Sample records for acidic ribosomal proteins

  1. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    PubMed Central


    Background Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. Results We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Conclusions Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction

  2. Identification by affinity chromatography of the eukaryotic ribosomal proteins that bind to 5.8 S ribosomal ribonucleic acid.


    Ulbrich, N; Lin, A; Wool, I G


    The proteins that bind to rat liver 5.8 S ribosomal ribonucleic acid were identified by affinity chromatography. The nucleic acid was oxidized with periodate and coupled by its 3'-terminus to Sepharose 4B through and adipic acid dihydrazide spacer. The ribosomal proteins that associate with the immobilized 5.8 S rRNA were identified by polyacrylamide gel electrophoresiss: they were L19, L8, and L6 from the 60 S subunit; and S13 and S9 from the small subparticle. Small amounts of L14, L17', L18, L27/L27', and L35', and of S11, S15, S23/S24, and S26 also were bound to the affinity column, but whether they associate directly and specifically with 5.8 S rRNA is not known. Escherichia coli ribosomal proteins did not bind to the rat liver 5.8 S rRNA affinity column. PMID:468846

  3. Ribosomal proteins: functions beyond the ribosome

    PubMed Central

    Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua


    Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. PMID:25735597

  4. Evolutionary analyses of the 12-kDa acidic ribosomal P-proteins reveal a distinct protein of higher plant ribosomes

    PubMed Central

    Szick, Kathleen; Springer, Mark; Bailey-Serres, Julia


    The P-protein complex of eukaryotic ribosomes forms a lateral stalk structure in the active site of the large ribosomal subunit and is thought to assist in the elongation phase of translation by stimulating GTPase activity of elongation factor-2 and removal of deacylated tRNA. The complex in animals, fungi, and protozoans is composed of the acidic phosphoproteins P0 (35 kDa), P1 (11–12 kDa), and P2 (11–12 kDa). Previously we demonstrated by protein purification and microsequencing that ribosomes of maize (Zea mays L.) contain P0, one type of P1, two types of P2, and a distinct P1/P2 type protein designated P3. Here we implemented distance matrices, maximum parsimony, and neighbor-joining analyses to assess the evolutionary relationships between the 12 kDa P-proteins of maize and representative eukaryotic species. The analyses identify P3, found to date only in mono- and dicotyledonous plants, as an evolutionarily distinct P-protein. Plants possess three distinct groups of 12 kDa P-proteins (P1, P2, and P3), whereas animals, fungi, and protozoans possess only two distinct groups (P1 and P2). These findings demonstrate that the P-protein complex has evolved into a highly divergent complex with respect to protein composition despite its critical position within the active site of the ribosome. PMID:9482893

  5. Protein Synthesis with Ribosomes Selected for the Incorporation of β-Amino Acids.


    Maini, Rumit; Chowdhury, Sandipan Roy; Dedkova, Larisa M; Roy, Basab; Daskalova, Sasha M; Paul, Rakesh; Chen, Shengxi; Hecht, Sidney M


    In an earlier study, β³-puromycin was used for the selection of modified ribosomes, which were utilized for the incorporation of five different β-amino acids into Escherichia coli dihydrofolate reductase (DHFR). The selected ribosomes were able to incorporate structurally disparate β-amino acids into DHFR, in spite of the use of a single puromycin for the selection of the individual clones. In this study, we examine the extent to which the structure of the β³-puromycin employed for ribosome selection influences the regio- and stereochemical preferences of the modified ribosomes during protein synthesis; the mechanistic probe was a single suppressor tRNA(CUA) activated with each of four methyl-β-alanine isomers (1-4). The modified ribosomes were found to incorporate each of the four isomeric methyl-β-alanines into DHFR but exhibited a preference for incorporation of 3(S)-methyl-β-alanine (β-mAla; 4), i.e., the isomer having the same regio- and stereochemistry as the O-methylated β-tyrosine moiety of β³-puromycin. Also conducted were a selection of clones that are responsive to β²-puromycin and a demonstration of reversal of the regio- and stereochemical preferences of these clones during protein synthesis. These results were incorporated into a structural model of the modified regions of 23S rRNA, which included in silico prediction of a H-bonding network. Finally, it was demonstrated that incorporation of 3(S)-methyl-β-alanine (β-mAla; 4) into a short α-helical region of the nucleic acid binding domain of hnRNP LL significantly stabilized the helix without affecting its DNA binding properties.

  6. Primary structures of three highly acidic ribosomal proteins S6, S12 and S15 from the archaebacterium Halobacterium marismortui.


    Kimura, J; Arndt, E; Kimura, M


    The amino acid sequences of three extremely acidic ribosomal proteins, S6, S12, and S15, from Halobacterium marismortui have been determined. The sequences were obtained by the sequence analysis of peptides derived by enzymatic digestion with trypsin. Stapylococcus aureus protease and chymotrypsin, as well as by cleavage with dilute HCl. The proteins, S6, S12 and S15, consist of 116, 147 and 102 amino acid residues, and have molecular masses of 12,251, 16,440 and 11,747 Da, respectively. Comparison of the amino acid sequences of these proteins with ribosomal protein sequences of other organisms revealed that halobacterial protein S12 has homology with the eukaryotic protein S16A from Saccharomyces cerevisiae, while S15 is significantly related to the Xenopus laevis S19 protein. No homology was found between these halobacterial proteins and any eubacterial ribosomal proteins.

  7. The human ubiquitin-52 amino acid fusion protein gene shares several structural features with mammalian ribosomal protein genes.

    PubMed Central

    Baker, R T; Board, P G


    Complementary DNA clones encoding ubiquitin fused to a 52 amino acid tail protein were isolated from human placental and adrenal gland cDNA libraries. The deduced human 52 amino acid tail protein is very similar to the homologous protein from other species, including the conservation of the putative metal-binding, nucleic acid-binding domain observed in these proteins. Northern blot analysis with a tail-specific probe indicated that the previously identified UbA mRNA species most likely represents comigrating transcripts of the 52 amino acid tail (UbA52) and 80 amino acid tail (UbA80) ubiquitin fusion genes. The UbA52 gene was isolated from a human genomic library and consists of five exons distributed over 3400 base pairs. One intron is in the 5' non-coding region, two interrupt the single ubiquitin coding unit, and the fourth intron is within the tail coding region. Several members of the Alu family of repetitive DNA are associated with the gene. The UbA52 promoter has several features in common with mammalian ribosomal protein genes, including its location in a CpG-rich island, initiation of transcription within a polypyrimidine tract, the lack of a consensus TATA motif, and the presence of Sp1 binding sites, observations that are consistent with the recent identification of the ubiquitin-free tail proteins as ribosomal proteins. Thus, in spite of its unusual feature of being translationally fused to ubiquitin, the 52 amino acid tail ribosomal protein is expressed from a structurally typical ribosomal protein gene. Images PMID:1850507

  8. Ribosome-inactivating proteins

    PubMed Central

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M


    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

  9. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.


    Poirot, Olivier; Timsit, Youri


    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  10. Topography and stoichiometry of acidic proteins in large ribosomal subunits from Artemia salina as determined by crosslinking

    SciTech Connect

    Uchiumi, T.; Wahba, A.J.; Traut, R.R.


    The 60S subunits isolated from Artemia salina ribosomes were treated with the crosslinking reagent 2-iminothiolane under mild conditions. Proteins were extracted and fractions containing crosslinked acidic proteins were obtained by stepwise elution from CM-cellulose. Each fraction was analyzed by diagonal (two-dimensional nonreducing-reducing) NaDodSO/sub 4//polyacrylamide gel electrophoresis. Crosslinked proteins below the diagonal were radioiodinated and identified by two-dimensional acidic urea-NaDodSO/sub 4/ gel electrophoresis. Each of the acidic proteins P1 and P2 was crosslinked individually to the same third protein, PO. The fractions containing acidic proteins were also analyzed by two-dimensional nonequilibrium isoelectric focusing-NaDodSO/sub 4//polyacrylamide gel electrophoresis. Two crosslinked complexes were observed that coincide in isoelectric positions with monomeric P1 and P2, respectively. Both P1 and P2 appear to form crosslinked homodimers. These results suggest the presence in the 60S subunit of (P1)/sub 2/ and (P2)/sub 2/ dimers, each of which is anchored to PO. Protein PO appears to play the same role as L10 in Escherichia coli ribosomes and may form a pentameric complex with the two dimers in the 60S subunits.

  11. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    PubMed Central

    Poirot, Olivier; Timsit, Youri


    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  12. The identification by affinity chromatography of the rat liver ribosomal proteins that bind to elongator and initiator transfer ribonucleic acids.


    Ulbrich, N; Wool, I G; Ackerman, E; Sigler, P B


    Mixed yeast elongator-tRNAs (bulk tRNA lacking fRNAm,fMet), pure isoaccepting species of elongator-tRNAs (tRNAmMet and tRNAPhe), and purified initiator-tRNA (tRNAfMet) were each oxidized with periodate and the 3' terminus was coupled to Sepharose 4B through an adipic acid dihydrazide spacer. The rat liver ribosomal proteins that associated with the tRNAs were isolated by affinity chromatography and identified by electrophoresis in polyacrylamide gels. The rat liver ribosomal proteins that were bound to the elongator-tRNA preparations were L6, L35a, and S15; small amounts of a number of other proteins also associated with the nucleic acid. When initiator-tRNA (tRNAfMet) was immobilized on Sepharose, only L6 and L35a were bound; no 40 S subunit proteins associated with initiator-tRNA. No Escherichia coli proteins formed a complex with either eukaryotic initiator- or elongator-tRNAs. PMID:7391064

  13. Temperature related alterations in the acidic alanine-rich "A" protein from the 50S ribosomal particle of the extreme halophile, Halobacterium cutirubrum.


    Strom, A R; Oda, G; Hasnain, S; Yaguchi, M; Visentin, L P


    50-S ribosomal subunits from the extreme halophilic bacterium, Halobacterium cutirubrum, contain an alanine-rich acidic "A" protein which resembles the L7--L12 multimer (Kaltschmidt and Wittmann, 1970) found in the 50-S ribosomal subunit of Escherichia coli cells. The protein contains 24 mole % alanine and is devoid of histidine, tryptophan and cysteine. Unlike E. coli which has two forms of the "A" protein distinguished solely by the acetylation state of the serine amino terminus. H. cutirubrum 50-S subunits contain only one unsubstituted form of the "A" protein in vivo. However, during purification of ribosomes from cells grown between 25 and 37 degrees C the latter "A" protein undergoes rapid, specific, in vitro enzymatic alteration at its carboxy-terminal end. When the halophile is grown in the temperature range of 40 to 42 degrees C the cleaving enzyme is not active and only one form of the "A" protein is found on the ribosomes.

  14. An Evolutionary Strategy for All-Atom Folding of the 60-Amino-Acid Bacterial Ribosomal Protein L20

    PubMed Central

    Schug, A.; Wenzel, W.


    We have investigated an evolutionary algorithm for de novo all-atom folding of the bacterial ribosomal protein L20. We report results of two simulations that converge to near-native conformations of this 60-amino-acid, four-helix protein. We observe a steady increase of “native content” in both simulated ensembles and a large number of near-native conformations in their final populations. We argue that these structures represent a significant fraction of the low-energy metastable conformations, which characterize the folding funnel of this protein. These data validate our all-atom free-energy force field PFF01 for tertiary structure prediction of a previously inaccessible structural family of proteins. We also compare folding simulations of the evolutionary algorithm with the basin-hopping technique for the Trp-cage protein. We find that the evolutionary algorithm generates a dynamic memory in the simulated population, which leads to faster overall convergence. PMID:16565067

  15. Paradigms of ribosome synthesis: Lessons learned from ribosomal proteins

    PubMed Central

    Gamalinda, Michael; Woolford, John L


    The proteome in all cells is manufactured via the intricate process of translation by multimolecular factories called ribosomes. Nevertheless, these ribonucleoprotein particles, the largest of their kind, also have an elaborate assembly line of their own. Groundbreaking discoveries that bacterial ribosomal subunits can be self-assembled in vitro jumpstarted studies on how ribosomes are constructed. Until recently, ribosome assembly has been investigated almost entirely in vitro with bacterial small subunits under equilibrium conditions. In light of high-resolution ribosome structures and a more sophisticated toolkit, the past decade has been defined by a burst of kinetic studies in vitro and, importantly, also a shift to examining ribosome maturation in living cells, especially in eukaryotes. In this review, we summarize the principles governing ribosome assembly that emerged from studies focusing on ribosomal proteins and their interactions with rRNA. Understanding these paradigms has taken center stage, given the linkage between anomalous ribosome biogenesis and proliferative disorders. PMID:26779413

  16. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.


    Al-Hadid, Qais; White, Jonelle; Clarke, Steven


    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. PMID:26801560

  17. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.


    Al-Hadid, Qais; White, Jonelle; Clarke, Steven


    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation.

  18. Chloroplast ribosomes and protein synthesis.

    PubMed Central

    Harris, E H; Boynton, J E; Gillham, N W


    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles in protein synthesis. This review is concerned primarily with the RNAs and proteins that constitute the chloroplast ribosome, the genes that encode these components, and their expression. It begins with an overview of chloroplast genome structure in land plants and algae and then presents a brief comparison of chloroplast and prokaryotic protein-synthesizing systems and a more detailed analysis of chloroplast rRNAs and ribosomal proteins. A description of the synthesis and assembly of chloroplast ribosomes follows. The review concludes with discussion of whether chloroplast protein synthesis is essential for cell survival. PMID:7854253

  19. Ribosome Inactivating Proteins from Rosaceae.


    Shang, Chenjing; Rougé, Pierre; Van Damme, Els J M


    Ribosome-inactivating proteins (RIPs) are widespread among higher plants of different taxonomic orders. In this study, we report on the RIP sequences found in the genome/transcriptome of several important Rosaceae species, including many economically important edible fruits such as apple, pear, peach, apricot, and strawberry. All RIP domains from Rosaceae share high sequence similarity with conserved residues in the catalytic site and the carbohydrate binding sites. The genomes of Malus domestica and Pyrus communis contain both type 1 and type 2 RIP sequences, whereas for Prunus mume, Prunus persica, Pyrus bretschneideri, and Pyrus communis a complex set of type 1 RIP sequences was retrieved. Heterologous expression and purification of the type 1 as well as the type 2 RIP from apple allowed to characterize the biological activity of the proteins. Both RIPs from Malus domestica can inhibit protein synthesis. Furthermore, molecular modelling suggests that RIPs from Rosaceae possess three-dimensional structures that are highly similar to the model proteins and can bind to RIP substrates. Screening of the recombinant type 2 RIP from apple on a glycan array revealed that this type 2 RIP interacts with terminal sialic acid residues. Our data suggest that the RIPs from Rosaceae are biologically active proteins. PMID:27556443

  20. Ribosome Inactivating Proteins from Rosaceae.


    Shang, Chenjing; Rougé, Pierre; Van Damme, Els J M


    Ribosome-inactivating proteins (RIPs) are widespread among higher plants of different taxonomic orders. In this study, we report on the RIP sequences found in the genome/transcriptome of several important Rosaceae species, including many economically important edible fruits such as apple, pear, peach, apricot, and strawberry. All RIP domains from Rosaceae share high sequence similarity with conserved residues in the catalytic site and the carbohydrate binding sites. The genomes of Malus domestica and Pyrus communis contain both type 1 and type 2 RIP sequences, whereas for Prunus mume, Prunus persica, Pyrus bretschneideri, and Pyrus communis a complex set of type 1 RIP sequences was retrieved. Heterologous expression and purification of the type 1 as well as the type 2 RIP from apple allowed to characterize the biological activity of the proteins. Both RIPs from Malus domestica can inhibit protein synthesis. Furthermore, molecular modelling suggests that RIPs from Rosaceae possess three-dimensional structures that are highly similar to the model proteins and can bind to RIP substrates. Screening of the recombinant type 2 RIP from apple on a glycan array revealed that this type 2 RIP interacts with terminal sialic acid residues. Our data suggest that the RIPs from Rosaceae are biologically active proteins.

  1. Ribosomes and Ribosomal Protein from Neurospora crassa I. Physical, Chemical, and Immunochemical Properties1

    PubMed Central

    Alberghina, F. A. M.; Suskind, S. R.


    Ribosomes from Neurospora crassa, initially characterized by ultracentrifugal and immunochemical analyses, have been used to prepare ribosomal protein for physical, chemical, and immunochemical study. The acrylamide gel disc electrophoretic profiles of Neurospora ribosomal protein exhibit a degree of heterogeneity comparable to what has been observed in other systems. Only by chemical modification or by aggregation of the protein do alterations in the profile become apparent. Disulfide-bond formation appears to play a role in the aggregation of ribosomal protein to complexes of S20,w = 200. The aggregation can be prevented by alkylation of −SH groups, and protein treated in this fashion has a subunit molecular weight of about 20,000 as determined by equilibrium centrifugation. Finger-printing of tryptic peptides indicates that more than one unique sequence of amino acids must be present in ribosomal protein, although gross primary structural heterogeneity is questioned. Antigenic heterogeneity is much less apparent; only a few precipitin bands are resolved by immunodiffusion tests, although complete reactivity of total ribosomal protein is suggested by quantitative precipitin analysis. The antigenically active ribosomal protein components appear to reside in at least two fractions; one is removed readily from the ribosome by CsC1 treatment. Ribosomal protein of N. crassa possesses antigenic determinants present in E. coli ribosomal protein as judged by spur formation in immunodiffusion tests. Images PMID:4962303

  2. β-Boswellic acid, a bioactive substance used in food supplements, inhibits protein synthesis by targeting the ribosomal machinery.


    Casapullo, A; Cassiano, C; Capolupo, A; Del Gaudio, F; Esposito, R; Tosco, A; Riccio, R; Monti, M C


    The Boswellia gum resin extracts have been used in traditional medicines because of their remarkable anti-inflammatory properties. Nowadays, these extracts are on the market as food supplements. β-Boswellic acid (βBA) is one of the main pentacyclic triterpene components, among the family of BAs, of the Boswellia gum resins. BAs have been broadly studied and are well known for their wide anti-inflammatory and potential anticancer properties. In this paper, a mass spectrometry-based chemoproteomic approach has been applied to characterize the whole βBA interacting profile. Among the large numbers of proteins fished out, proteasome, 14-3-3 and some ribosomal proteins were considered the most interesting targets strictly connected to the modulation of the cancer progression. In particular, because of their recent assessment as innovative chemotherapeutic targets, the ribosomal proteins were considered the most attractive βBA partners, and the biological role of their interaction with the natural compound has been evaluated. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27460774

  3. The properties of ribosomal proteins from a moderate halophile.


    Falkenberg, P; Matheson, A T; Rollin, C F


    The ribosomes from the extreme halophile Halobacterium cutirubrum are unusual in that their ribosomal proteins are acidic rather than basic as is the case with almost all bacterial ribosomes (Bayley, S.T. (1966) J. Mol. Biol. 15, 420-427). To determine whether the ribosomes of a moderate halophile show similar properties the ribosomal proteins from an unidentified moderate halophile, which grows over a wide range of NaCl concentrations (0.04-4.3 M), were compared to those of Escherichia coli and H. cutirubrum. The proteins are slightly more acidic than those of E. coli but much less acidic than those from the extreme halophile as judged by their mobility on polyacrylamide gels and their amino acid composition. The electrophoretic profile on polyacrylamide gels of the ribosomal proteins from the moderate halophile is similar whether the cells are grown in 0.5 M or 4.25 M NaCl.

  4. Phylogenomics of Prokaryotic Ribosomal Proteins

    PubMed Central

    Yutin, Natalya; Puigbò, Pere; Koonin, Eugene V.; Wolf, Yuri I.


    Archaeal and bacterial ribosomes contain more than 50 proteins, including 34 that are universally conserved in the three domains of cellular life (bacteria, archaea, and eukaryotes). Despite the high sequence conservation, annotation of ribosomal (r-) protein genes is often difficult because of their short lengths and biased sequence composition. We developed an automated computational pipeline for identification of r-protein genes and applied it to 995 completely sequenced bacterial and 87 archaeal genomes available in the RefSeq database. The pipeline employs curated seed alignments of r-proteins to run position-specific scoring matrix (PSSM)-based BLAST searches against six-frame genome translations, mitigating possible gene annotation errors. As a result of this analysis, we performed a census of prokaryotic r-protein complements, enumerated missing and paralogous r-proteins, and analyzed the distributions of ribosomal protein genes among chromosomal partitions. Phyletic patterns of bacterial and archaeal r-protein genes were mapped to phylogenetic trees reconstructed from concatenated alignments of r-proteins to reveal the history of likely multiple independent gains and losses. These alignments, available for download, can be used as search profiles to improve genome annotation of r-proteins and for further comparative genomics studies. PMID:22615861

  5. Humoral and Cell-mediated Autoimmune Reactions to Human Acidic Ribosomal P2 Protein in Individuals Sensitized to Aspergillus fumigatus P2 Protein

    PubMed Central

    Mayer, Christina; Appenzeller, Ulrich; Seelbach, Heike; Achatz, Gernot; Oberkofler, Hannes; Breitenbach, Michael; Blaser, Kurt; Crameri, Reto


    A panel of cDNAs encoding allergenic proteins was isolated from an Aspergillus fumigatus cDNA library displayed on the surface of filamentous phage. Solid phase–immobilized serum immunoglobulin E (IgE) from A. fumigatus–allergic individuals was used to enrich phage displaying IgE-binding molecules. One of the cDNAs encoded a 11.1-kD protein that was identified as acidic ribosomal phosphoprotein type 2 (P2 protein). The allergen, formally termed rAsp f 8, shares >62% sequence identity and >84% sequence homology to corresponding eukaryotic P2 proteins, including human P2 protein. The sequences encoding human and fungal P2 protein were subcloned, expressed in Escherichia coli as His6-tagged fusion proteins, and purified by Ni2+–chelate affinity chromatography. Both recombinant P2 proteins were recognized by IgE antibodies from allergic individuals sensitized to the A. fumigatus P2 protein and elicited strong type 1–specific skin reactions in these individuals. Moreover, human and fungal P2 proteins induced proliferative responses in peripheral blood mononuclear cells of A. fumigatus– allergic subjects sensitized to the fungal P2 protein. These data provide strong evidence for in vitro and in vivo humoral and cell-mediated autoreactivity to human P2 protein in patients suffering from chronic A. fumigatus allergy. PMID:10224291

  6. Evaluation of DNA encoding acidic ribosomal protein P2 of Cryptosporidium parvum as a potential vaccine candidate for cryptosporidiosis.


    Benitez, Alvaro; Priest, Jeffrey W; Ehigiator, Humphrey N; McNair, Nina; Mead, Jan R


    The Cryptosporidium parvum acidic ribosomal protein P2 (CpP2) is an important immunodominant marker in C. parvum infection. In this study, the CpP2 antigen was evaluated as a vaccine candidate using a DNA vaccine model in adult C57BL/6 IL-12 knockout (KO) mice, which are susceptible to C. parvum infection. Our data show that subcutaneous immunization in the ear with DNA encoding CpP2 (CpP2-DNA) cloned into the pUMVC4b vector induced a significant anti-CpP2 IgG antibody response that was predominantly of the IgG1 isotype. Compared to control KO mice immunized with plasmid alone, CpP2-immunized mice demonstrated specific in vitro spleen cell proliferation as well as enhanced IFN-γ production to recombinant CpP2. Further, parasite loads in CpP2 DNA-immunized mice were compared to control mice challenged with C. parvum oocysts. Although a trend in reduction of infection was observed in the CpP2 DNA-immunized mice, differences between groups were not statistically significant. These results suggest that a DNA vaccine encoding the C. parvum P2 antigen is able to provide an effective means of eliciting humoral and cellular responses and has the potential to generate protective immunity against C. parvum infection but may require using alternative vectors or adjuvant to generate a more potent and balanced response.

  7. Interaction of neomycin with ribosomes and ribosomal ribonucleic acid.


    Dahlberg, A E; Horodyski, F; Keller, P


    Neomycin binds ribosomes and ribosomal ribonucleic acid (rRNA) in vivo and in vitro producing changes detectable by increases in gel electrophoretic mobility. These changes were observed in gels that contain ethylenediaminetetraacetic acid or no added magnesium ion. The progressive increase in gel electrophoretic mobility with increasing antibiotic concentrations suggests that neomycin is binding at multiple sites on RNA. The binding was reversible but sufficiently stable to survive dialysis and electrophoresis. It is proposed that bound neomycin stabilizes the ribosome and RNA structures, restricting the unfolding of the particles during electrophoresis and thus allowing for a more rapid migration in the gel. Gentamicin produced an effect similar to that of neomycin. Paromomycin, differing from neomycin by only one amino group, had considerably less effect on ribosome and rRNA mobilities. The binding of neomycin to rRNA improved the linearity of the plot of log molecular weight versus mobility and thus may be of benefit in providing a more accurate estimation of molecular weights of large RNAs.

  8. High efficacy of a 20 amino acid peptide of the acidic ribosomal protein P0 against the cattle tick, Rhipicephalus microplus.


    Rodríguez-Mallon, Alina; Encinosa, Pedro E; Méndez-Pérez, Lídice; Bello, Yamil; Rodríguez Fernández, Rafmary; Garay, Hilda; Cabrales, Ania; Méndez, Luis; Borroto, Carlos; Estrada, Mario Pablo


    Current strategies to control cattle ticks use integrated control programs (ICP) that include vaccination. Reduction in the use of chemicals and in the cost of tick control, the delay or elimination of acaricide resistance and the decreasing of environmental pollution are the advantages of using these programs. This integrated program is potentially applicable to all genotypes of chemical resistant ticks. However, the problem here is to improve the efficacy of anti-tick vaccines. The P0 protein is a structural component of the ribosome of all organisms. We have identified an immunogenic region of ribosomal protein P0 from Rhipicephalus spp. ticks that is not very conserved compared to the orthologous protein in their hosts. A synthetic 20 amino acid peptide from this sequence was effective as a vaccine against Rhipicephalus sanguineus infestations in an immunization and challenge experiment using rabbits. In this paper, the same peptide used as vaccine against the cattle tick Rhipicephalus Boophilus microplus shows a significant diminution in the number of engorged females recovered, in the weight of females and the weight of egg masses. The number of eggs hatched was also significantly reduced for the vaccinated group, with an overall effectivity for the antigen pP0 of 96%. These results, together with the conserved sequence of the P0 peptide among ticks, suggest that this antigen could be a good broad spectrum vaccine candidate. It would be expected to be active against many species of ticks and thus has promise in an ICP for effective control of ticks and thereby to improve the efficiency and productivity of the livestock industry. PMID:25958782

  9. Ribosome-associated protein quality control

    PubMed Central

    Brandman, Onn; Hegde, Ramanujan S


    Protein synthesis by the ribosome can fail for numerous reasons including faulty mRNA, insufficient availability of charged tRNAs and genetic errors. All organisms have evolved mechanisms to recognize stalled ribosomes and initiate pathways for recycling, quality control and stress signaling. Here we review the discovery and molecular dissection of the eukaryotic ribosome-associated quality-control pathway for degradation of nascent polypeptides arising from interrupted translation. PMID:26733220

  10. Posttranslational Modifications of Ribosomal Proteins in Escherichia coli.


    Nesterchuk, M V; Sergiev, P V; Dontsova, O A


    А number of ribosomal proteins inEscherichia coliundergo posttranslational modifications. Six ribosomal proteins are methylated (S11, L3, L11, L7/L12, L16, and L33), three proteins are acetylated (S5, S18, and L7), and protein S12 is methylthiolated. Extra amino acid residues are added to protein S6. С-terminal amino acid residues are partially removed from protein L31. The functional significance of these modifications has remained unclear. These modifications are not vital to the cells, and it is likely that they have regulatory functions. This paper reviews all the known posttranslational modifications of ribosomal proteins inEscherichia coli. Certain enzymes responsible for the modifications and mechanisms of enzymatic reactions are also discussed.

  11. Differential Stoichiometry among Core Ribosomal Proteins

    PubMed Central

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander


    Summary Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  12. Differential Stoichiometry among Core Ribosomal Proteins.


    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander


    Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  13. The quantitative assessment of the role played by basic amino acid clusters in the nuclear uptake of human ribosomal protein L7

    SciTech Connect

    Tai, Lin-Ru; Chou, Chang-Wei; Lee, I-Fang; Kirby, Ralph; Lin, Alan


    In this study, we used a multiple copy (EGFP){sub 3} reporter system to establish a numeric nuclear index system to assess the degree of nuclear import. The system was first validated by a FRAP assay, and then was applied to evaluate the essential and multifaceted nature of basic amino acid clusters during the nuclear import of ribosomal protein L7. The results indicate that the sequence context of the basic cluster determines the degree of nuclear import, and that the number of basic residues in the cluster is irrelevant; rather the position of the pertinent basic residues is crucial. Moreover, it also found that the type of carrier protein used by basic cluster has a great impact on the degree of nuclear import. In case of L7, importin β2 or importin β3 are preferentially used by clusters with a high import efficiency, notwithstanding that other importins are also used by clusters with a weaker level of nuclear import. Such a preferential usage of multiple basic clusters and importins to gain nuclear entry would seem to be a common practice among ribosomal proteins in order to ensure their full participation in high rate ribosome synthesis. - Highlights: ► We introduce a numeric index system that represents the degree of nuclear import. ► The rate of nuclear import is dictated by the sequence context of the basic cluster. ► Importin β2 and β3 were mainly responsible for the N4 mediated nuclear import.

  14. A new system for naming ribosomal proteins

    PubMed Central

    Ban, Nenad; Beckmann, Roland; Cate, Jamie HD; Dinman, Jonathan D; Dragon, François; Ellis, Steven R; Lafontaine, Denis LJ; Lindahl, Lasse; Liljas, Anders; Lipton, Jeffrey M; McAlear, Michael A; Moore, Peter B; Noller, Harry F; Ortega, Joaquin; Panse, Vikram Govind; Ramakrishnan, V; Spahn, Christian MT; Steitz, Thomas A; Tchorzewski, Marek; Tollervey, David; Warren, Alan J; Williamson, James R; Wilson, Daniel; Yonath, Ada; Yusupov, Marat


    A system for naming ribosomal proteins is described that the authors intend to use in the future. They urge others to adopt it. The objective is to eliminate the confusion caused by the assignment of identical names to ribosomal proteins from different species that are unrelated in structure and function. In the system proposed here, homologous ribosomal proteins are assigned the same name, regardless of species. It is designed so that new names are similar enough to old names to be easily recognized, but are written in a format that unambiguously identifies them as ‘new system’ names. PMID:24524803

  15. Protein synthesis by ribosomes with tethered subunits.


    Orelle, Cédric; Carlson, Erik D; Szal, Teresa; Florin, Tanja; Jewett, Michael C; Mankin, Alexander S


    The ribosome is a ribonucleoprotein machine responsible for protein synthesis. In all kingdoms of life it is composed of two subunits, each built on its own ribosomal RNA (rRNA) scaffold. The independent but coordinated functions of the subunits, including their ability to associate at initiation, rotate during elongation, and dissociate after protein release, are an established model of protein synthesis. Furthermore, the bipartite nature of the ribosome is presumed to be essential for biogenesis, since dedicated assembly factors keep immature ribosomal subunits apart and prevent them from translation initiation. Free exchange of the subunits limits the development of specialized orthogonal genetic systems that could be evolved for novel functions without interfering with native translation. Here we show that ribosomes with tethered and thus inseparable subunits (termed Ribo-T) are capable of successfully carrying out protein synthesis. By engineering a hybrid rRNA composed of both small and large subunit rRNA sequences, we produced a functional ribosome in which the subunits are covalently linked into a single entity by short RNA linkers. Notably, Ribo-T was not only functional in vitro, but was also able to support the growth of Escherichia coli cells even in the absence of wild-type ribosomes. We used Ribo-T to create the first fully orthogonal ribosome-messenger RNA system, and demonstrate its evolvability by selecting otherwise dominantly lethal rRNA mutations in the peptidyl transferase centre that facilitate the translation of a problematic protein sequence. Ribo-T can be used for exploring poorly understood functions of the ribosome, enabling orthogonal genetic systems, and engineering ribosomes with new functions.

  16. On the expansion of ribosomal proteins and RNAs in eukaryotes.


    Parker, Michael S; Sah, Renu; Balasubramaniam, Ambikaipakan; Sallee, Floyd R; Park, Edwards A; Parker, Steven L


    While the ribosome constitution is similar in all biota, there is a considerable increase in size of both ribosomal proteins (RPs) and RNAs in eukaryotes as compared to archaea and bacteria. This is pronounced in the large (60S) ribosomal subunit (LSU). In addition to enlargement (apparently maximized already in lower eukarya), the RP changes include increases in fraction, segregation and clustering of basic residues, and decrease in hydrophobicity. The acidic fraction is lower in eukaryote as compared to prokaryote RPs. In all eukaryote groups tested, the LSU RPs have significantly higher content of basic residues and homobasic segments than the SSU RPs. The vertebrate LSU RPs have much higher sequestration of basic residues than those of bacteria, archaea and even of the lower eukarya. The basic clusters are highly aligned in the vertebrate, but less in the lower eukarya, and only within families in archaea and bacteria. Increase in the basicity of RPs, besides helping transport to the nucleus, should promote stability of the assembled ribosome as well as the association with translocons and other intracellular matrix proteins. The size and GC nucleotide bias of the expansion segments of large LSU rRNAs also culminate in the vertebrate, and should support ribosome association with the endoplasmic reticulum and other intracellular networks. However, the expansion and nucleotide bias of eukaryote LSU rRNAs do not clearly correlate with changes in ionic parameters of LSU ribosomal proteins.

  17. Methylation of ribosomal protein S10 by protein-arginine methyltransferase 5 regulates ribosome biogenesis.


    Ren, Jinqi; Wang, Yaqing; Liang, Yuheng; Zhang, Yongqing; Bao, Shilai; Xu, Zhiheng


    Modulation of ribosomal assembly is a fine tuning mechanism for cell number and organ size control. Many ribosomal proteins undergo post-translational modification, but their exact roles remain elusive. Here, we report that ribosomal protein s10 (RPS10) is a novel substrate of an oncoprotein, protein-arginine methyltransferase 5 (PRMT5). We show that PRMT5 interacts with RPS10 and catalyzes its methylation at the Arg(158) and Arg(160) residues. The methylation of RPS10 at Arg(158) and Arg(160) plays a role in the proper assembly of ribosomes, protein synthesis, and optimal cell proliferation. The RPS10-R158K/R160K mutant is not efficiently assembled into ribosomes and is unstable and prone to degradation by the proteasomal pathway. In nucleoli, RPS10 interacts with nucleophosmin/B23 and is predominantly concentrated in the granular component region, which is required for ribosome assembly. The RPS10 methylation mutant interacts weakly with nucleophosmin/B23 and fails to concentrate in the granular component region. Our results suggest that PRMT5 is likely to regulate cell proliferation through the methylation of ribosome proteins, and thus reveal a novel mechanism for PRMT5 in tumorigenesis.

  18. Interrelationships between Yeast Ribosomal Protein Assembly Events and Transient Ribosome Biogenesis Factors Interactions in Early Pre-Ribosomes

    PubMed Central

    Jakob, Steffen; Ohmayer, Uli; Neueder, Andreas; Hierlmeier, Thomas; Perez-Fernandez, Jorge; Hochmuth, Eduard; Deutzmann, Rainer; Griesenbeck, Joachim; Tschochner, Herbert; Milkereit, Philipp


    Early steps of eukaryotic ribosome biogenesis require a large set of ribosome biogenesis factors which transiently interact with nascent rRNA precursors (pre-rRNA). Most likely, concomitant with that initial contacts between ribosomal proteins (r-proteins) and ribosome precursors (pre-ribosomes) are established which are converted into robust interactions between pre-rRNA and r-proteins during the course of ribosome maturation. Here we analysed the interrelationship between r-protein assembly events and the transient interactions of ribosome biogenesis factors with early pre-ribosomal intermediates termed 90S pre-ribosomes or small ribosomal subunit (SSU) processome in yeast cells. We observed that components of the SSU processome UTP-A and UTP-B sub-modules were recruited to early pre-ribosomes independently of all tested r-proteins. On the other hand, groups of SSU processome components were identified whose association with early pre-ribosomes was affected by specific r-protein assembly events in the head-platform interface of the SSU. One of these components, Noc4p, appeared to be itself required for robust incorporation of r-proteins into the SSU head domain. Altogether, the data reveal an emerging network of specific interrelationships between local r-protein assembly events and the functional interactions of SSU processome components with early pre-ribosomes. They point towards some of these components being transient primary pre-rRNA in vivo binders and towards a role for others in coordinating the assembly of major SSU domains. PMID:22431976

  19. Studies on ribosomal proteins in the cellular slime mold Dictyostelium discoideum. Resolution, nomenclature and molecular weights of proteins in the 40-S and 60-S ribosomal subunits.


    Ramagopal, S; Ennis, H L


    This study is concerned with the identification and subunit localization of ribosomal proteins in Dictyostelium discoideum. The characterization is based on the resolution of ribosomal proteins by various methods of electrophoresis. 34 and 42 unique proteins were identified in the 40-S and 60-S ribosomal subunits respectively. The total mass of proteins in the 40-S subunit was 746,100 daltons and 981,900 daltons in the 60-S subunit. The molecular weights of individual proteins in the 40-S subunit ranged from 13,200 to 40,900 with a number-average molecular weight of 21,900. The molecular weight range for the 60-S subunit was 13,800--51,100 with a number-average molecular weight of 23,400. The 80-S ribosome contained 78 proteins, two of which were lost upon its dissociation into subunits. All the proteins of the 40-S and 60-S subunits could be identified individually in a 80-S map as well as in unfractionated proteins from whole cells. Purification of ribosomes in high-ionic-strength buffers resulted in non-specific loss of the various proteins from the 40-S and 60-S subunits. In addition, the undissociated ribosomes contained about 10 acidic proteins in the molecular weight range 50,000--100,000, which were retained after washing the ribosomes in high-salt buffers. They were found in polysomes, run-off ribosomes and could also be identified in the 40-S subunit after dissociation.

  20. Diversity of acid stress resistant variants of Listeria monocytogenes and the potential role of ribosomal protein S21 encoded by rpsU

    PubMed Central

    Metselaar, Karin I.; den Besten, Heidy M. W.; Boekhorst, Jos; van Hijum, Sacha A. F. T.; Zwietering, Marcel H.; Abee, Tjakko


    The dynamic response of microorganisms to environmental conditions depends on the behavior of individual cells within the population. Adverse environments can select for stable stress resistant subpopulations. In this study, we aimed to get more insight in the diversity within Listeria monocytogenes LO28 populations, and the genetic basis for the increased resistance of stable resistant fractions isolated after acid exposure. Phenotypic cluster analysis of 23 variants resulted in three clusters and four individual variants and revealed multiple-stress resistance, with both unique and overlapping features related to stress resistance, growth, motility, biofilm formation, and virulence indicators. A higher glutamate decarboxylase activity correlated with increased acid resistance. Whole genome sequencing revealed mutations in rpsU, encoding ribosomal protein S21 in the largest phenotypic cluster, while mutations in ctsR, which were previously shown to be responsible for increased resistance of heat and high hydrostatic pressure resistant variants, were not found in the acid resistant variants. This underlined that large population diversity exists within one L. monocytogenes strain and that different adverse conditions drive selection for different variants. The finding that acid stress selects for rpsU variants provides potential insights in the mechanisms underlying population diversity of L. monocytogenes. PMID:26005439

  1. The tails of ubiquitin precursors are ribosomal proteins whose fusion to ubiquitin facilitates ribosome biogenesis

    NASA Astrophysics Data System (ADS)

    Finley, Daniel; Bartel, Bonnie; Varshavsky, Alexander


    Three of the four yeast ubiquitin genes encode hybrid proteins which are cleaved to yield ubiquitin and previously unidentified ribosomal proteins. The transient association between ubiquitin and these proteins promotes their incorporation into nascent ribosomes and is required for efficient ribosome biogenesis. These results suggest a novel 'chaperone' function for ubiquitin, in which its covalent association with other proteins promotes the formation of specific cellular structures.

  2. Ribosome-mediated translational pause and protein domain organization.

    PubMed Central

    Thanaraj, T. A.; Argos, P.


    Because regions on the messenger ribonucleic acid differ in the rate at which they are translated by the ribosome and because proteins can fold cotranslationally on the ribosome, a question arises as to whether the kinetics of translation influence the folding events in the growing nascent polypeptide chain. Translationally slow regions were identified on mRNAs for a set of 37 multidomain proteins from Escherichia coli with known three-dimensional structures. The frequencies of individual codons in mRNAs of highly expressed genes from E. coli were taken as a measure of codon translation speed. Analysis of codon usage in slow regions showed a consistency with the experimentally determined translation rates of codons; abundant codons that are translated with faster speeds compared with their synonymous codons were found to be avoided; rare codons that are translated at an unexpectedly higher rate were also found to be avoided in slow regions. The statistical significance of the occurrence of such slow regions on mRNA spans corresponding to the oligopeptide domain termini and linking regions on the encoded proteins was assessed. The amino acid type and the solvent accessibility of the residues coded by such slow regions were also examined. The results indicated that protein domain boundaries that mark higher-order structural organization are largely coded by translationally slow regions on the RNA and are composed of such amino acids that are stickier to the ribosome channel through which the synthesized polypeptide chain emerges into the cytoplasm. The translationally slow nucleotide regions on mRNA possess the potential to form hairpin secondary structures and such structures could further slow the movement of ribosome. The results point to an intriguing correlation between protein synthesis machinery and in vivo protein folding. Examination of available mutagenic data indicated that the effects of some of the reported mutations were consistent with our hypothesis

  3. Ribonucleic acid-protein cross-linking within the intact Escherichia coli ribosome, utilizing ethylene glycol bis[3-(2-ketobutyraldehyde) ether], a reversible, bifunctional reagent: identification of 30S proteins.


    Brewer, L A; Noller, H F


    To obtain detailed topographical information concerning the spatial arrangement of the multitude of ribosomal proteins with respect to specific sequences in the three RNA chains of intact ribosomes, a reagent capable of covalently and reversibly joining RNA to protein has been synthesized [Brewer, L.A., Goelz, S., & Noller, H. F. (1983) Biochemistry (preceding paper in this issue)]. This compound, ethylene glycol bis[3-(2-ketobutyraldehyde) ether] which we term "bikethoxal", possesses two reactive ends similar to kethoxal. Accordingly, it reacts selectively with guanine in single-stranded regions of nucleic acid and with arginine in protein. The cross-linking is reversible in that the arginine- and guanine-bikethoxal linkage can be disrupted by treatment with mild base, allowing identification of the linked RNA and protein components by standard techniques. Further, since the sites of kethoxal modification within the RNA sequences of intact subunits are known, the task of identifying the components of individual ribonucleoprotein complexes should be considerably simplified. About 15% of the ribosomal protein was covalently cross-linked to 16S RNA by bikethoxal under our standard reaction conditions, as monitored by comigration of 35S-labeled protein with RNA on Sepharose 4B in urea. Cross-linked 30S proteins were subsequently removed from 16S RNA by treatment with T1 ribonuclease and/or mild base cleavage of the reagent and were identified by two-dimensional polyacrylamide gel electrophoresis. The major 30S proteins found in cross-linked complexes are S4, S5, S6, S7, S8, S9 (S11), S16, and S18. The minor ones are S2, S3, S12, S13, S14, S15, and S17.

  4. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function

    PubMed Central

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D


    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  5. Potential extra-ribosomal functions of ribosomal proteins in Saccharomyces cerevisiae.


    Lu, Hui; Zhu, Yi-Fei; Xiong, Juan; Wang, Rong; Jia, Zhengping


    Ribosomal proteins (RPs), are essential components of the ribosomes, the molecular machines that turn mRNA blueprints into proteins, as they serve to stabilize the structure of the rRNA, thus improving protein biosynthesis. In addition, growing evidence suggests that RPs can function in other cellular roles. In the present review, we summarize several potential extra-ribosomal functions of RPs in ribosomal biogenesis, transcription activity, translation process, DNA repair, replicative life span, adhesive growth, and morphological transformation in Saccharomyces cerevisiae. However, the future in-depth studies are needed to identify these novel secondary functions of RPs in S. cerevisiae.

  6. [Topography of ribosomal proteins: reconsideration of of protein map of small ribosomal subunit].


    Spirin, A S; Agafonov, D E; Kolb, V A; Kommer, A


    Exposure of proteins on the surface of the small (30S) ribosomal subunit of Escherichia coli was studied by the hot tritium bombardment technique. Eight of 21 proteins of the 30 S subunit (S3, S8, S10, S12, S15, S16, S17, and S19) had virtually no groups exposed on the surface of the particle, i.e., they were mainly hidden inside. Seven proteins (S1, S4, S5, S7, S18, S20, and S21) were all well exposed on the surface of the particle, thus being outside proteins. The remaining proteins (S2, S6, S9 and/or S11, S13, and S14) were partially exposed. On the basis of these results a reconcilement of the three-dimensional protein map of the small ribosomal subunit has been done and corrected model is proposed.

  7. Ribosomal History Reveals Origins of Modern Protein Synthesis

    PubMed Central

    Harish, Ajith; Caetano-Anollés, Gustavo


    The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17) and the oldest substructure (the ribosomal ratchet) in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world. PMID:22427882

  8. Ribosomal history reveals origins of modern protein synthesis.


    Harish, Ajith; Caetano-Anollés, Gustavo


    The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17) and the oldest substructure (the ribosomal ratchet) in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world. PMID:22427882

  9. Ribosome-Inactivating and Related Proteins

    PubMed Central

    Schrot, Joachim; Weng, Alexander; Melzig, Matthias F.


    Ribosome-inactivating proteins (RIPs) are toxins that act as N-glycosidases (EC They are mainly produced by plants and classified as type 1 RIPs and type 2 RIPs. There are also RIPs and RIP related proteins that cannot be grouped into the classical type 1 and type 2 RIPs because of their different sizes, structures or functions. In addition, there is still not a uniform nomenclature or classification existing for RIPs. In this review, we give the current status of all known plant RIPs and we make a suggestion about how to unify those RIPs and RIP related proteins that cannot be classified as type 1 or type 2 RIPs. PMID:26008228

  10. Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae

    PubMed Central

    Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine


    ABSTRACT The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5′ untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62–K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62–K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62–K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62–K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62–K70 segment of Rps26 and the 5′ untranslated region of mRNA. The data suggested a specific role of the Y62–K70 motif during translation initiation. Here, we report that single

  11. Feedback regulation of ribosomal protein gene expression in Escherichia coli: structural homology of ribosomal RNA and ribosomal protein MRNA.

    PubMed Central

    Nomura, M; Yates, J L; Dean, D; Post, L E


    Certain ribosomal proteins (r proteins) in Escherichia coli, such as S4 and S7, function as feedback repressors in the regulation of r-protein synthesis. These proteins inhibit the translation of their own mRNA. The repressor r proteins so far identified are also known to bind specifically to rRNA at an initial stage in ribosome assembly. We have found structural homology between the S7 binding region on 16S rRNA and a region of the mRNA where S7 acts as a translational repressor. Similarly, there is structural homology between one of the reported S4 binding regions on 16S rRNA and the mRNA target site for S4. The observed homology supports the concept that regulation by repressor r proteins is based on competition between rRNA and mRNA for these proteins and that the same structural features and of the r proteins are used in their interactions with both rRNA and mRNA. PMID:7012833

  12. Feedback regulation of ribosomal protein gene expression in Escherichia coli: structural homology of ribosomal RNA and ribosomal protein MRNA.


    Nomura, M; Yates, J L; Dean, D; Post, L E


    Certain ribosomal proteins (r proteins) in Escherichia coli, such as S4 and S7, function as feedback repressors in the regulation of r-protein synthesis. These proteins inhibit the translation of their own mRNA. The repressor r proteins so far identified are also known to bind specifically to rRNA at an initial stage in ribosome assembly. We have found structural homology between the S7 binding region on 16S rRNA and a region of the mRNA where S7 acts as a translational repressor. Similarly, there is structural homology between one of the reported S4 binding regions on 16S rRNA and the mRNA target site for S4. The observed homology supports the concept that regulation by repressor r proteins is based on competition between rRNA and mRNA for these proteins and that the same structural features and of the r proteins are used in their interactions with both rRNA and mRNA.

  13. The Leishmania infantum Acidic Ribosomal Protein P0 Administered as a DNA Vaccine Confers Protective Immunity to Leishmania major Infection in BALB/c Mice

    PubMed Central

    Iborra, Salvador; Soto, Manuel; Carrión, Javier; Nieto, Ana; Fernández, Edgar; Alonso, Carlos; Requena, Jose M.


    In this study, we examined the immunogenic properties of the Leishmania infantum acidic ribosomal protein P0 (LiP0) in the BALB/c mouse model. The humoral and cellular responses induced by the administration of the LiP0 antigen, either as soluble recombinant LiP0 (rLiP0) or as a plasmid DNA formulation (pcDNA3-LiP0), were determined. Also, the immunological response associated with a prime-boost strategy, consisting of immunization with pcDNA3-LiP0 followed by a boost with rLiP0, was assayed. Immunization with rLiP0 induced a predominant Th2-like humoral response, but no anti-LiP0 antibodies were induced after immunization with pcDNA3-LiP0, whereas a strong humoral response consisting of a mixed immunoglobulin G2a (IgG2a)-IgG1 isotype profile was induced in mice immunized with the prime-boost regime. For all three immunization protocols, rLiP0-stimulated production of gamma interferon (IFN-γ) in both splenocytes and lymph node cells from immunized mice was observed. However, it was only when mice were immunized with pcDNA3-LiP0 that noticeable protection against L. major infection was achieved, as determined by both lesion development and parasite burden. Immunization of mice with LiP0-DNA primes both CD4+ and CD8+ T cells, which, with the L. major challenge, were boosted to produce significant levels of IL-12-dependent, antigen-specific IFN-γ. Taken together, these data indicate that genetic vaccination with LiP0 induces protective immunological effector mechanisms, yet the immunological response elicited by LiP0 is not sufficient to keep the infection from progressing. PMID:14573678

  14. Direct interaction of the N-terminal domain of ribosomal protein S1 with protein S2 in Escherichia coli.


    Byrgazov, Konstantin; Manoharadas, Salim; Kaberdina, Anna C; Vesper, Oliver; Moll, Isabella


    Despite of the high resolution structure available for the E. coli ribosome, hitherto the structure and localization of the essential ribosomal protein S1 on the 30 S subunit still remains to be elucidated. It was previously reported that protein S1 binds to the ribosome via protein-protein interaction at the two N-terminal domains. Moreover, protein S2 was shown to be required for binding of protein S1 to the ribosome. Here, we present evidence that the N-terminal domain of S1 (amino acids 1-106; S1(106)) is necessary and sufficient for the interaction with protein S2 as well as for ribosome binding. We show that over production of protein S1(106) affects E. coli growth by displacing native protein S1 from its binding pocket on the ribosome. In addition, our data reveal that the coiled-coil domain of protein S2 (S2α(2)) is sufficient to allow protein S1 to bind to the ribosome. Taken together, these data uncover the crucial elements required for the S1/S2 interaction, which is pivotal for translation initiation on canonical mRNAs in gram-negative bacteria. The results are discussed in terms of a model wherein the S1/S2 interaction surface could represent a possible target to modulate the selectivity of the translational machinery and thereby alter the translational program under distinct conditions.

  15. Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.


    de la Cruz, Jesús; Karbstein, Katrin; Woolford, John L


    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79-80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type-specific disorders that often transition from hypoproliferative to hyperproliferative growth.

  16. Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.


    de la Cruz, Jesús; Karbstein, Katrin; Woolford, John L


    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79-80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type-specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  17. Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo

    PubMed Central


    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  18. Role of ribosomal protein mutations in tumor development (Review).


    Goudarzi, Kaveh M; Lindström, Mikael S


    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research.

  19. Role of ribosomal protein mutations in tumor development (Review)

    PubMed Central



    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  20. Molecular mechanisms of ribosomal protein gene coregulation

    PubMed Central

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B. Franklin


    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20–50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1–TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. PMID:26385964

  1. Sites of synthesis of chloroplast ribosomal proteins in Chlamydomonas

    PubMed Central


    Cells of Chlamydomonas reinhardtii were pulse-labeled in vivo in the presence of inhibitors of cytoplasmic (anisomycin) or chloroplast (lincomycin) protein synthesis to ascertain the sites of synthesis of chloroplast ribosomal proteins. Fluorographs of the labeled proteins, resolved on two-dimensional (2-D) charge/SDS and one-dimensional (1-D) SDS-urea gradient gels, demonstrated that five to six of the large subunit proteins are products of chloroplast protein synthesis while 26 to 27 of the large subunit proteins are synthesized on cytoplasmic ribosomes. Similarly, 14 of 31 small subunit proteins are products of chloroplast protein synthesis, while the remainder are synthesized in the cytoplasm. The 20 ribosomal proteins shown to be made in the chloroplast of Chlamydomonas more than double the number of proteins known to be synthesized in the chloroplast of this alga. PMID:6841455

  2. Cotranslational Protein Folding inside the Ribosome Exit Tunnel

    PubMed Central

    Nilsson, Ola B.; Hedman, Rickard; Marino, Jacopo; Wickles, Stephan; Bischoff, Lukas; Johansson, Magnus; Müller-Lucks, Annika; Trovato, Fabio; Puglisi, Joseph D.; O’Brien, Edward P.; Beckmann, Roland; von Heijne, Gunnar


    Summary At what point during translation do proteins fold? It is well established that proteins can fold cotranslationally outside the ribosome exit tunnel, whereas studies of folding inside the exit tunnel have so far detected only the formation of helical secondary structure and collapsed or partially structured folding intermediates. Here, using a combination of cotranslational nascent chain force measurements, inter-subunit fluorescence resonance energy transfer studies on single translating ribosomes, molecular dynamics simulations, and cryoelectron microscopy, we show that a small zinc-finger domain protein can fold deep inside the vestibule of the ribosome exit tunnel. Thus, for small protein domains, the ribosome itself can provide the kind of sheltered folding environment that chaperones provide for larger proteins. PMID:26321634

  3. Ribosomes, Polyribosomes, and Deoxyribonucleic Acid from Thermophilic, Mesophilic, and Psychrophilic Clostridia

    PubMed Central

    Irwin, Carol C.; Akagi, James M.; Himes, Richard H.


    Analysis of deoxyribonucleic acid (DNA) from four species of Clostridium, including two thermophiles, a mesophile, and a psychrophile, revealed no obvious relationship between growth temperature and DNA base composition. The melting temperatures (Tm) of the DNA from the four species varied no more among the thermophilic, mesophilic, and psychrophilic species than among many related mesophilic species. Characterization of ribosomes from the clostridia by means of optical rotatory dispersion yielded similar spectra in common with other unrelated organisms. Only small differences were noted in the base composition of ribosomal ribonucleic acid (RNA) and in the amino acid composition of ribosomal proteins, including half-cystine content, as determined by cysteic acid analysis, and accessible sulfhydryl groups, as determined by titration with dithiobis (2-nitrobenzoic acid). Except for the two thermophiles, the ribosomal protein electrophoretic patterns were dissimilar. No unusual thermal stability was manifested in the Tm values of thermophile ribosomal RNA. However, thermophile ribosome Tm values (69 C) were higher than were mesophile and psychrophile Tm values (64 C). Ribosomes from the four clostridial species were also examined in regard to the effect of heat on their functional integrity, measured by their activity in poly U-directed 14C-phenylaline incorporation, and their gross physical integrity, measured by sucrose gradient analysis. The Td, 5 values (temperature which produces 50% inactivation after 5 min) was found to be 70 and 72 C for the two thermophiles C. tartarivorum and C. thermosaccharolyticum, respectively; 57 C for a mesophile, C. pasteurianum; and 53 C for a psychrophile, Clostridium sp. strain 69. At 55 C, little effect was seen on the thermophile ribosomes, but the mesophile ribosomes lost 90% of their activity in 1 hr, and psychrophile ribosomes lost 100% of their activity within 10 min. According to sucrose gradient profiles, heating at 55 C

  4. Disassembly of yeast 80S ribosomes into subunits is a concerted action of ribosome-assisted folding of denatured protein.


    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati


    It has been shown by several groups that ribosome can assist folding of denatured protein in vitro and the process is conserved across the species. Domain V of large ribosomal rRNA which occupies the intersubunit side of the large subunit was identified as the key player responsible for chaperoning the folding process. Thus, it is conceivable that denatured protein needs to access the intersubunit space of the ribosome in order to get folded. In this study, we have investigated the mechanism of release of the protein from the eukaryotic ribosome following reactivation. We have observed significant splitting of yeast 80S ribosome when incubated with the denatured BCAII protein. Energy-free disassembly mechanism functions in low Mg(+2) ion concentration for prokaryotic ribosomes. Eukaryotic ribosomes do not show significant splitting even at low Mg(+2) ion concentration. In this respect, denatured protein-induced disassembly of eukaryotic ribosome without the involvement of any external energy source is intriguing. For prokaryotic ribosomes, it was reported that the denatured protein induces ribosome splitting into subunits in order to access domain V-rRNA. In contrast, our results suggest an alternative mechanism for eukaryotic ribosomal rRNA-mediated protein folding and subsequent separation of the subunits by which release of the activated-protein occurs.

  5. Cotranslational protein folding on the ribosome monitored in real time.


    Holtkamp, Wolf; Kokic, Goran; Jäger, Marcus; Mittelstaet, Joerg; Komar, Anton A; Rodnina, Marina V


    Protein domains can fold into stable tertiary structures while they are synthesized on the ribosome. We used a high-performance, reconstituted in vitro translation system to investigate the folding of a small five-helix protein domain-the N-terminal domain of Escherichia coli N5-glutamine methyltransferase HemK-in real time. Our observations show that cotranslational folding of the protein, which folds autonomously and rapidly in solution, proceeds through a compact, non-native conformation that forms within the peptide tunnel of the ribosome. The compact state rearranges into a native-like structure immediately after the full domain sequence has emerged from the ribosome. Both folding transitions are rate-limited by translation, allowing for quasi-equilibrium sampling of the conformational space restricted by the ribosome. Cotranslational folding may be typical of small, intrinsically rapidly folding protein domains. PMID:26612953

  6. Comprehensive Analysis of Phosphorylated Proteins of E. coli Ribosomes

    PubMed Central

    Soung, George Y.; Miller, Jennifer L.; Koc, Hasan; Koc, Emine C.


    Phosphorylation of bacterial ribosomal proteins has been known for decades; however, there is still very limited information available on specific locations of the phosphorylation sites in ribosomal proteins and the role they might play in protein synthesis. In this study, we have mapped the specific phosphorylation sites in twenty-four E. coli ribosomal proteins by tandem mass spectrometry. Specific detection of phosphorylation was achieved by either phosphorylation specific visualization techniques, ProQ staining and antibodies for phospho-Ser, Thr, and Tyr, or by mass spectrometry equipped with a capability to detect addition and the loss of the phosphate moiety. Enrichment by immobilized metal affinity and/or strong cation exchange chromatography was used to improve the success of detection of the low abundance phosphopeptides. We found the small subunit (30S) proteins S3, S4, S5, S7, S11, S12, S13, S18, and S21 and the large subunit (50S) proteins L1, L2, L3, L5, L6, L7/L12, L13, L14, L16, L18, L19, L21, L22, L28, L31 to be phosphorylated at one or more residues. Potential roles for each specific site in ribosome function were deduced through careful evaluation of the given site of the phosphorylation in 3D-crystal structure models of ribosomes and the previous mutational studies of E. coli ribosomal proteins. PMID:19469554

  7. Functional Interaction between Ribosomal Protein L6 and RbgA during Ribosome Assembly

    PubMed Central

    Davis, Joseph H.; Williamson, James R.; Britton, Robert A.


    RbgA is an essential GTPase that participates in the assembly of the large ribosomal subunit in Bacillus subtilis and its homologs are implicated in mitochondrial and eukaryotic large subunit assembly. How RbgA functions in this process is still poorly understood. To gain insight into the function of RbgA we isolated suppressor mutations that partially restored the growth of an RbgA mutation (RbgA-F6A) that caused a severe growth defect. Analysis of these suppressors identified mutations in rplF, encoding ribosomal protein L6. The suppressor strains all accumulated a novel ribosome intermediate that migrates at 44S in sucrose gradients. All of the mutations cluster in a region of L6 that is in close contact with helix 97 of the 23S rRNA. In vitro maturation assays indicate that the L6 substitutions allow the defective RbgA-F6A protein to function more effectively in ribosome maturation. Our results suggest that RbgA functions to properly position L6 on the ribosome, prior to the incorporation of L16 and other late assembly proteins. PMID:25330043

  8. Effect of growth rate on the amounts of ribosomal and transfer ribonucleic acids in yeast.

    PubMed Central

    Waldron, C; Lacroute, F


    The steady-state growth rate of Saccharomyces cerevisiae was varied by growing the cells in different media. The total amount of ribonucleic acid (RNA) per cell was found to decrease as a nonlinear function of decreasing growh rate. The RNA from cells growing in different media was analyzed by polyacrylamide gel electrophoresis. Although the amounts of both ribosomal RNA and transfer RNA decreased with decreasing growth rate, the ratio of ribosomal to transfer RNA was not constant. As the growth rate was reduced the ribosomal RNA fraction decreased slightly, whereas the transfer RNA fraction increased slightly. Thus the levels of ribosomal and transfer RNA were regulated to similar yet different extents. The levels of the different ribosomal RNA species were more closely coordinated. At all growth rates the ribosomal RNAs (including 5S RNA) were present in equimolar amounts. The rate of protein synthesis in yeast cells also decreased with decreasing growth rate. The low rates of protein synthesis did not appear to be due to limiting numbers of ribosomes or transfer RNA molecules. PMID:1097403

  9. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.


    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi


    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions.

  10. Structures of eukaryotic ribosomal stalk proteins and its complex with trichosanthin, and their implications in recruiting ribosome-inactivating proteins to the ribosomes.


    Choi, Andrew K H; Wong, Eddie C K; Lee, Ka-Ming; Wong, Kam-Bo


    Ribosome-inactivating proteins (RIP) are RNA N-glycosidases that inactivate ribosomes by specifically depurinating a conserved adenine residue at the α-sarcin/ricin loop of 28S rRNA. Recent studies have pointed to the involvement of the C-terminal domain of the eukaryotic stalk proteins in facilitating the toxic action of RIPs. This review highlights how structural studies of eukaryotic stalk proteins provide insights into the recruitment of RIPs to the ribosomes. Since the C-terminal domain of eukaryotic stalk proteins is involved in specific recognition of elongation factors and some eukaryote-specific RIPs (e.g., trichosanthin and ricin), we postulate that these RIPs may have evolved to hijack the translation-factor-recruiting function of ribosomal stalk in reaching their target site of rRNA.

  11. Structures of Eukaryotic Ribosomal Stalk Proteins and Its Complex with Trichosanthin, and Their Implications in Recruiting Ribosome-Inactivating Proteins to the Ribosomes

    PubMed Central

    Choi, Andrew K. H.; Wong, Eddie C. K.; Lee, Ka-Ming; Wong, Kam-Bo


    Ribosome-inactivating proteins (RIP) are RNA N-glycosidases that inactivate ribosomes by specifically depurinating a conserved adenine residue at the α-sarcin/ricin loop of 28S rRNA. Recent studies have pointed to the involvement of the C-terminal domain of the eukaryotic stalk proteins in facilitating the toxic action of RIPs. This review highlights how structural studies of eukaryotic stalk proteins provide insights into the recruitment of RIPs to the ribosomes. Since the C-terminal domain of eukaryotic stalk proteins is involved in specific recognition of elongation factors and some eukaryote-specific RIPs (e.g., trichosanthin and ricin), we postulate that these RIPs may have evolved to hijack the translation-factor-recruiting function of ribosomal stalk in reaching their target site of rRNA. PMID:25723321

  12. Molecular morphology of ribosomes. Iodination of Escherichia coli ribosomal proteins with solid-state lactoperoxidase.


