encode hundreds of proteins, are being discovered and characterized with increasing frequency. Most, but not all, of these large viruses (often referred to as giruses) infect protists that live in aqueous environments. Bioinformatic analyses of metagenomes of aqueous samples indicate that large DNA viruses are quite common in nature and await discovery. One issue that is perhaps not appreciated by the virology community is that large viruses, even those classified in the same family, can differ significantly in morphology, lifestyle, and gene complement. This brief commentary, which will mention some of these unique properties, was stimulated by the characterization of the newest member of this club, virus CroV (Fischer, M.G.; Allen, M.J.; Wilson, W.H.; Suttle, C.A. Giant virus with a remarkable complement of genes infects marine zooplankton. Proc. Natl. Acad. Sci. USA 2010, 107, 19508-19513). CroV has a 730 kb genome (with ∼544 protein-encoding genes) and infects the marine microzooplankton Cafeteria roenbergensis producing a lytic infection.

  14. Kinetics of virus production from single cells.


    Timm, Andrea; Yin, John


    The production of virus by infected cells is an essential process for the spread and persistence of viral diseases, the effectiveness of live-viral vaccines, and the manufacture of viruses for diverse applications. Yet despite its importance, methods to precisely measure virus production from cells are lacking. Most methods test infected-cell populations, masking how individual cells behave. Here we measured the kinetics of virus production from single cells. We combined simple steps of liquid-phase infection, serial dilution, centrifugation, and harvesting, without specialized equipment, to track the production of virus particles from BHK cells infected with vesicular stomatitis virus. Remarkably, cell-to-cell differences in latent times to virus release were within a factor of two, while production rates and virus yields spanned over 300-fold, highlighting an extreme diversity in virus production for cells from the same population. These findings have fundamental and technological implications for health and disease.

  15. PC viruses: How do they do that

    SciTech Connect

    Pichnarczyk, K.


    The topic of PC Viruses has been an issue for a number of years now. They've been reported in every major newspaper, tabloids, television and radio. People from all fields get viruses: government, private sector businesses, home computers, schools, computer software suppliers. A definition is proposed to introduce the virus phenomenon. Virus authors come from a variety of communities. Motives and ideologies of authors are discussed, and examples of viruses are offered. Also mentioned is the growing number of viruses developed, isolated, and never distributed to the public at large, but kept within the antivirus research community. Virus examples are offered as well. Viruses are distributed not only through bulletin boards and shareware, but also from areas previously assumed to be safe, including the threat of receiving a virus through a standard in-house function, such as an in-house hardware maintenance shop. Three categories of viruses are presented: File Infecter viruses, Boot Sector Infecters, and the new category of Directory Entry Infecter virus. Also discussed are crossover viruses, that is, viruses which utilize a variety of techniques to ensure survival. An explanation of what is occurring within every stage of various viruses is given. Replication strategies common to all three types is noted, mainly the two different replication strategies of memory resident infecters and active selection infecters. A detailed definition, description and application of a stealth virus is presented. Detection strategies are discussed as each topic in this section is completed; a high level schemata of the operation of various virus detection programs ispresented. Since most eradication today is done using virus detection/eradication software, this paper attempts to reveal the techniques used by these packages.Included in the paper is the topic of manual eradication.

  16. PC viruses: How do they do that?

    SciTech Connect

    Pichnarczyk, K.


    The topic of PC Viruses has been an issue for a number of years now. They`ve been reported in every major newspaper, tabloids, television and radio. People from all fields get viruses: government, private sector businesses, home computers, schools, computer software suppliers. A definition is proposed to introduce the virus phenomenon. Virus authors come from a variety of communities. Motives and ideologies of authors are discussed, and examples of viruses are offered. Also mentioned is the growing number of viruses developed, isolated, and never distributed to the public at large, but kept within the antivirus research community. Virus examples are offered as well. Viruses are distributed not only through bulletin boards and shareware, but also from areas previously assumed to be safe, including the threat of receiving a virus through a standard in-house function, such as an in-house hardware maintenance shop. Three categories of viruses are presented: File Infecter viruses, Boot Sector Infecters, and the new category of Directory Entry Infecter virus. Also discussed are crossover viruses, that is, viruses which utilize a variety of techniques to ensure survival. An explanation of what is occurring within every stage of various viruses is given. Replication strategies common to all three types is noted, mainly the two different replication strategies of memory resident infecters and active selection infecters. A detailed definition, description and application of a stealth virus is presented. Detection strategies are discussed as each topic in this section is completed; a high level schemata of the operation of various virus detection programs ispresented. Since most eradication today is done using virus detection/eradication software, this paper attempts to reveal the techniques used by these packages.Included in the paper is the topic of manual eradication.

  17. Methods for engineering resistance to plant viruses.


    Sudarshana, Mysore R; Roy, Gourgopal; Falk, Bryce W


    The development of genetically engineered resistance to plant viruses is a result of efforts to understand the plant-virus interactions involved in "crossprotection," a phenomenon observed with several plant virus diseases. Historically, expression of the coat protein gene of Tobacco mosaic virus in transgenic tobacco (Nicotiana tabacum) plants is the first example of transgene-mediated resistance to a plant virus. Subsequently, virus-derived sequences of several plant viruses were shown to confer virus resistance in experimental and/or natural hosts. For plant RNA viruses, virus complementary DNA sequences shown to confer resistance include wild-type genes, mutated genes that produced truncated protein products, and nontranslatable sense or antisense transcripts to various regions of the virus genome. Resistance also has been demonstrated for some viruses by mutant trans-dominant gene products, derived from the movement protein and replication-associated protein genes. In addition to virus-derived sequences, gene sequences of plant origin have also been used for transgenic resistance, and such resistance can be virus-specific, for instance, R genes isolated from resistant plant genotypes, or nonspecific, for example, ribosome inactivating proteins and proteinase inhibitors. Plantibodies and 2-5A synthetase, a class of proteins of mammalian origin, have also been useful in engineering plant virus resistance. In the case of transgenic resistance mediated by viral coat protein, the mechanism of resistance was suggested to operate during the early events of virus infection. However, transgene-mediated RNA silencing and generation of small interfering RNAs appears to be the primary mechanism that confers resistance to plant viruses. Despite the advantages of transgene-mediated resistance, current interest in the development and use of transgenic virus resistant plants is low in most parts of the world. However, because of its real potential, we believe that this

  18. Emerging influenza viruses and the prospect of a universal influenza virus vaccine.


    Krammer, Florian


    Influenza viruses cause annual seasonal epidemics and pandemics at irregular intervals. Several cases of human infections with avian and swine influenza viruses have been detected recently, warranting enhanced surveillance and the development of more effective countermeasures to address the pandemic potential of these viruses. The most effective countermeasure against influenza virus infection is the use of prophylactic vaccines. However, vaccines that are currently in use for seasonal influenza viruses have to be re-formulated and re-administered in a cumbersome process every year due to the antigenic drift of the virus. Furthermore, current seasonal vaccines are ineffective against novel pandemic strains. This paper reviews zoonotic influenza viruses with pandemic potential and technological advances towards better vaccines that induce broad and long lasting protection from influenza virus infection. Recent efforts have focused on the development of broadly protective/universal influenza virus vaccines that can provide immunity against drifted seasonal influenza virus strains but also against potential pandemic viruses.

  19. Circulating avian influenza viruses closely related to the 1918 virus have pandemic potential.


    Watanabe, Tokiko; Zhong, Gongxun; Russell, Colin A; Nakajima, Noriko; Hatta, Masato; Hanson, Anthony; McBride, Ryan; Burke, David F; Takahashi, Kenta; Fukuyama, Satoshi; Tomita, Yuriko; Maher, Eileen A; Watanabe, Shinji; Imai, Masaki; Neumann, Gabriele; Hasegawa, Hideki; Paulson, James C; Smith, Derek J; Kawaoka, Yoshihiro


    Wild birds harbor a large gene pool of influenza A viruses that have the potential to cause influenza pandemics. Foreseeing and understanding this potential is important for effective surveillance. Our phylogenetic and geographic analyses revealed the global prevalence of avian influenza virus genes whose proteins differ only a few amino acids from the 1918 pandemic influenza virus, suggesting that 1918-like pandemic viruses may emerge in the future. To assess this risk, we generated and characterized a virus composed of avian influenza viral segments with high homology to the 1918 virus. This virus exhibited pathogenicity in mice and ferrets higher than that in an authentic avian influenza virus. Further, acquisition of seven amino acid substitutions in the viral polymerases and the hemagglutinin surface glycoprotein conferred respiratory droplet transmission to the 1918-like avian virus in ferrets, demonstrating that contemporary avian influenza viruses with 1918 virus-like proteins may have pandemic potential. PMID:24922572

  20. Circulating avian influenza viruses closely related to the 1918 virus have pandemic potential

    PubMed Central

    Watanabe, Tokiko; Zhong, Gongxun; Russell, Colin A.; Nakajima, Noriko; Hatta, Masato; Hanson, Anthony; McBride, Ryan; Burke, David F.; Takahashi, Kenta; Fukuyama, Satoshi; Tomita, Yuriko; Maher, Eileen A.; Watanabe, Shinji; Imai, Masaki; Neumann, Gabriele; Hasegawa, Hideki; Paulson, James C.; Smith, Derek J.; Kawaoka, Yoshihiro


    Summary Wild birds harbor a large gene pool of influenza A viruses that have the potential to cause influenza pandemics. Foreseeing and understanding this potential is important for effective surveillance. Our phylogenetic and geographic analyses revealed the global prevalence of avian influenza virus genes whose proteins differ only a few amino acids from the 1918 pandemic influenza virus, suggesting that 1918-like pandemic viruses may emerge in the future. To assess this risk, we generated and characterized a virus composed of avian influenza viral segments with high homology to the 1918 virus. This virus exhibited higher pathogenicity in mice and ferrets than an authentic avian influenza virus. Further, acquisition of seven amino acid substitutions in the viral polymerases and the hemagglutinin surface glycoprotein conferred respiratory droplet transmission to the 1918-like avian virus in ferrets, demonstrating that contemporary avian influenza viruses with 1918 virus-like proteins may have pandemic potential. PMID:24922572

  1. Zika Virus Infection and Zika Fever: Frequently Asked Questions


    ... Updated: 25 March 2016 ABOUT ZIKA What is Zika virus infection? Zika virus infection is caused by the ... possible to characterize the disease better. How is Zika virus transmitted? Zika virus is transmitted to people through ...

  2. Quantitative nanoscale electrostatics of viruses

    NASA Astrophysics Data System (ADS)

    Hernando-Pérez, M.; Cartagena-Rivera, A. X.; Lošdorfer Božič, A.; Carrillo, P. J. P.; San Martín, C.; Mateu, M. G.; Raman, A.; Podgornik, R.; de Pablo, P. J.


    Electrostatics is one of the fundamental driving forces of the interaction between biomolecules in solution. In particular, the recognition events between viruses and host cells are dominated by both specific and non-specific interactions and the electric charge of viral particles determines the electrostatic force component of the latter. Here we probe the charge of individual viruses in liquid milieu by measuring the electrostatic force between a viral particle and the Atomic Force Microscope tip. The force spectroscopy data of co-adsorbed φ29 bacteriophage proheads and mature virions, adenovirus and minute virus of mice capsids is utilized for obtaining the corresponding density of charge for each virus. The systematic differences of the density of charge between the viral particles are consistent with the theoretical predictions obtained from X-ray structural data. Our results show that the density of charge is a distinguishing characteristic of each virus, depending crucially on the nature of the viral capsid and the presence/absence of the genetic material.Electrostatics is one of the fundamental driving forces of the interaction between biomolecules in solution. In particular, the recognition events between viruses and host cells are dominated by both specific and non-specific interactions and the electric charge of viral particles determines the electrostatic force component of the latter. Here we probe the charge of individual viruses in liquid milieu by measuring the electrostatic force between a viral particle and the Atomic Force Microscope tip. The force spectroscopy data of co-adsorbed φ29 bacteriophage proheads and mature virions, adenovirus and minute virus of mice capsids is utilized for obtaining the corresponding density of charge for each virus. The systematic differences of the density of charge between the viral particles are consistent with the theoretical predictions obtained from X-ray structural data. Our results show that the density of

  3. Unusual Influenza A Viruses in Bats

    PubMed Central

    Mehle, Andrew


    Influenza A viruses infect a remarkably diverse number of hosts. Two completely new influenza A virus subtypes were recently discovered in bats, dramatically expanding the host range of the virus. These bat viruses are extremely divergent from all other known strains and likely have unique replication cycles. Phylogenetic analysis indicates long-term, isolated evolution in bats. This is supported by a high seroprevalence in sampled bat populations. As bats represent ~20% of all classified mammals, these findings suggests the presence of a massive cryptic reservoir of poorly characterized influenza A viruses. Here, we review the exciting progress made on understanding these newly discovered viruses, and discuss their zoonotic potential. PMID:25256392

  4. Cell entry of enveloped viruses.


    Cosset, François-Loic; Lavillette, Dimitri


    Enveloped viruses penetrate their cell targets following the merging of their membrane with that of the cell. This fusion process is catalyzed by one or several viral glycoproteins incorporated on the membrane of the virus. These envelope glycoproteins (EnvGP) evolved in order to combine two features. First, they acquired a domain to bind to a specific cellular protein, named "receptor." Second, they developed, with the help of cellular proteins, a function of finely controlled fusion to optimize the replication and preserve the integrity of the cell, specific to the genus of the virus. Following the activation of the EnvGP either by binding to their receptors and/or sometimes the acid pH of the endosomes, many changes of conformation permit ultimately the action of a specific hydrophobic domain, the fusion peptide, which destabilizes the cell membrane and leads to the opening of the lipidic membrane. The comprehension of these mechanisms is essential to develop medicines of the therapeutic class of entry inhibitor like enfuvirtide (Fuzeon) against human immunodeficiency virus (HIV). In this chapter, we will summarize the different envelope glycoprotein structures that viruses develop to achieve membrane fusion and the entry of the virus. We will describe the different entry pathways and cellular proteins that viruses have subverted to allow infection of the cell and the receptors that are used. Finally, we will illustrate more precisely the recent discoveries that have been made within the field of the entry process, with a focus on the use of pseudoparticles. These pseudoparticles are suitable for high-throughput screenings that help in the development of natural or artificial inhibitors as new therapeutics of the class of entry inhibitors.

  5. Marek's disease virus latency.


    Morgan, R W; Xie, Q; Cantello, J L; Miles, A M; Bernberg, E L; Kent, J; Anderson, A


    MDV latency is defined as the persistence of the viral genome in the absence of production of infectious virus except during reactivation. A number of systems for studying MDV latency exist, and most involve the use of lymphoblastoid cells or tumors. It has been difficult to divorce latency and transformation. Understanding the relationship between these two states remains a major challenge for the MDV system. Based on their patterns of expression, the MDV LATs are apt to be important in the balance between latent and lytic infections. The LATs are a complex group of transcripts. The profile of gene expression that characterizes latency differs among all herpesviruses, and MDV is no exception. MDV LATs bear little resemblance to LATs of other alphaherpesviruses or to the LATs of other lymphotropic herpesviruses. LAT splicing patterns are complex and the relationships among various spliced species or between these species and the large 10-kb transcript are unknown. In addition, the existence of any protein gene products of significance is unknown at this time. More work is needed to further investigate the significance and function of these RNAs. Better technology to construct mutants in the MDV system is badly needed, since the analysis of mutants in the chicken is a powerful and unique advantage of the MDV system. PMID:11217424

  6. Usutu virus in Africa.


    Nikolay, Birgit; Diallo, Mawlouth; Boye, Cheikh Saad Bouh; Sall, Amadou Alpha


    Usutu virus (USUV) was discovered in South Africa in 1959. Since then, it has been reported in several African countries including Senegal, Central African Republic, Nigeria, Uganda, Burkina Faso, Cote d'Ivoire, and Morocco. In 2001, USUV has been identified for the first time outside of Africa, namely in Europe, where it caused a significant mortality among blackbirds in Vienna, Austria. In 2009, the first two human cases of USUV infection in Europe have been reported in Italy, causing encephalitis in immunocompromised patients. The host range in Africa includes mainly Culex mosquitoes, birds, and also humans with one benign and one severe case. Given its role as a potential human pathogen and the similar appearance compared with other emerging arboviruses, it is essential to investigate the natural history and ecology of USUV in Africa. In this regard, we review the emergence of USUV in Africa, summarizing data about isolations, host range, and potential vectors, which should help to improve our understanding of the factors underlying the circulation of USUV in Europe and Africa. PMID:21767160

  7. Dengue viruses - an overview.


    Bäck, Anne Tuiskunen; Lundkvist, Ake


    Dengue viruses (DENVs) cause the most common arthropod-borne viral disease in man with 50-100 million infections per year. Because of the lack of a vaccine and antiviral drugs, the sole measure of control is limiting the Aedes mosquito vectors. DENV infection can be asymptomatic or a self-limited, acute febrile disease ranging in severity. The classical form of dengue fever (DF) is characterized by high fever, headache, stomach ache, rash, myalgia, and arthralgia. Severe dengue, dengue hemorrhagic fever (DHF), and dengue shock syndrome (DSS) are accompanied by thrombocytopenia, vascular leakage, and hypotension. DSS, which can be fatal, is characterized by systemic shock. Despite intensive research, the underlying mechanisms causing severe dengue is still not well understood partly due to the lack of appropriate animal models of infection and disease. However, even though it is clear that both viral and host factors play important roles in the course of infection, a fundamental knowledge gap still remains to be filled regarding host cell tropism, crucial host immune response mechanisms, and viral markers for virulence.

  8. Stochastic analysis of virus transport in aquifers

    USGS Publications Warehouse

    Campbell, Rehmann L.L.; Welty, C.; Harvey, R.W.


    A large-scale model of virus transport in aquifers is derived using spectral perturbation analysis. The effects of spatial variability in aquifer hydraulic conductivity and virus transport (attachment, detachment, and inactivation) parameters on large-scale virus transport are evaluated. A stochastic mean model of virus transport is developed by linking a simple system of local-scale free-virus transport and attached-virus conservation equations from the current literature with a random-field representation of aquifer and virus transport properties. The resultant mean equations for free and attached viruses are found to differ considerably from the local-scale equations on which they are based and include effects such as a free-virus effective velocity that is a function of aquifer heterogeneity as well as virus transport parameters. Stochastic mean free-virus breakthrough curves are compared with local model output in order to observe the effects of spatial variability on mean one-dimensional virus transport in three-dimensionally heterogeneous porous media. Significant findings from this theoretical analysis include the following: (1) Stochastic model breakthrough occurs earlier than local model breakthrough, and this effect is most pronounced for the least conductive aquifers studied. (2) A high degree of aquifer heterogeneity can lead to virus breakthrough actually preceding that of a conservative tracer. (3) As the mean hydraulic conductivity is increased, the mean model shows less sensitivity to the variance of the natural-logarithm hydraulic conductivity and mean virus diameter. (4) Incorporation of a heterogeneous colloid filtration term results in higher predicted concentrations than a simple first-order adsorption term for a given mean attachment rate. (5) Incorporation of aquifer heterogeneity leads to a greater range of virus diameters for which significant breakthrough occurs. (6) The mean model is more sensitive to the inactivation rate of viruses

  9. Acute otitis media and respiratory virus infections.


    Ruuskanen, O; Arola, M; Putto-Laurila, A; Mertsola, J; Meurman, O; Viljanen, M K; Halonen, P


    We studied the association of acute otitis media with different respiratory virus infections in a pediatric department on the basis of epidemics between 1980 and 1985. Altogether 4524 cases of acute otitis media were diagnosed. The diagnosis was confirmed by tympanocentesis in 3332 ears. Respiratory virus infection was diagnosed during the same period in 989 patients by detecting viral antigen in nasopharyngeal mucus. There was a significant correlation between acute otitis media and respiratory virus epidemics, especially respiratory syncytial virus epidemics. There was no significant correlation between outbreaks of other respiratory viruses and acute otitis media. Acute otitis media was diagnosed in 57% of respiratory syncytial virus, 35% of influenza A virus, 33% of parainfluenza type 3 virus, 30% of adenovirus, 28% of parainfluenza type 1 virus, 18% of influenza B virus and 10% of parainfluenza type 2 virus infections. These observations show a clear association of respiratory virus infections with acute otitis media. In this study on hospitalized children Haemophilus influenzae strains were the most common bacteriologic pathogens in middle ear fluid, occurring in 19% of cases. Streptococcus pneumoniae was present in 16% and Branhamella catarrhalis in 7% of cases. There was no association between specific viruses and bacteria observed in this study.

  10. Viruses and viruslike particles of eukaryotic algae.

    PubMed Central

    Van Etten, J L; Lane, L C; Meints, R H


    Until recently there was little interest or information on viruses and viruslike particles of eukaryotic algae. However, this situation is changing. In the past decade many large double-stranded DNA-containing viruses that infect two culturable, unicellular, eukaryotic green algae have been discovered. These viruses can be produced in large quantities, assayed by plaque formation, and analyzed by standard bacteriophage techniques. The viruses are structurally similar to animal iridoviruses, their genomes are similar to but larger (greater than 300 kbp) than that of poxviruses, and their infection process resembles that of bacteriophages. Some of the viruses have DNAs with low levels of methylated bases, whereas others have DNAs with high concentrations of 5-methylcytosine and N6-methyladenine. Virus-encoded DNA methyltransferases are associated with the methylation and are accompanied by virus-encoded DNA site-specific (restriction) endonucleases. Some of these enzymes have sequence specificities identical to those of known bacterial enzymes, and others have previously unrecognized specificities. A separate rod-shaped RNA-containing algal virus has structural and nucleotide sequence affinities to higher plant viruses. Quite recently, viruses have been associated with rapid changes in marine algal populations. In the next decade we envision the discovery of new algal viruses, clarification of their role in various ecosystems, discovery of commercially useful genes in these viruses, and exploitation of algal virus genetic elements in plant and algal biotechnology. Images PMID:1779928

  11. Plasmodesmata: channels for viruses on the move.


    Heinlein, Manfred


    The symplastic communication network established by plasmodesmata (PD) and connected phloem provides an essential pathway for spatiotemporal intercellular signaling in plant development but is also exploited by viruses for moving their genomes between cells in order to infect plants systemically. Virus movement depends on virus-encoded movement proteins (MPs) that target PD and therefore represent important keys to the cellular mechanisms underlying the intercellular trafficking of viruses and other macromolecules. Viruses and their MPs have evolved different mechanisms for intracellular transport and interaction with PD. Some viruses move from cell to cell by interacting with cellular mechanisms that control the size exclusion limit of PD whereas other viruses alter the PD architecture through assembly of specialized transport structures within the channel. Some viruses move between cells in the form of assembled virus particles whereas other viruses may interact with nucleic acid transport mechanisms to move their genomes in a non-encapsidated form. Moreover, whereas several viruses rely on the secretory pathway to target PD, other viruses interact with the cortical endoplasmic reticulum and associated cytoskeleton to spread infection. This chapter provides an introduction into viruses and their role in studying the diverse cellular mechanisms involved in intercellular PD-mediated macromolecular trafficking.

  12. Autophagic machinery activated by dengue virus enhances virus replication

    SciTech Connect

    Lee, Y.-R.; Lei, H.-Y.; Liu, M.-T.; Wang, J.-R.; Chen, S.-H.; Jiang-Shieh, Y.-F.; Lin, Y.-S.; Yeh, T.-M.; Liu, C.-C.; Liu, H.-S.


    Autophagy is a cellular response against stresses which include the infection of viruses and bacteria. We unravel that Dengue virus-2 (DV2) can trigger autophagic process in various infected cell lines demonstrated by GFP-LC3 dot formation and increased LC3-II formation. Autophagosome formation was also observed under the transmission electron microscope. DV2-induced autophagy further enhances the titers of extracellular and intracellular viruses indicating that autophagy can promote viral replication in the infected cells. Moreover, our data show that ATG5 protein is required to execute DV2-induced autophagy. All together, we are the first to demonstrate that DV can activate autophagic machinery that is favorable for viral replication.

  13. Polypeptide composition of spleen necrosis virus, a reticuloendotheliosis virus.

    PubMed Central

    Mosser, A G


    The polypeptide composition of virions of spleen necrosis virus, a reticuloendotheliosis virus, was determined using electrophoresis on sodium dodecyl sulfate-containing, 10 percent polyacrylamide gels. Ten polypeptides were resolved. Four of these were present in minor and somewhat variable amounts. Two proteins, gp71 and gp22, contained D-glucosamine and were located on the outer surface of the lipid envelope, as demonstrated by lactoperoxidase-catalyzed iodination and by bromelain digestion. The results suggest that two of the minor proteins, p36 and p26, were also located on the outer surface, although they lacked D-glucosamine. Treatment of the virus with 0.25 percent Nonidet P-40 and 1 percent dithiothreitol produced a subparticle with a buoyant density of approximately 1.31 g/cm-3. This particle was relatively enriched with polypeptides p77, p62, and p50 and contained small amounts of three other polypeptides. PMID:1142473

  14. [Bats and Viruses: complex relationships].