    Michalski, C J; Sells, B H


    Using either soluble or solid-state lactoperoxidase, a comparison was made between the enzymic iodination of ribosomal proteins iodinated as 30-S and 50-S subunits or as 70-S monosomes. Proteins S7, S11 and S12 of the 30-S subunit and proteins L2, L11, L26 and L28 of the 50-S subunit were labelled to a greater extent in isolated particles than in the 70-S ribosome. In contrast, proteins S4, S19 and S20 were labelled to a lesser extent in the isolated subunit. No significant differences were observed in the iodination patterns of ribosomes iodinated in the presence of soluble lactoperoxidase and those iodinated in the presence of lactoperoxidase bound to Sepharose 4B. It is suggested that the 30-S subunit undergoes a conformational change during its association with the 50-S subunit to form a 70-S monosome. Implications from results obtained with solid-state lactoperoxidase-catalyzed iodination of ribosomal proteins are also discussed.

  13. Small protein domains fold inside the ribosome exit tunnel.


    Marino, Jacopo; von Heijne, Gunnar; Beckmann, Roland


    Cotranslational folding of small protein domains within the ribosome exit tunnel may be an important cellular strategy to avoid protein misfolding. However, the pathway of cotranslational folding has so far been described only for a few proteins, and therefore, it is unclear whether folding in the ribosome exit tunnel is a common feature for small protein domains. Here, we have analyzed nine small protein domains and determined at which point during translation their folding generates sufficient force on the nascent chain to release translational arrest by the SecM arrest peptide, both in vitro and in live E. coli cells. We find that all nine protein domains initiate folding while still located well within the ribosome exit tunnel. PMID:26879042

  14. [Protein synthesis by the ribosome: a pathway full of pitfalls].


    Macé, Kevin; Giudice, Emmanuel; Gillet, Reynald


    Protein synthesis is accomplished through a process known as translation and is carried out by the ribosome, a large macromolecular complex found in every living organism. Given the huge amount of biological data that must be deciphered, it is not uncommon for ribosomes to regularly stall during the process of translation. Any disruption of this finely tuned process will jeopardize the viability of the cell. In bacteria, the main quality-control mechanism for rescuing ribosomes that undergo arrest during translation is trans-translation, which is performed by transfer-messenger RNA (tmRNA) in association with small protein B (SmPB). However, other rescue systems have been discovered recently, revealing a far more complicated network of factors dedicated to ribosome rescue. These discoveries make it possible to consider inhibition of these pathways as a very promising target for the discovery of new antibiotics.

  15. A functional interaction between ribosomal proteins S7 and S11 within the bacterial ribosome.


    Robert, Francis; Brakier-Gingras, Léa


    In this study, we used site-directed mutagenesis to disrupt an interaction that had been detected between ribosomal proteins S7 and S11 in the crystal structure of the bacterial 30 S subunit. This interaction, which is located in the E site, connects the head of the 30 S subunit to the platform and is involved in the formation of the exit channel through which passes the 30 S-bound messenger RNA. Neither mutations in S7 nor mutations in S11 prevented the incorporation of the proteins into the 30 S subunits but they perturbed the function of the ribosome. In vivo assays showed that ribosomes with either mutated S7 or S11 were altered in the control of translational fidelity, having an increased capacity for frameshifting, readthrough of a nonsense codon and codon misreading. Toeprinting and filter-binding assays showed that 30 S subunits with either mutated S7 or S11 have an enhanced capacity to bind mRNA. The effects of the S7 and S11 mutations can be related to an increased flexibility of the head of the 30 S, to an opening of the mRNA exit channel and to a perturbation of the proposed allosteric coupling between the A and E sites. Altogether, our results demonstrate that S7 and S11 interact in a functional manner and support the notion that protein-protein interactions contribute to the dynamics of the ribosome.

  16. Ribosomal protein gene expression is cell type specific during development in Dictyostelium discoideum.


    Agarwal, A K; Parrish, S N; Blumberg, D D


    Starvation for amino acids initiates the developmental cycle in the cellular slime mold, Dictyostelium discoideum. Upon starvation one of the earliest developmental events is the selective loss of the ribosomal protein mRNAs from polysomes. This loss depends upon sequences in the 5' non-translated leader of the ribosomal protein (r-protein) mRNAs. Here evidence is presented which indicates that those cells which will become prestalk cells express the ribosomal protein genes during development under starvation conditions. Cells which enter the prespore pathway shut off r-protein synthesis. The promoter and 5' non-translated leader sequences from two ribosomal protein genes, the rp-L11 and the rp-S9 genes, are fused to the Escherichia coli beta-galactosidase reporter gene. While beta-galactosidase enzyme activity is detected in situ in most growing cells, by 15 h of development beta-galactosidase enzyme activity is largely lost from the prespore cells although strong beta-galactosidase enzyme activity is present in the prestalk cells. These observations suggest the possibility that the ribosomal protein mRNAs are excluded from polysomes in a cell-type-specific manner. PMID:10550541

  17. Optimized plasmid systems for the incorporation of multiple different unnatural amino acids by evolved orthogonal ribosomes.


    Lammers, Christoph; Hahn, Liljan E; Neumann, Heinz


    Incorporation of multiple different unnatural amino acids into the same polypeptide remains a significant challenge. Orthogonal ribosomes, which are evolvable as they direct the translation of a single dedicated orthogonal mRNA, can provide an avenue to produce such polypeptides routinely. Recent advances in engineering orthogonal ribosomes have created a prototype system to enable genetically encoded introduction of two different functional groups, albeit with limited efficiency. Here, we systematically investigated the limiting factors of this system by using assays to measure the levels and activities of individual components; we identified Methanosarcina barkeri PylRS as a limiting factor for protein yield. Balancing the expression levels of individual components significantly improved growth rate and protein yield. This optimization of the system is likely to increase the scope of evolved orthogonal ribosome-mediated incorporation of multiple different unnatural amino acids.

  18. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection

    PubMed Central

    Sharkey, Liam K. R.; Edwards, Thomas A.


    ABSTRACT Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to an in vitro translation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosome in vitro. To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection. PMID:27006457

  19. Ribosome Dwell Times and the Protein Copy Number Distribution

    NASA Astrophysics Data System (ADS)

    Gorissen, Mieke; Vanderzande, Carlo


    Translation is the cellular process in which ribosomes make proteins from information encoded on messenger RNA (mRNA). We model translation with an exclusion process taking into account the experimentally determined, non-exponential, waiting time between steps of a ribosome. From numerical simulations using realistic parameter values, we determine the distribution P( E) of the number of proteins E produced by one mRNA. We find that for small E this distribution is not geometric. We present a simplified and analytically solvable model that relates P( E) to the distributions of the times to produce the first E proteins.

  20. Compensatory evolution reveals functional interactions between ribosomal proteins S12, L14 and L19.


    Maisnier-Patin, Sophie; Paulander, Wilhelm; Pennhag, Alexandra; Andersson, Dan I


    Certain mutations in S12, a ribosomal protein involved in translation elongation rate and translation accuracy, confer resistance to the aminoglycoside streptomycin. Previously we showed in Salmonella typhimurium that the fitness cost, i.e. reduced growth rate, due to the amino acid substitution K42N in S12 could be compensated by at least 35 different mutations located in the ribosomal proteins S4, S5 and L19. Here, we have characterized in vivo the fitness, translation speed and translation accuracy of four different L19 mutants. When separated from the resistance mutation located in S12, the three different compensatory amino acid substitutions in L19 at position 40 (Q40H, Q40L and Q40R) caused a decrease in fitness while the G104A change had no effect on bacterial growth. The rate of protein synthesis was unaffected or increased by the mutations at position 40 and the level of read-through of a UGA nonsense codon was increased in vivo, indicating a loss of translational accuracy. The mutations in L19 increased sensitivity to aminoglycosides active at the A-site, further indicating a perturbation of the decoding step. These phenotypes are similar to those of the classical S4 and S5 ram (ribosomal ambiguity) mutants. By evolving low-fitness L19 mutants by serial passage, we showed that the fitness cost conferred by the L19 mutations could be compensated by additional mutations in the ribosomal protein L19 itself, in S12 and in L14, a protein located close to L19. Our results reveal a novel functional role for the 50 S ribosomal protein L19 during protein synthesis, supporting published structural data suggesting that the interaction of L14 and L19 with 16 S rRNA could influence function of the 30 S subunit. Moreover, our study demonstrates how compensatory fitness-evolution can be used to discover new molecular functions of ribosomal proteins.

  1. Folding and escape of nascent proteins at ribosomal exit tunnel

    NASA Astrophysics Data System (ADS)

    Bui, Phuong Thuy; Hoang, Trinh Xuan


    We investigate the interplay between post-translational folding and escape of two small single-domain proteins at the ribosomal exit tunnel by using Langevin dynamics with coarse-grained models. It is shown that at temperatures lower or near the temperature of the fastest folding, folding proceeds concomitantly with the escape process, resulting in vectorial folding and enhancement of foldability of nascent proteins. The concomitance between the two processes, however, deteriorates as temperature increases. Our folding simulations as well as free energy calculation by using umbrella sampling show that, at low temperatures, folding at the tunnel follows one or two specific pathways without kinetic traps. It is shown that the escape time can be mapped to a one-dimensional diffusion model with two different regimes for temperatures above and below the folding transition temperature. Attractive interactions between amino acids and attractive sites on the tunnel wall lead to a free energy barrier along the escape route of the protein. It is suggested that this barrier slows down the escape process and consequently promotes correct folding of the released nascent protein.

  2. Dissecting the transcriptional phenotype of ribosomal protein deficiency: implications for Diamond-Blackfan Anemia.


    Aspesi, Anna; Pavesi, Elisa; Robotti, Elisa; Crescitelli, Rossella; Boria, Ilenia; Avondo, Federica; Moniz, Hélène; Da Costa, Lydie; Mohandas, Narla; Roncaglia, Paola; Ramenghi, Ugo; Ronchi, Antonella; Gustincich, Stefano; Merlin, Simone; Marengo, Emilio; Ellis, Steven R; Follenzi, Antonia; Santoro, Claudio; Dianzani, Irma


    Defects in genes encoding ribosomal proteins cause Diamond Blackfan Anemia (DBA), a red cell aplasia often associated with physical abnormalities. Other bone marrow failure syndromes have been attributed to defects in ribosomal components but the link between erythropoiesis and the ribosome remains to be fully defined. Several lines of evidence suggest that defects in ribosome synthesis lead to "ribosomal stress" with p53 activation and either cell cycle arrest or induction of apoptosis. Pathways independent of p53 have also been proposed to play a role in DBA pathogenesis. We took an unbiased approach to identify p53-independent pathways activated by defects in ribosome synthesis by analyzing global gene expression in various cellular models of DBA. Ranking-Principal Component Analysis (Ranking-PCA) was applied to the identified datasets to determine whether there are common sets of genes whose expression is altered in these different cellular models. We observed consistent changes in the expression of genes involved in cellular amino acid metabolic process, negative regulation of cell proliferation and cell redox homeostasis. These data indicate that cells respond to defects in ribosome synthesis by changing the level of expression of a limited subset of genes involved in critical cellular processes. Moreover, our data support a role for p53-independent pathways in the pathophysiology of DBA.

  3. Covalent modifications of ribosomal proteins in growing and aggregation-competent dictyostelium discoideum: phosphorylation and methylation.


    Ramagopal, S


    Phosphorylated and methylated ribosomal proteins were identified in vegetatively growing amoebae and in the starvation-induced, aggregation-competent cells of Dictyostelium discoideum. Of the 15 developmentally regulated cell-specific ribosomal proteins reported earlier, protein A and the acidic proteins A1, A2, and A3 were identified as phosphoproteins, and S5, S6, S10, and D were identified as methylated proteins. Three other ribosomal proteins were phosphorylated and 19 others methylated. S19, L13, A1, A2, and A3 were the predominant phosphoproteins in growing amoebae, whereas S20 and A were the predominant ones in the aggregation-competent cells. Among the methylated proteins, eight (S6, S10, S13, S30, D, L1, L2, and L31) were modified only during growth phase, six (S5, S7, S8, S24, S31, and L36) were altered only during aggregation-competent phase, and nine (S9, S27, S28, S29, S34, L7, L35, L41, and L42) were modified under both phases. Five proteins (S6, S24, L7, L41, and L42) were heavily methylated and of these, the large subunit proteins were present in both growing amoebae and aggregation-competent cells. These findings demonstrate that covalent modification of specific ribosomal proteins is regulated during cell differentiation in D. discoideum.

  4. Protein-guided RNA dynamics during early ribosome assembly

    NASA Astrophysics Data System (ADS)

    Kim, Hajin; Abeysirigunawarden, Sanjaya C.; Chen, Ke; Mayerle, Megan; Ragunathan, Kaushik; Luthey-Schulten, Zaida; Ha, Taekjip; Woodson, Sarah A.


    The assembly of 30S ribosomes requires the precise addition of 20 proteins to the 16S ribosomal RNA. How early binding proteins change the ribosomal RNA structure so that later proteins may join the complex is poorly understood. Here we use single-molecule fluorescence resonance energy transfer (FRET) to observe real-time encounters between Escherichia coli ribosomal protein S4 and the 16S 5' domain RNA at an early stage of 30S assembly. Dynamic initial S4-RNA complexes pass through a stable non-native intermediate before converting to the native complex, showing that non-native structures can offer a low free-energy path to protein-RNA recognition. Three-colour FRET and molecular dynamics simulations reveal how S4 changes the frequency and direction of RNA helix motions, guiding a conformational switch that enforces the hierarchy of protein addition. These protein-guided dynamics offer an alternative explanation for induced fit in RNA-protein complexes.

  5. Protein-guided RNA dynamics during early ribosome assembly.


    Kim, Hajin; Abeysirigunawarden, Sanjaya C; Chen, Ke; Mayerle, Megan; Ragunathan, Kaushik; Luthey-Schulten, Zaida; Ha, Taekjip; Woodson, Sarah A


    The assembly of 30S ribosomes requires the precise addition of 20 proteins to the 16S ribosomal RNA. How early binding proteins change the ribosomal RNA structure so that later proteins may join the complex is poorly understood. Here we use single-molecule fluorescence resonance energy transfer (FRET) to observe real-time encounters between Escherichia coli ribosomal protein S4 and the 16S 5' domain RNA at an early stage of 30S assembly. Dynamic initial S4-RNA complexes pass through a stable non-native intermediate before converting to the native complex, showing that non-native structures can offer a low free-energy path to protein-RNA recognition. Three-colour FRET and molecular dynamics simulations reveal how S4 changes the frequency and direction of RNA helix motions, guiding a conformational switch that enforces the hierarchy of protein addition. These protein-guided dynamics offer an alternative explanation for induced fit in RNA-protein complexes.

  6. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    SciTech Connect

    Lindstroem, Mikael S.


    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-{kappa}B, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  7. RNA structures regulating ribosomal protein biosynthesis in bacilli.


    Deiorio-Haggar, Kaila; Anthony, Jon; Meyer, Michelle M


    In Bacilli, there are three experimentally validated ribosomal-protein autogenous regulatory RNAs that are not shared with E. coli. Each of these RNAs forms a unique secondary structure that interacts with a ribosomal protein encoded by a downstream gene, namely S4, S15, and L20. Only one of these RNAs that interacts with L20 is currently found in the RNA Families Database. We created, or modified, existing structural alignments for these three RNAs and used them to perform homology searches. We have determined that each structure exhibits a narrow phylogenetic distribution, mostly relegated to the Firmicute class Bacilli. This work, in conjunction with other similar work, demonstrates that there are most likely many non-homologous RNA regulatory elements regulating ribosomal protein biosynthesis that still await discovery and characterization in other bacterial species. PMID:23611891

  8. RNA structures regulating ribosomal protein biosynthesis in bacilli

    PubMed Central

    Deiorio-Haggar, Kaila; Anthony, Jon; Meyer, Michelle M.


    In Bacilli, there are three experimentally validated ribosomal-protein autogenous regulatory RNAs that are not shared with E. coli. Each of these RNAs forms a unique secondary structure that interacts with a ribosomal protein encoded by a downstream gene, namely S4, S15, and L20. Only one of these RNAs that interacts with L20 is currently found in the RNA Families Database. We created, or modified, existing structural alignments for these three RNAs and used them to perform homology searches. We have determined that each structure exhibits a narrow phylogenetic distribution, mostly relegated to the Firmicute class Bacilli. This work, in conjunction with other similar work, demonstrates that there are most likely many non-homologous RNA regulatory elements regulating ribosomal protein biosynthesis that still await discovery and characterization in other bacterial species. PMID:23611891

  9. Selective translational regulation of ribosomal protein gene expression during early development of Drosophila melanogaster.

    PubMed Central

    Kay, M A; Jacobs-Lorena, M


    We have previously characterized a cloned cDNA coding for a developmentally regulated mRNA in Drosophila melanogaster whose expression is selectively regulated at the translational level during oogenesis and embryogenesis. In this report we show that this translationally regulated mRNA (rpA1) codes for an acidic ribosomal protein. Furthermore, our results indicate that most ribosomal protein mRNAs are regulated similarly to rpA1 mRNA. This conclusion is based on cell-free translation of mRNAs derived from polysomes and postpolysomal supernatants as well as in vivo labeling experiments. Thus, the translation of many ribosomal protein mRNAs appears to be temporally related to the synthesis of rRNA during D. melanogaster development. The relationship between rRNA transcription and ribosomal protein mRNA translation was further investigated by genetically reducing rRNA synthesis with the use of bobbed mutants. Unexpectedly, neither ribosomal protein mRNA abundance nor translation was altered in these mutants. Images PMID:3939320

  10. The small subunit of the mammalian mitochondrial ribosome. Identification of the full complement of ribosomal proteins present.


    Cavdar Koc, E; Burkhart, W; Blackburn, K; Moseley, A; Spremulli, L L


    Identification of all the protein components of the small subunit (28 S) of the mammalian mitochondrial ribosome has been achieved by carrying out proteolytic digestions of whole 28 S subunits followed by analysis of the resultant peptides by liquid chromatography and tandem mass spectrometry (LC/MS/MS). Peptide sequence information was used to search the human EST data bases and complete coding sequences of the proteins were assembled. The human mitochondrial ribosome has 29 distinct proteins in the small subunit. Fourteen of this group of proteins are homologs of the Escherichia coli 30 S ribosomal proteins S2, S5, S6, S7, S9, S10, S11, S12, S14, S15, S16, S17, S18, and S21. All of these proteins have homologs in Drosophila melanogaster, Caenorhabditis elegans, and Saccharomyces cerevisiae mitochondrial ribosomes. Surprisingly, three variants of ribosomal protein S18 are found in the mammalian and D. melanogaster mitochondrial ribosomes while C. elegans has two S18 homologs. The S18 homologs tend to be more closely related to chloroplast S18s than to prokaryotic S18s. No mitochondrial homologs to prokaryotic ribosomal proteins S1, S3, S4, S8, S13, S19, and S20 could be found in the peptides obtained from the whole 28 S subunit digests or by analysis of the available data bases. The remaining 15 proteins present in mammalian mitochondrial 28 S subunits (MRP-S22 through MRP-S36) are specific to mitochondrial ribosomes. Proteins in this group have no apparent homologs in bacterial, chloroplast, archaebacterial, or cytosolic ribosomes. All but two of these proteins have a clear homolog in D. melanogaster while all but three can be found in the genome of C. elegans. Five of the mitochondrial specific ribosomal proteins have homologs in S. cerevisiae.

  11. Protein folding on the ribosome studied using NMR spectroscopy.


    Waudby, Christopher A; Launay, Hélène; Cabrita, Lisa D; Christodoulou, John


    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome-nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity.

  12. Crystal structure of prokaryotic ribosomal protein L9: a bi-lobed RNA-binding protein.

    PubMed Central

    Hoffman, D W; Davies, C; Gerchman, S E; Kycia, J H; Porter, S J; White, S W; Ramakrishnan, V


    The crystal structure of protein L9 from the Bacillus stearothermophilus ribosome has been determined at 2.8 A resolution using X-ray diffraction methods. This primary RNA-binding protein has a highly elongated and unusual structure consisting of two separated domains joined by a long exposed alpha-helix. Conserved, positively charged and aromatic amino acids on the surfaces of both domains probably represent the sites of specific interactions with 23S rRNA. Comparisons with other prokaryotic L9 sequences show that while the length of the connecting alpha-helix is invariant, the sequence within the exposed central region is not conserved. This suggests that the alpha-helix has an architectural role and serves to fix the relative separation and orientation of the N- and C-terminal domains within the ribosome. The N-terminal domain has structural homology to the smaller ribosomal proteins L7/L12 and L30, and the eukaryotic RNA recognition motif (RRM). Images PMID:8306963

  13. Homodimerization of pokeweed antiviral protein as a mechanism to limit depurination of pokeweed ribosomes.


    Tourlakis, Marina E; Karran, Rajita A; Desouza, Leroi; Siu, K W Michael; Hudak, Katalin A


    Ribosome inactivating proteins are glycosidases synthesized by many plants and have been hypothesized to serve in defence against pathogens. These enzymes catalytically remove a conserved purine from the sarcin/ricin loop of the large ribosomal RNA, which has been shown in vitro to limit protein synthesis. The resulting toxicity suggests that plants may possess a mechanism to protect their ribosomes from depurination during the synthesis of these enzymes. For example, pokeweed antiviral protein (PAP) is cotranslationally inserted into the lumen of the endoplasmic reticulum and travels via the endomembrane system to be stored in the cell wall. However, some PAP may retrotranslocate across the endoplasmic reticulum membrane to be released back into the cytosol, thereby exposing ribosomes to depurination. In this work, we isolated and characterized a complexed form of the enzyme that exhibits substantially reduced activity. We showed that this complex is a homodimer of PAP and that dimerization involves a peptide that contains a conserved aromatic amino acid, tyrosine 123, located in the active site of the enzyme. Bimolecular fluorescence complementation demonstrated that the homodimer may form in vivo and that dimerization is prevented by the substitution of tyrosine 123 for alanine. The homodimer is a minor form of PAP, observed only in the cytosol of cells and not in the apoplast. Taken together, these data support a novel mechanism for the limitation of depurination of autologous ribosomes by molecules of the protein that escape transport to the cell wall by the endomembrane system.

  14. The spc ribosomal protein operon of Escherichia coli: sequence and cotranscription of the ribosomal protein genes and a protein export gene.


    Cerretti, D P; Dean, D; Davis, G R; Bedwell, D M; Nomura, M


    The genes encoding the 52 ribosomal proteins (r-proteins) of Escherichia coli are organized into approximately 19 operons scattered throughout the chromosome. One of these, the spc operon, contains the genes for ten ribosomal proteins: L14, L24, L5, S14, S8, L6, L18, S5, L30 and L15 (rp1N, rp1X, rp1E, rpsN, rpsH, rp1F, rp1R, rpsE, rpmD, and rp1O). We now report the entire 5.9 kb nucleotide sequence of the spc operon. DNA sequence analysis has confirmed the genetic organization and refined the amino acid sequence of the ten r-proteins in this operon. It has also revealed the presence of two open reading frames past the last known gene (L15) of the spc operon. One of these corresponds to a gene (pr1A or secY) which recently has been shown by others to be involved in protein export. In addition, S1 mapping experiments indicate that a significant proportion of transcription initiated from the spc operon continues not only into the two putative genes, but also without termination into the downstream alpha r-protein operon.

  15. The sequential addition of ribosomal proteins during the formation of the small ribosomal subunit in Friend erythroleukemia cells.


    Todorov, I T; Noll, F; Hadjiolov, A A


    Nucleolar '80-S' and '40-S' preribosomes (containing 45-S and 21-S pre-rRNA, respectively), as well as cytoplasmic ribosomes, were isolated from Friend erythroleukemia cells. The presence of structural ribosomal proteins in the isolated particles was studied by using antisera against individual rat liver small ribosomal subunit proteins. The analysis is based on the established crossreactivity between rat and mouse ribosomes [F. Noll and H. Bielka (1970) Mol. Gen. Genet. 106, 106-113]. The identification of the proteins was achieved by two independent immunological techniques: the passive haemagglutination test and the enzyme immunoassay of electrophoretically fractionated proteins, blotted on nitrocellulose. All 17 proteins tested are present in cytoplasmic ribosomes. A large number of proteins (S3a, S6, S7, S8, S11, S14, S18, S20, S23/24 and S25) are present in the '80-S' preribosome. Only two proteins (S3 and S21) are added during the formation of the '40-S' preribosome in the nucleolus. Four proteins (S2, S19, S26 and S29) are added at later, possibly extranucleolar, stages of ribosome formation. The results obtained provide evidence for the sequential addition of proteins during the formation of the small ribosomal subunit in Friend erythroleukemia cells.

  16. Regulation of drug sensitivity by ribosomal protein S3a.


    Hu, Z B; Minden, M D; McCulloch, E A; Stahl, J


    When bcl-2 is immunoprecipitated from (32)P-labeled cell extracts of all-trans retinoic acid (ATRA)-treated acute myeloblastic leukemia (AML) blasts, a phosphorylated protein of approximately 30 kd is coprecipitated. This protein has been identified as ribosomal protein S3a. The biologic effects of S3a include favoring apoptosis and enhancing the malignant phenotype. We sought to determine whether S3a, like bcl-2, influenced the response of cells to chemotherapeutic drugs and ATRA. Cell lines were studied in which S3a was genetically increased or disrupted; increased S3a was regularly associated with increased plating efficiency and increased sensitivity to either cytosine arabinoside (ara-C) or doxorubicin (DNR). S3a did not affect the sensitivity of cells to paclitaxel. Pulse exposures to either (3)HTdR or ara-C showed a greater percentage of clonogenic cells in the S phase of the cell cycle in cells with increased S3a than in controls. Cells with increased S3a responded to ATRA by increased ara-C or DNR sensitivity, whereas cells with reduced S3a protein were either protected by ATRA or not affected. We studied cryopreserved blast cells from patients with AML or chronic myelomonocytic leukemia (CMML). S3a protein levels were heterogeneous in these populations. In 32 cryopreserved blast populations, S3a levels were significantly correlated with both bcl-2 and with cell growth in culture. As in cell lines, high S3a in cryopreserved blasts was associated with ATRA-induced sensitization to ara-C. No significant association was seen between S3a levels and response to treatment. PMID:10648421

  17. Essential ribosome assembly factor Fap7 regulates a hierarchy of RNA–protein interactions during small ribosomal subunit biogenesis

    PubMed Central

    Hellmich, Ute A.; Weis, Benjamin L.; Lioutikov, Anatoli; Wurm, Jan Philip; Kaiser, Marco; Christ, Nina A.; Hantke, Katharina; Kötter, Peter; Entian, Karl-Dieter; Schleiff, Enrico; Wöhnert, Jens


    Factor activating Pos9 (Fap7) is an essential ribosome biogenesis factor important for the assembly of the small ribosomal subunit with an uncommon dual ATPase and adenylate kinase activity. Depletion of Fap7 or mutations in its ATPase motifs lead to defects in small ribosomal subunit rRNA maturation, the absence of ribosomal protein Rps14 from the assembled subunit, and retention of the nascent small subunit in a quality control complex with the large ribosomal subunit. The molecular basis for the role of Fap7 in ribosome biogenesis is, however, not yet understood. Here we show that Fap7 regulates multiple interactions between the precursor rRNA, ribosomal proteins, and ribosome assembly factors in a hierarchical manner. Fap7 binds to Rps14 with a very high affinity. Fap7 binding blocks both rRNA-binding elements of Rps14, suggesting that Fap7 inhibits premature interactions of Rps14 with RNA. The Fap7/Rps14 interaction is modulated by nucleotide binding to Fap7. Rps14 strongly activates the ATPase activity but not the adenylate kinase activity of Fap7, identifying Rps14 as an example of a ribosomal protein functioning as an ATPase-activating factor. In addition, Fap7 inhibits the RNA cleavage activity of Nob1, the endonuclease responsible for the final maturation step of the small subunit rRNA, in a nucleotide independent manner. Thus, Fap7 may regulate small subunit biogenesis at multiple stages. PMID:24003121

  18. Single Molecule Force Measurement for Protein Synthesis on the Ribosome

    NASA Astrophysics Data System (ADS)

    Uemura, Sotaro


    The ribosome is a molecular machine that translates the genetic code described on the messenger RNA (mRNA) into an amino acid sequence through repetitive cycles of transfer RNA (tRNA) selection, peptide bond formation and translocation. Although the detailed interactions between the translation components have been revealed by extensive structural and biochemical studies, it is not known how the precise regulation of macromolecular movements required at each stage of translation is achieved. Here we demonstrate an optical tweezer assay to measure the rupture force between a single ribosome complex and mRNA. The rupture force was compared between ribosome complexes assembled on an mRNA with and without a strong Shine-Dalgarno (SD) sequence. The removal of the SD sequence significantly reduced the rupture force, indicating that the SD interactions contribute significantly to the stability of the ribosomal complex on the mRNA in a pre-peptidyl transfer state. In contrast, the post-peptidyl transfer state weakened the rupture force as compared to the complex in a pre-peptidyl transfer state and it was the same for both the SD-containing and SD-deficient mRNAs. The results suggest that formation of the first peptide bond destabilizes the SD interaction, resulting in the weakening of the force with which the ribosome grips an mRNA. This might be an important requirement to facilitate movement of the ribosome along mRNA during the first translocation step. In this article, we discuss about the above new results including the introduction of the ribosome translation mechanism and the optical tweezer method.

  19. A novel Drosophila Minute locus ribosomal protein S13

    SciTech Connect

    Saeboe-Larssen, S.; Lambertsson, A.


    Minutes comprise >50 phenotypically similar Drosophila mutations believed to affect ribosomal protein genes. Common traits of the Minute phenotype are short and thin bristles, slow development, and recessive lethality. To further investigate the proposed Minute to ribosomal protein correspondence, loss-of-function Minute mutations were induced by P-element mutagenesis. Here, we report a previously undescribed Minute locus that maps to 32A on chromosome 2L; this Minute allele is named P(lacW)M(2)32A{sup 1} and the gene M(2)32A. Flies heterozygous for P(lacW)M(2)32A{sup 1} have a medium Minute phenotype. The gene interrupted by the P-element insertion was cloned. Sequence analyses revealed that it encodes the Drosophila homologue of eukaryotic ribosomal protein S13. It is a single-copy gene and the level of RPS13 transcript is reduced to {approximately}50% in P(lacW)M(2)32A{sup 1} heterozygotes. Both transcript level and phenotype are restored to wild type by remobilizing the P element, demonstrating that the mutation is caused by insertion of the P-element construct. These results further strengthen the notion that Minutes encode ribosomal proteins and demonstrate the P-element mutagenesis is a fruitful approach to use in these studies. 47 refs., 7 figs.

  20. Mutations in ribosomal proteins: Apoptosis, cell competition, and cancer.


    Baker, Nicholas E; Kale, Abhijit


    Mutations affecting multiple ribosomal proteins are implicated in cancer. Using genetic mosaics in the fruit fly Drosophila, we describe 3 apoptotic mechanisms that affect Rp/Rp homozygous mutant cells, Rp/+ heterozygous cells, or Rp/+ heterozygous cells in competition with nearby wild type cells, and discuss how apoptosis might be related to cancer predisposition. PMID:27308545

  1. The HIV Tat protein affects processing of ribosomal RNA precursor

    PubMed Central

    Ponti, Donatella; Troiano, Maria; Bellenchi, Gian Carlo; Battaglia, Piero A; Gigliani, Franca


    Background Inside the cell, the HIV Tat protein is mainly found in the nucleus and nucleolus. The nucleolus, the site of ribosome biogenesis, is a highly organized, non-membrane-bound sub-compartment where proteins with a high affinity for nucleolar components are found. While it is well known that Tat accumulates in the nucleolus via a specific nucleolar targeting sequence, its function in this compartment it still unknown. Results To clarify the significance of the Tat nucleolar localization, we induced the expression of the protein during oogenesis in Drosophila melanogaster strain transgenic for HIV-tat gene. Here we show that Tat localizes in the nucleoli of Drosophila oocyte nurse cells, where it specifically co-localizes with fibrillarin. Tat expression is accompanied by a significant decrease of cytoplasmic ribosomes, which is apparently related to an impairment of ribosomal rRNA precursor processing. Such an event is accounted for by the interaction of Tat with fibrillarin and U3 snoRNA, which are both required for pre-rRNA maturation. Conclusion Our data contribute to understanding the function of Tat in the nucleolus, where ribosomal RNA synthesis and cell cycle control take place. The impairment of nucleolar pre-rRNA maturation through the interaction of Tat with fibrillarin-U3snoRNA complex suggests a process by which the virus modulates host response, thus contributing to apoptosis and protein shut-off in HIV-uninfected cells. PMID:18559082

  2. Phosphorylation of ribosomal proteins influences subunit association and translation of poly (U) in Streptomyces coelicolor.


    Mikulík, Karel; Bobek, Jan; Ziková, Alice; Smětáková, Magdalena; Bezoušková, Silvie


    The occurrence of phosphorylated proteins in ribosomes of Streptomyces coelicolor was investigated. Little is known about which biological functions these posttranslational modifications might fulfil. A protein kinase associated with ribosomes phosphorylated six ribosomal proteins of the small subunit (S3, S4, S12, S13, S14 and S18) and seven ribosomal proteins of the large subunit (L2, L3, L7/L12, L16, L17, L23 and L27). The ribosomal proteins were phosphorylated mainly on the Ser/Thr residues. Phosphorylation of the ribosomal proteins influences ribosomal subunits association. Ribosomes with phosphorylated proteins were used to examine poly (U) translation activity. Phosphorylation induced about 50% decrease in polyphenylalanine synthesis. After preincubation of ribosomes with alkaline phosphatase the activity of ribosomes was greatly restored. Small differences were observed between phosphorylated and unphosphorylated ribosomes in the kinetic parameters of the binding of Phe-tRNA to the A-site of poly (U) programmed ribosomes, suggesting that the initial binding of Phe-tRNA is not significantly affected by phosphorylation. On contrary, the rate of peptidyl transferase was about two-fold lower than that in unphosphorylated ribosomes. The data presented demonstrate that phosphorylation of ribosomal proteins affects critical steps of protein synthesis.

  3. Protein-guided RNA dynamics during early ribosome assembly

    PubMed Central

    Kim, Hajin; Abeysirigunawardena, Sanjaya C.; Chen, Ke; Mayerle, Megan; Ragunathan, Kaushik; Luthey-Schulten, Zaida; Ha, Taekjip; Woodson, Sarah A.


    The assembly of 30S ribosomes requires the precise addition of 20 proteins to the 16S ribosomal RNA. How early binding proteins change the rRNA structure so that later proteins may join the complex is poorly understood. Here we use single molecule fluorescence resonance energy transfer (smFRET) to observe real-time encounters between ribosomal protein S4 and the 16S 5′ domain RNA at an early stage of 30S assembly. Dynamic initial S4-RNA complexes pass through a stable non-native intermediate before converting to the native complex, showing that non-native structures can offer a low free energy path to protein-RNA recognition. Three-color FRET and molecular dynamics (MD) simulations reveal how S4 changes the frequency and direction of RNA helix motions, guiding a conformational switch that enforces the hierarchy of protein addition. This protein-guided dynamics offers an alternative explanation for induced fit in RNA-protein complexes. PMID:24522531

  4. Differential expression of ribosomal proteins in myelodysplastic syndromes.


    Rinker, Elizabeth B; Dueber, Julie C; Qualtieri, Julianne; Tedesco, Jason; Erdogan, Begum; Bosompem, Amma; Kim, Annette S


    Aberrations of ribosomal biogenesis have been implicated in several congenital bone marrow failure syndromes, such as Diamond-Blackfan anaemia, Shwachman-Diamond syndrome and Dyskeratosis Congenita. Recent studies have identified haploinsufficiency of RPS14 in the acquired bone marrow disease isolated 5q minus syndrome, a subtype of myelodysplastic syndromes (MDS). However, the expression of various proteins comprising the ribosomal subunits and other proteins enzymatically involved in the synthesis of the ribosome has not been explored in non-5q minus MDS. Furthermore, differences in the effects of these expression alterations among myeloid, erythroid and megakaryocyte lineages have not been well elucidated. We examined the expression of several proteins related to ribosomal biogenesis in bone marrow biopsy specimens from patients with MDS (5q minus patients excluded) and controls with no known myeloid disease. Specifically, we found that there is overexpression of RPS24, DKC1 and SBDS in MDS. This overexpression is in contrast to the haploinsufficiency identified in the congenital bone marrow failure syndromes and in acquired 5q minus MDS. Potential mechanisms for these differences and aetiology for these findings in MDS are discussed.

  5. Protein folding on the ribosome studied using NMR spectroscopy

    PubMed Central

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John


    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  6. Suppression of Myc oncogenic activity by ribosomal protein haploinsufficiency.


    Barna, Maria; Pusic, Aya; Zollo, Ornella; Costa, Maria; Kondrashov, Nadya; Rego, Eduardo; Rao, Pulivarthi H; Ruggero, Davide


    The Myc oncogene regulates the expression of several components of the protein synthetic machinery, including ribosomal proteins, initiation factors of translation, RNA polymerase III and ribosomal DNA. Whether and how increasing the cellular protein synthesis capacity affects the multistep process leading to cancer remains to be addressed. Here we use ribosomal protein heterozygote mice as a genetic tool to restore increased protein synthesis in Emu-Myc/+ transgenic mice to normal levels, and show that the oncogenic potential of Myc in this context is suppressed. Our findings demonstrate that the ability of Myc to increase protein synthesis directly augments cell size and is sufficient to accelerate cell cycle progression independently of known cell cycle targets transcriptionally regulated by Myc. In addition, when protein synthesis is restored to normal levels, Myc-overexpressing precancerous cells are more efficiently eliminated by programmed cell death. Our findings reveal a new mechanism that links increases in general protein synthesis rates downstream of an oncogenic signal to a specific molecular impairment in the modality of translation initiation used to regulate the expression of selective messenger RNAs. We show that an aberrant increase in cap-dependent translation downstream of Myc hyperactivation specifically impairs the translational switch to internal ribosomal entry site (IRES)-dependent translation that is required for accurate mitotic progression. Failure of this translational switch results in reduced mitotic-specific expression of the endogenous IRES-dependent form of Cdk11 (also known as Cdc2l and PITSLRE), which leads to cytokinesis defects and is associated with increased centrosome numbers and genome instability in Emu-Myc/+ mice. When accurate translational control is re-established in Emu-Myc/+ mice, genome instability is suppressed. Our findings demonstrate how perturbations in translational control provide a highly specific outcome

  7. Implication of mammalian ribosomal protein S3 in the processing of DNA damage.


    Kim, J; Chubatsu, L S; Admon, A; Stahl, J; Fellous, R; Linn, S


    A human apurinic/apyrimidinic endonuclease activity, called AP endonuclease I, is missing from or altered specifically in cells cultured from Xeroderma pigmentosum group-D individuals (XP-D cells) (Kuhnlein, U., Lee, B., Penhoet, E. E., and Linn, S. (1978) Nucleic Acids Res. 5,951-960). We have now observed that another nuclease activity, UV endonuclease III, is similarly not detected in XP-D cells and is inseparable from the AP endonuclease I activity. This activity preferentially cleaves the phosphodiester backbone of heavily ultraviolet-irradiated DNA at unknown lesions as well as at one of the phosphodiester bonds within a cyclobutane pyrimidine dimer. The nuclease activities have been purified from mouse cells to yield a peptide of M(r) = 32,000, whose sequence indicates identity with ribosomal protein S3. The nuclease activities all cross-react with immunopurified antibody directed against authentic rat ribosomal protein S3, and, upon expression in Escherichia coli of a cloned rat cDNA for ribosomal protein S3, each of the activities was recovered and was indistinguishable from those of the mammalian UV endonuclease III. Moreover, the protein expressed in E. coli and its activities cross-react with the rat protein antibody. Ribosomal protein S3 contains a potential nuclear localization signal, and the protein isolated as a nuclease also has a glycosylation pattern consistent with a nuclear localization as determined by lectin binding. The unexpected role of a ribosomal protein in DNA damage processing and the unexplained inability to detect the nuclease activities in extracts from XP-D cells are discussed. PMID:7775413

  8. Diverse effects of residues 74-78 in ribosomal protein S12 on decoding and antibiotic sensitivity.


    Agarwal, Deepali; O'Connor, Michael


    Ribosomal protein S12 plays key roles in the ribosome's response to the error-promoting antibiotic streptomycin and in modulating the accuracy of translation. The discovery that substitutions at His76 in S12, distant from the streptomycin binding site, conferred streptomycin resistance in the thermophilic bacterium Thermus thermophilus prompted us to make similar alterations in the S12 protein of Escherichia coli. While, none of the E. coli S12 mutations confers streptomycin resistance, they all have distinct effects on the accuracy of translation. In addition, a subset of the S12 alterations renders the cells hypersensitive to fusidic acid, an inhibitor of the translocation step of translation. These results indicate that the His 76 region of ribosomal protein S12 plays key roles in tRNA selection and translocation steps of protein synthesis, consistent with its interaction with elongation factors EF-Tu and EF-G, as deduced from structural studies of ribosomal complexes. PMID:24530394

  9. The immunodominant T helper 2 (Th2) response elicited in BALB/c mice by the Leishmania LiP2a and LiP2b acidic ribosomal proteins cannot be reverted by strong Th1 inducers

    PubMed Central

    Iborra, S; Abánades, D R; Parody, N; Carrión, J; Risueño, R M; Pineda, M A; Bonay, P; Alonso, C; Soto, M


    The search for disease-associated T helper 2 (Th2) Leishmania antigens and the induction of a Th1 immune response to them using defined vaccination protocols is a potential strategy to induce protection against Leishmania infection. Leishmania infantum LiP2a and LiP2b acidic ribosomal protein (P proteins) have been described as prominent antigens during human and canine visceral leishmaniasis. In this study we demonstrate that BALB/c mice infected with Leishmania major develop a Th2-like humoral response against Leishmania LiP2a and LiP2b proteins and that the same response is induced in BALB/c mice when the parasite P proteins are immunized as recombinant molecules without adjuvant. The genetic immunization of BALB/c mice with eukaryotic expression plasmids coding for these proteins was unable to redirect the Th2-like response induced by these antigens, and only the co-administration of the recombinant P proteins with CpG oligodeoxynucleotides (CpG ODN) promoted a mixed Th1/Th2 immune response. According to the preponderance of a Th2 or mixed Th1/Th2 responses elicited by the different regimens of immunization tested, no evidence of protection was observed in mice after challenge with L. major. Although alterations of the clinical outcome were not detected in mice presensitized with the P proteins, the enhanced IgG1 and interleukin (IL)-4 response against total Leishmania antigens in these mice may indicate an exacerbation of the disease. PMID:17900304

  10. Ribosomal ribonucleic acid and ribosomal precursor ribonucleic acid in Anacystis nidulans.


    Szalay, A; Munsche, D; Wolligiehn, R; Parthier, B


    The RNA of the blue-green alga Anacystis nidulans contains three ribosomal RNA species with molecular weights of 0.56x10(6), 0.9x10(6), and 1.1x10(6) if the RNA is extracted in the absence of Mg(2+). The 0.9x10(6)mol.wt. rRNA is extremely slowly labelled in (32)P-incorporation experiments. This rRNA may be a cleavage product of the 1.1x10(6)mol.wt. rRNA from the ribosomes of cells in certain physiological states (e.g. light-deficiency during growth). The cleavage of the 1.1x10(6)mol.wt. rRNA during the extraction procedure can be prevented by the addition of 10mm-MgCl(2). (32)P-pulse-labelling studies demonstrate the rapid synthesis of two ribosomal precursor RNA species. One precursor RNA migrating slightly slower than the 1.1x10(6)mol.wt. rRNA appears much less stable than the other precursor RNA, which shows the electrophoretic behaviour of the 0.7x10(6)mol.wt. rRNA. Our observations support the close relationship between bacteria and blue-green algae also with respect to rRNA maturation. The conversion of the ribosomal precursor RNA species into 0.56x10(6)- and 1.1x10(6)-mol.wt. rRNA species requires Mg(2+) in the incubation medium.

  11. Molecular characterization of a human gene for S28 ribosomal binding protein

    SciTech Connect

    Wong, P.; Borst, D.E.; Chader, G.J.


    The mechanism of ribosome action and the ribosomal binding proteins which cooperatively interact in the working of this structure are not completely understood. Theoretically, mutations in genes that encode these proteins may compromise the efficiency of protein synthesis and therefore lead to a functional disorder. In the course of our search for human genes which show homology to the C. elegans CED-4 death gene, we have serendipitously identified one of the human S28 ribosomal binding protein genes as a random fragment fused to the end of one of our putative CED-4 positive homologue clones. The cloned S28 fragment consists of 381 nucleotides with a putative open reading frame of 113 amino acids. Sequence comparisons to GenBank revealed significant homologies to ribosomal binding protein genes in other species (including the rat S28 ribosomal binding protein gene) indicating that the S28 gene sequence is highly conserved. This finding is confirmed by zooblot analysis. Significant homologies also exist to two human expressed tagged sites (HUMRIBPROB; L05091 and HSAFIF072; Z21908). Analysis of the putative S28 peptide sequence allows insights into possible functional regions of the protein. The identification of 8 distinct bands upon Southern analysis of the S28 fragments suggests that there are multiple copies of the S28 gene in the human genome. Mapping of the S28 fragment on somatic cell hybrid panels identified distinct S28 gene loci on chromosomes 1, 2, 7, 10, 11, 12, 17 expression in adult tissues (pancreas, kidney, muscle, liver, lung, placenta, brain, heart, and retina) as well as in fetal tissues (kidney, liver, lung, brain, and heart).

  12. Protein folding: When ribosomes pick the structure

    NASA Astrophysics Data System (ADS)

    Sivertsson, Elin M.; Itzhaki, Laura S.


    Anfinsen's principle tells us that the folded structure of a protein is determined solely by its sequence. Now, it has been shown that the rate at which a polypeptide chain is synthesized in the cell can affect which of two alternative folded structures it adopts.

  13. The ribosome can discriminate the chirality of amino acids within its peptidyl-transferase center

    PubMed Central

    Englander, Michael T.; Avins, Joshua L.; Fleisher, Rachel C.; Liu, Bo; Effraim, Philip R.; Wang, Jiangning; Schulten, Klaus; Leyh, Thomas S.; Gonzalez, Ruben L.; Cornish, Virginia W.


    The cellular translational machinery (TM) synthesizes proteins using exclusively L- or achiral aminoacyl-tRNAs (aa-tRNAs), despite the presence of D-amino acids in nature and their ability to be aminoacylated onto tRNAs by aa-tRNA synthetases. The ubiquity of L-amino acids in proteins has led to the hypothesis that D-amino acids are not substrates for the TM. Supporting this view, protein engineering efforts to incorporate D-amino acids into proteins using the TM have thus far been unsuccessful. Nonetheless, a mechanistic understanding of why D-aa-tRNAs are poor substrates for the TM is lacking. To address this deficiency, we have systematically tested the translation activity of D-aa-tRNAs using a series of biochemical assays. We find that the TM can effectively, albeit slowly, accept D-aa-tRNAs into the ribosomal aa-tRNA binding (A) site, use the A-site D-aa-tRNA as a peptidyl-transfer acceptor, and translocate the resulting peptidyl-D-aa-tRNA into the ribosomal peptidyl-tRNA binding (P) site. During the next round of continuous translation, however, we find that ribosomes carrying a P-site peptidyl-D-aa-tRNA partition into subpopulations that are either translationally arrested or that can continue translating. Consistent with its ability to arrest translation, chemical protection experiments and molecular dynamics simulations show that P site-bound peptidyl-D-aa-tRNA can trap the ribosomal peptidyl-transferase center in a conformation in which peptidyl transfer is impaired. Our results reveal a novel mechanism through which D-aa-tRNAs interfere with translation, provide insight into how the TM might be engineered to use D-aa-tRNAs, and increase our understanding of the physiological role of a widely distributed enzyme that clears D-aa-tRNAs from cells. PMID:25918365

  14. The ribosome can discriminate the chirality of amino acids within its peptidyl-transferase center.


    Englander, Michael T; Avins, Joshua L; Fleisher, Rachel C; Liu, Bo; Effraim, Philip R; Wang, Jiangning; Schulten, Klaus; Leyh, Thomas S; Gonzalez, Ruben L; Cornish, Virginia W


    The cellular translational machinery (TM) synthesizes proteins using exclusively L- or achiral aminoacyl-tRNAs (aa-tRNAs), despite the presence of D-amino acids in nature and their ability to be aminoacylated onto tRNAs by aa-tRNA synthetases. The ubiquity of L-amino acids in proteins has led to the hypothesis that D-amino acids are not substrates for the TM. Supporting this view, protein engineering efforts to incorporate D-amino acids into proteins using the TM have thus far been unsuccessful. Nonetheless, a mechanistic understanding of why D-aa-tRNAs are poor substrates for the TM is lacking. To address this deficiency, we have systematically tested the translation activity of D-aa-tRNAs using a series of biochemical assays. We find that the TM can effectively, albeit slowly, accept D-aa-tRNAs into the ribosomal aa-tRNA binding (A) site, use the A-site D-aa-tRNA as a peptidyl-transfer acceptor, and translocate the resulting peptidyl-D-aa-tRNA into the ribosomal peptidyl-tRNA binding (P) site. During the next round of continuous translation, however, we find that ribosomes carrying a P-site peptidyl-D-aa-tRNA partition into subpopulations that are either translationally arrested or that can continue translating. Consistent with its ability to arrest translation, chemical protection experiments and molecular dynamics simulations show that P site-bound peptidyl-D-aa-tRNA can trap the ribosomal peptidyl-transferase center in a conformation in which peptidyl transfer is impaired. Our results reveal a novel mechanism through which D-aa-tRNAs interfere with translation, provide insight into how the TM might be engineered to use D-aa-tRNAs, and increase our understanding of the physiological role of a widely distributed enzyme that clears D-aa-tRNAs from cells.

  15. RNA-protein distance patterns in ribosomes reveal the mechanism of translational attenuation.


    Yu, DongMei; Zhang, Chao; Qin, PeiWu; Cornish, Peter V; Xu, Dong


    Elucidating protein translational regulation is crucial for understanding cellular function and drug development. A key molecule in protein translation is ribosome, which is a super-molecular complex extensively studied for more than a half century. The structure and dynamics of ribosome complexes were resolved recently thanks to the development of X-ray crystallography, Cryo-EM, and single molecule biophysics. Current studies of the ribosome have shown multiple functional states, each with a unique conformation. In this study, we analyzed the RNA-protein distances of ribosome (2.5 MDa) complexes and compared these changes among different ribosome complexes. We found that the RNA-protein distance is significantly correlated with the ribosomal functional state. Thus, the analysis of RNA-protein binding distances at important functional sites can distinguish ribosomal functional states and help understand ribosome functions. In particular, the mechanism of translational attenuation by nascent peptides and antibiotics was revealed by the conformational changes of local functional sites.

  16. Crystal structure of a mutant of archaeal ribosomal protein L1 from Methanococcus jannaschii

    NASA Astrophysics Data System (ADS)

    Sarskikh, A. V.; Gabdulkhakov, A. G.; Kostareva, O. S.; Shklyaeva, A. A.; Tishchenko, S. V.


    The crystal structure of a mutant of archaeal ribosomal protein L1 from Methanococcus jannaschii with the deletion of a nonconserved positively charged cluster consisting of eight C-terminal amino acid residues is determined by the molecular replacement method at 1.75 Å resolution. This mutant is shown to form more stable and ordered crystals belonging to a space group other than that of the wild-type protein crystals. The positively charged C-terminal region has only a slight effect on the interaction between protein L1 and RNA molecules. Hence, this mutant can be used to prepare protein-RNA complexes and obtain their crystals.

  17. Structure determination of archaea-specific ribosomal protein L46a reveals a novel protein fold

    SciTech Connect

    Feng, Yingang; Song, Xiaxia; Lin, Jinzhong; Xuan, Jinsong; Cui, Qiu; Wang, Jinfeng


    Highlights: • The archaea-specific ribosomal protein L46a has no homology to known proteins. • Three dimensional structure and backbone dynamics of L46a were determined by NMR. • The structure of L46a represents a novel protein fold. • A potential rRNA-binding surface on L46a was identified. • The potential position of L46a on the ribosome was proposed. - Abstract: Three archaea-specific ribosomal proteins recently identified show no sequence homology with other known proteins. Here we determined the structure of L46a, the most conserved one among the three proteins, from Sulfolobus solfataricus P2 using NMR spectroscopy. The structure presents a twisted β-sheet formed by the N-terminal part and two helices at the C-terminus. The L46a structure has a positively charged surface which is conserved in the L46a protein family and is the potential rRNA-binding site. Searching homologous structures in Protein Data Bank revealed that the structure of L46a represents a novel protein fold. The backbone dynamics identified by NMR relaxation experiments reveal significant flexibility at the rRNA binding surface. The potential position of L46a on the ribosome was proposed by fitting the structure into a previous electron microscopy map of the ribosomal 50S subunit, which indicated that L46a contacts to domain I of 23S rRNA near a multifunctional ribosomal protein L7ae.

  18. Antibacterial Action of Primaquine: Effects In Vitro on Polypeptide Synthesis and In Vivo on Ribosomes and Ribosomal Ribonucleic Acid

    PubMed Central

    Olenick, John G.


    Primaquine inhibited polyphenylalanine formation directed by poly(U) in a cell-free system obtained from Bacillus megaterium only when the drug was preincubated with transfer ribonucleic acid (tRNA), poly(U), or ribosomes. Considerably less inhibition was produced when the ionic strength of the preincubation mixture of tRNA or poly(U) plus primaquine was increased; with ribosomes, the extent of inhibition was only slightly reduced. In cultures of B. megaterium, primaquine induced the breakdown of ribosomes and their RNA. PMID:813574

  19. Eukaryotic Initiation Factor 6, an evolutionarily conserved regulator of ribosome biogenesis and protein translation

    SciTech Connect

    Guo, Jianjun; Jin, Zhaoqing; Yang, Xiaohan; Li, Jian-Feng; Chen, Jay


    We recently identified Receptor for Activated C Kinase 1 (RACK1) as one of the molecular links between abscisic acid (ABA) signaling and its regulation on protein translation. Moreover, we identified Eukaryotic Initiation Factor 6 (eIF6) as an interacting partner of RACK1. Because the interaction between RACK1 and eIF6 in mammalian cells is known to regulate the ribosome assembly step of protein translation initiation, it was hypothesized that the same process of protein translation in Arabidopsis is also regulated by RACK1 and eIF6. In this article, we analyzed the amino acid sequences of eIF6 in different species from different lineages and discovered some intriguing differences in protein phosphorylation sites that may contribute to its action in ribosome assembly and biogenesis. In addition, we discovered that, distinct from non-plant organisms in which eIF6 is encoded by a single gene, all sequenced plant genomes contain two or more copies of eIF6 genes. While one copy of plant eIF6 is expressed ubiquitously and might possess the conserved function in ribosome biogenesis and protein translation, the other copy seems to be only expressed in specific organs and therefore may have gained some new functions. We proposed some important studies that may help us better understand the function of eIF6 in plants.

  20. Yeast Ribosomal Protein L40 Assembles Late into Precursor 60 S Ribosomes and Is Required for Their Cytoplasmic Maturation*

    PubMed Central

    Fernández-Pevida, Antonio; Rodríguez-Galán, Olga; Díaz-Quintana, Antonio; Kressler, Dieter; de la Cruz, Jesús


    Most ribosomal proteins play important roles in ribosome biogenesis and function. Here, we have examined the contribution of the essential ribosomal protein L40 in these processes in the yeast Saccharomyces cerevisiae. Deletion of either the RPL40A or RPL40B gene and in vivo depletion of L40 impair 60 S ribosomal subunit biogenesis. Polysome profile analyses reveal the accumulation of half-mers and a moderate reduction in free 60 S ribosomal subunits. Pulse-chase, Northern blotting, and primer extension analyses in the L40-depleted strain clearly indicate that L40 is not strictly required for the precursor rRNA (pre-rRNA) processing reactions but contributes to optimal 27 SB pre-rRNA maturation. Moreover, depletion of L40 hinders the nucleo-cytoplasmic export of pre-60 S ribosomal particles. Importantly, all these defects most likely appear as the direct consequence of impaired Nmd3 and Rlp24 release from cytoplasmic pre-60 S ribosomal subunits and their inefficient recycling back into the nucle(ol)us. In agreement, we show that hemagglutinin epitope-tagged L40A assembles in the cytoplasm into almost mature pre-60 S ribosomal particles. Finally, we have identified that the hemagglutinin epitope-tagged L40A confers resistance to sordarin, a translation inhibitor that impairs the function of eukaryotic elongation factor 2, whereas the rpl40a and rpl40b null mutants are hypersensitive to this antibiotic. We conclude that L40 is assembled at a very late stage into pre-60 S ribosomal subunits and that its incorporation into 60 S ribosomal subunits is a prerequisite for subunit joining and may ensure proper functioning of the translocation process. PMID:22995916

  1. Proteomic analysis of rodent ribosomes revealed heterogeneity including ribosomal proteins L10-like, L22-like 1, and L39-like.


    Sugihara, Yoshihiko; Honda, Hiroki; Iida, Tomoharu; Morinaga, Takuma; Hino, Shingo; Okajima, Tetsuya; Matsuda, Tsukasa; Nadano, Daita


    Heterogeneity of ribosome structure, due to variations in ribosomal protein composition, has been shown to be of physiological significance in plants and yeast. Mammalian genomics have demonstrated numerous genes that are paralogous to genes encoding ribosomal proteins. Although the vast majority are considered to be pseudogenes, mRNA expression of a few paralogues, such as human ribosomal protein L39-like/L39-2, has been reported. In the present study, ribosomes from the liver, mammary gland, and testis of rodents were analyzed using a combination of two-dimensional gel electrophoresis under radical-free and highly reducing conditions, and mass spectrometry. This system allowed identification of 78 ribosomal proteins and Rack1 from a single gel. The degree of heterogeneity was far less than that reported for plant and yeast ribosomes, and was in accord with published biochemical and genetic data for mammalian ribosomes. Nevertheless, an uncharacterized paralogue of ribosomal protein L22, ribosomal protein L22-like 1, was identified as a minor ribosomal component. Ribosomal proteins L10-like and L39-like, paralogues of ribosomal proteins L10 and L39, respectively, were found in ribosomes only from the testis. Reverse transcription-polymerase chain reaction yielded supportive evidence for specific expression of L10-like and L39-like in the testis. Newly synthesized L39-like is likely to be transported to the nucleolus, where ribosome biosynthesis occurs, and then incorporated into translating ribosomes in the cytoplasm. Heterogeneity of mammalian testicular ribosomes is structurally non-negligible, and may offer valuable insights into the function of the customized ribosome.

  2. Effect of alpha-sarcin and ribosome-inactivating proteins on the interaction of elongation factors with ribosomes.


    Brigotti, M; Rambelli, F; Zamboni, M; Montanaro, L; Sperti, S


    alpha-Sarcin from Aspergillus giganteus and the ribosome-inactivating proteins (RIPs) from higher plants inactivate the 60 S ribosomal subunit. The former is an RNAase, whereas RIPs are N-glycosidases. The site of cleavage of RNA and that of N-glycosidic depurinization are at one nucleotide distance in 28 S rRNA [Endo & Tsurugi (1987) J. Biol. Chem. 262, 8128-8130]. The effect of alpha-sarcin and that of RIPs on the interaction of elongation factors with Artemia salina (brine shrimp) ribosomes have been investigated. alpha-Sarcin inhibits both the EF1 (elongation factor 1)-dependent binding of aminoacyl-tRNA and the GTP-dependent binding of EF2 (elongation factor 2) to ribosomes, whereas two of the RIPs tested, ricin from Ricinus communis (castor bean) and volkensin from Adenia volkensii (kilyambiti), inhibit only the latter reaction. EF2 protects ribosomes from inactivation by both alpha-sarcin and ricin. The EF1-binding site is affected only by alpha-sarcin. The sensitivity of this site to alpha-sarcin is increased by pretreatment of ribosomes with ricin. A. salina ribosomes were highly resistant to the third RIP tested, namely gelonin from Gelonium multiflorum. All four proteins tested have, however, a comparable activity on the rabbit reticulocyte-lysate system. PMID:2930482

  3. Dynamic evolution of mitochondrial ribosomal proteins in Holozoa.


    Scheel, Bettina M; Hausdorf, Bernhard


    We studied the highly dynamic evolution of mitochondrial ribosomal proteins (MRPs) in Holozoa. Most major clades within Holozoa are characterized by gains and/or losses of MRPs. The usefulness of gains of MRPs as rare genomic changes in phylogenetics is undermined by the high frequency of secondary losses. However, phylogenetic analyses of the MRP sequences provide evidence for the Acrosomata hypothesis, a sister group relationship between Ctenophora and Bilateria. An extensive restructuring of the mitochondrial genome and, as a consequence, of the mitochondrial ribosomes occurred in the ancestor of metazoans. The last MRP genes encoded in the mitochondrial genome were either moved to the nuclear genome or were lost. The strong decrease in size of the mitochondrial genome was probably caused by selection for rapid replication of mitochondrial DNA during oogenesis in the metazoan ancestor. A phylogenetic analysis of MRPL56 sequences provided evidence for a horizontal gene transfer of the corresponding MRP gene between metazoans and Dictyostelidae (Amoebozoa). The hypothesis that the requisition of additional MRPs compensated for a loss of rRNA segments in the mitochondrial ribosomes is corroborated by a significant negative correlation between the number of MRPs and length of the rRNA. Newly acquired MRPs evolved faster than bacterial MRPs and positions in eukaryote-specific MRPs were more strongly affected by coevolution than positions in prokaryotic MRPs in accordance with the necessity to fit these proteins into the pre-existing structure of the mitoribosome. PMID:24631858

  4. Dynamic evolution of mitochondrial ribosomal proteins in Holozoa.


    Scheel, Bettina M; Hausdorf, Bernhard


    We studied the highly dynamic evolution of mitochondrial ribosomal proteins (MRPs) in Holozoa. Most major clades within Holozoa are characterized by gains and/or losses of MRPs. The usefulness of gains of MRPs as rare genomic changes in phylogenetics is undermined by the high frequency of secondary losses. However, phylogenetic analyses of the MRP sequences provide evidence for the Acrosomata hypothesis, a sister group relationship between Ctenophora and Bilateria. An extensive restructuring of the mitochondrial genome and, as a consequence, of the mitochondrial ribosomes occurred in the ancestor of metazoans. The last MRP genes encoded in the mitochondrial genome were either moved to the nuclear genome or were lost. The strong decrease in size of the mitochondrial genome was probably caused by selection for rapid replication of mitochondrial DNA during oogenesis in the metazoan ancestor. A phylogenetic analysis of MRPL56 sequences provided evidence for a horizontal gene transfer of the corresponding MRP gene between metazoans and Dictyostelidae (Amoebozoa). The hypothesis that the requisition of additional MRPs compensated for a loss of rRNA segments in the mitochondrial ribosomes is corroborated by a significant negative correlation between the number of MRPs and length of the rRNA. Newly acquired MRPs evolved faster than bacterial MRPs and positions in eukaryote-specific MRPs were more strongly affected by coevolution than positions in prokaryotic MRPs in accordance with the necessity to fit these proteins into the pre-existing structure of the mitoribosome.

  5. Nuclear and nucleolar targeting of human ribosomal protein S6.

    PubMed Central

    Schmidt, C; Lipsius, E; Kruppa, J


    Chimeric proteins were constructed to define the nuclear localization signals (NLSs) of human ribosomal protein S6. The complete cDNA sequence, different cDNA fragments and oligonucleotides of the human ribosomal proteins S6, respectively, were joined to the 5' end of the entire LacZ gene of Escherichia coli by using recombinant techniques. The hybrid genes were transfected into L cells, transiently expressed, and the intracellular location of the fusion proteins was determined by their beta-galactosidase activity. Three NLSs were identified in the C-terminal half of the S6 protein. Deletion mutagenesis demonstrated that a single NLS is sufficient for targeting the corresponding S6-beta-galactosidase chimera into the nucleus. Removal of all three putative NLSs completely blocked the nuclear import of the resulting S6-beta-galactosidase fusion protein, which instead became evenly distributed in the cytoplasm. Chimeras containing deletion mutants of S6 with at least one single NLS or unmodified S6 accumulated in the nucleolus. Analysis of several constructs reveals the existence of a specific domain that is essential but not sufficient for nucleolar accumulation of S6. Images PMID:8590812

  6. Factors Affecting Immunogenic Activity of Mycobacterial Ribosomal and Ribonucleic Acid Preparations

    PubMed Central

    Youmans, Anne S.; Youmans, Guy P.


    By following careful procedures, mycobacterial ribosomal fractions and ribonucleic acid (RNA) prepared by ethyl alcohol precipitation were obtained which have immunogenic activities similar to the viable attenuated H37Ra cells of Mycobacterium tuberculosis from which they were obtained. This comparison was based on the amount of ribonucleic acid (RNA) present. These preparations consisted of approximately 63% RNA and 37% protein; no deoxyribonucleic acid or polysaccharide was detected by chemical tests. A high correlation was found between the immunogenic activity of a preparation and the per cent increase in hyperchromicity at 260 nm of a ribonuclease-hydrolyzed portion. Final concentrations of sodium dodecyl sulfate higher than 0.25% when used for the preparation of the ribosomal fractions and RNA resulted in significantly lower immune responses and greater variation between experiments. This was not related to the amount of protein present. The stability of the ribosomal and RNA preparations was tested under a variety of conditions. The need for a good protective adjuvant again was shown since mouse serum readily hydrolyzed the RNA. Equal immunity was obtained after immunization by the intraperitoneal and subcutaneous routes; however, no immune response was obtained when the intravenous route was used. Preliminary results with RNA prepared with phenol showed that it was more easily degraded during preparation. This resulted in a lower immune response than was obtained with the RNA prepared with ethyl alcohol. PMID:4979447

  7. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.


    Stark, B C; Chooi, W Y


    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  8. A general procedure for the production of antibody reagents against eukaryotic ribosomal proteins.


    Dieci, Giorgio; Bottarelli, Lorena; Ottonello, Simone


    Despite recent progress in the structural and functional analysis of bacterial and archaeal ribosomes, the structure and biogenesis of eukaryotic ribosomes still awaits a detailed characterization. Ribosomal protein-specific antibodies would be valuable tools for such studies, but their production is commonly hindered by the poor expression and solubility of eukaryotic ribosomal proteins in E. coli. We report here an improved general procedure for the over-production of recombinant eukaryotic ribosomal proteins and for the generation of the corresponding polyclonal antibodies. The specificity and sensitivity of detection of the antibodies produced by this procedure are documented.

  9. Ribosomal protein L4 is a novel regulator of the MDM2-p53 loop

    PubMed Central

    He, Xia; Li, Yuhuang; Dai, Mu-Shui; Sun, Xiao-Xin


    A number of ribosomal proteins (RPs) have been shown to play a critical role in coordinating ribosome biogenesis with cell growth and proliferation by suppressing MDM2 to induce p53 activation. While how the MDM2-p53 pathway is regulated by multiple RPs is unclear, it remains to be interesting to identify additional RPs that can regulate this pathway. Here we report that ribosomal protein L4 (RPL4) directly interacts with MDM2 at the central acidic domain and suppresses MDM2-mediated p53 ubiquitination and degradation, leading to p53 stabilization and activation. Interestingly, overexpression of RPL4 promotes the binding of MDM2 to RPL5 and RPL11 and forms a complex with RPL5, RPL11 and MDM2 in cells. Conversely, knockdown of RPL4 also induces p53 levels and p53-dependent cell cycle arrest. This p53-dependent effect requires both RPL5 and RPL11, suggesting that depletion of RPL4 triggers ribosomal stress. Together, our results reveal that balanced levels of RPL4 are critical for normal cell growth and proliferation via regulating the MDM2-p53 loop. PMID:26908445

  10. Vaccination with the Leishmania infantum Acidic Ribosomal P0 Protein plus CpG Oligodeoxynucleotides Induces Protection against Cutaneous Leishmaniasis in C57BL/6 Mice but Does Not Prevent Progressive Disease in BALB/c Mice

    PubMed Central

    Iborra, Salvador; Carrión, Javier; Anderson, Charles; Alonso, Carlos; Sacks, David; Soto, Manuel


    We have examined the efficacy of the administration in mice of a molecularly defined vaccine based on the Leishmania infantum acidic ribosomal protein P0 (rLiP0). Two different challenge models of murine cutaneous leishmaniasis were used: (i) subcutaneous inoculation of L. major parasites in susceptible BALB/c mice (a model widely used for vaccination analysis) and (ii) the intradermal inoculation of a low infective dose in resistant C57BL/6 mice (a model that more accurately reproduces the L. major infection in natural reservoirs and in human hosts). First, we demonstrated that C57BL/6 mice vaccinated with LiP0-DNA or rLiP0 protein plus CpG oligodeoxynucleotides (ODN) were protected against the development of dermal pathology and showed a reduction in the parasite load. This protection was associated with production of gamma interferon (IFN-γ) in the dermal site. Secondly, we showed that immunization with rLiP0 plus CpG ODN is able to induce only partial protection in BALB/c, since these mice finally developed a progressive disease. Further, we demonstrated that LiP0 vaccination induces a Th1 immunological response in both strains of mice. In both cases, the antibodies against LiP0 were predominantly of the immunoglobulin G2a isotype, which was correlated with an rLiP0-stimulated production of IFN-γ in draining lymph nodes. Finally, we demonstrated that LiP0 vaccination does not prevent the Th2 response induced by L. major infection in BALB/c mice. Taken together, these data indicate that the BALB/c model of cutaneous leishmaniasis may undervalue the potential efficacy of some vaccines based on defined proteins, making C57BL/6 a suitable alternative model to test vaccine candidates. PMID:16113303

  11. Positive modulation of RNA polymerase III transcription by ribosomal proteins

    SciTech Connect

    Dieci, Giorgio; Carpentieri, Andrea; Amoresano, Angela; Ottonello, Simone


    A yeast nuclear fraction of unknown composition, named TFIIIE, was reported previously to enhance transcription of tRNA and 5S rRNA genes in vitro. We show that TFIIIE activity co-purifies with a specific subset of ribosomal proteins (RPs) which, as revealed by chromatin immunoprecipitation analysis, generally interact with tRNA and 5S rRNA genes, but not with a Pol II-specific promoter. Only Rpl6Ap and Rpl6Bp, among the tested RPs, were found associated to a TATA-containing tRNA{sup Ile}(TAT) gene. The RPL6A gene also emerged as a strong multicopy suppressor of a conditional mutation in the basal transcription factor TFIIIC, while RPL26A and RPL14A behaved as weak suppressors. The data delineate a novel extra-ribosomal role for one or a few RPs which, by influencing 5S rRNA and tRNA synthesis, could play a key role in the coordinate regulation of the different sub-pathways required for ribosome biogenesis and functionality.

  12. Truncation of the Mrp20 protein reveals new ribosome-assembly subcomplex in mitochondria.


    Kaur, Jasvinder; Stuart, Rosemary A


    Mitochondrial ribosomal protein 20 (Mrp20) is a component of the yeast mitochondrial large (54S) ribosomal subunit and is homologous to the bacterial L23 protein, located at the ribosomal tunnel exit site. The carboxy-terminal mitochondrial-specific domain of Mrp20 was found to have a crucial role in the assembly of the ribosomes. A new, membrane-bound, ribosomal-assembly subcomplex composed of known tunnel-exit-site proteins, an uncharacterized ribosomal protein, MrpL25, and the mitochondrial peroxiredoxin (Prx), Prx1, accumulates in an mrp20ΔC yeast mutant. Finally, data supporting the idea that the inner mitochondrial membrane acts as a platform for the ribosome assembly process are discussed.

  13. Co-evolution of Bacterial Ribosomal Protein S15 with Diverse mRNA Regulatory Structures

    PubMed Central

    Slinger, Betty L.; Newman, Hunter; Lee, Younghan; Pei, Shermin; Meyer, Michelle M.


    RNA-protein interactions are critical in many biological processes, yet how such interactions affect the evolution of both partners is still unknown. RNA and protein structures are impacted very differently by mechanisms of genomic change. While most protein families are identifiable at the nucleotide level across large phylogenetic distances, RNA families display far less nucleotide similarity and are often only shared by closely related bacterial species. Ribosomal protein S15 has two RNA binding functions. First, it is a ribosomal protein responsible for organizing the rRNA during ribosome assembly. Second, in many bacterial species S15 also interacts with a structured portion of its own transcript to negatively regulate gene expression. While the first interaction is conserved in most bacteria, the second is not. Four distinct mRNA structures interact with S15 to enable regulation, each of which appears to be independently derived in different groups of bacteria. With the goal of understanding how protein-binding specificity may influence the evolution of such RNA regulatory structures, we examine whether examples of these mRNA structures are able to interact with, and regulate in response to, S15 homologs from organisms containing distinct mRNA structures. We find that despite their shared RNA binding function in the rRNA, S15 homologs have distinct RNA recognition profiles. We present a model to explain the specificity patterns observed, and support this model by with further mutagenesis. After analyzing the patterns of conservation for the S15 protein coding sequences, we also identified amino acid changes that alter the binding specificity of an S15 homolog. In this work we demonstrate that homologous RNA-binding proteins have different specificity profiles, and minor changes to amino acid sequences, or to RNA structural motifs, can have large impacts on RNA-protein recognition. PMID:26675164

  14. Outwitting EF-Tu and the ribosome: translation with d-amino acids

    PubMed Central

    Achenbach, John; Jahnz, Michael; Bethge, Lucas; Paal, Krisztina; Jung, Maria; Schuster, Maja; Albrecht, Renate; Jarosch, Florian; Nierhaus, Knud H.; Klussmann, Sven


    Key components of the translational apparatus, i.e. ribosomes, elongation factor EF-Tu and most aminoacyl-tRNA synthetases, are stereoselective and prevent incorporation of d-amino acids (d-aa) into polypeptides. The rare appearance of d-aa in natural polypeptides arises from post-translational modifications or non-ribosomal synthesis. We introduce an in vitro translation system that enables single incorporation of 17 out of 18 tested d-aa into a polypeptide; incorporation of two or three successive d-aa was also observed in several cases. The system consists of wild-type components and d-aa are introduced via artificially charged, unmodified tRNAGly that was selected according to the rules of ‘thermodynamic compensation’. The results reveal an unexpected plasticity of the ribosomal peptidyltransferase center and thus shed new light on the mechanism of chiral discrimination during translation. Furthermore, ribosomal incorporation of d-aa into polypeptides may greatly expand the armamentarium of in vitro translation towards the identification of peptides and proteins with new properties and functions. PMID:26026160

  15. A mutation in ribosomal protein L9 affects ribosomal hopping during translation of gene 60 from bacteriophage T4.

    PubMed Central

    Herbst, K L; Nichols, L M; Gesteland, R F; Weiss, R B


    Ribosomes hop over a 50-nt coding gap during translation of gene 60 mRNA from bacteriophage T4. This event occurs with near-unitary efficiency when gene 60-lacZ fusions are expressed in Escherichia coli. One of the components necessary for this hop is an RNA hairpin structure containing the 5' junction of the 50-nt coding gap. A mutant E. coli was isolated and found to significantly increase hopping when carrying gene 60-lacZ constructs with altered hairpins. The mutation, hop-1, changed Ser93 to Phe in rplI, the gene coding for ribosomal large-subunit protein L9. Ribosomal hopping on a synthetic sequence in the absence of a hairpin was also increased by this mutation. These data suggest that hop-1 may substitute for the function of the hairpin during ribosomal hopping. Images Fig. 1 Fig. 2 Fig. 4 PMID:7809071

  16. Immunological evidence for structural homology between Drosophila melanogaster (S14), rabbit liver (S12), Saccharomyces cerevisiae (S25), Bacillus subtilis (S6), and Escherichia coli (S6) ribosomal proteins.


    Chooi, W Y; Otaka, E


    Specific antibodies directed against Drosophila melanogaster acidic ribosomal protein S14 were used in a comparative study of eucaryotic and procaryotic ribosomes by immunoblotting and enzyme-linked immunosorbent assays. Common antigenic determinants and, thus, structural homology were found between D. melanogaster, Saccharomyces cerevisiae (S25), rabbit liver (S12), Bacillus subtilis (S6), and Escherichia coli (S6) ribosomes.

  17. Proteins on ribosome surface: Measurements of protein exposure by hot tritium bombardment technique

    PubMed Central

    Agafonov, Dmitry E.; Kolb, Vyacheslav A.; Spirin, Alexander S.


    The hot tritium bombardment technique [Goldanskii, V. I., Kashirin, I. A., Shishkov, A. V., Baratova, L. A. & Grebenshchikov, N. I. (1988) J. Mol. Biol. 201, 567–574] has been applied to measure the exposure of proteins on the ribosomal surface. The technique is based on replacement of hydrogen by high energy tritium atoms in thin surface layer of macromolecules. Quantitation of tritium radioactivity of each protein has revealed that proteins S1, S4, S5, S7, S18, S20, and S21 of the small subunit, and proteins L7/L12, L9, L10, L11, L16, L17, L24, and L27 of the large subunit are well exposed on the surface of the Escherichia coli 70 S ribosome. Proteins S8, S10, S12, S16, S17, L14, L20, L29, L30, L31, L32, L33, and L34 have virtually no groups exposed on the ribosomal surface. The remaining proteins are found to be exposed to lesser degree than the well exposed ones. No additional ribosomal proteins was exposed upon dissociation of ribosomes into subunits, thus indicating the absence of proteins on intersubunit contacting surfaces. PMID:9371771

  18. Interplay between trigger factor and other protein biogenesis factors on the ribosome

    NASA Astrophysics Data System (ADS)

    Bornemann, Thomas; Holtkamp, Wolf; Wintermeyer, Wolfgang


    Nascent proteins emerging from translating ribosomes in bacteria are screened by a number of ribosome-associated protein biogenesis factors, among them the chaperone trigger factor (TF), the signal recognition particle (SRP) that targets ribosomes synthesizing membrane proteins to the membrane and the modifying enzymes, peptide deformylase (PDF) and methionine aminopeptidase (MAP). Here, we examine the interplay between these factors both kinetically and at equilibrium. TF rapidly scans the ribosomes until it is stabilized on ribosomes presenting TF-specific nascent chains. SRP binding to those complexes is strongly impaired. Thus, TF in effect prevents SRP binding to the majority of ribosomes, except those presenting SRP-specific signal sequences, explaining how the small amount of SRP in the cell can be effective in membrane targeting. PDF and MAP do not interfere with TF or SRP binding to translating ribosomes, indicating that nascent-chain processing can take place before or in parallel with TF or SRP binding.

  19. Ribosomal proteins produced in excess are degraded by the ubiquitin-proteasome system.


    Sung, Min-Kyung; Reitsma, Justin M; Sweredoski, Michael J; Hess, Sonja; Deshaies, Raymond J


    Ribosome assembly is an essential process that consumes prodigious quantities of cellular resources. Ribosomal proteins cannot be overproduced in Saccharomyces cerevisiae because the excess proteins are rapidly degraded. However, the responsible quality control (QC) mechanisms remain poorly characterized. Here we demonstrate that overexpression of multiple proteins of the small and large yeast ribosomal subunits is suppressed. Rpl26 overexpressed from a plasmid can be detected in the nucleolus and nucleoplasm, but it largely fails to assemble into ribosomes and is rapidly degraded. However, if the endogenous RPL26 loci are deleted, plasmid-encoded Rpl26 assembles into ribosomes and localizes to the cytosol. Chemical and genetic perturbation studies indicate that overexpressed ribosomal proteins are degraded by the ubiquitin-proteasome system and not by autophagy. Inhibition of the proteasome led to accumulation of multiple endogenous ribosomal proteins in insoluble aggregates, consistent with the operation of this QC mechanism in the absence of ribosomal protein overexpression. Our studies reveal that ribosomal proteins that fail to assemble into ribosomes are rapidly distinguished from their assembled counterparts and ubiquitinated and degraded within the nuclear compartment. PMID:27385339

  20. Localization of eukaryote-specific ribosomal proteins in a 5.5-Å cryo-EM map of the 80S eukaryotic ribosome

    PubMed Central

    Armache, Jean-Paul; Jarasch, Alexander; Anger, Andreas M.; Villa, Elizabeth; Becker, Thomas; Bhushan, Shashi; Jossinet, Fabrice; Habeck, Michael; Dindar, Gülcin; Franckenberg, Sibylle; Marquez, Viter; Mielke, Thorsten; Thomm, Michael; Berninghausen, Otto; Beatrix, Birgitta; Söding, Johannes; Westhof, Eric; Wilson, Daniel N.; Beckmann, Roland


    Protein synthesis in all living organisms occurs on ribonucleoprotein particles, called ribosomes. Despite the universality of this process, eukaryotic ribosomes are significantly larger in size than their bacterial counterparts due in part to the presence of 80 r proteins rather than 54 in bacteria. Using cryoelectron microscopy reconstructions of a translating plant (Triticum aestivum) 80S ribosome at 5.5-Å resolution, together with a 6.1-Å map of a translating Saccharomyces cerevisiae 80S ribosome, we have localized and modeled 74/80 (92.5%) of the ribosomal proteins, encompassing 12 archaeal/eukaryote-specific small subunit proteins as well as the complete complement of the ribosomal proteins of the eukaryotic large subunit. Near-complete atomic models of the 80S ribosome provide insights into the structure, function, and evolution of the eukaryotic translational apparatus. PMID:20974910

  1. Ribosomal Protein S3: A Multifunctional Target of Attaching/Effacing Bacterial Pathogens

    PubMed Central

    Gao, Xiaofei; Hardwidge, Philip R.


    The extraribosomal functions of ribosomal proteins have drawn significant recent attention. Ribosomal protein S3 (RPS3), a component of the eukaryotic 40S ribosomal subunit, is a multifunctional protein that regulates DNA repair, apoptosis, and the innate immune response to bacterial infection. Here we the review the latest findings about RPS3 extraribosomal functions, with special emphasis on their relation to microbial pathogenesis and enteropathogenic Escherichia coli. PMID:21738525

  2. The extended loops of ribosomal proteins uL4 and uL22 of Escherichia coli contribute to ribosome assembly and protein translation

    PubMed Central

    Lawrence, Marlon G.; Shamsuzzaman, Md; Kondopaka, Maithri; Pascual, Clarence; Zengel, Janice M.; Lindahl, Lasse


    Nearly half of ribosomal proteins are composed of a domain on the ribosome surface and a loop or extension that penetrates into the organelle's RNA core. Our previous work showed that ribosomes lacking the loops of ribosomal proteins uL4 or uL22 are still capable of entering polysomes. However, in those experiments we could not address the formation of mutant ribosomes, because we used strains that also expressed wild-type uL4 and uL22. Here, we have focused on ribosome assembly and function in strains in which loop deletion mutant genes are the only sources of uL4 or uL22 protein. The uL4 and uL22 loop deletions have different effects, but both mutations result in accumulation of immature particles that do not accumulate in detectable amounts in wild-type strains. Thus, our results suggest that deleting the loops creates kinetic barriers in the normal assembly pathway, possibly resulting in assembly via alternate pathway(s). Furthermore, deletion of the uL4 loop results in cold-sensitive ribosome assembly and function. Finally, ribosomes carrying either of the loop-deleted proteins responded normally to the secM translation pausing peptide, but the uL4 mutant responded very inefficiently to the cmlAcrb pause peptide. PMID:27257065

  3. Efficient reconstitution of functional Escherichia coli 30S ribosomal subunits from a complete set of recombinant small subunit ribosomal proteins.


    Culver, G M; Noller, H F


    Previous studies have shown that the 30S ribosomal subunit of Escherichia coli can be reconstituted in vitro from individually purified ribosomal proteins and 16S ribosomal RNA, which were isolated from natural 30S subunits. We have developed a 30S subunit reconstitution system that uses only recombinant ribosomal protein components. The genes encoding E. coli ribosomal proteins S2-S21 were cloned, and all twenty of the individual proteins were overexpressed and purified. Reconstitution, following standard procedures, using the complete set of recombinant proteins and purified 16S ribosomal RNA is highly inefficient. Efficient reconstitution of 30S subunits using these components requires sequential addition of proteins, following either the 30S subunit assembly map (Mizushima & Nomura, 1970, Nature 226:1214-1218; Held et al., 1974, J Biol Chem 249:3103-3111) or following the order of protein assembly predicted from in vitro assembly kinetics (Powers et al., 1993, J MoI Biol 232:362-374). In the first procedure, the proteins were divided into three groups, Group I (S4, S7, S8, S15, S17, and S20), Group II (S5, S6, S9, Sll, S12, S13, S16, S18, and S19), and Group III (S2, S3, S10, S14, and S21), which were sequentially added to 16S rRNA with a 20 min incubation at 42 degrees C following the addition of each group. In the second procedure, the proteins were divided into Group I (S4, S6, S11, S15, S16, S17, S18, and S20), Group II (S7, S8, S9, S13, and S19), Group II' (S5 and S12) and Group III (S2, S3, S10, S14, and S21). Similarly efficient reconstitution is observed whether the proteins are grouped according to the assembly map or according to the results of in vitro 30S subunit assembly kinetics. Although reconstitution of 30S subunits using the recombinant proteins is slightly less efficient than reconstitution using a mixture of total proteins isolated from 30S subunits, it is much more efficient than reconstitution using proteins that were individually isolated

  4. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.


    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M


    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  5. Ribosome-inactivating proteins: from plant defense to tumor attack.


    de Virgilio, Maddalena; Lombardi, Alessio; Caliandro, Rocco; Fabbrini, Maria Serena


    Ribosome-inactivating proteins (RIPs) are EC3.2.32.22 N-glycosidases that recognize a universally conserved stem-loop structure in 23S/25S/28S rRNA, depurinating a single adenine (A4324 in rat) and irreversibly blocking protein translation, leading finally to cell death of intoxicated mammalian cells. Ricin, the plant RIP prototype that comprises a catalytic A subunit linked to a galactose-binding lectin B subunit to allow cell surface binding and toxin entry in most mammalian cells, shows a potency in the picomolar range. The most promising way to exploit plant RIPs as weapons against cancer cells is either by designing molecules in which the toxic domains are linked to selective tumor targeting domains or directly delivered as suicide genes for cancer gene therapy. Here, we will provide a comprehensive picture of plant RIPs and discuss successful designs and features of chimeric molecules having therapeutic potential. PMID:22069572

  6. Identification of an unconventional nuclear localization signal in human ribosomal protein S2

    SciTech Connect

    Antoine, M.; Reimers, K.; Wirz, W.; Gressner, A.M.; Mueller, R.; Kiefer, P. . E-Mail:


    Ribosomal proteins must be imported into the nucleus after being synthesized in the cytoplasm. Since the rpS2 amino acid sequence does not contain a typical nuclear localization signal, we used deletion mutant analysis and rpS2-{beta}-galactosidase chimeric proteins to identify the nuclear targeting domains in rpS2. Nuclear rpS2 is strictly localized in the nucleoplasm and is not targeted to the nucleoli. Subcellular localization analysis of deletion mutants of rpS2-{beta}-galactosidase chimeras identified a central domain comprising 72 amino acids which is necessary and sufficient to target the chimeric {beta}-galactosidase to the nucleus. The nuclear targeting domain shares no significant similarity to already characterized nuclear localization signals in ribosomal proteins or other nuclear proteins. Although a Nup153 fragment containing the importin{beta} binding site fused to VP22 blocks nuclear import of rpS2-{beta}-galactosidase fusion proteins, nuclear uptake of rpS2 could be mediated by several import receptors since it binds to importin{alpha}/{beta} and transportin.

  7. Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

    SciTech Connect

    Nishimura, Mitsuhiro; Kaminishi, Tatsuya; Kawazoe, Masahito; Shirouzu, Mikako; Takemoto, Chie; Yokoyama, Shigeyuki; Tanaka, Akiko; Sugano, Sumio; Yoshida, Takuya; Ohkubo, Tadayasu; Kobayashi, Yuji


    A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to space group P3{sub 1}21 or P3{sub 2}21.

  8. Ribosomal protein gene mapping and human chromosomal disorders

    SciTech Connect

    Kenmochi, N.; Goodman, N.; Page, D.C.


    In Drosophila, the Minute phenotype (reduced body size, diminished viability and fertility, and short, thin bristles) results from heterozygous deficiencies (deletions) at any one of 50 loci scattered about the genome. A handful of these Minute loci have been molecularly characterized, and all have been found to encode ribosomal proteins. Thus, the Minute phenotype appears to result from reduced protein synthetic capacity in flies with one rather than two copies of a given ribosomal protein (rp) gene. We are pursuing the possibility that similar reductions in protein synthetic capacity--again resulting from rp gene deficiencies--might underlie phenotypes associated with certain chromosomal disorders in humans. We and our colleagues have reported findings consistent with a role for RPS4 deficiency in the etiology of certain features of Turner syndrome, a complex human disorder classically associated with an XO karyotype. We are intrigued by the possibility that deficiencies of other human rp genes might cause phenotypic abnormalities similar to those seen in Turner syndrome--just as deficiencies of any of a number of Drosophila rp genes cause the Minute phenotype. We must first learn the chromosomal map position of each of the estimated 83 human rp genes. The task of mapping the functional (intron-containing) rp genes is complicated by the existence of processed pseudogenes elsewhere in the genome. To date, we have assigned (or confirmed the previous assignment of) 38 rp genes to individual human chromosomes by PCR analysis of human-rodent somatic cell hybrids containing subsets of human chromosomes, with all but four chromosomes carrying at least one rp gene. We have also identified more than 100 large-insert human YAC (yeast artificial chromosome) clones that contain individual rp genes. Such screening of YAC libraries will result in precise positioning of the rp genes on the emerging physical map of the human genome.

  9. Characterization and analysis of ribosomal proteins in two marine calanoid copepods

    NASA Astrophysics Data System (ADS)

    Yang, Feifei; Xu, Donghui; Zhuang, Yunyun; Huang, Yousong; Yi, Xiaoyan; Chen, Hongju; Liu, Guangxing; Zhang, Huan


    Copepods are among the most abundant and successful metazoans in the marine ecosystem. However, genomic resources related to fundamental cellular processes are still limited in this particular group of crustaceans. Ribosomal proteins are the building blocks of ribosomes, the primary site for protein synthesis. In this study, we characterized and analyzed the cDNAs of cytoplasmic ribosomal proteins (cRPs) of two calanoid copepods, Pseudodiaptomus poplesia and Acartia pacifica. We obtained 79 cRP cDNAs from P. poplesia and 67 from A. pacifica by cDNA library construction/sequencing and rapid amplification of cDNA ends. Analysis of the nucleic acid composition showed that the copepod cRP-encoding genes had higher GC content in the protein-coding regions (CDSs) than in the untranslated regions (UTRs), and single nucleotide repeats (>3 repeats) were common, with "A" repeats being the most frequent, especially in the CDSs. The 3'-UTRs of the cRP genes were significantly longer than the 5'-UTRs. Codon usage analysis showed that the third positions of the codons were dominated by C or G. The deduced amino acid sequences of the cRPs contained high proportions of positively charged residues and had high pI values. This is the first report of a complete set of cRP-encoding genes from copepods. Our results shed light on the characteristics of cRPs in copepods, and provide fundamental data for further studies of protein synthesis in copepods. The copepod cRP information revealed in this study indicates that additional comparisons and analysis should be performed on different taxonomic categories such as orders and families.

  10. Characterization and analysis of ribosomal proteins in two marine calanoid copepods

    NASA Astrophysics Data System (ADS)

    Yang, Feifei; Xu, Donghui; Zhuang, Yunyun; Huang, Yousong; Yi, Xiaoyan; Chen, Hongju; Liu, Guangxing; Zhang, Huan


    Copepods are among the most abundant and successful metazoans in the marine ecosystem. However, genomic resources related to fundamental cellular processes are still limited in this particular group of crustaceans. Ribosomal proteins are the building blocks of ribosomes, the primary site for protein synthesis. In this study, we characterized and analyzed the cDNAs of cytoplasmic ribosomal proteins (cRPs) of two calanoid copepods, Pseudodiaptomus poplesia and Acartia pacifica. We obtained 79 cRP cDNAs from P. poplesia and 67 from A. pacifica by cDNA library construction/sequencing and rapid amplification of cDNA ends. Analysis of the nucleic acid composition showed that the copepod cRP-encoding genes had higher GC content in the protein-coding regions (CDSs) than in the untranslated regions (UTRs), and single nucleotide repeats (>3 repeats) were common, with "A" repeats being the most frequent, especially in the CDSs. The 3'-UTRs of the cRP genes were significantly longer than the 5'-UTRs. Codon usage analysis showed that the third positions of the codons were dominated by C or G. The deduced amino acid sequences of the cRPs contained high proportions of positively charged residues and had high pI values. This is the first report of a complete set of cRP-encoding genes from copepods. Our results shed light on the characteristics of cRPs in copepods, and provide fundamental data for further studies of protein synthesis in copepods. The copepod cRP information revealed in this study indicates that additional comparisons and analysis should be performed on different taxonomic categories such as orders and families.

  11. Ribosome-mediated incorporation of a non-standard amino acid into a peptide through expansion of the genetic code.


    Bain, J D; Switzer, C; Chamberlin, A R; Benner, S A


    One serious limitation facing protein engineers is the availability of only 20 'proteinogenic' amino acids encoded by natural messenger RNA. The lack of structural diversity among these amino acids restricts the mechanistic and structural issues that can be addressed by site-directed mutagenesis. Here we describe a new technology for incorporating non-standard amino acids into polypeptides by ribosome-based translation. In this technology, the genetic code is expanded through the creation of a 65th codon-anticodon pair from unnatural nucleoside bases having non-standard hydrogen-bonding patterns. This new codon-anticodon pair efficiently supports translation in vitro to yield peptides containing a non-standard amino acid. The versatility of the ribosome as a synthetic tool offers new possibilities for protein engineering, and compares favourably with another recently described approach in which the genetic code is simply rearranged to recruit stop codons to play a coding role. PMID:1560827

  12. Assembly of the 30S ribosomal subunit: positioning ribosomal protein S13 in the S7 assembly branch.


    Grondek, Joel F; Culver, Gloria M


    Studies of Escherichia coli 30S ribosomal subunit assembly have revealed a hierarchical and cooperative association of ribosomal proteins with 16S ribosomal RNA; these results have been used to compile an in vitro 30S subunit assembly map. In single protein addition and omission studies, ribosomal protein S13 was shown to be dependent on the prior association of ribosomal protein S20 for binding to the ribonucleoprotein particle. While the overwhelming majority of interactions revealed in the assembly map are consistent with additional data, the dependency of S13 on S20 is not. Structural studies position S13 in the head of the 30S subunit > 100 A away from S20, which resides near the bottom of the body of the 30S subunit. All of the proteins that reside in the head of the 30S subunit, except S13, have been shown to be part of the S7 assembly branch, that is, they all depend on S7 for association with the assembling 30S subunit. Given these observations, the assembly requirements for S13 were investigated using base-specific chemical footprinting and primer extension analysis. These studies reveal that S13 can bind to 16S rRNA in the presence of S7, but not S20. Additionally, interaction between S13 and other members of the S7 assembly branch have been observed. These results link S13 to the 3' major domain family of proteins, and the S7 assembly branch, placing S13 in a new location in the 30S subunit assembly map where its position is in accordance with much biochemical and structural data.

  13. Nucleotide sequence of a Dictyostelium discoideum gene encoding a protein homologous to the yeast ribosomal protein S31.


    Hoja, U; Hofmann, J; Marschalek, R; Dingermann, T


    A cDNA clone has been isolated whose coding potential is significantly homologous to the yeast ribosomal protein S31. The single copy genomic gene contains a 271 bp intron immediately downstream from the ATG translation initiation codon and is flanked by cannonical exon/intron junctions. The intron carries a CAATCAAT motif which has been described as inducer element for discoidin I gamma expression and which has also been found within the intron of the rp29 gene form D. discoideum. The deduced protein contains 110 amino acids and is slightly basic. PMID:7916591

  14. Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues. [Zea mays

    SciTech Connect

    Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.


    The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of ({sup 32}P) ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of {sup 32}P incorporation and the electrophoretic patterns were dependent on {sup 32}P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K{sub m} values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins.

  15. Isolation and characterization of ribosome-inactivating proteins from Cucurbitaceae.


    Zhang, Daoning; Halaweish, Fathi T


    Due to their RNA-N-glycosidase activity, ribosome-inactivating proteins (RIPs) are attractive candidates as antitumor and antiviral agents in biomedical and agricultural research. We have isolated and characterized two such proteins, foetidissimin II and texanin, from two Cucurbitaceae species. Foetidissimin II, obtained from the roots of Cucurbita foetidissima, was identified as a type-2 RIP, with a molecular weight of 61 kDa, as estimated by gel electrophoresis. It is composed of two chains, a 29-kDa chain A, and a 32-kDa chain B. Texanin, isolated from the fruits of Cucurbita texana, is a type-I RIP, with a single chain of molecular weight 29.7 kDa, as estimated by MALDI-TOF-MS. Both proteins exhibit RNA-N-glycosidase activity, with aniline playing a critical role in rRNA cleavage. The IC50 value of foetidissimin II, determined by cell-free protein-synthesis inhibition, was 0.251 muM. In an in vitro cytotoxicity assay, foetidissimin II exhibited IC50 values of ca. 70 nM to both adenocarcinoma and erythroleukemia cells. Texanin exhibited a weaker anticancer activity against erythroleukemia cells, with an IC50 value of 95 microM, but no activity against adenocarcinoma cells. The N-terminal sequences of both proteins were compared with those of reported RIPs.

  16. Reduction in Ribosomal Protein Synthesis Is Sufficient To Explain Major Effects on Ribosome Production after Short-Term TOR Inactivation in Saccharomyces cerevisiae▿

    PubMed Central

    Reiter, Alarich; Steinbauer, Robert; Philippi, Anja; Gerber, Jochen; Tschochner, Herbert; Milkereit, Philipp; Griesenbeck, Joachim


    Ribosome synthesis depends on nutrient availability, sensed by the target of rapamycin (TOR) signaling pathway in eukaryotes. TOR inactivation affects ribosome biogenesis at the level of rRNA gene transcription, expression of ribosomal proteins (r-proteins) and biogenesis factors, preribosome processing, and transport. Here, we demonstrate that upon TOR inactivation, levels of newly synthesized ribosomal subunits drop drastically before the integrity of the RNA polymerase I apparatus is severely impaired but in good correlation with a sharp decrease in r-protein production. Inhibition of translation by cycloheximide mimics the rRNA maturation defect observed immediately after TOR inactivation. Both cycloheximide addition and the depletion of individual r-proteins also reproduce TOR-dependent nucleolar entrapment of specific ribosomal precursor complexes. We suggest that shortage of newly synthesized r-proteins after short-term TOR inactivation is sufficient to explain most of the observed effects on ribosome production. PMID:21149576

  17. Protection of rat liver 80 S ribosomes against ricin A chain inactivation by proteins extracted from rat liver and wheat germ ribosomal subunits with ammonium chloride/magnesium chloride.


    Chang, M S; Houston, L L


    Proteins extracted from wheat germ 60 S ribosomal subunits and rat liver 60 S and 40 S ribosomal subunits with 3 M NH4Cl/75 mM MgCl2 were able to prevent the ricin A chain-mediated inactivation of untreated 80 S rat liver ribosomes. The protection of polyphenylalanine synthetic capability of 80 S ribosomes was saturable and reached 100% protection in the presence of about 20 micrograms of extracted protein using a uniform set of assay conditions. No protection was observed using proteins extracted from wheat germ 40 S subunits or the core fraction of rat liver 60 S subunits or protein extracted from Escherichia coli ribosomes or ribosomal subunits. The conclusion that the protective effect of extracted 60 S subunit proteins was specific, was further strengthened by showing that unrelated proteins such as alpha-lactalbumin, bovine serum albumin and lysozyme, and polypeptides such as polylysine and poly(aspartic acid), also showed no protection. If 80 S ribosomes were first treated with ricin A chain and then incubated with proteins extracted from rat liver 60 S subunits, no protection was observed. Proteins extracted with NH4Cl/MgCl2 from 60 S rat liver subunits were applied to carboxymethylcellulose column equilibrated with 6 M urea. Stepwise elution with increasing concentrations of LiCl resulted in seven fractions. One fraction (D) contained most of the protective factor; one fraction (E) contained a lesser amount of the protective factor. Two-dimensional polyacrylamide gel electrophoresis of fraction D showed the presence of ten proteins. These data are consistent with the idea that the enzymatic target of ricin A chain is protein is nature and that fraction D contains one or more proteins that appear to act as a inhibitor against ricin A chain.

  18. Autogenous Regulation of Splicing of the Transcript of a Yeast Ribosomal Protein Gene

    NASA Astrophysics Data System (ADS)

    Dabeva, Mariana D.; Post-Beittenmiller, Martha A.; Warner, Jonathan R.


    The gene for a yeast ribosomal protein, RPL32, contains a single intron. The product of this gene appears to participate in feedback control of the splicing of the intron from the transcript. This autogenous regulation of splicing provides a striking analogy to the autogenous regulation of translation of ribosomal proteins in Escherichia coli.

  19. A new nomenclature for the cytoplasmic ribosomal proteins of Saccharomyces cerevisiae.

    PubMed Central

    Mager, W H; Planta, R J; Ballesta, J G; Lee, J C; Mizuta, K; Suzuki, K; Warner, J R; Woolford, J


    The availability of the complete sequence of the Saccharomyces cerevisiae genome has allowed a comprehensive analysis of the genes encoding cytoplasmic ribosomal proteins in this organism. On the basis of this complete inventory a new nomenclature for the yeast ribosomal proteins is presented. PMID:9396790

  20. Ubiquitin and ubiquitin-like proteins in the nucleolus: multitasking tools for a ribosome factory.


    Shcherbik, Natalia; Pestov, Dimitri G


    Synthesis of new ribosomes is an essential process upregulated during cell growth and proliferation. Here, we review our current understanding of the role that ubiquitin and ubiquitin-like proteins (UBLs) play in ribosome biogenesis, with a focus on mammalian cells. One important function of the nuclear ubiquitin-proteasome system is to control the supply of ribosomal proteins for the assembly of new ribosomal subunits in the nucleolus. Mutations in ribosomal proteins or ribosome assembly factors, stress, and many anticancer drugs have been shown to disrupt normal ribosome biogenesis, triggering a p53-dependent response. We discuss how p53 can be activated by the aberrant ribosome formation, centering on the current models of the interaction between ribosomal proteins released from the nucleolus and the ubiquitin ligase Mdm2. Recent studies also revealed multiple ubiquitin- and UBL-conjugated forms of nucleolar proteins with largely unknown functions, indicating that many new details about the role of these modifications in the nucleolus await to be discovered.

  1. Cross-species conservation of complementary amino acid-ribonucleobase interactions and their potential for ribosome-free encoding

    PubMed Central

    Cannon, John G. D.; Sherman, Rachel M.; Wang, Victoria M. Y.; Newman, Grace A.


    The role of amino acid-RNA nucleobase interactions in the evolution of RNA translation and protein-mRNA autoregulation remains an open area of research. We describe the inference of pairwise amino acid-RNA nucleobase interaction preferences using structural data from known RNA-protein complexes. We observed significant matching between an amino acid’s nucleobase affinity and corresponding codon content in both the standard genetic code and mitochondrial variants. Furthermore, we showed that knowledge of nucleobase preferences allows statistically significant prediction of protein primary sequence from mRNA using purely physiochemical information. Interestingly, ribosomal primary sequences were more accurately predicted than non-ribosomal sequences, suggesting a potential role for direct amino acid-nucleobase interactions in the genesis of amino acid-based ribosomal components. Finally, we observed matching between amino acid-nucleobase affinities and corresponding mRNA sequences in 35 evolutionarily diverse proteomes. We believe these results have important implications for the study of the evolutionary origins of the genetic code and protein-mRNA cross-regulation. PMID:26656258

  2. Nucleotide sequence of cDNA coding for dianthin 30, a ribosome inactivating protein from Dianthus caryophyllus.


    Legname, G; Bellosta, P; Gromo, G; Modena, D; Keen, J N; Roberts, L M; Lord, J M


    Rabbit antibodies raised against dianthin 30, a ribosome inactivating protein from carnation (Dianthus caryophyllus) leaves, were used to identify a full length dianthin precursor cDNA clone from a lambda gt11 expression library. N-terminal amino acid sequencing of purified dianthin 30 and dianthin 32 confirmed that the clone encoded dianthin 30. The cDNA was 1153 basepairs in length and encoded a precursor protein of 293 amino acid residues. The first 23 N-terminal amino acids of the precursor represented the signal sequence. The protein contained a carboxy-terminal region which, by analogy with barley lectin, may contain a vacuolar targeting signal.

  3. Ribosomal Protein Gene Knockdown Causes Developmental Defects in Zebrafish

    PubMed Central

    Uechi, Tamayo; Nakajima, Yukari; Nakao, Akihiro; Torihara, Hidetsugu; Chakraborty, Anirban; Inoue, Kunio; Kenmochi, Naoya


    The ribosomal proteins (RPs) form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases. PMID:17183665

  4. The primary structure of the ribosomal A-protein (L12) from the moderate halophile NRCC 41227.


    Falkenberg, P; Yaguchi, M; Roy, C; Zuker, M; Matheson, A T


    The complete amino acid sequence of the ribosomal A-protein (equivalent to L7/L12 in Escherichia coli) from a moderate halophile, NRCC 41227, has been determined using an automatic Beckman sequencer and by the manual Edman cleavage of peptides obtained from selective proteolytic cleavage of the ribosomal A-protein. The protein contains 122 amino acids and has a composition of Asp5, Asn2, Thr6, Ser6, Glu21, Gln2, Pro2, Gly12, Ala21, Val14, Met4, Ile4, Leu9, Phe2, Lys11, and Arg1, and a molecular weight of 12 537. It has a net negative charge of -14 and is, therefore, slightly more acidic than other eubacterial ribosomal A-proteins. The phylogenetic tree, obtained by computer analysis of the amino acid sequence of this and other eubacterial A-proteins, indicate these proteins form five subgroups within the eubacterial kingdom. The moderate halophile NRCC 41227 is part of a group of Gram-negative bacteria that include E. coli and another moderate halophile Vibrio costicola. The sequence data provides further evidence that the moderate and extreme halophiles have evolved by separate pathways.

  5. Secondary structures of proteins from the 30S subunit of the Escherichia coli ribosome.


    Dzionara, M; Robinson, S M; Wittmann-Liebold, B


    The secondary structures of the proteins S4, S6, S8, S9, S12, S13, S15, S16, S18, S20 and S21 from the subunit of the E. coli ribosome were predicted according to four different methods. From the resultant diagrams indicating regions of helix, turn, extended structure and random coil, average values for the respective secondary structures could be calculated for each protein. Using the known relative distances for residues in the helical, turn and sheet or allowed random conformations, estimates are made of the maximum possible lengths of the proteins in order to correlate these with results obtained from antibody binding studies to the 30S subunit as determined by electron microscopy. The influence of amino acid changes on the predicted secondary structures of proteins from a few selected mutants was studied. The altered residues tend to be structurally conservative or to induce only minimal local changes.

  6. Identification of methylated proteins in the yeast small ribosomal subunit: a role for SPOUT methyltransferases in protein arginine methylation.


    Young, Brian D; Weiss, David I; Zurita-Lopez, Cecilia I; Webb, Kristofor J; Clarke, Steven G; McBride, Anne E


    We have characterized the posttranslational methylation of Rps2, Rps3, and Rps27a, three small ribosomal subunit proteins in the yeast Saccharomyces cerevisiae, using mass spectrometry and amino acid analysis. We found that Rps2 is substoichiometrically modified at arginine-10 by the Rmt1 methyltransferase. We demonstrated that Rps3 is stoichiometrically modified by ω-monomethylation at arginine-146 by mass spectrometric and site-directed mutagenic analyses. Substitution of alanine for arginine at position 146 is associated with slow cell growth, suggesting that the amino acid identity at this site may influence ribosomal function and/or biogenesis. Analysis of the three-dimensional structure of Rps3 in S. cerevisiae shows that arginine-146 makes contacts with the small subunit rRNA. Screening of deletion mutants encoding potential yeast methyltransferases revealed that the loss of the YOR021C gene results in the absence of methylation of Rps3. We demonstrated that recombinant Yor021c catalyzes ω-monomethylarginine formation when incubated with S-adenosylmethionine and hypomethylated ribosomes prepared from a YOR021C deletion strain. Interestingly, Yor021c belongs to the family of SPOUT methyltransferases that, to date, have only been shown to modify RNA substrates. Our findings suggest a wider role for SPOUT methyltransferases in nature. Finally, we have demonstrated the presence of a stoichiometrically methylated cysteine residue at position 39 of Rps27a in a zinc-cysteine cluster. The discovery of these three novel sites of protein modification within the small ribosomal subunit will now allow for an analysis of their functional roles in translation and possibly other cellular processes.

  7. A ribosome-inactivating protein in a Drosophila defensive symbiont.


    Hamilton, Phineas T; Peng, Fangni; Boulanger, Martin J; Perlman, Steve J


    Vertically transmitted symbionts that protect their hosts against parasites and pathogens are well known from insects, yet the underlying mechanisms of symbiont-mediated defense are largely unclear. A striking example of an ecologically important defensive symbiosis involves the woodland fly Drosophila neotestacea, which is protected by the bacterial endosymbiont Spiroplasma when parasitized by the nematode Howardula aoronymphium. The benefit of this defense strategy has led to the rapid spread of Spiroplasma throughout the range of D. neotestacea, although the molecular basis for this protection has been unresolved. Here, we show that Spiroplasma encodes a ribosome-inactivating protein (RIP) related to Shiga-like toxins from enterohemorrhagic Escherichia coli and that Howardula ribosomal RNA (rRNA) is depurinated during Spiroplasma-mediated protection of D. neotestacea. First, we show that recombinant Spiroplasma RIP catalyzes depurination of 28S rRNAs in a cell-free assay, as well as Howardula rRNA in vitro at the canonical RIP target site within the α-sarcin/ricin loop (SRL) of 28S rRNA. We then show that Howardula parasites in Spiroplasma-infected flies show a strong signal of rRNA depurination consistent with RIP-dependent modification and large decreases in the proportion of 28S rRNA intact at the α-sarcin/ricin loop. Notably, host 28S rRNA is largely unaffected, suggesting targeted specificity. Collectively, our study identifies a novel RIP in an insect defensive symbiont and suggests an underlying RIP-dependent mechanism in Spiroplasma-mediated defense. PMID:26712000

  8. A ribosome-inactivating protein in a Drosophila defensive symbiont

    PubMed Central

    Hamilton, Phineas T.; Peng, Fangni; Boulanger, Martin J.; Perlman, Steve J.


    Vertically transmitted symbionts that protect their hosts against parasites and pathogens are well known from insects, yet the underlying mechanisms of symbiont-mediated defense are largely unclear. A striking example of an ecologically important defensive symbiosis involves the woodland fly Drosophila neotestacea, which is protected by the bacterial endosymbiont Spiroplasma when parasitized by the nematode Howardula aoronymphium. The benefit of this defense strategy has led to the rapid spread of Spiroplasma throughout the range of D. neotestacea, although the molecular basis for this protection has been unresolved. Here, we show that Spiroplasma encodes a ribosome-inactivating protein (RIP) related to Shiga-like toxins from enterohemorrhagic Escherichia coli and that Howardula ribosomal RNA (rRNA) is depurinated during Spiroplasma-mediated protection of D. neotestacea. First, we show that recombinant Spiroplasma RIP catalyzes depurination of 28S rRNAs in a cell-free assay, as well as Howardula rRNA in vitro at the canonical RIP target site within the α-sarcin/ricin loop (SRL) of 28S rRNA. We then show that Howardula parasites in Spiroplasma-infected flies show a strong signal of rRNA depurination consistent with RIP-dependent modification and large decreases in the proportion of 28S rRNA intact at the α-sarcin/ricin loop. Notably, host 28S rRNA is largely unaffected, suggesting targeted specificity. Collectively, our study identifies a novel RIP in an insect defensive symbiont and suggests an underlying RIP-dependent mechanism in Spiroplasma-mediated defense. PMID:26712000

  9. Ribosomal protein L7a is encoded by a gene (Surf-3) within the tightly clustered mouse surfeit locus.

    PubMed Central

    Giallongo, A; Yon, J; Fried, M


    The mouse Surfeit locus, which contains a cluster of at least four genes (Surf-1 to Surf-4), is unusual in that adjacent genes are separated by no more than 73 base pairs (bp). The heterogeneous 5' ends of Surf-1 and Surf-2 are separated by only 15 to 73 bp, the 3' ends of Surf-1 and Surf-3 are only 70 bp apart, and the 3' ends of Surf-2 and Surf-4 overlap by 133 bp. This very tight clustering suggests a cis interaction between adjacent Surfeit genes. The Surf-3 gene (which could code for a basic polypeptide of 266 amino acids) is a highly expressed member of a pseudogene-containing multigene family. By use of an anti-peptide serum (against the C-terminal nine amino acids of the putative Surf-3 protein) for immunofluorescence and immunoblotting of mouse cell components and by in vitro translation of Surf-3 cDNA hybrid-selected mRNA, the Surf-3 gene product was identified as a 32-kilodalton ribosomal protein located in the 60S ribosomal subunit. From its subunit location, gel migration, and homology with a limited rat ribosomal peptide sequence, the Surf-3 gene was shown to encode the mouse L7a ribosomal protein. The Surf-3 gene is highly conserved through evolution and was detected by nucleic acid hybridization as existing in multiple copies (multigene families) in other mammals and as one or a few copies in birds, Xenopus, Drosophila, and Schizosaccharomyces pombe. The Surf-3 C-terminal anti-peptide serum detects a 32-kilodalton protein in other mammals, birds, and Xenopus but not in Drosophila and S. pombe. The possible effect of interaction of the Surf-3 ribosomal protein gene with adjacent genes in the Surfeit locus at the transcriptional or posttranscriptional level or both levels is discussed. Images PMID:2648130

  10. Methylation of yeast ribosomal protein S2 is elevated during stationary phase growth conditions.


    Ladror, Daniel T; Frey, Brian L; Scalf, Mark; Levenstein, Mark E; Artymiuk, Jacklyn M; Smith, Lloyd M


    Ribosomes, as the center of protein translation in the cell, require careful regulation via multiple pathways. While regulation of ribosomal synthesis and function has been widely studied on the transcriptional and translational "levels," the biological roles of ribosomal post-translational modifications (PTMs) are largely not understood. Here, we explore this matter by using quantitative mass spectrometry to compare the prevalence of ribosomal methylation and acetylation for yeast in the log phase and the stationary phase of growth. We find that of the 27 modified peptides identified, two peptides experience statistically significant changes in abundance: a 1.9-fold decrease in methylation for k(Me)VSGFKDEVLETV of ribosomal protein S1B (RPS1B), and a 10-fold increase in dimethylation for r(DiMe)GGFGGR of ribosomal protein S2 (RPS2). While the biological role of RPS1B methylation has largely been unexplored, RPS2 methylation is a modification known to have a role in processing and export of ribosomal RNA. This suggests that yeast in the stationary phase increase methylation of RPS2 in order to regulate ribosomal synthesis. These results demonstrate the utility of mass spectrometry for quantifying dynamic changes in ribosomal PTMs.

  11. Methylation of Yeast Ribosomal Protein S2 is Elevated During Stationary Phase Growth Conditions

    PubMed Central

    Ladror, Daniel T.; Frey, Brian L.; Scalf, Mark; Levenstein, Mark E.; Artymiuk, Jacklyn M.; Smith, Lloyd M.


    Ribosomes, as the center of protein translation in the cell, require careful regulation via multiple pathways. While regulation of ribosomal synthesis and function has been widely studied on the transcriptional and translational “levels,” the biological roles of ribosomal post-translational modifications (PTMs) are largely not understood. Here, we explore this matter by using quantitative mass spectrometry to compare the prevalence of ribosomal methylation and acetylation for yeast in the log phase and the stationary phase of growth. We find that of the 27 modified peptides identified, two peptides experience statistically significant changes in abundance: a 1.9-fold decrease in methylation for k(Me)VSGFKDEVLETV of ribosomal protein S1B (RPS1B), and a 10-fold increase in dimethylation for r(DiMe)GGFGGR of ribosomal protein S2 (RPS2). While the biological role of RPS1B methylation has largely been unexplored, RPS2 methylation is a modification known to have a role in processing and export of ribosomal RNA. This suggests that yeast in the stationary phase increase methylation of RPS2 in order to regulate ribosomal synthesis. These results demonstrate the utility of mass spectrometry for quantifying dynamic changes in ribosomal PTMs. PMID:24486316

  12. What makes ribosome-mediated transcriptional attenuation sensitive to amino acid limitation?


    Elf, Johan; Ehrenberg, Måns


    Ribosome-mediated transcriptional attenuation mechanisms are commonly used to control amino acid biosynthetic operons in bacteria. The mRNA leader of such an operon contains an open reading frame with "regulatory" codons, cognate to the amino acid that is synthesized by the enzymes encoded by the operon. When the amino acid is in short supply, translation of the regulatory codons is slow, which allows transcription to continue into the structural genes of the operon. When amino acid supply is in excess, translation of regulatory codons is rapid, which leads to termination of transcription. We use a discrete master equation approach to formulate a probabilistic model for the positioning of the RNA polymerase and the ribosome in the attenuator leader sequence. The model describes how the current rate of amino acid supply compared to the demand in protein synthesis (signal) determines the expression of the amino acid biosynthetic operon (response). The focus of our analysis is on the sensitivity of operon expression to a change in the amino acid supply. We show that attenuation of transcription can be hyper-sensitive for two main reasons. The first is that its response depends on the outcome of a race between two multi-step mechanisms with synchronized starts: transcription of the leader of the operon, and translation of its regulatory codons. The relative change in the probability that transcription is aborted (attenuated) can therefore be much larger than the relative change in the time it takes for the ribosome to read a regulatory codon. The second is that the general usage frequencies of codons of the type used in attenuation control are small. A small percentage decrease in the rate of supply of the controlled amino acid can therefore lead to a much larger percentage decrease in the rate of reading a regulatory codon. We show that high sensitivity further requires a particular choice of regulatory codon among several synonymous codons for the same amino acid. We

  13. Cardiomyopathy Is Associated with Ribosomal Protein Gene Haplo-Insufficiency in Drosophila melanogaster

    PubMed Central

    Casad, Michelle E.; Abraham, Dennis; Kim, Il-Man; Frangakis, Stephan; Dong, Brian; Lin, Na; Wolf, Matthew J.; Rockman, Howard A.


    The Minute syndrome in Drosophila melanogaster is characterized by delayed development, poor fertility, and short slender bristles. Many Minute loci correspond to disruptions of genes for cytoplasmic ribosomal proteins, and therefore the phenotype has been attributed to alterations in translational processes. Although protein translation is crucial for all cells in an organism, it is unclear why Minute mutations cause effects in specific tissues. To determine whether the heart is sensitive to haplo-insufficiency of genes encoding ribosomal proteins, we measured heart function of Minute mutants using optical coherence tomography. We found that cardiomyopathy is associated with the Minute syndrome caused by haplo-insufficiency of genes encoding cytoplasmic ribosomal proteins. While mutations of genes encoding non-Minute cytoplasmic ribosomal proteins are homozygous lethal, heterozygous deficiencies spanning these non-Minute genes did not cause a change in cardiac function. Deficiencies of genes for non-Minute mitochondrial ribosomal proteins also did not show abnormal cardiac function, with the exception of a heterozygous disruption of mRpS33. We demonstrate that cardiomyopathy is a common trait of the Minute syndrome caused by haplo-insufficiency of genes encoding cytoplasmic ribosomal proteins. In contrast, most cases of heterozygous deficiencies of genes encoding non-Minute ribosomal proteins have normal heart function in adult Drosophila. PMID:21890737

  14. Co-translational capturing of nascent ribosomal proteins by their dedicated chaperones

    NASA Astrophysics Data System (ADS)

    Pausch, Patrick; Singh, Ujjwala; Ahmed, Yasar Luqman; Pillet, Benjamin; Murat, Guillaume; Altegoer, Florian; Stier, Gunter; Thoms, Matthias; Hurt, Ed; Sinning, Irmgard; Bange, Gert; Kressler, Dieter


    Exponentially growing yeast cells produce every minute >160,000 ribosomal proteins. Owing to their difficult physicochemical properties, the synthesis of assembly-competent ribosomal proteins represents a major challenge. Recent evidence highlights that dedicated chaperone proteins recognize the N-terminal regions of ribosomal proteins and promote their soluble expression and delivery to the assembly site. Here we explore the intuitive possibility that ribosomal proteins are captured by dedicated chaperones in a co-translational manner. Affinity purification of four chaperones (Rrb1, Syo1, Sqt1 and Yar1) selectively enriched the mRNAs encoding their specific ribosomal protein clients (Rpl3, Rpl5, Rpl10 and Rps3). X-ray crystallography reveals how the N-terminal, rRNA-binding residues of Rpl10 are shielded by Sqt1's WD-repeat β-propeller, providing mechanistic insight into the incorporation of Rpl10 into pre-60S subunits. Co-translational capturing of nascent ribosomal proteins by dedicated chaperones constitutes an elegant mechanism to prevent unspecific interactions and aggregation of ribosomal proteins on their road to incorporation.

  15. Co-translational capturing of nascent ribosomal proteins by their dedicated chaperones

    PubMed Central

    Pausch, Patrick; Singh, Ujjwala; Ahmed, Yasar Luqman; Pillet, Benjamin; Murat, Guillaume; Altegoer, Florian; Stier, Gunter; Thoms, Matthias; Hurt, Ed; Sinning, Irmgard; Bange, Gert; Kressler, Dieter


    Exponentially growing yeast cells produce every minute >160,000 ribosomal proteins. Owing to their difficult physicochemical properties, the synthesis of assembly-competent ribosomal proteins represents a major challenge. Recent evidence highlights that dedicated chaperone proteins recognize the N-terminal regions of ribosomal proteins and promote their soluble expression and delivery to the assembly site. Here we explore the intuitive possibility that ribosomal proteins are captured by dedicated chaperones in a co-translational manner. Affinity purification of four chaperones (Rrb1, Syo1, Sqt1 and Yar1) selectively enriched the mRNAs encoding their specific ribosomal protein clients (Rpl3, Rpl5, Rpl10 and Rps3). X-ray crystallography reveals how the N-terminal, rRNA-binding residues of Rpl10 are shielded by Sqt1's WD-repeat β-propeller, providing mechanistic insight into the incorporation of Rpl10 into pre-60S subunits. Co-translational capturing of nascent ribosomal proteins by dedicated chaperones constitutes an elegant mechanism to prevent unspecific interactions and aggregation of ribosomal proteins on their road to incorporation. PMID:26112308

  16. Eukaryote-specific extensions in ribosomal proteins of the small subunit: Structure and function.


    Ghosh, Arnab; Komar, Anton A


    High-resolution structures of yeast ribosomes have improved our understanding of the architecture and organization of eukaryotic rRNA and proteins, as well as eukaryote-specific extensions present in some conserved ribosomal proteins. Despite this progress, assignment of specific functions to individual proteins and/or eukaryote-specific protein extensions remains challenging. It has been suggested that eukaryote-specific extensions of conserved proteins from the small ribosomal subunit may facilitate eukaryote-specific reactions in the initiation phase of protein synthesis. This review summarizes emerging data describing the structural and functional significance of eukaryote-specific extensions of conserved small ribosomal subunit proteins, particularly their possible roles in recruitment and spatial organization of eukaryote-specific initiation factors. PMID:26779416

  17. Combinatorial action of transcription factors orchestrates cell cycle-dependent expression of the ribosomal protein genes and ribosome biogenesis.


    Nosrati, Nagisa; Kapoor, Neetu R; Kumar, Vijay


    Nucleolar assembly begins at the early G1 phase of the cell cycle and is a hub of ribosomal DNA transcription and rRNA biosynthesis. The newly-formed rRNAs together with ribosomal proteins (RPs) constitute the building block of the ribosomal machinery. Although RPs play a major role in protein biosynthesis, their own regulation and expression is rather poorly understood. In the present study, we investigated the regulation of RP genes RPS27a, RPS24, RPS6, RPL9 and RPL4 in synchronized mammalian cell culture. Quantitative RT-PCR analysis indicated their expression during the mid to late G1 phase, whereas the rRNA genes were expressed during the early G1 phase of the cell cycle. The promoter reporter analysis of the RPS27a gene revealed that it could be synergistically stimulated by the transcription factors specificity protein 1 (Sp1) and cAMP response element-binding protein (CREB). However, E2F transcription factor 1 (E2F1) appeared to negatively regulate gene expression. Chromatin immunoprecipitation studies confirmed the promoter occupancy of Sp1, CREB and E2F1. Although Sp1 and CREB binding enhanced the promoter occupancy of histone acetyltransferases PCAF, p300 and CREB binding protein, E2F1 facilitated the recruitment of histone deacetylases. Both acetylation (histone H4 pan-acetyl, histone H3 acetyl Lys 14) and methylation (histone H3 trimethyl Lys 9) marks were observed in the RPS27a promoter region, suggesting their important regulatory role in gene expression. Because the promoter regions of most RP genes are well conserved, we propose that their orchestrated regulation and synthesis during the cell cycle facilitates ribosome biogenesis. PMID:24646001

  18. Ribosome reinitiation at leader peptides increases translation of bacterial proteins.


    Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A


    Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well.

  19. Most RNAs regulating ribosomal protein biosynthesis in Escherichia coli are narrowly distributed to Gammaproteobacteria

    PubMed Central

    Fu, Yang; Deiorio-Haggar, Kaila; Anthony, Jon; Meyer, Michelle M.