    Rodhain, F


    With more than 1 200 species, bats and flying foxes (Order Chiroptera) constitute the most important and diverse order of Mammals after Rodents. Many species of bats are insectivorous while others are frugivorous and few of them are hematophagous. Some of these animals fly during the night, others are crepuscular or diurnal. Some fly long distances during seasonal migrations. Many species are colonial cave-dwelling, living in a rather small home range while others are relatively solitary. However, in spite of the importance of bats for terrestrial biotic communities and ecosystem ecology, the diversity in their biology and lifestyles remain poorly known and underappreciated. More than sixty viruses have been detected or isolated in bats; these animals are therefore involved in the natural cycles of many of them. This is the case, for instance, of rabies virus and other Lyssavirus (Family Rhabdoviridae), Nipah and Hendra viruses (Paramyxoviridae), Ebola and Marburg viruses (Filoviridae), SARS-CoV and MERS-CoV (Coronaviridae). For these zoonotic viruses, a number of bat species are considered as important reservoir hosts, efficient disseminators or even directly responsible of the transmission. Some of these bat-borne viruses cause highly pathogenic diseases while others are of potential significance for humans and domestic or wild animals; so, bats are an important risk in human and animal public health. Moreover, some groups of viruses developed through different phylogenetic mechanisms of coevolution between viruses and bats. The fact that most of these viral infections are asymptomatic in bats has been observed since a long time but the mechanisms of the viral persistence are not clearly understood. The various bioecology of the different bat populations allows exchange of virus between migrating and non-migrating conspecific species. For a better understanding of the role of bats in the circulation of these viral zoonoses, epidemiologists must pay attention to

  15. [Bats and Viruses: complex relationships].


    Rodhain, F


    With more than 1 200 species, bats and flying foxes (Order Chiroptera) constitute the most important and diverse order of Mammals after Rodents. Many species of bats are insectivorous while others are frugivorous and few of them are hematophagous. Some of these animals fly during the night, others are crepuscular or diurnal. Some fly long distances during seasonal migrations. Many species are colonial cave-dwelling, living in a rather small home range while others are relatively solitary. However, in spite of the importance of bats for terrestrial biotic communities and ecosystem ecology, the diversity in their biology and lifestyles remain poorly known and underappreciated. More than sixty viruses have been detected or isolated in bats; these animals are therefore involved in the natural cycles of many of them. This is the case, for instance, of rabies virus and other Lyssavirus (Family Rhabdoviridae), Nipah and Hendra viruses (Paramyxoviridae), Ebola and Marburg viruses (Filoviridae), SARS-CoV and MERS-CoV (Coronaviridae). For these zoonotic viruses, a number of bat species are considered as important reservoir hosts, efficient disseminators or even directly responsible of the transmission. Some of these bat-borne viruses cause highly pathogenic diseases while others are of potential significance for humans and domestic or wild animals; so, bats are an important risk in human and animal public health. Moreover, some groups of viruses developed through different phylogenetic mechanisms of coevolution between viruses and bats. The fact that most of these viral infections are asymptomatic in bats has been observed since a long time but the mechanisms of the viral persistence are not clearly understood. The various bioecology of the different bat populations allows exchange of virus between migrating and non-migrating conspecific species. For a better understanding of the role of bats in the circulation of these viral zoonoses, epidemiologists must pay attention to

  16. Coping with Computer Viruses: General Discussion and Review of Symantec Anti-Virus for the Macintosh.

    ERIC Educational Resources Information Center

    Primich, Tracy


    Discusses computer viruses that attack the Macintosh and describes Symantec AntiVirus for Macintosh (SAM), a commercial program designed to detect and eliminate viruses; sample screen displays are included. SAM is recommended for use in library settings as well as two public domain virus protection programs. (four references) (MES)

  17. Generation of virus like particles for epizootic hemorrhagic disease virus.


    Forzan, Mario; Maan, Sushila; Mazzei, Maurizio; Belaganahalli, Manjunatha N; Bonuccelli, Lucia; Calamari, Monica; Carrozza, Maria Luisa; Cappello, Valentina; Di Luca, Mariagrazia; Bandecchi, Patrizia; Mertens, Peter P C; Tolari, Francesco


    Epizootic hemorrhagic disease virus (EHDV) is a distinct species within the genus Orbivirus, within the family Reoviridae. The epizootic hemorrhagic disease virus genome comprises ten segments of linear, double stranded (ds) RNA, which are packaged within each virus particle. The EHDV virion has a three layered capsid-structure, generated by four major viral proteins: VP2 and VP5 (outer capsid layer); VP7 (intermediate, core-surface layer) and VP3 (innermost, sub-core layer). Although EHDV infects cattle sporadically, several outbreaks have recently occurred in this species in five Mediterranean countries, indicating a potential threat to the European cattle industry. EHDV is transmitted by biting midges of the genus Culicoides, which can travel long distances through wind-born movements (particularly over water), increasing the potential for viral spread in new areas/countries. Expression systems to generate self-assembled virus like particles (VLPs) by simultaneous expression of the major capsid-proteins, have been established for several viruses (including bluetongue virus). This study has developed expression systems for production of EHDV VLPs, for use as non-infectious antigens in both vaccinology and serology studies, avoiding the risk of genetic reassortment between vaccine and field strains and facilitating large scale antigen production. Genes encoding the four major-capsid proteins of a field strain of EHDV-6, were isolated and cloned into transfer vectors, to generate two recombinant baculoviruses. The expression of these viral genes was assessed in insect cells by monitoring the presence of specific viral mRNAs and by western blotting. Electron microscopy studies confirmed the formation and purification of assembled VLPs. PMID:27473984

  18. Feline Leukemia Virus Immunity Induced by Whole Inactivated Virus Vaccination

    PubMed Central

    Torres, Andrea N.; O’Halloran, Kevin P.; Larson, Laurie J.; Schultz, Ronald D.; Hoover, Edward A.


    A fraction of cats exposed to feline leukemia virus (FeLV) effectively contain virus and resist persistent antigenemia/viremia. Using real-time PCR (qPCR) to quantitate circulating viral DNA levels, previously we detected persistent FeLV DNA in blood cells of non-antigenemic cats considered to have resisted FeLV challenge. In addition, previously we used RNA qPCR to quantitate circulating viral RNA levels and determined that the vast majority of viral DNA is transcriptionally active, even in the absence of antigenemia. A single comparison of all USDA-licensed commercially available FeLV vaccines using these modern sensitive methods has not been reported. To determine whether FeLV vaccination would prevent nucleic acid persistence, we assayed circulating viral DNA, RNA, antigen, infectious virus, and virus neutralizing (VN) antibody in vaccinated and unvaccinated cats challenged with infectious FeLV. We identified challenged vaccinates with undetectable antigenemia and viremia concomitant with persistent FeLV DNA and/or RNA. Moreover, these studies demonstrated that two whole inactivated virus (WIV) adjuvanted FeLV vaccines (Fort Dodge Animal Health’s Fel-O-Vax Lv-K® and Schering-Plough Animal Health’s FEVAXYN FeLV®) provided effective protection against FeLV challenge. In nearly every recipient of these vaccines, neither viral DNA, RNA, antigen, nor infectious virus could be detected in blood after FeLV challenge. Interestingly, this effective viral containment occurred despite a weak to undetectable VN antibody response. The above findings reinforce the precept of FeLV infection as a unique model of effective retroviral immunity elicited by WIV vaccination, and as such holds valuable insights into retroviral immunoprevention and therapy. PMID:20004483

  19. Viruses and thyroiditis: an update

    PubMed Central

    Desailloud, Rachel; Hober, Didier


    Viral infections are frequently cited as a major environmental factor involved in subacute thyroiditis and autoimmune thyroid diseases This review examines the data related to the role of viruses in the development of thyroiditis. Our research has been focused on human data. We have reviewed virological data for each type of thyroiditis at different levels of evidence; epidemiological data, serological data or research on circulating viruses, direct evidence of thyroid tissue infection. Interpretation of epidemiological and serological data must be cautious as they don't prove that this pathogen is responsible for the disease. However, direct evidence of the presence of viruses or their components in the organ are available for retroviruses (HFV) and mumps in subacute thyroiditis, for retroviruses (HTLV-1, HFV, HIV and SV40) in Graves's disease and for HTLV-1, enterovirus, rubella, mumps virus, HSV, EBV and parvovirus in Hashimoto's thyroiditis. However, it remains to determine whether they are responsible for thyroid diseases or whether they are just innocent bystanders. Further studies are needed to clarify the relationship between viruses and thyroid diseases, in order to develop new strategies for prevention and/or treatment. PMID:19138419

  20. Droplet Microfluidics for Virus Discovery

    NASA Astrophysics Data System (ADS)

    Rotem, Assaf; Cockrell, Shelley; Guo, Mira; Pipas, James; Weitz, David


    The ability to detect, isolate, and characterize an infectious agent is important for diagnosing and curing infectious diseases. Detecting new viral diseases is a challenge because the number of virus particles is often low and/or localized to a small subset of cells. Even if a new virus is detected, it is difficult to isolate it from clinical or environmental samples where multiple viruses are present each with very different properties. Isolation is crucial for whole genome sequencing because reconstructing a genome from fragments of many different genomes is practically impossible. We present a Droplet Microfluidics platform that can detect, isolate and sequence single viral genomes from complex samples containing mixtures of many viruses. We use metagenomic information about the sample of mixed viruses to select a short genomic sequence whose genome we are interested in characterizing. We then encapsulate single virions from the same sample in picoliter volume droplets and screen for successful PCR amplification of the sequence of interest. The selected drops are pooled and their contents sequenced to reconstruct the genome of interest. This method provides a general tool for detecting, isolating and sequencing genetic elements in clinical and environmental samples.

  1. Designing herpes viruses as oncolytics

    PubMed Central

    Peters, Cole; Rabkin, Samuel D


    Oncolytic herpes simplex virus (oHSV) was one of the first genetically-engineered oncolytic viruses. Because HSV is a natural human pathogen that can cause serious disease, it is incumbent that it can be genetically-engineered or significantly attenuated for safety. Here, we present a detailed explanation of the functions of HSV-1 genes frequently mutated to endow oncolytic activity. These genes are nonessential for growth in tissue culture cells but are important for growth in postmitotic cells, interfering with intrinsic antiviral and innate immune responses or causing pathology, functions dispensable for replication in cancer cells. Understanding the function of these genes leads to informed creation of new oHSVs with better therapeutic efficacy. Virus infection and replication can also be directed to cancer cells through tumor-selective receptor binding and transcriptional- or post-transcriptional miRNA-targeting, respectively. In addition to the direct effects of oHSV on infected cancer cells and tumors, oHSV can be “armed” with transgenes that are: reporters, to track virus replication and spread; cytotoxic, to kill uninfected tumor cells; immune modulatory, to stimulate antitumor immunity; or tumor microenvironment altering, to enhance virus spread or to inhibit tumor growth. In addition to HSV-1, other alphaherpesviruses are also discussed for their oncolytic activity. PMID:26462293

  2. Control of viruses infecting grapevine.


    Maliogka, Varvara I; Martelli, Giovanni P; Fuchs, Marc; Katis, Nikolaos I


    Grapevine is a high value vegetatively propagated fruit crop that suffers from numerous viruses, including some that seriously affect the profitability of vineyards. Nowadays, 64 viruses belonging to different genera and families have been reported in grapevines and new virus species will likely be described in the future. Three viral diseases namely leafroll, rugose wood, and infectious degeneration are of major economic importance worldwide. The viruses associated with these diseases are transmitted by mealybugs, scale and soft scale insects, or dagger nematodes. Here, we review control measures of the major grapevine viral diseases. More specifically, emphasis is laid on (i) approaches for the production of clean stocks and propagative material through effective sanitation, robust diagnosis, as well as local and regional certification efforts, (ii) the management of vectors of viruses using cultural, biological, and chemical methods, and (iii) the production of resistant grapevines mainly through the application of genetic engineering. The benefits and limitations of the different control measures are discussed with regard to accomplishments and future research directions.

  3. Quantitative nanoscale electrostatics of viruses.


    Hernando-Pérez, M; Cartagena-Rivera, A X; Lošdorfer Božič, A; Carrillo, P J P; San Martín, C; Mateu, M G; Raman, A; Podgornik, R; de Pablo, P J


    Electrostatics is one of the fundamental driving forces of the interaction between biomolecules in solution. In particular, the recognition events between viruses and host cells are dominated by both specific and non-specific interactions and the electric charge of viral particles determines the electrostatic force component of the latter. Here we probe the charge of individual viruses in liquid milieu by measuring the electrostatic force between a viral particle and the Atomic Force Microscope tip. The force spectroscopy data of co-adsorbed ϕ29 bacteriophage proheads and mature virions, adenovirus and minute virus of mice capsids is utilized for obtaining the corresponding density of charge for each virus. The systematic differences of the density of charge between the viral particles are consistent with the theoretical predictions obtained from X-ray structural data. Our results show that the density of charge is a distinguishing characteristic of each virus, depending crucially on the nature of the viral capsid and the presence/absence of the genetic material. PMID:26228582

  4. RB virus: a strain of Friend virus that produces a 'Friend virus-like' disease in Fv-2rr mice.


    Geib, R W; Seaward, M B; Stevens, M L; Cho, C L; Majumdar, M


    RB virus is a newly derived strain of Friend virus that was adapted to produce a 'Friend-like' disease in mice that are genetically resistant to wild-type Friend virus. RB virus was produced by passing high titers of the wild-type Friend virus (Lilly-Steeves polycythemia-producing strain) through adult Fv-2rr mice. Titration of the defective spleen focus-forming virus indicated RB virus infected similar numbers of Fv-2ss or Fv-2rr target cells. Analysis of the spleens from mice infected with RB virus indicated that RB induced the early stage of Friend disease (erythroid proliferation) in both Fv-2rr and Fv-2ss mice. Fv-2ss mice infected with RB virus developed the classical Friend disease within 3 weeks. In contrast, the percentage of Fv-2rr mice developing the 'Friend-like' disease after infection with RB virus never exceeded 60%. The latency period of RBV in Fv-2rr mice was strain dependent. D2.R16 (Fv-2rr) developed the syndrome more rapidly than C57BL/6 (Fv-2rr). RB virus retained the capacity to transform erythroprogenitor cells from both Fv-2ss and Fv-2rr animals. Cells infected with RB virus consistently produced a modified SFFV envelope protein, gp48.

  5. Influenza Virus Infection of Marine Mammals.


    Fereidouni, Sasan; Munoz, Olga; Von Dobschuetz, Sophie; De Nardi, Marco


    Interspecies transmission may play a key role in the evolution and ecology of influenza A viruses. The importance of marine mammals as hosts or carriers of potential zoonotic pathogens such as highly pathogenic H5 and H7 influenza viruses is not well understood. The fact that influenza viruses are some of the few zoonotic pathogens known to have caused infection in marine mammals, evidence for direct transmission of influenza A virus H7N7 subtype from seals to man, transmission of pandemic H1N1 influenza viruses to seals and also limited evidence for long-term persistence of influenza B viruses in seal populations without significant genetic change, makes monitoring of influenza viruses in marine mammal populations worth being performed. In addition, such monitoring studies could be a great tool to better understand the ecology of influenza viruses in nature. PMID:25231137

  6. A Multicomponent Animal Virus Isolated from Mosquitoes.


    Ladner, Jason T; Wiley, Michael R; Beitzel, Brett; Auguste, Albert J; Dupuis, Alan P; Lindquist, Michael E; Sibley, Samuel D; Kota, Krishna P; Fetterer, David; Eastwood, Gillian; Kimmel, David; Prieto, Karla; Guzman, Hilda; Aliota, Matthew T; Reyes, Daniel; Brueggemann, Ernst E; St John, Lena; Hyeroba, David; Lauck, Michael; Friedrich, Thomas C; O'Connor, David H; Gestole, Marie C; Cazares, Lisa H; Popov, Vsevolod L; Castro-Llanos, Fanny; Kochel, Tadeusz J; Kenny, Tara; White, Bailey; Ward, Michael D; Loaiza, Jose R; Goldberg, Tony L; Weaver, Scott C; Kramer, Laura D; Tesh, Robert B; Palacios, Gustavo


    RNA viruses exhibit a variety of genome organization strategies, including multicomponent genomes in which each segment is packaged separately. Although multicomponent genomes are common among viruses infecting plants and fungi, their prevalence among those infecting animals remains unclear. We characterize a multicomponent RNA virus isolated from mosquitoes, designated Guaico Culex virus (GCXV). GCXV belongs to a diverse clade of segmented viruses (Jingmenvirus) related to the prototypically unsegmented Flaviviridae. The GCXV genome comprises five segments, each of which appears to be separately packaged. The smallest segment is not required for replication, and its presence is variable in natural infections. We also describe a variant of Jingmen tick virus, another Jingmenvirus, sequenced from a Ugandan red colobus monkey, thus expanding the host range of this segmented and likely multicomponent virus group. Collectively, this study provides evidence for the existence of multicomponent animal viruses and their potential relevance for animal and human health.

  7. A Multicomponent Animal Virus Isolated from Mosquitoes.


    Ladner, Jason T; Wiley, Michael R; Beitzel, Brett; Auguste, Albert J; Dupuis, Alan P; Lindquist, Michael E; Sibley, Samuel D; Kota, Krishna P; Fetterer, David; Eastwood, Gillian; Kimmel, David; Prieto, Karla; Guzman, Hilda; Aliota, Matthew T; Reyes, Daniel; Brueggemann, Ernst E; St John, Lena; Hyeroba, David; Lauck, Michael; Friedrich, Thomas C; O'Connor, David H; Gestole, Marie C; Cazares, Lisa H; Popov, Vsevolod L; Castro-Llanos, Fanny; Kochel, Tadeusz J; Kenny, Tara; White, Bailey; Ward, Michael D; Loaiza, Jose R; Goldberg, Tony L; Weaver, Scott C; Kramer, Laura D; Tesh, Robert B; Palacios, Gustavo


    RNA viruses exhibit a variety of genome organization strategies, including multicomponent genomes in which each segment is packaged separately. Although multicomponent genomes are common among viruses infecting plants and fungi, their prevalence among those infecting animals remains unclear. We characterize a multicomponent RNA virus isolated from mosquitoes, designated Guaico Culex virus (GCXV). GCXV belongs to a diverse clade of segmented viruses (Jingmenvirus) related to the prototypically unsegmented Flaviviridae. The GCXV genome comprises five segments, each of which appears to be separately packaged. The smallest segment is not required for replication, and its presence is variable in natural infections. We also describe a variant of Jingmen tick virus, another Jingmenvirus, sequenced from a Ugandan red colobus monkey, thus expanding the host range of this segmented and likely multicomponent virus group. Collectively, this study provides evidence for the existence of multicomponent animal viruses and their potential relevance for animal and human health. PMID:27569558

  8. Control of virus diseases of berry crops.


    Martin, Robert R; Tzanetakis, Ioannis E


    Virus control in berry crops starts with the development of plants free of targeted pathogens, usually viruses, viroids, phytoplasmas, and systemic bacteria, through a combination of testing and therapy. These then become the top-tier plants in certification programs and are the source from which all certified plants are produced, usually after multiple cycles of propagation. In certification schemes, efforts are made to produce plants free of the targeted pathogens to provide plants of high health status to berry growers. This is achieved using a systems approach to manage virus vectors. Once planted in fruit production fields, virus control shifts to disease control where efforts are focused on controlling viruses or virus complexes that result in disease. In fruiting fields, infection with a virus that does not cause disease is of little concern to growers. Virus control is based on the use of resistance and tolerance, vector management, and isolation.

  9. Virus Discovery Using Tick Cell Lines

    PubMed Central

    Bell-Sakyi, Lesley; Attoui, Houssam


    While ticks have been known to harbor and transmit pathogenic arboviruses for over 80 years, the application of high-throughput sequencing technologies has revealed that ticks also appear to harbor a diverse range of endogenous tick-only viruses belonging to many different families. Almost nothing is known about these viruses; indeed, it is unclear in most cases whether the identified viral sequences are derived from actual replication-competent viruses or from endogenous virus elements incorporated into the ticks’ genomes. Tick cell lines play an important role in virus discovery and isolation through the identification of novel viruses chronically infecting such cell lines and by acting as host cells to aid in determining whether or not an entire replication-competent, infective virus is present in a sample. Here, we review recent progress in tick-borne virus discovery and comment on the actual and potential applications for tick cell lines in this emerging research area. PMID:27679414

  10. Infectious enveloped RNA virus antigenic chimeras.


    London, S D; Schmaljohn, A L; Dalrymple, J M; Rice, C M


    Random insertion mutagenesis has been used to construct infectious Sindbis virus structural protein chimeras containing a neutralization epitope from a heterologous virus, Rift Valley fever virus. Insertion sites, permissive for recovery of chimeric viruses with growth properties similar to the parental virus, were found in the virion E2 glycoprotein and the secreted E3 glycoprotein. For the E2 chimeras, the epitope was expressed on the virion surface and stimulated a partially protective immune response to Rift Valley fever virus infection in vivo. Besides providing a possible approach for developing live attenuated vaccine viruses, insertion of peptide ligands into virion surface proteins may ultimately allow targeting of virus infection to specific cell types.

  11. Virus Discovery Using Tick Cell Lines

    PubMed Central

    Bell-Sakyi, Lesley; Attoui, Houssam


    While ticks have been known to harbor and transmit pathogenic arboviruses for over 80 years, the application of high-throughput sequencing technologies has revealed that ticks also appear to harbor a diverse range of endogenous tick-only viruses belonging to many different families. Almost nothing is known about these viruses; indeed, it is unclear in most cases whether the identified viral sequences are derived from actual replication-competent viruses or from endogenous virus elements incorporated into the ticks’ genomes. Tick cell lines play an important role in virus discovery and isolation through the identification of novel viruses chronically infecting such cell lines and by acting as host cells to aid in determining whether or not an entire replication-competent, infective virus is present in a sample. Here, we review recent progress in tick-borne virus discovery and comment on the actual and potential applications for tick cell lines in this emerging research area.

  12. Swine Influenza/Variant Influenza Viruses


    ... Humans Key Facts about Human Infections with Variant Viruses Interim Guidance for Clinicians on Human Infections Background, Risk Assessment & Reporting Reported Infections with Variant Influenza Viruses in the United States since 2005 Prevention Treatment ...

  13. Avian Influenza A Virus Infections in Humans


    ... Research Making a Candidate Vaccine Virus Related Links Influenza Types Seasonal Avian Swine Variant Pandemic Other Get ... Submit What's this? Submit Button Past Newsletters Avian Influenza A Virus Infections in Humans Language: English Españ ...

  14. A "virus" disease of chinook salmon

    USGS Publications Warehouse

    Ross, A.J.; Rucker, R.R.


    Epizootics among chinook salmon fingerlings at the Coleman National Fish Hatchery have occurred periodically since 1941. A virus or virus-like filterable agent has been demonstrated to be the causative agent of this disease.

  15. The Origins of the AIDS Virus.

    ERIC Educational Resources Information Center

    Essex, Max; Kanki, Phyllis J.


    States that the virus is not unique since it has been discovered in other primates as well as in man. Relates studies of viruses that indicate some have evolved disease-free coexistence with their animal hosts. (RT)

  16. FAQ: West Nile Virus and Dead Birds


    ... Education Public Service Videos West Nile Virus & Dead Birds Recommend on Facebook Tweet Share Compartir On this ... dead bird sightings to local authorities. How do birds get infected with West Nile virus? West Nile ...

  17. A Literature Review of Zika Virus.


    Plourde, Anna R; Bloch, Evan M


    Zika virus is a mosquitoborne flavivirus that is the focus of an ongoing pandemic and public health emergency. Previously limited to sporadic cases in Africa and Asia, the emergence of Zika virus in Brazil in 2015 heralded rapid spread throughout the Americas. Although most Zika virus infections are characterized by subclinical or mild influenza-like illness, severe manifestations have been described, including Guillain-Barre syndrome in adults and microcephaly in babies born to infected mothers. Neither an effective treatment nor a vaccine is available for Zika virus; therefore, the public health response primarily focuses on preventing infection, particularly in pregnant women. Despite growing knowledge about this virus, questions remain regarding the virus's vectors and reservoirs, pathogenesis, genetic diversity, and potential synergistic effects of co-infection with other circulating viruses. These questions highlight the need for research to optimize surveillance, patient management, and public health intervention in the current Zika virus epidemic.

  18. A Literature Review of Zika Virus.


    Plourde, Anna R; Bloch, Evan M


    Zika virus is a mosquitoborne flavivirus that is the focus of an ongoing pandemic and public health emergency. Previously limited to sporadic cases in Africa and Asia, the emergence of Zika virus in Brazil in 2015 heralded rapid spread throughout the Americas. Although most Zika virus infections are characterized by subclinical or mild influenza-like illness, severe manifestations have been described, including Guillain-Barre syndrome in adults and microcephaly in babies born to infected mothers. Neither an effective treatment nor a vaccine is available for Zika virus; therefore, the public health response primarily focuses on preventing infection, particularly in pregnant women. Despite growing knowledge about this virus, questions remain regarding the virus's vectors and reservoirs, pathogenesis, genetic diversity, and potential synergistic effects of co-infection with other circulating viruses. These questions highlight the need for research to optimize surveillance, patient management, and public health intervention in the current Zika virus epidemic. PMID:27070380

  19. About Epstein-Barr Virus (EBV)


    ... Providers Laboratory Testing References & Resources About Epstein-Barr Virus (EBV) Recommend on Facebook Tweet Share Compartir On ... Page Symptoms Transmission Diagnosis Prevention & Treatment Epstein-Barr virus (EBV), also known as human herpesvirus 4, is ...

  20. Virus Discovery Using Tick Cell Lines.


    Bell-Sakyi, Lesley; Attoui, Houssam


    While ticks have been known to harbor and transmit pathogenic arboviruses for over 80 years, the application of high-throughput sequencing technologies has revealed that ticks also appear to harbor a diverse range of endogenous tick-only viruses belonging to many different families. Almost nothing is known about these viruses; indeed, it is unclear in most cases whether the identified viral sequences are derived from actual replication-competent viruses or from endogenous virus elements incorporated into the ticks' genomes. Tick cell lines play an important role in virus discovery and isolation through the identification of novel viruses chronically infecting such cell lines and by acting as host cells to aid in determining whether or not an entire replication-competent, infective virus is present in a sample. Here, we review recent progress in tick-borne virus discovery and comment on the actual and potential applications for tick cell lines in this emerging research area. PMID:27679414

  1. Serological relationship of the Tacaribe complex of viruses to lymphocytic choriomeningitis virus.


    Rowe, W P; Pugh, W E; Webb, P A; Peters, C J


    By means of the indirect fluorescent-antibody test, cross serological reactivity was demonstrated between lymphocytic choriomeningitis (LCM) virus and the viruses of the Tacaribe complex. Antisera to all members of the Tacaribe complex reacted with LCM virus; LCM antisera gave significant staining of Amapari virus, but minimal or inconsistent reactions with Tacaribe virus, and no reaction with two other viruses of the Tacaribe complex. A low level cross-reaction was observed in complement fixation tests of Machupo and Pichinde antisera against LCM antigen. Immunization with Tacaribe and Amapari viruses did not protect mice against challenge with LCM virus. Because of the identical appearance of the virions, the sharing of antigens, and the many biological similarities between LCM and the Tacaribe complex viruses, it is proposed that they be considered as constituting a new taxonomic group of viruses.

  2. Preservation of Influenza Virus Infectivity by Lyophilization

    PubMed Central

    Beardmore, W. B.; Clark, T. D.; Jones, K. V.


    A method of lyophilizing influenza virus in allantoic fluid with retention of high-titer of egg infectivity is described. Five strains of virus were lyophilized, and all were much more stable than fluid virus preparations, retaining 2 to 3 logs of infectivity after storage at 37 C for 60 to 95 days. Statistical analysis of an accelerated storage test by extrapolation of viral degradation indicates that the lyophilized viruses are stable indefinitely at or below room temperature. PMID:5645420

  3. Rapid genotyping of swine influenza viruses.


    Mak, Polly W Y; Wong, Chloe K S; Li, Olive T W; Chan, Kwok Hung; Cheung, Chung Lam; Ma, Edward S; Webby, Richard J; Guan, Yi; Malik Peiris, Joseph S; Poon, Leo L M


    The emergence of pandemic (H1N1) 2009 virus highlighted the need for enhanced surveillance of swine influenza viruses. We used real-time reverse-transcription PCR-based genotyping and found that this rapid and simple genotyping method may identify reassortants derived from viruses of Eurasian avian-like, triple reassortant-like, and pandemic (H1N1) 2009 virus lineages.

  4. Rapid Genotyping of Swine Influenza Viruses

    PubMed Central

    Mak, Polly W.Y.; Wong, Chloe K.S.; Li, Olive T.W.; Chan, Kwok Hung; Cheung, Chung Lam; Ma, Edward S.; Webby, Richard J.; Guan, Yi; Peiris, Joseph S. Malik


    The emergence of pandemic (H1N1) 2009 virus highlighted the need for enhanced surveillance of swine influenza viruses. We used real-time reverse–transcription PCR–based genotyping and found that this rapid and simple genotyping method may identify reassortants derived from viruses of Eurasian avian-like, triple reassortant-like, and pandemic (H1N1) 2009 virus lineages. PMID:21470462

  5. Historical review: viruses, crystals and geodesic domes.


    Morgan, Gregory J


    In the mid 1950s, Francis Crick and James Watson attempted to explain the structure of spherical viruses. They hypothesized that spherical viruses consist of 60 identical equivalently situated subunits. Such an arrangement has icosahedral symmetry. Subsequent biophysical and electron micrographic data suggested that many viruses had >60 subunits. Drawing inspiration from architecture, Donald Caspar and Aaron Klug discovered a solution to the problem - they proposed that spherical viruses were structured like miniature geodesic domes.

  6. Reverse Genetics of Respiratory Syncytial Virus.


    Stobart, Christopher C; Hotard, Anne L; Meng, Jia; Moore, Martin L


    Respiratory syncytial virus (RSV) is a negative-strand RNA virus that is associated with severe lower respiratory tract infections in young infants and the elderly. RSV remains a leading cause worldwide of infant mortality, and despite the high clinical and economic burden of the virus there are currently no available vaccines. Here, we describe the methods for recovery of recombinant RSV viruses using a bacterial artificial chromosome and methods related to procurement and expansion of stocks of RSV mutants. PMID:27464692

  7. Characteristics of Filoviridae: Marburg and Ebola Viruses

    NASA Astrophysics Data System (ADS)

    Beer, Brigitte; Kurth, Reinhard; Bukreyev, Alexander

    Filoviruses are enveloped, nonsegmented negative-stranded RNA viruses. The two species, Marburg and Ebola virus, are serologically, biochemically, and genetically distinct. Marburg virus was first isolated during an outbreak in Europe in 1967, and Ebola virus emerged in 1976 as the causative agent of two simultaneous outbreaks in southern Sudan and northern Zaire. Although the main route of infection is known to be person-to-person transmission by intimate contact, the natural reservoir for filoviruses still remains a mystery.

  8. Searching for virus phylotypes

    PubMed Central

    Chevenet, François; Jung, Matthieu; Peeters, Martine; de Oliveira, Tulio; Gascuel, Olivier


    Motivation: Large phylogenies are being built today to study virus evolution, trace the origin of epidemics, establish the mode of transmission and survey the appearance of drug resistance. However, no tool is available to quickly inspect these phylogenies and combine them with extrinsic traits (e.g. geographic location, risk group, presence of a given resistance mutation), seeking to extract strain groups of specific interest or requiring surveillance. Results: We propose a new method for obtaining such groups, which we call phylotypes, from a phylogeny having taxa (strains) annotated with extrinsic traits. Phylotypes are subsets of taxa with close phylogenetic relationships and common trait values. The method combines ancestral trait reconstruction using parsimony, with combinatorial and numerical criteria measuring tree shape characteristics and the diversity and separation of the potential phylotypes. A shuffling procedure is used to assess the statistical significance of phylotypes. All algorithms have linear time complexity. This results in low computing times, typically a few minutes for the larger data sets with a number of shuffling steps. Two HIV-1 data sets are analyzed, one of which is large, containing >3000 strains of HIV-1 subtype C collected worldwide, where the method shows its ability to recover known clusters and transmission routes, and to detect new ones. Availability: This method and companion tools are implemented in an interactive Web interface (, which provides a wide choice of graphical views and output formats, and allows for exploratory analyses of large data sets. Contact:, Supplementary information: Supplementary data are available at Bioinformatics online. PMID:23329414

  9. [Zika virus, an emerging threat].


    Salinas, Sara; Foulongne, Vincent; Loustalot, Fabien; Fournier-Wirth, Chantal; Molès, Jean-Pierre; Briant, Laurence; Nagot, Nicolas; Van de Perre, Philippe; Simonin, Yannick


    Zika virus, discovered in 1947, is particularly publicized because of its involvement in a major epidemic that began in 2015 and which epicenter is located in Latin America, mainly in Brazil. In the majority of cases (70-80 %) the infection is asymptomatic, however in some patients, moderate fever, skin rash, conjunctivitis and myalgia may occur. More alarming, neurological complications are reported, in particular cases of microcephaly probably resulting from the infection of women in the first or second trimester of pregnancy. Moreover, Guillain-Barré syndromes have also been identified in patients whose infection was confirmed. The extent of the current outbreak reveals the very primitive state of knowledge about the pathophysiology of this virus. Thus, a global effort is being undertaken in order to quickly characterize the molecular interaction of the virus with human cells, but also to develop specific diagnostic assays and vaccinal approaches.

  10. Hepatitis Virus Infections in Poultry.


    Yugo, Danielle M; Hauck, Ruediger; Shivaprasad, H L; Meng, Xiang-Jin


    Viral hepatitis in poultry is a complex disease syndrome caused by several viruses belonging to different families including avian hepatitis E virus (HEV), duck hepatitis B virus (DHBV), duck hepatitis A virus (DHAV-1, -2, -3), duck hepatitis virus Types 2 and 3, fowl adenoviruses (FAdV), and turkey hepatitis virus (THV). While these hepatitis viruses share the same target organ, the liver, they each possess unique clinical and biological features. In this article, we aim to review the common and unique features of major poultry hepatitis viruses in an effort to identify the knowledge gaps and aid the prevention and control of poultry viral hepatitis. Avian HEV is an Orthohepevirus B in the family Hepeviridae that naturally infects chickens and consists of three distinct genotypes worldwide. Avian HEV is associated with hepatitis-splenomegaly syndrome or big liver and spleen disease in chickens, although the majority of the infected birds are subclinical. Avihepadnaviruses in the family of Hepadnaviridae have been isolated from ducks, snow geese, white storks, grey herons, cranes, and parrots. DHBV evolved with the host as a noncytopathic form without clinical signs and rarely progressed to chronicity. The outcome for DHBV infection varies by the host's ability to elicit an immune response and is dose and age dependent in ducks, thus mimicking the pathogenesis of human hepatitis B virus (HBV) infections and providing an excellent animal model for human HBV. DHAV is a picornavirus that causes a highly contagious virus infection in ducks with up to 100% flock mortality in ducklings under 6 wk of age, while older birds remain unaffected. The high morbidity and mortality has an economic impact on intensive duck production farming. Duck hepatitis virus Types 2 and 3 are astroviruses in the family of Astroviridae with similarity phylogenetically to turkey astroviruses, implicating the potential for cross-species infections between strains. Duck astrovirus (DAstV) causes

  11. Viruses as nanomedicine for cancer

    PubMed Central

    Badrinath, Narayanasamy; Heo, Jeong; Yoo, So Young


    Oncolytic virotherapy, a type of nanomedicine in which oncolytic viruses (OVs) are used to selectively infect and lyse cancer cells, is an emerging field in cancer therapy. Some OVs exhibit a specific tropism for cancer cells, whereas others require genetic modification to enhance their binding with and entry into cancer cells. OVs both kill tumor cells and induce the host’s immune response against tumor cells. Armed with antitumor cellular molecules, antibodies, and/or in combination with anticancer drugs, OVs can accelerate the lysis of cancer cells. Among the OVs, vaccinia virus has been the focus of preclinical and clinical research because of its many favorable properties. In this review, the basic mechanisms of action of OVs are presented, including their entry, survival, tumor lysis, and immune activation, and the latest research in vaccinia virus-based virotherapy and its status as an anticancer nanomedicine in prospective clinical trials are discussed. PMID:27703350

  12. Hepatitis Virus Infections in Poultry.


    Yugo, Danielle M; Hauck, Ruediger; Shivaprasad, H L; Meng, Xiang-Jin


    Viral hepatitis in poultry is a complex disease syndrome caused by several viruses belonging to different families including avian hepatitis E virus (HEV), duck hepatitis B virus (DHBV), duck hepatitis A virus (DHAV-1, -2, -3), duck hepatitis virus Types 2 and 3, fowl adenoviruses (FAdV), and turkey hepatitis virus (THV). While these hepatitis viruses share the same target organ, the liver, they each possess unique clinical and biological features. In this article, we aim to review the common and unique features of major poultry hepatitis viruses in an effort to identify the knowledge gaps and aid the prevention and control of poultry viral hepatitis. Avian HEV is an Orthohepevirus B in the family Hepeviridae that naturally infects chickens and consists of three distinct genotypes worldwide. Avian HEV is associated with hepatitis-splenomegaly syndrome or big liver and spleen disease in chickens, although the majority of the infected birds are subclinical. Avihepadnaviruses in the family of Hepadnaviridae have been isolated from ducks, snow geese, white storks, grey herons, cranes, and parrots. DHBV evolved with the host as a noncytopathic form without clinical signs and rarely progressed to chronicity. The outcome for DHBV infection varies by the host's ability to elicit an immune response and is dose and age dependent in ducks, thus mimicking the pathogenesis of human hepatitis B virus (HBV) infections and providing an excellent animal model for human HBV. DHAV is a picornavirus that causes a highly contagious virus infection in ducks with up to 100% flock mortality in ducklings under 6 wk of age, while older birds remain unaffected. The high morbidity and mortality has an economic impact on intensive duck production farming. Duck hepatitis virus Types 2 and 3 are astroviruses in the family of Astroviridae with similarity phylogenetically to turkey astroviruses, implicating the potential for cross-species infections between strains. Duck astrovirus (DAstV) causes

  13. [Zika virus, an emerging threat].


    Salinas, Sara; Foulongne, Vincent; Loustalot, Fabien; Fournier-Wirth, Chantal; Molès, Jean-Pierre; Briant, Laurence; Nagot, Nicolas; Van de Perre, Philippe; Simonin, Yannick


    Zika virus, discovered in 1947, is particularly publicized because of its involvement in a major epidemic that began in 2015 and which epicenter is located in Latin America, mainly in Brazil. In the majority of cases (70-80 %) the infection is asymptomatic, however in some patients, moderate fever, skin rash, conjunctivitis and myalgia may occur. More alarming, neurological complications are reported, in particular cases of microcephaly probably resulting from the infection of women in the first or second trimester of pregnancy. Moreover, Guillain-Barré syndromes have also been identified in patients whose infection was confirmed. The extent of the current outbreak reveals the very primitive state of knowledge about the pathophysiology of this virus. Thus, a global effort is being undertaken in order to quickly characterize the molecular interaction of the virus with human cells, but also to develop specific diagnostic assays and vaccinal approaches. PMID:27137695

  14. [Capping strategies in RNA viruses].


    Bouvet, Mickaël; Ferron, François; Imbert, Isabelle; Gluais, Laure; Selisko, Barbara; Coutard, Bruno; Canard, Bruno; Decroly, Etienne


    Most viruses use the mRNA-cap dependent cellular translation machinery to translate their mRNAs into proteins. The addition of a cap structure at the 5' end of mRNA is therefore an essential step for the replication of many virus families. Additionally, the cap protects the viral RNA from degradation by cellular nucleases and prevents viral RNA recognition by innate immunity mechanisms. Viral RNAs acquire their cap structure either by using cellular capping enzymes, by stealing the cap of cellular mRNA in a process named "cap snatching", or using virus-encoded capping enzymes. Many viral enzymes involved in this process have recently been structurally and functionally characterized. These studies have revealed original cap synthesis mechanisms and pave the way towards the development of specific inhibitors bearing antiviral drug potential. PMID:22549871

  15. Virus detection and quantification using electrical parameters

    PubMed Central

    Ahmad, Mahmoud Al; Mustafa, Farah; Ali, Lizna M.; Rizvi, Tahir A.


    Here we identify and quantitate two similar viruses, human and feline immunodeficiency viruses (HIV and FIV), suspended in a liquid medium without labeling, using a semiconductor technique. The virus count was estimated by calculating the impurities inside a defined volume by observing the change in electrical parameters. Empirically, the virus count was similar to the absolute value of the ratio of the change of the virus suspension dopant concentration relative to the mock dopant over the change in virus suspension Debye volume relative to mock Debye volume. The virus type was identified by constructing a concentration-mobility relationship which is unique for each kind of virus, allowing for a fast (within minutes) and label-free virus quantification and identification. For validation, the HIV and FIV virus preparations were further quantified by a biochemical technique and the results obtained by both approaches corroborated well. We further demonstrate that the electrical technique could be applied to accurately measure and characterize silica nanoparticles that resemble the virus particles in size. Based on these results, we anticipate our present approach to be a starting point towards establishing the foundation for label-free electrical-based identification and quantification of an unlimited number of viruses and other nano-sized particles. PMID:25355078

  16. Citrus tristeza virus-host interactions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Citrus tristeza virus (CTV) is a phloem-limited virus whose natural host range is restricted to citrus and related species. Although the virus has killed millions of trees, almost destroying whole industries, and continually limits production in many citrus growing areas, most isolates are mild or s...

  17. Ebola Virus Persistence in Semen Ex Vivo.


    Fischer, Robert J; Judson, Seth; Miazgowicz, Kerri; Bushmaker, Trent; Munster, Vincent J


    On March 20, 2015, a case of Ebola virus disease was identified in Liberia that most likely was transmitted through sexual contact. We assessed the efficiency of detecting Ebola virus in semen samples by molecular diagnostics and the stability of Ebola virus in ex vivo semen under simulated tropical conditions. PMID:26811984

  18. Virus Infections of Honeybees Apis Mellifera

    PubMed Central

    Tantillo, Giuseppina; Bottaro, Marilisa; Di Pinto, Angela; Martella, Vito; Di Pinto, Pietro


    The health and vigour of honeybee colonies are threatened by numerous parasites (such as Varroa destructor and Nosema spp.) and pathogens, including viruses, bacteria, protozoa. Among honeybee pathogens, viruses are one of the major threats to the health and well-being of honeybees and cause serious concern for researchers and beekeepers. To tone down the threats posed by these invasive organisms, a better understanding of bee viral infections will be of crucial importance in developing effective and environmentally benign disease control strategies. Here we summarize recent progress in the understanding of the morphology, genome organization, transmission, epidemiology and pathogenesis of eight honeybee viruses: Deformed wing virus (DWV) and Kakugo virus (KV); Sacbrood virus (SBV); Black Queen cell virus (BQCV); Acute bee paralysis virus (ABPV); Kashmir bee virus (KBV); Israeli Acute Paralysis Virus (IAPV); Chronic bee paralysis virus (CBPV). The review has been designed to provide researchers in the field with updated information about honeybee viruses and to serve as a starting point for future research. PMID:27800411

  19. Ecological dynamics of emerging bat virus spillover.


    Plowright, Raina K; Eby, Peggy; Hudson, Peter J; Smith, Ina L; Westcott, David; Bryden, Wayne L; Middleton, Deborah; Reid, Peter A; McFarlane, Rosemary A; Martin, Gerardo; Tabor, Gary M; Skerratt, Lee F; Anderson, Dale L; Crameri, Gary; Quammen, David; Jordan, David; Freeman, Paul; Wang, Lin-Fa; Epstein, Jonathan H; Marsh, Glenn A; Kung, Nina Y; McCallum, Hamish


    Viruses that originate in bats may be the most notorious emerging zoonoses that spill over from wildlife into domestic animals and humans. Understanding how these infections filter through ecological systems to cause disease in humans is of profound importance to public health. Transmission of viruses from bats to humans requires a hierarchy of enabling conditions that connect the distribution of reservoir hosts, viral infection within these hosts, and exposure and susceptibility of recipient hosts. For many emerging bat viruses, spillover also requires viral shedding from bats, and survival of the virus in the environment. Focusing on Hendra virus, but also addressing Nipah virus, Ebola virus, Marburg virus and coronaviruses, we delineate this cross-species spillover dynamic from the within-host processes that drive virus excretion to land-use changes that increase interaction among species. We describe how land-use changes may affect co-occurrence and contact between bats and recipient hosts. Two hypotheses may explain temporal and spatial pulses of virus shedding in bat populations: episodic shedding from persistently infected bats or transient epidemics that occur as virus is transmitted among bat populations. Management of livestock also may affect the probability of exposure and disease. Interventions to decrease the probability of virus spillover can be implemented at multiple levels from targeting the reservoir host to managing recipient host exposure and susceptibility.

  20. Ecological dynamics of emerging bat virus spillover

    PubMed Central

    Plowright, Raina K.; Eby, Peggy; Hudson, Peter J.; Smith, Ina L.; Westcott, David; Bryden, Wayne L.; Middleton, Deborah; Reid, Peter A.; McFarlane, Rosemary A.; Martin, Gerardo; Tabor, Gary M.; Skerratt, Lee F.; Anderson, Dale L.; Crameri, Gary; Quammen, David; Jordan, David; Freeman, Paul; Wang, Lin-Fa; Epstein, Jonathan H.; Marsh, Glenn A.; Kung, Nina Y.; McCallum, Hamish


    Viruses that originate in bats may be the most notorious emerging zoonoses that spill over from wildlife into domestic animals and humans. Understanding how these infections filter through ecological systems to cause disease in humans is of profound importance to public health. Transmission of viruses from bats to humans requires a hierarchy of enabling conditions that connect the distribution of reservoir hosts, viral infection within these hosts, and exposure and susceptibility of recipient hosts. For many emerging bat viruses, spillover also requires viral shedding from bats, and survival of the virus in the environment. Focusing on Hendra virus, but also addressing Nipah virus, Ebola virus, Marburg virus and coronaviruses, we delineate this cross-species spillover dynamic from the within-host processes that drive virus excretion to land-use changes that increase interaction among species. We describe how land-use changes may affect co-occurrence and contact between bats and recipient hosts. Two hypotheses may explain temporal and spatial pulses of virus shedding in bat populations: episodic shedding from persistently infected bats or transient epidemics that occur as virus is transmitted among bat populations. Management of livestock also may affect the probability of exposure and disease. Interventions to decrease the probability of virus spillover can be implemented at multiple levels from targeting the reservoir host to managing recipient host exposure and susceptibility. PMID:25392474

  1. Viruses take center stage in cellular evolution

    PubMed Central

    Claverie, Jean-Michel


    The origins of viruses are shrouded in mystery, but advances in genomics and the discovery of highly complex giant DNA viruses have stimulated new hypotheses that DNA viruses were involved in the emergence of the eukaryotic cell nucleus, and that they are worthy of being considered as living organisms. PMID:16787527

  2. Focus on: Hendra virus in Australia.


    Hughes, Kristopher


    Cases of Hendra virus infection in horses in Australia have been seen regularly since the virus was first isolated in 1994. Kristopher Hughes, associate professor of equine medicine at Charles Sturt University in Australia, gives an overview of how knowledge of the virus has developed in the past 20 years.

  3. Virus detection and quantification using electrical parameters

    NASA Astrophysics Data System (ADS)

    Ahmad, Mahmoud Al; Mustafa, Farah; Ali, Lizna M.; Rizvi, Tahir A.


    Here we identify and quantitate two similar viruses, human and feline immunodeficiency viruses (HIV and FIV), suspended in a liquid medium without labeling, using a semiconductor technique. The virus count was estimated by calculating the impurities inside a defined volume by observing the change in electrical parameters. Empirically, the virus count was similar to the absolute value of the ratio of the change of the virus suspension dopant concentration relative to the mock dopant over the change in virus suspension Debye volume relative to mock Debye volume. The virus type was identified by constructing a concentration-mobility relationship which is unique for each kind of virus, allowing for a fast (within minutes) and label-free virus quantification and identification. For validation, the HIV and FIV virus preparations were further quantified by a biochemical technique and the results obtained by both approaches corroborated well. We further demonstrate that the electrical technique could be applied to accurately measure and characterize silica nanoparticles that resemble the virus particles in size. Based on these results, we anticipate our present approach to be a starting point towards establishing the foundation for label-free electrical-based identification and quantification of an unlimited number of viruses and other nano-sized particles.

  4. Ebola Virus Persistence in Semen Ex Vivo.


    Fischer, Robert J; Judson, Seth; Miazgowicz, Kerri; Bushmaker, Trent; Munster, Vincent J


    On March 20, 2015, a case of Ebola virus disease was identified in Liberia that most likely was transmitted through sexual contact. We assessed the efficiency of detecting Ebola virus in semen samples by molecular diagnostics and the stability of Ebola virus in ex vivo semen under simulated tropical conditions.