    In Escherichia coli, 12 distinct RNA structures within the transcripts encoding ribosomal proteins interact with specific ribosomal proteins to allow autogenous regulation of expression from large multi-gene operons, thus coordinating ribosomal protein biosynthesis across multiple operons. However, these RNA structures are typically not represented in the RNA Families Database or annotated in genomic sequences databases, and their phylogenetic distribution is largely unknown. To investigate the extent to which these RNA structures are conserved across eubacterial phyla, we created multiple sequence alignments representing 10 of these messenger RNA (mRNA) structures in E. coli. We find that while three RNA structures are widely distributed across many phyla of bacteria, seven of the RNAs are narrowly distributed to a few orders of Gammaproteobacteria. To experimentally validate our computational predictions, we biochemically confirmed dual L1-binding sites identified in many Firmicute species. This work reveals that RNA-based regulation of ribosomal protein biosynthesis is used in nearly all eubacterial phyla, but the specific RNA structures that regulate ribosomal protein biosynthesis in E. coli are narrowly distributed. These results highlight the limits of our knowledge regarding ribosomal protein biosynthesis regulation outside of E. coli, and the potential for alternative RNA structures responsible for regulating ribosomal proteins in other eubacteria. PMID:23396277

  20. Proteins of rough microsomal membranes related to ribosome binding. II. Cross-linking of bound ribosomes to specific membrane proteins exposed at the binding sites

    PubMed Central


    Two proteins (ribophorins I and II), which are integral components of rough microsomal membranes and appear to be related to the bound ribosomes, were shown to be exposed on the surface of rat liver rough microsomes (RM) and to be in close proximity to the bound ribosomes. Both proteins were labeled when intact RM were incubated with a lactoperoxidase iodinating system, but only ribophorin I was digested during mild trypsinization of intact RM. Ribophorin II (63,000 daltons) was only proteolyzed when the luminal face of the microsomal vesicles was made accessible to trypsin by the addition of sublytical detergent concentrations. Only 30--40% of the bound ribosomes were released during trypsinization on intact RM, but ribosome release was almost complete in the presence of low detergent concentrations. Very low glutaraldehyde concentrations (0.005--0.02%) led to the preferential cross-linking of large ribosomal subunits of bound ribosomes to the microsomal membranes. This cross-linking prevented the release of subunits caused by puromycin in media of high ionic strength, but not the incorporation of [3H]puromycin into nascent polypeptide chains. SDS- acrylamide gel electrophoresis of cross-linked samples a preferential reduction in the intensity of the bands representing the ribophorins and the formation of aggregates which did not penetrate into the gels. At low methyl-4-mercaptobutyrimidate (MMB) concentrations (0.26 mg/ml) only 30% of the ribosomes were cross-linked to the microsomal membranes, as shown by the puromycin-KCl test, but membranes could still be solubilized with 1% DOC. This allowed the isolation of the ribophorins together with the sedimentable ribosomes, as was shown by electrophoresis of the sediments after disruption of the cross-links by reduction. Experiments with RM which contained only inactive ribosomes showed that the presence of nascent chains was not necessary for the reversible cross-linking of ribosomes to the membranes. These

  1. Cloning, sequencing, gene organization, and localization of the human ribosomal protein RPL23A gene

    SciTech Connect

    Fan, Wufang; Christensen, M.; Eichler, E.


    The intron-containing gene for human ribosomal protein RPL23A has been cloned, sequenced, and localized. The gene is approximately 4.0 kb in length and contains five exons and four introns. All splice sites exactly match the AG/GT consensus rule. The transcript is about 0.6 kb and is detected in all tissues examined. In adult tissues, the RPL23A transcript is dramatically more abundant in pancreas, skeletal muscle, and heart, while much less abundant in kidney, brain, placenta, lung, and liver. A full-length cDNA clone of 576 nt was identified, and the nucleotide sequence was found to match the exon sequence precisely. The open reading frame encodes a polypeptide of 156 amino acids, which is absolutely conserved with the rat RPL23A protein. In the 5{prime} flanking region of the gene, a canonical TATA sequence and a defined CAAT box were found for the first time in a mammalian ribosomal protein gene. The intron-containing RPL23A gene was mapped to cytogenetic band 17q11 by fluorescence in situ hybridization. 33 refs., 4 figs.

  2. Specific contacts between protein S4 and ribosomal RNA are required at multiple stages of ribosome assembly.


    Mayerle, Megan; Woodson, Sarah A


    Assembly of bacterial 30S ribosomal subunits requires structural rearrangements to both its 16S rRNA and ribosomal protein components. Ribosomal protein S4 nucleates 30S assembly and associates rapidly with the 5' domain of the 16S rRNA. In vitro, transformation of initial S4-rRNA complexes to long-lived, mature complexes involves refolding of 16S helix 18, which forms part of the decoding center. Here we use targeted mutagenesis of Geobacillus stearothermophilus S4 to show that remodeling of S4-rRNA complexes is perturbed by ram alleles associated with reduced translational accuracy. Gel mobility shift assays, SHAPE chemical probing, and in vivo complementation show that the S4 N-terminal extension is required for RNA binding and viability. Alanine substitutions in Y47 and L51 that interact with 16S helix 18 decrease S4 affinity and destabilize the helix 18 pseudoknot. These changes to the protein-RNA interface correlate with no growth (L51A) or cold-sensitive growth, 30S assembly defects, and accumulation of 17S pre-rRNA (Y47A). A third mutation, R200A, over-stabilizes the helix 18 pseudoknot yet results in temperature-sensitive growth, indicating that complex stability is finely tuned by natural selection. Our results show that early S4-RNA interactions guide rRNA folding and impact late steps of 30S assembly.

  3. The RNA-binding protein Gemin5 binds directly to the ribosome and regulates global translation

    PubMed Central

    Francisco-Velilla, Rosario; Fernandez-Chamorro, Javier; Ramajo, Jorge; Martinez-Salas, Encarnación


    RNA-binding proteins (RBPs) play crucial roles in all organisms. The protein Gemin5 harbors two functional domains. The N-terminal domain binds to snRNAs targeting them for snRNPs assembly, while the C-terminal domain binds to IRES elements through a non-canonical RNA-binding site. Here we report a comprehensive view of the Gemin5 interactome; most partners copurified with the N-terminal domain via RNA bridges. Notably, Gemin5 sediments with the subcellular ribosome fraction, and His-Gemin5 binds to ribosome particles via its N-terminal domain. The interaction with the ribosome was lost in F381A and Y474A Gemin5 mutants, but not in W14A and Y15A. Moreover, the ribosomal proteins L3 and L4 bind directly with Gemin5, and conversely, Gemin5 mutants impairing the binding to the ribosome are defective in the interaction with L3 and L4. The overall polysome profile was affected by Gemin5 depletion or overexpression, concomitant to an increase or a decrease, respectively, of global protein synthesis. Gemin5, and G5-Nter as well, were detected on the polysome fractions. These results reveal the ribosome-binding capacity of the N-ter moiety, enabling Gemin5 to control global protein synthesis. Our study uncovers a crosstalk between this protein and the ribosome, and provides support for the view that Gemin5 may control translation elongation. PMID:27507887

  4. Crystal structure of Gib2, a signal-transducing protein scaffold associated with ribosomes in Cryptococcus neoformans.


    Ero, Rya; Dimitrova, Valya Tenusheva; Chen, Yun; Bu, Wenting; Feng, Shu; Liu, Tongbao; Wang, Ping; Xue, Chaoyang; Tan, Suet Mien; Gao, Yong-Gui


    The atypical Gβ-like/RACK1 Gib2 protein promotes cAMP signalling that plays a central role in regulating the virulence of Cryptococcus neoformans. Gib2 contains a seven-bladed β transducin structure and is emerging as a scaffold protein interconnecting signalling pathways through interactions with various protein partners. Here, we present the crystal structure of Gib2 at a 2.2-Å resolution. The structure allows us to analyse the association between Gib2 and the ribosome, as well as to identify the Gib2 amino acid residues involved in ribosome binding. Our studies not only suggest that Gib2 has a role in protein translation but also present Gib2 as a physical link at the crossroads of various regulatory pathways important for the growth and virulence of C. neoformans.

  5. Crystal structure of Gib2, a signal-transducing protein scaffold associated with ribosomes in Cryptococcus neoformans

    NASA Astrophysics Data System (ADS)

    Ero, Rya; Dimitrova, Valya Tenusheva; Chen, Yun; Bu, Wenting; Feng, Shu; Liu, Tongbao; Wang, Ping; Xue, Chaoyang; Tan, Suet Mien; Gao, Yong-Gui


    The atypical Gβ-like/RACK1 Gib2 protein promotes cAMP signalling that plays a central role in regulating the virulence of Cryptococcus neoformans. Gib2 contains a seven-bladed β transducin structure and is emerging as a scaffold protein interconnecting signalling pathways through interactions with various protein partners. Here, we present the crystal structure of Gib2 at a 2.2-Å resolution. The structure allows us to analyse the association between Gib2 and the ribosome, as well as to identify the Gib2 amino acid residues involved in ribosome binding. Our studies not only suggest that Gib2 has a role in protein translation but also present Gib2 as a physical link at the crossroads of various regulatory pathways important for the growth and virulence of C. neoformans.

  6. The Saccharomyces cerevisiae protein Stm1p facilitates ribosome preservation during quiescence

    SciTech Connect

    Van Dyke, Natalya; Chanchorn, Ekkawit; Van Dyke, Michael W.


    Highlights: Black-Right-Pointing-Pointer Stm1p confers increased resistance to the macrolide starvation-mimic rapamycin. Black-Right-Pointing-Pointer Stm1p maintains 80S ribosome integrity during stationary phase-induced quiescence. Black-Right-Pointing-Pointer Stm1p facilitates polysome formation following quiescence exit. Black-Right-Pointing-Pointer Stm1p facilitates protein synthesis following quiescence exit. Black-Right-Pointing-Pointer Stm1p is a ribosome preservation factor under conditions of nutrient deprivation. -- Abstract: Once cells exhaust nutrients from their environment, they enter an alternative resting state known as quiescence, whereby proliferation ceases and essential nutrients are obtained through internal stores and through the catabolism of existing macromolecules and organelles. One example of this is ribophagy, the degradation of ribosomes through the process of autophagy. However, some ribosomes need to be preserved for an anticipated recovery from nutrient deprivation. We found that the ribosome-associated protein Stm1p greatly increases the quantity of 80S ribosomes present in quiescent yeast cells and that these ribosomes facilitate increased protein synthesis rates once nutrients are restored. These findings suggest that Stm1p can act as a ribosome preservation factor under conditions of nutrient deprivation and restoration.

  7. Proteins with abortifacient, ribosome inactivating, immunomodulatory, antitumor and anti-AIDS activities from Cucurbitaceae plants.


    Ng, T B; Chan, W Y; Yeung, H W


    1. The biochemical characteristics and biological activities of eight Cucurbitaceae plant proteins designated trichosanthin (isolated from tubers of Trichosanthes kirilowii), beta-trichosanthin (isolated from tubers of Trichosanthes cucumeroides), alpha- and beta-momorcharins (isolated from seeds of Momordica charantia), momorchochin (isolated from tubers of Momordica cochinchinensis), luffaculin (isolated from seeds of Luffa acutangula) and luffin-a and luffin-b (isolated from seeds of Luffa cylindrica), were reviewed. 2. The isolation procedures for all eight proteins are based on aqueous extraction, acetone fractionation and ion exchange chromatography. Ammonium sulfate precipitation and gel filtration are steps which may be included to improve purification. 3. The proteins are basic in nature and possess a molecular weight of approx. 30,000. All except trichosanthin are glycoproteins. The content of Asx and Glx residues is high. The N-terminal amino acid residue is Asp. Their amino acid compositions and N-terminal amino acid sequences are similar. 4. Circular dichroism spectroscopic studies revealed that trichosanthin, alpha- and beta-momorcharins possess similar secondary but different tertiary structures. 5. Most of the proteins are immunologically distinct. 6. The proteins exhibit abortifacient, antitumor, ribosome inactivating and immunomodulatory activities. Trichosanthin manifests anti-human immunodeficiency virus activity. PMID:1397965

  8. Proteins with abortifacient, ribosome inactivating, immunomodulatory, antitumor and anti-AIDS activities from Cucurbitaceae plants.


    Ng, T B; Chan, W Y; Yeung, H W


    1. The biochemical characteristics and biological activities of eight Cucurbitaceae plant proteins designated trichosanthin (isolated from tubers of Trichosanthes kirilowii), beta-trichosanthin (isolated from tubers of Trichosanthes cucumeroides), alpha- and beta-momorcharins (isolated from seeds of Momordica charantia), momorchochin (isolated from tubers of Momordica cochinchinensis), luffaculin (isolated from seeds of Luffa acutangula) and luffin-a and luffin-b (isolated from seeds of Luffa cylindrica), were reviewed. 2. The isolation procedures for all eight proteins are based on aqueous extraction, acetone fractionation and ion exchange chromatography. Ammonium sulfate precipitation and gel filtration are steps which may be included to improve purification. 3. The proteins are basic in nature and possess a molecular weight of approx. 30,000. All except trichosanthin are glycoproteins. The content of Asx and Glx residues is high. The N-terminal amino acid residue is Asp. Their amino acid compositions and N-terminal amino acid sequences are similar. 4. Circular dichroism spectroscopic studies revealed that trichosanthin, alpha- and beta-momorcharins possess similar secondary but different tertiary structures. 5. Most of the proteins are immunologically distinct. 6. The proteins exhibit abortifacient, antitumor, ribosome inactivating and immunomodulatory activities. Trichosanthin manifests anti-human immunodeficiency virus activity.

  9. Crystal Structure of Ribosome-Inactivating Protein Ricin A Chain in Complex with the C-Terminal Peptide of the Ribosomal Stalk Protein P2

    PubMed Central

    Shi, Wei-Wei; Tang, Yun-Sang; Sze, See-Yuen; Zhu, Zhen-Ning; Wong, Kam-Bo; Shaw, Pang-Chui


    Ricin is a type 2 ribosome-inactivating protein (RIP), containing a catalytic A chain and a lectin-like B chain. It inhibits protein synthesis by depurinating the N-glycosidic bond at α-sarcin/ricin loop (SRL) of the 28S rRNA, which thereby prevents the binding of elongation factors to the GTPase activation center of the ribosome. Here, we present the 1.6 Å crystal structure of Ricin A chain (RTA) complexed to the C-terminal peptide of the ribosomal stalk protein P2, which plays a crucial role in specific recognition of elongation factors and recruitment of eukaryote-specific RIPs to the ribosomes. Our structure reveals that the C-terminal GFGLFD motif of P2 peptide is inserted into a hydrophobic pocket of RTA, while the interaction assays demonstrate the structurally untraced SDDDM motif of P2 peptide contributes to the interaction with RTA. This interaction mode of RTA and P protein is in contrast to that with trichosanthin (TCS), Shiga-toxin (Stx) and the active form of maize RIP (MOD), implying the flexibility of the P2 peptide-RIP interaction, for the latter to gain access to ribosome. PMID:27754366

  10. The Ribosomal Protein-Mdm2-p53 Pathway and Energy Metabolism

    PubMed Central

    Deisenroth, Chad; Zhang, Yanping


    Cellular growth and division are two fundamental processes that are exquisitely sensitive and responsive to environmental fluctuations. One of the most energetically demanding functions of these processes is ribosome biogenesis, the key component to regulating overall protein synthesis and cell growth. Perturbations to ribosome biogenesis have been demonstrated to induce an acute stress response leading to p53 activation through the inhibition of Mdm2 by a number of ribosomal proteins. The energy status of a cell is a highly dynamic variable that naturally contributes to metabolic fluctuations, which can affect both the rates of ribosome biogenesis and p53 function. This, in turn, determines whether a cell is in an anabolic, growth-promoting state or a catabolic, growth-suppressing state. Here the authors integrate the known functions of p53 to postulate how changes in nutrient availability may induce the ribosomal protein–Mdm2-p53 signaling pathway to modulate p53-dependent metabolic regulation. PMID:21779508

  11. Erythrocytic Stage-dependent Regulation of Oligomerization of Plasmodium Ribosomal Protein P2*

    PubMed Central

    Das, Sudipta; Sudarsan, Rajagopal; Sivakami, Subramanian; Sharma, Shobhona


    The eukaryotic 60 S-ribosomal stalk consists of P0, P1, and P2 proteins, which associate in a pentameric structure (P12-P0-P22). The Plasmodium falciparum protein P2 (PfP2) appears to play nonribosomal roles. It gets exported to the infected erythrocyte (IE) surface at 30 h post-merozoite invasion (PMI), concomitant with extensive oligomerization. Here we present certain biophysical properties of PfP2. Recombinant P2 (rPfP2) protein showed SDS-resistant oligomerization, which could be significantly abolished under reducing conditions. However, the protein continued to oligomerize even when both cysteine residues were mutated, and with up to 40 amino acids (aa) deleted from the C-terminal end. CD analysis of P2 showed largely α-helical and random coil domains. The SDS- and DTT-resistant oligomerization was studied further as it occurred in a development-specific manner in Plasmodium. In a synchronized erythrocytic culture of P. falciparum, the PfP2 protein was detected as part of the ribosomal complex (∼96 kDa) at 18 and 30 h PMI, and was SDS sensitive. However, at 30 h, large amounts of SDS-sensitive aggregates of >600 kDa were also seen. At 30 h PMI, each of the parasites, IE cytosol and IE ghost contained 60–80-kDa PfP2 complexes, which resolved to a single 65-kDa species on SDS-PAGE. Tetramethylrhodamine-labeled rPfP2 protein exhibited DTT- and SDS-resistant oligomerization when treated with P. falciparum parasite extracts only from 24 to 36 h PMI, and multiple proteins appeared to be required for this oligomerization. Understanding the regulation of oligomerization of PfP2 may help in the elucidation of the novel structure-function relationship in the export of PfP2 to the red cell surface. PMID:23060439

  12. Editing and translation of ribosomal protein S13 transcripts: unedited translation products are not detectable in maize mitochondria.


    Williams, M A; Tallakson, W A; Phreaner, C G; Mulligan, R M


    Maize mitochondrial transcripts for the ribosomal protein S13 gene (rps13) have six C- to -U editing sites, and each nucleotide conversion causes a change in the amino acid specified by the effected codons. Sequence analysis of 30 cDNA clones indicated that 73% of the cDNAS were edited at all six sites and 3% were completely unedited. Antibodies were produced against synthetic peptides that corresponded to unedited or edited translation products at editing sites V and VI (80% and 83% edited, respectively). Antibody preparations were purified that selectively recognized the edited or unedited forms of the epitope. The antibody preparations were highly sensitive to the amino-acid residue encoded at editing site VI, but relatively insensitive to the residue encoded at editing site V. Immunological analyses demonstrated that the edited translation product accumulated as a ribosomal protein, but that the unedited translation product was not detected in the mitochondrion, in the ribosomal fraction, or in a post-ribosomal supernatant. These results, taken together with other studies which demonstrated that incompletely edited transcripts are incorporated into polyribosomes, suggest that incompletely edited transcripts may be translated, but polypeptides encoded by incompletely edited RNAs may be unstable and, consequently, fail to accumulate.

  13. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors

    PubMed Central

    Sauert, Martina; Martín-Marcos, Pilar; Tamame, Mercedes; Tschochner, Herbert; Griesenbeck, Joachim; Milkereit, Philipp


    Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins) and ribosomal RNAs (rRNAs). Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs) with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU) rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs. PMID:26642313

  14. Cloning and characterization of a gene from Rhizobium melilotii 2011 coding for ribosomal protein S1.

    PubMed Central

    Schnier, J; Thamm, S; Lurz, R; Hussain, A; Faist, G; Dobrinski, B


    A 7 kb chromosomal DNA fragment from R. melilotii was cloned, which complemented temperature-sensitivity of an E. coli amber mutant in rpsA, the gene for ribosomal protein S1 (ES1). From complementation and maxicell analysis a 58 kd protein was identified as the homolog of protein S1 (RS1). DNA sequence analysis of the R. melilotii rpsA gene identified a protein of 568 amino acids, which showed 47% identical amino acid homology to protein S1 from E. coli. The RS1 protein lacked the two Cys residues which had been reported to play an important role for the function of ES1. Two repeats containing Shine-Dalgarno sequences were identified upstream of the structural gene. Binding studies with RNA polymerase from E. coli and Pseudomonas putida located one RNA-polymerase binding site close to the RS1 gene and another one several hundred basepairs upstream. One possible promoter was also identified by DNA sequence comparison with the corresponding E. coli promoter. Images PMID:3368316

  15. Crystal structure of the RNA binding ribosomal protein L1 from Thermus thermophilus.

    PubMed Central

    Nikonov, S; Nevskaya, N; Eliseikina, I; Fomenkova, N; Nikulin, A; Ossina, N; Garber, M; Jonsson, B H; Briand, C; Al-Karadaghi, S; Svensson, A; Aevarsson, A; Liljas, A


    L1 has a dual function as a ribosomal protein binding rRNA and as a translational repressor binding mRNA. The crystal structure of L1 from Thermus thermophilus has been determined at 1.85 angstroms resolution. The protein is composed of two domains with the N- and C-termini in domain I. The eight N-terminal residues are very flexible, as the quality of electron density map shows. Proteolysis experiments have shown that the N-terminal tail is accessible and important for 23S rRNA binding. Most of the conserved amino acids are situated at the interface between the two domains. They probably form the specific RNA binding site of L1. Limited non-covalent contacts between the domains indicate an unstable domain interaction in the present conformation. Domain flexibility and RNA binding by induced fit seems plausible. Images PMID:8635468

  16. Specific sequences in the fragile X syndrome protein FMR1 and the FXR proteins mediate their binding to 60S ribosomal subunits and the interactions among them.

    PubMed Central

    Siomi, M C; Zhang, Y; Siomi, H; Dreyfuss, G


    Fragile X syndrome, the most common form of hereditary mental retardation, usually results from lack of expression of the FMR1 gene. The FMR1 protein is a cytoplasmic RNA-binding protein. The RNA-binding activity of FMR1 is an essential feature of FMR1, as fragile X syndrome can also result from the expression of mutant FMR1 protein that is impaired in RNA binding. Recently, we described two novel cytoplasmic proteins, FXR1 and FXR2, which are both very similar in amino acid sequence to FMR1 and which also interact strongly with FMR1 and with each other. To understand the function of FMR1 and the FXR proteins, we carried out cell fractionation and sedimentation experiments with monoclonal antibodies to these proteins to characterize the complexes they form. Here, we report that the FMR1 and FXR proteins are associated with ribosomes, predominantly with 60S large ribosomal subunits. The FXR proteins are associated with 60S ribosomal subunits even in cells that lack FMR1 and that are derived from a fragile X syndrome patient, indicating that FMR1 is not required for this association. We delineated the regions of FMR1 that mediate its binding to 60S ribosomal subunits and the interactions among the FMR1-FXR family members. Both regions contain sequences predicted to have a high propensity to form coiled coil interactions, and the sequences are highly evolutionarily conserved in this protein family. The association of the FMR1, FXR1, and FXR2 proteins with ribosomes suggests they have functions in translation or mRNA stability. PMID:8668200

  17. Systematic identification of seven ribosomal protein genes in bighead carp and their expression in response to microcystin-LR.


    Cai, Yan; Zhang, Chao; Hao, Le; Chen, Jun; Xie, Ping; Chen, Zhidong


    Microcystin-LR (MCLR) is one of the most toxic cyanotoxins produced in algal blooms. The toxic effects of MCLR on the expression of some organelles genes (mitochondrion, endoplasmic reticulum, and cytoskeleton etc) have been widely investigated, but little is known how it impacts on the expression of ribosomal genes. In this study we identified seven ribosomal protein genes RPS6, RPS12, RPS24, RPS27a, RPL12, RPL27 and RPL29 in bighead carp (Aristichthys nobilis), whose expression was regulated by MCLR. The amino acid sequences of those 7 genes shared more than 90% identity with corresponding sequences from zebrafish, and were well conserved throughout evolution. The 3D structure prediction showed that the structures of these ribosomal proteins were conserved, but had species specificity. Q-PCR analysis revealed that expression of seven genes changed dramatically at 3 hr, then went back to a moderate change- level at 24 hr in almost all tested tissues (liver, kidney, intestine, heart, spleen and gill) post MCLR injection, but in brain expression of the seven genes stayed same as the normal level. This study will help us to know not only about the evolution and functions of ribosomal proteins in anti-MCLR response in bighead carp, but also about the MCLR toxicity and its impact on aquaculture and human health. PMID:26961614

  18. Translation initiation rate determines the impact of ribosome stalling on bacterial protein synthesis.


    Hersch, Steven J; Elgamal, Sara; Katz, Assaf; Ibba, Michael; Navarre, William Wiley


    Ribosome stalling during translation can be caused by a number of characterized mechanisms. However, the impact of elongation stalls on protein levels is variable, and the reasons for this are often unclear. To investigate this relationship, we examined the bacterial translation elongation factor P (EF-P), which plays a critical role in rescuing ribosomes stalled at specific amino acid sequences including polyproline motifs. In previous proteomic analyses of both Salmonella and Escherichia coli efp mutants, it was evident that not all proteins containing a polyproline motif were dependent on EF-P for efficient expression in vivo. The α- and β-subunits of ATP synthase, AtpA and AtpD, are translated from the same mRNA transcript, and both contain a PPG motif; however, proteomic analysis revealed that AtpD levels are strongly dependent on EF-P, whereas AtpA levels are independent of EF-P. Using these model proteins, we systematically determined that EF-P dependence is strongly influenced by elements in the 5'-untranslated region of the mRNA. By mutating either the Shine-Dalgarno sequence or the start codon, we find that EF-P dependence correlates directly with the rate of translation initiation where strongly expressed proteins show the greatest dependence on EF-P. Our findings demonstrate that polyproline-induced stalls exert a net effect on protein levels only if they limit translation significantly more than initiation. This model can be generalized to explain why sequences that induce pauses in translation elongation to, for example, facilitate folding do not necessarily exact a penalty on the overall production of the protein. PMID:25148683

  19. Ribosomal protein L7Ae is a subunit of archaeal RNase P.


    Cho, I-Ming; Lai, Lien B; Susanti, Dwi; Mukhopadhyay, Biswarup; Gopalan, Venkat


    To the mounting evidence of nonribosomal functions for ribosomal proteins, we now add L7Ae as a subunit of archaeal RNase P, a ribonucleoprotein (RNP) that catalyzes 5'-maturation of precursor tRNAs (pre-tRNAs). We first demonstrate that L7Ae coelutes with partially purified Methanococcus maripaludis (Mma) RNase P activity. After establishing in vitro reconstitution of the single RNA with four previously known protein subunits (POP5, RPP21, RPP29, and RPP30), we show that addition of L7Ae to this RNase P complex increases the optimal reaction temperature and k(cat)/K(m) (by approximately 360-fold) for pre-tRNA cleavage to those observed with partially purified native Mma RNase P. We identify in the Mma RNase P RNA a putative kink-turn (K-turn), the structural motif recognized by L7Ae. The large stimulatory effect of Mma L7Ae on RNase P activity decreases to acids in L7Ae shown to be essential for K-turn binding. The critical, multifunctional role of archaeal L7Ae in RNPs acting in tRNA processing (RNase P), RNA modification (H/ACA, C/D snoRNPs), and translation (ribosomes), especially by employing the same RNA-recognition surface, suggests coevolution of various translation-related functions, presumably to facilitate their coordinate regulation. PMID:20675586

  20. Zinc Regulates a Switch between Primary and Alternative S18 Ribosomal Proteins in Mycobacterium tuberculosis

    PubMed Central

    Prisic, Sladjana; Hwang, Hyonson; Dow, Allexa; Barnaby, Omar; Pan, Tenny S.; Lonzanida, Jaymes A.; Chazin, Walter J.; Steen, Hanno; Husson, Robert N.


    SUMMARY The Mycobacterium tuberculosis genome encodes five putative “alternative” ribosomal proteins whose expression is repressed at high Zn2+ concentration. Each alternative protein has a primary homolog that is predicted to bind Zn2+. We hypothesized that zinc triggers a switch between these paired homologous proteins and therefore chose one of these pairs, S18-1/S18-2, to study mechanisms of the predicted competition for their incorporation into ribosomes. As predicted, our data show that Zn2+-depletion causes accumulation of both S18-2 mRNA and protein. In contrast, S18-1 mRNA levels are unchanged to slightly elevated under Zn2+-limited conditions. However the amount of S18-1 protein is markedly decreased. We further demonstrate that both S18 proteins interact with ribosomal protein S6, a committed step in ribosome biogenesis. Zn2+ is absolutely required for the S18-1/S6 interaction, while it is dispensable for S18-2/S6 dimer formation. These data suggest a model in which the S18-1 is the dominant ribosome constituent in high zinc conditions, e.g. inside of phagosomes, but that it can be replaced by S18-2 when zinc is deficient, e.g. in the extracellular milieu. Consequently, Zn2+-depletion may serve as a signal for building alternative ribosomes when M. tuberculosis is released from macrophages, to allow survival in the extracellular environment. PMID:25858183

  1. In vitro synthesis of ribosomal proteins directed by Escherichia coli DNA.


    Kaltschmidt, E; Kahan, L; Nomura, M


    In vitro synthesis of a number of E. coli 30S ribosomal proteins has been demonstrated in a cell-free system consisting of ribosomes, initiation factors, RNA polymerase, a fraction containing soluble enzymes and factors, and E. coli DNA. DNA-dependent synthesis of the following 30S proteins has been demonstrated: S4, S5, S7, S8, S9, S10, S13, S14, S16, S19, and S20.

  2. Ribosomal protein genes are overexpressed in colorectal cancer: isolation of a cDNA clone encoding the human S3 ribosomal protein.


    Pogue-Geile, K; Geiser, J R; Shu, M; Miller, C; Wool, I G; Meisler, A I; Pipas, J M


    We have isolated a cDNA clone encoding the human S3 ribosomal protein from a normal human colon cDNA library. The clone was identified as one of many that detected genes whose level of expression was increased in adenocarcinoma of the colon relative to normal colonic mucosa. Increased levels of the S3 transcript were present in the tumors of all eight patients examined. Moreover, the S3 mRNA was also more abundant in 7 of 10 adenomatous polyps, the presumed precursor of carcinoma. Additional studies demonstrated that increased levels of mRNAs encoding several other ribosomal proteins, including S6, S8, S12, L5, and P0, were present in colorectal tumors and polyps. These results suggest that there is increased synthesis of ribosomes in colorectal tumors and that this increase is an early event in colon neoplasia.

  3. Nuclear-encoded chloroplast ribosomal protein L12 of Nicotiana tabacum: characterization of mature protein and isolation and sequence analysis of cDNA clones encoding its cytoplasmic precursor.

    PubMed Central

    Elhag, G A; Thomas, F J; McCreery, T P; Bourque, D P


    Poly(A)+ mRNA isolated from Nicotiana tabacum (cv. Petite Havana) leaves was used to prepare a cDNA library in the expression vector lambda gt11. Recombinant phage containing cDNAs coding for chloroplast ribosomal protein L12 were identified and sequenced. Mature tobacco L12 protein has 44% amino acid identity with ribosomal protein L7/L12 of Escherichia coli. The longest L12 cDNA (733 nucleotides) codes for a 13,823 molecular weight polypeptide with a transit peptide of 53 amino acids and a mature protein of 133 amino acids. The transit peptide and mature protein share 43% and 79% amino acid identity, respectively, with corresponding regions of spinach chloroplast ribosomal protein L12. The predicted amino terminus of the mature protein was confirmed by partial sequence analysis of HPLC-purified tobacco chloroplast ribosomal protein L12. A single L12 mRNA of about 0.8 kb was detected by hybridization of L12 cDNA to poly(A)+ and total leaf RNA. Hybridization patterns of restriction fragments of tobacco genomic DNA probed with the L12 cDNA suggested the existence of more than one gene for ribosomal protein L12. Characterization of a second cDNA with an identical L12 coding sequence but a different 3'-noncoding sequence provided evidence that at least two L12 genes are expressed in tobacco. Images PMID:1542565

  4. Binding of 16S rRNA to chloroplast 30S ribosomal proteins blotted on nitrocellulose.


    Rozier, C; Mache, R


    Protein-RNA associations were studied by a method using proteins blotted on a nitrocellulose sheet. This method was assayed with Escherichia Coli 30S ribosomal components. In stringent conditions (300 mM NaCl or 20 degrees C) only 9 E. coli ribosomal proteins strongly bound to the 16S rRNA: S4, S5, S7, S9, S12, S13, S14, S19, S20. 8 of these proteins have been previously found to bind independently to the 16S rRNA. The same method was applied to determine protein-RNA interactions in spinach chloroplast 30S ribosomal subunits. A set of only 7 proteins was bound to chloroplast rRNA in stringent conditions: chloroplast S6, S10, S11, S14, S15, S17 and S22. They also bound to E. coli 16S rRNA. This set includes 4 chloroplast-synthesized proteins: S6, S11, S15 and S22. The core particles obtained after treatment by LiCl of chloroplast 30S ribosomal subunit contained 3 proteins (S6, S10 and S14) which are included in the set of 7 binding proteins. This set of proteins probably play a part in the early steps of the assembly of the chloroplast 30S ribosomal subunit.

  5. PSRP1 is not a ribosomal protein, but a ribosome-binding factor that is recycled by the ribosome-recycling factor (RRF) and elongation factor G (EF-G).


    Sharma, Manjuli R; Dönhöfer, Alexandra; Barat, Chandana; Marquez, Viter; Datta, Partha P; Fucini, Paola; Wilson, Daniel N; Agrawal, Rajendra K


    Plastid-specific ribosomal proteins (PSRPs) have been proposed to play roles in the light-dependent regulation of chloroplast translation. Here we demonstrate that PSRP1 is not a bona fide ribosomal protein, but rather a functional homologue of the Escherichia coli cold-shock protein pY. Three-dimensional Cryo-electron microscopic (Cryo-EM) reconstructions reveal that, like pY, PSRP1 binds within the intersubunit space of the 70S ribosome, at a site overlapping the positions of mRNA and A- and P-site tRNAs. PSRP1 induces conformational changes within ribosomal components that comprise several intersubunit bridges, including bridge B2a, thereby stabilizes the ribosome against dissociation. We find that the presence of PSRP1/pY lowers the binding of tRNA to the ribosome. Furthermore, similarly to tRNAs, PSRP1/pY is recycled from the ribosome by the concerted action of the ribosome-recycling factor (RRF) and elongation factor G (EF-G). These results suggest a novel function for EF-G and RRF in the post-stress return of PSRP1/pY-inactivated ribosomes to the actively translating pool. PMID:19965869

  6. Modulation of decoding fidelity by ribosomal proteins S4 and S5.


    Agarwal, Deepali; Kamath, Divya; Gregory, Steven T; O'Connor, Michael


    Ribosomal proteins S4 and S5 participate in the decoding and assembly processes on the ribosome and the interaction with specific antibiotic inhibitors of translation. Many of the characterized mutations affecting these proteins decrease the accuracy of translation, leading to a ribosomal-ambiguity phenotype. Structural analyses of ribosomal complexes indicate that the tRNA selection pathway involves a transition between the closed and open conformations of the 30S ribosomal subunit and requires disruption of the interface between the S4 and S5 proteins. In agreement with this observation, several of the mutations that promote miscoding alter residues located at the S4-S5 interface. Here, the Escherichia coli rpsD and rpsE genes encoding the S4 and S5 proteins were targeted for mutagenesis and screened for accuracy-altering mutations. While a majority of the 38 mutant proteins recovered decrease the accuracy of translation, error-restrictive mutations were also recovered; only a minority of the mutant proteins affected rRNA processing, ribosome assembly, or interactions with antibiotics. Several of the mutations affect residues at the S4-S5 interface. These include five nonsense mutations that generate C-terminal truncations of S4. These truncations are predicted to destabilize the S4-S5 interface and, consistent with the domain closure model, all have ribosomal-ambiguity phenotypes. A substantial number of the mutations alter distant locations and conceivably affect tRNA selection through indirect effects on the S4-S5 interface or by altering interactions with adjacent ribosomal proteins and 16S rRNA.

  7. Oncogenic activation of the human trk proto-oncogene by recombination with the ribosomal large subunit protein L7a.

    PubMed Central

    Ziemiecki, A; Müller, R G; Fu, X C; Hynes, N E; Kozma, S


    The trk-2h oncogene, isolated from the human breast carcinoma cell line MDA-MB 231 by genomic DNA-transfection into NIH3T3 cells, consists of the trk proto-oncogene receptor kinase domain fused to a N-terminal 41 amino acid activating sequence (Kozma, S.C., Redmond, S.M.S., Xiao-Chang, F., Saurer, S.M., Groner, B. and Hynes, N.E. (1988) EMBO J., 7, 147-154). Antibodies raised against a bacterially produced beta gal-trk receptor kinase fusion protein recognized a 44 kd phosphoprotein phosphorylated on serine, threonine and tyrosine in extracts of trk-2h transformed NIH3T3 cells. In vitro, in the presence of Mn2+/gamma ATP, this protein became phosphorylated extensively on tyrosine. Cells transformed by trk-2h did not, however, show an elevation in total phosphotyrosine. We have cloned and sequenced the cDNA encoding the amino terminal activating sequences of trk-2h (Kozma et al., 1988). The encoded protein has a high basic amino acid content and the gene is expressed as an abundant 1.2 kb mRNA in human, rat and mouse cells. Antipeptide antibodies raised against a C-terminal peptide recognized specifically a 30 kd protein on Western blots of human, rat and mouse cell extracts. Immunofluorescence revealed, in addition to granular cytoplasmic fluorescence, intense nucleolar staining. The high basic amino acid content and nucleolar staining prompted us to investigate whether the 30 kd protein could be a ribosomal protein. Western immunoblotting analysis of 2D-electrophoretically resolved ribosomal proteins indicated that the 30 kd protein is the ribosomal large subunit protein L7a.(ABSTRACT TRUNCATED AT 250 WORDS) Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 9. PMID:2403926

  8. The number of copies of ribosome-bound proteins L7 and L12 required for protein synthesis activity.


    Lee, C C; Cantor, C R; Wittmann-Liebold, B


    Poly(U)-dependent poly(Phe) synthesis and elongation factor G (EF-G)-dependent GTPase activity were used to study the partial reconstitution of L7/L12-deficient ribosomes with proteins L7/L12 and fluorescent conjugates. Seventy-five per cent of these activities are restored when unmodified L7/L12 dimer is added to L7/L12-deficient cores at a ratio of 1:1. Various covalent fluorescent conjugates of L7/L12 bind to these cores about as well as unmodified protein. A fluorescein-5-isothiocyanate derivative of L12 shows almost no functional activity when bound. However, mixed reconstitutes of this conjugate and unmodified L12 have 75% functional activity when half the protein is unmodified. These results can be explained by a model in which there are two independent binding sites on the ribosome for two dimers of L7/L12. The binding of dimers to ribosomes is totally random and complete; the particle is 100% active so long as it has one active dimer bound to either one of the two sites. However, more complex models cannot be ruled out. An 5-(iodoacetamidoethyl)-aminonaphthalene-1-sulfonic acid (IAEDANS) derivative of L7 is labeled semispecifically at the COOH terminus. This conjugate shows partial functional activity. When assay results are analyzed using the above model, it appears that the specific COOH-terminal modification has no effect on activity. However, all but a small fraction of the nonspecific IAEDANS modifications lead to inactivation.

  9. Sequential domain assembly of ribosomal protein S3 drives 40S subunit maturation

    PubMed Central

    Mitterer, Valentin; Murat, Guillaume; Réty, Stéphane; Blaud, Magali; Delbos, Lila; Stanborough, Tamsyn; Bergler, Helmut; Leulliot, Nicolas; Kressler, Dieter; Pertschy, Brigitte


    Eukaryotic ribosomes assemble by association of ribosomal RNA with ribosomal proteins into nuclear precursor particles, which undergo a complex maturation pathway coordinated by non-ribosomal assembly factors. Here, we provide functional insights into how successive structural re-arrangements in ribosomal protein S3 promote maturation of the 40S ribosomal subunit. We show that S3 dimerizes and is imported into the nucleus with its N-domain in a rotated conformation and associated with the chaperone Yar1. Initial assembly of S3 with 40S precursors occurs via its C-domain, while the N-domain protrudes from the 40S surface. Yar1 is replaced by the assembly factor Ltv1, thereby fixing the S3 N-domain in the rotated orientation and preventing its 40S association. Finally, Ltv1 release, triggered by phosphorylation, and flipping of the S3 N-domain into its final position results in the stable integration of S3. Such a stepwise assembly may represent a new paradigm for the incorporation of ribosomal proteins. PMID:26831757

  10. The human Shwachman-Diamond syndrome protein, SBDS, associates with ribosomal RNA.


    Ganapathi, Karthik A; Austin, Karyn M; Lee, Chung-Sheng; Dias, Anusha; Malsch, Maggie M; Reed, Robin; Shimamura, Akiko


    Shwachman-Diamond syndrome (SDS) is an autosomal recessive disorder characterized by bone marrow failure, exocrine pancreatic dysfunction, and leukemia predisposition. Mutations in the SBDS gene are identified in most patients with SDS. SBDS encodes a highly conserved protein of unknown function. Data from SBDS orthologs suggest that SBDS may play a role in ribosome biogenesis or RNA processing. Human SBDS is enriched in the nucleolus, the major cellular site of ribosome biogenesis. Here we report that SBDS nucleolar localization is dependent on active rRNA transcription. Cells from patients with SDS or Diamond-Blackfan anemia are hypersensitive to low doses of actinomycin D, an inhibitor of rRNA transcription. The addition of wild-type SBDS complements the actinomycin D hypersensitivity of SDS patient cells. SBDS migrates together with the 60S large ribosomal subunit in sucrose gradients and coprecipitates with 28S ribosomal RNA (rRNA). Loss of SBDS is not associated with a discrete block in rRNA maturation or with decreased levels of the 60S ribosomal subunit. SBDS forms a protein complex with nucleophosmin, a multifunctional protein implicated in ribosome biogenesis and leukemogenesis. Our studies support the addition of SDS to the growing list of human bone marrow failure syndromes involving the ribosome.

  11. The human Shwachman-Diamond syndrome protein, SBDS, associates with ribosomal RNA

    PubMed Central

    Ganapathi, Karthik A.; Austin, Karyn M.; Lee, Chung-Sheng; Dias, Anusha; Malsch, Maggie M.; Reed, Robin


    Shwachman-Diamond syndrome (SDS) is an autosomal recessive disorder characterized by bone marrow failure, exocrine pancreatic dysfunction, and leukemia predisposition. Mutations in the SBDS gene are identified in most patients with SDS. SBDS encodes a highly conserved protein of unknown function. Data from SBDS orthologs suggest that SBDS may play a role in ribosome biogenesis or RNA processing. Human SBDS is enriched in the nucleolus, the major cellular site of ribosome biogenesis. Here we report that SBDS nucleolar localization is dependent on active rRNA transcription. Cells from patients with SDS or Diamond-Blackfan anemia are hypersensitive to low doses of actinomycin D, an inhibitor of rRNA transcription. The addition of wild-type SBDS complements the actinomycin D hypersensitivity of SDS patient cells. SBDS migrates together with the 60S large ribosomal subunit in sucrose gradients and coprecipitates with 28S ribosomal RNA (rRNA). Loss of SBDS is not associated with a discrete block in rRNA maturation or with decreased levels of the 60S ribosomal subunit. SBDS forms a protein complex with nucleophosmin, a multifunctional protein implicated in ribosome biogenesis and leukemogenesis. Our studies support the addition of SDS to the growing list of human bone marrow failure syndromes involving the ribosome. PMID:17475909

  12. Sequence, overproduction and purification of Vibrio proteolyticus ribosomal protein L18 for in vitro and in vivo studies

    NASA Technical Reports Server (NTRS)

    Setterquist, R. A.; Smith, G. K.; Oakley, T. H.; Lee, Y. H.; Fox, G. E.


    A strategy suggested by comparative genomic studies was used to amplify the entire Vibrio proteolyticus (Vp) gene for ribosomal protein L18. Vp L18 and its flanking regions were sequenced and compared with the deduced amino acid (aa) sequences of other known L18 proteins. A 26-aa residue segment at the carboxy terminus contains many strongly conserved residues and may be critical for the L18 interaction with 5S rRNA. This approach should allow rapid characterization of L18 from large numbers of bacteria. Both Vp L18 and Escherichia coli (Ec) L18 were overproduced and purified using a T7 expression vector which fuses an N-terminal peptide segment (His-tag) containing 6 histidine residues to the recombinant protein. The purified fusion proteins, Vp His::L18 and Ec His::L18, were both found to bind to either the Vp 5S or Ec 5S rRNAs in vitro. Vp His::L18 protein was also shown to incorporate into Ec ribosomes in vivo. This His-tag strategy likely will have general applicability for the study of ribosomal proteins in vitro and in vivo.

  13. The protein composition of reconstituted 30S ribosomal subunits: the effects of single protein omission.


    Buck, M A; Olah, T V; Perrault, A R; Cooperman, B S


    Using reverse phase HPLC, we have been able to quantify the protein compositions of reconstituted 30S ribosomal subunits, formed either with the full complement of 30S proteins in the reconstitution mix or with a single protein omitted. We denote particles formed in the latter case as SPORE (single protein omission reconstitution) particles. An important goal in 30S reconstitution studies is the formation of reconstituted subunits having uniform protein composition, preferably corresponding to one copy of each protein per reconstituted particle. Here we describe procedures involving variation of the protein:rRNA ratio that approach this goal. In SPORE particles the omission of one protein often results in the partial loss in uptake of other proteins. We also describe procedures to increase the uptake of such proteins into SPORE particles, thus enhancing the utility of the SPORE approach in defining the role of specific proteins in 30S structure and function. The losses of proteins other than the omitted protein provide a measure of protein:protein interaction within the 30S subunit. Most of these losses are predictable on the basis of other such measures. However, we do find evidence for several long-range protein:protein interactions (S6:S3, S6:S12, S10:S16, and S6:S4) that have not been described previously.

  14. Yeast ribosomal protein L7 and its homologue Rlp7 are simultaneously present at distinct sites on pre-60S ribosomal particles

    PubMed Central

    Babiano, Reyes; Badis, Gwenael; Saveanu, Cosmin; Namane, Abdelkader; Doyen, Antonia; Díaz-Quintana, Antonio; Jacquier, Alain; Fromont-Racine, Micheline; de la Cruz, Jesús


    Ribosome biogenesis requires >300 assembly factors in Saccharomyces cerevisiae. Ribosome assembly factors Imp3, Mrt4, Rlp7 and Rlp24 have sequence similarity to ribosomal proteins S9, P0, L7 and L24, suggesting that these pre-ribosomal factors could be placeholders that prevent premature assembly of the corresponding ribosomal proteins to nascent ribosomes. However, we found L7 to be a highly specific component of Rlp7-associated complexes, revealing that the two proteins can bind simultaneously to pre-ribosomal particles. Cross-linking and cDNA analysis experiments showed that Rlp7 binds to the ITS2 region of 27S pre-rRNAs, at two sites, in helix III and in a region adjacent to the pre-rRNA processing sites C1 and E. However, L7 binds to mature 25S and 5S rRNAs and cross-linked predominantly to helix ES7Lb within 25S rRNA. Thus, despite their predicted structural similarity, our data show that Rlp7 and L7 clearly bind at different positions on the same pre-60S particles. Our results also suggest that Rlp7 facilitates the formation of the hairpin structure of ITS2 during 60S ribosomal subunit maturation. PMID:23945946

  15. Stochastic theory of protein synthesis and polysome: ribosome profile on a single mRNA transcript.


    Sharma, Ajeet K; Chowdhury, Debashish


    The process of polymerizing a protein by a ribosome, using a messenger RNA (mRNA) as the corresponding template, is called translation. Ribosome may be regarded as a molecular motor for which the mRNA template serves also as the track. Often several ribosomes may translate the same (mRNA) simultaneously. The ribosomes bound simultaneously to a single mRNA transcript are the members of a polyribosome (or, simply, polysome). Experimentally measured polysome profile gives the distribution of polysome sizes. Recently a breakthrough in determining the instantaneous positions of the ribosomes on a given mRNA track has been achieved and the technique is called ribosome profiling (Ingolia et al., 2009; Guo et al., 2010). Motivated by the success of these techniques, we have studied the spatio-temporal organization of ribosomes by extending a theoretical model that we have reported elsewhere (Sharma and Chowdhury, 2011). This extended version of our model incorporates not only (i) mechano-chemical cycle of individual ribomes, and (ii) their steric interactions, but also (iii) the effects of (a) kinetic proofreading, (b) translational infidelity, (c) ribosome recycling, and (d) sequence inhomogeneities. The theoretical framework developed here will serve in guiding further experiments and in analyzing the data to gain deep insight into various kinetic processes involved in translation.

  16. The Up-Regulation of Ribosomal Proteins Further Regulates Protein Expression Profile in Female Schistosoma japonicum after Pairing

    PubMed Central

    Sun, Jun; Li, Chen; Wang, Suwen


    Background Pairing of Schistosoma males and females leads to and maintains female sexual maturation. However, the mechanism by which pairing facilitates sexual maturation of females is not clear. An increasing body of evidence suggests that ribosomal proteins have regulatory rather than constitutive roles in protein translation. Methodology/Principal Findings To investigate the effect of ribosome regulation on female sex maturation, Solexa and iTRAQ techniques were used to analyze the relationship between ribosomal gene or protein expression and sexual development of Schistosoma females. In the present study, considerably higher number of ribosomal genes or proteins were found to be differentially expressed in paired 23-day-old females. Moreover, mature female-specific proteins associated with egg production, such as ferritin-1 heavy chain and superoxide dismutase, were selectively highly expressed in paired females, rather than higher level of protein synthesis of all transcripts compared with those in unpaired 23-day-old females. Furthermore, other developmental stages were utilized to investigate different expression pattern of ribosomal proteins in females by analysing 18-day-old female schistosomula from single- or double-sex infections to determine the relationship between ribosomal protein expression pattern and development. Results showed that undeveloped 18-day-old females from single- and double-sex infections, as well as 23-day-old unpaired females, possessed similar ribosomal protein expression patterns, which were distinct from those in 23-day-old paired females. Conclusions/Significance Our findings reveal that the pairing of females and males triggers a specialized ribosomal protein expression profile which further regulates the protein profile for sexual maturation in Schistosoma japonicum, based on its gene expression profile. PMID:26070205

  17. Enacyloxin IIa, an inhibitor of protein biosynthesis that acts on elongation factor Tu and the ribosome.


    Cetin, R; Krab, I M; Anborgh, P H; Cool, R H; Watanabe, T; Sugiyama, T; Izaki, K; Parmeggiani, A


    This work analyzes the action of enacyloxin Ila, an inhibitor of bacterial protein biosynthesis. Enacyloxin IIa [IC50 on poly(Phe) synthesis approximately 70 nM] is shown to affect the interaction between elongation factor (EF) Tu and GTP or GDP; in particular, the dissociation of EF-Tu-GTP is strongly retarded, causing the Kd of EF- Tu-GTP to decrease from 500 to 0.7 nM. In its presence, the migration velocity of both GTP- and GDP-bound EF-Tu on native PAGE is increased. The stimulation of EF-Tu-GDP dissociation by EF-Ts is inhibited. EF- Tu-GTP can still form a stable complex with aminoacyl-tRNA (aa-tRNA), but it no longer protects aa-tRNA against spontaneous deacylation, showing that the EF-Tu-GTP orientation with respect to the 3' end of aa-tRNA is modified. However, the EF-Tu-dependent binding of aa-tRNA to the ribosomal A-site is impaired only slightly by the antibiotic and the activity of the peptidyl-transferase center, as determined by puromycin reactivity, is not affected. In contrast, the C-terminal incorporation of Phe into poly(Phe)-tRNA bound to the P-site is inhibited, an effect that is observed if Phe-tRNA is bound to the A-site nonenzymatically as well. Thus, enacyloxin IIa can affect both EF-Tu and the ribosomal A-site directly, inducing an anomalous positioning of aa-tRNA, that inhibits the incorporation of the amino acid into the polypeptide chain. Therefore, it is the first antibiotic found to have a dual specificity targeted to EF-Tu and the ribosome.

  18. Identification, characterization and structure analysis of a type I ribosome-inactivating protein from Sapium sebiferum (Euphorbiaceae)

    SciTech Connect

    Wu, Ying; Mao, Yingji; Jin, Shan; Hou, Jinyan; Du, Hua; Yang, Minglei; Wu, Lifang


    Ribosome-inactivating proteins (RIPs) are N-glycosidases (EC3.2.2.22) that universally inactivate the ribosome, thereby inhibiting protein biosynthesis. In this study, a novel type I RIPs named SEBIN was identified in Sapium sebiferum. Nuclear acid depurine experiment showed that SEBIN had rRNA N-Glycosidase activity. Further experiment indicated that SEBIN significantly inhibited Caenorhabditis elegans development as well as resulted in worm cell apoptosis. This is the first report to evaluate RIPs toxicity using C. elegans. We proposed that SEBIN may impaire C. elegans reproduction in a DNA-damage manner besides traditional protein synthesis inhibition approach. The predicted 3D structure was modeled using threading and ab initio modeling, and the r-RNA binding residue of SEBIN was identified through the protein-ligand docking approach. It showed the amino acid residues, Glu195, Asn81, Ala82, Tyr83, Glu164, Ser163, Ile159 and Arg167, played critical roles in catalytic process. Our results provided the theoretical foundation of structure–function relationships between enzymatic properties, toxicity and structural characterization of SEBIN. - Graphical abstract: Superposition of main chains of ricin (cyan) and SEBIN (brown), and adenine binding site residues of SEBIN. - Highlights: • A Ribosome-inactivating proteins gene (SEBIN) was isolated from Sapium sebiferum. • SEBIN had DNase activity besides widely reported ribosome inactivation via N-glycosidases activity. • SEBIN significantly inhibited Caenorhabditis elegans development in vivo. • SEBIN may impaire C. elegans reproduction in a DNA-damage manner with the aid of mutant strains hus-1 and clk-2. • The possible active sites between SEBIN and the adenine of rRNA were predicted.

  19. Structural basis for translational surveillance by the large ribosomal subunit-associated protein quality control complex

    PubMed Central

    Lyumkis, Dmitry; Oliveira dos Passos, Dario; Tahara, Erich B.; Webb, Kristofor; Bennett, Eric J.; Vinterbo, Staal; Potter, Clinton S.; Carragher, Bridget; Joazeiro, Claudio A. P.


    All organisms have evolved mechanisms to manage the stalling of ribosomes upon translation of aberrant mRNA. In eukaryotes, the large ribosomal subunit-associated quality control complex (RQC), composed of the listerin/Ltn1 E3 ubiquitin ligase and cofactors, mediates the ubiquitylation and extraction of ribosome-stalled nascent polypeptide chains for proteasomal degradation. How RQC recognizes stalled ribosomes and performs its functions has not been understood. Using single-particle cryoelectron microscopy, we have determined the structure of the RQC complex bound to stalled 60S ribosomal subunits. The structure establishes how Ltn1 associates with the large ribosomal subunit and properly positions its E3-catalytic RING domain to mediate nascent chain ubiquitylation. The structure also reveals that a distinguishing feature of stalled 60S particles is an exposed, nascent chain-conjugated tRNA, and that the Tae2 subunit of RQC, which facilitates Ltn1 binding, is responsible for selective recognition of stalled 60S subunits. RQC components are engaged in interactions across a large span of the 60S subunit surface, connecting the tRNA in the peptidyl transferase center to the distally located nascent chain tunnel exit. This work provides insights into a mechanism linking translation and protein degradation that targets defective proteins immediately after synthesis, while ignoring nascent chains in normally translating ribosomes. PMID:25349383

  20. Mapping of the RNA recognition site of Escherichia coli ribosomal protein S7.

    PubMed Central

    Robert, F; Gagnon, M; Sans, D; Michnick, S; Brakier-Gingras, L


    Bacterial ribosomal protein S7 initiates the folding of the 3' major domain of 16S ribosomal RNA by binding to its lower half. The X-ray structure of protein S7 from thermophilic bacteria was recently solved and found to be a modular structure, consisting of an alpha-helical domain with a beta-ribbon extension. To gain further insights into its interaction with rRNA, we cloned the S7 gene from Escherichia coli K12 into a pET expression vector and introduced 4 deletions and 12 amino acid substitutions in the protein sequence. The binding of each mutant to the lower half of the 3' major domain of 16S rRNA was assessed by filtration on nitrocellulose membranes. Deletion of the N-terminal 17 residues or deletion of the B hairpins (residues 72-89) severely decreased S7 affinity for the rRNA. Truncation of the C-terminal portion (residues 138-178), which includes part of the terminal alpha-helix, significantly affected S7 binding, whereas a shorter truncation (residues 148-178) only marginally influenced its binding. Severe effects were also observed with several strategic point mutations located throughout the protein, including Q8A and F17G in the N-terminal region, and K35Q, G54S, K113Q, and M115G in loops connecting the alpha-helices. Our results are consistent with the occurrence of several sites of contact between S7 and the 16S rRNA, in line with its role in the folding of the 3' major domain. PMID:11105763

  1. Mapping of the RNA recognition site of Escherichia coli ribosomal protein S7.


    Robert, F; Gagnon, M; Sans, D; Michnick, S; Brakier-Gingras, L


    Bacterial ribosomal protein S7 initiates the folding of the 3' major domain of 16S ribosomal RNA by binding to its lower half. The X-ray structure of protein S7 from thermophilic bacteria was recently solved and found to be a modular structure, consisting of an alpha-helical domain with a beta-ribbon extension. To gain further insights into its interaction with rRNA, we cloned the S7 gene from Escherichia coli K12 into a pET expression vector and introduced 4 deletions and 12 amino acid substitutions in the protein sequence. The binding of each mutant to the lower half of the 3' major domain of 16S rRNA was assessed by filtration on nitrocellulose membranes. Deletion of the N-terminal 17 residues or deletion of the B hairpins (residues 72-89) severely decreased S7 affinity for the rRNA. Truncation of the C-terminal portion (residues 138-178), which includes part of the terminal alpha-helix, significantly affected S7 binding, whereas a shorter truncation (residues 148-178) only marginally influenced its binding. Severe effects were also observed with several strategic point mutations located throughout the protein, including Q8A and F17G in the N-terminal region, and K35Q, G54S, K113Q, and M115G in loops connecting the alpha-helices. Our results are consistent with the occurrence of several sites of contact between S7 and the 16S rRNA, in line with its role in the folding of the 3' major domain.

  2. In vitro expression of Escherichia coli ribosomal protein genes: autogenous inhibition of translation.

    PubMed Central

    Yates, J L; Arfsten, A E; Nomura, M


    Escherichia coli ribosomal protein L1 (0.5 micro M) was found to inhibit the synthesis of both proteins of the L11 operon, L11 and L1, but not the synthesis of other proteins directed by lambda rifd 18 DNA. Similarly, S4 (1 micro M) selectively inhibited the synthesis of three proteins of the alpha operon, S13, S11, and S4, directed by lambda spcI DNA or a restriction enzyme fragment obtained from this DNA. S8 (3.6 micro M) also showed preferential inhibitory effects on the synthesis of some proteins encoded in the spc operon, L24 and L5 (and probably S14 and S8), directed by lambda spcl DNA or a restriction enzyme fragment carrying the genes for these proteins. The inhibitory effect of L1 was observed only with L1 and not with other proteins examined, including S4 and S8. Similarly, the effect of S4 was not observed with L1 or S8, and that of S8 was not seen with L1 or S4. Inhibition was shown to take place at the level of translation rather than transcription. Thus, at least some ribosomal proteins (L1 S4, and S8) have the ability to cause selective translational inhibition of the synthesis of certain ribosomal proteins whose genes are in the same operon as their own. These results support the hypothesis that certain free ribosomal proteins not assembled into ribosomes act as "autogenous" feedback inhibitors to regulate the synthesis of ribosomal proteins. Images PMID:6445562

  3. SRY interacts with ribosomal proteins S7 and L13a in nuclear speckles.


    Sato, Youichi; Yano, Shojiro; Ewis, Ashraf A; Nakahori, Yutaka


    The SRY (sex-determining region on the Y chromosome) is essential for male development; however, the molecular mechanism by which the SRY induces testis development is still unclear. To elucidate the mechanism of testis development, we identified SRY-interacting proteins using a yeast two-hybrid system. We found two ribosomal proteins, RPS7 (ribosomal protein S7) and RPL13a (ribosomal protein L13a) that interact with the HMG (high-mobility group) box domain of SRY. Furthermore, we confirmed the intracellular distributions of RPS7, RPL13a and SRY and found that the three proteins were co-expressed in COS1 cells. SRY, RPS7 and RPL13a were co-localized in nuclear speckles. These findings suggest that SRY plays an important role in activities associated with nuclear speckles via an unknown mechanism.

  4. Developmentally regulated phosphorylation-dephosphorylation of ribosomal proteins from maize embryonic axes

    SciTech Connect

    Perez-Mendez, A.; Aguilar, R.; Sanchez-de-Jimenez, E.


    Previous work in our lab suggests translational control during maize germination. To test this possibility the present research focuses on the phosphorylated status of the ribosomal proteins of maize axes during germination. Ribosomes from embryonic axes incubated for different periods were in vitro or in vivo labeled by 1h-pulse for {sup 32}P orthophosphate. Electrophoretic analysis of the ribosomal proteins and autoradiographs revealed: (a) in vitro, several {sup 32}P bands and very similar patterns for all stages tested (0 to 24h); in vivo, less number of labeled bands and a changing pattern from 3 to 24h of incubation. A protein of 30,900 MW did not appear phosphorylated until 8h of incubation, while a 17,000 MW protein was strongly labeled at 3h and fastly dephosphorylated toward 24h. Phosphorylated proteins belong to both the small and the large subunits. The implication of this process will be discussed.

  5. Alcoholic Liver Disease and the Mitochondrial Ribosome

    PubMed Central

    Cahill, Alan; Sykora, Peter


    Summary Chronic alcohol consumption has been shown to severely compromise mitochondrial protein synthesis. Hepatic mitochondria isolated from alcoholic animals contain decreased levels of respiratory complexes and display depressed respiration rates when compared to pair-fed controls. One underlying mechanism for this involves ethanol-elicited alterations in the structural and functional integrity of the mitochondrial ribosome. Ethanol feeding results in ribosomal changes that include decreased sedimentation rates, larger hydrodynamic volumes, increased levels of unassociated subunits and changes in the levels of specific ribosomal proteins. The methods presented in this chapter detail how to isolate mitochondrial ribosomes, determine ribosomal activity, separate ribosomes into nucleic acid and protein, and perform two-dimensional nonequilibrium pH gradient electrophoretic polyacrylamide gel electrophoresis to separate and subsequently identify mitochondrial ribosomal proteins. PMID:18369931

  6. Dosage Sensitivity of RPL9 and Concerted Evolution of Ribosomal Protein Genes in Plants

    PubMed Central

    Devis, Deborah; Firth, Sue M.; Liang, Zhe; Byrne, Mary E.


    The ribosome in higher eukaryotes is a large macromolecular complex composed of four rRNAs and eighty different ribosomal proteins. In plants, each ribosomal protein is encoded by multiple genes. Duplicate genes within a family are often necessary to provide a threshold dose of a ribosomal protein but in some instances appear to have non-redundant functions. Here, we addressed whether divergent members of the RPL9 gene family are dosage sensitive or whether these genes have non-overlapping functions. The RPL9 family in Arabidopsis thaliana comprises two nearly identical members, RPL9B and RPL9C, and a more divergent member, RPL9D. Mutations in RPL9C and RPL9D genes lead to delayed growth early in development, and loss of both genes is embryo lethal, indicating that these are dosage-sensitive and redundant genes. Phylogenetic analysis of RPL9 as well as RPL4, RPL5, RPL27a, RPL36a, and RPS6 family genes in the Brassicaceae indicated that multicopy ribosomal protein genes have been largely retained following whole genome duplication. However, these gene families also show instances of tandem duplication, small scale deletion, and evidence of gene conversion. Furthermore, phylogenetic analysis of RPL9 genes in angiosperm species showed that genes within a species are more closely related to each other than to RPL9 genes in other species, suggesting ribosomal protein genes undergo convergent evolution. Our analysis indicates that ribosomal protein gene retention following whole genome duplication contributes to the number of genes in a family. However, small scale rearrangements influence copy number and likely drive concerted evolution of these dosage-sensitive genes. PMID:26734020

  7. The catalytic subunit of shiga-like toxin 1 interacts with ribosomal stalk proteins and is inhibited by their conserved C-terminal domain.