  5. Ecological dynamics of emerging bat virus spillover.


    Plowright, Raina K; Eby, Peggy; Hudson, Peter J; Smith, Ina L; Westcott, David; Bryden, Wayne L; Middleton, Deborah; Reid, Peter A; McFarlane, Rosemary A; Martin, Gerardo; Tabor, Gary M; Skerratt, Lee F; Anderson, Dale L; Crameri, Gary; Quammen, David; Jordan, David; Freeman, Paul; Wang, Lin-Fa; Epstein, Jonathan H; Marsh, Glenn A; Kung, Nina Y; McCallum, Hamish


    Viruses that originate in bats may be the most notorious emerging zoonoses that spill over from wildlife into domestic animals and humans. Understanding how these infections filter through ecological systems to cause disease in humans is of profound importance to public health. Transmission of viruses from bats to humans requires a hierarchy of enabling conditions that connect the distribution of reservoir hosts, viral infection within these hosts, and exposure and susceptibility of recipient hosts. For many emerging bat viruses, spillover also requires viral shedding from bats, and survival of the virus in the environment. Focusing on Hendra virus, but also addressing Nipah virus, Ebola virus, Marburg virus and coronaviruses, we delineate this cross-species spillover dynamic from the within-host processes that drive virus excretion to land-use changes that increase interaction among species. We describe how land-use changes may affect co-occurrence and contact between bats and recipient hosts. Two hypotheses may explain temporal and spatial pulses of virus shedding in bat populations: episodic shedding from persistently infected bats or transient epidemics that occur as virus is transmitted among bat populations. Management of livestock also may affect the probability of exposure and disease. Interventions to decrease the probability of virus spillover can be implemented at multiple levels from targeting the reservoir host to managing recipient host exposure and susceptibility. PMID:25392474

  6. Ebola Virus Persistence in Semen Ex Vivo

    PubMed Central

    Fischer, Robert J.; Judson, Seth; Miazgowicz, Kerri; Bushmaker, Trent


    On March 20, 2015, a case of Ebola virus disease was identified in Liberia that most likely was transmitted through sexual contact. We assessed the efficiency of detecting Ebola virus in semen samples by molecular diagnostics and the stability of Ebola virus in ex vivo semen under simulated tropical conditions. PMID:26811984

  7. Computer Viruses and Safe Educational Practices.

    ERIC Educational Resources Information Center

    Azarmsa, Reza


    This discussion of computer viruses explains how these viruses may be transmitted, describes their effects on data and/or computer application programs, and identifies three groups that propagate them. Ten major viruses are listed and described, and measures to deal with them are discussed. Nineteen antiviral programs are also listed and…

  8. Dominant resistance against plant viruses

    PubMed Central

    de Ronde, Dryas; Butterbach, Patrick; Kormelink, Richard


    To establish a successful infection plant viruses have to overcome a defense system composed of several layers. This review will overview the various strategies plants employ to combat viral infections with main emphasis on the current status of single dominant resistance (R) genes identified against plant viruses and the corresponding avirulence (Avr) genes identified so far. The most common models to explain the mode of action of dominant R genes will be presented. Finally, in brief the hypersensitive response (HR) and extreme resistance (ER), and the functional and structural similarity of R genes to sensors of innate immunity in mammalian cell systems will be described. PMID:25018765

  9. Oncogenic viruses and hepatocellular carcinoma.


    Ben Ari, Ziv; Weitzman, Ella; Safran, Michal


    About 80% of hepatocellular carcinoma (HCC) is caused by hepatitis B virus (HBV) and/or hepatitis C virus (HCV) infections especially in the setting of established cirrhosis or advanced fibrosis, making HCC prevention a major goal of antiviral therapy. HCC tumors are highly complex and heterogeneous resulting from the aberrant function of multiple molecular pathways. The roles of HCV or HBV in promoting HCC development are still either directly or indirectly are still speculative, but the evidence for both effects is compelling. In patients with chronic hepatitis viral infection, cirrhosis is not a prerequisite for tumorigenesis.

  10. Development of high-yield influenza A virus vaccine viruses

    PubMed Central

    Ping, Jihui; Lopes, Tiago J.S.; Nidom, Chairul A.; Ghedin, Elodie; Macken, Catherine A.; Fitch, Adam; Imai, Masaki; Maher, Eileen A.; Neumann, Gabriele; Kawaoka, Yoshihiro


    Vaccination is one of the most cost-effective ways to prevent infection. Influenza vaccines propagated in cultured cells are approved for use in humans, but their yields are often suboptimal. Here, we screened A/Puerto Rico/8/34 (PR8) virus mutant libraries to develop vaccine backbones (defined here as the six viral RNA segments not encoding haemagglutinin and neuraminidase) that support high yield in cell culture. We also tested mutations in the coding and regulatory regions of the virus, and chimeric haemagglutinin and neuraminidase genes. A combination of high-yield mutations from these screens led to a PR8 backbone that improved the titres of H1N1, H3N2, H5N1 and H7N9 vaccine viruses in African green monkey kidney and Madin–Darby canine kidney cells. This PR8 backbone also improves titres in embryonated chicken eggs, a common propagation system for influenza viruses. This PR8 vaccine backbone thus represents an advance in seasonal and pandemic influenza vaccine development. PMID:26334134

  11. Viruses and host evolution: virus-mediated self identity.


    Villarreal, Luis


    Virus evolution has become a topic that involves population based selection. Both quasispecies based populations and reticulated mosaic exchange of populations of genetic elements are now well established. This has led us to the understanding that a cooperative consortia can be a crucial aspect of virus driven evolution. Thus viruses exist in groups that can cooperate. However, consortial based evolution (group selection) has long been dismissed by evolutionary biologist. Recently, biocommunication theory has concluded that the evolution and editing of any code or language requires a consortial based process in order to adhere to pragmatic (context) requirements for meaning (in conflict with survival of the fittest concepts). This has led to the idea that viruses are the natural editors of biological codes or language. In this chapter, I present the view that the persistence of virus information in their host provides a natural process of host code editing that is inherently consortial. Since persistence requires mechanisms to attain stability and preclude competition, it also provided mechanisms that promote group identity. Accordingly, I review the viral origins of addiction modules and how these affect both persistence and group identity. The concepts emerging from addiction module based group identity are then generalized and applied to social identity systems as well. I then examine the prokaryotes and the involvement of viral elements in the emergence of their group identity systems (biofilms). Here, integrating dsDNA agents prevailed. In the eukaryotes, however, a large shift in virus-host evolution occurred in which the role of dsDNA agents was diminished but the role of retroviruses and retroposons was greatly enhanced. These agents provided greatly expanded and network based regulatory complexity that was controlled by sensory inputs. From this perspective, the role of virus in the origin of the adaptive immune system is then outlined. I then consider

  12. Viruses and host evolution: virus-mediated self identity.


    Villarreal, Luis


    Virus evolution has become a topic that involves population based selection. Both quasispecies based populations and reticulated mosaic exchange of populations of genetic elements are now well established. This has led us to the understanding that a cooperative consortia can be a crucial aspect of virus driven evolution. Thus viruses exist in groups that can cooperate. However, consortial based evolution (group selection) has long been dismissed by evolutionary biologist. Recently, biocommunication theory has concluded that the evolution and editing of any code or language requires a consortial based process in order to adhere to pragmatic (context) requirements for meaning (in conflict with survival of the fittest concepts). This has led to the idea that viruses are the natural editors of biological codes or language. In this chapter, I present the view that the persistence of virus information in their host provides a natural process of host code editing that is inherently consortial. Since persistence requires mechanisms to attain stability and preclude competition, it also provided mechanisms that promote group identity. Accordingly, I review the viral origins of addiction modules and how these affect both persistence and group identity. The concepts emerging from addiction module based group identity are then generalized and applied to social identity systems as well. I then examine the prokaryotes and the involvement of viral elements in the emergence of their group identity systems (biofilms). Here, integrating dsDNA agents prevailed. In the eukaryotes, however, a large shift in virus-host evolution occurred in which the role of dsDNA agents was diminished but the role of retroviruses and retroposons was greatly enhanced. These agents provided greatly expanded and network based regulatory complexity that was controlled by sensory inputs. From this perspective, the role of virus in the origin of the adaptive immune system is then outlined. I then consider

  13. Hepatitis B virus infection.


    Chang, Mei-Hwei


    Hepatitis B virus (HBV) infection is a worldwide health problem and may cause acute, fulminant, chronic hepatitis, liver cirrhosis, or hepatocelullar carcinoma (HCC). Infection with HBV in infancy or early childhood may lead to a high rate of persistent infection (25-90%), while the rates are lower if infection occurs during adulthood (5-10%). In most endemic areas, infection occurs mainly during early childhood and mother-to-infant transmission accounts for approximately 50% of the chronic infection cases. Hepatitis B during pregnancy does not increase maternal mortality or morbidity or the risk of fetal complications. Approximately 90% of the infants of HBsAg carrier mothers with positive hepatitis B e-antigen (HBeAg) will become carriers if no immunoprophylaxis is given. Transplacental HBeAg may induce a specific non-responsiveness of helper T cells and HBcAg. Spontaneous HBeAg seroconversion to anti-HBe may develop with time but liver damage may occur during the process of the immune clearance of HBV and HBeAg. Mother-to-infant transmission of HBV from HBeAg negative but HBsAg positive mothers is the most important cause of acute or fulminant hepatitis B in infancy. Although antiviral agents are available to treat and avoid the complications of chronic hepatitis B, prevention of HBV infection is the best way for control. Screening for maternal HBsAg with/without HBeAg, followed by three to four doses of HBV vaccine in infancy and hepatitis B immunoglobulin (HBIG) within 24h of birth is the most effective way to prevent HBV infection. In areas with a low prevalence of HBV infection or with limited resources, omitting maternal screening but giving three doses of HBV vaccine universally in infancy can also produce good protective efficacy. The first universal HBV immunisation programme in the world was launched in Taiwan 22 years ago. HBV infection rates, chronicity rates, incidence of HCC and incidence of fulminant hepatitis in children have been effectively

  14. The big unknown: plant virus biodiversity.


    Roossinck, Marilyn J


    Studies on plant virus biodiversity are in their infancy, but with new technologies we can expect to see more information about novel plant viruses in the near future. The challenge for virus biodiversity work is that viruses do not have any universal coding sequence, such as ribosomal RNAs found in all cellular life. These obstacles are being overcome in clever ways. Understanding what exists in our natural environment will help us to tackle big issues in agriculture, such as disease emergence and the use of beneficial viruses and other microbes.

  15. Influenza virus activation of the interferon system

    PubMed Central

    Killip, Marian J.; Fodor, Ervin; Randall, Richard E.


    The host interferon (IFN) response represents one of the first barriers that influenza viruses must surmount in order to establish an infection. Many advances have been made in recent years in understanding the interactions between influenza viruses and the interferon system. In this review, we summarise recent work regarding activation of the type I IFN response by influenza viruses, including attempts to identify the viral RNA responsible for IFN induction, the stage of the virus life cycle at which it is generated and the role of defective viruses in this process. PMID:25678267

  16. Innate Immunity and BK Virus: Prospective Strategies.


    Kariminik, Ashraf; Yaghobi, Ramin; Dabiri, Shahriar


    Recent information demonstrated that BK virus reactivation is a dominant complication after kidney transplantation, which occurs because of immunosuppression. BK virus reactivation is the main reason of transplanted kidney losing. Immune response against BK virus is the major inhibitor of the virus reactivation. Therefore, improving our knowledge regarding the main parameters that fight against BK viruses can shed light on to direct new treatment strategies to suppress BK infection. Innate immunity consists of numerous cell systems and also soluble molecules, which not only suppress virus replication, but also activate adaptive immunity to eradicate the infection. Additionally, it appears that immune responses against reactivated BK virus are the main reasons for induction of BK virus-associated nephropathy (BKAN). Thus, improving our knowledge regarding the parameters and detailed mechanisms of innate immunity and also the status of innate immunity of the patients with BK virus reactivation and its complications can introduce new prospective strategies to either prevent or as therapy of the complication. Therefore, this review was aimed to collate the most recent data regarding the roles played by innate immunity against BK virus and also the status of innate immunity in the patients with reactivation BK virus and BKAN.

  17. Comparative analysis of chrysanthemum transcriptome in response to three RNA viruses: Cucumber mosaic virus, Tomato spotted wilt virus and Potato virus X.


    Choi, Hoseong; Jo, Yeonhwa; Lian, Sen; Jo, Kyoung-Min; Chu, Hyosub; Yoon, Ju-Yeon; Choi, Seung-Kook; Kim, Kook-Hyung; Cho, Won Kyong


    The chrysanthemum is one of popular flowers in the world and a host for several viruses. So far, molecular interaction studies between the chrysanthemum and viruses are limited. In this study, we carried out a transcriptome analysis of chrysanthemum in response to three different viruses including Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV) and Potato virus X (PVX). A chrysanthemum 135K microarray derived from expressed sequence tags was successfully applied for the expression profiles of the chrysanthemum at early stage of virus infection. Finally, we identified a total of 125, 70 and 124 differentially expressed genes (DEGs) for CMV, TSWV and PVX, respectively. Many DEGs were virus specific; however, 33 DEGs were commonly regulated by three viruses. Gene ontology (GO) enrichment analysis identified a total of 132 GO terms, and of them, six GO terms related stress response and MCM complex were commonly identified for three viruses. Several genes functioning in stress response such as chitin response and ethylene mediated signaling pathway were up-regulated indicating their involvement in establishment of host immune system. In particular, TSWV infection significantly down-regulated genes related to DNA metabolic process including DNA replication, chromatin organization, histone modification and cytokinesis, and they are mostly targeted to nucleosome and MCM complex. Taken together, our comparative transcriptome analysis revealed several genes related to hormone mediated viral stress response and DNA modification. The identified chrysanthemums genes could be good candidates for further functional study associated with resistant to various plant viruses.

  18. Persistence of virus lipid signatures upon silicification

    NASA Astrophysics Data System (ADS)

    Kyle, J.; Jahnke, L. L.; Stedman, K. M.


    To date there is no known evidence of viruses within the rock record. Their small size and absence of a metabolism has led to the hypothesis that they lack unique biological signatures, and the potential to become preserved. Biosignature research relevant to early Earth has focused on prokaryotic communities; however, the most abundant member of modern ecosystems, viruses, have been ignored. In order to establish a baseline for research on virus biosignatures, we have initiated laboratory research on known lipid-containing viruses. PRD1 is a lipid-containing virus that infects and replicates in Salmonella typhimurium LT2. PRD1 is a 65 nm spherical virus with an internal lipid membrane, which is a few nanometers thick. When the PRD1 virus stock was mixed with a 400 ppm SiO2 (final concentration) solution and incubated for six months. Fourier Transform Infrared Spectroscopy and lipid analysis using gas chromatography revealed that the virus lipids were still detectable despite complete removal of dissolved silica. Free fatty acids were also detected. Titers of infectious PRD1 viruses after six months in the presence of silica decreased 40 times more than without silica. Though virus biosignature research is in its incipient stages, the data suggest that virus lipid signatures are preserved under laboratory conditions and may offer the potential for contribution to the organic geochemical record.

  19. Human viruses in sediments, sludges, and soils*

    PubMed Central

    Rao, V. Chalapati; Metcalf, Theodore G.; Melnick, Joseph L.


    Recent studies have provided a greater understanding of the movement of viruses in the environment by their attachment to solids. These studies have focused on solids-associated viruses present in wastewater discharged into the ocean and on viruses in sludge and wastewater that may be retained in soil following their land disposal. Such ocean or land disposal of wastewater and sludge may result in a discharge of one or more of 120 human enteric virus pathogens including those causing poliomyelitis, viral hepatitis A and acute gastroenteritis. Solids-associated viruses in effluents discharged into coastal waters accumulate in bottom sediments, which may contain 10 to 10 000 more virus per unit volume than the overlying seawater. Solids-associated viruses resuspended by water turbulence may be transported from polluted to distant non-polluted recreational or shellfish-growing water. Transmission of viruses causing hepatitis or gastroenteritis may result from contact by bathers or swimmers with these viruses in recreational waters, or from ingestion of raw or improperly cooked shellfish in which the solids-associated virus had been bioaccumulated. The land disposal of sludge and wastewater has a potential of causing infections in farm workers, contamination of crops, pollution of raw potable water sources or infiltration of ground water. Viruses retained on soils can be released by rain water and may contaminate ground water through lateral and vertical movements. PMID:3015442

  20. Turnip Yellow Mosaic Virus Structure

    NASA Technical Reports Server (NTRS)


    The bumpy exterior of the turnip yellow mosaic virus (TYMV) protein coat, or capsid, was defined in detail by Dr. Alexander McPherson of the University of California, Irvin using protein crystallized in space for analysis on Earth. TYMV is an icosahedral virus constructed from 180 copies of the same protein arranged into 12 clusters of five proteins (pentamers), and 20 clusters of six proteins (hexamers). The final TYMV structure led to the enexpected hypothesis that the virus release its RNA by essentially chemical-mechanical means. Most viruses have farly flat coats, but in TYMV, the fold in each protein, called the jellyroll, is clustered at the points where the protein pentamers and hexamers join. The jellyrolls are almost standing on end, producing a bumpy surface with knobs at all of the pentamers and hexamers. At the inside surface of the pentamers is a void that is not present at the hexamers. The coating had been seen in early studies of TYMV, but McPhereson's atomic structure shows much more detail. The inside surface is strikingly, and unexpectedly, different than the outside. While the pentamers contain a central viod on the inside, the hexameric units contain peptides liked to each other, forming a ring or, more accurately, rings to fill the voild. Credit: Dr. Alexander McPherson, University of California, Irvine.

  1. Cucumber mosaic virus in Rubus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cucumber mosaic virus (CMV) has been reported on red raspberry in Chile, Scotland and the Soviet Union and in Chile on blackberry. Its occurrence in Rubus is rare and seems to cause little damage. Except for one early, unconfirmed report, CMV has not been reported on Rubus in North America. This vir...

  2. New vaccines against influenza virus

    PubMed Central

    Lee, Young-Tae; Kim, Ki-Hye; Ko, Eun-Ju; Lee, Yu-Na; Kim, Min-Chul; Kwon, Young-Man; Tang, Yinghua; Cho, Min-Kyoung; Lee, Youn-Jeong


    Vaccination is one of the most effective and cost-benefit interventions that prevent the mortality and reduce morbidity from infectious pathogens. However, the licensed influenza vaccine induces strain-specific immunity and must be updated annually based on predicted strains that will circulate in the upcoming season. Influenza virus still causes significant health problems worldwide due to the low vaccine efficacy from unexpected outbreaks of next epidemic strains or the emergence of pandemic viruses. Current influenza vaccines are based on immunity to the hemagglutinin antigen that is highly variable among different influenza viruses circulating in humans and animals. Several scientific advances have been endeavored to develop universal vaccines that will induce broad protection. Universal vaccines have been focused on regions of viral proteins that are highly conserved across different virus subtypes. The strategies of universal vaccines include the matrix 2 protein, the hemagglutinin HA2 stalk domain, and T cell-based multivalent antigens. Supplemented and/or adjuvanted vaccination in combination with universal target antigenic vaccines would have much promise. This review summarizes encouraging scientific advances in the field with a focus on novel vaccine designs. PMID:24427759

  3. Viruses, Mark Thy Message Well.


    Ye, Fengchun; Karn, Jonathan


    Post-transcriptional m(6)A methylation of RNA has profound effects on RNA splicing, export, stability, and translation. A recent study by Lichinchi et al. (2016) and one in this issue of Cell Host & Microbe by Kennedy et al. (2016) demonstrate that HIV mRNA is extensively m(6)A methylated, which promotes efficient virus replication. PMID:27173921

  4. Xenotransplantation and Hepatitis E virus.


    Denner, Joachim


    Xenotransplantation using pig cells, tissues and organs may be associated with the transmission of porcine microorganisms to the human recipient. Some of these microorganisms may induce a zoonosis, that is an infectious disease induced by microorganisms transmitted from another species. With exception of the porcine endogenous retroviruses (PERVs), which are integrated in the genome of all pigs, the transmission of all other microorganisms can be prevented by specified or designated pathogen-free (spf or dpf, respectively) production of the animals. However, it is becoming clear in the last years that the hepatitis E virus (HEV) is one of the viruses which are difficult to eliminate. It is important to note that there are differences between HEV of genotypes (gt) 1 and gt2 on one hand and HEV of gt3 and gt4 on the other. HEV gt1 and gt2 are human viruses, and they induce hepatitis and in the worst case fatal infections in pregnant women. In contrast, HEV gt3 and gt4 are viruses of pigs, and they may infect humans, induce commonly only mild diseases, if any, and are harmless for pregnant women. The goal of this review was to evaluate the risk posed by HEV gt3 and gt4 for xenotransplantation and to indicate ways of their elimination from pigs in order to prevent transmission to the human recipient.

  5. New vaccines against influenza virus.


    Lee, Young-Tae; Kim, Ki-Hye; Ko, Eun-Ju; Lee, Yu-Na; Kim, Min-Chul; Kwon, Young-Man; Tang, Yinghua; Cho, Min-Kyoung; Lee, Youn-Jeong; Kang, Sang-Moo


    Vaccination is one of the most effective and cost-benefit interventions that prevent the mortality and reduce morbidity from infectious pathogens. However, the licensed influenza vaccine induces strain-specific immunity and must be updated annually based on predicted strains that will circulate in the upcoming season. Influenza virus still causes significant health problems worldwide due to the low vaccine efficacy from unexpected outbreaks of next epidemic strains or the emergence of pandemic viruses. Current influenza vaccines are based on immunity to the hemagglutinin antigen that is highly variable among different influenza viruses circulating in humans and animals. Several scientific advances have been endeavored to develop universal vaccines that will induce broad protection. Universal vaccines have been focused on regions of viral proteins that are highly conserved across different virus subtypes. The strategies of universal vaccines include the matrix 2 protein, the hemagglutinin HA2 stalk domain, and T cell-based multivalent antigens. Supplemented and/or adjuvanted vaccination in combination with universal target antigenic vaccines would have much promise. This review summarizes encouraging scientific advances in the field with a focus on novel vaccine designs.

  6. Nonpathogenic Simian Immunodeficiency Virus Infections

    PubMed Central

    Klatt, Nichole R.; Silvestri, Guido; Hirsch, Vanessa


    The simian immunodeficiency viruses (SIVs) are a diverse group of viruses that naturally infect a wide range of African primates, including African green monkeys (AGMs) and sooty mangabey monkeys (SMs). Although natural infection is widespread in feral populations of AGMs and SMs, this infection generally does not result in immunodeficiency. However, experimental inoculation of Asian macaques results in an immunodeficiency syndrome remarkably similar to human AIDS. Thus, natural nonprogressive SIV infections appear to represent an evolutionary adaptation between these animals and their primate lentiviruses. Curiously, these animals maintain robust virus replication but have evolved strategies to avoid disease progression. Adaptations observed in these primates include phenotypic changes to CD4+ T cells, limited chronic immune activation, and altered mucosal immunity. It is probable that these animals have achieved a unique balance between T-cell renewal and proliferation and loss through activation-induced apoptosis, and virus-induced cell death. A clearer understanding of the mechanisms underlying the lack of disease progression in natural hosts for SIV infection should therefore yield insights into the pathogenesis of AIDS and may inform vaccine design. PMID:22315718

  7. Satellite Tobacco Mosaic Virus (STMV)

    NASA Technical Reports Server (NTRS)


    The structure of the Satellite Tobacco Mosaic Virus (STMV)--one of the smallest viruses known--has been successfully deduced using STMV crystals grown aboard the Space Shuttle in 1992 and 1994. The STMV crystals were up to 30 times the volume of any seen in the laboratory. At the same time they gave the best resolution data ever obtained on any virus crystal. STMV is a small icosahedral plant virus, consisting of a protein shell made up of 60 identical protein subunits of molecular weight 17,500. Particularly noteworthy is the fact that, in contrast to the crystal grown on Earth, the crystals grown under microgravity conditions were viusally perfect, with no striations or clumping of crystals. Furthermore, the X-ray diffraction data obtained from the space-grown crystals was of a much higher quality than the best data available at that time from ground-based crystals. This computer model shows the external coating or capsid. STMV is used because it is a simple protein to work with; studies are unrelated to tobacco. Credit: Dr. Alex McPherson, Univeristy of California at Irvin.

  8. Microcephaly and the Zika virus.



    Cases of microcephaly brought about by the Zika virus have brought professional and personal challenges for nurses in Brazil. Paediatric nurses, such as Roberta Seabra (pictured), take over as part of the multidisciplinary team once the baby is born. In this article health writer Jacqui Thornton presents some personal stories. PMID:27615590

  9. Microcephaly and the Zika virus.



    Cases of microcephaly brought about by the Zika virus have brought professional and personal challenges for nurses in Brazil. Paediatric nurses, such as Roberta Seabra (pictured), take over as part of the multidisciplinary team once the baby is born. In this article health writer Jacqui Thornton presents some personal stories.

  10. Enteric viruses in turkey enteritis.


    Jindal, Naresh; Mor, Sunil K; Goyal, Sagar M


    Gut health is very important to get maximum returns in terms of weight gain and egg production. Enteric diseases such as poult enteritis complex (PEC) in turkeys do not allow their production potential to be achieved to its maximum. A number of viruses, bacteria, and protozoa have been implicated but the primary etiology has not been definitively established. Previously, electron microscopy was used to detect the presence of enteric viruses, which were identified solely on the basis of their morphology. With the advent of rapid molecular diagnostic methods and next generation nucleic acid sequencing, researchers have made long strides in identification and characterization of viruses associated with PEC. The molecular techniques have also helped us in identification of pathogens which were previously not known. Regional and national surveys have revealed the presence of several different enteric viruses in PEC including rotavirus, astrovirus, reovirus and coronavirus either alone or in combination. There may still be unknown pathogens that may directly or indirectly play a role in enteritis in turkeys. This review will focus on the role of turkey coronavirus, rotavirus, reovirus, and astrovirus in turkey enteritis. PMID:25674583

  11. A Literature Review of Zika Virus

    PubMed Central

    Bloch, Evan M.


    Zika virus is a mosquitoborne flavivirus that is the focus of an ongoing pandemic and public health emergency. Previously limited to sporadic cases in Africa and Asia, the emergence of Zika virus in Brazil in 2015 heralded rapid spread throughout the Americas. Although most Zika virus infections are characterized by subclinical or mild influenza-like illness, severe manifestations have been described, including Guillain-Barre syndrome in adults and microcephaly in babies born to infected mothers. Neither an effective treatment nor a vaccine is available for Zika virus; therefore, the public health response primarily focuses on preventing infection, particularly in pregnant women. Despite growing knowledge about this virus, questions remain regarding the virus’s vectors and reservoirs, pathogenesis, genetic diversity, and potential synergistic effects of co-infection with other circulating viruses. These questions highlight the need for research to optimize surveillance, patient management, and public health intervention in the current Zika virus epidemic. PMID:27070380

  12. [Ebola virus reproduction in cell cultures].


    Titenko, A M; Novozhilov, S S; Andaev, E I; Borisova, T I; Kulikova, E V


    Ebola-Zaire virus production in Vero and BGM cells was studied. The CPE developed in both cell cultures. The cell monolayer destruction by 80-90% was seen at a low multiplicity of infection in 7-8 days after virus inoculation. An overlay composition was developed for virus titration using plaque assay. The plaque production was shown to be directly proportional to the virus dose. The curve of Ebola virus production in Vero cell culture fluid was determined. At a multiplicity of infection of 0.01 PFU/cell, the maximum virus titer of 10(6.4) PFU/ml was reached in 7 days postinfection. Specific antisera were generated by inoculation of guinea pigs. Indirect immunofluorescent assay was used for testing of virus-specific antigen and antibody.

  13. Newcastle disease virus: propagation, quantification, and storage.


    McGinnes, Lori W; Pantua, Homer; Reitter, Julie; Morrison, Trudy G


    Newcastle disease virus (NDV) is a prototype paramyxovirus used to define basic steps in the life cycle of this family of viruses. NDV is also an ideal virus system for elucidating determinants of viral pathogenicity. Some strains of this virus are important agricultural pathogens that cause disease in poultry with a high mortality while other strains are avirulent and used for vaccines. Methods for preparation and titration of virus stocks are essential for all of these purposes. Procedures for growth and purification of NDV stocks in embryonated chicken eggs as well as in tissue culture cells are described. Use of embryonated chicken eggs to grow the virus is the superior method since infectious stocks of all strains of NDV result. Stocks of avirulent NDV prepared in tissue culture are noninfectious. Virus stocks are routinely titered using plaque assays or hemagglutination assays, both of which are described.

  14. The semipermeability of simple spherical virus capsids.


    Durham, A C; Witz, J; Bancroft, J B


    Hydrogen-ion titration curves are reported for tomato bushy stunt virus, two strains of cowpea chlorotic mottle virus, and turnip crinkle virus, with particular attention to the hysteresis loops associated with the swelling and contraction of virions. There appears to be an archetypal shape of hysteresis loops, which is shared by viruses in several groups, suggestive of many intermediate states in the swelling of any one particle. In contrast, eggplant mosaic virus behaves as if its protein capsid is impermeable to small ions in mild conditions; its cation-binding sites were revealed by treatment with high concentrations of salt or urea, or at raised temperatures. Putting these observations together with the fact that a spherical virus capsid is a closed, holey, charged surface leads to a theory of titration hysteresis: its key feature is that the protein capsids of simple viruses are inherently semipermeable, with many of the ion-handling properties usually attributed only to complex lipid membranes.

  15. Carrier cultures of simian foamy virus.


    Clarke, J K; Samuels, J; Dermott, E; Gay, F W


    The production of cultures of HEp-2 and BHK-21 cells persistently infected with a type 1 simian foamy virus is described. After infection, HEp-2 cells showed no structural changes, whereas BHK-21 cells lost their normal spindle shape and showed mitochondrial damage, and some cells contained many lysosomes. Thin sections also showed that a few BHK-21 cells contained virus particles in low concentration, and infectious virus could be isolated from both the cells and the supernatant fluid. No virus was seen in thin sections of HEp-2 cells, although infectious virus in low titer could be recovered intermittently from lysed cells. Both carrier cultures were immune to challenge with homologous virus and antigen could be detected in over 90% of the cells even after growth for 9 weeks in the presence of virus-neutralizing serum. The distribution of antigen in carrier cultures of both cell types is described and compared with that seen in cytocidal infections. PMID:4986851

  16. Systems analysis of West Nile virus infection.


    Suthar, Mehul S; Pulendran, Bali


    Emerging and re-emerging mosquito-borne viruses continue to pose a significant threat to human health throughout the world. Over the past decade, West Nile virus (WNV), Dengue virus (DENV), and Chikungunya virus (CHIKV), have caused annual epidemics of virus-induced encephalitis, hemorrhagic fever\\shock syndromes, and arthritis, respectively. Currently, no specific antiviral therapies or vaccines exist for use in humans to combat or prevent these viral infections. Thus, there is a pressing need to define the virus-host interactions that govern immunity and infection outcome. Recent technological breakthroughs in 'omics' resources and high-throughput based assays are beginning to accelerate antiviral drug discovery and improve on current strategies for vaccine design. In this review, we highlight studies with WNV and discuss how traditional and systems biological approaches are being used to rapidly identify novel host targets for therapeutic intervention and develop a deeper conceptual understanding of the host response to virus infection.

  17. Neutrophil uptake of vaccinia virus in vitro

    SciTech Connect

    West, B.C.; Eschete, M.L.; Cox, M.E.; King, J.W.


    We studied human neutrophils for uptake of vaccinia virus. Uptake was determined radiometrically and by electron microscopy. Vaccinia virus was labeled with /sup 14/C or /sup 3/H, incubated with neutrophils, and quantified in neutrophil pellets in a new radiometric phagocytosis assay. Better results were obtained from assays of (/sup 3/H)thymidine-labeled virus; uptake increased through 1 hr and then plateaued. Phagocytosis of 3H-labeled Staphylococcus aureus was normal. Uptake of virus was serum dependent. Hexose monophosphate shunt activity was measured by two methods. No /sup 14/CO/sub 2/ from (/sup 14/C)1-glucose accompanied uptake of vaccinia virus, in contrast to the respiratory burst accompanying bacterial phagocytosis. Electron microscopy showed intact to slightly digested intraphagolysosomal vaccinia virus. Pock reduction assay showed a decrease in viral content due to neutrophils until 6 hr of incubation, when a modest but significant increase was observed. Thus, neutrophil uptake of vaccinia virus is distinguished from bacterial phagocytosis.

  18. Autogenous immunity to endogenous RNA tumor virus: humoral immune response to virus envelope antigens.


    Hanna, M G; Ihle, J N; Lee, J C


    Autogenous immune sera from several strains of mice have been examined for type-, group-, or interspecies-specific reactivities against leukemia virus envelope antigens and virus-induced cell surface proteins. The natural antibody of these test sera react with gp69/71, gp43, and p15 structural components on murine leukemia viruses including AKR, Friend, Rauscher, Moloney, and xenotropic BALB:virus-2. Furthermore, comparable radioimmune titration curves are obtained when these viruses are used in radioimmune precipitation assays. Competition experiments, however, suggest that natural immune sera are predominantly type specific and only weakly cross-react with the Rauscher or Friend virus. Natural immune sera react with the virion envelope but not with the virus-induced cell surface antigen. With respect to the biological activity of autogenous immune sera, there appears to be an inconsistency between the spectrum of virus-precipitating antibody and virus-neutralizing antibody. Although normal mouse serum readily neutralizes xenotropic viruses (BALB:virus-2), only weak neutralization of the ecotropic viruses can be achieved in vitro. Although there is a lack of direct evidence to indicate that autogenous immunity to murine leukemia virus is involved in the control of virus-mediated neoplasia, several empirical correlations point in this direction.

  19. Viruses: are they living entities?


    Pennazio, Sergio


    The essence (living or nonliving entities) of viruses has today become an aporia, i.e. a difficulty inherent in reasoning because they shared four fundamental characteristics with livings (multiplication, genetic information, mutation and evolution) without having the capacity to have an independent life. For much time, however, they were considered minuscule pathogenetic micro-organisms in observance of Koch and Pasteur's 'germ theory' albeit no microbiologist could show their existence except their filterability and pathogenetic action. Only some voices based on experimental results raised against this dogmatic view, in particular those of Beijerinck, Baur and Mrowka, without dipping effectively into the dominant theory. The discovery relative to their nucleoprotein nature made between 1934 and 1936 (Schlesinger as for the phage, and Bawden and co-operators as for Tobacco mosaic virus; TMV), together with the first demonstrations of their structures thanks to electron microscopy (from 1939 onwards) started on casting a new light on their true identity, which could be more clearly identified when, from 1955 onwards, phage and TMV proved to be decisive factors to understand the strategies of replication of the genetic material. Following the new knowledge, the theoretical view relative to viruses changed rather radically and the current view looks on these pathogenetic agents as nonliving aggregates of macromolecules provided with biological properties. There is, however, a current of thought, made explicitly by Lwoff that places viruses as compromise between living and non living and, perhaps, as primitive forms of life which have had great importance for the evolution of cellular life. At any rate, viruses are peculiar entities whose importance cannot be unacknowledged. PMID:22220354

  20. Hamster-tropic sarcomagenic and nonsarcomagenic viruses derived from hamster tumors induced by the Gross pseudotype of Moloney sarcoma virus.


    Kelloff, G; Huebner, R J; Lee, Y K; Toni, R; Gilden, R


    Hamster sarcomas induced by the Gross pseudotype of Moloney sarcoma virus yielded a virus sarcomagenic for hamsters but not mice. This virus was able to produce foci on hamster embryo cells, but not on mouse embryo cells. A hamster-tropic nonfocus-forming helper virus was also found in the viral stocks. These hamster-tropic viruses are not immunologically related to the murine viruses in the original inoculum but appear to represent indigenous C-type RNA viruses of the hamster.

  1. Full genome characterization of the culicoides-borne marsupial orbiviruses: Wallal virus, Mudjinbarry virus and Warrego viruses.


    Belaganahalli, Manjunatha N; Maan, Sushila; Maan, Narender S; Pritchard, Ian; Kirkland, Peter D; Brownlie, Joe; Attoui, Houssam; Mertens, Peter P C


    Viruses belonging to the species Wallal virus and Warrego virus of the genus Orbivirus were identified as causative agents of blindness in marsupials in Australia during 1994/5. Recent comparisons of nucleotide (nt) and amino acid (aa) sequences have provided a basis for the grouping and classification of orbivirus isolates. However, full-genome sequence data are not available for representatives of all Orbivirus species. We report full-genome sequence data for three additional orbiviruses: Wallal virus (WALV); Mudjinabarry virus (MUDV) and Warrego virus (WARV). Comparisons of conserved polymerase (Pol), sub-core-shell 'T2' and core-surface 'T13' proteins show that these viruses group with other Culicoides borne orbiviruses, clustering with Eubenangee virus (EUBV), another orbivirus infecting marsupials. WARV shares <70% aa identity in all three conserved proteins (Pol, T2 and T13) with other orbiviruses, consistent with its classification within a distinct Orbivirus species. Although WALV and MUDV share <72.86%/67.93% aa/nt identity with other orbiviruses in Pol, T2 and T13, they share >99%/90% aa/nt identities with each other (consistent with membership of the same virus species - Wallal virus). However, WALV and MUDV share <68% aa identity in their larger outer capsid protein VP2(OC1), consistent with membership of different serotypes within the species - WALV-1 and WALV-2 respectively. PMID:25299687

  2. Competitive virus assay method for titration of noncytopathogenic bovine viral diarrhea viruses (END⁺ and END⁻ viruses).


    Muhsen, Mahmod; Ohi, Kota; Aoki, Hiroshi; Ikeda, Hidetoshi; Fukusho, Akio


    A new, reliable and secure virus assay method, named the competitive virus assay (CVA) method, has been established for the titration of bovine viral diarrhea viruses (BVDVs) that either show the exaltation of Newcastle disease virus (END) phenomenon or heterologous interference phenomenon (but not the END phenomenon). This method is based on the principle of (1) homologous interference between BVDVs, by using BVDV RK13/E(-) or BVDV RK13/E(+) strains as competitor virus, and (2) END phenomenon and heterologous interference, by using attenuated Newcastle disease virus (NDV) TCND strain as challenge virus. In titration of BVDV END(+) and BVDV END(-) viruses, no significant difference in estimated virus titer was observed between CVA and conventional methods. CVA method demonstrated comparable levels of sensitivity and accuracy as conventional END and interference methods, which require the use of a velogenic Miyadera strain of NDV and vesicular stomatitis virus (VSV), both of which are agents of high-risk diseases. As such, the CVA method is a safer alternative, with increased bio-safety and bio-containment, through avoidance of virulent strains that are commonly employed with conventional methods.

  3. Full genome characterization of the culicoides-borne marsupial orbiviruses: Wallal virus, Mudjinbarry virus and Warrego viruses.


    Belaganahalli, Manjunatha N; Maan, Sushila; Maan, Narender S; Pritchard, Ian; Kirkland, Peter D; Brownlie, Joe; Attoui, Houssam; Mertens, Peter P C


    Viruses belonging to the species Wallal virus and Warrego virus of the genus Orbivirus were identified as causative agents of blindness in marsupials in Australia during 1994/5. Recent comparisons of nucleotide (nt) and amino acid (aa) sequences have provided a basis for the grouping and classification of orbivirus isolates. However, full-genome sequence data are not available for representatives of all Orbivirus species. We report full-genome sequence data for three additional orbiviruses: Wallal virus (WALV); Mudjinabarry virus (MUDV) and Warrego virus (WARV). Comparisons of conserved polymerase (Pol), sub-core-shell 'T2' and core-surface 'T13' proteins show that these viruses group with other Culicoides borne orbiviruses, clustering with Eubenangee virus (EUBV), another orbivirus infecting marsupials. WARV shares <70% aa identity in all three conserved proteins (Pol, T2 and T13) with other orbiviruses, consistent with its classification within a distinct Orbivirus species. Although WALV and MUDV share <72.86%/67.93% aa/nt identity with other orbiviruses in Pol, T2 and T13, they share >99%/90% aa/nt identities with each other (consistent with membership of the same virus species - Wallal virus). However, WALV and MUDV share <68% aa identity in their larger outer capsid protein VP2(OC1), consistent with membership of different serotypes within the species - WALV-1 and WALV-2 respectively.

  4. Clarification and guidance on the proper usage of virus and virus species names

    PubMed Central

    Jahrling, Peter B.


    A pivotal step in the development of a consistent nomenclature for virus classification was the introduction of the virus species concept by the International Committee on Taxonomy of Viruses (ICTV) in 1991. Yet, almost two decades later, many virologists still are unable to differentiate between virus species and actual viruses. Here we attempt to explain the origin of this confusion, clarify the difference between taxa and physical entities, and suggest simple measures that could be implemented by ICTV Study Groups to make virus taxonomy and nomenclature more accessible to laboratory virologists. PMID:20204430

  5. Clinical and biological differences between recurrent herpes simplex virus and varicella-zoster virus infections

    SciTech Connect

    Straus, S.E. )


    The major features that distinguish recurrent herpes simplex virus infections from zoster are illustrated in this article by two case histories. The clinical and epidemiologic features that characterize recurrent herpes simplex virus and varicella-zoster virus infections are reviewed. It is noted that herpesvirus infections are more common and severe in patients with cellular immune deficiency. Each virus evokes both humoral and cellular immune response in the course of primary infection. DNA hybridization studies with RNA probes labelled with sulfur-35 indicate that herpes simplex viruses persist within neurons, and that varicella-zoster virus is found in the satellite cells that encircle the neurons.

  6. West Nile virus: North American experience

    USGS Publications Warehouse

    Hofmeister, Erik K.


    West Nile virus, a mosquito-vectored flavivirus of the Japanese encephalitis serogroup, was first detected in North America following an epizootic in the New York City area in 1999. In the intervening 11 years since the arrival of the virus in North America, it has crossed the contiguous USA, entered the Canadian provinces bordering the USA, and has been reported in the Caribbean islands, Mexico, Central America and, more recently, South America. West Nile virus has been reported in over 300 species of birds in the USA and has caused the deaths of thousands of birds, local population declines of some avian species, the clinical illness and deaths of thousands of domestic horses, and the clinical disease in over 30 000 Americans and the deaths of over 1000. Prior to the emergence of West Nile virus in North America, St. Louis encephalitis virus and Dengue virus were the only other known mosquito-transmitted flaviviruses in North America capable of causing human disease. This review will discuss the North American experience with mosquito-borne flavivirus prior to the arrival of West Nile virus, the entry and spread of West Nile virus in North America, effects on wild bird populations, genetic changes in the virus, and the current state of West Nile virus transmission.

  7. BK and JC virus: a review.


    Pinto, Michelle; Dobson, Simon


    Polyomaviruses are ubiquitous, species-specific viruses belonging to the family Papovaviridae. The two most commonly known human polyomaviruses, BK virus and JC virus were first described in the 1970s. Newer human polyomaviruses, namely KI polyoma virus, WU polyoma virus and Merkel cell polyoma virus were identified in the last five years. Most humans encounter BK and JC virus during childhood, causing mild illness. However, when reactivated or acquired in the immunocompromised host, BK and JC virus have been implicated in a number of human clinical disease states. BK is most commonly associated with renal involvement, such as ureteral stenosis, hemorrhagic cystitis and nephropathy. Less commonly, it is associated with pneumonitis, retinitis, liver disease and meningoencephalitis. JC virus is most well known for its association with progressive multifocal leukoencephalopathy, and is possibly implicated in the development of various human neoplasms. The following chapter will outline the basic virology, epidemiology and clinical manifestations of BK and JC virus and discuss relevant diagnostic and treatment options.

  8. Chloroplast in Plant-Virus Interaction

    PubMed Central

    Zhao, Jinping; Zhang, Xian; Hong, Yiguo; Liu, Yule


    In plants, the chloroplast is the organelle that conducts photosynthesis. It has been known that chloroplast is involved in virus infection of plants for approximate 70 years. Recently, the subject of chloroplast-virus interplay is getting more and more attention. In this article we discuss the different aspects of chloroplast-virus interaction into three sections: the effect of virus infection on the structure and function of chloroplast, the role of chloroplast in virus infection cycle, and the function of chloroplast in host defense against viruses. In particular, we focus on the characterization of chloroplast protein-viral protein interactions that underlie the interplay between chloroplast and virus. It can be summarized that chloroplast is a common target of plant viruses for viral pathogenesis or propagation; and conversely, chloroplast and its components also can play active roles in plant defense against viruses. Chloroplast photosynthesis-related genes/proteins (CPRGs/CPRPs) are suggested to play a central role during the complex chloroplast-virus interaction. PMID:27757106

  9. Recombination in Eukaryotic Single Stranded DNA Viruses

    PubMed Central

    Martin, Darren P.; Biagini, Philippe; Lefeuvre, Pierre; Golden, Michael; Roumagnac, Philippe; Varsani, Arvind


    Although single stranded (ss) DNA viruses that infect humans and their domesticated animals do not generally cause major diseases, the arthropod borne ssDNA viruses of plants do, and as a result seriously constrain food production in most temperate regions of the world. Besides the well known plant and animal-infecting ssDNA viruses, it has recently become apparent through metagenomic surveys of ssDNA molecules that there also exist large numbers of other diverse ssDNA viruses within almost all terrestrial and aquatic environments. The host ranges of these viruses probably span the tree of life and they are likely to be important components of global ecosystems. Various lines of evidence suggest that a pivotal evolutionary process during the generation of this global ssDNA virus diversity has probably been genetic recombination. High rates of homologous recombination, non-homologous recombination and genome component reassortment are known to occur within and between various different ssDNA virus species and we look here at the various roles that these different types of recombination may play, both in the day-to-day biology, and in the longer term evolution, of these viruses. We specifically focus on the ecological, biochemical and selective factors underlying patterns of genetic exchange detectable amongst the ssDNA viruses and discuss how these should all be considered when assessing the adaptive value of recombination during ssDNA virus evolution. PMID:21994803

  10. Virus-induced congenital malformations in cattle.


    Agerholm, Jørgen S; Hewicker-Trautwein, Marion; Peperkamp, Klaas; Windsor, Peter A


    Diagnosing the cause of bovine congenital malformations (BCMs) is challenging for bovine veterinary practitioners and laboratory diagnosticians as many known as well as a large number of not-yet reported syndromes exist. Foetal infection with certain viruses, including bovine virus diarrhea virus (BVDV), Schmallenberg virus (SBV), blue tongue virus (BTV), Akabane virus (AKAV), or Aino virus (AV), is associated with a range of congenital malformations. It is tempting for veterinary practitioners to diagnose such infections based only on the morphology of the defective offspring. However, diagnosing a virus as a cause of BCMs usually requires laboratory examination and even in such cases, interpretation of findings may be challenging due to lack of experience regarding genetic defects causing similar lesions, even in cases where virus or congenital antibodies are present. Intrauterine infection of the foetus during the susceptible periods of development, i.e. around gestation days 60-180, by BVDV, SBV, BTV, AKAV and AV may cause malformations in the central nervous system, especially in the brain. Brain lesions typically consist of hydranencephaly, porencephaly, hydrocephalus and cerebellar hypoplasia, which in case of SBV, AKAV and AV infections may be associated by malformation of the axial and appendicular skeleton, e.g. arthrogryposis multiplex congenita. Doming of the calvarium is present in some, but not all, cases. None of these lesions are pathognomonic so diagnosing a viral cause based on gross lesions is uncertain. Several genetic defects share morphology with virus induced congenital malformations, so expert advice should be sought when BCMs are encountered.

  11. [Epidemiological characteristics of Zika virus disease].


    Li, Jiandong; Li, Dexin


    Zika virus disease is an emerging mosquito-borne acute infectious disease caused by Zika virus, so far there have been no available vaccine or specific treatment. Currently, the outbreaks of Zika virus disease mainly occurs in the Americas, but the regional distribution of the disease is in rapid expansion, 34 countries and territories have reported autochthonous transmission of the virus. The illness is usually mild with very rarely death, but increased reports of birth defects and neurologic disorders in the areas affected by Zika virus has caused extensive concern worldwide. In China, the competent vectors for Zika virus are widely distributed, imported viraemic cases may become a source of local transmission of the virus. However, Zika virus disease is preventable, the spread of virus could be stopped when the effective prevention measures are taken. This paper summarizes the retrieval results from Medline database and the information from the reports of the governments of countries affected or health organizations about the epidemiological characteristics of Zika virus disease.

  12. Reassortment patterns in Swine influenza viruses.


    Khiabanian, Hossein; Trifonov, Vladimir; Rabadan, Raul


    Three human influenza pandemics occurred in the twentieth century, in 1918, 1957, and 1968. Influenza pandemic strains are the results of emerging viruses from non-human reservoirs to which humans have little or no immunity. At least two of these pandemic strains, in 1957 and in 1968, were the results of reassortments between human and avian viruses. Also, many cases of swine influenza viruses have reportedly infected humans, in particular, the recent H1N1 influenza virus of swine origin, isolated in Mexico and the United States. Pigs are documented to allow productive replication of human, avian, and swine influenza viruses. Thus it has been conjectured that pigs are the "mixing vessel" that create the avian-human reassortant strains, causing the human pandemics. Hence, studying the process and patterns of viral reassortment, especially in pigs, is a key to better understanding of human influenza pandemics. In the last few years, databases containing sequences of influenza A viruses, including swine viruses, collected since 1918 from diverse geographical locations, have been developed and made publicly available. In this paper, we study an ensemble of swine influenza viruses to analyze the reassortment phenomena through several statistical techniques. The reassortment patterns in swine viruses prove to be similar to the previous results found in human viruses, both in vitro and in vivo, that the surface glycoprotein coding segments reassort most often. Moreover, we find that one of the polymerase segments (PB1), reassorted in the strains responsible for the last two human pandemics, also reassorts frequently.