    McCluskey, Andrew J; Poon, Gregory M K; Bolewska-Pedyczak, Eleonora; Srikumar, Tharan; Jeram, Stanley M; Raught, Brian; Gariépy, Jean


    Shiga-like toxin 1 (SLT-1) is a type II ribosome-inactivating protein; its A(1) domain blocks protein synthesis in eukaryotic cells by catalyzing the depurination of a single adenine base in 28 S rRNA. The molecular mechanism leading to this site-specific depurination event is thought to involve interactions with eukaryotic ribosomal proteins. Here, we present evidence that the A(1) chain of SLT-1 binds to the ribosomal proteins P0, P1, and P2. These proteins were identified from a HeLa cell lysate by tandem mass spectrometry, and subsequently confirmed to bind to SLT-1 A(1) chain by yeast-two-hybrid and pull-down experiments using candidate full-length proteins. Moreover, the removal of the last 17 amino acids of either protein P1 or P2 abolishes the interaction with the A(1) chain, whereas P0, lacking this common C terminus, still binds to the A(1) domain. In vitro pull-down experiments using fusion protein-tagged C-terminal peptides corresponding to the common 7, 11, and 17 terminal residues of P1 and P2 confirmed that the A(1) chain of SLT-1 as well as the A chain of ricin bind to this shared C-terminal peptide motif. More importantly, a synthetic peptide corresponding to the 17 amino acid C terminus of P1 and P2 was shown to inhibit the ribosome-inactivating function of the A(1) chain of SLT-1 in an in vitro transcription and translation-coupled assay. These results suggest a role for the ribosomal stalk in aiding the A(1) chain of SLT-1 and other type II ribosome-inactivating proteins in localizing its catalytic domain near the site of depurination in the 28 S rRNA. PMID:18358491

  8. Modification of Escherichia coli ribosomes with the fluorescent reagent N-[[(iodoacetyl)amino]ethyl]-5-naphthylamine-1-sulfonic acid. Identification of derivatized L31' and studies on its intraribosomal properties.


    Hanas, J S; Simpson, M V


    N-[[(Iodoacetyl)amino]ethyl]-5-naphthylamine-1-sulfonic acid (IAEDANS) is a fluorescent reagent which reacts covalently with the free thiol groups of proteins. When the reagent is reacted with the Escherichia coli ribosome under mild conditions, gel electrophoresis shows modification of predominantly two proteins, S18 and L31', which become labeled to an equal extent. When the native (i.e., untreated) ribosome is dissociated into 30S and 50S subunits, only the 30S ribosomal protein S18 reacts with IAEDANS despite the fact that L31' is still present on the large subunit. Upon heat activation of the subunits, a procedure which alters subunit conformation, S18 plus a number of higher molecular weight proteins is modified, but not L31'; the latter reacts with IAEDANS only in the 70S ribosome or when it is free. In contrast to the relatively stable association of L31' with native or with dissociated ribosomes, dissociation of N-[(acetylamino)ethyl]-5-naphthylaminesulfonic acid (AEDANS)-treated ribosomes weakens the AEDANS-L31'/ribosome interaction, resulting, upon gel filtration analysis, in ribosomes devoid of this derivatized protein.

  9. The N-terminal extension of yeast ribosomal protein L8 is involved in two major remodeling events during late nuclear stages of 60S ribosomal subunit assembly.


    Tutuncuoglu, Beril; Jakovljevic, Jelena; Wu, Shan; Gao, Ning; Woolford, John L


    Assaying effects on pre-rRNA processing and ribosome assembly upon depleting individual ribosomal proteins (r-proteins) provided an initial paradigm for assembly of eukaryotic ribosomes in vivo-that each structural domain of ribosomal subunits assembles in a hierarchical fashion. However, two features suggest that a more complex pathway may exist: (i) Some r-proteins contain extensions that reach long distances across ribosomes to interact with multiple rRNA domains as well as with other r-proteins. (ii) Individual r-proteins may assemble in a stepwise fashion. For example, the globular domain of an r-protein might assemble separately from its extensions. Thus, these extensions might play roles in assembly that could not be revealed by depleting the entire protein. Here, we show that deleting or mutating extensions of r-proteins L7 (uL30) and L35 (uL29) from yeast reveal important roles in early and middle steps during 60S ribosomal subunit biogenesis. Detailed analysis of the N-terminal terminal extension of L8 (eL8) showed that it is necessary for late nuclear stages of 60S subunit assembly involving two major remodeling events: removal of the ITS2 spacer; and reorganization of the central protuberance (CP) containing 5S rRNA and r-proteins L5 (uL18) and L11 (uL5). Mutations in the L8 extension block processing of 7S pre-rRNA, prevent release of assembly factors Rpf2 and Rrs1 from pre-ribosomes, which is required for rotation of the CP, and block association of Sda1, the Rix1 complex, and the Rea1 ATPase involved in late steps of remodeling. PMID:27390266

  10. The N-terminal extension of yeast ribosomal protein L8 is involved in two major remodeling events during late nuclear stages of 60S ribosomal subunit assembly.


    Tutuncuoglu, Beril; Jakovljevic, Jelena; Wu, Shan; Gao, Ning; Woolford, John L


    Assaying effects on pre-rRNA processing and ribosome assembly upon depleting individual ribosomal proteins (r-proteins) provided an initial paradigm for assembly of eukaryotic ribosomes in vivo-that each structural domain of ribosomal subunits assembles in a hierarchical fashion. However, two features suggest that a more complex pathway may exist: (i) Some r-proteins contain extensions that reach long distances across ribosomes to interact with multiple rRNA domains as well as with other r-proteins. (ii) Individual r-proteins may assemble in a stepwise fashion. For example, the globular domain of an r-protein might assemble separately from its extensions. Thus, these extensions might play roles in assembly that could not be revealed by depleting the entire protein. Here, we show that deleting or mutating extensions of r-proteins L7 (uL30) and L35 (uL29) from yeast reveal important roles in early and middle steps during 60S ribosomal subunit biogenesis. Detailed analysis of the N-terminal terminal extension of L8 (eL8) showed that it is necessary for late nuclear stages of 60S subunit assembly involving two major remodeling events: removal of the ITS2 spacer; and reorganization of the central protuberance (CP) containing 5S rRNA and r-proteins L5 (uL18) and L11 (uL5). Mutations in the L8 extension block processing of 7S pre-rRNA, prevent release of assembly factors Rpf2 and Rrs1 from pre-ribosomes, which is required for rotation of the CP, and block association of Sda1, the Rix1 complex, and the Rea1 ATPase involved in late steps of remodeling.

  11. Ribosomal Synthesis of Macrocyclic Peptides in Vitro and in Vivo Mediated by Genetically Encoded Amino-Thiol Unnatural Amino Acids

    PubMed Central

    Frost, John R.; Jacob, Nicholas T.; Papa, Louis J.; Owens, Andrew E.


    A versatile method for orchestrating the formation of side-chain-to-tail cyclic peptides from ribosomally derived polypeptide precursors is reported. Upon ribosomal incorporation into intein-containing precursor proteins, designer unnatural amino acids bearing side-chain 1,3- or 1,2-aminothiol functionalities are able to promote the cyclization of a downstream target peptide sequence via a C-terminal ligation/ring contraction mechanism. Using this approach, peptide macrocycles of variable size and composition could be generated in a pH-triggered manner in vitro, or directly in living bacterial cells. This methodology furnishes a new platform for the creation and screening of genetically encoded libraries of conformationally constrained peptides. This strategy was applied to identify and isolate a low micromolar streptavidin binder (KD = 1.1 µM) from a library of cyclic peptides produced in E. coli, thereby illustrating its potential toward aiding the discovery of functional peptide macrocycles. PMID:25933125

  12. Identification of a mammalian mitochondrial homolog of ribosomal protein S7.


    Cavdar Koc, E; Blackburn, K; Burkhart, W; Spremulli, L L


    Bovine mitochondrial small subunit ribosomal proteins were separated by two-dimensional electrophoresis. The region containing the most basic protein(s) was excised and the protein(s) present subjected to in-gel digestion with trypsin. Electrospray tandem mass spectrometry was used to provide sequence information on some of the peptide products. Searches of the human EST database using the sequence of the longest peptide analyzed indicated that this peptide was from the mammalian mitochondrial homolog of prokaryotic ribosomal protein S7 (MRP S7(human)). MRP S7(human) is a 28-kDa protein with a pI of 10. Significant homology to bacterial S7 is observed especially in the C-terminal half of the protein. Surprisingly, MRP S7(human) shows less homology to the corresponding mitochondrial proteins from plants and fungi than to bacterial S7.

  13. Ribosome profiling reveals pervasive translation outside of annotated protein-coding genes.


    Ingolia, Nicholas T; Brar, Gloria A; Stern-Ginossar, Noam; Harris, Michael S; Talhouarne, Gaëlle J S; Jackson, Sarah E; Wills, Mark R; Weissman, Jonathan S


    Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5' UTRs and long noncoding RNAs (lncRNAs). Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs). Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV) infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences. PMID:25159147

  14. Protein-RNA Dynamics in the Central Junction Control 30S Ribosome Assembly.


    Baker, Kris Ann; Lamichhane, Rajan; Lamichhane, Tek; Rueda, David; Cunningham, Philip R


    Interactions between ribosomal proteins (rproteins) and ribosomal RNA (rRNA) facilitate the formation of functional ribosomes. S15 is a central domain primary binding protein that has been shown to trigger a cascade of conformational changes in 16S rRNA, forming the functional structure of the central domain. Previous biochemical and structural studies in vitro have revealed that S15 binds a three-way junction of helices 20, 21, and 22, including nucleotides 652-654 and 752-754. All junction nucleotides except 653 are highly conserved among the Bacteria. To identify functionally important motifs within the junction, we subjected nucleotides 652-654 and 752-754 to saturation mutagenesis and selected and analyzed functional mutants. Only 64 mutants with greater than 10% ribosome function in vivo were isolated. S15 overexpression complemented mutations in the junction loop in each of the partially active mutants, although mutations that produced inactive ribosomes were not complemented by overexpression of S15. Single-molecule Förster or fluorescence resonance energy transfer (smFRET) was used to study the Mg(2+)- and S15-induced conformational dynamics of selected junction mutants. Comparison of the structural dynamics of these mutants with the wild type in the presence and absence of S15 revealed specific sequence and structural motifs in the central junction that are important in ribosome function. PMID:27192112

  15. Cryo-electron microscopic structure of SecA protein bound to the 70S ribosome.


    Singh, Rajkumar; Kraft, Christian; Jaiswal, Rahul; Sejwal, Kushal; Kasaragod, Vikram Babu; Kuper, Jochen; Bürger, Jörg; Mielke, Thorsten; Luirink, Joen; Bhushan, Shashi


    SecA is an ATP-dependent molecular motor pumping secretory and outer membrane proteins across the cytoplasmic membrane in bacteria. SecA associates with the protein-conducting channel, the heterotrimeric SecYEG complex, in a so-called posttranslational manner. A recent study further showed binding of a monomeric state of SecA to the ribosome. However, the true oligomeric state of SecA remains controversial because SecA can also form functional dimers, and high-resolution crystal structures exist for both the monomer and the dimer. Here we present the cryo-electron microscopy structures of Escherichia coli SecA bound to the ribosome. We show that not only a monomeric SecA binds to the ribosome but also that two copies of SecA can be observed that form an elongated dimer. Two copies of SecA completely surround the tunnel exit, providing a unique environment to the nascent polypeptides emerging from the ribosome. We identified the N-terminal helix of SecA required for a stable association with the ribosome. The structures indicate a possible function of the dimeric form of SecA at the ribosome. PMID:24443566

  16. Transcriptional effects of polyamines on ribosomal proteins and on polyamine-synthesizing enzymes in Escherichia coli.


    Huang, S C; Panagiotidis, C A; Canellakis, E S


    We find that the transcription of various ribosomal proteins can be differentially affected by polyamines and by changes in growth rates. Using strain MG1655 of Escherichia coli K-12 (F-, lambda-), we have determined the effects of polyamines and changes in growth rate on the transcription of several ribosomal genes and the polyamine-synthesizing enzymes ornithine decarboxylase (L-ornithine carboxy-lyase; EC and arginine decarboxylase (L-arginine carboxylyase; EC Ribosomal proteins S20 and L34 can be differentiated from the other ribosomal proteins studied; the transcription of S20 and L34 is especially sensitive to polyamines and less sensitive to changes in growth rates. In contrast, the transcription of S10, S15, S19, L2, L4, L20, L22, and L23 is insensitive to polyamines although it is particularly sensitive to changes in growth rates. Like S20 and L34, the transcription of ornithine decarboxylase and arginine decarboxylase is especially sensitive to polyamines. Polyamines specifically enhance the transcription of ribosomal proteins S20 and L34, and decrease that of ornithine decarboxylase and arginine decarboxylase. It is evident that polyamines can exert both positive and negative regulation of gene expression in E. coli that can be differentiated from the effects caused by changes in growth rates.

  17. Pokeweed Antiviral Protein, a Ribosome Inactivating Protein: Activity, Inhibition and Prospects

    PubMed Central

    Domashevskiy, Artem V.; Goss, Dixie J.


    Viruses employ an array of elaborate strategies to overcome plant defense mechanisms and must adapt to the requirements of the host translational systems. Pokeweed antiviral protein (PAP) from Phytolacca americana is a ribosome inactivating protein (RIP) and is an RNA N-glycosidase that removes specific purine residues from the sarcin/ricin (S/R) loop of large rRNA, arresting protein synthesis at the translocation step. PAP is thought to play an important role in the plant’s defense mechanism against foreign pathogens. This review focuses on the structure, function, and the relationship of PAP to other RIPs, discusses molecular aspects of PAP antiviral activity, the novel inhibition of this plant toxin by a virus counteraction—a peptide linked to the viral genome (VPg), and possible applications of RIP-conjugated immunotoxins in cancer therapeutics. PMID:25635465

  18. Pokeweed antiviral protein, a ribosome inactivating protein: activity, inhibition and prospects.


    Domashevskiy, Artem V; Goss, Dixie J


    Viruses employ an array of elaborate strategies to overcome plant defense mechanisms and must adapt to the requirements of the host translational systems. Pokeweed antiviral protein (PAP) from Phytolacca americana is a ribosome inactivating protein (RIP) and is an RNA N-glycosidase that removes specific purine residues from the sarcin/ricin (S/R) loop of large rRNA, arresting protein synthesis at the translocation step. PAP is thought to play an important role in the plant's defense mechanism against foreign pathogens. This review focuses on the structure, function, and the relationship of PAP to other RIPs, discusses molecular aspects of PAP antiviral activity, the novel inhibition of this plant toxin by a virus counteraction-a peptide linked to the viral genome (VPg), and possible applications of RIP-conjugated immunotoxins in cancer therapeutics.

  19. Gene clusters for ribosomal proteins in the mitochondrial genome of a liverwort, Marchantia polymorpha.

    PubMed Central

    Takemura, M; Oda, K; Yamato, K; Ohta, E; Nakamura, Y; Nozato, N; Akashi, K; Ohyama, K


    We detected 16 genes for ribosomal proteins in the complete sequence of the mitochondrial DNA from a liverwort, Marchantia polymorpha. The genes formed two major clusters, rps12-rps7 and rps10-rpl2-rps19-rps3-rpl16-rpl5- rps14-rps8- rpl6-rps13-rps11-rps1, very similar in organization to Escherichia coli ribosomal protein operons (str and S10-spc-alpha operons, respectively). In contrast, rps2 and rps4 genes were located separately in the liverwort mitochondrial genome (the latter was part of the alpha operon in E. coli). Furthermore, several ribosomal proteins encoded by the liverwort mitochondrial genome differed substantially in size from their counterparts in E. coli and liverwort chloroplast. PMID:1620617

  20. Characterization of the Interaction between Hantavirus Nucleocapsid Protein (N) and Ribosomal Protein S19 (RPS19)*

    PubMed Central

    Cheng, Erdong; Haque, Absarul; Rimmer, Mary Ashley; Hussein, Islam T. M.; Sheema, Sheema; Little, Alex; Mir, Mohammad A.


    Hantaviruses, members of the Bunyaviridae family, are negative-stranded emerging RNA viruses and category A pathogens that cause serious illness when transmitted to humans through aerosolized excreta of infected rodent hosts. Hantaviruses have evolved a novel translation initiation mechanism, operated by nucleocapsid protein (N), which preferentially facilitates the translation of viral mRNAs. N binds to the ribosomal protein S19 (RPS19), a structural component of the 40 S ribosomal subunit. In addition, N also binds to both the viral mRNA 5′ cap and a highly conserved triplet repeat sequence of the viral mRNA 5′ UTR. The simultaneous binding of N at both the terminal cap and the 5′ UTR favors ribosome loading on viral transcripts during translation initiation. We characterized the binding between N and RPS19 and demonstrate the role of the N-RPS19 interaction in N-mediated translation initiation mechanism. We show that N specifically binds to RPS19 with high affinity and a binding stoichiometry of 1:1. The N-RPS19 interaction is an enthalpy-driven process. RPS19 undergoes a conformational change after binding to N. Using T7 RNA polymerase, we synthesized the hantavirus S segment mRNA, which matches the transcript generated by the viral RNA-dependent RNA polymerase in cells. We show that the N-RPS19 interaction plays a critical role in the translation of this mRNA both in cells and rabbit reticulocyte lysates. Our results demonstrate that the N-mediated translation initiation mechanism, which lures the host translation machinery for the preferential translation of viral transcripts, primarily depends on the N-RPS19 interaction. We suggest that the N-RPS19 interaction is a novel target to shut down the N-mediated translation strategy and hence virus replication in cells. PMID:21296889

  1. Investigation of the regulatory function of archaeal ribosomal protein L4.


    Mikhaylina, A O; Kostareva, O S; Sarskikh, A V; Fedorov, R V; Piendl, W; Garber, M B; Tishchenko, S V


    Ribosomal protein L4 is a regulator of protein synthesis in the Escherichia coli S10 operon, which contains genes of 11 ribosomal proteins. In this work, we have investigated regulatory functions of ribosomal protein L4 of the thermophilic archaea Methanococcus jannaschii. The S10-like operon from M. jannaschii encodes not 11, but only five ribosomal proteins (L3, L4, L23, L2, S19), and the first protein is L3 instead of S10. We have shown that MjaL4 and its mutant form lacking an elongated loop specifically inhibit expression of the first gene of the S10-like operon from the same organism in a coupled transcription-translation system in vitro. By deletion analysis, an L4-binding regulatory site has been found on MjaL3 mRNA, and a fragment of mRNA with length of 40 nucleotides has been prepared that is necessary and sufficient for the specific interaction with the MjaL4 protein.

  2. Study of mammalian ribosomal protein reactivity in situ. II. - Effect of glutaraldehyde and salts.


    Reboud, A M; Buisson, M; Madjar, J J; Reboud, J P


    Results concerning ribosomal protein sensitivity to glutaraldehyde were compared to protein depletion studies using LiCl centrifugation. The relative degree of reactivity of the different proteins was determined by two-dimensional acrylamide gel electrophoresis, and the activity of the reacted subunits was measured. The results obtained mostly confirmed the studies of methoxynitrotropone reactivity reported earlier. For example, L16, L25, L29, L30, L31, S18, S20 appeared to be definitely exposed to both NH2-reagents and LiCl. Some interesting points emerged from this study regarding protein topography in both subunits: (1) with few exceptions, almost all ribosomal proteins were accessible to the surrounding medium; (2) the sensitivity of the 40S proteins to the three reagents used was lower than was that of the 60S proteins; (3) the reactivities of the subunit components changed when subunits were associated: L8 was more reactive with glutaraldehyde in 60S subunits than in 80S ribosomes. In contrast, S14, S15 and S19 were more exposed in ribosomes than in the 40S subunits.

  3. Promotion of viral internal ribosomal entry site-mediated translation under amino acid starvation.


    Licursi, Maria; Komatsu, Yumiko; Pongnopparat, Theerawat; Hirasawa, Kensuke


    Cap-dependent and internal ribosomal entry site (IRES)-mediated translation are regulated differently within cells. Viral IRES-mediated translation often remains active when cellular cap-dependent translation is severely impaired under cellular stresses induced by virus infection. To investigate how cellular stresses influence the efficiency of viral IRES-mediated translation, we used a bicistronic luciferase reporter construct harbouring IRES elements from the following viruses: encephalomyocarditis virus (EMCV), foot-and-mouth disease virus (FMDV), hepatitis C virus (HCV) or human rhinovirus (HRV). NIH3T3 cells transfected with these bicistronic reporter constructs were subjected to different cellular stresses. Increased translation initiation was only observed under amino acid starvation when EMCV or FMDV IRES elements were present. To identify cellular mechanisms that promoted viral IRES-mediated translation, we tested the involvement of eukaryotic initiation factor 4E-binding protein (4E-BP), general control non-depressed 2 (GCN2) and eukaryotic initiation factor 2B (eIF2B), as these are known to be modulated under amino acid starvation. Knockdown of 4E-BP1 impaired the promotion of EMCV and FMDV IRES-mediated translation under amino acid starvation, whereas GCN2 and eIF2B were not involved. To further investigate how 4E-BP1 regulates translation initiated by EMCV and FMDV IRES elements, we used a phosphoinositide kinase-3 inhibitor (LY294002), an mTOR inhibitor (Torin1) or leucine starvation to mimic 4E-BP1 dephosphorylation induced by amino acid starvation. 4E-BP1 dephosphorylation induced by the treatments was not sufficient to promote viral IRES-mediated translation. These results suggest that 4E-BP1 regulates EMCV and FMDV IRES-mediated translation under amino acid starvation, but not via its dephosphorylation. PMID:22302880

  4. Cochinin B, a novel ribosome-inactivating protein from the seeds of Momordica cochinchinensis.


    Chuethong, Juthamas; Oda, Kohei; Sakurai, Hiroaki; Saiki, Ikuo; Leelamanit, Wichet


    Cochinin B, a novel ribosome-inactivating protein (RIP) with a molecular weight of 28 kDa, was purified from the seeds of Momordica cochinchinensis (Cucurbitaceae). The isolation procedure entailed ammonium sulfate precipitation, cation-exchange chromatography on SP Sepharose column and size-exclusion chromatography on Superdex 75 column with a fast protein liquid chromatography (FPLC) system. The first twenty N-terminal amino acid residues of Cochinin B showed homology to type I RIPs from other Momordica species. The purified Cochinin B displayed a strong inhibitory activity on protein synthesis in the cell-free rabbit reticulocyte lysate system with IC50 of 0.36 nM. Furthermore, it exhibited N-glycosidase activity and cytotoxicity against Vero cell line with IC50 higher than 1540 nM. Interestingly, Cochinin B manifested strong anti-tumor activities on human cervical epithelial carcinoma (HeLa), human embryonic kidney (HEK293) and human small cell lung cancer (NCI-H187) cell lines with IC50 of 16.9, 114 and 574 nM, respectively. PMID:17329832

  5. Ribosomal protein S6 phosphorylation is controlled by TOR and modulated by PKA in Candida albicans.


    Chowdhury, Tahmeena; Köhler, Julia R


    TOR and PKA signaling pathways control eukaryotic cell growth and proliferation. TOR activity in model fungi, such as Saccharomyces cerevisiae, responds principally to nutrients, e.g., nitrogen and phosphate sources, which are incorporated into the growing cell mass; PKA signaling responds to the availability of the cells' major energy source, glucose. In the fungal commensal and pathogen, Candida albicans, little is known of how these pathways interact. Here, the signal from phosphorylated ribosomal protein S6 (P-S6) was defined as a surrogate marker for TOR-dependent anabolic activity in C. albicans. Nutritional, pharmacologic and genetic modulation of TOR activity elicited corresponding changes in P-S6 levels. The P-S6 signal corresponded to translational activity of a GFP reporter protein. Contributions of four PKA pathway components to anabolic activation were then examined. In high glucose concentrations, only Tpk2 was required to upregulate P-S6 to physiologic levels, whereas all four tested components were required to downregulate P-S6 in low glucose. TOR was epistatic to PKA components with respect to P-S6. In many host niches inhabited by C. albicans, glucose is scarce, with protein being available as a nitrogen source. We speculate that PKA may modulate TOR-dependent cell growth to a rate sustainable by available energy sources, when monomers of anabolic processes, such as amino acids, are abundant.

  6. Cochinin B, a novel ribosome-inactivating protein from the seeds of Momordica cochinchinensis.


    Chuethong, Juthamas; Oda, Kohei; Sakurai, Hiroaki; Saiki, Ikuo; Leelamanit, Wichet


    Cochinin B, a novel ribosome-inactivating protein (RIP) with a molecular weight of 28 kDa, was purified from the seeds of Momordica cochinchinensis (Cucurbitaceae). The isolation procedure entailed ammonium sulfate precipitation, cation-exchange chromatography on SP Sepharose column and size-exclusion chromatography on Superdex 75 column with a fast protein liquid chromatography (FPLC) system. The first twenty N-terminal amino acid residues of Cochinin B showed homology to type I RIPs from other Momordica species. The purified Cochinin B displayed a strong inhibitory activity on protein synthesis in the cell-free rabbit reticulocyte lysate system with IC50 of 0.36 nM. Furthermore, it exhibited N-glycosidase activity and cytotoxicity against Vero cell line with IC50 higher than 1540 nM. Interestingly, Cochinin B manifested strong anti-tumor activities on human cervical epithelial carcinoma (HeLa), human embryonic kidney (HEK293) and human small cell lung cancer (NCI-H187) cell lines with IC50 of 16.9, 114 and 574 nM, respectively.

  7. Expression of muscle-specific ribosomal protein L3-like impairs myotube growth†

    PubMed Central

    Chaillou, Thomas; Zhang, Xiping; McCarthy, John J.


    The ribosome has historically been considered to have no cell-specific function but rather serve in a “housekeeping” capacity. This view is being challenged by evidence showing that heterogeneity in the protein composition of the ribosome can lead to the functional specialization of the ribosome. Expression profiling of different tissues revealed that ribosomal protein large 3-like (Rpl3l) is exclusively expressed in striated muscle. In response to a hypertrophic stimulus, Rpl3l expression in skeletal muscle was significantly decreased by 82% whereas expression of the ubiquitous paralog Rpl3 was significantly increased by ~5-fold. Based on these findings, we developed the hypothesis that Rpl3l functions as a negative regulator of muscle growth. To test this hypothesis, we used the Tet-On system to express Rpl3l in myoblasts during myotube formation. In support of our hypothesis, RPL3L expression significantly impaired myotube growth as assessed by myotube diameter (−23%) and protein content (−14%). Further analysis showed that the basis of this impairment was caused by a significant decrease in myoblast fusion as the fusion index was significantly lower (−17%) with RPL3L expression. These findings are the first evidence to support the novel concept of ribosome specialization in skeletal muscle and its role in the regulation of skeletal muscle growth. PMID:26684695

  8. Ribosomal RNA and protein transcripts persist in the cysts of Entamoeba invadens.


    Ojha, Sandeep; Ahamad, Jamaluddin; Bhattacharya, Alok; Bhattacharya, Sudha


    In most organisms rDNA transcription ceases under conditions of growth stress. However, we have earlier shown that pre-rRNA accumulates during encystation in Entamoeba invadens. We labeled newly-synthesized rRNA during encystation, with [methyl-(3)H] methionine in the presence of chitinase to enable uptake of isotope. Incorporation rate reduced after 24h, and then increased to reach levels comparable with normal cells. The label was rapidly chased to the ribosomal pellet in dividing cells, while at late stages of encystation the ratio of counts going to the pellet dropped 3-fold. The transcript levels of selected ribosomal protein genes also went down initially but went up again at later stages of encystation. This suggested that rRNA and ribosomal protein transcription may be coordinately regulated. Our data shows that encysting E. invadens cells accumulate transcripts of both the RNA and protein components of the ribosome, which may ensure rapid synthesis of new ribosomes when growth resumes.

  9. Protein Folding Activity of Ribosomal RNA Is a Selective Target of Two Unrelated Antiprion Drugs

    PubMed Central

    Tribouillard-Tanvier, Déborah; Dos Reis, Suzana; Gug, Fabienne; Voisset, Cécile; Béringue, Vincent; Sabate, Raimon; Kikovska, Ema; Talarek, Nicolas; Bach, Stéphane; Huang, Chenhui; Desban, Nathalie; Saupe, Sven J.; Supattapone, Surachai; Thuret, Jean-Yves; Chédin, Stéphane; Vilette, Didier; Galons, Hervé; Sanyal, Suparna; Blondel, Marc


    Background 6-Aminophenanthridine (6AP) and Guanabenz (GA, a drug currently in use for the treatment of hypertension) were isolated as antiprion drugs using a yeast-based assay. These structurally unrelated molecules are also active against mammalian prion in several cell-based assays and in vivo in a mouse model for prion-based diseases. Methodology/Principal Findings Here we report the identification of cellular targets of these drugs. Using affinity chromatography matrices for both drugs, we demonstrate an RNA-dependent interaction of 6AP and GA with the ribosome. These specific interactions have no effect on the peptidyl transferase activity of the ribosome or on global translation. In contrast, 6AP and GA specifically inhibit the ribosomal RNA-mediated protein folding activity of the ribosome. Conclusion/Significance 6AP and GA are therefore the first compounds to selectively inhibit the protein folding activity of the ribosome. They thus constitute precious tools to study the yet largely unexplored biological role of this protein folding activity. PMID:18478094

  10. Reduced expression of the mouse ribosomal protein Rpl17 alters the diversity of mature ribosomes by enhancing production of shortened 5.8S rRNA.


    Wang, Minshi; Parshin, Andrey V; Shcherbik, Natalia; Pestov, Dimitri G


    Processing of rRNA during ribosome assembly can proceed through alternative pathways but it is unclear whether this could affect the structure of the ribosome. Here, we demonstrate that shortage of a ribosomal protein can change pre-rRNA processing in a way that over time alters ribosome diversity in the cell. Reducing the amount of Rpl17 in mouse cells led to stalled 60S subunit maturation, causing degradation of most of the synthesized precursors. A fraction of pre-60S subunits, however, were able to complete maturation, but with a 5'-truncated 5.8S rRNA, which we named 5.8SC. The 5' exoribonuclease Xrn2 is involved in the generation of both 5.8S(C) and the canonical long form of 5.8S rRNA. Ribosomes containing 5.8S(C) rRNA are present in various mouse and human cells and engage in translation. These findings uncover a previously undescribed form of mammalian 5.8S rRNA and demonstrate that perturbations in ribosome assembly can be a source of heterogeneity in mature ribosomes.

  11. Reduced expression of the mouse ribosomal protein Rpl17 alters the diversity of mature ribosomes by enhancing production of shortened 5.8S rRNA

    PubMed Central

    Wang, Minshi; Parshin, Andrey V.; Shcherbik, Natalia; Pestov, Dimitri G.


    Processing of rRNA during ribosome assembly can proceed through alternative pathways but it is unclear whether this could affect the structure of the ribosome. Here, we demonstrate that shortage of a ribosomal protein can change pre-rRNA processing in a way that over time alters ribosome diversity in the cell. Reducing the amount of Rpl17 in mouse cells led to stalled 60S subunit maturation, causing degradation of most of the synthesized precursors. A fraction of pre-60S subunits, however, were able to complete maturation, but with a 5′-truncated 5.8S rRNA, which we named 5.8SC. The 5′ exoribonuclease Xrn2 is involved in the generation of both 5.8SC and the canonical long form of 5.8S rRNA. Ribosomes containing 5.8SC rRNA are present in various mouse and human cells and engage in translation. These findings uncover a previously undescribed form of mammalian 5.8S rRNA and demonstrate that perturbations in ribosome assembly can be a source of heterogeneity in mature ribosomes. PMID:25995445

  12. Mass spectrometric analysis of 40 S ribosomal proteins from Rat-1 fibroblasts.


    Louie, D F; Resing, K A; Lewis, T S; Ahn, N G


    Although sequences of most mammalian ribosomal proteins are available, little is known about the post-translational processing of ribosomal proteins. To examine their post-translational modifications, 40 S subunit proteins purified from Rat-1 fibroblasts and their peptides were analyzed by liquid chromatography coupled with electrospray mass spectrometry. Of 41 proteins observed, 36 corresponded to the 32 rat 40 S ribosomal proteins with known sequences (S3, S5, S7, and S24 presented in two forms). The observed masses of S4, S6-S8, S13, S15a, S16, S17, S19, S27a, S29, and S30 matched those predicted. Sa, S3a, S5, S11, S15, S18, S20, S21, S24, S26-S28, and an S7 variant showed changes in mass that were consistent with N-terminal demethionylation and/or acetylation (S5 and S27 also appeared to be internally formylated and acetylated, respectively). S23 appeared to be internally hydroxylated or methylated. S2, S3, S9, S10, S12, S14, and S25 showed changes in mass inconsistent with known covalent modifications (+220, -75, +86, +56, -100, -117, and -103 Da, respectively), possibly representing novel post-translational modifications or allelic sequence variation. Five unidentified proteins (12,084, 13,706, 13,741, 13,884, and 34, 987 Da) were observed; for one, a sequence tag (PPGPPP), absent in any known ribosomal proteins, was determined, suggesting that it is a previously undescribed ribosome-associated protein. This study establishes a powerful method to rapidly analyze protein components of large biological complexes and their covalent modifications.

  13. The stimulation of Escherichia coli stringent factor-dependent synthesis of guanosine 3',5'-polyphosphate [(p)ppGpp] by rat liver ribosomal proteins.


    Fehr, S; Lin, A; Wool, I G; Richter, D


    The effect of groups of proteins from rat liver ribosomes on the Escherichia coli stringent factor-catalyzed synthesis of (p)ppGpp was tested. Most groups were capable of supporting (p)ppGpp synthesis; the exceptions were A40, B140, B240 and B160 which contain proteins which are relatively less basic than those in the active groups. The capacity of 30 individual rat liver ribosomal proteins to activate stringent factor was assessed; most sustained the synthesis of (p)ppGpp. Proteins S12, S21, L12, P1, and P2 (which are acidic or relatively acid) had no activity; proteins S6, S8, and L3 were the most active: the others had moderate activity.

  14. E. coli metabolic protein aldehyde-alcohol dehydrogenase-E binds to the ribosome: a unique moonlighting action revealed

    PubMed Central

    Shasmal, Manidip; Dey, Sandip; Shaikh, Tanvir R.; Bhakta, Sayan; Sengupta, Jayati


    It is becoming increasingly evident that a high degree of regulation is involved in the protein synthesis machinery entailing more interacting regulatory factors. A multitude of proteins have been identified recently which show regulatory function upon binding to the ribosome. Here, we identify tight association of a metabolic protein aldehyde-alcohol dehydrogenase E (AdhE) with the E. coli 70S ribosome isolated from cell extract under low salt wash conditions. Cryo-EM reconstruction of the ribosome sample allows us to localize its position on the head of the small subunit, near the mRNA entrance. Our study demonstrates substantial RNA unwinding activity of AdhE which can account for the ability of ribosome to translate through downstream of at least certain mRNA helices. Thus far, in E. coli, no ribosome-associated factor has been identified that shows downstream mRNA helicase activity. Additionally, the cryo-EM map reveals interaction of another extracellular protein, outer membrane protein C (OmpC), with the ribosome at the peripheral solvent side of the 50S subunit. Our result also provides important insight into plausible functional role of OmpC upon ribosome binding. Visualization of the ribosome purified directly from the cell lysate unveils for the first time interactions of additional regulatory proteins with the ribosome. PMID:26822933

  15. E. coli metabolic protein aldehyde-alcohol dehydrogenase-E binds to the ribosome: a unique moonlighting action revealed.


    Shasmal, Manidip; Dey, Sandip; Shaikh, Tanvir R; Bhakta, Sayan; Sengupta, Jayati


    It is becoming increasingly evident that a high degree of regulation is involved in the protein synthesis machinery entailing more interacting regulatory factors. A multitude of proteins have been identified recently which show regulatory function upon binding to the ribosome. Here, we identify tight association of a metabolic protein aldehyde-alcohol dehydrogenase E (AdhE) with the E. coli 70S ribosome isolated from cell extract under low salt wash conditions. Cryo-EM reconstruction of the ribosome sample allows us to localize its position on the head of the small subunit, near the mRNA entrance. Our study demonstrates substantial RNA unwinding activity of AdhE which can account for the ability of ribosome to translate through downstream of at least certain mRNA helices. Thus far, in E. coli, no ribosome-associated factor has been identified that shows downstream mRNA helicase activity. Additionally, the cryo-EM map reveals interaction of another extracellular protein, outer membrane protein C (OmpC), with the ribosome at the peripheral solvent side of the 50S subunit. Our result also provides important insight into plausible functional role of OmpC upon ribosome binding. Visualization of the ribosome purified directly from the cell lysate unveils for the first time interactions of additional regulatory proteins with the ribosome. PMID:26822933

  16. Amino acids and proteins.


    van Goudoever, Johannes B; Vlaardingerbroek, Hester; van den Akker, Chris H; de Groof, Femke; van der Schoor, Sophie R D


    Amino acids and protein are key factors for growth. The neonatal period requires the highest intake in life to meet the demands. Those demands include amino acids for growth, but proteins and amino acids also function as signalling molecules and function as neurotransmitters. Often the nutritional requirements are not met, resulting in a postnatal growth restriction. However, current knowledge on adequate levels of both amino acid as well as protein intake can avoid under nutrition in the direct postnatal phase, avoid the need for subsequent catch-up growth and improve later outcome.

  17. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.


    MacKay, R M; Gray, M W; Doolittle, W F


    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  18. Scattering studies on ribosomes in solution

    NASA Astrophysics Data System (ADS)

    Ramakrishnan, V.


    Ribosomes are organelles that play a central role in protein synthesis. They are complexes of protein and nucleic acid, and can be analysed as two-component systems by neutron scattering. Moreover, ribosomes can be biochemically prepared that have specific proteins deuterated. Both these properties have been exploited to study the structure of the ribosome by neutron scattering. This article reviews the studies carried out on the small ribosomal subunit, and describes a recent study that has resolved a conflict between the results of two classes of experiments.

  19. Ribosomal proteins are encoded by single copy genes in Dictyostelium discoideum.


    Steel, L F; Jacobson, A


    Five recombinant plasmids which encode ribosomal proteins (r-proteins) from Dictyostelium discoideum have been isolated. Poly(A) + RNA was size-fractionated by preparative agarose gel electrophoresis and a fraction encoding proteins of less than 35 kDa was used to construct a cDNA library in the plasmid vector pBR322. Individual clones from the library were screened by hybrid-selected translation and those encoding r-proteins were identified by co-migration of the translation products in two-dimensional gel electrophoresis with marker proteins purified from Dictyostelium ribosomes. Initial characterization using the five cDNA plasmids indicates that these r-proteins are encoded by single copy genes and that they are not tightly clustered in the genome.

  20. Ribosome-associated pentatricopeptide repeat proteins function as translational activators in mitochondria of trypanosomes

    PubMed Central

    Aphasizheva, Inna; Maslov, Dmitri A.; Qian, Yu; Huang, Lan; Wang, Qi; Costello, Catherine E.; Aphasizhev, Ruslan


    Summary Mitochondrial ribosomes of Trypanosoma brucei are composed of 9S and 12S rRNAs, eubacterial-type ribosomal proteins, polypeptides lacking discernible motifs and approximately 20 pentatricopeptide repeat (PPR) RNA binding proteins. Several PPRs also populate the polyadenylation complex; among these, KPAF1 and KPAF2 function as general mRNA 3′ adenylation/uridylation factors. The A/U-tail enables mRNA binding to the small ribosomal subunit and is essential for translation. The presence of A/U-tail also correlates with requirement for translation of certain mRNAs in mammalian and insect parasite stages. Here, we inquired whether additional PPRs activate translation of individual mRNAs. Proteomic analysis identified KRIPP1 and KRIPP8 as components of the small ribosomal subunit in mammalian and insect forms, but also revealed their association with the polyadenylation complex in the latter. RNAi knockdowns demonstrated essential functions of KRIPP1 and KRIPP8 in the actively respiring insect stage, but not in the mammalian stage. In the KRIPP1 knockdown, A/U-tailed mRNA encoding cytochrome c oxidase subunit 1 declined concomitantly with the de novo synthesis of this subunit whereas polyadenylation and translation of cyb mRNA were unaffected. In contrast, the KRIPP8 knockdown inhibited A/U-tailing and translation of both CO1 and cyb mRNAs. Our findings indicate that ribosome-associated PPRs may selectively activate mRNAs for translation. PMID:26713541

  1. Ribosome-associated pentatricopeptide repeat proteins function as translational activators in mitochondria of trypanosomes.


    Aphasizheva, Inna; Maslov, Dmitri A; Qian, Yu; Huang, Lan; Wang, Qi; Costello, Catherine E; Aphasizhev, Ruslan


    Mitochondrial ribosomes of Trypanosoma brucei are composed of 9S and 12S rRNAs, eubacterial-type ribosomal proteins, polypeptides lacking discernible motifs and approximately 20 pentatricopeptide repeat (PPR) RNA binding proteins. Several PPRs also populate the polyadenylation complex; among these, KPAF1 and KPAF2 function as general mRNA 3' adenylation/uridylation factors. The A/U-tail enables mRNA binding to the small ribosomal subunit and is essential for translation. The presence of A/U-tail also correlates with requirement for translation of certain mRNAs in mammalian and insect parasite stages. Here, we inquired whether additional PPRs activate translation of individual mRNAs. Proteomic analysis identified KRIPP1 and KRIPP8 as components of the small ribosomal subunit in mammalian and insect forms, but also revealed their association with the polyadenylation complex in the latter. RNAi knockdowns demonstrated essential functions of KRIPP1 and KRIPP8 in the actively respiring insect stage, but not in the mammalian stage. In the KRIPP1 knockdown, A/U-tailed mRNA encoding cytochrome c oxidase subunit 1 declined concomitantly with the de novo synthesis of this subunit whereas polyadenylation and translation of cyb mRNA were unaffected. In contrast, the KRIPP8 knockdown inhibited A/U-tailing and translation of both CO1 and cyb mRNAs. Our findings indicate that ribosome-associated PPRs may selectively activate mRNAs for translation. PMID:26713541

  2. Molecular Simulations of Cotranslational Protein Folding: Fragment Stabilities, Folding Cooperativity, and Trapping in the Ribosome

    PubMed Central

    Elcock, Adrian H


    Although molecular simulation methods have yielded valuable insights into mechanistic aspects of protein refolding in vitro, they have up to now not been used to model the folding of proteins as they are actually synthesized by the ribosome. To address this issue, we report here simulation studies of three model proteins: chymotrypsin inhibitor 2 (CI2), barnase, and Semliki forest virus protein (SFVP), and directly compare their folding during ribosome-mediated synthesis with their refolding from random, denatured conformations. To calibrate the methodology, simulations are first compared with in vitro data on the folding stabilities of N-terminal fragments of CI2 and barnase; the simulations reproduce the fact that both the stability and thermal folding cooperativity increase as fragments increase in length. Coupled simulations of synthesis and folding for the same two proteins are then described, showing that both fold essentially post-translationally, with mechanisms effectively identical to those for refolding. In both cases, confinement of the nascent polypeptide chain within the ribosome tunnel does not appear to promote significant formation of native structure during synthesis; there are however clear indications that the formation of structure within the nascent chain is sensitive to location within the ribosome tunnel, being subject to both gain and loss as the chain lengthens. Interestingly, simulations in which CI2 is artificially stabilized show a pronounced tendency to become trapped within the tunnel in partially folded conformations: non-cooperative folding, therefore, appears in the simulations to exert a detrimental effect on the rate at which fully folded conformations are formed. Finally, simulations of the two-domain protease module of SFVP, which experimentally folds cotranslationally, indicate that for multi-domain proteins, ribosome-mediated folding may follow different pathways from those taken during refolding. Taken together, these

  3. Dictyostelium ribosomal protein genes and the elongation factor 1B gene show coordinate developmental regulation which is under post-transcriptional control.


    Agarwal, A K; Blumberg, D D


    Starvation for amino acids initiates the developmental program in the cellular slime mold, Dictyostelium discoideum [19, 20]. One of the earliest developmental events is the decline in ribosomal protein synthesis [2, 17, 29, 30]. The ribosomal protein mRNAs are excluded from polysomes with 20 min to 1 h following the removal of nutrients, and their mRNA levels decline sharply at about 9 h into the 24-h developmental cycle [28, 31, 35, 36]. It has been generally assumed that the decline in r-protein mRNA levels during late development reflected a decline in the transcription rate [12, 32, 43]. Here we demonstrate that this is not the case. The transcription rates of three ribosomal protein genes, rpL11, rpL23 and rpS9 as well as an elongation factor 1B gene have been determined during growth and development in Dictyostelium. Throughout growth and development the transcription rate of the ribosomal protein genes remains relatively constant at 0.2%-0.5% of the rate of rRNA transcription while the elongation factor 1B gene is transcribed at 0.4%-0.6% of the rRNA rate. This low but constant transcription rate is in contrast to a spore coat protein gene Psp D, which is transcribed at 6% of the rRNA rate in late developing cells. The elongation factor 1B gene appears to be co-regulated with the ribosomal protein genes both in terms of its transcription rate and mRNA accumulation. Dictyostelium has been a popular model for understanding signal transduction and the growth to differentiation transition, thus it is of significance that the regulation of ribosome biosynthesis in Dictyostelium resembles that of higher eukaryotes in being regulated largely at the post-transcriptional level in response to starvation as opposed to yeasts where the regulation is largely transcriptional [27]. PMID:10374261

  4. Recognition of Ribosomal Protein L11 by the Protein Trimethyltransferase PrmA

    SciTech Connect

    Demirci,H.; Gregory, S.; Dahlberg, A.; Jogl, G.


    Bacterial ribosomal protein L11 is post-translationally trimethylated at multiple residues by a single methyltransferase, PrmA. Here, we describe four structures of PrmA from the extreme thermophile Thermus thermophilus. Two apo-PrmA structures at 1.59 and 2.3 {angstrom} resolution and a third with bound cofactor S-adenosyl-L-methionine at 1.75 {angstrom} each exhibit distinct relative positions of the substrate recognition and catalytic domains, revealing how PrmA can position the L11 substrate for multiple, consecutive side-chain methylation reactions. The fourth structure, the PrmA-L11 enzyme-substrate complex at 2.4 {angstrom} resolution, illustrates the highly specific interaction of the N-terminal domain with its substrate and places Lys39 in the PrmA active site. The presence of a unique flexible loop in the cofactor-binding site suggests how exchange of AdoMet with the reaction product S-adenosyl-L-homocysteine can occur without necessitating the dissociation of PrmA from L11. Finally, the mode of interaction of PrmA with L11 explains its observed preference for L11 as substrate before its assembly into the 50S ribosomal subunit.

  5. Evidence that E. coli ribosomal protein S13 has two separable functional domains involved in 16S RNA recognition and protein S19 binding.


    Schwarzbauer, J; Craven, G R


    We have found that E. coli ribosomal protein S13 recognizes multiple sites on 16S RNA. However, when protein S19 is included with a mixture of proteins S4, S7, S8, S16/S17 and S20, the S13 binds to the complex with measurably greater strength and with a stoichiometry of 1.5 copies per particle. This suggests that the protein may have two functional domains. We have tested this idea by cleaving the protein into two polypeptides. It was found that one of the fragments, composed of amino acid residues 84-117, retained the capacity to bind 16S RNA at multiple sites. Protein S19 had no affect on the strength or stoichiometry of the binding of this fragment. These data suggest that S13 has a C-terminal domain primarily responsible for RNA recognition and possibly that the N-terminal region is important for association with protein S19.

  6. A conserved quality-control pathway that mediates degradation of unassembled ribosomal proteins

    PubMed Central

    Sung, Min-Kyung; Porras-Yakushi, Tanya R; Reitsma, Justin M; Huber, Ferdinand M; Sweredoski, Michael J; Hoelz, André; Hess, Sonja; Deshaies, Raymond J


    Overproduced yeast ribosomal protein (RP) Rpl26 fails to assemble into ribosomes and is degraded in the nucleus/nucleolus by a ubiquitin-proteasome system quality control pathway comprising the E2 enzymes Ubc4/Ubc5 and the ubiquitin ligase Tom1. tom1 cells show reduced ubiquitination of multiple RPs, exceptional accumulation of detergent-insoluble proteins including multiple RPs, and hypersensitivity to imbalances in production of RPs and rRNA, indicative of a profound perturbation to proteostasis. Tom1 directly ubiquitinates unassembled RPs primarily via residues that are concealed in mature ribosomes. Together, these data point to an important role for Tom1 in normal physiology and prompt us to refer to this pathway as ERISQ, for excess ribosomal protein quality control. A similar pathway, mediated by the Tom1 homolog Huwe1, restricts accumulation of overexpressed hRpl26 in human cells. We propose that ERISQ is a key element of the quality control machinery that sustains protein homeostasis and cellular fitness in eukaryotes. DOI: PMID:27552055

  7. A conserved quality-control pathway that mediates degradation of unassembled ribosomal proteins.


    Sung, Min-Kyung; Porras-Yakushi, Tanya R; Reitsma, Justin M; Huber, Ferdinand M; Sweredoski, Michael J; Hoelz, André; Hess, Sonja; Deshaies, Raymond J


    Overproduced yeast ribosomal protein (RP) Rpl26 fails to assemble into ribosomes and is degraded in the nucleus/nucleolus by a ubiquitin-proteasome system quality control pathway comprising the E2 enzymes Ubc4/Ubc5 and the ubiquitin ligase Tom1. tom1 cells show reduced ubiquitination of multiple RPs, exceptional accumulation of detergent-insoluble proteins including multiple RPs, and hypersensitivity to imbalances in production of RPs and rRNA, indicative of a profound perturbation to proteostasis. Tom1 directly ubiquitinates unassembled RPs primarily via residues that are concealed in mature ribosomes. Together, these data point to an important role for Tom1 in normal physiology and prompt us to refer to this pathway as ERISQ, for excess ribosomal protein quality control. A similar pathway, mediated by the Tom1 homolog Huwe1, restricts accumulation of overexpressed hRpl26 in human cells. We propose that ERISQ is a key element of the quality control machinery that sustains protein homeostasis and cellular fitness in eukaryotes. PMID:27552055

  8. Tempo and Mode of Gene Duplication in Mammalian Ribosomal Protein Evolution

    PubMed Central

    Gajdosik, Matthew D.; Simon, Amanda; Nelson, Craig E.


    Gene duplication has been widely recognized as a major driver of evolutionary change and organismal complexity through the generation of multi-gene families. Therefore, understanding the forces that govern the evolution of gene families through the retention or loss of duplicated genes is fundamentally important in our efforts to study genome evolution. Previous work from our lab has shown that ribosomal protein (RP) genes constitute one of the largest classes of conserved duplicated genes in mammals. This result was surprising due to the fact that ribosomal protein genes evolve slowly and transcript levels are very tightly regulated. In our present study, we identified and characterized all RP duplicates in eight mammalian genomes in order to investigate the tempo and mode of ribosomal protein family evolution. We show that a sizable number of duplicates are transcriptionally active and are very highly conserved. Furthermore, we conclude that existing gene duplication models do not readily account for the preservation of a very large number of intact retroduplicated ribosomal protein (RT-RP) genes observed in mammalian genomes. We suggest that selection against dominant-negative mutations may underlie the unexpected retention and conservation of duplicated RP genes, and may shape the fate of newly duplicated genes, regardless of duplication mechanism. PMID:25369106

  9. Synaptic Activation of Ribosomal Protein S6 Phosphorylation Occurs Locally in Activated Dendritic Domains

    ERIC Educational Resources Information Center

    Pirbhoy, Patricia Salgado; Farris, Shannon; Steward, Oswald


    Previous studies have shown that induction of long-term potentiation (LTP) induces phosphorylation of ribosomal protein S6 (rpS6) in postsynaptic neurons, but the functional significance of rpS6 phosphorylation is poorly understood. Here, we show that synaptic stimulation that induces perforant path LTP triggers phosphorylation of rpS6 (p-rpS6)…

  10. The major elderberry (Sambucus nigra) fruit protein is a lectin derived from a truncated type 2 ribosome-inactivating protein.


    Van Damme, E J; Roy, S; Barre, A; Rougé, P; Van Leuven, F; Peumans, W J


    The major protein of elderberry (Sambucus nigra L.) fruits is a lectin, called Sambucus nigra agglutinin IVf or SNAIVf. This lectin is composed of subunits that strongly resemble the B chain of the type 2 ribosome-inactivating protein (RIP), called SNAVf, present in the same tissue. To corroborate the possible relationship between both proteins their corresponding cDNAs were cloned and compared. Alignment of the deduced amino acid sequences revealed that the cDNA encoding SNAIVf is almost identical to that of SNAVf except that its A chain is truncated. Northern blot analysis confirmed that the mRNA encoding SNAIVf is about 500 nucleotides shorter than the SNAVf mRNA. In addition, the occurrence of a truncated type 2 RIP gene was unambiguously demonstrated by the analysis of PCR amplified genomic sequences. These results not only demonstrate for the first time that a plant lectin is encoded by a truncated type 2 RIP gene but also address important questions with respect to the molecular evolution of RIP and lectins.

  11. Mammalian HCA66 protein is required for both ribosome synthesis and centriole duplication

    PubMed Central

    Gérus, Marie; Hoareau-Aveilla, Coralie; Kiss, Tamás; Caizergues-Ferrer, Michèle; Henry, Yves; Henras, Anthony K.


    Ribosome production, one of the most energy-consuming biosynthetic activities in living cells, is adjusted to growth conditions and coordinated with the cell cycle. Connections between ribosome synthesis and cell cycle progression have been described, but the underlying mechanisms remain only partially understood. The human HCA66 protein was recently characterized as a component of the centrosome, the major microtubule-organizing center (MTOC) in mammalian cells, and was shown to be required for centriole duplication and assembly of the mitotic spindle. We show here that HCA66 is also required for nucleolar steps of the maturation of the 40S ribosomal subunit and therefore displays a dual function. Overexpression of a dominant negative version of HCA66, accumulating at the centrosome but absent from the nucleoli, alters centrosome function but has no effect on pre-rRNA processing, suggesting that HCA66 acts independently in each process. In yeast and HeLa cells, depletion of MTOC components does not impair ribosome synthesis. Hence our results suggest that both in yeast and human cells, assembly of a functional MTOC and ribosome synthesis are not closely connected processes. PMID:22434888

  12. Fluctuations in protein synthesis from a single RNA template: Stochastic kinetics of ribosomes

    NASA Astrophysics Data System (ADS)

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T. V.


    Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them—namely, the dwell time distribution—has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

  13. A model of protein translation including codon bias, nonsense errors, and ribosome recycling.


    Gilchrist, Michael A; Wagner, Andreas


    We present and analyse a model of protein translation at the scale of an individual messenger RNA (mRNA) transcript. The model we develop is unique in that it incorporates the phenomena of ribosome recycling and nonsense errors. The model conceptualizes translation as a probabilistic wave of ribosome occupancy traveling down a heterogeneous medium, the mRNA transcript. Our results show that the heterogeneity of the codon translation rates along the mRNA results in short-scale spikes and dips in the wave. Nonsense errors attenuate this wave on a longer scale while ribosome recycling reinforces it. We find that the combination of nonsense errors and codon usage bias can have a large effect on the probability that a ribosome will completely translate a transcript. We also elucidate how these forces interact with ribosome recycling to determine the overall translation rate of an mRNA transcript. We derive a simple cost function for nonsense errors using our model and apply this function to the yeast (Saccharomyces cervisiae) genome. Using this function we are able to detect position dependent selection on codon bias which correlates with gene expression levels as predicted a priori. These results indirectly validate our underlying model assumptions and confirm that nonsense errors can play an important role in shaping codon usage bias. PMID:16171830

  14. The hinge region of Escherichia coli ribosomal protein L7/L12 is required for factor binding and GTP hydrolysis.


    Dey, D; Oleinikov, A V; Traut, R R


    A variant form of Escherichia coli ribosomal protein L7/L12 that lacked residues 42 to 52 (L7/L12: delta 42-52) in the hinge region was shown previously to be completely inactive in supporting polyphenylalanine synthesis although it bound to L7/L12 deficient core particles with the normal stoichiometry of four copies per particle (Oleinikov AV, Perroud B, Wang B, Traut RR (1993) J Biol Chem, 268, 917-922). The result suggested that the hinge confers flexibility that is required for activity because the resulting bent conformation allows the distal C-terminal domain to occupy a location on the body of the large ribosomal subunit proximal to the base of the L7/L12 stalk where elongation factors bind. Factor binding to the hinge-truncated variant was tested. As an alternative strategy to deleting residues from the hinge, seven amino acid residues within the putative hinge region were replaced by seven consecutive proline residues in an attempt to confer increased rigidity that might reduce or eliminate the bending of the molecule inferred to be functionally important. This variant, L7/L12:(Pro)7, remained fully active in protein synthesis. Whereas the binding of both factors in ribosomes containing L7/L12:delta 42-52 was decreased by about 50%, there was no loss of factor binding in ribosomes containing L7/L12:(Pro)7, as predicted from the retention of protein synthesis activity. The factor:ribosome complexes that contained L7/L12:delta 42-52 had the same low level of GTP hydrolysis as the core particles completely lacking L7/L12 and EF-G did not support translocation measured by the reaction of phe-tRNA bound in the A site with puromycin. It is concluded that the hinge region is required for the functionally productive binding of elongation factors, and the defect in protein synthesis reported previously is due to this defect. The variant produced by the introduction of the putative rigid Pro7 sequence retains sufficient flexibility for full activity.

  15. Protein Folding Activity of the Ribosome is involved in Yeast Prion Propagation

    PubMed Central

    Blondel, Marc; Soubigou, Flavie; Evrard, Justine; Nguyen, Phu hai; Hasin, Naushaba; Chédin, Stéphane; Gillet, Reynald; Contesse, Marie-Astrid; Friocourt, Gaëlle; Stahl, Guillaume; Jones, Gary W.; Voisset, Cécile


    6AP and GA are potent inhibitors of yeast and mammalian prions and also specific inhibitors of PFAR, the protein-folding activity borne by domain V of the large rRNA of the large subunit of the ribosome. We therefore explored the link between PFAR and yeast prion [PSI+] using both PFAR-enriched mutants and site-directed methylation. We demonstrate that PFAR is involved in propagation and de novo formation of [PSI+]. PFAR and the yeast heat-shock protein Hsp104 partially compensate each other for [PSI+] propagation. Our data also provide insight into new functions for the ribosome in basal thermotolerance and heat-shocked protein refolding. PFAR is thus an evolutionarily conserved cell component implicated in the prion life cycle, and we propose that it could be a potential therapeutic target for human protein misfolding diseases. PMID:27633137

  16. Protein Folding Activity of the Ribosome is involved in Yeast Prion Propagation.


    Blondel, Marc; Soubigou, Flavie; Evrard, Justine; Nguyen, Phu Hai; Hasin, Naushaba; Chédin, Stéphane; Gillet, Reynald; Contesse, Marie-Astrid; Friocourt, Gaëlle; Stahl, Guillaume; Jones, Gary W; Voisset, Cécile


    6AP and GA are potent inhibitors of yeast and mammalian prions and also specific inhibitors of PFAR, the protein-folding activity borne by domain V of the large rRNA of the large subunit of the ribosome. We therefore explored the link between PFAR and yeast prion [PSI(+)] using both PFAR-enriched mutants and site-directed methylation. We demonstrate that PFAR is involved in propagation and de novo formation of [PSI(+)]. PFAR and the yeast heat-shock protein Hsp104 partially compensate each other for [PSI(+)] propagation. Our data also provide insight into new functions for the ribosome in basal thermotolerance and heat-shocked protein refolding. PFAR is thus an evolutionarily conserved cell component implicated in the prion life cycle, and we propose that it could be a potential therapeutic target for human protein misfolding diseases. PMID:27633137

  17. Human acidic ribosomal phosphoproteins P0, P1, and P2: Analysis of cDNA clones, in vitro synthesis, and assembly

    SciTech Connect

    Rich, B.E.; Steitz, J.A.


    cDNA clones encoding three antigenically related human ribosomal phosophoproteins (P-proteins) P0, P1, and P2 were isolated and sequenced. P1 and P2 are analogous to Escherichia coli ribosomal protein L7/L12, and P0 is likely to be an analog of L10. The three proteins have a nearly identical carboxy-terminal 17-amino-acid sequence (KEESEESD(D/E)DMGFGLFD-COOH) that is the basis of their immunological cross-reactivity. The identifies of the P1 and P2 cDNAs were confirmed by the strong similarities of their encoded amino acid sequences to published primary structures of the homologous rat, brine shrimp, and Saccharomyces cerevisiae proteins. The P0 cDNA was initially identified by translation of hybrid-selected mRNA and immunoprecipitation of the products. To demonstrate that the coding sequences are full length, the P0, P1, and P2 cDNAs were transcribed in vitro by bacteriophage T7 RNA polymerase and the resulting mRNAs were translated in vitro. The synthetic P0, P1, and P2 proteins were serologically and electrophoretically identical to P-proteins extracted from HeLa cells. These synthetic P-proteins were incorporated into 60S but not 40S ribosomes and also assembled into a complex similar to that described for E. coli L7/L12 and L10.

  18. Synthesis of ribosomes in Saccharomyces cerevisiae.

    PubMed Central

    Warner, J R


    The assembly of a eucaryotic ribosome requires the synthesis of four ribosomal ribonucleic acid (RNA) molecules and more than 75 ribosomal proteins. It utilizes all three RNA polymerases; it requires the cooperation of the nucleus and the cytoplasm, the processing of RNA, and the specific interaction of RNA and protein molecules. It is carried out efficiently and is exquisitely sensitive to the needs of the cell. Our current understanding of this process in the genetically tractable yeast Saccharomyces cerevisiae is reviewed. The ribosomal RNA genes are arranged in a tandem array of 100 to 200 copies. This tandem array has led to unique ways of carrying out a number of functions. Replication is asymmetric and does not initiate from every autonomously replicating sequence. Recombination is suppressed. Transcription of the major ribosomal RNA appears to involve coupling between adjacent transcription units, which are separated by the 5S RNA transcription unit. Genes for many ribosomal proteins have been cloned and sequenced. Few are linked; most are duplicated; most have an intron. There is extensive homology between yeast ribosomal proteins and those of other species. Most, but not all, of the ribosomal protein genes have one or two sites that are essential for their transcription and that bind a common transcription factor. This factor binds also to many other places in the genome, including the telomeres. There is coordinated transcription of the ribosomal protein genes under a variety of conditions. However, the cell seems to possess no mechanism for regulating the transcription of individual ribosomal protein genes in response either to a deficiency or an excess of a particular ribosomal protein. A deficiency causes slow growth. Any excess ribosomal protein is degraded very rapidly, with a half-life of 1 to 5 min. Unlike most types of cells, yeast cells appear not to regulate the translation of ribosomal proteins. However, in the case of ribosomal protein L32

  19. Mutations of ribosomal protein S5 suppress a defect in late-30S ribosomal subunit biogenesis caused by lack of the RbfA biogenesis factor

    PubMed Central

    Nord, Stefan; Bhatt, Monika J.; Tükenmez, Hasan; Farabaugh, Philip J.; Wikström, P. Mikael


    The in vivo assembly of ribosomal subunits requires assistance by maturation proteins that are not part of mature ribosomes. One such protein, RbfA, associates with the 30S ribosomal subunits. Loss of RbfA causes cold sensitivity and defects of the 30S subunit biogenesis and its overexpression partially suppresses the dominant cold sensitivity caused by a C23U mutation in the central pseudoknot of 16S rRNA, a structure essential for ribosome function. We have isolated suppressor mutations that restore partially the growth of an RbfA-lacking strain. Most of the strongest suppressor mutations alter one out of three distinct positions in the carboxy-terminal domain of ribosomal protein S5 (S5) in direct contact with helix 1 and helix 2 of the central pseudoknot. Their effect is to increase the translational capacity of the RbfA-lacking strain as evidenced by an increase in polysomes in the suppressed strains. Overexpression of RimP, a protein factor that along with RbfA regulates formation of the ribosome's central pseudoknot, was lethal to the RbfA-lacking strain but not to a wild-type strain and this lethality was suppressed by the alterations in S5. The S5 mutants alter translational fidelity but these changes do not explain consistently their effect on the RbfA-lacking strain. Our genetic results support a role for the region of S5 modified in the suppressors in the formation of the central pseudoknot in 16S rRNA. PMID:26089326

  20. Crystal structure of bacillus subtilis YdaF protein : a putative ribosomal N-acetyltransferase.

    SciTech Connect

    Brunzelle, J. S.; Wu, R.; Korolev, S. V.; Collart, F. R.; Joachimiak, A.; Anderson, W. F.; Biosciences Division; Northwestern Univ.; Saint Louis Univ. School of Medicine


    Comparative sequence analysis suggests that the ydaF gene encodes a protein (YdaF) that functions as an N-acetyltransferase, more specifically, a ribosomal N-acetyltransferase. Sequence analysis using basic local alignment search tool (BLAST) suggests that YdaF belongs to a large family of proteins (199 proteins found in 88 unique species of bacteria, archaea, and eukaryotes). YdaF also belongs to the COG1670, which includes the Escherichia coli RimL protein that is known to acetylate ribosomal protein L12. N-acetylation (NAT) has been found in all kingdoms. NAT enzymes catalyze the transfer of an acetyl group from acetyl-CoA (AcCoA) to a primary amino group. For example, NATs can acetylate the N-terminal {alpha}-amino group, the {epsilon}-amino group of lysine residues, aminoglycoside antibiotics, spermine/speridine, or arylalkylamines such as serotonin. The crystal structure of the alleged ribosomal NAT protein, YdaF, from Bacillus subtilis presented here was determined as a part of the Midwest Center for Structural Genomics. The structure maintains the conserved tertiary structure of other known NATs and a high sequence similarity in the presumed AcCoA binding pocket in spite of a very low overall level of sequence identity to other NATs of known structure.