  13. West Nile virus: North American experience.


    Hofmeister, Erik K


    West Nile virus, a mosquito-vectored flavivirus of the Japanese encephalitis serogroup, was first detected in North America following an epizootic in the New York City area in 1999. In the intervening 11 years since the arrival of the virus in North America, it has crossed the contiguous USA, entered the Canadian provinces bordering the USA, and has been reported in the Caribbean islands, Mexico, Central America and, more recently, South America. West Nile virus has been reported in over 300 species of birds in the USA and has caused the deaths of thousands of birds, local population declines of some avian species, the clinical illness and deaths of thousands of domestic horses, and the clinical disease in over 30 000 Americans and the deaths of over 1000. Prior to the emergence of West Nile virus in North America, St. Louis encephalitis virus and Dengue virus were the only other known mosquito-transmitted flaviviruses in North America capable of causing human disease. This review will discuss the North American experience with mosquito-borne flavivirus prior to the arrival of West Nile virus, the entry and spread of West Nile virus in North America, effects on wild bird populations, genetic changes in the virus, and the current state of West Nile virus transmission.

  14. IFITMs restrict the replication of multiple pathogenic viruses

    PubMed Central

    Perreira, Jill M.; Chin, Christopher R.; Feeley, Eric M.; Brass, Abraham L.


    The IFITM family of proteins inhibit a growing number of pathogenic viruses, among them influenza A virus, dengue virus, hepatitis C virus, and Ebola virus. This review covers recent developments in our understanding of the IFITM’s molecular determinants, potential mechanisms of action, and impact on pathogenesis. PMID:24076421

  15. Detection of Multiple Potato Viruses in the Field Suggests Synergistic Interactions among Potato Viruses in Pakistan.


    Hameed, Amir; Iqbal, Zafar; Asad, Shaheen; Mansoor, Shahid


    Viral diseases have been a major limiting factor threating sustainable potato (Solanum tuberosum L.) production in Pakistan. Surveys were conducted to serologically quantify the incidence of RNA viruses infecting potato; Potato virus X (PVX), Potato virus Y (PVY), Potato virus S (PVS), Potato virus A (PVA), Potato virus M (PVM) and Potato leaf roll virus (PLRV) in two major potato cultivars (Desiree and Cardinal). The results suggest the prevalence of multiple viruses in all surveyed areas with PVY, PVS and PVX dominantly widespread with infection levels of up to 50% in some regions. Co-infections were detected with the highest incidence (15.5%) for PVX and PVS. Additionally the data showed a positive correlation between co-infecting viruses with significant increase in absorbance value (virus titre) for at least one of the virus in an infected plant and suggested a synergistic interaction. To test this hypothesis, glasshouse grown potato plants were challenged with multiple viruses and analyzed for systemic infections and symptomology studies. The results obtained conclude that multiple viral infections dramatically increase disease epidemics as compared to single infection and an effective resistance strategy in targeting multiple RNA viruses is required to save potato crop. PMID:25506305

  16. Initial characterization of Vaccinia Virus B4 suggests a role in virus spread

    SciTech Connect

    Burles, Kristin; Irwin, Chad R.; Burton, Robyn-Lee; Schriewer, Jill; Evans, David H.; Buller, R. Mark; Barry, Michele


    Currently, little is known about the ankyrin/F-box protein B4. Here, we report that B4R-null viruses exhibited reduced plaque size in tissue culture, and decreased ability to spread, as assessed by multiple-step growth analysis. Electron microscopy indicated that B4R-null viruses still formed mature and extracellular virions; however, there was a slight decrease of virions released into the media following deletion of B4R. Deletion of B4R did not affect the ability of the virus to rearrange actin; however, VACV811, a large vaccinia virus deletion mutant missing 55 open reading frames, had decreased ability to produce actin tails. Using ectromelia virus, a natural mouse pathogen, we demonstrated that virus devoid of EVM154, the B4R homolog, showed decreased spread to organs and was attenuated during infection. This initial characterization suggests that B4 may play a role in virus spread, and that other unidentified mediators of actin tail formation may exist in vaccinia virus. - Highlights: • B4R-null viruses show reduced plaque size, and decreased ability to spread. • B4R-null viruses formed mature and extracellular virions; and rearranged actin. • Virus devoid of EVM154, the B4R homolog, was attenuated during infection. • Initial characterization suggests that B4 may play a role in virus spread. • Unidentified mediators of actin tail formation may exist in vaccinia virus.

  17. Expression of the structural proteins of dengue 2 virus and yellow fever virus by recombinant vaccinia viruses.


    Hahn, Y S; Lenches, E M; Galler, R; Rice, C M; Dalrymple, J; Strauss, J H


    Vaccinia virus recombinants were constructed which contained cDNA sequences encoding the structural region of dengue 2 virus (PR159/S1 strain) or yellow fever virus (17D strain). The flavivirus cDNA sequences were expressed under the control of the vaccinia 7.5k early/late promotor. Cultured cells infected with these recombinants expressed immunologically reactive flavivirus structural proteins, precursor prM and E. These proteins appeared to be cleaved and glycosylated properly since they comigrated with the authentic proteins from dengue 2 virus- and yellow fever virus-infected cells. Mice immunized with the dengue/vaccinia recombinant showed a dengue-specific immune response that included low levels of neutralizing antibodies. Immunization of mice with the yellow fever/vaccinia recombinant was less effective at inducing an immune response to yellow fever virus and in only some of the mice were low titers of neutralizing antibodies produced.

  18. Herpes Simplex Virus and Varicella-Zoster Virus.


    Levin, Myron J; Weinberg, Adriana; Schmid, D Scott


    The most common specimens from immunocompromised patients that are analyzed for detection of herpes simplex virus (HSV) or varicella-zoster virus (VZV) are from skin lesions. Many types of assays are applicable to these samples, but some, such as virus isolation and direct fluorescent antibody testing, are useful only in the early phases of the lesions. In contrast, nucleic acid (NA) detection methods, which generally have superior sensitivity and specificity, can be applied to skin lesions at any stage of progression. NA methods are also the best choice, and sometimes the only choice, for detecting HSV or VZV in blood, cerebrospinal fluid, aqueous or vitreous humor, and from mucosal surfaces. NA methods provide the best performance when reliability and speed (within 24 hours) are considered together. They readily distinguish the type of HSV detected or the source of VZV detected (wild type or vaccine strain). Nucleic acid detection methods are constantly being improved with respect to speed and ease of performance. Broader applications are under study, such as the use of quantitative results of viral load for prognosis and to assess the efficacy of antiviral therapy. PMID:27337486

  19. Human immunodeficiency virus, herpes virus infections, and pulmonary vascular disease

    PubMed Central

    Flores, Sonia C.; Almodovar, Sharilyn


    The following state-of-the-art seminar was delivered as part of the Aspen Lung Conference on Pulmonary Hypertension and Vascular Diseases held in Aspen, Colorado in June 2012. This paper will summarize the lecture and present results from a nonhuman primate model of infection with Simian (Human) Immunodeficiency Virus - nef chimeric virions as well as the idea that polymorphisms in the HIV-1 nef gene may be driving the immune response that results in exuberant inflammation and aberrant endothelial cell (EC) function. We will present data gathered from primary HIV nef isolates where we tested the biological consequences of these polymorphisms and how their presence in human populations may predict patients at risk for developing this disease. In this article, we also discuss how a dysregulated immune system, in conjunction with a viral infection, could contribute to pulmonary arterial hypertension (PAH). Both autoimmune diseases and some viruses are associated with defects in the immune system, primarily in the function of regulatory T cells. These T-cell defects may be a common pathway in the formation of plexiform lesions. Regardless of the route by which viruses may lead to PAH, it is important to recognize their role in this rare disease. PMID:23662195

  20. Yellow fever virus exhibits slower evolutionary dynamics than dengue virus.


    Sall, Amadou A; Faye, Ousmane; Diallo, Mawlouth; Firth, Cadhla; Kitchen, Andrew; Holmes, Edward C


    Although yellow fever has historically been one of the most important viral infections of humans, relatively little is known about the evolutionary processes that shape its genetic diversity. Similarly, there is limited information on the molecular epidemiology of yellow fever virus (YFV) in Africa even though it most likely first emerged on this continent. Through an analysis of complete E gene sequences, including a newly acquired viral collection from Central and West Africa (Senegal, Cameroon, Central African Republic, Côte d'Ivoire, Mali, and Mauritania), we show that YFV exhibits markedly lower rates of evolutionary change than dengue virus, despite numerous biological similarities between these two viruses. From this observation, along with a lack of clock-like evolutionary behavior in YFV, we suggest that vertical transmission, itself characterized by lower replication rates, may play an important role in the evolution of YFV in its enzootic setting. Despite a reduced rate of nucleotide substitution, phylogenetic patterns and estimates of times to common ancestry in YFV still accord well with the dual histories of colonialism and the slave trade, with areas of sylvatic transmission (such as Kedougou, Senegal) acting as enzootic/epidemic foci.

  1. Malsoor Virus, a Novel Bat Phlebovirus, Is Closely Related to Severe Fever with Thrombocytopenia Syndrome Virus and Heartland Virus

    PubMed Central

    Yadav, P. D.; Basu, A.; Shete, A.; Patil, D. Y.; Zawar, D.; Majumdar, T. D.; Kokate, P.; Sarkale, P.; Raut, C. G.; Jadhav, S. M.


    During a survey in the year 2010, a novel phlebovirus was isolated from the Rousettus leschenaultii species of bats in western India. The virus was identified by electron microscopy from infected Vero E6 cells. Phylogenic analysis of the complete genome showed its close relation to severe fever with thrombocytopenia syndrome (SFTS) and Heartland viruses, which makes it imperative to further study its natural ecology and potential as a novel emerging zoonotic virus. PMID:24390329

  2. Evolution and ecology of influenza A viruses.

    PubMed Central

    Webster, R G; Bean, W J; Gorman, O T; Chambers, T M; Kawaoka, Y


    In this review we examine the hypothesis that aquatic birds are the primordial source of all influenza viruses in other species and study the ecological features that permit the perpetuation of influenza viruses in aquatic avian species. Phylogenetic analysis of the nucleotide sequence of influenza A virus RNA segments coding for the spike proteins (HA, NA, and M2) and the internal proteins (PB2, PB1, PA, NP, M, and NS) from a wide range of hosts, geographical regions, and influenza A virus subtypes support the following conclusions. (i) Two partly overlapping reservoirs of influenza A viruses exist in migrating waterfowl and shorebirds throughout the world. These species harbor influenza viruses of all the known HA and NA subtypes. (ii) Influenza viruses have evolved into a number of host-specific lineages that are exemplified by the NP gene and include equine Prague/56, recent equine strains, classical swine and human strains, H13 gull strains, and all other avian strains. Other genes show similar patterns, but with extensive evidence of genetic reassortment. Geographical as well as host-specific lineages are evident. (iii) All of the influenza A viruses of mammalian sources originated from the avian gene pool, and it is possible that influenza B viruses also arose from the same source. (iv) The different virus lineages are predominantly host specific, but there are periodic exchanges of influenza virus genes or whole viruses between species, giving rise to pandemics of disease in humans, lower animals, and birds. (v) The influenza viruses currently circulating in humans and pigs in North America originated by transmission of all genes from the avian reservoir prior to the 1918 Spanish influenza pandemic; some of the genes have subsequently been replaced by others from the influenza gene pool in birds. (vi) The influenza virus gene pool in aquatic birds of the world is probably perpetuated by low-level transmission within that species throughout the year. (vii

  3. Influenza A virus targets a cGAS-independent STING pathway that controls enveloped RNA viruses.


    Holm, Christian K; Rahbek, Stine H; Gad, Hans Henrik; Bak, Rasmus O; Jakobsen, Martin R; Jiang, Zhaozaho; Hansen, Anne Louise; Jensen, Simon K; Sun, Chenglong; Thomsen, Martin K; Laustsen, Anders; Nielsen, Camilla G; Severinsen, Kasper; Xiong, Yingluo; Burdette, Dara L; Hornung, Veit; Lebbink, Robert Jan; Duch, Mogens; Fitzgerald, Katherine A; Bahrami, Shervin; Mikkelsen, Jakob Giehm; Hartmann, Rune; Paludan, Søren R


    Stimulator of interferon genes (STING) is known be involved in control of DNA viruses but has an unexplored role in control of RNA viruses. During infection with DNA viruses STING is activated downstream of cGAMP synthase (cGAS) to induce type I interferon. Here we identify a STING-dependent, cGAS-independent pathway important for full interferon production and antiviral control of enveloped RNA viruses, including influenza A virus (IAV). Further, IAV interacts with STING through its conserved hemagglutinin fusion peptide (FP). Interestingly, FP antagonizes interferon production induced by membrane fusion or IAV but not by cGAMP or DNA. Similar to the enveloped RNA viruses, membrane fusion stimulates interferon production in a STING-dependent but cGAS-independent manner. Abolishment of this pathway led to reduced interferon production and impaired control of enveloped RNA viruses. Thus, enveloped RNA viruses stimulate a cGAS-independent STING pathway, which is targeted by IAV.

  4. Pseudotyping of vesicular stomatitis virus with the envelope glycoproteins of highly pathogenic avian influenza viruses.


    Zimmer, Gert; Locher, Samira; Berger Rentsch, Marianne; Halbherr, Stefan J


    Pseudotype viruses are useful for studying the envelope proteins of harmful viruses. This work describes the pseudotyping of vesicular stomatitis virus (VSV) with the envelope glycoproteins of highly pathogenic avian influenza viruses. VSV lacking the homotypic glycoprotein (G) gene (VSVΔG) was used to express haemagglutinin (HA), neuraminidase (NA) or the combination of both. Propagation-competent pseudotype viruses were only obtained when HA and NA were expressed from the same vector genome. Pseudotype viruses containing HA from different H5 clades were neutralized specifically by immune sera directed against the corresponding clade. Fast and sensitive reading of test results was achieved by vector-mediated expression of GFP. Pseudotype viruses expressing a mutant VSV matrix protein showed restricted spread in IFN-competent cells. This pseudotype system will facilitate the detection of neutralizing antibodies against virulent influenza viruses, circumventing the need for high-level biosafety containment.

  5. Processing Strategies to Inactivate Enteric Viruses in Shellfish: Limitations of Surrogate Viruses and Molecular Methods

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Noroviruses, hepatitis A and E viruses, sapovirus, astrovirus, rotavirus, Aichi virus, enteric adenoviruses, poliovirus, and other enteroviruses enter shellfish through contaminated seawater or by contamination during handling and processing, resulting in outbreaks ranging from isolated to epidemic....

  6. Proposal for a uniform nomenclature for defective interfering viruses of vesicular stomatitis virus.

    PubMed Central

    Reichmann, M E; Bishop, D H; Brown, F; Crick, J; Holland, J J; Kang, C Y; Lazzarini, R; Moyer, S; Perrault, J; Prevec, L; Pringle, C R; Wagner, R R; Youngner, J S; Huang, A S


    Defective interfering particles of vesicular stomatitis virus have been named according to their parental derivation and to their genomic length and physical properties. This suggested uniform nomenclature can be adapted for other virus systems. PMID:6247514

  7. Impact of anti-virus software on computer virus dynamical behavior

    NASA Astrophysics Data System (ADS)

    Sun, Mei; Li, Dandan; Han, Dun; Jia, Changsheng


    The impact of anti-virus software on the spreading of computer virus is investigated via developing a mathematical model in this paper. Considering the anti-virus software may not be effective, as it may be an outdated version, and then the computers may be infected with a reduced incidence rate. According to the method of next generation matrix, the basic reproduction number is derived. By introducing appropriate Lyapunov function and the Routh stability criterion, acquiring the stability conditions of the virus-free equilibrium and virus equilibrium. The effect of anti-virus software and disconnecting rate on the spreading of virus are also analyzed. When combined with the numerical results, a set of suggestions are put forward for eradicating virus effectively.

  8. Influenza A virus targets a cGAS-independent STING pathway that controls enveloped RNA viruses

    PubMed Central

    Holm, Christian K.; Rahbek, Stine H.; Gad, Hans Henrik; Bak, Rasmus O.; Jakobsen, Martin R.; Jiang, Zhaozaho; Hansen, Anne Louise; Jensen, Simon K.; Sun, Chenglong; Thomsen, Martin K.; Laustsen, Anders; Nielsen, Camilla G.; Severinsen, Kasper; Xiong, Yingluo; Burdette, Dara L.; Hornung, Veit; Lebbink, Robert Jan; Duch, Mogens; Fitzgerald, Katherine A.; Bahrami, Shervin; Mikkelsen, Jakob Giehm; Hartmann, Rune; Paludan, Søren R.


    Stimulator of interferon genes (STING) is known be involved in control of DNA viruses but has an unexplored role in control of RNA viruses. During infection with DNA viruses STING is activated downstream of cGAMP synthase (cGAS) to induce type I interferon. Here we identify a STING-dependent, cGAS-independent pathway important for full interferon production and antiviral control of enveloped RNA viruses, including influenza A virus (IAV). Further, IAV interacts with STING through its conserved hemagglutinin fusion peptide (FP). Interestingly, FP antagonizes interferon production induced by membrane fusion or IAV but not by cGAMP or DNA. Similar to the enveloped RNA viruses, membrane fusion stimulates interferon production in a STING-dependent but cGAS-independent manner. Abolishment of this pathway led to reduced interferon production and impaired control of enveloped RNA viruses. Thus, enveloped RNA viruses stimulate a cGAS-independent STING pathway, which is targeted by IAV. PMID:26893169

  9. Influenza A virus targets a cGAS-independent STING pathway that controls enveloped RNA viruses.


    Holm, Christian K; Rahbek, Stine H; Gad, Hans Henrik; Bak, Rasmus O; Jakobsen, Martin R; Jiang, Zhaozaho; Hansen, Anne Louise; Jensen, Simon K; Sun, Chenglong; Thomsen, Martin K; Laustsen, Anders; Nielsen, Camilla G; Severinsen, Kasper; Xiong, Yingluo; Burdette, Dara L; Hornung, Veit; Lebbink, Robert Jan; Duch, Mogens; Fitzgerald, Katherine A; Bahrami, Shervin; Mikkelsen, Jakob Giehm; Hartmann, Rune; Paludan, Søren R


    Stimulator of interferon genes (STING) is known be involved in control of DNA viruses but has an unexplored role in control of RNA viruses. During infection with DNA viruses STING is activated downstream of cGAMP synthase (cGAS) to induce type I interferon. Here we identify a STING-dependent, cGAS-independent pathway important for full interferon production and antiviral control of enveloped RNA viruses, including influenza A virus (IAV). Further, IAV interacts with STING through its conserved hemagglutinin fusion peptide (FP). Interestingly, FP antagonizes interferon production induced by membrane fusion or IAV but not by cGAMP or DNA. Similar to the enveloped RNA viruses, membrane fusion stimulates interferon production in a STING-dependent but cGAS-independent manner. Abolishment of this pathway led to reduced interferon production and impaired control of enveloped RNA viruses. Thus, enveloped RNA viruses stimulate a cGAS-independent STING pathway, which is targeted by IAV. PMID:26893169

  10. Identification of Novel Viruses Using VirusHunter -- an Automated Data Analysis Pipeline

    PubMed Central

    Zhao, Guoyan; Krishnamurthy, Siddharth; Cai, Zhengqiu; Popov, Vsevolod L.; Travassos da Rosa, Amelia P.; Guzman, Hilda; Cao, Song; Virgin, Herbert W.; Tesh, Robert B.; Wang, David


    Quick and accurate identification of microbial pathogens is essential for both diagnosis and response to emerging infectious diseases. The advent of next-generation sequencing technology offers an unprecedented platform for rapid sequencing-based identification of novel viruses. We have developed a customized bioinformatics data analysis pipeline, VirusHunter, for the analysis of Roche/454 and other long read Next generation sequencing platform data. To illustrate the utility of VirusHunter, we performed Roche/454 GS FLX titanium sequencing on two unclassified virus isolates from the World Reference Center for Emerging Viruses and Arboviruses (WRCEVA). VirusHunter identified sequences derived from a novel bunyavirus and a novel reovirus in the two samples respectively. Further sequence analysis demonstrated that the viruses were novel members of the Phlebovirus and Orbivirus genera. Both Phlebovirus and Orbivirus genera include many economic important viruses or serious human pathogens. PMID:24167629

  11. Detection of sweet potato virus C, sweet potato virus 2 and sweet potato feathery mottle virus in Portugal.


    Varanda, Carla M R; Santos, Susana J; Oliveira, Mônica D M; Clara, Maria Ivone E; Félix, Maria Rosário F


    Field sweet potato plants showing virus-like symptoms, as stunting, leaf distortion, mosaic and chlorosis, were collected in southwest Portugal and tested for the presence of four potyviruses, sweet potato virus C (SPVC), sweet potato virus 2 (SPV2), sweet potato feathery mottle virus (SPFMV), sweet potato virus G (SPVG), and the crinivirus sweet potato chlorotic stunt virus (SPCSV). DsRNA fractions were extracted from symptomatic leaves and used as templates in single and multiplex RT-PCR assays using previously described specific primers for each analyzed virus. The amplified reaction products for SPVC, SPV2 and SPFMV were of expected size, and direct sequencing of PCR products revealed that they correspond to the coat protein gene (CP) and showed 98%, 99% and 99% identity, respectively, to those viruses. Comparison of the CP genomic and amino acid sequences of the Portuguese viral isolates recovered here with those of ten other sequences of isolates obtained in different countries retrieved from the GenBank showed very few differences. The application of the RT-PCR assays revealed for the first time the presence of SPVC and SPFMV in the sweet potato crop in Portugal, the absence of SPVG and SPCSV in tested plants, as well as the occurrence of triple virus infections under field conditions.

  12. Comparative analysis of rabbit hemorrhagic disease virus (RHDV) and new RHDV2 virus antigenicity, using specific virus-like particles.


    Bárcena, Juan; Guerra, Beatriz; Angulo, Iván; González, Julia; Valcárcel, Félix; Mata, Carlos P; Castón, José R; Blanco, Esther; Alejo, Alí


    In 2010 a new Lagovirus related to rabbit haemorrhagic disease virus (RHDV) emerged in France and has since rapidly spread throughout domestic and wild rabbit populations of several European countries. The new virus, termed RHDV2, exhibits distinctive genetic, antigenic and pathogenic features. Notably, RHDV2 kills rabbits previously vaccinated with RHDV vaccines. Here we report for the first time the generation and characterization of RHDV2-specific virus-like particles (VLPs). Our results further confirmed the differential antigenic properties exhibited by RHDV and RHDV2, highlighting the need of using RHDV2-specific diagnostic assays to monitor the spread of this new virus. PMID:26403184

  13. Detection of sweet potato virus C, sweet potato virus 2 and sweet potato feathery mottle virus in Portugal.


    Varanda, Carla M R; Santos, Susana J; Oliveira, Mônica D M; Clara, Maria Ivone E; Félix, Maria Rosário F


    Field sweet potato plants showing virus-like symptoms, as stunting, leaf distortion, mosaic and chlorosis, were collected in southwest Portugal and tested for the presence of four potyviruses, sweet potato virus C (SPVC), sweet potato virus 2 (SPV2), sweet potato feathery mottle virus (SPFMV), sweet potato virus G (SPVG), and the crinivirus sweet potato chlorotic stunt virus (SPCSV). DsRNA fractions were extracted from symptomatic leaves and used as templates in single and multiplex RT-PCR assays using previously described specific primers for each analyzed virus. The amplified reaction products for SPVC, SPV2 and SPFMV were of expected size, and direct sequencing of PCR products revealed that they correspond to the coat protein gene (CP) and showed 98%, 99% and 99% identity, respectively, to those viruses. Comparison of the CP genomic and amino acid sequences of the Portuguese viral isolates recovered here with those of ten other sequences of isolates obtained in different countries retrieved from the GenBank showed very few differences. The application of the RT-PCR assays revealed for the first time the presence of SPVC and SPFMV in the sweet potato crop in Portugal, the absence of SPVG and SPCSV in tested plants, as well as the occurrence of triple virus infections under field conditions. PMID:26104336

  14. Zika virus challenges for neuropsychiatry.


    Simões E Silva, Ana Cristina; Moreira, Janaina Matos; Romanelli, Roberta Maia Castro; Teixeira, Antonio Lucio


    Before 2007, Zika virus (ZIKV) was generally considered as an arbovirus of low clinical relevance, causing a mild self-limiting febrile illness in tropical Africa and Southeast Asia. Currently, a large, ongoing outbreak of ZIKV that started in Brazil in 2015 is spreading across the Americas. Virus infection during pregnancy has been potentially linked to congenital malformations, including microcephaly. In addition to congenital malformations, a temporal association between ZIKV infection and an increase in cases of Guillain-Barré syndrome is currently being observed in several countries. The mechanisms underlying these neurological complications are still unknown. Emerging evidence, mainly from in vitro studies, suggests that ZIKV may have direct effects on neuronal cells. The aim of this study was to critically review the literature available regarding the neurobiology of ZIKV and its potential neuropsychiatric manifestations.