  1. The DEAD box protein Mrh4 functions in the assembly of the mitochondrial large ribosomal subunit.


    De Silva, Dasmanthie; Fontanesi, Flavia; Barrientos, Antoni


    Proteins in a cell are universally synthesized by ribosomes. Mitochondria contain their own ribosomes, which specialize in the synthesis of a handful of proteins required for oxidative phosphorylation. The pathway of mitoribosomal biogenesis and factors involved are poorly characterized. An example is the DEAD box proteins, widely known to participate in the biogenesis of bacterial and cytoplasmic eukaryotic ribosomes as either RNA helicases or RNA chaperones, whose mitochondrial counterparts remain completely unknown. Here, we have identified the Saccharomyces cerevisiae mitochondrial DEAD box protein Mrh4 as essential for large mitoribosome subunit biogenesis. Mrh4 interacts with the 21S rRNA, mitoribosome subassemblies, and fully assembled mitoribosomes. In the absence of Mrh4, the 21S rRNA is matured and forms part of a large on-pathway assembly intermediate missing proteins Mrpl16 and Mrpl39. We conclude that Mrh4 plays an essential role during the late stages of mitoribosome assembly by promoting remodeling of the 21S rRNA-protein interactions.

  2. Amino Acid Flux from Metabolic Network Benefits Protein Translation: the Role of Resource Availability

    PubMed Central

    Hu, Xiao-Pan; Yang, Yi; Ma, Bin-Guang


    Protein translation is a central step in gene expression and affected by many factors such as codon usage bias, mRNA folding energy and tRNA abundance. Despite intensive previous studies, how metabolic amino acid supply correlates with protein translation efficiency remains unknown. In this work, we estimated the amino acid flux from metabolic network for each protein in Escherichia coli and Saccharomyces cerevisiae by using Flux Balance Analysis. Integrated with the mRNA expression level, protein abundance and ribosome profiling data, we provided a detailed description of the role of amino acid supply in protein translation. Our results showed that amino acid supply positively correlates with translation efficiency and ribosome density. Moreover, with the rank-based regression model, we found that metabolic amino acid supply facilitates ribosome utilization. Based on the fact that the ribosome density change of well-amino-acid-supplied genes is smaller than poorly-amino-acid-supply genes under amino acid starvation, we reached the conclusion that amino acid supply may buffer ribosome density change against amino acid starvation and benefit maintaining a relatively stable translation environment. Our work provided new insights into the connection between metabolic amino acid supply and protein translation process by revealing a new regulation strategy that is dependent on resource availability. PMID:26056817

  3. Ribosomal P3 protein AtP3B of Arabidopsis acts as both protein and RNA chaperone to increase tolerance of heat and cold stresses.


    Kang, Chang Ho; Lee, Young Mee; Park, Joung Hun; Nawkar, Ganesh M; Oh, Hun Taek; Kim, Min Gab; Lee, Soo In; Kim, Woe Yeon; Yun, Dae-Jin; Lee, Sang Yeol


    The P3 proteins are plant-specific ribosomal P-proteins; however, their molecular functions have not been characterized. In a screen for components of heat-stable high-molecular weight (HMW) complexes, we isolated the P3 protein AtP3B from heat-treated Arabidopsis suspension cultures. By size-exclusion chromatography (SEC), SDS-PAGE and native PAGE followed by immunoblotting with anti-AtP3B antibody, we showed that AtP3B was stably retained in HMW complexes following heat shock. The level of AtP3B mRNA increased in response to both high- and low-temperature stresses. Bacterially expressed recombinant AtP3B protein exhibited both protein and RNA chaperone activities. Knockdown of AtP3B by RNAi made plants sensitive to both high- and low-temperature stresses, whereas overexpression of AtP3B increased tolerance of both conditions. Together, our results suggest that AtP3B protects cells against both high- and low-temperature stresses. These findings provide novel insight into the molecular functions and in vivo roles of acidic ribosomal P-proteins, thereby expanding our knowledge of the protein production machinery. PMID:27004478

  4. Eudistomin C, an Antitumor and Antiviral Natural Product, Targets 40S Ribosome and Inhibits Protein Translation.


    Ota, Yu; Chinen, Takumi; Yoshida, Keisuke; Kudo, Shun; Nagumo, Yoko; Shiwa, Yuh; Yamada, Ryosuke; Umihara, Hirotatsu; Iwasaki, Kotaro; Masumoto, Hiroshi; Yokoshima, Satoshi; Yoshikawa, Hirofumi; Fukuyama, Tohru; Kobayashi, Junichi; Usui, Takeo


    Eudistomin C (EudiC), a natural product, shows potent antitumor and antiviral activities, but the target molecule and the mechanism of action remain to be revealed. Here, we show that the 40S ribosome is the target in EudiC cytotoxicity. We isolated EudiC-resistant mutants from a multidrug-sensitive yeast strain, and a genetic analysis classified these YER (yeast EudiC resistance) mutants into three complementation groups. A genome-wide study revealed that the YER1-6 mutation is in the uS11 gene (RPS14A). Biotinylated EudiC pulled down Rps14p-containing complexes from 40S and 80S ribosomes, but not from the 60S ribosome. EudiC strongly inhibited translation of the wild-type strain but not of YER1-6 in cells and in vitro. These results indicate that EudiC is a protein synthesis inhibitor targeting the uS11-containing ribosomal subunit, and shows cytotoxicity by inhibiting protein translation. PMID:27304596

  5. Depletion of ribosomal protein S19 causes a reduction of rRNA synthesis

    PubMed Central

    Juli, Giada; Gismondi, Angelo; Monteleone, Valentina; Caldarola, Sara; Iadevaia, Valentina; Aspesi, Anna; Dianzani, Irma; Proud, Christopher G.; Loreni, Fabrizio


    Ribosome biogenesis plays key roles in cell growth by providing increased capacity for protein synthesis. It requires coordinated production of ribosomal proteins (RP) and ribosomal RNA (rRNA), including the processing of the latter. Here, we show that, the depletion of RPS19 causes a reduction of rRNA synthesis in cell lines of both erythroid and non-erythroid origin. A similar effect is observed upon depletion of RPS6 or RPL11. The deficiency of RPS19 does not alter the stability of rRNA, but instead leads to an inhibition of RNA Polymerase I (Pol I) activity. In fact, results of nuclear run-on assays and ChIP experiments show that association of Pol I with the rRNA gene is reduced in RPS19-depleted cells. The phosphorylation of three known regulators of Pol I, CDK2, AKT and AMPK, is altered during ribosomal stress and could be involved in the observed downregulation. Finally, RNA from patients with Diamond Blackfan Anemia (DBA), shows, on average, a lower level of 47S precursor. This indicates that inhibition of rRNA synthesis could be one of the molecular alterations at the basis of DBA. PMID:27734913

  6. GATA1 and PU.1 Bind to Ribosomal Protein Genes in Erythroid Cells: Implications for Ribosomopathies

    PubMed Central

    Amanatiadou, Elsa P.; Papadopoulos, Giorgio L.; Strouboulis, John; Vizirianakis, Ioannis S.


    The clear connection between ribosome biogenesis dysfunction and specific hematopoiesis-related disorders prompted us to examine the role of critical lineage-specific transcription factors in the transcriptional regulation of ribosomal protein (RP) genes during terminal erythroid differentiation. By applying EMSA and ChIP methodologies in mouse erythroleukemia cells we show that GATA1 and PU.1 bind in vitro and in vivo the proximal promoter region of the RPS19 gene which is frequently mutated in Diamond-Blackfan Anemia. Moreover, ChIPseq data analysis also demonstrates that several RP genes are enriched as potential GATA1 and PU.1 gene targets in mouse and human erythroid cells, with GATA1 binding showing an association with higher ribosomal protein gene expression levels during terminal erythroid differentiation in human and mouse. Our results suggest that RP gene expression and hence balanced ribosome biosynthesis may be specifically and selectively regulated by lineage specific transcription factors during hematopoiesis, a finding which may be clinically relevant to ribosomopathies. PMID:26447946

  7. GATA1 and PU.1 Bind to Ribosomal Protein Genes in Erythroid Cells: Implications for Ribosomopathies.


    Amanatiadou, Elsa P; Papadopoulos, Giorgio L; Strouboulis, John; Vizirianakis, Ioannis S


    The clear connection between ribosome biogenesis dysfunction and specific hematopoiesis-related disorders prompted us to examine the role of critical lineage-specific transcription factors in the transcriptional regulation of ribosomal protein (RP) genes during terminal erythroid differentiation. By applying EMSA and ChIP methodologies in mouse erythroleukemia cells we show that GATA1 and PU.1 bind in vitro and in vivo the proximal promoter region of the RPS19 gene which is frequently mutated in Diamond-Blackfan Anemia. Moreover, ChIPseq data analysis also demonstrates that several RP genes are enriched as potential GATA1 and PU.1 gene targets in mouse and human erythroid cells, with GATA1 binding showing an association with higher ribosomal protein gene expression levels during terminal erythroid differentiation in human and mouse. Our results suggest that RP gene expression and hence balanced ribosome biosynthesis may be specifically and selectively regulated by lineage specific transcription factors during hematopoiesis, a finding which may be clinically relevant to ribosomopathies. PMID:26447946

  8. The structure of a ribosomal protein S8/spc operon mRNA complex.


    Merianos, Helen J; Wang, Jimin; Moore, Peter B


    In bacteria, translation of all the ribosomal protein cistrons in the spc operon mRNA is repressed by the binding of the product of one of them, S8, to an internal sequence at the 5' end of the L5 cistron. The way in which the first two genes of the spc operon are regulated, retroregulation, is mechanistically distinct from translational repression by S8 of the genes from L5 onward. A 2.8 A resolution crystal structure has been obtained of Escherichia coli S8 bound to this site. Despite sequence differences, the structure of this complex is almost identical to that of the S8/helix 21 complex seen in the small ribosomal subunit, consistent with the hypothesis that autogenous regulation of ribosomal protein synthesis results from conformational similarities between mRNAs and rRNAs. S8 binding must repress the translation of its own mRNA by inhibiting the formation of a ribosomal initiation complex at the start of the L5 cistron.

  9. Ribosome engineering to promote new crystal forms

    SciTech Connect

    Selmer, Maria; Gao, Yong-Gui; Weixlbaumer, Albert; Ramakrishnan, V.


    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors.

  10. Solution Structure of Ribosomal Protein S28E From Methanobacterium Thermoautotrophicum

    SciTech Connect

    Wu, Bin; Yee, Adelinda; Pineda-Lucena, Antonio; Semesi, Anthony; Ramelot, Theresa A.; Cort, John R.; Jung, Jin-Won; Edwards, Aled M.; Lee, Weontae; Kennedy, Michael A.; Arrowsmith, Cheryl H.


    The ribosomal protein S28E from the archaeon Methanobacterium thermoautotrophicum is a component of the 30S ribosomal subunit. Sequence homologs of S28E are found only in archaea and eukaryotes. Here we report the three-dimensional solution structure of S28E by NMR spectroscopy. S28E contains a globular region and a long C-terminal tail protruding from the core. The globular region consists of four antiparallel {beta}-strands which are arranged in a Greek-key topology. Unique features of S28E include an extended loop L2-3 that folds back onto the protein and a 12-residue charged C-terminal tail with no regular secondary structure and greater flexibility relative to the rest of the protein.

  11. Arrested cell proliferation through cysteine protease activity of eukaryotic ribosomal protein S4.


    Yadaiah, Madasu; Sudhamalla, Babu; Rao, P Nageswara; Roy, Karnati R; Ramakrishna, Dasari; Hussain Syed, Gulam; Ramaiah, Kolluru V A; Bhuyan, Abani K


    S4 is an integral protein of the smaller subunit of cytosolic ribosome. In prokaryotes, it regulates the synthesis of ribosomal proteins by feedback inhibition of the α-operon gene expression, and it facilitates ribosomal RNA synthesis by direct binding to RNA polymerase. However, functional roles of S4 in eukaryotes are poorly understood, although its deficiency in humans is thought to produce Turner syndrome. We report here that wheat S4 is a cysteine protease capable of abrogating total protein synthesis in an actively translating cell-free system of rabbit reticulocytes. The translation-blocked medium, imaged by atomic force microscopy, scanning electron microscopy, and transmission electron microscopy, shows dispersed polysomes, and the disbanded polyribosome elements aggregate to form larger bodies. We also show that human embryonic kidney cells transfected with recombinant wheat S4 are unable to grow and proliferate. The mutant S4 protein, where the putative active site residue Cys 41 is replaced by a phenylalanine, can neither suppress protein synthesis nor arrest cell proliferation, suggesting that the observed phenomenon arises from the cysteine protease attribute of S4. The results also inspire many questions concerning in vivo significance of extraribosomal roles of eukaryotic S4 performed through its protease activity.

  12. NAD(+)- dependent deacetylase SIRT3 regulates mitochondrial protein synthesis by deacetylation of the ribosomal protein MRPL10

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A member of the sirtuin family of NAD (+)-dependent deacetylases, SIRT3, is located in mammalian mitochondria and is important for regulation of mitochondrial metabolism, cell survival, and longevity. In this study, MRPL10 (mitochondrial ribosomal protein L10) was identified as the major acetylated ...

  13. Photoinduced cross-linkage, in situ, of Escherichia coli 30S ribosomal proteins to 16S rRNA: identification of cross-linked proteins and relationships between reactivity and ribosome structure.


    Gorelic, L


    The kinetics of photoinduced cross-linkage of Escherichia coli 30S ribosomal proteins to the 16S-rRNA molecule in the intact Escherichia coli 30S ribosomal subunit was studied in this report. All of the 30S ribosomal proteins become cross-linked to the 16S rRNA before changes in the sedimentation characteristics of the 30S ribosomal subunit can be detected. The proteins exhibit different reactivities in the cross-linkage reaction. One group of proteins-S3, S7-S9, S11, S12, and S15-S19-is cross-linked to the 16S rRNA by single-hit kinetics, or by photoprocesses of nonunity but low multiplicities. A second group of proteins--S1, S2, S4-S6, S10, S13, S14, and S21--is cross-linked to the 16S rRNA by photoprocesses of a complex nature. A comparison of these data with other properties of the individual 30S ribosomal proteins related to ribosome structure indicated that most of the 30S ribosomal proteins cross-linked to the 16S rRNA by photoprocesses of low multiplicities had been classified rRNA-binding proteins by nonphotochemical methods, and most of the proteins cross-linked to the 16S rRNA by photoprocesses of large multiplicities had been classified as nonbinding proteins. There were certain exceptions to these correlations. Proteins S4 and S20, both RNA-binding proteins, become cross-linked to the 16S rRNA by photoprocessses of large multiplicities, and proteins S3, S11, S12, and S18, none of which have been classified RNA-binding proteins, exhibited low multiplicities in the cross-linkage reaction. All of these exceptions could be explained in terms of limitations inherent in the photochemical methods used in this study and in other types of methods that have been used to study RNA-protein interactions in the 30S ribosomal subunit. The data presented here also suggest that labile RNA-protein cross-links are present in the uv-irradiated 30S ribosomal subunits, and that neither peptide-bond cleavage nor photoinduced modification of the charged side-chain groups in

  14. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    PubMed Central


    Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny. PMID:18366624

  15. Ribosomal protein-dependent orientation of the 16 S rRNA environment of S15.


    Jagannathan, Indu; Culver, Gloria M


    Ribosomal protein S15 binds specifically to the central domain of 16 S ribosomal RNA (16 S rRNA) and directs the assembly of four additional proteins to this domain. The central domain of 16 S rRNA along with these five proteins form the platform of the 30 S subunit. Previously, directed hydroxyl radical probing from Fe(II)-S15 in small ribonucleoprotein complexes was used to study assembly of the central domain of 16 S rRNA. Here, this same approach was used to understand the 16 S rRNA environment of Fe(II)-S15 in 30 S subunits and to determine the ribosomal proteins that are involved in forming the mature S15-16 S rRNA environment. We have identified additional sites of Fe(II)-S15-directed cleavage in 30S subunits compared to the binary complex of Fe(II)-S15/16 S rRNA. Along with novel targets in the central domain, sites within the 5' and 3' minor domains are also cleaved. This suggests that during the course of 30S subunit assembly these elements are positioned in the vicinity of S15. Besides the previously determined role for S8, roles for S5, S6+S18, and S16 in altering the 16 S rRNA environment of S15 were established. These studies reveal that ribosomal proteins can alter the assembly of regions of the 30 S subunit from a considerable distance and influence the overall conformation of this ribonucleoprotein particle.

  16. The Hymenopteran Tree of Life: Evidence from Protein-Coding Genes and Objectively Aligned Ribosomal Data

    PubMed Central

    Klopfstein, Seraina; Vilhelmsen, Lars; Heraty, John M.; Sharkey, Michael; Ronquist, Fredrik


    Previous molecular analyses of higher hymenopteran relationships have largely been based on subjectively aligned ribosomal sequences (18S and 28S). Here, we reanalyze the 18S and 28S data (unaligned about 4.4 kb) using an objective and a semi-objective alignment approach, based on MAFFT and BAli-Phy, respectively. Furthermore, we present the first analyses of a substantial protein-coding data set (4.6 kb from one mitochondrial and four nuclear genes). Our results indicate that previous studies may have suffered from inflated support values due to subjective alignment of the ribosomal sequences, but apparently not from significant biases. The protein data provide independent confirmation of several earlier results, including the monophyly of non-xyelid hymenopterans, Pamphilioidea + Unicalcarida, Unicalcarida, Vespina, Apocrita, Proctotrupomorpha and core Proctotrupomorpha. The protein data confirm that Aculeata are nested within a paraphyletic Evaniomorpha, but cast doubt on the monophyly of Evanioidea. Combining the available morphological, ribosomal and protein-coding data, we examine the total-evidence signal as well as congruence and conflict among the three data sources. Despite an emerging consensus on many higher-level hymenopteran relationships, several problems remain unresolved or contentious, including rooting of the hymenopteran tree, relationships of the woodwasps, placement of Stephanoidea and Ceraphronoidea, and the sister group of Aculeata. PMID:23936325

  17. Crystal structure of a beta-finger domain of Prp8 reveals analogy to ribosomal proteins

    SciTech Connect

    Yang, K.; Heroux, A.; Zhang, L.; Zhao, R.


    Prp8 stands out among hundreds of splicing factors as a key regulator of spliceosome activation and a potential cofactor of the splicing reaction. We present here the crystal structure of a 274-residue domain (residues 1,822-2,095) near the C terminus of Saccharomyces cerevisiae Prp8. The most striking feature of this domain is a {beta}-hairpin finger protruding out of the protein (hence, this domain will be referred to as the {beta}-finger domain), resembling many globular ribosomal proteins with protruding extensions. Mutations throughout the {beta}-finger change the conformational equilibrium between the first and the second catalytic step. Mutations at the base of the {beta}-finger affect U4/U6 unwinding-mediated spliceosome activation. Prp8 may insert its {beta}-finger into the first-step complex (U2/U5/U6/pre-mRNA) or U4/U6.U5 tri-snRNP and stabilize these complexes. Mutations on the {beta}-finger likely alter these interactions, leading to the observed mutant phenotypes. Our results suggest a possible mechanism of how Prp8 regulates spliceosome activation. These results also demonstrate an analogy between a spliceosomal protein and ribosomal proteins that insert extensions into folded rRNAs and stabilize the ribosome.

  18. cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).


    Abolhassani, Mohsen; Roux, Kenneth H


    Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

  19. Orsay virus utilizes ribosomal frameshifting to express a novel protein that is incorporated into virions

    SciTech Connect

    Jiang, Hongbing; Franz, Carl J.; Wu, Guang; Renshaw, Hilary; Zhao, Guoyan; Firth, Andrew E.; Wang, David


    Orsay virus is the first identified virus that is capable of naturally infecting Caenorhabditis elegans. Although it is most closely related to nodaviruses, Orsay virus differs from nodaviruses in its genome organization. In particular, the Orsay virus RNA2 segment encodes a putative novel protein of unknown function, termed delta, which is absent from all known nodaviruses. Here we present evidence that Orsay virus utilizes a ribosomal frameshifting strategy to express a novel fusion protein from the viral capsid (alpha) and delta ORFs. Moreover, the fusion protein was detected in purified virus fractions, demonstrating that it is most likely incorporated into Orsay virions. Furthermore, N-terminal sequencing of both the fusion protein and the capsid protein demonstrated that these proteins must be translated from a non-canonical initiation site. While the function of the alpha–delta fusion remains cryptic, these studies provide novel insights into the fundamental properties of this new clade of viruses. - Highlights: • Orsay virus encodes a novel fusion protein by a ribosomal frameshifting mechanism. • Orsay capsid and fusion protein is translated from a non-canonical initiation site. • The fusion protein is likely incorporated into Orsay virions.

  20. Deletions in a ribosomal protein-coding gene are associated with tigecycline resistance in Enterococcus faecium.


    Niebel, Marc; Quick, Joshua; Prieto, Ana Maria Guzman; Hill, Robert L R; Pike, Rachel; Huber, Damon; David, Miruna; Hornsey, Michael; Wareham, David; Oppenheim, Beryl; Woodford, Neil; van Schaik, Willem; Loman, Nicholas


    Enterococcus faecium is an emerging nosocomial pathogen associated with antibiotic therapy in the hospital environment. Whole-genome sequences were determined for three pairs of related, consecutively collected E. faecium clinical isolates to determine putative mechanisms of resistance to tigecycline. The first isolates (1S, 2S and 3S) in each of the three pairs were sensitive to tigecycline [minimum inhibitory concentration (MIC) of 0.125 mg/L]. Following tigecycline therapy, the second isolate in each pair demonstrated increased resistance to tigecycline. Two isolates (1R and 2R) were resistant (MIC of 8 mg/L) and one isolate (3I) demonstrated reduced susceptibility (MIC of 0.5 mg/L). Mutations distinguishing each pair of sensitive and resistant isolates were determined through alignment to a reference genome and variant detection. In addition, a de novo assembly of each isolate genome was constructed to confirm mutations. A total of 16 mutations in eleven coding sequences were determined. Mutations in the rpsJ gene, which encodes a structural protein forming part of the 30S ribosomal subunit, were detected in each of the pairs. Mutations were in regions proximal to the predicted tigecycline-binding site. Predicted amino acid substitutions were detected in 1R and 3I. The resistant strains were additionally associated with deletions of 15 nucleotides (2R) and 3 nucleotides (1R). This study confirms that amino acid substitutions in rpsJ contribute towards reduced susceptibility to tigecycline and suggests that deletions may be required for tigecycline resistance in E. faecium.

  1. The ribosomal protein L10/QM-like protein is a component of the NIK-mediated antiviral signaling

    SciTech Connect

    Rocha, Carolina S.; Santos, Anesia A.; Machado, Joao Paulo B.; Fontes, Elizabeth P.B.


    The NIK (NSP-interacting kinase)-mediated antiviral signaling pathway was identified as a virulence target of the begomovirus nuclear shuttle protein (NSP). Here, we further characterized this layer of plant innate defense by identifying the ribosomal protein L10 (rpL10), a QM-like protein, as a downstream effector of the antiviral signaling. Although both ribosomal proteins rpL10 and rpL18 were found to associate with NIK1 through yeast two-hybrid screening, the NIK receptors specifically phosphorylated rpL10 in vitro. Furthermore, loss of rpL10 function significantly increased susceptibility to begomovirus infection, recapitulating the phenotype of nik knockout lines. Our results genetically linked rpL10 to the NIK-mediated antiviral signaling.

  2. Crystallization and preliminary X-ray structure analysis of human ribosomal protein L30e.


    Kawaguchi, Akiko; Ose, Toyoyuki; Yao, Min; Tanaka, Isao


    Many functions have been reported for the eukaryotic ribosomal protein L30e. L30e makes several inter-subunit and intra-subunit interactions with protein or RNA components of the 80S ribosome. Yeast L30e has been shown to bind to its own transcript to autoregulate expression at both the transcriptional and the translational levels. Furthermore, it has been reported that mammalian L30e is a component of the selenocysteine-incorporation machinery by binding to the selenocysteine-insertion sequence on mRNA. As high-resolution crystal structures of mammalian L30e are not available, the purification, crystallization and X-ray structure analysis of human L30e are presented here.

  3. Impact of P-Site tRNA and Antibiotics on Ribosome Mediated Protein Folding: Studies Using the Escherichia coli Ribosome

    PubMed Central

    Mondal, Surojit; Pathak, Bani Kumar; Ray, Sutapa; Barat, Chandana


    Background The ribosome, which acts as a platform for mRNA encoded polypeptide synthesis, is also capable of assisting in folding of polypeptide chains. The peptidyl transferase center (PTC) that catalyzes peptide bond formation resides in the domain V of the 23S rRNA of the bacterial ribosome. Proper positioning of the 3′ –CCA ends of the A- and P-site tRNAs via specific interactions with the nucleotides of the PTC are crucial for peptidyl transferase activity. This RNA domain is also the center for ribosomal chaperoning activity. The unfolded polypeptide chains interact with the specific nucleotides of the PTC and are released in a folding competent form. In vitro transcribed RNA corresponding to this domain (bDV RNA) also displays chaperoning activity. Results The present study explores the effects of tRNAs, antibiotics that are A- and P-site PTC substrate analogs (puromycin and blasticidin) and macrolide antibiotics (erythromycin and josamycin) on the chaperoning ability of the E. coli ribosome and bDV RNA. Our studies using mRNA programmed ribosomes show that a tRNA positioned at the P-site effectively inhibits the ribosome's chaperoning function. We also show that the antibiotic blasticidin (that mimics the interaction between 3′–CCA end of P/P-site tRNA with the PTC) is more effective in inhibiting ribosome and bDV RNA chaperoning ability than either puromycin or the macrolide antibiotics. Mutational studies of the bDV RNA could identify the nucleotides U2585 and G2252 (both of which interact with P-site tRNA) to be important for its chaperoning ability. Conclusion Both protein synthesis and their proper folding are crucial for maintenance of a functional cellular proteome. The PTC of the ribosome is attributed with both these abilities. The silencing of the chaperoning ability of the ribosome in the presence of P-site bound tRNA might be a way to segregate these two important functions. PMID:25000563

  4. Plastid ribosomal protein S5 is involved in photosynthesis, plant development, and cold stress tolerance in Arabidopsis

    PubMed Central

    Zhang, Junxiang; Yuan, Hui; Yang, Yong; Fish, Tara; Lyi, Sangbom M.; Thannhauser, Theodore W; Zhang, Lugang; Li, Li


    Plastid ribosomal proteins are essential components of protein synthesis machinery and have diverse roles in plant growth and development. Mutations in plastid ribosomal proteins lead to a range of developmental phenotypes in plants. However, how they regulate these processes is not fully understood, and the functions of some individual plastid ribosomal proteins remain unknown. To identify genes responsible for chloroplast development, we isolated and characterized a mutant that exhibited pale yellow inner leaves with a reduced growth rate in Arabidopsis. The mutant (rps5) contained a missense mutation of plastid ribosomal protein S5 (RPS5), which caused a dramatically reduced abundance of chloroplast 16S rRNA and seriously impaired 16S rRNA processing to affect ribosome function and plastid translation. Comparative proteomic analysis revealed that the rps5 mutation suppressed the expression of a large number of core components involved in photosystems I and II as well as many plastid ribosomal proteins. Unexpectedly, a number of proteins associated with cold stress responses were greatly decreased in rps5, and overexpression of the plastid RPS5 improved plant cold stress tolerance. Our results indicate that RPS5 is an important constituent of the plastid 30S subunit and affects proteins involved in photosynthesis and cold stress responses to mediate plant growth and development. PMID:27006483

  5. Comparative genomics of bacterial zinc regulons: enhanced ion transport, pathogenesis, and rearrangement of ribosomal proteins.


    Panina, Ekaterina M; Mironov, Andrey A; Gelfand, Mikhail S


    Zinc is an important component of many proteins, but in large concentrations it is poisonous to the cell. Thus its transport is regulated by zinc repressors ZUR of proteobacteria and Gram-positive bacteria from the Bacillus group and AdcR of bacteria from the Streptococcus group. Comparative computational analysis allowed us to identify binding signals of ZUR repressors GAAATGTTATANTATAACATTTC for gamma-proteobacteria, GTAATGTAATAACATTAC for the Agrobacterium group, GATATGTTATAACATATC for the Rhododoccus group, TAAATCGTAATNATTACGATTTA for Gram-positive bacteria, and TTAACYRGTTAA of the streptococcal AdcR repressor. In addition to known transporters and their paralogs, zinc regulons were predicted to contain a candidate component of the ATP binding cassette, zinT (b1995 in Escherichia coli and yrpE in Bacillus subtilis). Candidate AdcR-binding sites were identified upstream of genes encoding pneumococcal histidine triad (PHT) proteins from a number of pathogenic streptococci. Protein functional analysis of this family suggests that PHT proteins are involved in the invasion process. Finally, repression by zinc was predicted for genes encoding a variety of paralogs of ribosomal proteins. The original copies of all these proteins contain zinc-ribbon motifs and thus likely bind zinc, whereas these motifs are destroyed in zinc-regulated paralogs. We suggest that the induction of these paralogs in conditions of zinc starvation leads to their incorporation in a fraction of ribosomes instead of the original ribosomal proteins; the latter are then degraded with subsequent release of some zinc for the utilization by other proteins. Thus we predict a mechanism for maintaining zinc availability for essential enzymes. PMID:12904577

  6. Ribosomal Protein Mutations Result in Constitutive p53 Protein Degradation through Impairment of the AKT Pathway

    PubMed Central

    Hermkens, Dorien; Wlodarski, Marcin W.; Da Costa, Lydie; MacInnes, Alyson W.


    Mutations in ribosomal protein (RP) genes can result in the loss of erythrocyte progenitor cells and cause severe anemia. This is seen in patients with Diamond-Blackfan anemia (DBA), a pure red cell aplasia and bone marrow failure syndrome that is almost exclusively linked to RP gene haploinsufficiency. While the mechanisms underlying the cytopenia phenotype of patients with these mutations are not completely understood, it is believed that stabilization of the p53 tumor suppressor protein may induce apoptosis in the progenitor cells. In stark contrast, tumor cells from zebrafish with RP gene haploinsufficiency are unable to stabilize p53 even when exposed to acute DNA damage despite transcribing wild type p53 normally. In this work we demonstrate that p53 has a limited role in eliciting the anemia phenotype of zebrafish models of DBA. In fact, we find that RP-deficient embryos exhibit the same normal p53 transcription, absence of p53 protein, and impaired p53 response to DNA damage as RP haploinsufficient tumor cells. Recently we reported that RP mutations suppress activity of the AKT pathway, and we show here that this suppression results in proteasomal degradation of p53. By re-activating the AKT pathway or by inhibiting GSK-3, a downstream modifier that normally represses AKT signaling, we are able to restore the stabilization of p53. Our work indicates that the anemia phenotype of zebrafish models of DBA is dependent on factors other than p53, and may hold clinical significance for both DBA and the increasing number of cancers revealing spontaneous mutations in RP genes. PMID:26132763

  7. Suppression of the Escherichia coli rpoH opal mutation by ribosomes lacking S15 protein.

    PubMed Central

    Yano, R; Yura, T


    Several suppressors (suhD) that can specifically suppress the temperature-sensitive opal rpoH11 mutation of Escherichia coli K-12 have been isolated and characterized. Unlike the parental rpoH11 mutant deficient in the heat shock response, the temperature-resistant pseudorevertants carrying suhD were capable of synthesizing sigma 32 and exhibiting partial induction of heat shock proteins. These strains were also cold sensitive and unable to grow at 25 degrees C. Genetic mapping and complementation studies permitted us to localize suhD near rpsO (69 min), the structural gene for ribosomal protein S15. Ribosomes and polyribosomes prepared from suhD cells contained a reduced level (ca. 10%) of S15 relative to that of the wild type. Cloning and sequencing of suhD revealed that an IS10-like element had been inserted at the attenuator-terminator region immediately downstream of the rpsO coding region. The rpsO mRNA level in the suhD strain was also reduced to about 10% that of wild type. Apparently, ribosomes lacking S15 can actively participate in protein synthesis and suppress the rpoH11 opal (UGA) mutation at high temperature but cannot sustain cell growth at low temperature. Images PMID:2646293

  8. Crystal structure of ribosomal protein L1 from the bacterium Aquifex aeolicus

    NASA Astrophysics Data System (ADS)

    Nikonova, E. Yu.; Tishchenko, S. V.; Gabdulkhakov, A. G.; Shklyaeva, A. A.; Garber, M. B.; Nikonov, S. V.; Nevskaya, N. A.


    The crystal structure of ribosomal protein L1 from the bacterium Aquifex aeolicus was solved by the molecular-replacement method and refined to R cryst = 19.4% and R free = 25.1% at 2.1 Å protein consists of two domains linked together by a flexible hinge region. In the structure under consideration, the domains are in close proximity and adopt a closed conformation. Earlier, this conformation has been found in the structure of protein L1 from the bacterium Thermus thermophilus, whereas the structures of archaeal L1 proteins and the structures of all L1 proteins in the RNA-bound form have an open conformation. The fact that a closed conformation was found in the structures of two L1 proteins which crystallize in different space groups and belong to different bacteria suggests that this conformation is a characteristic feature of L1 bacterial proteins in the free form.

  9. Mechanism of fusidic acid inhibition of RRF- and EF-G-dependent splitting of the bacterial post-termination ribosome

    PubMed Central

    Borg, Anneli; Pavlov, Michael; Ehrenberg, Måns


    The antibiotic drug fusidic acid (FA) is commonly used in the clinic against gram-positive bacterial infections. FA targets ribosome-bound elongation factor G (EF-G), a translational GTPase that accelerates both messenger RNA (mRNA) translocation and ribosome recycling. How FA inhibits translocation was recently clarified, but FA inhibition of ribosome recycling by EF-G and ribosome recycling factor (RRF) has remained obscure. Here we use fast kinetics techniques to estimate mean times of ribosome splitting and the stoichiometry of GTP hydrolysis by EF-G at varying concentrations of FA, EF-G and RRF. These mean times together with previous data on uninhibited ribosome recycling were used to clarify the mechanism of FA inhibition of ribosome splitting. The biochemical data on FA inhibition of translocation and recycling were used to model the growth inhibitory effect of FA on bacterial populations. We conclude that FA inhibition of translocation provides the dominant cause of bacterial growth reduction, but that FA inhibition of ribosome recycling may contribute significantly to FA-induced expression of short regulatory open reading frames, like those involved in FA resistance. PMID:27001509

  10. Mechanism of fusidic acid inhibition of RRF- and EF-G-dependent splitting of the bacterial post-termination ribosome.


    Borg, Anneli; Pavlov, Michael; Ehrenberg, Måns


    The antibiotic drug fusidic acid (FA) is commonly used in the clinic against gram-positive bacterial infections. FA targets ribosome-bound elongation factor G (EF-G), a translational GTPase that accelerates both messenger RNA (mRNA) translocation and ribosome recycling. How FA inhibits translocation was recently clarified, but FA inhibition of ribosome recycling by EF-G and ribosome recycling factor (RRF) has remained obscure. Here we use fast kinetics techniques to estimate mean times of ribosome splitting and the stoichiometry of GTP hydrolysis by EF-G at varying concentrations of FA, EF-G and RRF. These mean times together with previous data on uninhibited ribosome recycling were used to clarify the mechanism of FA inhibition of ribosome splitting. The biochemical data on FA inhibition of translocation and recycling were used to model the growth inhibitory effect of FA on bacterial populations. We conclude that FA inhibition of translocation provides the dominant cause of bacterial growth reduction, but that FA inhibition of ribosome recycling may contribute significantly to FA-induced expression of short regulatory open reading frames, like those involved in FA resistance. PMID:27001509

  11. The Ribosome-Sec61 Translocon Complex Forms a Cytosolically Restricted Environment for Early Polytopic Membrane Protein Folding.


    Patterson, Melissa A; Bandyopadhyay, Anannya; Devaraneni, Prasanna K; Woodward, Josha; Rooney, LeeAnn; Yang, Zhongying; Skach, William R


    Transmembrane topology of polytopic membrane proteins (PMPs) is established in the endoplasmic reticulum (ER) by the ribosome Sec61-translocon complex (RTC) through iterative cycles of translocation initiation and termination. It remains unknown, however, whether tertiary folding of transmembrane domains begins after the nascent polypeptide integrates into the lipid bilayer or within a proteinaceous environment proximal to translocon components. To address this question, we used cysteine scanning mutagenesis to monitor aqueous accessibility of stalled translation intermediates to determine when, during biogenesis, hydrophilic peptide loops of the aquaporin-4 (AQP4) water channel are delivered to cytosolic and lumenal compartments. Results showed that following ribosome docking on the ER membrane, the nascent polypeptide was shielded from the cytosol as it emerged from the ribosome exit tunnel. Extracellular loops followed a well defined path through the ribosome, the ribosome translocon junction, the Sec61-translocon pore, and into the ER lumen coincident with chain elongation. In contrast, intracellular loops (ICLs) and C-terminalresidues exited the ribosome into a cytosolically shielded environment and remained inaccessible to both cytosolic and lumenal compartments until translation was terminated. Shielding of ICL1 and ICL2, but not the C terminus, became resistant to maneuvers that disrupt electrostatic ribosome interactions. Thus, the early folding landscape of polytopic proteins is shaped by a spatially restricted environment localized within the assembled ribosome translocon complex. PMID:26254469

  12. Post-transcriptional regulation of ribosomal protein genes during serum starvation in Entamoeba histolytica.


    Ahamad, Jamaluddin; Ojha, Sandeep; Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha


    Ribosome synthesis involves all three RNA polymerases which are co-ordinately regulated to produce equimolar amounts of rRNAs and ribosomal proteins (RPs). Unlike model organisms where transcription of rRNA and RP genes slows down during stress, in E. histolytica rDNA transcription continues but pre-rRNA processing slows down and unprocessed pre-rRNA accumulates during serum starvation. To investigate the regulation of RP genes under stress we measured transcription of six selected RP genes from the small- and large-ribosomal subunits (RPS6, RPS3, RPS19, RPL5, RPL26, RPL30) representing the early-, mid-, and late-stages of ribosomal assembly. Transcripts of these genes persisted in growth-stressed cells. Expression of luciferase reporter under the control of two RP genes (RPS19 and RPL30) was studied during serum starvation and upon serum replenishment. Although luciferase transcript levels remained unchanged during starvation, luciferase activity steadily declined to 7.8% and 15% of control cells, respectively. After serum replenishment the activity increased to normal levels, suggesting post-transcriptional regulation of these genes. Mutations in the sequence -2 to -9 upstream of AUG in the RPL30 gene resulted in the phenotype expected of post-transcriptional regulation. Transcription of luciferase reporter was unaffected in this mutant, and luciferase activity did not decline during serum starvation, showing that this sequence is required to repress translation of RPL30 mRNA, and mutations in this region relieve repression. Our data show that during serum starvation E. histolytica blocks ribosome biogenesis post-transcriptionally by inhibiting pre-rRNA processing on the one hand, and the translation of RP mRNAs on the other.

  13. Sequence analysis of genes encoding ribosomal proteins of amitochondriate protists: L1 of Trichomonas vaginalis and L29 of Giardia lamblia.


    Wu, G; Hashimoto, T


    Two genes encoding the ribosomal proteins were cloned and sequenced from amitochondriate protists, L1 (L10a in mammalian nomenclature) from Trichomonas vaginalis and L29 (L35 in mammalian nomenclature) from Giardia lamblia. The deduced amino acid sequences were analyzed by sequence alignments and phylogenetic reconstructions. Both the T. vaginalis L1 and the G. lamblia L29 displayed eukaryotic sequence features, when compared with all the homologs from the three primary kingdoms.

  14. Defect in the Formation of 70S Ribosomes Caused by Lack of Ribosomal Protein L34 Can Be Suppressed by Magnesium

    PubMed Central

    Kobayashi, Ako; Suzuki, Shota; Kawamura, Fujio; Shiwa, Yuh; Watanabe, Satoru; Yoshikawa, Hirofumi; Hanai, Ryo; Ishizuka, Morio


    To elucidate the biological functions of the ribosomal protein L34, which is encoded by the rpmH gene, the rpmH deletion mutant of Bacillus subtilis and two suppressor mutants were characterized. Although the ΔrpmH mutant exhibited a severe slow-growth phenotype, additional mutations in the yhdP or mgtE gene restored the growth rate of the ΔrpmH strain. Either the disruption of yhdP, which is thought to be involved in the efflux of Mg2+, or overexpression of mgtE, which plays a major role in the import of Mg2+, could suppress defects in both the formation of the 70S ribosome and growth caused by the absence of L34. Interestingly, the Mg2+ content was lower in the ΔrpmH cells than in the wild type, and the Mg2+ content in the ΔrpmH cells was restored by either the disruption of yhdP or overexpression of mgtE. In vitro experiments on subunit association demonstrated that 50S subunits that lacked L34 could form 70S ribosomes only at a high concentration of Mg2+. These results showed that L34 is required for efficient 70S ribosome formation and that L34 function can be restored partially by Mg2+. In addition, the Mg2+ content was consistently lower in mutants that contained significantly reduced amounts of the 70S ribosome, such as the ΔrplA (L1) and ΔrplW (L23) strains and mutant strains with a reduced number of copies of the rrn operon. Thus, the results indicated that the cellular Mg2+ content is influenced by the amount of 70S ribosomes. PMID:25182490

  15. Defect in the formation of 70S ribosomes caused by lack of ribosomal protein L34 can be suppressed by magnesium.


    Akanuma, Genki; Kobayashi, Ako; Suzuki, Shota; Kawamura, Fujio; Shiwa, Yuh; Watanabe, Satoru; Yoshikawa, Hirofumi; Hanai, Ryo; Ishizuka, Morio


    To elucidate the biological functions of the ribosomal protein L34, which is encoded by the rpmH gene, the rpmH deletion mutant of Bacillus subtilis and two suppressor mutants were characterized. Although the ΔrpmH mutant exhibited a severe slow-growth phenotype, additional mutations in the yhdP or mgtE gene restored the growth rate of the ΔrpmH strain. Either the disruption of yhdP, which is thought to be involved in the efflux of Mg(2+), or overexpression of mgtE, which plays a major role in the import of Mg(2+), could suppress defects in both the formation of the 70S ribosome and growth caused by the absence of L34. Interestingly, the Mg(2+) content was lower in the ΔrpmH cells than in the wild type, and the Mg(2+) content in the ΔrpmH cells was restored by either the disruption of yhdP or overexpression of mgtE. In vitro experiments on subunit association demonstrated that 50S subunits that lacked L34 could form 70S ribosomes only at a high concentration of Mg(2+). These results showed that L34 is required for efficient 70S ribosome formation and that L34 function can be restored partially by Mg(2+). In addition, the Mg(2+) content was consistently lower in mutants that contained significantly reduced amounts of the 70S ribosome, such as the ΔrplA (L1) and ΔrplW (L23) strains and mutant strains with a reduced number of copies of the rrn operon. Thus, the results indicated that the cellular Mg(2+) content is influenced by the amount of 70S ribosomes.

  16. Activities of the peptidyl transferase center of ribosomes lacking protein L27

    PubMed Central

    Maracci, Cristina; Wohlgemuth, Ingo; Rodnina, Marina V.


    The ribosome is the molecular machine responsible for protein synthesis in all living organisms. Its catalytic core, the peptidyl transferase center (PTC), is built of rRNA, although several proteins reach close to the inner rRNA shell. In the Escherichia coli ribosome, the flexible N-terminal tail of the ribosomal protein L27 contacts the A- and P-site tRNA. Based on computer simulations of the PTC and on previous biochemical evidence, the N-terminal α-amino group of L27 was suggested to take part in the peptidyl-transfer reaction. However, the contribution of this group to catalysis has not been tested experimentally. Here we investigate the role of L27 in peptide-bond formation using fast kinetics approaches. We show that the rate of peptide-bond formation at physiological pH, both with aminoacyl-tRNA or with the substrate analog puromycin, is independent of the presence of L27; furthermore, translation of natural mRNAs is only marginally affected in the absence of L27. The pH dependence of the puromycin reaction is unaltered in the absence of L27, indicating that the N-terminal α-amine is not the ionizing group taking part in catalysis. Likewise, L27 is not required for the peptidyl-tRNA hydrolysis during termination. Thus, apart from the known effect on subunit association, which most likely explains the phenotype of the deletion strains, L27 does not appear to be a key player in the core mechanism of peptide-bond formation on the ribosome. PMID:26475831

  17. Activities of the peptidyl transferase center of ribosomes lacking protein L27.


    Maracci, Cristina; Wohlgemuth, Ingo; Rodnina, Marina V


    The ribosome is the molecular machine responsible for protein synthesis in all living organisms. Its catalytic core, the peptidyl transferase center (PTC), is built of rRNA, although several proteins reach close to the inner rRNA shell. In the Escherichia coli ribosome, the flexible N-terminal tail of the ribosomal protein L27 contacts the A- and P-site tRNA. Based on computer simulations of the PTC and on previous biochemical evidence, the N-terminal α-amino group of L27 was suggested to take part in the peptidyl-transfer reaction. However, the contribution of this group to catalysis has not been tested experimentally. Here we investigate the role of L27 in peptide-bond formation using fast kinetics approaches. We show that the rate of peptide-bond formation at physiological pH, both with aminoacyl-tRNA or with the substrate analog puromycin, is independent of the presence of L27; furthermore, translation of natural mRNAs is only marginally affected in the absence of L27. The pH dependence of the puromycin reaction is unaltered in the absence of L27, indicating that the N-terminal α-amine is not the ionizing group taking part in catalysis. Likewise, L27 is not required for the peptidyl-tRNA hydrolysis during termination. Thus, apart from the known effect on subunit association, which most likely explains the phenotype of the deletion strains, L27 does not appear to be a key player in the core mechanism of peptide-bond formation on the ribosome.

  18. Yeast ribosomal proteins: XII. YS11 of Saccharomyces cerevisiae is a homologue to E. coli S4 according to the gene analysis.

    PubMed Central

    Mizuta, K; Hashimoto, T; Suzuki, K; Otaka, E


    We isolated and sequenced a gene, YS11A, encoding ribosomal protein YS11 of Saccharomyces cerevisiae. YS11A is one of two functional copies of the YS11 gene, located on chromosome XVI and transcribed in a lower amount than the other copy which is located on chromosome II. The disruption of YS11A has no effect on the growth of yeast. The 5'-flanking region contains a similar sequence to consensus UASrpg and the T-rich region. The open reading frame is interrupted with an intron located near the 5'-end. The predicted amino acid sequence reveals that yeast YS11 is a homologue to E. coli S4, one of the ram proteins, three chloroplast S4s and others out of the ribosomal protein sequences currently available. Images PMID:2041737

  19. Solution Structure of Ribosomal Protein L40E, a Unique C4 Zinc Finger Protein Encoded by Archaeon Sulfolobus Solfataricus

    SciTech Connect

    Wu, Bin; Lukin, Jonathan A.; Yee, Adelinda; Lemak, Alexander; Semesi, Anthony; Ramelot, Theresa A.; Kennedy, Michael A.; Arrowsmith, Cheryl H.


    The ribosomal protein L40E from archaeon Sulfolobus solfataricus is a component of the 50S ribosomal subunit. L40E is a 56-residue, highly basic protein that contains a C4 zinc finger motif, CRKC_X10_CRRC. Homologs are found in both archaea and eukaryotes but are not present in bacteria. Eukaryotic genomes encode L40E as a ubiquitin-fusion protein. L40E was absent from the crystal structure of euryarchaeota 50S ribosomal subunit. Here we report the three-dimensional solution structure of L40E by NMR spectroscopy. The structure of L40E is a three-stranded b-sheet with a simple b2b1b3 topology. There are two unique characteristics revealed by the structure. First, a large and ordered b2–b3 loop twists to pack across the one side of the protein. L40E contains a buried polar cluster comprising Lys19, Lys20, Cys22, Asn29, and Cys36. Second, the surface of L40E is almost entirely positively charged. Ten conserved basic residues are positioned on the two sides of the surface. It is likely that binding of zinc is essential in stabilizing the tertiary structure of L40E to act as a scaffold to create a broad positively charged surface for RNA and/or protein recognition. A portion of this work was performed in the Environmental Molecular Sciences Facility, a DOE national scientific user facility.

  20. The Structure of PA1221, a Non-Ribosomal Peptide Synthetase containing Adenylation and Peptidyl Carrier Protein Domains

    PubMed Central

    Mitchell, Carter A.; Shi, Ce; Aldrich, Courtney C.; Gulick, Andrew M.


    Many bacteria use large modular enzymes for the synthesis of polyketide and peptide natural products. These multidomain enzymes contain integrated carrier domains that deliver bound substrates to multiple catalytic domains, requiring coordination of these chemical steps. Non-Ribosomal Peptide Synthetases (NRPSs) load amino acids onto carrier domains through the activity of an upstream adenylation domain. Our lab recently determined the structure of an engineered two-domain NRPS containing fused adenylation and carrier domains. This structure adopted a domain swapped dimer that illustrated the interface between these two domains. To continue our investigation, we now examine PA1221, a natural two-domain protein from Pseudomonas aeruginosa. We have determined the amino acid specificity of this new enzyme and used domain specific mutations to demonstrate that loading the downstream carrier domain within a single protein molecule occurs more quickly than loading of a non-fused carrier domain inter-molecularly. Finally, we have determined crystal structures of both the apo- and holo-PA1221 protein, the latter using a valine-adenosine vinylsulfonamide inhibitor that traps the adenylation-carrier domain interaction. The protein adopts a similar interface to that seen with the prior adenylation-carrier protein construct. A comparison of these structures with previous structures of multidomain NRPSs suggests that a large conformational change within the NRPS adenylation domains guides the carrier domain into the active site for thioester formation. PMID:22452656

  1. Highly conserved base A55 of 16S ribosomal RNA is important for the elongation cycle of protein synthesis.


    Sahu, Bhubanananda; Khade, Prashant K; Joseph, Simpson


    Accurate decoding of mRNA requires the precise interaction of protein factors and tRNAs with the ribosome. X-ray crystallography and cryo-electron microscopy have provided detailed structural information about the 70S ribosome with protein factors and tRNAs trapped during translation. Crystal structures showed that one of the universally conserved 16S rRNA bases, A55, in the shoulder domain of the 30S subunit interacts with elongation factors Tu and G (EF-Tu and EF-G, respectively). The exact functional role of A55 in protein synthesis is not clear. We changed A55 to U and analyzed the effect of the mutation on the elongation cycle of protein synthesis using functional assays. Expression of 16S rRNA with the A55U mutation in cells confers a dominant lethal phenotype. Additionally, ribosomes with the A55U mutation in 16S rRNA show substantially reduced in vitro protein synthesis activity. Equilibrium binding studies showed that the A55U mutation considerably inhibited the binding of the EF-Tu·GTP·tRNA ternary complex to the ribosome. Furthermore, the A55U mutation slightly inhibited the peptidyl transferase reaction, the binding of EF-G·GTP to the ribosome, and mRNA-tRNA translocation. These results indicate that A55 is important for fine-tuning the activity of the ribosome during the elongation cycle of protein synthesis.

  2. Immunogenicity of Ribosomal Preparations from Yeast Cells of Histoplasma capsulatum

    PubMed Central

    Feit, Carl; Tewari, Ram P.


    Protective immunity was elicited by immunization of mice with ribosomal preparations from yeast cells of Histoplasma capsulatum. Ribosomes from disrupted cells were isolated by differential centrifugation using sodium dodecyl sulfate. These preparations contained 55% protein and 45% ribonucleic acid and sedimented as a single peak with a sedimentation coefficient of 77S on sucrose density gradient analysis. Mice immunized subcutaneously with ribosomes, with or without adjuvant, were challenged intravenously with 8 × 106 yeast cells of H. capsulatum. Significant protection was induced by ribosomes and was greatly enhanced by adjuvants. Protection measured by 30-day survival compared favorably with the immunoprotection assessed by absence of lung lesions and negative spleen cultures. Treatment of ribosomes with ribonuclease before immunization reduced protection by 85%, whereas trypsin and Pronase reduced the protection by 50 to 55%. These findings indicate that both intact ribosomal ribonucleic acid and protein are necessary for maximal immunogenicity of Histoplasma ribosomes. PMID:16558095

  3. Versatile roles of Arabidopsis plastid ribosomal proteins in plant growth and development.


    Romani, Isidora; Tadini, Luca; Rossi, Fabio; Masiero, Simona; Pribil, Mathias; Jahns, Peter; Kater, Martin; Leister, Dario; Pesaresi, Paolo


    A lack of individual plastid ribosomal proteins (PRPs) can have diverse phenotypic effects in Arabidopsis thaliana, ranging from embryo lethality to compromised vitality, with the latter being associated with photosynthetic lesions and decreases in the expression of plastid proteins. In this study, reverse genetics was employed to study the function of eight PRPs, five of which (PRPS1, -S20, -L27, -L28 and -L35) have not been functionally characterised before. In the case of PRPS17, only leaky alleles or RNA interference lines had been analysed previously. PRPL1 and PRPL4 have been described as essential for embryo development, but their mutant phenotypes are analysed in detail here. We found that PRPS20, -L1, -L4, -L27 and -L35 are required for basal ribosome activity, which becomes crucial at the globular stage and during the transition from the globular to the heart stage of embryogenesis. Thus, lack of any of these PRPs leads to alterations in cell division patterns, and embryo development ceases prior to the heart stage. PRPL28 is essential at the latest stages of embryo-seedling development, during the greening process. PRPS1, -S17 and -L24 appear not to be required for basal ribosome activity and the organism can complete its entire life cycle in their absence. Interestingly, despite the prokaryotic origin of plastids, the significance of individual PRPs for plant development cannot be predicted from the relative phenotypic severity of the corresponding mutants in prokaryotic systems.

  4. Final pre-40S maturation depends on the functional integrity of the 60S subunit ribosomal protein L3.


    García-Gómez, Juan J; Fernández-Pevida, Antonio; Lebaron, Simon; Rosado, Iván V; Tollervey, David; Kressler, Dieter; de la Cruz, Jesús


    Ribosomal protein L3 is an evolutionarily conserved protein that participates in the assembly of early pre-60S particles. We report that the rpl3[W255C] allele, which affects the affinity and function of translation elongation factors, impairs cytoplasmic maturation of 20S pre-rRNA. This was not seen for other mutations in or depletion of L3 or other 60S ribosomal proteins. Surprisingly, pre-40S particles containing 20S pre-rRNA form translation-competent 80S ribosomes, and translation inhibition partially suppresses 20S pre-rRNA accumulation. The GTP-dependent translation initiation factor Fun12 (yeast eIF5B) shows similar in vivo binding to ribosomal particles from wild-type and rpl3[W255C] cells. However, the GTPase activity of eIF5B failed to stimulate processing of 20S pre-rRNA when assayed with ribosomal particles purified from rpl3[W255C] cells. We conclude that L3 plays an important role in the function of eIF5B in stimulating 3' end processing of 18S rRNA in the context of 80S ribosomes that have not yet engaged in translation. These findings indicate that the correct conformation of the GTPase activation region is assessed in a quality control step during maturation of cytoplasmic pre-ribosomal particles.

  5. The eukaryote-specific N-terminal extension of ribosomal protein S31 contributes to the assembly and function of 40S ribosomal subunits.


    Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús


    The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D. PMID:27422873

  6. The eukaryote-specific N-terminal extension of ribosomal protein S31 contributes to the assembly and function of 40S ribosomal subunits

    PubMed Central

    Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús


    The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D. PMID:27422873

  7. The eukaryote-specific N-terminal extension of ribosomal protein S31 contributes to the assembly and function of 40S ribosomal subunits.


    Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús


    The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D.

  8. The ribosome in action: Tuning of translational efficiency and protein folding.


    Rodnina, Marina V


    The cellular proteome is shaped by the combined activities of the gene expression and quality control machineries. While transcription plays an undoubtedly important role, in recent years also translation emerged as a key step that defines the composition and quality of the proteome and the functional activity of proteins in the cell. Among the different post-transcriptional control mechanisms, translation initiation and elongation provide multiple checkpoints that can affect translational efficiency. A multitude of specific signals in mRNAs can determine the frequency of translation initiation, choice of the open reading frame, global and local elongation velocities, and the folding of the emerging protein. In addition to specific signatures in the mRNAs, also variations in the global pools of translation components, including ribosomes, tRNAs, mRNAs, and translation factors can alter translational efficiencies. The cellular outcomes of phenomena such as mRNA codon bias are sometimes difficult to understand due to the staggering complexity of covariates that affect codon usage, translation, and protein folding. Here we summarize the experimental evidence on how the ribosome-together with the other components of the translational machinery-can alter translational efficiencies of mRNA at the initiation and elongation stages and how translation velocity affects protein folding. We seek to explain these findings in the context of mechanistic work on the ribosome. The results argue in favour of a new understanding of translation control as a hub that links mRNA homeostasis to production and quality control of proteins in the cell. PMID:27198711

  9. Rice Ribosomal Protein Large Subunit Genes and Their Spatio-temporal and Stress Regulation

    PubMed Central

    Moin, Mazahar; Bakshi, Achala; Saha, Anusree; Dutta, Mouboni; Madhav, Sheshu M.; Kirti, P. B.


    Ribosomal proteins (RPs) are well-known for their role in mediating protein synthesis and maintaining the stability of the ribosomal complex, which includes small and large subunits. In the present investigation, in a genome-wide survey, we predicted that the large subunit of rice ribosomes is encoded by at least 123 genes including individual gene copies, distributed throughout the 12 chromosomes. We selected 34 candidate genes, each having 2–3 identical copies, for a detailed characterization of their gene structures, protein properties, cis-regulatory elements and comprehensive expression analysis. RPL proteins appear to be involved in interactions with other RP and non-RP proteins and their encoded RNAs have a higher content of alpha-helices in their predicted secondary structures. The majority of RPs have binding sites for metal and non-metal ligands. Native expression profiling of 34 ribosomal protein large (RPL) subunit genes in tissues covering the major stages of rice growth shows that they are predominantly expressed in vegetative tissues and seedlings followed by meiotically active tissues like flowers. The putative promoter regions of these genes also carry cis-elements that respond specifically to stress and signaling molecules. All the 34 genes responded differentially to the abiotic stress treatments. Phytohormone and cold treatments induced significant up-regulation of several RPL genes, while heat and H2O2 treatments down-regulated a majority of them. Furthermore, infection with a bacterial pathogen, Xanthomonas oryzae, which causes leaf blight also induced the expression of 80% of the RPL genes in leaves. Although the expression of RPL genes was detected in all the tissues studied, they are highly responsive to stress and signaling molecules indicating that their encoded proteins appear to have roles in stress amelioration besides house-keeping. This shows that the RPL gene family is a valuable resource for manipulation of stress tolerance in

  10. Rice Ribosomal Protein Large Subunit Genes and Their Spatio-temporal and Stress Regulation

    PubMed Central

    Moin, Mazahar; Bakshi, Achala; Saha, Anusree; Dutta, Mouboni; Madhav, Sheshu M.; Kirti, P. B.


    Ribosomal proteins (RPs) are well-known for their role in mediating protein synthesis and maintaining the stability of the ribosomal complex, which includes small and large subunits. In the present investigation, in a genome-wide survey, we predicted that the large subunit of rice ribosomes is encoded by at least 123 genes including individual gene copies, distributed throughout the 12 chromosomes. We selected 34 candidate genes, each having 2–3 identical copies, for a detailed characterization of their gene structures, protein properties, cis-regulatory elements and comprehensive expression analysis. RPL proteins appear to be involved in interactions with other RP and non-RP proteins and their encoded RNAs have a higher content of alpha-helices in their predicted secondary structures. The majority of RPs have binding sites for metal and non-metal ligands. Native expression profiling of 34 ribosomal protein large (RPL) subunit genes in tissues covering the major stages of rice growth shows that they are predominantly expressed in vegetative tissues and seedlings followed by meiotically active tissues like flowers. The putative promoter regions of these genes also carry cis-elements that respond specifically to stress and signaling molecules. All the 34 genes responded differentially to the abiotic stress treatments. Phytohormone and cold treatments induced significant up-regulation of several RPL genes, while heat and H2O2 treatments down-regulated a majority of them. Furthermore, infection with a bacterial pathogen, Xanthomonas oryzae, which causes leaf blight also induced the expression of 80% of the RPL genes in leaves. Although the expression of RPL genes was detected in all the tissues studied, they are highly responsive to stress and signaling molecules indicating that their encoded proteins appear to have roles in stress amelioration besides house-keeping. This shows that the RPL gene family is a valuable resource for manipulation of stress tolerance in

  11. Rice Ribosomal Protein Large Subunit Genes and Their Spatio-temporal and Stress Regulation.


    Moin, Mazahar; Bakshi, Achala; Saha, Anusree; Dutta, Mouboni; Madhav, Sheshu M; Kirti, P B


    Ribosomal proteins (RPs) are well-known for their role in mediating protein synthesis and maintaining the stability of the ribosomal complex, which includes small and large subunits. In the present investigation, in a genome-wide survey, we predicted that the large subunit of rice ribosomes is encoded by at least 123 genes including individual gene copies, distributed throughout the 12 chromosomes. We selected 34 candidate genes, each having 2-3 identical copies, for a detailed characterization of their gene structures, protein properties, cis-regulatory elements and comprehensive expression analysis. RPL proteins appear to be involved in interactions with other RP and non-RP proteins and their encoded RNAs have a higher content of alpha-helices in their predicted secondary structures. The majority of RPs have binding sites for metal and non-metal ligands. Native expression profiling of 34 ribosomal protein large (RPL) subunit genes in tissues covering the major stages of rice growth shows that they are predominantly expressed in vegetative tissues and seedlings followed by meiotically active tissues like flowers. The putative promoter regions of these genes also carry cis-elements that respond specifically to stress and signaling molecules. All the 34 genes responded differentially to the abiotic stress treatments. Phytohormone and cold treatments induced significant up-regulation of several RPL genes, while heat and H2O2 treatments down-regulated a majority of them. Furthermore, infection with a bacterial pathogen, Xanthomonas oryzae, which causes leaf blight also induced the expression of 80% of the RPL genes in leaves. Although the expression of RPL genes was detected in all the tissues studied, they are highly responsive to stress and signaling molecules indicating that their encoded proteins appear to have roles in stress amelioration besides house-keeping. This shows that the RPL gene family is a valuable resource for manipulation of stress tolerance in rice

  12. Ribosome-inactivating proteins in edible plants and purification and characterization of a new ribosome-inactivating protein from Cucurbita moschata.