  15. Antiviral Strategies Against Chikungunya Virus.


    Abdelnabi, Rana; Neyts, Johan; Delang, Leen


    In the last few decades the Chikungunya virus (CHIKV) has evolved from a geographically isolated pathogen to a virus that is widespread in many parts of Africa, Asia and recently also in Central- and South-America. Although CHIKV infections are rarely fatal, the disease can evolve into a chronic stage, which is characterized by persisting polyarthralgia and joint stiffness. This chronic CHIKV infection can severely incapacitate patients for weeks up to several years after the initial infection. Despite the burden of CHIKV infections, no vaccine or antivirals are available yet. The current therapy is therefore only symptomatic and consists of the administration of analgesics, antipyretics, and anti-inflammatory agents. Recently several molecules with various viral or host targets have been identified as CHIKV inhibitors. In this chapter, we summarize the current status of the development of antiviral strategies against CHIKV infections.

  16. Dengue virus-mosquito interactions.


    Halstead, Scott B


    The mosquito Aedes aegypti is more widely dispersed now than at any time in the past, placing billions of humans at risk of infection with one or more of the four dengue viruses. This review presents and discusses information on mosquito-dengue infection dynamics and describes the prominent role that temperature and rainfall play in controlling dengue viral transmission including discussions of the effect of interannual climate variations and the predicted effect of global warming. Complementary human determinants of dengue epidemiology include viremia titer, variation in viremic period, enhanced viremias, and threshold viremia. Topics covered include epidemiological phenomena such as traveling waves, the generation of genetic diversity of dengue viruses following virgin soil introductions and in hyperendemic settings, and evidence for and against viral virulence as a determinant of the severity of dengue infections. Also described is the crucial role of monotypic and heterotypic herd immunity in shaping dengue epidemic behavior.

  17. West Nile Virus in California

    PubMed Central

    Lothrop, Hugh; Chiles, Robert; Madon, Minoo; Cossen, Cynthia; Woods, Leslie; Husted, Stan; Kramer, Vicki; Edman, John


    West Nile virus (WNV) was first isolated in California during July 2003 from a pool of Culex tarsalis collected near El Centro, Imperial County. WNV transmission then increased and spread in Imperial and Coachella Valleys, where it was tracked by isolation from pools of Cx. tarsalis, seroconversions in sentinel chickens, and seroprevalence in free-ranging birds. WNV then dispersed to the city of Riverside, Riverside County, and to the Whittier Dam area of Los Angeles County, where it was detected in dead birds and pools of Cx. pipiens quinquefasciatus. By October, WNV was detected in dead birds collected from riparian corridors in Los Angeles, west to Long Beach, and through inland valleys south from Riverside to San Diego County. WNV was reported concurrently from Arizona in mid-August and from Baja, Mexico, in mid-November. Possible mechanisms for virus introduction, amplification, and dispersal are discussed. PMID:15496236

  18. Zika virus challenges for neuropsychiatry

    PubMed Central

    Simões e Silva, Ana Cristina; Moreira, Janaina Matos; Romanelli, Roberta Maia Castro; Teixeira, Antonio Lucio


    Before 2007, Zika virus (ZIKV) was generally considered as an arbovirus of low clinical relevance, causing a mild self-limiting febrile illness in tropical Africa and Southeast Asia. Currently, a large, ongoing outbreak of ZIKV that started in Brazil in 2015 is spreading across the Americas. Virus infection during pregnancy has been potentially linked to congenital malformations, including microcephaly. In addition to congenital malformations, a temporal association between ZIKV infection and an increase in cases of Guillain–Barré syndrome is currently being observed in several countries. The mechanisms underlying these neurological complications are still unknown. Emerging evidence, mainly from in vitro studies, suggests that ZIKV may have direct effects on neuronal cells. The aim of this study was to critically review the literature available regarding the neurobiology of ZIKV and its potential neuropsychiatric manifestations. PMID:27478378

  19. Zika virus challenges for neuropsychiatry.


    Simões E Silva, Ana Cristina; Moreira, Janaina Matos; Romanelli, Roberta Maia Castro; Teixeira, Antonio Lucio


    Before 2007, Zika virus (ZIKV) was generally considered as an arbovirus of low clinical relevance, causing a mild self-limiting febrile illness in tropical Africa and Southeast Asia. Currently, a large, ongoing outbreak of ZIKV that started in Brazil in 2015 is spreading across the Americas. Virus infection during pregnancy has been potentially linked to congenital malformations, including microcephaly. In addition to congenital malformations, a temporal association between ZIKV infection and an increase in cases of Guillain-Barré syndrome is currently being observed in several countries. The mechanisms underlying these neurological complications are still unknown. Emerging evidence, mainly from in vitro studies, suggests that ZIKV may have direct effects on neuronal cells. The aim of this study was to critically review the literature available regarding the neurobiology of ZIKV and its potential neuropsychiatric manifestations. PMID:27478378

  20. Antiviral Strategies Against Chikungunya Virus.


    Abdelnabi, Rana; Neyts, Johan; Delang, Leen


    In the last few decades the Chikungunya virus (CHIKV) has evolved from a geographically isolated pathogen to a virus that is widespread in many parts of Africa, Asia and recently also in Central- and South-America. Although CHIKV infections are rarely fatal, the disease can evolve into a chronic stage, which is characterized by persisting polyarthralgia and joint stiffness. This chronic CHIKV infection can severely incapacitate patients for weeks up to several years after the initial infection. Despite the burden of CHIKV infections, no vaccine or antivirals are available yet. The current therapy is therefore only symptomatic and consists of the administration of analgesics, antipyretics, and anti-inflammatory agents. Recently several molecules with various viral or host targets have been identified as CHIKV inhibitors. In this chapter, we summarize the current status of the development of antiviral strategies against CHIKV infections. PMID:27233277

  1. Arenaviruses other than Lassa virus.


    Charrel, Rémi N; de Lamballerie, Xavier


    The family Arenaviridae includes 23 viral species, of which 5 can cause viral hemorrhagic fevers with a case fatality rate of about 20%. These five viruses are Junin, Machupo, Guanarito, Sabia and Lassa virus, the manipulation of which requires biosafety level 4 facilities. They are included in the Category A Pathogen List established by the Center for Disease Control and Prevention that groups agents with the greatest potential for adverse public health impact and mass casualties whether a situation characterized by a ill-intentioned abuse of natural or engineered arenavirus would be encountered. The aims of this article are to (i) summarize the current situation; (ii) provide information to help anticipating the effects to be expected in such a situation; and to (iii) emphasize the need for fundamental research to allow the development of diagnostic, prevention and therapeutic tools as countermeasures to weaponized arenaviruses.

  2. Structural polypeptides of Machupo virus.


    Gangemi, J D; Rosato, R R; Connell, E V; Johnson, E M; Eddy, G A


    The structural proteins of an arenavirus pathogen, Machupo virus, were compared to the structural proteins of two previously characterized non-pathogenic arenaviruses, Pichinde and Tacaribe, in SDS-polyacrylamide gels. Similarities in mol. wt. of the major structural proteins from both pathogenic and non-pathogenic viruses were apparent; however, some differences in the number of glycosylation properties of minor proteins were observed. Machupo virions contain two major protein species. The most prominent is a non-glycosylated protein with a mol. wt. of 68000, while the other was glycosylated protein with a mol. wt. of 41000. Minor amounts of other proteins (mol. wt. 84000, 74000, 50000 and 15000) and a glycolipid were also observed.

  3. Two tails of the normal curve. Similarities and differences in the study of mental retardation and giftedness.


    Robinson, N M; Zigler, E; Gallagher, J J


    Professionals in the fields of mental retardation and giftedness have much to teach each other as well as the field of human development in general. Examining the commonalities and differences between the fields in social issues, definitions, developmental differences from the norm, values and policy issues, and educational and long-term implications deepens insights about both normal and deviant development. The authors stress the importance of individual differences in the differential design of educational strategies and the application of approaches developed with specialized populations to normally developing children. Current social inequalities affect both of these fields in particular ways. Finally, numerous research agendas can be enhanced by including representatives of both ends of the normal curve.

  4. Endocytosis of Viruses and Bacteria

    PubMed Central

    Cossart, Pascale; Helenius, Ari


    Of the many pathogens that infect humans and animals, a large number use cells of the host organism as protected sites for replication. To reach the relevant intracellular compartments, they take advantage of the endocytosis machinery and exploit the network of endocytic organelles for penetration into the cytosol or as sites of replication. In this review, we discuss the endocytic entry processes used by viruses and bacteria and compare the strategies used by these dissimilar classes of pathogens. PMID:25085912

  5. Zika virus and Zika fever.


    Wang, Zhaoyang; Wang, Peigang; An, Jing


    An emerging mosquito-borne arbovirus named Zika virus (ZIKV), of the family Flaviviridae and genus Flavivirus, is becoming a global health threat. ZIKV infection was long neglected due to its sporadic nature and mild symptoms. However, recently, with its rapid spread from Asia to the Americas, affecting more than 30 countries, accumulating evidences have demonstrated a close association between infant microcephaly and Zika infection in pregnant women. Here, we reviewed the virological, epidemiological, and clinical essentials of ZIKV infection.

  6. Probiotics in respiratory virus infections.


    Lehtoranta, L; Pitkäranta, A; Korpela, R


    Viral respiratory infections are the most common diseases in humans. A large range of etiologic agents challenge the development of efficient therapies. Research suggests that probiotics are able to decrease the risk or duration of respiratory infection symptoms. However, the antiviral mechanisms of probiotics are unclear. The purpose of this paper is to review the current knowledge on the effects of probiotics on respiratory virus infections and to provide insights on the possible antiviral mechanisms of probiotics. A PubMed and Scopus database search was performed up to January 2014 using appropriate search terms on probiotic and respiratory virus infections in cell models, in animal models, and in humans, and reviewed for their relevance. Altogether, thirty-three clinical trials were reviewed. The studies varied highly in study design, outcome measures, probiotics, dose, and matrices used. Twenty-eight trials reported that probiotics had beneficial effects in the outcome of respiratory tract infections (RTIs) and five showed no clear benefit. Only eight studies reported investigating viral etiology from the respiratory tract, and one of these reported a significant decrease in viral load. Based on experimental studies, probiotics may exert antiviral effects directly in probiotic-virus interaction or via stimulation of the immune system. Although probiotics seem to be beneficial in respiratory illnesses, the role of probiotics on specific viruses has not been investigated sufficiently. Due to the lack of confirmatory studies and varied data available, more randomized, double-blind, and placebo-controlled trials in different age populations investigating probiotic dose response, comparing probiotic strains/genera, and elucidating the antiviral effect mechanisms are necessary.

  7. Resistant Pathogens, Fungi, and Viruses

    PubMed Central

    Guidry, Christopher A.; Mansfield, Sara A.; Sawyer, Robert G.; Cook, Charles H.


    The first reports of antibiotic pathogens occurred a few short years after the introduction of these powerful new agents, heralding a new kind of war between medicine and pathogens. Although originally described in Staphylococcus aureus, resistance among bacteria has now become a grim race to determine which classes of bacteria will become more resistant, pitting the Gram positive staphylococci, enterococci, and streptococci against the increasingly resistant Gram negative pathogens, e. g., carbapenemase-resistant enterobacteriaceae. In addition, the availability of antibacterial agents has allowed the development of whole new kinds of diseases caused by non-bacterial pathogens, related largely to fungi that are inherently resistant to antibacterials. All of these organisms are becoming more prevalent and, ultimately, more clinically relevant for surgeons. It is ironic that despite their ubiquity in our communities, there is seldom a second thought given to viral infections in patients with surgical illness. The extent of most surgeon’s interest in viral infections ends with hepatitis and HIV, no doubt related to transmissibility as well as the implications that these viruses might have in a patient’s hepatic or immune functions. There are chapters and even textbooks written about these viruses so these will not be considered here. Instead, we will present the growing body of knowledge of the herpes family viruses and their occurrence and consequences in patients with concomitant surgical disease or critical illness. We have also chosen to focus this chapter on previously immune competent patients, as the impact of herpes family viruses in immunosuppressed patients such as transplant or AIDS patients has received thorough treatment elsewhere. PMID:25440119

  8. Variola virus immune evasion proteins.


    Dunlop, Lance R; Oehlberg, Katherine A; Reid, Jeremy J; Avci, Dilek; Rosengard, Ariella M


    Variola virus, the causative agent of smallpox, encodes approximately 200 proteins. Over 80 of these proteins are located in the terminal regions of the genome, where proteins associated with host immune evasion are encoded. To date, only two variola proteins have been characterized. Both are located in the terminal regions and demonstrate immunoregulatory functions. One protein, the smallpox inhibitor of complement enzymes (SPICE), is homologous to a vaccinia virus virulence factor, the vaccinia virus complement-control protein (VCP), which has been found experimentally to be expressed early in the course of vaccinia infection. Both SPICE and VCP are similar in structure and function to the family of mammalian complement regulatory proteins, which function to prevent inadvertent injury to adjacent cells and tissues during complement activation. The second variola protein is the variola virus high-affinity secreted chemokine-binding protein type II (CKBP-II, CBP-II, vCCI), which binds CC-chemokine receptors. The vaccinia homologue of CKBP-II is secreted both early and late in infection. CKBP-II proteins are highly conserved among orthopoxviruses, sharing approximately 85% homology, but are absent in eukaryotes. This characteristic sets it apart from other known virulence factors in orthopoxviruses, which share sequence homology with known mammalian immune regulatory gene products. Future studies of additional variola proteins may help illuminate factors associated with its virulence, pathogenesis and strict human tropism. In addition, these studies may also assist in the development of targeted therapies for the treatment of both smallpox and human immune-related diseases.

  9. Treatment of ebola virus disease.


    Kilgore, Paul E; Grabenstein, John D; Salim, Abdulbaset M; Rybak, Michael


    In March 2014, the largest Ebola outbreak in history exploded across West Africa. As of November 14, 2014, the World Health Organization has reported a total of 21,296 Ebola virus disease (EVD) cases, including 13,427 laboratory-confirmed EVD cases reported from the three most affected countries (Guinea, Liberia, and Sierra Leone). As the outbreak of EVD has spread, clinical disease severity and national EVD case-fatality rates have remained high (21.2-60.8%). Prior to 2013, several EVD outbreaks were controlled by using routine public health interventions; however, the widespread nature of the current EVD outbreak as well as cultural practices in the affected countries have challenged even the most active case identification efforts. In addition, although treatment centers provide supportive care, no effective therapeutic agents are available for EVD-endemic countries. The ongoing EVD outbreak has stimulated investigation of several different therapeutic strategies that target specific viral structures and mechanisms of Ebola viruses. Six to eight putative pharmacotherapies or immunologically based treatments have demonstrated promising results in animal studies. In addition, agents composed of small interfering RNAs targeting specific proteins of Ebola viruses, traditional hyperimmune globulin isolated from Ebola animal models, monoclonal antibodies, and morpholino oligomers (small molecules used to block viral gene expression). A number of EVD therapeutic agents are now entering accelerated human trials in EVD-endemic countries. The goal of therapeutic agent development includes postexposure prevention and EVD cure. As knowledge of Ebola virus virology and pathogenesis grows, it is likely that new therapeutic tools will be developed. Deployment of novel Ebola therapies will require unprecedented cooperation as well as investment to ensure that therapeutic tools become available to populations at greatest risk for EVD and its complications. In this article, we

  10. Avian influenza virus in pregnancy.


    Liu, Shelan; Sha, Jianping; Yu, Zhao; Hu, Yan; Chan, Ta-Chien; Wang, Xiaoxiao; Pan, Hao; Cheng, Wei; Mao, Shenghua; Zhang, Run Ju; Chen, Enfu


    The unprecedented epizootic of avian influenza viruses, such as H5N1, H5N6, H7N1 and H10N8, has continued to cause disease in humans in recent years. In 2013, another novel influenza A (H7N9) virus emerged in China, and 30% of those patients died. Pregnant women are particularly susceptible to avian influenza and are more likely to develop severe complications and to die, especially when infection occurs in the middle and late trimesters. Viremia is believed to occur infrequently, and thus vertical transmission induced by avian influenza appears to be rare. However, avian influenza increases the risk of adverse pregnancy outcomes, including spontaneous abortion, preterm birth and fatal distress. This review summarises 39 cases of pregnant women and their fetuses from different countries dating back to 1997, including 11, 15 and 13 infections with H7N9, H5N1 and the 2009 pandemic influenza (H1N1), respectively. We analysed the epidemic features, following the geographical, population and pregnancy trimester distributions; underlying diseases; exposure history; medical timelines; human-to-human transmission; pathogenicity and vertical transmission; antivirus treatments; maternal severity and mortality and pregnancy outcome. The common experiences reported in different countries and areas suggest that early identification and treatment are imperative. In the future, vigilant virologic and epidemiologic surveillance systems should be developed to monitor avian influenza viruses during pregnancy. Furthermore, extensive study on the immune mechanisms should be conducted, as this will guide safe, rational immunomodulatory treatment among this high-risk population. Most importantly, we should develop a universal avian influenza virus vaccine to prevent outbreaks of the different subtypes. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27187752

  11. No Love Lost Between Viruses and Interferons.


    Fensterl, Volker; Chattopadhyay, Saurabh; Sen, Ganes C


    The interferon system protects mammals against virus infections. There are several types of interferons, which are characterized by their ability to inhibit virus replication and resultant pathogenesis by triggering both innate and cell-mediated immune responses. Virus infection is sensed by a variety of cellular pattern-recognition receptors and triggers the synthesis of interferons, which are secreted by the infected cells. In uninfected cells, cell surface receptors recognize the secreted interferons and activate intracellular signaling pathways that induce the expression of interferon-stimulated genes; the proteins encoded by these genes inhibit different stages of virus replication. To avoid extinction, almost all viruses have evolved mechanisms to defend themselves against the interferon system. Consequently, a dynamic equilibrium of survival is established between the virus and its host, an equilibrium that can be shifted to the host's favor by the use of exogenous interferon as a therapeutic antiviral agent. PMID:26958928

  12. Development of VIRUS alignment and assembly fixtures

    NASA Astrophysics Data System (ADS)

    Collins, Amanda D.; Vattiat, Brian; Marshall, J. L.; Hill, Gary J.; DePoy, D. L.; Lee, Hanshin; Allen, Richard D.; Prochaska, Travis; Villanueva, Steven, Jr.


    The Visible Integral-Field Replicable Unit Spectrograph (VIRUS) Instrument is a set of 150+ optical spectrographs to support observations for the Hobby-Eberly Telescope Dark Energy Experiment (HETDEX). We plan to use a production line assembly process to construct the large number of VIRUS units. This allows each sub-assembly of a VIRUS unit to be interchangeable amongst all other VIRUS units. A production line manufacturing procedure will enable various sub-assemblies to be built and tested in parallel. Examples of alignment and assembly fixtures required for the VIRUS manufacturing process include a camera mirror alignment system, a collimator structure assembly device, a collimator mirror mounting tool, and a grating alignment system. In this paper we describe the design of these fixtures and their importance in the VIRUS assembly process.

  13. Impacts of West Nile Virus on wildlife

    USGS Publications Warehouse

    Saito, E.K.; Wild, M.A.


    The recent epidemic of West Nile virus in the United States proved to be unexpectedly active and was the largest epidemic of the virus ever recorded. Much remains to be discovered about the ecology and epidemiology of West Nile virus in the United States, including which species are important in maintaining the virus in nature, why some species are more susceptible to lethal infection, and what environmental factors are important in predicting future epidemics. These factors will likely vary regionally, depending on local ecological characteristics. Until scientists better understand the virus and factors influencing its activity, predicting its effects for future seasons is impossible. However, experts are certain about one thing: West Nile virus is here to stay.

  14. Virus Infections in the Nervous System

    PubMed Central

    Koyuncu, Orkide O.; Hogue, Ian B.; Enquist, Lynn W.


    Virus infections usually begin in peripheral tissues and can invade the mammalian nervous system (NS), spreading into the peripheral (PNS) and more rarely the central nervous systems (CNS). The CNS is protected from most virus infections by effective immune responses and multi-layer barriers. However, some viruses enter the NS with high efficiency via the bloodstream or by directly infecting nerves that innervate peripheral tissues, resulting in debilitating direct and immune-mediated pathology. Most viruses in the NS are opportunistic or accidental pathogens, but a few, most notably the alpha herpesviruses and rabies virus, have evolved to enter the NS efficiently and exploit neuronal cell biology. Remarkably, the alpha herpesviruses can establish quiescent infections in the PNS, with rare but often fatal CNS pathology. Here we review how viruses gain access to and spread in the well-protected CNS, with particular emphasis on alpha herpesviruses, which establish and maintain persistent NS infections. PMID:23601101

  15. The ecology of emerging neurotropic viruses.


    Olival, Kevin J; Daszak, Peter


    The authors review common themes in the ecology of emerging viruses that cause neurological disease. Three issues emerge. First, 49% of emerging viruses are characterized by encephalitis or serious neurological clinical symptoms. Second, all of these viruses are driven to emerge by ecological, environmental, or human demographic changes, some of which are poorly understood. Finally, the control of these viruses would be enhanced by collaborative multidisciplinary research into these drivers of emergence. The authors highlight this review with a case study of Nipah virus, which emerged in Malaysia due largely to shifts in livestock production and alterations to reservoir host habitat. Collaboration between virologists, ecologists, disease modelers and wildlife biologists has been instrumental in retracing the factors involved in this virus's emergence. PMID:16287685

  16. Study of virus by Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Moor, K.; Kitamura, H.; Hashimoto, K.; Sawa, M.; Andriana, B. B.; Ohtani, K.; Yagura, T.; Sato, H.


    Problem of viruses is very actual for nowadays. Some viruses, which are responsible for human of all tumors, are about 15 %. Main purposes this study, early detection virus in live cell without labeling and in the real time by Raman spectroscopy. Micro Raman spectroscopy (mRs) is a technique that uses a Raman spectrometer to measure the spectra of microscopic samples. According to the Raman spectroscopy, it becomes possible to study the metabolites of a live cultured cell without labeling. We used mRs to detect the virus via HEK 293 cell line-infected adenovirus. We obtained raman specters of lives cells with viruses in 24 hours and 7 days after the infection. As the result, there is some biochemical changing after the treatment of cell with virus. One of biochemical alteration is at 1081 cm-1. For the clarification result, we use confocal fluorescent microscopy and transmission electron microscopy (TEM).

  17. Dengue virus evolution and virulence models.


    Rico-Hesse, Rebeca


    Dengue virus transmission has increased dramatically in the past 2 decades, making this virus one of the most important mosquito-borne human pathogens. The emergence of dengue hemorrhagic fever in most tropical countries has made its control a public health priority, but no vaccines or treatments exist. Little is understood about dengue virus pathogenesis, because no other animals develop symptoms of disease, and research, therefore, has been limited to studies involving patients. Although epidemiologic and evolutionary studies have pointed to host and viral factors in determining disease outcome, only recently developed models could prove the importance of viral genotypes in causing severe epidemics. The influence of host immune status and mosquito vectorial capacity are also being tested in mathematical models to determine virus population dynamics. Therefore, new technologies are allowing us to better understand how specific virus variants cause more disease than others, and these virus variants should be targeted for detection, control, and treatment.

  18. Control of virus diseases of citrus.


    Lee, Richard F


    Citrus is thought to have originated in Southeast Asia and horticulturally desirable clonal selections have been clonally cultivated for hundreds of years. While some citrus species have nucellar embryony, most cultivation of citrus has been by clonal propagation to ensure that propagated plants have the same traits as the parent selection. Clonal propagation also avoids juvenility, and the propagated plants produce fruit sooner. Because of the clonal propagation of citrus, citrus has accumulated a large number of viruses; many of these viruses are asymptomatic until a susceptible rootstock and/or scion is encountered. The viruses reported to occur in citrus will be summarized in this review. Methods of therapy to clean selected clones from viruses will be reviewed; the use of quarantine, clean stock, and certification programs for control of citrus viruses and other strategies to control insect spread citrus viruses, such as mild strain cross-protection and the use of pest management areas will be discussed.

  19. A rapid, quantitative assay for titration of bovine virus diarrhoea-mucosal disease virus.


    Roberts, P C; Etchison, J R; Bond, C W


    An end point dilution microtitration assay is described that can be used for the titration of both cytopathic and non-cytopathic isolates of bovine virus diarrhoea-mucosal disease virus. Indirect immunofluorescence is used to detect infected MDBK cells in the wells of Terasaki plates. The virus titre is derived from the number of uninfected wells, using the Poisson distribution. The assay is simple, fast and economical. Titres of cytopathic virus determined by the microtitration assay and standard plaque assay are equivalent.