    Barbieri, Luigi; Polito, Letizia; Bolognesi, Andrea; Ciani, Marialibera; Pelosi, Emanuele; Farini, Valentina; Jha, Ajay K; Sharma, Neelam; Vivanco, Jorge M; Chambery, Angela; Parente, Augusto; Stirpe, Fiorenzo


    The basic protein fraction of tissue extracts from 40 edible plants inhibited cell-free protein synthesis and released adenine from herring sperm DNA, thus having adenine glycosylase activity. This suggested the presence of ribosome-inactivating proteins (RIPs) in the plant extracts. This indication was further strengthened by the presence of the two activities after a partial chromatographic purification of three extracts, including that from Lycopersicon esculentum (tomato), which had very low activity. From the extract of Cucurbita moschata (pumpkin), the most active one, a glycoprotein of 30,665 Da was purified which had the properties of a RIP, in that (i) it inhibited protein synthesis by a rabbit reticulocyte lysate with IC50 (concentration giving 50% inhibition) 0.035 nM (1.08 ng ml(-1)) and by HeLa, HT29 and JM cells with IC50 in the 100 nM range, (ii) deadenylated hsDNA and other polynucleotidic substrates, and (iii) depurinated yeast rRNA at a concentration of 0.1 ng ml(-1), all values being comparable to those of other RIPs. The C. moschata RIP gave a weak cross-reaction only with an antiserum against dianthin 32, but not with antisera against other RIPs, and had superoxide dismutase, antifungal and antibacterial activities.

  13. A novel role for poly(C) binding proteins in programmed ribosomal frameshifting

    PubMed Central

    Napthine, Sawsan; Treffers, Emmely E.; Bell, Susanne; Goodfellow, Ian; Fang, Ying; Firth, Andrew E.; Snijder, Eric J.; Brierley, Ian


    Translational control through programmed ribosomal frameshifting (PRF) is exploited widely by viruses and increasingly documented in cellular genes. Frameshifting is induced by mRNA secondary structures that compromise ribosome fidelity during decoding of a heptanucleotide ‘slippery’ sequence. The nsp2 PRF signal of porcine reproductive and respiratory syndrome virus is distinctive in directing both −2 and −1 PRF and in its requirement for a trans-acting protein factor, the viral replicase subunit nsp1β. Here we show that the the trans-activation of frameshifting is carried out by a protein complex composed of nsp1β and a cellular poly(C) binding protein (PCBP). From the results of in vitro translation and electrophoretic mobility shift assays, we demonstrate that a PCBP/nsp1β complex binds to a C-rich sequence downstream of the slippery sequence and here mimics the activity of a structured mRNA stimulator of PRF. This is the first description of a role for a trans-acting cellular protein in PRF. The discovery broadens the repertoire of activities associated with poly(C) binding proteins and prototypes a new class of virus–host interactions. PMID:27257056

  14. The ribosomal subunit assembly line

    PubMed Central

    Dlakić, Mensur


    Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363

  15. Spatial Arrangement of Ribosomal Proteins: Reaction of the Escherichia coli 30S Subunit with bis-Imidoesters

    PubMed Central

    Bickle, T. A.; Hershey, J. W. B.; Traut, R. R.


    The 30S ribosomal subunit of E. coli was treated with the bifunctional reagent bis-(methyl)suberimidate. Crosslinked ribosomal proteins were identified as bands with increased molecular weight after electrophoresis in polyacrylamide gels containing sodium dodecyl sulphate. The pattern of crosslinked products was altered when unfolded subunits were used. Free ribosomal protein was not crosslinked. Several of the crosslinked products were cleaved by ammonolysis to form the original monomeric protein constituents. The low yields of the reactions necessitated the use of radioactive proteins and auto-radiographic procedures. The crosslinked proteins were tentatively identified by coelectrophoresis of the radioactive ammonolysis products with carrier 30S protein in sodium dodecyl sulphate, and coelectrophoresis at pH 4.5 in buffers containing urea. Images PMID:4556460

  16. Purification and characterization of a novel type i ribosome inactivating protein, pachyerosin, from Pachyrhizus erosus seeds, and preparation of its immunotoxin against human hepatoma cells.


    Guo, Jin-Lin; Cheng, Yuan-Liu; Qiu, Yi; Shen, Cai-Hong; Yi, Bin; Peng, Cheng


    Pachyrhizus erosus seeds have a high protein content and are used in China due to their cytotoxic effect. Here we report the biological and pharmacological activity of the protein extracts from P. erosus seeds. A novel ribosome-inactivating protein, pachyerosin, from P. erosus seeds was successively purified to homogeneity using ammonium sulfate precipitation, DEAE-sepharose FF, and Sephacryl S-200. Pachyerosin showed to be a type I ribosome-inactivating protein with a molecular mass of 29 kDa and an isoelectric point of 9.19. It strongly inhibited protein synthesis of rabbit reticulocyte lysate with an IC50 of 0.37 ng/mL and showed N-glycosidase activity on rat liver ribosomes with an EC50 of 85.9 pM. The N-terminal 27 amino acids of pachyerosin revealed a 60.71% sequence identity with abrin A from the seeds of Abrus precatorius. With the aim of targeting the delivery of pachyerosin, immunotoxin was prepared by conjugating pachyerosin with anti-human AFP monoclonal antibodies SM0736. The immunotoxin pachyerosin-SM0736 efficiently inhibited the growth of the human hepatoma cell line HuH-7 with an IC50 of 0.050 ± 0.004 nM, 2360 times lower than that of pachyerosin and 430 times lower than that of the immunotoxin against human gastric cancer cell line SGC7901. These results imply that pachyerosin may be used as a new promising anticancer agent. PMID:25029173

  17. Unbiased Quantitative Models of Protein Translation Derived from Ribosome Profiling Data

    PubMed Central

    Gritsenko, Alexey A.; Hulsman, Marc; Reinders, Marcel J. T.; de Ridder, Dick


    Translation of RNA to protein is a core process for any living organism. While for some steps of this process the effect on protein production is understood, a holistic understanding of translation still remains elusive. In silico modelling is a promising approach for elucidating the process of protein synthesis. Although a number of computational models of the process have been proposed, their application is limited by the assumptions they make. Ribosome profiling (RP), a relatively new sequencing-based technique capable of recording snapshots of the locations of actively translating ribosomes, is a promising source of information for deriving unbiased data-driven translation models. However, quantitative analysis of RP data is challenging due to high measurement variance and the inability to discriminate between the number of ribosomes measured on a gene and their speed of translation. We propose a solution in the form of a novel multi-scale interpretation of RP data that allows for deriving models with translation dynamics extracted from the snapshots. We demonstrate the usefulness of this approach by simultaneously determining for the first time per-codon translation elongation and per-gene translation initiation rates of Saccharomyces cerevisiae from RP data for two versions of the Totally Asymmetric Exclusion Process (TASEP) model of translation. We do this in an unbiased fashion, by fitting the models using only RP data with a novel optimization scheme based on Monte Carlo simulation to keep the problem tractable. The fitted models match the data significantly better than existing models and their predictions show better agreement with several independent protein abundance datasets than existing models. Results additionally indicate that the tRNA pool adaptation hypothesis is incomplete, with evidence suggesting that tRNA post-transcriptional modifications and codon context may play a role in determining codon elongation rates. PMID:26275099

  18. The host antimicrobial peptide Bac71-35 binds to bacterial ribosomal proteins and inhibits protein synthesis.


    Mardirossian, Mario; Grzela, Renata; Giglione, Carmela; Meinnel, Thierry; Gennaro, Renato; Mergaert, Peter; Scocchi, Marco


    Antimicrobial peptides (AMPs) are molecules from innate immunity with high potential as novel anti-infective agents. Most of them inactivate bacteria through pore formation or membrane barrier disruption, but others cross the membrane without damages and act inside the cells, affecting vital processes. However, little is known about their intracellular bacterial targets. Here we report that Bac71-35, a proline-rich AMP belonging to the cathelicidin family, can reach high concentrations (up to 340 μM) inside the E. coli cytoplasm. The peptide specifically and completely inhibits in vitro translation in the micromolar concentration range. Experiments of incorporation of radioactive precursors in macromolecules with E. coli cells confirmed that Bac71-35 affects specifically protein synthesis. Ribosome coprecipitation and crosslinking assays showed that the peptide interacts with ribosomes, binding to a limited subset of ribosomal proteins. Overall, these results indicate that the killing mechanism of Bac71-35 is based on a specific block of protein synthesis.

  19. Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes

    NASA Astrophysics Data System (ADS)

    Iwane, Yoshihiko; Hitomi, Azusa; Murakami, Hiroshi; Katoh, Takayuki; Goto, Yuki; Suga, Hiroaki


    In ribosomal polypeptide synthesis the library of amino acid building blocks is limited by the manner in which codons are used. Of the proteinogenic amino acids, 18 are coded for by multiple codons and therefore many of the 61 sense codons can be considered redundant. Here we report a method to reduce the redundancy of codons by artificially dividing codon boxes to create vacant codons that can then be reassigned to non-proteinogenic amino acids and thereby expand the library of genetically encoded amino acids. To achieve this, we reconstituted a cell-free translation system with 32 in vitro transcripts of transfer RNASNN (tRNASNN) (S = G or C), assigning the initiator and 20 elongator amino acids. Reassignment of three redundant codons was achieved by replacing redundant tRNASNNs with tRNASNNs pre-charged with non-proteinogenic amino acids. As a demonstration, we expressed a 32-mer linear peptide that consists of 20 proteinogenic and three non-proteinogenic amino acids, and a 14-mer macrocyclic peptide that contains more than four non-proteinogenic amino acids.

  20. Identification and fine mapping of nuclear and nucleolar localization signals within the human ribosomal protein S17.


    Kenney, Scott P; Meng, Xiang-Jin


    Human ribosomal protein S17 (RPS17) is mutated in Diamond-Blackfan Anemia (DBA), a bone marrow disorder that fails to produce sufficient red blood cells leading to anemia. Recently, an RPS17 protein sequence was also found to be naturally inserted in the genome of hepatitis E virus (HEV) from patients chronically-infected by HEV. The role of RPS17 in HEV replication and pathogenesis remains unknown due to the lack of knowledge about how RPS17 functions at a molecular level. Understanding the biological function of RPS17 is critical for elucidating its role in virus infection and DBA disease processes. In this study we probed the subcellular distribution of normal and mutant RPS17 proteins in a human liver cell line (Huh7). RPS17 was primarily detected within the nucleus, and more specifically within the nucleoli. Using a transient expression system in which RPS17 or truncations were expressed as fusions with enhanced yellow fluorescent protein (eYFP), we were able to identify and map, for the first time, two separate nuclear localization signals (NLSs), one to the first 13 amino acids of the amino-terminus of RPS17 and the other within amino acids 30-60. Additionally, we mapped amino acid sequences required for nucleolar accumulation of RPS17 to amino acids 60-70. Amino acids 60-70 possess a di-RG motif that may be necessary for nucleolar retention of RPS17. The results from this study enhance our knowledge of RSP17 and will facilitate future mechanistic studies about the roles of RSP17 in hepatitis E and DBA disease processes. PMID:25853866

  1. The Ribosome Biogenesis Protein Nol9 Is Essential for Definitive Hematopoiesis and Pancreas Morphogenesis in Zebrafish.


    Bielczyk-Maczyńska, Ewa; Lam Hung, Laure; Ferreira, Lauren; Fleischmann, Tobias; Weis, Félix; Fernández-Pevida, Antonio; Harvey, Steven A; Wali, Neha; Warren, Alan J; Barroso, Inês; Stemple, Derek L; Cvejic, Ana


    Ribosome biogenesis is a ubiquitous and essential process in cells. Defects in ribosome biogenesis and function result in a group of human disorders, collectively known as ribosomopathies. In this study, we describe a zebrafish mutant with a loss-of-function mutation in nol9, a gene that encodes a non-ribosomal protein involved in rRNA processing. nol9sa1022/sa1022 mutants have a defect in 28S rRNA processing. The nol9sa1022/sa1022 larvae display hypoplastic pancreas, liver and intestine and have decreased numbers of hematopoietic stem and progenitor cells (HSPCs), as well as definitive erythrocytes and lymphocytes. In addition, ultrastructural analysis revealed signs of pathological processes occurring in endothelial cells of the caudal vein, emphasizing the complexity of the phenotype observed in nol9sa1022/sa1022 larvae. We further show that both the pancreatic and hematopoietic deficiencies in nol9sa1022/sa1022 embryos were due to impaired cell proliferation of respective progenitor cells. Interestingly, genetic loss of Tp53 rescued the HSPCs but not the pancreatic defects. In contrast, activation of mRNA translation via the mTOR pathway by L-Leucine treatment did not revert the erythroid or pancreatic defects. Together, we present the nol9sa1022/sa1022 mutant, a novel zebrafish ribosomopathy model, which recapitulates key human disease characteristics. The use of this genetically tractable model will enhance our understanding of the tissue-specific mechanisms following impaired ribosome biogenesis in the context of an intact vertebrate. PMID:26624285

  2. The Ribosome Biogenesis Protein Nol9 Is Essential for Definitive Hematopoiesis and Pancreas Morphogenesis in Zebrafish

    PubMed Central

    Ferreira, Lauren; Fleischmann, Tobias; Weis, Félix; Fernández-Pevida, Antonio; Harvey, Steven A.; Wali, Neha; Warren, Alan J.; Barroso, Inês; Stemple, Derek L.; Cvejic, Ana


    Ribosome biogenesis is a ubiquitous and essential process in cells. Defects in ribosome biogenesis and function result in a group of human disorders, collectively known as ribosomopathies. In this study, we describe a zebrafish mutant with a loss-of-function mutation in nol9, a gene that encodes a non-ribosomal protein involved in rRNA processing. nol9 sa1022/sa1022 mutants have a defect in 28S rRNA processing. The nol9 sa1022/sa1022 larvae display hypoplastic pancreas, liver and intestine and have decreased numbers of hematopoietic stem and progenitor cells (HSPCs), as well as definitive erythrocytes and lymphocytes. In addition, ultrastructural analysis revealed signs of pathological processes occurring in endothelial cells of the caudal vein, emphasizing the complexity of the phenotype observed in nol9 sa1022/sa1022 larvae. We further show that both the pancreatic and hematopoietic deficiencies in nol9 sa1022/sa1022 embryos were due to impaired cell proliferation of respective progenitor cells. Interestingly, genetic loss of Tp53 rescued the HSPCs but not the pancreatic defects. In contrast, activation of mRNA translation via the mTOR pathway by L-Leucine treatment did not revert the erythroid or pancreatic defects. Together, we present the nol9 sa1022/sa1022 mutant, a novel zebrafish ribosomopathy model, which recapitulates key human disease characteristics. The use of this genetically tractable model will enhance our understanding of the tissue-specific mechanisms following impaired ribosome biogenesis in the context of an intact vertebrate. PMID:26624285

  3. Involvement of human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress

    PubMed Central

    Nicolas, Emilien; Parisot, Pascaline; Pinto-Monteiro, Celina; de Walque, Roxane; De Vleeschouwer, Christophe; Lafontaine, Denis L. J.


    The nucleolus is a potent disease biomarker and a target in cancer therapy. Ribosome biogenesis is initiated in the nucleolus where most ribosomal (r-) proteins assemble onto precursor rRNAs. Here we systematically investigate how depletion of each of the 80 human r-proteins affects nucleolar structure, pre-rRNA processing, mature rRNA accumulation and p53 steady-state level. We developed an image-processing programme for qualitative and quantitative discrimination of normal from altered nucleolar morphology. Remarkably, we find that uL5 (formerly RPL11) and uL18 (RPL5) are the strongest contributors to nucleolar integrity. Together with the 5S rRNA, they form the late-assembling central protuberance on mature 60S subunits, and act as an Hdm2 trap and p53 stabilizer. Other major contributors to p53 homeostasis are also strictly late-assembling large subunit r-proteins essential to nucleolar structure. The identification of the r-proteins that specifically contribute to maintaining nucleolar structure and p53 steady-state level provides insights into fundamental aspects of cell and cancer biology. PMID:27265389

  4. Bryodin, a ribosome-inactivating protein from the roots of Bryonia dioica L. (white bryony).

    PubMed Central

    Stirpe, F; Barbieri, L; Battelli, M G; Falasca, A I; Abbondanza, A; Lorenzoni, E; Stevens, W A


    Bryodin is a strongly basic (pI greater than or equal to 9.5) glycoprotein (neutral sugar content 6.3%) with Mr 30,000, purified from the roots of Bryonia dioica (white bryony). This protein inhibits protein synthesis by a rabbit reticulocyte lysate with and ID50 (concentration causing 50% inhibition) of 0.12 nM (3.6 ng/ml) and has much less effect on protein synthesis by whole cells, with ID50 values ranging from 46 nM to 2.27 microM (1.4-67 micrograms/ml). Bryodin acts by inactivating ribosomes, with a less-than-equimolar ratio, which suggests a catalytic action. Bryodin decreases the number of local lesions induced by tobacco mosaic virus in the leaves of Nicotiana glutinosa. From all its properties, bryodin can be considered to be a ribosome-inactivating protein, similar to those already known [reviews: Barbieri & Stirpe (1982) Cancer Surveys 1, 489-520; Stirpe & Barbieri (1986) FEBS Lett. 195, 1-8]. PMID:3827858

  5. The Sambucus nigra type-2 ribosome-inactivating protein SNA-I' exhibits in planta antiviral activity in transgenic tobacco.


    Chen, Ying; Peumans, Willy J; Van Damme, Els J M


    Transgenic tobacco (Samsun NN) plants transformed with a cDNA clone encoding SNA-I' from Sambucus nigra synthesize, and correctly process and assemble, a fully active type-2 ribosome-inactivating protein. Expression of SNA-I' under the control of the 35S cauliflower mosaic virus promoter enhances the plant's resistance against infection with tobacco mosaic virus. In contrast to type-1 ribosome-inactivating proteins, the expression of SNA-I' does not affect the growth and fertility of the transgenic plants and is not accompanied by an increased expression of pathogenesis-related proteins indicating that its antiviral activity most probably differs from that of pokeweed antiviral protein.

  6. Simulation study of the role of the ribosomal exit tunnel on protein folding

    NASA Astrophysics Data System (ADS)

    Chen, Changjun; Wang, Ercheng; Liu, Pengyu; Xiao, Yi


    To investigate the role of the ribosomal exit tunnel on protein folding, we simulate the initial-stage folding behavior of the protein villin headpiece subdomain HP35 (PDB id: 1yrf) with and without prefolding in the exit tunnel by using an all-atom model and find that prefolding in the exit tunnel could effectively help the protein form native secondary structures. Furthermore, our results show that, after releasing from the exit tunnel, the prefolded chains may have a tendency to form more native contacts than those only in free space and this reduces the conformational space of sampling. Our results may provide an alternative way to explain the fast folding mechanism of proteins in vivo.

  7. Characterization of the pattern of ribosomal protein L19 production during the lifecycle of Leishmania spp.


    de Almeida-Bizzo, Janayna Hammes; Alves, Lysangela Ronalte; Castro, Felipe F; Garcia, Juliana Bório Ferreira; Goldenberg, Samuel; Cruz, Angela Kaysel


    Leishmania is a genus of protozoan parasites causing a wide clinical spectrum of diseases in humans. Analysis of a region of chromosome 6 from Leishmania major (Iribar et al.) showed that the transcript of a putative L19 ribosomal protein (RPL19) was most abundant at the amastigote stage. We therefore decided to characterize L19 protein abundance throughout the lifecycle of Leishmania. Differential expression of the L19 gene during development has been observed for all Leishmania species studied to date (L. major, L. braziliensis, L. donovani, and L. amazonensis). Immunoblotting with polyclonal antibodies against L. major RPL19 revealed that changes to L19 protein abundance follow a similar pattern in various species. The amount of L19 protein was higher in exponentially growing promastigotes than in stationary phase promastigotes. The L19 protein was barely detectable in amastigotes, despite the abundance of L19 transcripts observed in L. major at this stage. Immunofluorescence assays showed a granular, dispersed distribution of RPL19 throughout the cytoplasm. Subcellular fractionation confirmed the presence of the protein in the ribosomal fraction, but not in the cytosol of L. major. We generated a L. major transfectant bearing a plasmid-borne L19 gene. Overproduction of the L19 transcript and protein resulted in impaired growth of the transfectants in association with high polysome peaks. We also showed by metabolic labeling that L19 overexpressing clones display low rates of translation. These data suggest that L19 overexpression affects negatively translation elongation or termination. The lack of correlation between L19 transcript and protein abundances suggest that the translation of L19 is differentially controlled during development in the various species investigated.

  8. Characterization of the pattern of ribosomal protein L19 production during the lifecycle of Leishmania spp.


    de Almeida-Bizzo, Janayna Hammes; Alves, Lysangela Ronalte; Castro, Felipe F; Garcia, Juliana Bório Ferreira; Goldenberg, Samuel; Cruz, Angela Kaysel


    Leishmania is a genus of protozoan parasites causing a wide clinical spectrum of diseases in humans. Analysis of a region of chromosome 6 from Leishmania major (Iribar et al.) showed that the transcript of a putative L19 ribosomal protein (RPL19) was most abundant at the amastigote stage. We therefore decided to characterize L19 protein abundance throughout the lifecycle of Leishmania. Differential expression of the L19 gene during development has been observed for all Leishmania species studied to date (L. major, L. braziliensis, L. donovani, and L. amazonensis). Immunoblotting with polyclonal antibodies against L. major RPL19 revealed that changes to L19 protein abundance follow a similar pattern in various species. The amount of L19 protein was higher in exponentially growing promastigotes than in stationary phase promastigotes. The L19 protein was barely detectable in amastigotes, despite the abundance of L19 transcripts observed in L. major at this stage. Immunofluorescence assays showed a granular, dispersed distribution of RPL19 throughout the cytoplasm. Subcellular fractionation confirmed the presence of the protein in the ribosomal fraction, but not in the cytosol of L. major. We generated a L. major transfectant bearing a plasmid-borne L19 gene. Overproduction of the L19 transcript and protein resulted in impaired growth of the transfectants in association with high polysome peaks. We also showed by metabolic labeling that L19 overexpressing clones display low rates of translation. These data suggest that L19 overexpression affects negatively translation elongation or termination. The lack of correlation between L19 transcript and protein abundances suggest that the translation of L19 is differentially controlled during development in the various species investigated. PMID:25290356

  9. Down regulation of ribosomal protein mRNAs during neuronal differentiation of human NTERA2 cells.


    Bévort, M; Leffers, H


    We have analysed the expression of 32 ribosomal protein (RP) mRNAs during retinoic acid induced neuronal differentiation of human NTERA2 cells. Except for a new S27 variant (S27v), all were down regulated both in selectively replated differentiated neurons and the most differentiated continuous cultures, i.e., non-replated cultures. However, the expression profiles of the individual RP mRNAs were different, most (L3, L7, L8, L10, L13, L23a, L27a, L36a, L39, P0, S2, S3, S3a, S4X, S6, S9, S12, S13, S16, S19, S20, S23, and S27a) exhibited a constant down regulation, whereas a few were either initially constant (L11, L32, S8, and S11) or up regulated (L6, L15, L17, L31, and S27y) and then down regulated. The expression of S27v remained elevated in the most differentiated continuous cultures but was down regulated in replated differentiated neurons. The down regulation of RP mRNAs was variable: the expression levels in differentiated replated neurons were between 10% (S3) and 90% (S11) of the levels in undifferentiated cells. The ratio between rRNA and RP mRNA changed during the differentiation; in differentiated neurons there were, on average, about half the number of RP mRNAs per rRNA as compared to undifferentiated cells. The expression profiles of a few translation-related proteins were also determined. EF1alpha1, EF1beta1, and EF1delta were down regulated, whereas the expression of the neuron and muscle specific EF1alpha2 increased. The reduction in the expression of RP mRNAs was coordinated with a reduction in the expression level of the proliferation marker PCNA. The expression levels of most RP mRNAs were lower in purified differentiated post-mitotic neurons than in the most differentiated continuous cultures, despite similar levels of PCNA, suggesting that both the differentiation state and the proliferative status of the cells affect the expression of RP mRNAs.

  10. Predicted class-I aminoacyl tRNA synthetase-like proteins in non-ribosomal peptide synthesis

    PubMed Central


    Background Recent studies point to a great diversity of non-ribosomal peptide synthesis systems with major roles in amino acid and co-factor biosynthesis, secondary metabolism, and post-translational modifications of proteins by peptide tags. The least studied of these systems are those utilizing tRNAs or aminoacyl-tRNA synthetases (AAtRS) in non-ribosomal peptide ligation. Results Here we describe novel examples of AAtRS related proteins that are likely to be involved in the synthesis of widely distributed peptide-derived metabolites. Using sensitive sequence profile methods we show that the cyclodipeptide synthases (CDPSs) are members of the HUP class of Rossmannoid domains and are likely to be highly derived versions of the class-I AAtRS catalytic domains. We also identify the first eukaryotic CDPSs in fungi and in animals; they might be involved in immune response in the latter organisms. We also identify a paralogous version of the methionyl-tRNA synthetase, which is widespread in bacteria, and present evidence using contextual information that it might function independently of protein synthesis as a peptide ligase in the formation of a peptide- derived secondary metabolite. This metabolite is likely to be heavily modified through multiple reactions catalyzed by a metal-binding cupin domain and a lysine N6 monooxygenase that are strictly associated with this paralogous methionyl-tRNA synthetase (MtRS). We further identify an analogous system wherein the MtRS has been replaced by more typical peptide ligases with the ATP-grasp or modular condensation-domains. Conclusions The prevalence of these predicted biosynthetic pathways in phylogenetically distant, pathogenic or symbiotic bacteria suggests that metabolites synthesized by them might participate in interactions with the host. More generally, these findings point to a complete spectrum of recruitment of AAtRS to various non-ribosomal biosynthetic pathways, ranging from the conventional AAtRS, through

  11. Assembly of the central domain of the 30S ribosomal subunit: roles for the primary binding ribosomal proteins S15 and S8.


    Jagannathan, Indu; Culver, Gloria M


    Assembly of the 30S ribosomal subunit occurs in a highly ordered and sequential manner. The ordered addition of ribosomal proteins to the growing ribonucleoprotein particle is initiated by the association of primary binding proteins. These proteins bind specifically and independently to 16S ribosomal RNA (rRNA). Two primary binding proteins, S8 and S15, interact exclusively with the central domain of 16S rRNA. Binding of S15 to the central domain results in a conformational change in the RNA and is followed by the ordered assembly of the S6/S18 dimer, S11 and finally S21 to form the platform of the 30S subunit. In contrast, S8 is not part of this major platform assembly branch. Of the remaining central domain binding proteins, only S21 association is slightly dependent on S8. Thus, although S8 is a primary binding protein that extensively contacts the central domain, its role in assembly of this domain remains unclear. Here, we used directed hydroxyl radical probing from four unique positions on S15 to assess organization of the central domain of 16S rRNA as a consequence of S8 association. Hydroxyl radical probing of Fe(II)-S15/16S rRNA and Fe(II)-S15/S8/16S rRNA ribonucleoprotein particles reveal changes in the 16S rRNA environment of S15 upon addition of S8. These changes occur predominantly in helices 24 and 26 near previously identified S8 binding sites. These S8-dependent conformational changes are consistent with 16S rRNA folding in complete 30S subunits. Thus, while S8 binding is not absolutely required for assembly of the platform, it appears to affect significantly the 16S rRNA environment of S15 by influencing central domain organization.

  12. Production and characterization of monoclonal antibodies against the ribosome inactivating proteins dianthin32 and momochin.


    Porro, G; Bonardi, M A; Giovanetti, E; Lento, P; Modena, D


    Female BALB/c mice were immunized with either dianthin32 or momochin, type 1 ribosome-inactivating proteins (RIPs) derived from Dianthus charyophyllus and Momordica cochinchinensis, respectively. Five anti-dianthin32 and 6 anti-momochin secreting hybridomas were obtained by somatic fusion of lymphocytes with myeloma cell line NS0. The monoclonal antibodies (MAbs) produced were highly specific, as demonstrated by cross-reactivity assays performed with taxonomically related and unrelated type 1 RIPs, and recognized different epitopes of the antigen. The affinity constant of anti-RIPs MAbs ranged between 10(8) M-1 and 10(10) M-1. PMID:7519581

  13. Production and characterization of monoclonal antibodies against the ribosome inactivating proteins dianthin32 and momochin.


    Porro, G; Bonardi, M A; Giovanetti, E; Lento, P; Modena, D


    Female BALB/c mice were immunized with either dianthin32 or momochin, type 1 ribosome-inactivating proteins (RIPs) derived from Dianthus charyophyllus and Momordica cochinchinensis, respectively. Five anti-dianthin32 and 6 anti-momochin secreting hybridomas were obtained by somatic fusion of lymphocytes with myeloma cell line NS0. The monoclonal antibodies (MAbs) produced were highly specific, as demonstrated by cross-reactivity assays performed with taxonomically related and unrelated type 1 RIPs, and recognized different epitopes of the antigen. The affinity constant of anti-RIPs MAbs ranged between 10(8) M-1 and 10(10) M-1.

  14. The global translation profile in a ribosomal protein mutant resembles that of an eIF3 mutant

    PubMed Central


    Background Genome-wide assays performed in Arabidopsis and other organisms have revealed that the translation status of mRNAs responds dramatically to different environmental stresses and genetic lesions in the translation apparatus. To identify additional features of the global landscape of translational control, we used microarray analysis of polysomal as well as non-polysomal mRNAs to examine the defects in translation in a poly(A) binding protein mutant, pab2 pab8, as well as in a mutant of a large ribosomal subunit protein, rpl24b/shortvalve1. Results The mutation of RPL24B stimulated the ribosome occupancy of mRNAs for nuclear encoded ribosomal proteins. Detailed analysis yielded new insights into the translational regulon containing the ribosomal protein mRNAs. First, the ribosome occupancy defects in the rpl24b mutant partially overlapped with those in a previously analyzed initiation factor mutant, eif3h. Second, a group of mRNAs with incomplete coding sequences appeared to be uncoupled from the regulon, since their dependence on RPL24B differed from regular mRNAs. Third, different sister paralogs of the ribosomal proteins differed in their translation state in the wild-type. Some sister paralogs also differed in their response to the rpl24b mutation. In contrast to rpl24b, the pab2 pab8 mutant revealed few gene specific translational defects, but a group of seed storage protein mRNAs were stimulated in their ribosome occupancy. In the course of this work, while optimizing the statistical analysis of ribosome occupancy data, we collected 12 biological replicates of translation states from wild-type seedlings. We defined 20% of mRNAs as having a high variance in their translation state. Many of these mRNAs were functionally associated with responses to the environment, suggesting that subtle variation in the environmental conditions is sensed by plants and transduced to affect the translational efficiency of hundreds of mRNAs. Conclusions These data

  15. An evolved ribosome-inactivating protein targets and kills human melanoma cells in vitro and in vivo

    PubMed Central


    Background Few treatment options exist for patients with metastatic melanoma, resulting in poor prognosis. One standard treatment, dacarbazine (DTIC), shows low response rates ranging from 15 to 25 percent with an 8-month median survival time. The development of targeted therapeutics with novel mechanisms of action may improve patient outcome. Ribosome-inactivating proteins (RIPs) such as Shiga-like Toxin 1 (SLT-1) represent powerful scaffolds for developing selective anticancer agents. Here we report the discovery and properties of a single chain ribosome-inactivating protein (scRIP) derived from the cytotoxic A subunit of SLT-1 (SLT-1A), harboring the 7-amino acid peptide insertion IYSNKLM (termed SLT-1AIYSNKLM) allowing the toxin variant to selectively target and kill human melanoma cells. Results SLT-1AIYSNKLM was able to kill 7 of 8 human melanoma cell lines. This scRIP binds to 518-A2 human melanoma cells with a dissociation constant of 18 nM, resulting in the blockage of protein synthesis and apoptosis in such cells. Biodistribution and imaging studies of radiolabeled SLT-1AIYSNKLM administered intravenously into SCID mice bearing a human melanoma xenograft indicate that SLT-1AIYSNKLM readily accumulates at the tumor site as opposed to non-target tissues. Furthermore, the co-administration of SLT-1AIYSNKLM with DTIC resulted in tumor regression and greatly increased survival in this mouse xenograft model in comparison to DTIC or SLT-1AIYSNKLM treatment alone (115 day median survival versus 46 and 47 days respectively; P values < 0.001). SLT-1AIYSNKLM is stable in serum and its intravenous administration resulted in modest immune responses following repeated injections in CD1 mice. Conclusions These results demonstrate that the evolution of a scRIP template can lead to the discovery of novel cancer cell-targeted compounds and in the case of SLT-1AIYSNKLM can specifically kill human melanoma cells in vitro and in vivo. PMID:20128926

  16. Antifungal activity of the ribosome-inactivating protein BE27 from sugar beet (Beta vulgaris L.) against the green mould Penicillium digitatum.


    Citores, Lucía; Iglesias, Rosario; Gay, Carolina; Ferreras, José Miguel


    The ribosome-inactivating protein BE27 from sugar beet (Beta vulgaris L.) leaves is an apoplastic protein induced by signalling compounds, such as hydrogen peroxide and salicylic acid, which has been reported to be involved in defence against viruses. Here, we report that, at a concentration much lower than that present in the apoplast, BE27 displays antifungal activity against the green mould Penicillium digitatum, a necrotrophic fungus that colonizes wounds and grows in the inter- and intracellular spaces of the tissues of several edible plants. BE27 is able to enter into the cytosol and kill fungal cells, thus arresting the growth of the fungus. The mechanism of action seems to involve ribosomal RNA (rRNA) N-glycosylase activity on the sarcin-ricin loop of the major rRNA which inactivates irreversibly the fungal ribosomes, thus inhibiting protein synthesis. We compared the C-terminus of the BE27 structure with antifungal plant defensins and hypothesize that a structural motif composed of an α-helix and a β-hairpin, similar to the γ-core motif of defensins, might contribute to the specific interaction with the fungal plasma membranes, allowing the protein to enter into the cell.

  17. Haploinsufficiency screen highlights two distinct groups of ribosomal protein genes essential for embryonic stem cell fate

    PubMed Central

    Fortier, Simon; MacRae, Tara; Bilodeau, Mélanie; Sargeant, Tobias; Sauvageau, Guy


    In a functional genomics screen of mouse embryonic stem cells (ESCs) with nested hemizygous chromosomal deletions, we reveal that ribosomal protein (RP) genes are the most significant haploinsufficient determinants for embryoid body (EB) formation. Hemizygocity for three RP genes (Rps5, Rps14, or Rps28), distinguished by the proximity of their corresponding protein to the ribosome's mRNA exit site, is associated with the most profound phenotype. This EB phenotype was fully rescued by BAC or cDNA complementation but not by the reduction of p53 levels, although such reduction was effective with most other RP-deleted clones corresponding to non-mRNA exit-site proteins. RNA-sequencing studies further revealed that undifferentiated ESCs hemizygous for Rps5 showed reduced expression levels of several mesoderm-specific genes as compared with wild-type counterparts. Together, these results reveal that RP gene dosage limits the differentiation, not the self-renewal, of mouse ESCs. They also highlight two separate mechanisms underlying this process, one of which is p53 independent. PMID:25646475

  18. Molecular insights into replication initiation by Qβ replicase using ribosomal protein S1

    PubMed Central

    Takeshita, Daijiro; Yamashita, Seisuke; Tomita, Kozo


    Ribosomal protein S1, consisting of six contiguous OB-folds, is the largest ribosomal protein and is essential for translation initiation in Escherichia coli. S1 is also one of the three essential host-derived subunits of Qβ replicase, together with EF-Tu and EF-Ts, for Qβ RNA replication in E. coli. We analyzed the crystal structure of Qβ replicase, consisting of the virus-encoded RNA-dependent RNA polymerase (β-subunit), EF-Tu, EF-Ts and the N-terminal half of S1, which is capable of initiating Qβ RNA replication. Structural and biochemical studies revealed that the two N-terminal OB-folds of S1 anchor S1 onto the β-subunit, and the third OB-fold is mobile and protrudes beyond the surface of the β-subunit. The third OB-fold mainly interacts with a specific RNA fragment derived from the internal region of Qβ RNA, and its RNA-binding ability is required for replication initiation of Qβ RNA. Thus, the third mobile OB-fold of S1, which is spatially anchored near the surface of the β-subunit, primarily recruits the Qβ RNA toward the β-subunit, leading to the specific and efficient replication initiation of Qβ RNA, and S1 functions as a replication initiation factor, beyond its established function in protein synthesis. PMID:25122749

  19. Altering the ribosomal subunit ratio in yeast maximizes recombinant protein yield

    PubMed Central

    Bonander, Nicklas; Darby, Richard AJ; Grgic, Ljuban; Bora, Nagamani; Wen, Jikai; Brogna, Saverio; Poyner, David R; O'Neill, Michael AA; Bill, Roslyn M


    Background The production of high yields of recombinant proteins is an enduring bottleneck in the post-genomic sciences that has yet to be addressed in a truly rational manner. Typically eukaryotic protein production experiments have relied on varying expression construct cassettes such as promoters and tags, or culture process parameters such as pH, temperature and aeration to enhance yields. These approaches require repeated rounds of trial-and-error optimization and cannot provide a mechanistic insight into the biology of recombinant protein production. We published an early transcriptome analysis that identified genes implicated in successful membrane protein production experiments in yeast. While there has been a subsequent explosion in such analyses in a range of production organisms, no one has yet exploited the genes identified. The aim of this study was to use the results of our previous comparative transcriptome analysis to engineer improved yeast strains and thereby gain an understanding of the mechanisms involved in high-yielding protein production hosts. Results We show that tuning BMS1 transcript levels in a doxycycline-dependent manner resulted in optimized yields of functional membrane and soluble protein targets. Online flow microcalorimetry demonstrated that there had been a substantial metabolic change to cells cultured under high-yielding conditions, and in particular that high yielding cells were more metabolically efficient. Polysome profiling showed that the key molecular event contributing to this metabolically efficient, high-yielding phenotype is a perturbation of the ratio of 60S to 40S ribosomal subunits from approximately 1:1 to 2:1, and correspondingly of 25S:18S ratios from 2:1 to 3:1. This result is consistent with the role of the gene product of BMS1 in ribosome biogenesis. Conclusion This work demonstrates the power of a rational approach to recombinant protein production by using the results of transcriptome analysis to engineer

  20. Characterization of silk gland ribosomes from a bivoltine caddisfly, Stenopsyche marmorata: translational suppression of a silk protein in cold conditions.


    Nomura, Takaomi; Ito, Miho; Kanamori, Mai; Shigeno, Yuta; Uchiumi, Toshio; Arai, Ryoichi; Tsukada, Masuhiro; Hirabayashi, Kimio; Ohkawa, Kousaku


    Larval Stenopsyche marmorata constructs food capture nets and fixed retreats underwater using self-produced proteinaceous silk fibers. In the Chikuma River (Nagano Prefecture, Japan) S. marmorata has a bivoltine life cycle; overwintering larvae grow slowly with reduced net spinning activity in winter. We recently reported constant transcript abundance of S. marmorata silk protein 1 (Smsp-1), a core S. marmorata silk fiber component, in all seasons, implying translational suppression in the silk gland during winter. Herein, we prepared and characterized silk gland ribosomes from seasonally collected S. marmorata larvae. Ribosomes from silk glands immediately frozen in liquid nitrogen (LN2) after dissection exhibited comparable translation elongation activity in spring, summer, and autumn. Conversely, silk glands obtained in winter did not contain active ribosomes and Smsp-1. Ribosomes from silk glands immersed in ice-cold physiological saline solution for approximately 4 h were translationally inactive, despite summer collection and Smsp-1 expression. The ribosomal inactivation occurs because of defects in the formation of 80S ribosomes, presumably due to splitting of 60S subunits containing 28S rRNA with central hidden break, in response to cold stress. These results suggest a novel-type ribosome-regulated translation control mechanism. PMID:26646291

  1. Characterization of silk gland ribosomes from a bivoltine caddisfly, Stenopsyche marmorata: translational suppression of a silk protein in cold conditions.


    Nomura, Takaomi; Ito, Miho; Kanamori, Mai; Shigeno, Yuta; Uchiumi, Toshio; Arai, Ryoichi; Tsukada, Masuhiro; Hirabayashi, Kimio; Ohkawa, Kousaku


    Larval Stenopsyche marmorata constructs food capture nets and fixed retreats underwater using self-produced proteinaceous silk fibers. In the Chikuma River (Nagano Prefecture, Japan) S. marmorata has a bivoltine life cycle; overwintering larvae grow slowly with reduced net spinning activity in winter. We recently reported constant transcript abundance of S. marmorata silk protein 1 (Smsp-1), a core S. marmorata silk fiber component, in all seasons, implying translational suppression in the silk gland during winter. Herein, we prepared and characterized silk gland ribosomes from seasonally collected S. marmorata larvae. Ribosomes from silk glands immediately frozen in liquid nitrogen (LN2) after dissection exhibited comparable translation elongation activity in spring, summer, and autumn. Conversely, silk glands obtained in winter did not contain active ribosomes and Smsp-1. Ribosomes from silk glands immersed in ice-cold physiological saline solution for approximately 4 h were translationally inactive, despite summer collection and Smsp-1 expression. The ribosomal inactivation occurs because of defects in the formation of 80S ribosomes, presumably due to splitting of 60S subunits containing 28S rRNA with central hidden break, in response to cold stress. These results suggest a novel-type ribosome-regulated translation control mechanism.

  2. Direct mass spectrometric analysis of intact proteins of the yeast large ribosomal subunit using capillary LC/FTICR

    PubMed Central

    Lee, Sang-Won; Berger, Scott J.; Martinović, Suzana; Paša-Tolić, Ljiljana; Anderson, Gordon A.; Shen, Yufeng; Zhao, Rui; Smith, Richard D.


    Electrospray ionization Fourier transform ion cyclotron resonance mass spectrometry coupled with capillary reverse-phase liquid chromatography was used to characterize intact proteins from the large subunit of the yeast ribosome. High mass measurement accuracy, achieved by “mass locking” with an internal standard from a dual electrospray ionization source, allowed identification of ribosomal proteins. Analyses of the intact proteins revealed information on cotranslational and posttranslational modifications of the ribosomal proteins that included loss of the initiating methionine, acetylation, methylation, and proteolytic maturation. High-resolution separations permitted differentiation of protein isoforms having high structural similarity as well as proteins from their modified forms, facilitating unequivocal assignments. The study identified 42 of the 43 core large ribosomal subunit proteins and 58 (of 64 possible) core large subunit protein isoforms having unique masses in a single analysis. These results demonstrate the basis for the high-throughput analyses of complex mixtures of intact proteins, which we believe will be an important complement to other approaches for defining protein modifications and their changes resulting from physiological processes or environmental perturbations. PMID:11983894

  3. Tn9 and IS1 inserts in a ribosomal ribonucleic acid operon of Escherichia coli are incompletely polar.

    PubMed Central

    Brewster, J M; Morgan, E A


    Transcription is known to be coupled to translation in many or all bacterial operons which code for proteins. In these operons, nonsense codons which prevent normal translation often result in premature termination of transcription (polarity). However, efficient transcription of ribosomal ribonucleic acid operons (rrn operons) occurs, although rrn transcripts are not translated. It therefore seemed possible that insertion sequences and transposable elements which are polar in protein-coding operons might not be polar in rrn operons. Previously, it has been shown (E. A. Morgan, Cell 21:257-265, 1980) that Tn10 is incompletely polar in the rrnX operon. Here we show that the transposon Tn9 and the insertion sequence IS1 also incompletely polar in rrnX. In normal cells expression of sequences distal to the insertions can be detected by genetic methods. In ultraviolet-irradiated cells expression of distal sequences is about 80% of that observed in uninterrupted rrnX operons. These observations provide evidence that ribonucleic acid polymerase molecules beginning at rrnX promoters can read through Tn9 and IS1 and that, at least in ultraviolet-irradiated cells, read-through is very efficient. Images PMID:6171559

  4. Dianthins, ribosome-damaging proteins with anti-viral properties from Dianthus caryophyllus L. (carnation).


    Stirpe, F; Williams, D G; Onyon, L J; Legg, R F; Stevens, W A


    1. Dianthin 30 and dianthin 32, two proteins isolated from the leaves of Diathus caryophyllus (carnation), were purified to homogeneity by chromatography on CM-cellulose. 2. The mol.wt. of dianthin 30 is 29 500 and that of dianthin 32 is 31 700. Both dianthins are glycoproteins containing mannose. 3. Dianthins inhibit protein synthesis in a lysate of rabbit reticulocytes, with an ID50 (concentration giving 50% inhibition) of 9.15 ng/ml (dianthin 30) and 3.6 ng/ml (dianthin 32). They act by damaging ribosomes in a less-than-equimolar ratio. Protein synthesis by intact cells is partially inhibited by dianthins at a concentration of 100 microgram/ml. 4. Dianthins mixed with tobacco-mosaic virus strongly decrease the number of local lesions on leaves of Nicotiana glutinosa.

  5. Appraisal of the Missing Proteins Based on the mRNAs Bound to Ribosomes.


    Xu, Shaohang; Zhou, Ruo; Ren, Zhe; Zhou, Baojin; Lin, Zhilong; Hou, Guixue; Deng, Yamei; Zi, Jin; Lin, Liang; Wang, Quanhui; Liu, Xin; Xu, Xun; Wen, Bo; Liu, Siqi


    Considering the technical limitations of mass spectrometry in protein identification, the mRNAs bound to ribosomes (RNC-mRNA) are assumed to reflect the mRNAs participating in the translational process. The RNC-mRNA data are reasoned to be useful for appraising the missing proteins. A set of the multiomics data including free-mRNAs, RNC-mRNAs, and proteomes was acquired from three liver cancer cell lines. On the basis of the missing proteins in neXtProt (release 2014-09-19), the bioinformatics analysis was carried out in three phases: (1) finding how many neXtProt missing proteins have or do not have RNA-seq and/or MS/MS evidence, (2) analyzing specific physicochemical and biological properties of the missing proteins that lack both RNA-seq and MS/MS evidence, and (3) analyzing the combined properties of these missing proteins. Total of 1501 missing proteins were found by neither RNC-mRNA nor MS/MS in the three liver cancer cell lines. For these missing proteins, some are expected higher hydrophobicity, unsuitable detection, or sensory functions as properties at the protein level, while some are predicted to have nonexpressing chromatin structures on the corresponding gene level. With further integrated analysis, we could attribute 93% of them (1391/1501) to these causal factors, which result in the expression products scarcely detected by RNA-seq or MS/MS.

  6. Genomic location of the major ribosomal protein gene locus determines Vibrio cholerae global growth and infectivity.


    Soler-Bistué, Alfonso; Mondotte, Juan A; Bland, Michael Jason; Val, Marie-Eve; Saleh, María-Carla; Mazel, Didier


    The effects on cell physiology of gene order within the bacterial chromosome are poorly understood. In silico approaches have shown that genes involved in transcription and translation processes, in particular ribosomal protein (RP) genes, localize near the replication origin (oriC) in fast-growing bacteria suggesting that such a positional bias is an evolutionarily conserved growth-optimization strategy. Such genomic localization could either provide a higher dosage of these genes during fast growth or facilitate the assembly of ribosomes and transcription foci by keeping physically close the many components of these macromolecular machines. To explore this, we used novel recombineering tools to create a set of Vibrio cholerae strains in which S10-spec-α (S10), a locus bearing half of the ribosomal protein genes, was systematically relocated to alternative genomic positions. We show that the relative distance of S10 to the origin of replication tightly correlated with a reduction of S10 dosage, mRNA abundance and growth rate within these otherwise isogenic strains. Furthermore, this was accompanied by a significant reduction in the host-invasion capacity in Drosophila melanogaster. Both phenotypes were rescued in strains bearing two S10 copies highly distal to oriC, demonstrating that replication-dependent gene dosage reduction is the main mechanism behind these alterations. Hence, S10 positioning connects genome structure to cell physiology in Vibrio cholerae. Our results show experimentally for the first time that genomic positioning of genes involved in the flux of genetic information conditions global growth control and hence bacterial physiology and potentially its evolution.

  7. Tagging ribosomal protein S7 allows rapid identification of mutants defective in assembly and function of 30 S subunits.


    Fredrick, K; Dunny, G M; Noller, H F


    Ribosomal protein S7 nucleates folding of the 16 S rRNA 3' major domain, which ultimately forms the head of the 30 S ribosomal subunit. Recent crystal structures indicate that S7 lies on the interface side of the 30 S subunit, near the tRNA binding sites of the ribosome. To map the functional surface of S7, we have tagged the protein with a Protein Kinase A recognition site and engineered alanine substitutions that target each exposed, conserved residue. We have also deleted conserved features of S7, using its structure to guide our design. By radiolabeling the tag sequence using Protein Kinase A, we are able to track the partitioning of each mutant protein into 30 S, 70 S, and polyribosome fractions in vivo. Overexpression of S7 confers a growth defect, and we observe a striking correlation between this phenotype and proficiency in 30 S subunit assembly among our collection of mutants. We find that the side chain of K35 is required for efficient assembly of S7 into 30 S subunits in vivo, whereas those of at least 17 other conserved exposed residues are not required. In addition, an S7 derivative lacking the N-terminal 17 residues causes ribosomes to accumulate on mRNA to abnormally high levels, indicating that our approach can yield interesting mutant ribosomes.

  8. Identification of Novel RNA-Protein Contact in Complex of Ribosomal Protein S7 and 3'-Terminal Fragment of 16S rRNA in E. coli.


    Golovin, A V; Khayrullina, G A; Kraal, B; Kopylov, Capital A Cyrillic М


    For prokaryotes in vitro, 16S rRNA and 20 ribosomal proteins are capable of hierarchical self- assembly yielding a 30S ribosomal subunit. The self-assembly is initiated by interactions between 16S rRNA and three key ribosomal proteins: S4, S8, and S7. These proteins also have a regulatory function in the translation of their polycistronic operons recognizing a specific region of mRNA. Therefore, studying the RNA-protein interactions within binary complexes is obligatory for understanding ribosome biogenesis. The non-conventional RNA-protein contact within the binary complex of recombinant ribosomal protein S7 and its 16S rRNA binding site (236 nucleotides) was identified. UV-induced RNA-protein cross-links revealed that S7 cross-links to nucleotide U1321 of 16S rRNA. The careful consideration of the published RNA- protein cross-links for protein S7 within the 30S subunit and their correlation with the X-ray data for the 30S subunit have been performed. The RNA - protein cross-link within the binary complex identified in this study is not the same as the previously found cross-links for a subunit both in a solution, and in acrystal. The structure of the binary RNA-protein complex formed at the initial steps of self-assembly of the small subunit appears to be rearranged during the formation of the final structure of the subunit.

  9. Mammalian ribosomal and chaperone protein RPS3A counteracts α-synuclein aggregation and toxicity in a yeast model system.


    De Graeve, Stijn; Marinelli, Sarah; Stolz, Frank; Hendrix, Jelle; Vandamme, Jurgen; Engelborghs, Yves; Van Dijck, Patrick; Thevelein, Johan M


    Accumulation of aggregated forms of αSyn (α-synuclein) into Lewy bodies is a known hallmark associated with neuronal cell death in Parkinson's disease. When expressed in the yeast Saccharomyces cerevisiae, αSyn interacts with the plasma membrane, forms inclusions and causes a concentration-dependent growth defect. We have used a yeast mutant, cog6Δ, which is particularly sensitive to moderate αSyn expression, for screening a mouse brain-specific cDNA library in order to identify mammalian proteins that counteract αSyn toxicity. The mouse ribosomal and chaperone protein RPS3A was identified as a suppressor of αSyn [WT (wild-type) and A53T] toxicity in yeast. We demonstrated that the 50 N-terminal amino acids are essential for this function. The yeast homologues of RPS3A were not effective in suppressing the αSyn-induced growth defect, illustrating the potential of our screening system to identify modifiers that would be missed using yeast gene overexpression as the first screening step. Co-expression of mouse RPS3A delayed the formation of αSyn-GFP inclusions in the yeast cells. The results of the present study suggest that the recently identified extraribosomal chaperonin function of RPS3A also acts on the neurodegeneration-related protein αSyn and reveal a new avenue for identifying promising candidate mammalian proteins involved in αSyn functioning.

  10. Hypoxia Strongly Affects Mitochondrial Ribosomal Proteins and Translocases, as Shown by Quantitative Proteomics of HeLa Cells

    PubMed Central

    Bousquet, Paula A.; Sandvik, Joe Alexander; Arntzen, Magnus Ø.; Jeppesen Edin, Nina F.; Christoffersen, Stine; Krengel, Ute; Pettersen, Erik O.; Thiede, Bernd


    Hypoxia is an important and common characteristic of many human tumors. It is a challenge clinically due to the correlation with poor prognosis and resistance to radiation and chemotherapy. Understanding the biochemical response to hypoxia would facilitate the development of novel therapeutics for cancer treatment. Here, we investigate alterations in gene expression in response to hypoxia by quantitative proteome analysis using stable isotope labeling with amino acids in cell culture (SILAC) in conjunction with LCMS/MS. Human HeLa cells were kept either in a hypoxic environment or under normoxic conditions. 125 proteins were found to be regulated, with maximum alteration of 18-fold. In particular, three clusters of differentially regulated proteins were identified, showing significant upregulation of glycolysis and downregulation of mitochondrial ribosomal proteins and translocases. This interaction is likely orchestrated by HIF-1. We also investigated the effect of hypoxia on the cell cycle, which shows accumulation in G1 and a prolonged S phase under these conditions. Implications. This work not only improves our understanding of the response to hypoxia, but also reveals proteins important for malignant progression, which may be targeted in future therapies. PMID:26421188

  11. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.


    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan


    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  12. Changes in regulation of ribosomal protein synthesis during vegetative growth and sporulation of Saccharomyces cerevisiae.

    PubMed Central

    Pearson, N J; Haber, J E


    When diploid Saccharomyces cerevisiae cells logarithmically growing in acetate medium were placed in sporulation medium, the relative rates of synthesis of 40 or more individual ribosomal proteins (r-proteins) were coordinately depressed to approximately 20% of those of growing cells. These new depressed rates remained constant for at least 10 h into sporulation. If yeast nitrogen base was added 4 yh after the beginning of sporulation to shift the cells back to vegetative growth, the original relative rates of r-protein synthesis were rapidly reestablished. this upshift in the rates occurred even in diploids homozygous for the regulatory mutation rna2 at the restrictive temperature for this mutation (34 degrees C). However, once these mutant cells began to bud and grow at 34 degrees C, the phenotype of rna2 was expressed and the syntheses of r-proteins were again coordinately depressed. At least one protein whose rate of synthesis was not depressed by rna2 in vegetative cells did have a decreased rate of synthesis during sporulation. Another r-protein whose synthesis was depressed by rna2 maintained a high rate of synthesis at the beginning of sporulation. These data suggest that the mechanism responsible for coordinate control of r-protein synthesis during sporulation does not require the gene product of RNA2 and thus defines a separate mechanism by which r-proteins are coordinately controlled in S. cerevisiae. Images PMID:6997272

  13. Re-analysis of cryoEM data on HCV IRES bound to 40S subunit of human ribosome integrated with recent structural information suggests new contact regions between ribosomal proteins and HCV RNA

    PubMed Central

    Joseph, Agnel Praveen; Bhat, Prasanna; Das, Saumitra; Srinivasan, Narayanaswamy


    In this study, we combine available high resolution structural information on eukaryotic ribosomes with low resolution cryo-EM data on the Hepatitis C Viral RNA (IRES) human ribosome complex. Aided further by the prediction of RNA-protein interactions and restrained docking studies, we gain insights on their interaction at the residue level. We identified the components involved at the major and minor contact regions, and propose that there are energetically favorable local interactions between 40S ribosomal proteins and IRES domains. Domain II of the IRES interacts with ribosomal proteins S5 and S25 while the pseudoknot and the downstream domain IV region bind to ribosomal proteins S26, S28 and S5. We also provide support using UV cross-linking studies to validate our proposition of interaction between the S5 and IRES domains II and IV. We found that domain IIIe makes contact with the ribosomal protein S3a (S1e). Our model also suggests that the ribosomal protein S27 interacts with domain IIIc while S7 has a weak contact with a single base RNA bulge between junction IIIabc and IIId. The interacting residues are highly conserved among mammalian homologs while IRES RNA bases involved in contact do not show strict conservation. IRES RNA binding sites for S25 and S3a show the best conservation among related viral IRESs. The new contacts identified between ribosomal proteins and RNA are consistent with previous independent studies on RNA-binding properties of ribosomal proteins reported in literature, though information at the residue level is not available in previous studies. PMID:25268799

  14. Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription

    PubMed Central

    Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J.; Naef, Félix


    In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and −1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these “fragile” nucleosomes play an important role in regulating RPG transcriptional output. PMID:25085421

  15. Bactobolin Resistance Is Conferred by Mutations in the L2 Ribosomal Protein

    PubMed Central

    Chandler, Josephine R.; Truong, Thao T.; Silva, Patricia M.; Seyedsayamdost, Mohammad R.; Carr, Gavin; Radey, Matthew; Jacobs, Michael A.; Sims, Elizabeth H.; Clardy, Jon; Greenberg, E. Peter


    ABSTRACT Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). PMID:23249812

  16. Ribosomal protein S7 is both a regulator and a substrate of MDM2.


    Zhu, Yan; Poyurovsky, Masha V; Li, Yingchun; Biderman, Lynn; Stahl, Joachim; Jacq, Xavier; Prives, Carol


    MDM2 associates with ribosomal protein S7, and this interaction is required to inhibit MDM2's E3 ligase activity, leading to stabilization of MDM2 and p53. Notably, the MDM2 homolog MDMX facilitates the inhibition of MDM2 E3 ligase activity by S7. Further, ablation of S7 inhibits MDM2 and p53 accumulation induced by different stress signals in some cell types. Thus, ribosomal/nucleolar stress is likely a key integrating event in DNA damage signaling to p53. Interestingly, S7 is itself a substrate for MDM2 E3 ligase activity both in vitro and in vivo. An S7-ubiquitin fusion protein (S7-Ub) selectively inhibits MDM2 degradation of p53 and is unaffected by MDMX. S7-Ub promotes apoptosis to a greater extent than S7 alone. This indicates that MDM2 ubiquitination of S7 is involved in sustaining the p53 response. Thus, S7 functions as both effector and affector of MDM2 to ensure a proper cellular response to different stress signals.

  17. Arabidopsis ribosomal proteins control vacuole trafficking and developmental programs through the regulation of lipid metabolism.


    Li, Ruixi; Sun, Ruobai; Hicks, Glenn R; Raikhel, Natasha V


    The vacuole is the most prominent compartment in plant cells and is important for ion and protein storage. In our effort to search for key regulators in the plant vacuole sorting pathway, ribosomal large subunit 4 (rpl4d) was identified as a translational mutant defective in both vacuole trafficking and normal development. Polysome profiling of the rpl4d mutant showed reduction in polysome-bound mRNA compared with wild-type, but no significant change in the general mRNA distribution pattern. Ribsomal profiling data indicated that genes in the lipid metabolism pathways were translationally down-regulated in the rpl4d mutant. Live imaging studies by Nile red staining suggested that both polar and nonpolar lipid accumulation was reduced in meristem tissues of rpl4d mutants. Pharmacological evidence showed that sterol and sphingolipid biosynthetic inhibitors can phenocopy the defects of the rpl4d mutant, including an altered vacuole trafficking pattern. Genetic evidence from lipid biosynthetic mutants indicates that alteration in the metabolism of either sterol or sphingolipid biosynthesis resulted in vacuole trafficking defects, similar to the rpl4d mutant. Tissue-specific complementation with key enzymes from lipid biosynthesis pathways can partially rescue both vacuole trafficking and auxin-related developmental defects in the rpl4d mutant. These results indicate that lipid metabolism modulates auxin-mediated tissue differentiation and endomembrane trafficking pathways downstream of ribosomal protein function.

  18. Plastid ribosomal protein S5 plays a critical role in photosynthesis, plant development, and cold stress tolerance in arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plastid ribosomal proteins (RPs) are essential components for protein synthesis machinery and exert diverse roles in plant growth and development. Mutations in plastid RPs lead to a range of developmental phenotypes in plants. However, how they regulate these processes is not fully understood and th...

  19. High temperature, differentiation, and endoplasmic reticulum stress decrease but epigenetic and antioxidative agents increase Aspergillus ribosomal protein gene expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genome-wide gene expression assays using next-generation sequencing techniques have allowed the identification of transcriptomes in many species. Transcript abundance of ribosomal protein (RP) genes can serve as a proxy for the capacity of general transcription and synthesis of cellular proteins tha...

  20. Retention of functional genes for S19 ribosomal protein in both the mitochondrion and nucleus for over 60 million years.


    Atluri, Sruthi; Rampersad, Sarah N; Bonen, Linda


    Ribosomal protein genes occasionally undergo successful migration from the mitochondrion to the nucleus in flowering plants and we previously presented evidence that the S19 ribosomal protein gene (rps19) had been transferred to the nucleus in the common ancestor of Poaceae grasses. In many lineages, the mitochondrial copy was subsequently lost or pseudogenized, although in rice it was retained and the nuclear copy lost. We have now determined that functional rps19 genes are present in both the mitochondrion and nucleus in brome grass (Bromus inermis). The mitochondrion-located rps19 gene, which is immediately downstream of an rpl2 pseudogene, is transcribed and edited. The nuclear-located rps19 gene is also actively expressed and it possesses the same intron-containing hsp70-type presequence as its counterparts in other grasses, as well as shared derived amino acids within the S19 core. We conclude that this brome rps19 gene is derived from the same transfer event that occurred in the common ancestor of grasses at least 60 million years ago. In the oat lineage, a subsequent exon shuffling-type event has resulted in novel amino-terminal sequences replacing part of the hsp70 presequence, and in the barley lineage, there has been an additional DNA-mediated transfer of the mitochondrial rps19 gene and its flanking sequences, followed by relatively recent loss of the mitochondrion-located copy. The prolonged persistence of functional copies in both compartments, as evidenced by present-day brome, raises interesting questions about their respective roles.