  20. Virus wars: using one virus to block the spread of another.


    Paff, Matthew L; Nuismer, Scott L; Ellington, Andrew; Molineux, Ian J; Bull, James J


    The failure of traditional interventions to block and cure HIV infections has led to novel proposals that involve treating infections with therapeutic viruses-infectious viruses that specifically inhibit HIV propagation in the host. Early efforts in evaluating these proposals have been limited chiefly to mathematical models of dynamics, for lack of suitable empirical systems. Here we propose, develop and analyze an empirical system of a therapeutic virus that protects a host cell population against a lethal virus. The empirical system uses E. coli bacteria as the host cell population, an RNA phage as the lethal virus and a filamentous phage as the therapeutic virus. Basic dynamic properties are established for each virus alone and then together. Observed dynamics broadly agree with those predicted by a computer simulation model, although some differences are noted. Two cases of dynamics are contrasted, differing in whether the therapeutic virus is introduced before the lethal virus or after the lethal virus. The therapeutic virus increases in both cases but by different mechanisms. With the therapeutic virus introduced first, it spreads infectiously without any appreciable change in host dynamics. With the therapeutic virus introduced second, host abundance is depressed at the time therapy is applied; following an initial period of therapeutic virus spread by infection, the subsequent rise of protection is through reproduction by hosts already protected. This latter outcome is due to inheritance of the therapeutic virus state when the protected cell divides. Overall, the work establishes the feasibility and robustness to details of a viral interference using a therapeutic virus. PMID:27413636

  1. Zika Virus: the Latest Newcomer.


    Saiz, Juan-Carlos; Vázquez-Calvo, Ángela; Blázquez, Ana B; Merino-Ramos, Teresa; Escribano-Romero, Estela; Martín-Acebes, Miguel A


    Since the beginning of this century, humanity has been facing a new emerging, or re-emerging, virus threat almost every year: West Nile, Influenza A, avian flu, dengue, Chikungunya, SARS, MERS, Ebola, and now Zika, the latest newcomer. Zika virus (ZIKV), a flavivirus transmitted by Aedes mosquitoes, was identified in 1947 in a sentinel monkey in Uganda, and later on in humans in Nigeria. The virus was mainly confined to the African continent until it was detected in south-east Asia the 1980's, then in the Micronesia in 2007 and, more recently in the Americas in 2014, where it has displayed an explosive spread, as advised by the World Health Organization, which resulted in the infection of hundreds of thousands of people. ZIKV infection was characterized by causing a mild disease presented with fever, headache, rash, arthralgia, and conjunctivitis, with exceptional reports of an association with Guillain-Barre syndrome (GBS) and microcephaly. However, since the end of 2015, an increase in the number of GBS associated cases and an astonishing number of microcephaly in fetus and new-borns in Brazil have been related to ZIKV infection, raising serious worldwide public health concerns. Clarifying such worrisome relationships is, thus, a current unavoidable goal. Here, we extensively review what is currently known about ZIKV, from molecular biology, transmission routes, ecology, and epidemiology, to clinical manifestations, pathogenesis, diagnosis, prophylaxis, and public health. PMID:27148186

  2. Zika Virus: the Latest Newcomer.


    Saiz, Juan-Carlos; Vázquez-Calvo, Ángela; Blázquez, Ana B; Merino-Ramos, Teresa; Escribano-Romero, Estela; Martín-Acebes, Miguel A


    Since the beginning of this century, humanity has been facing a new emerging, or re-emerging, virus threat almost every year: West Nile, Influenza A, avian flu, dengue, Chikungunya, SARS, MERS, Ebola, and now Zika, the latest newcomer. Zika virus (ZIKV), a flavivirus transmitted by Aedes mosquitoes, was identified in 1947 in a sentinel monkey in Uganda, and later on in humans in Nigeria. The virus was mainly confined to the African continent until it was detected in south-east Asia the 1980's, then in the Micronesia in 2007 and, more recently in the Americas in 2014, where it has displayed an explosive spread, as advised by the World Health Organization, which resulted in the infection of hundreds of thousands of people. ZIKV infection was characterized by causing a mild disease presented with fever, headache, rash, arthralgia, and conjunctivitis, with exceptional reports of an association with Guillain-Barre syndrome (GBS) and microcephaly. However, since the end of 2015, an increase in the number of GBS associated cases and an astonishing number of microcephaly in fetus and new-borns in Brazil have been related to ZIKV infection, raising serious worldwide public health concerns. Clarifying such worrisome relationships is, thus, a current unavoidable goal. Here, we extensively review what is currently known about ZIKV, from molecular biology, transmission routes, ecology, and epidemiology, to clinical manifestations, pathogenesis, diagnosis, prophylaxis, and public health.

  3. Virus removal by biogenic cerium.


    De Gusseme, Bart; Du Laing, Gijs; Hennebel, Tom; Renard, Piet; Chidambaram, Dev; Fitts, Jeffrey P; Bruneel, Els; Van Driessche, Isabel; Verbeken, Kim; Boon, Nico; Verstraete, Willy


    The rare earth element cerium has been known to exert antifungal and antibacterial properties in the oxidation states +III and +IV. This study reports on an innovative strategy for virus removal in drinking water by the combination of Ce(III) on a bacterial carrier matrix. The biogenic cerium (bio-Ce) was produced by addition of aqueous Ce(III) to actively growing cultures of either freshwater manganese-oxidizing bacteria (MOB) Leptothrix discophora or Pseudomonas putida MnB29. X-ray absorption spectroscopy results indicated that Ce remained in its trivalent state on the bacterial surface. The spectra were consistent with Ce(III) ions associated with the phosphoryl groups of the bacterial cell wall. In disinfection assays using a bacteriophage as model, it was demonstrated that bio-Ce exhibited antiviral properties. A 4.4 log decrease of the phage was observed after 2 h of contact with 50 mg L(-1) bio-Ce. Given the fact that virus removal with 50 mg L(-1) Ce(III) as CeNO(3) was lower, the presence of the bacterial carrier matrix in bio-Ce significantly enhanced virus removal. PMID:20704235

  4. Monitoring Intact Viruses Using Aptamers

    PubMed Central

    Kumar, Penmetcha K. R.


    Viral diagnosis and surveillance are necessary steps in containing the spread of viral diseases, and they help in the deployment of appropriate therapeutic interventions. In the past, the commonly employed viral detection methods were either cell-culture or molecule-level assays. Most of these assays are laborious and expensive, require special facilities, and provide a slow diagnosis. To circumvent these limitations, biosensor-based approaches are becoming attractive, especially after the successful commercialization of glucose and other biosensors. In the present article, I have reviewed the current progress using the biosensor approach for detecting intact viruses. At the time of writing this review, three types of bioreceptor surfaces (antibody-, glycan-, and aptamer-based) have been explored on different sensing platforms for detecting intact viruses. Among these bioreceptors, aptamer-based sensors have been increasingly explored for detecting intact viruses using surface plasmon resonance (SPR) and other platforms. Special emphasis is placed on the aptamer-based SPR platform in the present review. PMID:27527230

  5. Zika Virus: the Latest Newcomer

    PubMed Central

    Saiz, Juan-Carlos; Vázquez-Calvo, Ángela; Blázquez, Ana B.; Merino-Ramos, Teresa; Escribano-Romero, Estela; Martín-Acebes, Miguel A.


    Since the beginning of this century, humanity has been facing a new emerging, or re-emerging, virus threat almost every year: West Nile, Influenza A, avian flu, dengue, Chikungunya, SARS, MERS, Ebola, and now Zika, the latest newcomer. Zika virus (ZIKV), a flavivirus transmitted by Aedes mosquitoes, was identified in 1947 in a sentinel monkey in Uganda, and later on in humans in Nigeria. The virus was mainly confined to the African continent until it was detected in south-east Asia the 1980’s, then in the Micronesia in 2007 and, more recently in the Americas in 2014, where it has displayed an explosive spread, as advised by the World Health Organization, which resulted in the infection of hundreds of thousands of people. ZIKV infection was characterized by causing a mild disease presented with fever, headache, rash, arthralgia, and conjunctivitis, with exceptional reports of an association with Guillain–Barre syndrome (GBS) and microcephaly. However, since the end of 2015, an increase in the number of GBS associated cases and an astonishing number of microcephaly in fetus and new-borns in Brazil have been related to ZIKV infection, raising serious worldwide public health concerns. Clarifying such worrisome relationships is, thus, a current unavoidable goal. Here, we extensively review what is currently known about ZIKV, from molecular biology, transmission routes, ecology, and epidemiology, to clinical manifestations, pathogenesis, diagnosis, prophylaxis, and public health. PMID:27148186

  6. Immunosuppression During Influenza Virus Infection

    PubMed Central

    Kantzler, G. B.; Lauteria, S. F.; Cusumano, C. L.; Lee, J. D.; Ganguly, R.; Waldman, R. H.


    The effects of a live attenuated influenza vaccine and subsequent challenge with virulent influenza virus on the delayed hypersensitivity skin test, and the in vitro response of lymphocytes were evaluated. Volunteers were skin tested before and after administration of vaccine or placebo and challenge with PPD (a purified protein derivative of Mycobacterium tuberculosis), candida, mumps, and trichophytin, and their lymphocytes were tested for [3H]thymidine uptake in response to phytohemagglutin. Of eight volunteers who showed evidence of viral replication after administration of the attenuated vaccine, four had a significant diminution in their skin test response, whereas 8 of 13 volunteers infected with virulent influenza virus showed a diminution. Of the 21 volunteers who were infected with either attenuated or virulent influenza virus, 12 showed suppression of their phytohemagglutin response. None of the volunteers who were given placebo vaccine, or who showed no evidence for viral replication after immunization or challenge, had a suppression of their skin test or phytohemagglutin responses. Although most of the infected volunteers demonstrated suppression of their T-cell function, there was no evidence of a similar suppression of B-cell function. PMID:16558116

  7. Virus Removal by Biogenic Cerium

    SciTech Connect

    De Gusseme, B.; Du Laing, G; Hennebel, T; Renard, P; Chidambaram, D; Fitts, J; Bruneel, E; Van Driessche, I; Verbeken, K; et. al.


    The rare earth element cerium has been known to exert antifungal and antibacterial properties in the oxidation states +III and +IV. This study reports on an innovative strategy for virus removal in drinking water by the combination of Ce(III) on a bacterial carrier matrix. The biogenic cerium (bio-Ce) was produced by addition of aqueous Ce(III) to actively growing cultures of either freshwater manganese-oxidizing bacteria (MOB) Leptothrix discophora or Pseudomonas putida MnB29. X-ray absorption spectroscopy results indicated that Ce remained in its trivalent state on the bacterial surface. The spectra were consistent with Ce(III) ions associated with the phosphoryl groups of the bacterial cell wall. In disinfection assays using a bacteriophage as model, it was demonstrated that bio-Ce exhibited antiviral properties. A 4.4 log decrease of the phage was observed after 2 h of contact with 50 mg L{sup -1} bio-Ce. Given the fact that virus removal with 50 mg L{sup -1} Ce(III) as CeNO{sub 3} was lower, the presence of the bacterial carrier matrix in bio-Ce significantly enhanced virus removal.

  8. Hendra virus ecology and transmission.


    Field, Hume E


    Hendra virus causes acute and highly fatal infection in horses and humans. Pteropid bats (flying-foxes) are the natural host of the virus, with age and species being risk factors for infection. Urine is the primary route of excretion in flying-foxes, with viral RNA more frequently detected in Pteropus alecto and P. conspicillatus than other species. Infection prevalence in flying-foxes can vary between and within years, with a winter peak of excretion occurring in some regions. Vertical transmission and recrudescing infection has been reported in flying-foxes, but horizontal transmission is evidently the primary mode of transmission. The most parsimonious mode of flying-fox to horse transmission is equine contact (oro-nasal, conjunctival) with infected flying-fox urine, either directly, or via urine-contaminated pasture or surfaces. Horse to horse transmission is inefficient, requiring direct contact with infected body fluids. Flying-fox to human transmission has not been recorded; all human cases have been associated with close and direct contact with infected horses. Canine cases (subclinical) have also been limited to equine case properties. Notwithstanding the recent availability of an effective vaccine for horses, a comprehensive understanding of Hendra virus ecology and transmission is essential to limit inter-species transmission.

  9. West Nile Virus and wildlife

    USGS Publications Warehouse

    Marra, P.P.; Griffing, S.; Caffrey, C.; Kilpatrick, A.M.; McLean, R.; Brand, C.; Saito, E.; Dupuis, A.P.; Kramer, L.; Novak, R.


    West Nile virus (WNV) has spread rapidly across North America, resulting in human deaths and in the deaths of untold numbers of birds, mammals, and reptiles. The virus has reached Central America and the Caribbean and may spread to Hawaii and South America. Although tens of thousands of birds have died, and studies of some bird species show local declines, few regionwide declines can be attributed to WNV. Predicting future impacts of WNV on wildlife, and pinpointing what drives epidemics, will require substantial additional research into host susceptibility, reservoir competency, and linkages between climate, mosquitoes, and disease. Such work will entail a collaborative effort between scientists in governmental research groups, in surveillance and control programs, and in nongovernmental organizations. West Nile virus was not the first, and it will not be the last, exotic disease to be introduced to the New World. Its spread in North America highlights the need to strengthen animal monitoring programs and to integrate them with research on disease ecology.

  10. Satellite Tobacco Mosaic Virus Structure

    NASA Technical Reports Server (NTRS)


    The structure of the Satellite Tobacco Mosaic Viurus (STMV)--one of the smallest viruses known--has been successfully reduced using STMV crystals grown aboard the Space Shuttle in 1992 and 1994. The STMV crystals were up to 30 times the volume of any seen in the laboratory. At the time they gave the best resolution data ever obtained on any virus crystal. STMV is a small icosahedral plant virus, consisting of a protein shell made up of 60 identical protein subunits of molecular weight 17,500. Particularly noteworthy is the fact that, in contrast to the crystals grown on Earth, the crystals grown under microgravity conditions were visually perfect, with no striations or clumping of crystals. Furthermore, the x-ray diffraction data obtained from the space-grown crystals was of a much higher quality than the best data available at that time from ground-based crystals. This stylized ribbon model shows the protein coat in white and the nucleic acid in yellow. STMV is used because it is a simple protein to work with; studies are unrelated to tobacco. Credit: Dr. Alex McPherson, University of California at Irvin.

  11. West Nile Virus Drug Discovery

    PubMed Central

    Lim, Siew Pheng; Shi, Pei-Yong


    The outbreak of West Nile virus (WNV) in 1999 in the USA, and its continued spread throughout the Americas, parts of Europe, the Middle East and Africa, underscored the need for WNV antiviral development. Here, we review the current status of WNV drug discovery. A number of approaches have been used to search for inhibitors of WNV, including viral infection-based screening, enzyme-based screening, structure-based virtual screening, structure-based rationale design, and antibody-based therapy. These efforts have yielded inhibitors of viral or cellular factors that are critical for viral replication. For small molecule inhibitors, no promising preclinical candidate has been developed; most of the inhibitors could not even be advanced to the stage of hit-to-lead optimization due to their poor drug-like properties. However, several inhibitors developed for related members of the family Flaviviridae, such as dengue virus and hepatitis C virus, exhibited cross-inhibition of WNV, suggesting the possibility to re-purpose these antivirals for WNV treatment. Most promisingly, therapeutic antibodies have shown excellent efficacy in mouse model; one of such antibodies has been advanced into clinical trial. The knowledge accumulated during the past fifteen years has provided better rationale for the ongoing WNV and other flavivirus antiviral development. PMID:24300672

  12. Monitoring Intact Viruses Using Aptamers.


    Kumar, Penmetcha K R


    Viral diagnosis and surveillance are necessary steps in containing the spread of viral diseases, and they help in the deployment of appropriate therapeutic interventions. In the past, the commonly employed viral detection methods were either cell-culture or molecule-level assays. Most of these assays are laborious and expensive, require special facilities, and provide a slow diagnosis. To circumvent these limitations, biosensor-based approaches are becoming attractive, especially after the successful commercialization of glucose and other biosensors. In the present article, I have reviewed the current progress using the biosensor approach for detecting intact viruses. At the time of writing this review, three types of bioreceptor surfaces (antibody-, glycan-, and aptamer-based) have been explored on different sensing platforms for detecting intact viruses. Among these bioreceptors, aptamer-based sensors have been increasingly explored for detecting intact viruses using surface plasmon resonance (SPR) and other platforms. Special emphasis is placed on the aptamer-based SPR platform in the present review. PMID:27527230

  13. Hendra virus ecology and transmission.


    Field, Hume E


    Hendra virus causes acute and highly fatal infection in horses and humans. Pteropid bats (flying-foxes) are the natural host of the virus, with age and species being risk factors for infection. Urine is the primary route of excretion in flying-foxes, with viral RNA more frequently detected in Pteropus alecto and P. conspicillatus than other species. Infection prevalence in flying-foxes can vary between and within years, with a winter peak of excretion occurring in some regions. Vertical transmission and recrudescing infection has been reported in flying-foxes, but horizontal transmission is evidently the primary mode of transmission. The most parsimonious mode of flying-fox to horse transmission is equine contact (oro-nasal, conjunctival) with infected flying-fox urine, either directly, or via urine-contaminated pasture or surfaces. Horse to horse transmission is inefficient, requiring direct contact with infected body fluids. Flying-fox to human transmission has not been recorded; all human cases have been associated with close and direct contact with infected horses. Canine cases (subclinical) have also been limited to equine case properties. Notwithstanding the recent availability of an effective vaccine for horses, a comprehensive understanding of Hendra virus ecology and transmission is essential to limit inter-species transmission. PMID:26978066

  14. Pathogenesis of gut virus infection.


    Salim, A F; Phillips, A D; Farthing, M J


    In summary, the pathogenesis of many gut virus infections remains uncertain. However, human and animal studies indicate that the majority of gut viruses infect villous enterocytes. Viruses appear to have different affinities for enterocytes at different sites on the villus. Infection of enterocytes leads to cell death, extrusion into the lumen, and villous atrophy when the rate of cell production in the crypts cannot keep pace with the rate of enterocyte loss. This results in a reduced surface area as well as impairment of digestive and absorptive functions. This may also result in a net secretory state. All these changes, along with others such as reduced enzymatic activity and reduced epithelial integrity, may contribute to the induction of an acute but transient malabsorptive diarrhoea which may persist until the digestive/absorptive functions of the enterocyte are restored. However, if colonic compensation is sufficient to handle the increased fluid load, diarrhoea may not be evident. The roles of villous ischaemia, altered countercurrent exchanger of altered immune responses still remain uncertain and require further investigation. PMID:1962725

  15. Foamy Virus Budding and Release

    PubMed Central

    Hütter, Sylvia; Zurnic, Irena; Lindemann, Dirk


    Like all other viruses, a successful egress of functional particles from infected cells is a prerequisite for foamy virus (FV) spread within the host. The budding process of FVs involves steps, which are shared by other retroviruses, such as interaction of the capsid protein with components of cellular vacuolar protein sorting (Vps) machinery via late domains identified in some FV capsid proteins. Additionally, there are features of the FV budding strategy quite unique to the spumaretroviruses. This includes secretion of non-infectious subviral particles and a strict dependence on capsid-glycoprotein interaction for release of infectious virions from the cells. Virus-like particle release is not possible since FV capsid proteins lack a membrane-targeting signal. It is noteworthy that in experimental systems, the important capsid-glycoprotein interaction could be bypassed by fusing heterologous membrane-targeting signals to the capsid protein, thus enabling glycoprotein-independent egress. Aside from that, other systems have been developed to enable envelopment of FV capsids by heterologous Env proteins. In this review article, we will summarize the current knowledge on FV budding, the viral components and their domains involved as well as alternative and artificial ways to promote budding of FV particle structures, a feature important for alteration of target tissue tropism of FV-based gene transfer systems. PMID:23575110

  16. Zika virus: An emergent neuropathological agent.


    White, Martyn K; Wollebo, Hassen S; David Beckham, J; Tyler, Kenneth L; Khalili, Kamel


    The emergence of Zika virus in the Americas has followed a pattern that is familiar from earlier epidemics of other viruses, where a new disease is introduced into a human population and then spreads rapidly with important public health consequences. In the case of Zika virus, an accumulating body of recent evidence implicates the virus in the etiology of serious pathologies of the human nervous system, that is, the occurrence of microcephaly in neonates and Guillain-Barré syndrome in adults. Zika virus is an arbovirus (arthropod-borne virus) and a member of the family Flaviviridae, genus Flavivirus. Zika virions are enveloped and icosahedral, and contain a nonsegmented, single-stranded, positive-sense RNA genome, which encodes 3 structural and 7 nonstructural proteins that are expressed as a single polyprotein that undergoes cleavage. Zika genomic RNA replicates in the cytoplasm of infected host cells. Zika virus was first detected in 1947 in the blood of a febrile monkey in Uganda's Zika Forest and in crushed suspensions of the Aedes mosquito, which is one of the vectors for Zika virus. The virus remained obscure, with a few human cases confined to Africa and Asia. There are two lineages of the Zika virus, African and Asian, with the Asian strain causing outbreaks in Micronesia in 2007 and French Polynesia in 2013-2014. From here, the virus spread to Brazil with the first report of autochthonous Zika transmission in the Americas in March 2015. The rapid advance of the virus in the Americas and its likely association with microcephaly and Guillain-Barré syndrome make Zika an urgent public health concern. Ann Neurol 2016;80:479-489. PMID:27464346

  17. Control of virus diseases in maize.


    Redinbaugh, Margaret G; Zambrano, José L


    Diseases caused by viruses are found throughout the maize-growing regions of the world and can cause significant losses for producers. In this review, virus diseases of maize and the pathogens that cause them are discussed. Factors leading to the spread of disease and measures for disease control are reviewed, as is our current knowledge of the genetics of virus resistance in this important crop. PMID:25410107

  18. Zika virus: An emergent neuropathological agent.


    White, Martyn K; Wollebo, Hassen S; David Beckham, J; Tyler, Kenneth L; Khalili, Kamel


    The emergence of Zika virus in the Americas has followed a pattern that is familiar from earlier epidemics of other viruses, where a new disease is introduced into a human population and then spreads rapidly with important public health consequences. In the case of Zika virus, an accumulating body of recent evidence implicates the virus in the etiology of serious pathologies of the human nervous system, that is, the occurrence of microcephaly in neonates and Guillain-Barré syndrome in adults. Zika virus is an arbovirus (arthropod-borne virus) and a member of the family Flaviviridae, genus Flavivirus. Zika virions are enveloped and icosahedral, and contain a nonsegmented, single-stranded, positive-sense RNA genome, which encodes 3 structural and 7 nonstructural proteins that are expressed as a single polyprotein that undergoes cleavage. Zika genomic RNA replicates in the cytoplasm of infected host cells. Zika virus was first detected in 1947 in the blood of a febrile monkey in Uganda's Zika Forest and in crushed suspensions of the Aedes mosquito, which is one of the vectors for Zika virus. The virus remained obscure, with a few human cases confined to Africa and Asia. There are two lineages of the Zika virus, African and Asian, with the Asian strain causing outbreaks in Micronesia in 2007 and French Polynesia in 2013-2014. From here, the virus spread to Brazil with the first report of autochthonous Zika transmission in the Americas in March 2015. The rapid advance of the virus in the Americas and its likely association with microcephaly and Guillain-Barré syndrome make Zika an urgent public health concern. Ann Neurol 2016;80:479-489.

  19. Modeling Transport of Viruses in Fractured Rock

    NASA Astrophysics Data System (ADS)

    Sleep, B. E.; Mondal, P. K.


    Fractured rock aquifers are frequently used for water supply for human consumption. In many instances the fractured rock aquifers are vulnerable to contamination by pathogens, including viruses, due to co-location of on-site septic systems, wastewater discharges, biosolids and agricultural activities. Approximately half of the illnesses associated with groundwater consumption in the Unites States have been attributed to viral contamination. A number of these cases have been related to transport of viruses from septic systems to drinking water wells. Despite the potential for rapid transport of viruses through rock fractures to drinking water wells, the understanding of virus transport in fractured rock is limited. In particular, the impacts of virus size, fracture aperture variability and roughness, matrix porosity, groundwater velocity, and geochemical conditions have not been well studied. In this study, a multidimensional model for virus transport in variable aperture fractures is presented. The model is applied to laboratory experiments on transport of virus-sized latex microspheres (0.02 and 0.2 microns) and bacteriophages (MS2 and PR772) in artificially fractured dolomite rocks. In these experiments significant impacts of particle size, fracture characteristics, groundwater velocity, and geochemistry were observed. Given the variability in aperture distribution and associated spatial variation in groundwater flow field, one-dimensional models were not suitable for a comprehensive evaluation of the mechanisms governing the microsphere and bacteriophage transport. Various relationships for virus retention (attachment and detachment) are evaluated to provide insight into the governing processes in virus transport in fractured rock. In addition, the role of virus size, fracture aperture variability, fracture roughness, fracture surface charge, matrix porosity, groundwater velocity, and ionic strength in virus transport are evaluated. Scale-up to the field is

  20. RNA virus reverse genetics and vaccine design.


    Stobart, Christopher C; Moore, Martin L


    RNA viruses are capable of rapid spread and severe or potentially lethal disease in both animals and humans. The development of reverse genetics systems for manipulation and study of RNA virus genomes has provided platforms for designing and optimizing viral mutants for vaccine development. Here, we review the impact of RNA virus reverse genetics systems on past and current efforts to design effective and safe viral therapeutics and vaccines.