  1. The human WBSCR22 protein is involved in the biogenesis of the 40S ribosomal subunits in mammalian cells.


    Õunap, Kadri; Käsper, Ly; Kurg, Ants; Kurg, Reet


    The human WBSCR22 protein was previously shown to be up-regulated in invasive breast cancer and its ectopic expression enhances tumor cell survival in the vasculature. In the current study, we show that the WBSCR22 protein is important for cell growth. Knock-down of WBSCR22 with siRNA results in slower growth of WBSCR22-depleted cells. Treatment with siWBSCR22 causes defects in the processing of pre-rRNAs and reduces the level of free 40S ribosomal subunit, suggesting that WBSCR22 is involved in ribosome small subunit biosynthesis. The human WBSCR22 partially complements the growth of WBSCR22 yeast homologue, bud23 deletion mutant suggesting that the human WBSCR22 is a functional homologue of yeast Bud23. WBSCR22 is localized throughout the cell nucleus and is not stably associated with ribosomal subunits within the cell nucleus. We also show that the WBSCR22 protein level is decreased in lymphoblastoid cell lines derived from William-Beuren Syndrome (WBS) patients compared to healthy controls. Our data suggest that the WBSCR22 protein is a ribosome biogenesis factor involved in the biosynthesis of 40S ribosomal particles in mammalian cells.

  2. Knockdown of ribosomal protein S7 causes developmental abnormalities via p53 dependent and independent pathways in zebrafish.


    Duan, Juan; Ba, Qian; Wang, Ziliang; Hao, Miao; Li, Xiaoguang; Hu, Pingting; Zhang, Deyi; Zhang, Ruiwen; Wang, Hui


    Ribosomal proteins (RPs), structural components of the ribosome involved in protein synthesis, are of significant importance in all organisms. Previous studies have suggested that some RPs may have other functions in addition to assembly of the ribosome. The small ribosomal subunits RPS7, has been reported to modulate the mdm2-p53 interaction. To further investigate the biological functions of RPS7, we used morpholino antisense oligonucleotides (MO) to specifically knockdown RPS7 in zebrafish. In RPS7-deficient embryos, p53 was activated, and its downstream target genes and biological events were induced, including apoptosis and cell cycle arrest. Hematopoiesis was also impaired seriously in RPS7-deficient embryos, which was confirmed by the hemoglobin O-dianisidine staining of blood cells, and the expression of scl, gata1 and α-E1 globin were abnormal. The matrix metalloproteinase (mmp) family genes were also activated in RPS7 morphants, indicating that improper cell migration might also cause development defects. Furthermore, simultaneously knockdown of the p53 protein by co-injecting a p53 MO could partially reverse the abnormal phenotype in the morphants. These results strengthen the hypothesis that specific ribosomal proteins regulate p53 and that their deficiency affects hematopoiesis. Moreover, our data implicate that RPS7 is a regulator of matrix metalloproteinase (mmp) family in zebrafish system. These specific functions of RPS7 may provide helpful clues to study the roles of RPs in human disease.

  3. The Recombinant Maize Ribosome-Inactivating Protein Transiently Reduces Viral Load in SHIV89.6 Infected Chinese Rhesus Macaques

    PubMed Central

    Wang, Rui-Rui; Au, Ka-Yee; Zheng, Hong-Yi; Gao, Liang-Min; Zhang, Xuan; Luo, Rong-Hua; Law, Sue Ka-Yee; Mak, Amanda Nga-Sze; Wong, Kam-Bo; Zhang, Ming-Xu; Pang, Wei; Zhang, Gao-Hong; Shaw, Pang-Chui; Zheng, Yong-Tang


    Ribosome inactivating proteins (RIPs) inhibit protein synthesis by depurinating the large ribosomal RNA and some are found to possess anti-human immunodeficiency virus (HIV) activity. Maize ribosome inactivating protein (RIP) has an internal inactivation loop which is proteolytically removed for full catalytic activity. Here, we showed that the recombinant active maize RIP protected chimeric simian-human immunodeficiency virus (SHIV) 89.6-infected macaque peripheral blood mononuclear cells from lysis ex vivo and transiently reduced plasma viral load in SHIV89.6-infected rhesus macaque model. No evidence of immune dysregulation and other obvious side-effects was found in the treated macaques. Our work demonstrates the potential development of maize RIP as an anti-HIV agent without impeding systemic immune functions. PMID:25606813

  4. Ribosomal Stalk Protein Silencing Partially Corrects the ΔF508-CFTR Functional Expression Defect

    PubMed Central

    Veit, Guido; Oliver, Kathryn; Apaja, Pirjo M.; Perdomo, Doranda; Bidaud-Meynard, Aurélien; Guo, Jingyu; Icyuz, Mert; Sorscher, Eric J.; Hartman, John L.; Lukacs, Gergely L.


    The most common cystic fibrosis (CF) causing mutation, deletion of phenylalanine 508 (ΔF508 or Phe508del), results in functional expression defect of the CF transmembrane conductance regulator (CFTR) at the apical plasma membrane (PM) of secretory epithelia, which is attributed to the degradation of the misfolded channel at the endoplasmic reticulum (ER). Deletion of phenylalanine 670 (ΔF670) in the yeast oligomycin resistance 1 gene (YOR1, an ABC transporter) of Saccharomyces cerevisiae phenocopies the ΔF508-CFTR folding and trafficking defects. Genome-wide phenotypic (phenomic) analysis of the Yor1-ΔF670 biogenesis identified several modifier genes of mRNA processing and translation, which conferred oligomycin resistance to yeast. Silencing of orthologues of these candidate genes enhanced the ΔF508-CFTR functional expression at the apical PM in human CF bronchial epithelia. Although knockdown of RPL12, a component of the ribosomal stalk, attenuated the translational elongation rate, it increased the folding efficiency as well as the conformational stability of the ΔF508-CFTR, manifesting in 3-fold augmented PM density and function of the mutant. Combination of RPL12 knockdown with the corrector drug, VX-809 (lumacaftor) restored the mutant function to ~50% of the wild-type channel in primary CFTRΔF508/ΔF508 human bronchial epithelia. These results and the observation that silencing of other ribosomal stalk proteins partially rescue the loss-of-function phenotype of ΔF508-CFTR suggest that the ribosomal stalk modulates the folding efficiency of the mutant and is a potential therapeutic target for correction of the ΔF508-CFTR folding defect. PMID:27168400

  5. Ribosomal Stalk Protein Silencing Partially Corrects the ΔF508-CFTR Functional Expression Defect.


    Veit, Guido; Oliver, Kathryn; Apaja, Pirjo M; Perdomo, Doranda; Bidaud-Meynard, Aurélien; Lin, Sheng-Ting; Guo, Jingyu; Icyuz, Mert; Sorscher, Eric J; Hartman Iv, John L; Lukacs, Gergely L


    The most common cystic fibrosis (CF) causing mutation, deletion of phenylalanine 508 (ΔF508 or Phe508del), results in functional expression defect of the CF transmembrane conductance regulator (CFTR) at the apical plasma membrane (PM) of secretory epithelia, which is attributed to the degradation of the misfolded channel at the endoplasmic reticulum (ER). Deletion of phenylalanine 670 (ΔF670) in the yeast oligomycin resistance 1 gene (YOR1, an ABC transporter) of Saccharomyces cerevisiae phenocopies the ΔF508-CFTR folding and trafficking defects. Genome-wide phenotypic (phenomic) analysis of the Yor1-ΔF670 biogenesis identified several modifier genes of mRNA processing and translation, which conferred oligomycin resistance to yeast. Silencing of orthologues of these candidate genes enhanced the ΔF508-CFTR functional expression at the apical PM in human CF bronchial epithelia. Although knockdown of RPL12, a component of the ribosomal stalk, attenuated the translational elongation rate, it increased the folding efficiency as well as the conformational stability of the ΔF508-CFTR, manifesting in 3-fold augmented PM density and function of the mutant. Combination of RPL12 knockdown with the corrector drug, VX-809 (lumacaftor) restored the mutant function to ~50% of the wild-type channel in primary CFTRΔF508/ΔF508 human bronchial epithelia. These results and the observation that silencing of other ribosomal stalk proteins partially rescue the loss-of-function phenotype of ΔF508-CFTR suggest that the ribosomal stalk modulates the folding efficiency of the mutant and is a potential therapeutic target for correction of the ΔF508-CFTR folding defect.

  6. Ribosomal Stalk Protein Silencing Partially Corrects the ΔF508-CFTR Functional Expression Defect.


    Veit, Guido; Oliver, Kathryn; Apaja, Pirjo M; Perdomo, Doranda; Bidaud-Meynard, Aurélien; Lin, Sheng-Ting; Guo, Jingyu; Icyuz, Mert; Sorscher, Eric J; Hartman Iv, John L; Lukacs, Gergely L


    The most common cystic fibrosis (CF) causing mutation, deletion of phenylalanine 508 (ΔF508 or Phe508del), results in functional expression defect of the CF transmembrane conductance regulator (CFTR) at the apical plasma membrane (PM) of secretory epithelia, which is attributed to the degradation of the misfolded channel at the endoplasmic reticulum (ER). Deletion of phenylalanine 670 (ΔF670) in the yeast oligomycin resistance 1 gene (YOR1, an ABC transporter) of Saccharomyces cerevisiae phenocopies the ΔF508-CFTR folding and trafficking defects. Genome-wide phenotypic (phenomic) analysis of the Yor1-ΔF670 biogenesis identified several modifier genes of mRNA processing and translation, which conferred oligomycin resistance to yeast. Silencing of orthologues of these candidate genes enhanced the ΔF508-CFTR functional expression at the apical PM in human CF bronchial epithelia. Although knockdown of RPL12, a component of the ribosomal stalk, attenuated the translational elongation rate, it increased the folding efficiency as well as the conformational stability of the ΔF508-CFTR, manifesting in 3-fold augmented PM density and function of the mutant. Combination of RPL12 knockdown with the corrector drug, VX-809 (lumacaftor) restored the mutant function to ~50% of the wild-type channel in primary CFTRΔF508/ΔF508 human bronchial epithelia. These results and the observation that silencing of other ribosomal stalk proteins partially rescue the loss-of-function phenotype of ΔF508-CFTR suggest that the ribosomal stalk modulates the folding efficiency of the mutant and is a potential therapeutic target for correction of the ΔF508-CFTR folding defect. PMID:27168400

  7. Crystal structure of RimI from Salmonella typhimurium LT2, the GNAT responsible for Nα-acetylation of ribosomal protein S18

    PubMed Central

    Vetting, Matthew W.; Bareich, David C.; Yu, Michael; Blanchard, John S.


    The three ribosomal proteins L7, S5, and S18 are included in the rare subset of prokaryotic proteins that are known to be Nα-acetylated. The GCN5-related N-acetyltransferase (GNAT) protein RimI, responsible for the Nα-acetylation of the ribosomal protein S18, was cloned from Salmonella typhimurium LT2 (RimIST), overexpressed, and purified to homogeneity. Steady-state kinetic parameters for RimIST were determined for AcCoA and a peptide substrate consisting of the first six amino acids of the target protein S18. The crystal structure of RimIST was determined in complex with CoA, AcCoA, and a CoA-S-acetyl-ARYFRR bisubstrate inhibitor. The structures are consistent with a direct nucleophilic addition–elimination mechanism with Glu103 and Tyr115 acting as the catalytic base and acid, respectively. The RimIST-bisubstrate complex suggests that several residues change conformation upon interacting with the N terminus of S18, including Glu103, the proposed active site base, facilitating proton exchange and catalysis. PMID:18596200

  8. Distribution of dwell times of a ribosome: effects of infidelity, kinetic proofreading and ribosome crowding

    NASA Astrophysics Data System (ADS)

    Sharma, Ajeet K.; Chowdhury, Debashish


    Ribosome is a molecular machine that polymerizes a protein where the sequence of the amino acid residues, the monomers of the protein, is dictated by the sequence of codons (triplets of nucleotides) on a messenger RNA (mRNA) that serves as the template. The ribosome is a molecular motor that utilizes the template mRNA strand also as the track. Thus, in each step the ribosome moves forward by one codon and, simultaneously, elongates the protein by one amino acid. We present a theoretical model that captures most of the main steps in the mechanochemical cycle of a ribosome. The stochastic movement of the ribosome consists of an alternating sequence of pause and translocation; the sum of the durations of a pause and the following translocation is the time of dwell of the ribosome at the corresponding codon. We derive the analytical expression for the distribution of the dwell times of a ribosome in our model. Wherever experimental data are available, our theoretical predictions are consistent with those results. We suggest appropriate experiments to test the new predictions of our model, particularly the effects of the quality control mechanism of the ribosome and that of their crowding on the mRNA track.

  9. Molecular characterization and systemic induction of single-chain ribosome-inactivating proteins (RIPs) in sugar beet (Beta vulgaris) leaves.


    Iglesias, Rosario; Pérez, Yolanda; de Torre, Carlos; Ferreras, J Miguel; Antolín, Pilar; Jiménez, Pilar; Rojo, M Angeles; Méndez, Enrique; Girbés, Tomás


    Sugar beet (Beta vulgaris L.) leaves contain virus-inducible type 1 (single chain) ribosome-inactivating proteins that have been named beetins. The structural and functional characterization, the cellular location, and the potential role of beetins as antiviral agents are reported here. Beetins are formed of a single polypeptide chain with a varying degree of glycosylation and strongly inhibited in vitro protein synthesis in rabbit reticulocyte lysates (IC50=1.15 ng ml(-1)) and a Vicia sativa L. cell-free system (IC50=68 ng ml(-1)) through the single depurination of the large rRNA. Beetins trigger the multidepurination of tobacco mosaic virus (TMV) genomic RNA which underwent extensive degradation upon treatment with acid aniline. Beetins are extracellular proteins that were recovered from the apoplastic fluid. Induction of sugar beet RIPs with either H2O2 or artichoke mottled crinkle virus (AMCV) was observed in leaves distant from the site of application of such elicitors. The external application of purified beetin to sugar leaves prevented infection by AMCV which supports the preliminary hypothesis that beetins could be involved in plant systemic acquired resistance subjected to induction by phytopathogens.

  10. RPLP1, a Crucial Ribosomal Protein for Embryonic Development of the Nervous System

    PubMed Central

    Perucho, Laura; Artero-Castro, Ana; Guerrero, Sergi; Ramón y Cajal, Santiago; LLeonart, Matilde E.; Wang, Zhao-Qi


    Ribosomal proteins are pivotal to development and tissue homeostasis. RP Large P1 (Rplp1) overexpression is associated with tumorigenesis. However, the physiological function of Rplp1 in mammalian development remains unknown. In this study, we disrupted Rplp1 in the mouse germline and central nervous system (Rplp1CNSΔ). Rplp1 heterozygosity caused body size reductions, male infertility, systemic abnormalities in various tissues and a high frequency of early postnatal death. Rplp1CNSΔ newborn mice exhibited perinatal lethality and brain atrophy with size reductions of the neocortex, midbrain and ganglionic eminence. The Rplp1 knockout neocortex exhibited progenitor cell proliferation arrest and apoptosis due to the dysregulation of key cell cycle and apoptosis regulators (cyclin A, cyclin E, p21CIP1, p27KIP1, p53). Similarly, Rplp1 deletion in pMEFs led to proliferation arrest and premature senescence. Importantly, Rplp1 deletion in primary mouse embryonic fibroblasts did not alter global protein synthesis, but did change the expression patterns of specific protein subsets involved in protein folding and the unfolded protein response, cell death, protein transport and signal transduction, among others. Altogether, we demonstrated that the translation “fine-tuning” exerted by Rplp1 is essential for embryonic and brain development and for proper cell proliferation. PMID:24959908

  11. Proteins associated with rRNA in the Escherichia coli ribosome.


    Bernabeu, C; Vazquez, D; Ballesta, J P


    Ribosomal proteins located near the rRNA have been identified by cross linking to [14C]spermine with 1,5-difluoro-2,4-dinitrobenzene. The polyamine binds to double-stranded rRNA; those proteins showing radioactivity covalently bound after treatment with the bifunctional reagent should therefore be located in the vicinity of these regions of rRNA. Six proteins from the small subunit, S4, S5, S9, S18, S19 and S20 and ten proteins from the large subunit L2, L6, L13, L14, L16, L17, L18, L19, L22 and L27 preferentially take up the label. The results obtained with three proteins from the large subunit, L6, L16 and L27, show a high degree of variability that could reflect differences of conformation in the subunit population. Several proteins were drastically modified by the cross-linking agent but were not detected in the two-dimensional gel electrophoresis (e.g., S1, S11, S21, L7, L8 and L12) and therefore could not be studied.

  12. Fibroblast growth factor 3, a protein with a dual subcellular fate, is interacting with human ribosomal protein S2

    SciTech Connect

    Antoine, Marianne; Reimers, Kerstin; Wirz, Werner; Gressner, Axel M.; Mueller, Robert; Kiefer, Paul . E-mail:


    The secreted isoform of fibroblast growth factor 3 (FGF3) induces a mitogenic cell response, while the nuclear form inhibits cell proliferation. Recently, we identified a nucleolar FGF3-binding protein which is implicated in processing of pre-rRNA as a possible target of nuclear FGF3 signalling. Here, we report a second candidate protein identified by a yeast two-hybrid screen for nuclear FGF3 action, ribosomal protein S2, rpS2. Recombinant rpS2 binds to in vitro translated FGF3 and to nuclear FGF3 extracted from transfected COS-1 cells. Characterization of the FGF3 binding domain of rpS2 showed that both the Arg-Gly-rich N-terminal region and a short carboxyl-terminal sequence of rpS2 are necessary for FGF3 binding. Mapping the S2 binding domains of FGF3 revealed that these domains are important for both NoBP and rpS2 interaction. Transient co-expression of rpS2 and nuclear FGF3 resulted in a reduced nucleolar localization of the FGF. These findings suggest that the nuclear form of FGF3 inhibits cell proliferation by interfering with ribosomal biogenesis.

  13. Ribosomal protein mutations induce autophagy through S6 kinase inhibition of the insulin pathway.


    Heijnen, Harry F; van Wijk, Richard; Pereboom, Tamara C; Goos, Yvonne J; Seinen, Cor W; van Oirschot, Brigitte A; van Dooren, Rowie; Gastou, Marc; Giles, Rachel H; van Solinge, Wouter; Kuijpers, Taco W; Gazda, Hanna T; Bierings, Marc B; Da Costa, Lydie; MacInnes, Alyson W


    Mutations affecting the ribosome lead to several diseases known as ribosomopathies, with phenotypes that include growth defects, cytopenia, and bone marrow failure. Diamond-Blackfan anemia (DBA), for example, is a pure red cell aplasia linked to the mutation of ribosomal protein (RP) genes. Here we show the knock-down of the DBA-linked RPS19 gene induces the cellular self-digestion process of autophagy, a pathway critical for proper hematopoiesis. We also observe an increase of autophagy in cells derived from DBA patients, in CD34+ erythrocyte progenitor cells with RPS19 knock down, in the red blood cells of zebrafish embryos with RP-deficiency, and in cells from patients with Shwachman-Diamond syndrome (SDS). The loss of RPs in all these models results in a marked increase in S6 kinase phosphorylation that we find is triggered by an increase in reactive oxygen species (ROS). We show that this increase in S6 kinase phosphorylation inhibits the insulin pathway and AKT phosphorylation activity through a mechanism reminiscent of insulin resistance. While stimulating RP-deficient cells with insulin reduces autophagy, antioxidant treatment reduces S6 kinase phosphorylation, autophagy, and stabilization of the p53 tumor suppressor. Our data suggest that RP loss promotes the aberrant activation of both S6 kinase and p53 by increasing intracellular ROS levels. The deregulation of these signaling pathways is likely playing a major role in the pathophysiology of ribosomopathies. PMID:24875531

  14. S6:S18 ribosomal protein complex interacts with a structural motif present in its own mRNA

    PubMed Central

    Matelska, Dorota; Purta, Elzbieta; Panek, Sylwia; Boniecki, Michal J.; Bujnicki, Janusz M.; Dunin-Horkawicz, Stanislaw


    Prokaryotic ribosomal protein genes are typically grouped within highly conserved operons. In many cases, one or more of the encoded proteins not only bind to a specific site in the ribosomal RNA, but also to a motif localized within their own mRNA, and thereby regulate expression of the operon. In this study, we computationally predicted an RNA motif present in many bacterial phyla within the 5′ untranslated region of operons encoding ribosomal proteins S6 and S18. We demonstrated that the S6:S18 complex binds to this motif, which we hereafter refer to as the S6:S18 complex-binding motif (S6S18CBM). This motif is a conserved CCG sequence presented in a bulge flanked by a stem and a hairpin structure. A similar structure containing a CCG trinucleotide forms the S6:S18 complex binding site in 16S ribosomal RNA. We have constructed a 3D structural model of a S6:S18 complex with S6S18CBM, which suggests that the CCG trinucleotide in a specific structural context may be specifically recognized by the S18 protein. This prediction was supported by site-directed mutagenesis of both RNA and protein components. These results provide a molecular basis for understanding protein-RNA recognition and suggest that the S6S18CBM is involved in an auto-regulatory mechanism. PMID:23980204

  15. Overexpression, purification, and pharmacologic evaluation of anticancer activity of ribosomal protein L24 from the giant panda (Ailuropoda melanoleuca).


    Hou, Y L; Ding, X; Hou, W; Song, B; Wang, T; Wang, F; Li, J; Zhong, J; Xu, T; Ma, B X; Zhu, H Q; Li, J H; Zhong, J C


    The ribosomal protein L24 (RPL24) belongs to the L24E family of ribosomal proteins and is located in the cytoplasm. The purpose of this study was to investigate the structure and anti-cancer function of RPL24 of the giant panda (Ailuropoda melanoleuca). The complementary DNA of RPL24 was cloned successfully using reverse transcription-polymerase chain reaction technology. We constructed a recombinant expression vector containing RPL24 complementary DNA and overexpressed it in Escherichia coli using pET28a plasmids. The expression product obtained was purified using Ni-chelating affinity chromatography. The results indicated that the length of the fragment cloned is 509 bp, and it contains an open-reading frame of 474 bp encoding 157 amino acids. Primary structure analysis revealed that the molecular weight of the putative RPL24 protein is 17.78 kDa with a theoretical isoelectric point of 11.86. The RPL24 gene is readily expressed in E. coli, and the RPL24 fused with the N-terminal histidine-tagged protein to give rise to the accumulation of an expected 23.51-kDa polypeptide. The inhibitory rate in mice treated with 0.1 mg/mL RPL24, the highest of 3 doses administered, can reach 67.662%, which may be comparable to the response to mannatide. The histology of organs with tumors showed that the tissues in the RPL24 group displayed a looser arrangement compared with that in the control group. Furthermore, no obvious damage was apparent in other organs, such as heart, lung, and kidney. The data showed that the recombinant RPL24 had time and dose dependency on the cell growth inhibition rate. Human laryngeal carcinoma Hep-2 cells treated with 0.3125-10 µg/mL RPL24 for 24 h displayed significant cell growth inhibition (P < 0.05; N = 6) in assays using 3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyltetrazolium bromide compared with that in control (untreated) cells. By contrast, human hepatoma Hep G-2 cells displayed no significant change (P > 0.05; N = 6) from control

  16. Overexpression, purification, and pharmacologic evaluation of anticancer activity of ribosomal protein L24 from the giant panda (Ailuropoda melanoleuca).


    Hou, Y L; Ding, X; Hou, W; Song, B; Wang, T; Wang, F; Li, J; Zhong, J; Xu, T; Ma, B X; Zhu, H Q; Li, J H; Zhong, J C


    The ribosomal protein L24 (RPL24) belongs to the L24E family of ribosomal proteins and is located in the cytoplasm. The purpose of this study was to investigate the structure and anti-cancer function of RPL24 of the giant panda (Ailuropoda melanoleuca). The complementary DNA of RPL24 was cloned successfully using reverse transcription-polymerase chain reaction technology. We constructed a recombinant expression vector containing RPL24 complementary DNA and overexpressed it in Escherichia coli using pET28a plasmids. The expression product obtained was purified using Ni-chelating affinity chromatography. The results indicated that the length of the fragment cloned is 509 bp, and it contains an open-reading frame of 474 bp encoding 157 amino acids. Primary structure analysis revealed that the molecular weight of the putative RPL24 protein is 17.78 kDa with a theoretical isoelectric point of 11.86. The RPL24 gene is readily expressed in E. coli, and the RPL24 fused with the N-terminal histidine-tagged protein to give rise to the accumulation of an expected 23.51-kDa polypeptide. The inhibitory rate in mice treated with 0.1 mg/mL RPL24, the highest of 3 doses administered, can reach 67.662%, which may be comparable to the response to mannatide. The histology of organs with tumors showed that the tissues in the RPL24 group displayed a looser arrangement compared with that in the control group. Furthermore, no obvious damage was apparent in other organs, such as heart, lung, and kidney. The data showed that the recombinant RPL24 had time and dose dependency on the cell growth inhibition rate. Human laryngeal carcinoma Hep-2 cells treated with 0.3125-10 µg/mL RPL24 for 24 h displayed significant cell growth inhibition (P < 0.05; N = 6) in assays using 3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyltetrazolium bromide compared with that in control (untreated) cells. By contrast, human hepatoma Hep G-2 cells displayed no significant change (P > 0.05; N = 6) from control

  17. Elderberries: a source of ribosome-inactivating proteins with lectin activity.


    Tejero, Jesús; Jiménez, Pilar; Quinto, Emiliano J; Cordoba-Diaz, Damián; Garrosa, Manuel; Cordoba-Diaz, Manuel; Gayoso, Manuel J; Girbés, Tomás


    Sambucus (Adoxaceae) species have been used for both food and medicine purposes. Among these, Sambucus nigra L. (black elder), Sambucus ebulus L. (dwarf elder), and Sambucus sieboldiana L. are the most relevant species studied. Their use has been somewhat restricted due to the presence of bioactive proteins or/and low molecular weight compounds whose ingestion could trigger deleterious effects. Over the last few years, the chemical and pharmacological characteristics of Sambucus species have been investigated. Among the proteins present in Sambucus species both type 1, and type 2 ribosome-inactivating proteins (RIPs), and hololectins have been reported. The biological role played by these proteins remains unknown, although they are conjectured to be involved in defending plants against insect predators and viruses. These proteins might have an important impact on the nutritional characteristics and food safety of elderberries. Type 2 RIPs are able to interact with gut cells of insects and mammals triggering a number of specific and mostly unknown cell signals in the gut mucosa that could significantly affect animal physiology. In this paper, we describe all known RIPs that have been isolated to date from Sambucus species, and comment on their antiviral and entomotoxic effects, as well as their potential uses.

  18. Characterization of Two Novel Type I Ribosome-Inactivating Proteins from the Storage Roots of the Andean Crop Mirabilis expansa1

    PubMed Central

    Vivanco, Jorge M.; Savary, Brett J.; Flores, Hector E.


    Two novel type I ribosome-inactivating proteins (RIPs) were found in the storage roots of Mirabilis expansa, an underutilized Andean root crop. The two RIPs, named ME1 and ME2, were purified to homogeneity by ammonium sulfate precipitation, cation-exchange perfusion chromatography, and C4 reverse-phase chromatography. The two proteins were found to be similar in size (27 and 27.5 kD) by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and their isoelectric points were determined to be greater than pH 10.0. Amino acid N-terminal sequencing revealed that both ME1 and ME2 had conserved residues characteristic of RIPs. Amino acid composition and western-blot analysis further suggested a structural similarity between ME1 and ME2. ME2 showed high similarity to the Mirabilis jalapa antiviral protein, a type I RIP. Depurination of yeast 26S rRNA by ME1 and ME2 demonstrated their ribosome-inactivating activity. Because these two proteins were isolated from roots, their antimicrobial activity was tested against root-rot microorganisms, among others. ME1 and ME2 were active against several fungi, including Pythium irregulare, Fusarium oxysporum solani, Alternaria solani, Trichoderma reesei, and Trichoderma harzianum, and an additive antifungal effect of ME1 and ME2 was observed. Antibacterial activity of both ME1 and ME2 was observed against Pseudomonas syringae, Agrobacterium tumefaciens, Agrobacterium radiobacter, and others. PMID:10198104

  19. Ribosomal protein S7 from Escherichia coli uses the same determinants to bind 16S ribosomal RNA and its messenger RNA

    PubMed Central

    Robert, Francis; Brakier-Gingras, Léa


    Ribosomal protein S7 from Escherichia coli binds to the lower half of the 3′ major domain of 16S rRNA and initiates its folding. It also binds to its own mRNA, the str mRNA, and represses its translation. Using filter binding assays, we show in this study that the same mutations that interfere with S7 binding to 16S rRNA also weaken its affinity for its mRNA. This suggests that the same protein regions are responsible for mRNA and rRNA binding affinities, and that S7 recognizes identical sequence elements within the two RNA targets, although they have dissimilar secondary structures. Overexpression of S7 is known to inhibit bacterial growth. This phenotypic growth defect was relieved in cells overexpressing S7 mutants that bind poorly the str mRNA, confirming that growth impairment is controlled by the binding of S7 to its mRNA. Interestingly, a mutant with a short deletion at the C-terminus of S7 was more detrimental to cell growth than wild-type S7. This suggests that the C-terminal portion of S7 plays an important role in ribosome function, which is perturbed by the deletion. PMID:11160889

  20. La Autoantigen Induces Ribosome Binding Protein 1 (RRBP1) Expression through Internal Ribosome Entry Site (IRES)-Mediated Translation during Cellular Stress Condition

    PubMed Central

    Gao, Wenqing; Li, Qi; Zhu, Ruiyu; Jin, Jian


    The function of ribosome binding protein 1 (RRBP1) is regulating the transportation and secretion of some intracellular proteins in mammalian cells. Transcription of RRBP1 is induced by various cytokines. However, few studies focused on the process of RRPB1 mRNA translation. The RRBP1 mRNA has a long 5′ untranslated region that potentially formed a stable secondary structure. In this study, we show that the 5′ UTR of RRBP1 mRNA contains an internal ribosome entry site (IRES). Moreover, the RRBP1 expression is induced by chemotherapeutic drug paclitaxel or adriamycin in human hepatocellular carcinoma cells and accompanied with the increased expression of La autoantigen (La), which binds to RRBP1 IRES element and facilitates translation initiation. Interestingly, we found IRES-mediated RRBP1 translation is also activated during serum-starvation condition which can induce cytoplasmic localization of La. After mapping the entire RRBP1 5′ UTR, we determine the core IRES activity is located between nt-237 and -58. Furthermore, two apical GARR loops within the functional RRBP1 IRES elements may be important for La binding. These results strongly suggest an important role for IRES-dependent translation of RRBP1 mRNA in hepatocellular carcinoma cells during cellular stress conditions. PMID:27447629

  1. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    SciTech Connect

    Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan


    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.

  2. La Autoantigen Induces Ribosome Binding Protein 1 (RRBP1) Expression through Internal Ribosome Entry Site (IRES)-Mediated Translation during Cellular Stress Condition.


    Gao, Wenqing; Li, Qi; Zhu, Ruiyu; Jin, Jian


    The function of ribosome binding protein 1 (RRBP1) is regulating the transportation and secretion of some intracellular proteins in mammalian cells. Transcription of RRBP1 is induced by various cytokines. However, few studies focused on the process of RRPB1 mRNA translation. The RRBP1 mRNA has a long 5' untranslated region that potentially formed a stable secondary structure. In this study, we show that the 5' UTR of RRBP1 mRNA contains an internal ribosome entry site (IRES). Moreover, the RRBP1 expression is induced by chemotherapeutic drug paclitaxel or adriamycin in human hepatocellular carcinoma cells and accompanied with the increased expression of La autoantigen (La), which binds to RRBP1 IRES element and facilitates translation initiation. Interestingly, we found IRES-mediated RRBP1 translation is also activated during serum-starvation condition which can induce cytoplasmic localization of La. After mapping the entire RRBP1 5' UTR, we determine the core IRES activity is located between nt-237 and -58. Furthermore, two apical GARR loops within the functional RRBP1 IRES elements may be important for La binding. These results strongly suggest an important role for IRES-dependent translation of RRBP1 mRNA in hepatocellular carcinoma cells during cellular stress conditions. PMID:27447629

  3. Ribosomal protein S7 from Escherichia coli uses the same determinants to bind 16S ribosomal RNA and its messenger RNA.


    Robert, F; Brakier-Gingras, L


    Ribosomal protein S7 from Escherichia coli binds to the lower half of the 3' major domain of 16S rRNA and initiates its folding. It also binds to its own mRNA, the str mRNA, and represses its translation. Using filter binding assays, we show in this study that the same mutations that interfere with S7 binding to 16S rRNA also weaken its affinity for its mRNA. This suggests that the same protein regions are responsible for mRNA and rRNA binding affinities, and that S7 recognizes identical sequence elements within the two RNA targets, although they have dissimilar secondary structures. Overexpression of S7 is known to inhibit bacterial growth. This phenotypic growth defect was relieved in cells overexpressing S7 mutants that bind poorly the str mRNA, confirming that growth impairment is controlled by the binding of S7 to its mRNA. Interestingly, a mutant with a short deletion at the C-terminus of S7 was more detrimental to cell growth than wild-type S7. This suggests that the C-terminal portion of S7 plays an important role in ribosome function, which is perturbed by the deletion.

  4. Protein costs do not explain evolution of metabolic strategies and regulation of ribosomal content: does protein investment explain an anaerobic bacterial Crabtree effect?


    Goel, Anisha; Eckhardt, Thomas H; Puri, Pranav; de Jong, Anne; Branco Dos Santos, Filipe; Giera, Martin; Fusetti, Fabrizia; de Vos, Willem M; Kok, Jan; Poolman, Bert; Molenaar, Douwe; Kuipers, Oscar P; Teusink, Bas


    Protein investment costs are considered a major driver for the choice of alternative metabolic strategies. We tested this premise in Lactococcus lactis, a bacterium that exhibits a distinct, anaerobic version of the bacterial Crabtree/Warburg effect; with increasing growth rates it shifts from a high yield metabolic mode [mixed-acid fermentation; 3 adenosine triphosphate (ATP) per glucose] to a low yield metabolic mode (homolactic fermentation; 2 ATP per glucose). We studied growth rate-dependent relative transcription and protein ratios, enzyme activities, and fluxes of L. lactis in glucose-limited chemostats, providing a high-quality and comprehensive data set. A three- to fourfold higher growth rate rerouted metabolism from acetate to lactate as the main fermentation product. However, we observed hardly any changes in transcription, protein levels and enzyme activities. Even levels of ribosomal proteins, constituting a major investment in cellular machinery, changed only slightly. Thus, contrary to the original hypothesis, central metabolism in this organism appears to be hardly regulated at the level of gene expression, but rather at the metabolic level. We conclude that L. lactis is either poorly adapted to growth at low and constant glucose concentrations, or that protein costs play a less important role in fitness than hitherto assumed.

  5. NMR solution structure of a dsRNA binding domain from Drosophila staufen protein reveals homology to the N-terminal domain of ribosomal protein S5.

    PubMed Central

    Bycroft, M; Grünert, S; Murzin, A G; Proctor, M; St Johnston, D


    The double-stranded RNA binding domain (dsRBD) is an approximately 65 amino acid motif that is found in a variety of proteins that interact with double-stranded (ds) RNA, such as Escherichia coli RNase III and the dsRNA-dependent kinase, PKR. Drosophila staufen protein contains five copies of this motif, and the third of these binds dsRNA in vitro. Using multinuclear/multidimensional NMR methods, we have determined that staufen dsRBD3 forms a compact protein domain with an alpha-beta-beta-beta-alpha structure in which the two alpha-helices lie on one face of a three-stranded anti-parallel beta-sheet. This structure is very similar to that of the N-terminal domain of a prokaryotic ribosomal protein S5. Furthermore, the consensus derived from all known S5p family sequences shares several conserved residues with the dsRBD consensus sequence, indicating that the two domains share a common evolutionary origin. Using in vitro mutagenesis, we have identified several surface residues which are important for the RNA binding of the dsRBD, and these all lie on the same side of the domain. Two residues that are essential for RNA binding, F32 and K50, are also conserved in the S5 protein family, suggesting that the two domains interact with RNA in a similar way. Images PMID:7628456

  6. Ribosomal Protein S6 Phosphorylation in the Nervous System: From Regulation to Function

    PubMed Central

    Biever, Anne; Valjent, Emmanuel; Puighermanal, Emma


    Since the discovery of the phosphorylation of the 40S ribosomal protein S6 (rpS6) about four decades ago, much effort has been made to uncover the molecular mechanisms underlying the regulation of this post-translational modification. In the field of neuroscience, rpS6 phosphorylation is commonly used as a readout of the mammalian target of rapamycin complex 1 signaling activation or as a marker for neuronal activity. Nevertheless, its biological role in neurons still remains puzzling. Here we review the pharmacological and physiological stimuli regulating this modification in the nervous system as well as the pathways that transduce these signals into rpS6 phosphorylation. Altered rpS6 phosphorylation observed in various genetic and pathophysiological mouse models is also discussed. Finally, we examine the current state of knowledge on the physiological role of this post-translational modification and highlight the questions that remain to be addressed. PMID:26733799

  7. Type 1 ribosome-inactivating proteins from Phytolacca dioica L. leaves: differential seasonal and age expression, and cellular localization.


    Parente, Augusto; Conforto, Barbara; Di Maro, Antimo; Chambery, Angela; De Luca, Paolo; Bolognesi, Andrea; Iriti, Marcello; Faoro, Franco


    The expression of type 1 ribosome-inactivating proteins (RIPs) in Phytolacca dioica L. leaves was investigated. Fully expanded leaves of young P. dioica plants (up to 3 years old) expressed two novel RIPs, dioicin 1 and dioicin 2. The former was also found in developing leaves from adult P. dioica within about two and a half weeks after leaf development, and the latter continuously synthesized, with no seasonal or ontogenetic constraint. Fully expanded leaves from adult P. dioica expressed four RIPs (PD-Ls1-4) exhibiting seasonal variation. RIPs were localized in the extracellular space, in the vacuole and in the Golgi apparatus of mesophyll cells. Dioicin 1 and dioicin 2 showed rRNA N-beta-glycosidase activity and displayed the following properties, respectively: (1) Mr values of 30,047.00 and 29,910.00, (2) pIs of 8.74 and 9.37, and (3) IC(50) values of 19.74 (0.658 nM) and 6.85 ng/mL (0.229 nM). Furthermore, they showed adenine polynucleotide glycosylase activity and nicked pBR322 dsDNA. The amino acid sequence of dioicin 2 had 266 amino acid residues, and the highest percentage identity (81.6%) and similarity (84.6%) with PAP-II from Phytolacca americana, while its identity with other RIPs from Phytolaccaceae was around 40%.

  8. Yeast ribosomal protein L32 recognizes an RNA G:U juxtaposition.

    PubMed Central

    White, S A; Li, H


    Yeast ribosomal protein L32, RPL32, specifically represses splicing by binding to a purine-rich asymmetric loop adjacent to the 5' splice site of its own transcript. A potential G:U pair closes the internal loop and the goal of the present study is to understand what features of the putative G:U pair are recognized by RPL32. Two RNA oligomers containing 10 and 13 nt were annealed to form a bimolecular stem-loop-stem protein-binding site. Protein binding to each of 16 sequence variants was examined using electrophoretic bandshift and filter-binding experiments. The proteins binds to only the duplex RNA and not to the individual oligomers, and the G:U pair is critical for full-strength binding. Mutational studies show that the duplex having a G:U has the highest protein affinity (Kd = 10 nM), followed by RNAs bearing G:A, C:C, U:A, U:C, or G:G. Duplexes containing the other possible pairs bind very weakly and Watson-Crick pairing does not favor protein binding. The G of the G:U is required for strong protein binding, but replacement by inosine reduces binding only modestly. Therefore, the minor groove guanine amino group is not a key protein recognition element. Both nucleotides of the pair influence the binding strength, but their contributions are in general not additive. These data imply that the G:U is probably paired and influences binding indirectly through its effect on the conformation of the RNA. PMID:8608446

  9. Modulation of maturation and ribosomal protein S6 phosphorylation in Xenopus oocytes by microinjection of oncogenic ras protein and protein kinase C.

    PubMed Central

    Kamata, T; Kung, H F


    Using Xenopus oocytes as a model system, we investigated the possible involvement of ras proteins in the pathway leading to phosphorylation of ribosomal protein S6. Our results indicate that microinjection of oncogenic T24 H-ras protein (which contains valine at position 12) markedly stimulated S6 phosphorylation on serine residues in oocytes, whereas normal ras protein (which contains glycine at position 12) was without effect. The S6 phosphorylation activity in the cell extract from T24 ras protein-injected oocytes was increased significantly. In addition, injection of protein kinase C potentiated the induction of maturation and S6 phosphorylation by the oncogenic ras protein. A similar potentiation was detected when T24 ras protein-injected oocytes were incubated with active phorbol ester. These findings suggest that ras proteins activate the pathway linked to S6 phosphorylation and that protein kinase C has a synergistic effect on the ras-mediated pathway. Images PMID:2406569

  10. Ubiquitous Autofragmentation of Fluorescent Proteins Creates Abundant Defective Ribosomal Products (DRiPs) for Immunosurveillance*

    PubMed Central

    Wei, Jiajie; Gibbs, James S.; Hickman, Heather D.; Cush, Stephanie S.; Bennink, Jack R.; Yewdell, Jonathan W.


    Green fluorescent protein (GFP) and other fluorescent proteins are essential tools for biological research. When fused to peptides or proteins as a reporter, GFP enables localization and quantitation of gene products in otherwise unmanipulated live cells or organisms. We previously reported that a sizable fraction of nascent GFP is post-translationally converted into a 20-kDa Triton X-100-insoluble proteasome substrate (Qian, S. B., Princiotta, M. F., Bennink, J. R., and Yewdell, J. W. (2006) J. Biol. Chem. 281, 392–400; Dolan, B. P., Li, L., Veltri, C. A., Ireland, C. M., Bennink, J. R., and Yewdell, J. W. (2011) J. Immunol. 186, 2065–2072). Here, we show that a similarly sized fragment is generated by all GFP and red fluorescent protein family members we examined. We demonstrate that fragmentation is a by-product of GFP chromophore rearrangement. A non-rearranging GFP mutant fails to fragment and generates diminished levels of Kb-SIINFEKL complexes when SIINFEKL is genetically fused to either the C- or N-terminal domains of GFP fusion proteins. Instructively, another fragmenting GFP mutant that cannot create the functional chromophore but still generates fragments also demonstrates diminished Kb-SIINFEKL generation. However, the mutant and wild-type fragments differ fundamentally in that wild-type fragments are rapidly liberated from the intact molecule and degraded quickly, accounting for increased Kb-SIINFEKL generation. In the fragmenting mutant, the fragments are generated slowly and remain associated, likely in a native conformation based on their original structural description (Barondeau, D. P., Kassmann, C. J., Tainer, J. A., and Getzoff, E. D. (2006) J. Am. Chem. Soc. 128, 4685–4693). The wild-type GFP fragments represent the first biochemically defined natural defective ribosomal products to contribute peptides for immunosurveillance, enabling quantitation of peptide generation efficiency from this source of defective ribosomal products. More

  11. Molecular Evolution Directs Protein Translation Using Unnatural Amino Acids.


    Cox, Vanessa E; Gaucher, Eric A


    Unnatural amino acids have in recent years established their importance in a wide range of fields, from pharmaceuticals to polymer science. Unnatural amino acids can increase the number of chemical groups within proteins and thus expand or enhance biological function. Our ability to utilize these important building blocks, however, has been limited by the inherent difficulty in incorporating these molecules into proteins. To address this challenge, researchers have examined how the canonical twenty amino acids are incorporated, regulated, and modified in nature. This review focuses on achievements and techniques used to engineer the ribosomal protein-translation machinery, including the introduction of orthogonal translation components, how directed evolution enhances the incorporation of unnatural amino acids, and the potential utility of ancient biomolecules for this process.

  12. Analysis of the Linker Region Joining the Adenylation and Carrier Protein Domains of the Modular Non-Ribosomal Peptide Synthetases

    PubMed Central

    Miller, Bradley R.; Sundlov, Jesse A.; Drake, Eric J.; Makin, Thomas A.; Gulick, Andrew M.


    Non-Ribosomal Peptide Synthetases (NRPSs) are multi-modular proteins capable of producing important peptide natural products. Using an assembly-line process the amino acid substrate and peptide intermediates are passed between the active sites of different catalytic domains of the NRPS while bound covalently to a peptidyl carrier protein (PCP) domain. Examination of the linker sequences that join the NRPS adenylation and PCP domains identified several conserved proline residues that are not found in standalone adenylation domains. We examined the roles of these proline residues and neighboring conserved sequences through mutagenesis and biochemical analysis of the reaction catalyzed by the adenylation domain and the fully reconstituted NRPS pathway. In particular, we identified a conserved LPxP motif at the start of the adenylation-PCP linker. The LPxP motif interacts with a region on the adenylation domain to stabilize a critical catalytic lysine residue belonging to the A10 motif that immediately precedes the linker. Further, this interaction with the C-terminal sub-domain of the adenylation domain may coordinate movement of the PCP with the conformational change of the adenylation domain. Through this work, we extend the conserved A10 motif of the adenylation domain and identify residues that enable proper adenylation domain function. PMID:24975514

  13. Folding behavior of ribosomal protein S6 studied by modified Go¯ -like model

    NASA Astrophysics Data System (ADS)

    Wu, L.; Zhang, J.; Wang, J.; Li, W. F.; Wang, W.


    Recent experimental and theoretical studies suggest that, although topology is the determinant factor in protein folding, especially for small single-domain proteins, energetic factors also play an important role in the folding process. The ribosomal protein S6 has been subjected to intensive studies. A radical change of the transition state in its circular permutants has been observed, which is believed to be caused by a biased distribution of contact energies. Since the simplistic topology-only Gō -like model is not able to reproduce such an observation, we modify the model by introducing variable contact energies between residues based on their physicochemical properties. The modified Gō -like model can successfully reproduce the Φ -value distributions, folding nucleus, and folding pathways of both the wild-type and circular permutants of S6. Furthermore, by comparing the results of the modified and the simplistic models, we find that the hydrophobic effect constructs the major force that balances the loop entropies. This may indicate that nature maintains the folding cooperativity of this protein by carefully arranging the location of hydrophobic residues in the sequence. Our study reveals a strategy or mechanism used by nature to get out of the dilemma when the native structure, possibly required by biological function, conflicts with folding cooperativity. Finally, the possible relationship between such a design of nature and amyloidosis is also discussed.

  14. Isolation, characterization, sequencing and crystal structure of charybdin, a type 1 ribosome-inactivating protein from Charybdis maritima agg.


    Touloupakis, Eleftherios; Gessmann, Renate; Kavelaki, Kalliopi; Christofakis, Emmanuil; Petratos, Kyriacos; Ghanotakis, Demetrios F


    A novel, type 1 ribosome-inactivating protein designated charybdin was isolated from bulbs of Charybdis maritima agg. The protein, consisting of a single polypeptide chain with a molecular mass of 29 kDa, inhibited translation in rabbit reticulocytes with an IC50 of 27.2 nm. Plant genomic DNA extracted from the bulb was amplified by PCR between primers based on the N-terminal and C-terminal sequence of the protein from dissolved crystals. The complete mature protein sequence was derived by partial DNA sequencing and terminal protein sequencing, and was confirmed by high-resolution crystal structure analysis. The protein contains Val at position 79 instead of the conserved Tyr residue of the ribosome-inactivating proteins known to date. To our knowledge, this is the first observation of a natural substitution of a catalytic residue at the active site of a natural ribosome-inactivating protein. This substitution in the active site may be responsible for the relatively low in vitro translation inhibitory effect compared with other ribosome-inactivating proteins. Single crystals were grown in the cold room from PEG6000 solutions. Diffraction data collected to 1.6 A resolution were used to determine the protein structure by the molecular replacement method. The fold of the protein comprises two structural domains: an alpha + beta N-terminal domain (residues 4-190) and a mainly alpha-helical C-terminal domain (residues 191-257). The active site is located in the interface between the two domains and comprises residues Val79, Tyr117, Glu167 and Arg170.

  15. Positions of proteins S14, S18 and S20 in the 30 S ribosomal subunit of Escherichia coli.


    Ramakrishnan, V; Capel, M; Kjeldgaard, M; Engelman, D M; Moore, P B


    A map of the 30 S ribosomal subunit is presented giving the positions of 15 of its 21 proteins. The components located in the map are S1, S3, S4, S5, S6, S7, S8, S9, S10, S11, S12, S14, S15, S18 and S20.

  16. Characterization of hybrid plasmids carrying individual ribosomal ribonucleic acid transcription units of Escherichia coli.

    PubMed Central

    Kenerley, M E; Morgan, E A; Post, L; Lindahl, L; Nomura, M


    We have screened the strains with ColE1 hybrid plasmids constructed by Clarke and Carbon (Cell 9:91-99, 1976) for the presence of ribosomal ribonucleic acid (rRNA) genes on the plasmids and identified 16 strains whose plasmids carry rRNA genes. The structures of these 16 plasmids were compared by heteroduplex analysis, and the plasmids were classified into six groups on the basis of their chromosomal origins. Homology with known transducing-phage deoxyribonucleic acids and genetic mapping have assigned locations on the Escherichia coli chromosome to three of the six groups. These are rrnB near rif at 88 min, rrnC near ilvE at 83 min, and rrnD near aroE at 71 min. A fourth group is probably rrnA at 85 min (T. Ikemura and M. Nomura, Cell, 11:779-793, 1977). We conclude that the minimum number of rRNA transcription units per haploid chromosomes is seven, that is, the six groups identified in this work plus a known operon (rrnE near metA at 89 min) that we failed to find among the hybrid plasmids. This heteroduplex analysis also suggests that there are only two kinds of rRNA operons with respect to their spacer region; three of the six rRNA operon groups studied here have one kind, whereas the remaining three have the other kind. Images PMID:336613

  17. DNA sequence analysis of a 10 624 bp fragment of the left arm of chromosome XV from Saccharomyces cerevisiae reveals a RNA binding protein, a mitochondrial protein, two ribosomal proteins and two new open reading frames.


    Lafuente, M J; Gamo, F J; Gancedo, C


    We have determined the sequence of a 10624 bp DNA segment located in the left arm of chromosome XV of Saccharomyces cerevisiae. The sequence contains eight open reading frames (ORFs) longer than 100 amino acids. Two of them do not present significant homology with sequences found in the databases. The product of ORF o0553 is identical to the protein encoded by the gene SMF1. Internal to it there is another ORF, o0555 that is apparently expressed. The proteins encoded by ORFs o0559 and o0565 are identical to ribosomal proteins S19.e and L18 respectively. ORF o0550 encodes a protein with an RNA binding signature including RNP motifs and stretches rich in asparagine, glutamine and arginine.

  18. MrpL36p, a highly diverged L31 ribosomal protein homolog with additional functional domains in Saccharomyces cerevisiae mitochondria.

    PubMed Central

    Williams, Elizabeth H; Perez-Martinez, Xochitl; Fox, Thomas D


    Translation in mitochondria utilizes a large complement of ribosomal proteins. Many mitochondrial ribosomal components are clearly homologous to eubacterial ribosomal proteins, but others appear unique to the mitochondrial system. A handful of mitochondrial ribosomal proteins appear to be eubacterial in origin but to have evolved additional functional domains. MrpL36p is an essential mitochondrial ribosomal large-subunit component in Saccharomyces cerevisiae. Increased dosage of MRPL36 also has been shown to suppress certain types of translation defects encoded within the mitochondrial COX2 mRNA. A central domain of MrpL36p that is similar to eubacterial ribosomal large-subunit protein L31 is sufficient for general mitochondrial translation but not suppression, and proteins bearing this domain sediment with the ribosomal large subunit in sucrose gradients. In contrast, proteins lacking the L31 domain, but retaining a novel N-terminal sequence and a C-terminal sequence with weak similarity to the Escherichia coli signal recognition particle component Ffh, are sufficient for dosage suppression and do not sediment with the large subunit of the ribosome. Interestingly, the activity of MrpL36p as a dosage suppressor exhibits gene and allele specificity. We propose that MrpL36p represents a highly diverged L31 homolog with derived domains functioning in mRNA selection in yeast mitochondria. PMID:15166137

  19. A new age for biomedical applications of Ribosome Inactivating Proteins (RIPs): from bioconjugate to nanoconstructs.


    Pizzo, Elio; Di Maro, Antimo


    Ribosome-inactivating proteins (RIPs) are enzymes ( that possess N-glycosilase activity that irreversibly inhibits protein synthesis. RIPs have been found in plants, fungi, algae, and bacteria; their biological role is still under investigation, even if it has been recognized their role in plant defence against predators and viruses. Nevertheless, several studies on these toxins have been performed to evaluate their applicability in the biomedical field making RIPs selectively toxic towards target cells. Indeed, these molecules are extensively used to produce chimeric biomolecules, such as immunotoxins or protein/peptides conjugates. However, to date, clinical use of most of these bioconiujates has been limited by toxicity and immunogenicity. More recently, material sciences have provided a wide range of nanomaterials to be used as excellent vehicles for toxin-delivery, since they are characterized by improved stability, solubility, and in vivo pharmacokinetics. This review discusses progresses in the development of RIPs bioconjugates, with particular attention to the recent use of nanomaterials, whose appropriate design opens up a broad range of different possibilities to the use of RIPs in novel therapeutic approaches in human diseases.

  20. A new age for biomedical applications of Ribosome Inactivating Proteins (RIPs): from bioconjugate to nanoconstructs.


    Pizzo, Elio; Di Maro, Antimo


    Ribosome-inactivating proteins (RIPs) are enzymes ( that possess N-glycosilase activity that irreversibly inhibits protein synthesis. RIPs have been found in plants, fungi, algae, and bacteria; their biological role is still under investigation, even if it has been recognized their role in plant defence against predators and viruses. Nevertheless, several studies on these toxins have been performed to evaluate their applicability in the biomedical field making RIPs selectively toxic towards target cells. Indeed, these molecules are extensively used to produce chimeric biomolecules, such as immunotoxins or protein/peptides conjugates. However, to date, clinical use of most of these bioconiujates has been limited by toxicity and immunogenicity. More recently, material sciences have provided a wide range of nanomaterials to be used as excellent vehicles for toxin-delivery, since they are characterized by improved stability, solubility, and in vivo pharmacokinetics. This review discusses progresses in the development of RIPs bioconjugates, with particular attention to the recent use of nanomaterials, whose appropriate design opens up a broad range of different possibilities to the use of RIPs in novel therapeutic approaches in human diseases. PMID:27439918

  1. Evolutionarily conserved autoregulation of alternative pre-mRNA splicing by ribosomal protein L10a

    PubMed Central

    Takei, Satomi; Togo-Ohno, Marina; Suzuki, Yutaka; Kuroyanagi, Hidehito


    Alternative splicing of pre-mRNAs can regulate expression of protein-coding genes by generating unproductive mRNAs rapidly degraded by nonsense-mediated mRNA decay (NMD). Many of the genes directly regulated by alternative splicing coupled with NMD (AS-NMD) are related to RNA metabolism, but the repertoire of genes regulated by AS-NMD in vivo is to be determined. Here, we analyzed transcriptome data of wild-type and NMD-defective mutant strains of the nematode worm Caenorhabditis elegans and demonstrate that eight of the 82 cytoplasmic ribosomal protein (rp) genes generate unproductively spliced mRNAs. Knockdown of any of the eight rp genes exerted a dynamic and compensatory effect on alternative splicing of its own transcript and inverse effects on that of the other rp genes. A large subunit protein L10a, termed RPL-1 in nematodes, directly and specifically binds to an evolutionarily conserved 39-nt stretch termed L10ARE between the two alternative 5′ splice sites in its own pre-mRNA to switch the splice site choice. Furthermore, L10ARE-mediated splicing autoregulation of the L10a-coding gene is conserved in vertebrates. These results indicate that L10a is an evolutionarily conserved splicing regulator and that homeostasis of a subset of the rp genes are regulated at the level of pre-mRNA splicing in vivo. PMID:26961311

  2. Mice with a Mutation in the Mdm2 Gene That Interferes with MDM2/Ribosomal Protein Binding Develop a Defect in Erythropoiesis

    PubMed Central

    Kamio, Takuya; Gu, Bai-wei; Olson, Timothy S.; Zhang, Yanping; Mason, Philip J.; Bessler, Monica


    MDM2, an E3 ubiquitin ligase, is an important negative regulator of tumor suppressor p53. In turn the Mdm2 gene is a transcriptional target of p53, forming a negative feedback loop that is important in cell cycle control. It has recently become apparent that the ubiquitination of p53 by MDM2 can be inhibited when certain ribosomal proteins, including RPL5 and RPL11, bind to MDM2. This inhibition, and the resulting increase in p53 levels has been proposed to be responsible for the red cell aplasia seen in Diamond-Blackfan anemia (DBA) and in 5q- myelodysplastic syndrome (MDS). DBA and 5q- MDS are associated with inherited (DBA) or acquired (5q- MDS) haploinsufficiency of ribosomal proteins. A mutation in Mdm2 causing a C305F amino acid substitution blocks the binding of ribosomal proteins. Mice harboring this mutation (Mdm2C305F), retain a normal p53 response to DNA damage, but lack the p53 response to perturbations in ribosome biogenesis. While studying the interaction between RP haploinsufficiency and the Mdm2C305F mutation we noticed that Mdm2C305F homozygous mice had altered hematopoiesis. These mice developed a mild macrocytic anemia with reticulocytosis. In the bone marrow (BM), these mice showed a significant decrease in Ter119hi cells compared to wild type (WT) littermates, while no decrease in the number of mature erythroid cells (Ter119hiCD71low) was found in the spleen, which showed compensated bone marrow hematopoiesis. In methylcellulose cultures, BFU-E colonies from the mutant mice were slightly reduced in number and there was a significant reduction in CFU-E colony numbers in mutant mice compared with WT controls (p < 0.01). This erythropoietic defect was abrogated by concomitant p53 deficiency (Trp53ko/ko). Further investigation revealed that in Mdm2C305F animals, there was a decrease in Lin-Sca-1+c-Kit+ (LSK) cells, accompanied by significant decreases in multipotent progenitor (MPP) cells (p < 0.01). Competitive BM repopulation experiments showed

  3. Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

    PubMed Central

    Carol, P; Rozier, C; Lazaro, E; Ballesta, J P; Mache, R


    The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain. Images PMID:8441674

  4. Mutations in the Bacterial Ribosomal Protein L3 and Their Association with Antibiotic Resistance

    PubMed Central

    Klitgaard, Rasmus N.; Ntokou, Eleni; Nørgaard, Katrine; Biltoft, Daniel; Hansen, Lykke H.; Trædholm, Nicolai M.; Kongsted, Jacob


    Different groups of antibiotics bind to the peptidyl transferase center (PTC) in the large subunit of the bacterial ribosome. Resistance to these groups of antibiotics has often been linked with mutations or methylations of the 23S rRNA. In recent years, there has been a rise in the number of studies where mutations have been found in the ribosomal protein L3 in bacterial strains resistant to PTC-targeting antibiotics but there is often no evidence that these mutations actually confer antibiotic resistance. In this study, a plasmid exchange system was used to replace plasmid-carried wild-type genes with mutated L3 genes in a chromosomal L3 deletion strain. In this way, the essential L3 gene is available for the bacteria while allowing replacement of the wild type with mutated L3 genes. This enables investigation of the effect of single mutations in Escherichia coli without a wild-type L3 background. Ten plasmid-carried mutated L3 genes were constructed, and their effect on growth and antibiotic susceptibility was investigated. Additionally, computational modeling of the impact of L3 mutations in E. coli was used to assess changes in 50S structure and antibiotic binding. All mutations are placed in the loops of L3 near the PTC. Growth data show that 9 of the 10 mutations were well accepted in E. coli, although some of them came with a fitness cost. Only one of the mutants exhibited reduced susceptibility to linezolid, while five exhibited reduced susceptibility to tiamulin. PMID:25845869

  5. cDNA cloning, overexpression, purification and pharmacologic evaluation for anticancer activity of ribosomal protein L23A gene (RPL23A) from the Giant Panda.


    Sun, Bing; Hou, Yi-Ling; Hou, Wan-Ru; Zhang, Si-Nan; Ding, Xiang; Su, Xiu-Lan


    RPL23A gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L23P family of ribosomal proteins, which is located in the cytoplasm. The purpose of this paper was to explore the structure and anti-cancer function of ribosomal protein L23A (RPL23A) gene of the Giant Panda (Ailuropoda melanoleuca). The cDNA of RPL23A was cloned successfully from the Giant Panda using RT-PCR technology. We constructed a recombinant expression vector containing RPL23A cDNA and over-expressed it in Escherichia coli using pET28a plasmids. The expression product obtained was purified by using Ni chelating affinity chromatography. Recombinant protein of RPL23A obtained from the experiment acted on Hep-2 cells and human HepG-2 cells, then the growth inhibitory effect of these cells was observed by MTT (3-[4,5-dimethyl-2-thiazolyl]-2,5-diphenyl-2H-tetrazolium bromide) assay. The result indicated that the length of the fragment cloned is 506 bp, and it contains an open-reading frame (ORF) of 471 bp encoding 156 amino acids. Primary structure analysis revealed that the molecular weight of the putative RPL23A protein is 17.719 kDa with a theoretical pI 11.16. The molecular weight of the recombinant protein RPL23A is 21.265 kDa with a theoretical pI 10.57. The RPL23A gene can be really expressed in E. coli and the RPL23A protein, fusioned with the N-terminally His-tagged protein, gave rise to the accumulation of an expected 22 KDa polypeptide. The data showed that the recombinant protein RPL23A had a time- and dose-dependency on the cell growth inhibition rate. The data also indicated that the effect at low concentrations was better than at high concentrations on Hep-2 cells, and that the concentration of 0.185 μg/mL had the best rate of growth inhibition of 36.31%. All results of the experiment revealed that the recombinant protein RPL23A exhibited anti-cancer function on the Hep-2 cells. The study provides a scientific basis and aids orientation for

  6. Eaf1p Is Required for Recruitment of NuA4 in Targeting TFIID to the Promoters of the Ribosomal Protein Genes for Transcriptional Initiation In Vivo

    PubMed Central

    Uprety, Bhawana; Sen, Rwik


    NuA4 (nucleosome acetyltransferase of H4) promotes transcriptional initiation of TFIID (a complex of TBP and TBP-associated factors [TAFs])-dependent ribosomal protein genes involved in ribosome biogenesis. However, it is not clearly understood how NuA4 regulates the transcription of ribosomal protein genes. Here, we show that NuA4 is recruited to the promoters of ribosomal protein genes, such as RPS5, RPL2B, and RPS11B, for TFIID recruitment to initiate transcription, and the recruitment of NuA4 to these promoters is impaired in the absence of its Eaf1p component. Intriguingly, impaired NuA4 recruitment in a Δeaf1 strain depletes recruitment of TFIID (a TAF-dependent form of TBP) but not the TAF-independent form of TBP to the promoters of ribosomal protein genes. However, in the absence of NuA4, SAGA (Spt-Ada-Gcn5-acetyltransferase) is involved in targeting the TAF-independent form of TBP to the promoters of ribosomal protein genes for transcriptional initiation. Thus, NuA4 plays an important role in targeting TFIID to the promoters of ribosomal protein genes for transcriptional initiation in vivo. Such a function is mediated via its targeted histone acetyltransferase activity. In the absence of NuA4, ribosomal protein genes lose TFIID dependency and become SAGA dependent for transcriptional initiation. Collectively, these results provide significant insights into the regulation of ribosomal protein gene expression and, hence, ribosome biogenesis and functions. PMID:26100014

  7. Protein folding: understanding the role of water and the low Reynolds number environment as the peptide chain emerges from the ribosome and folds.


    Sen, Siddhartha; Voorheis, H Paul


    The mechanism of protein folding during early stages of the process has three determinants. First, moving water molecules obey the rules of low Reynolds number physics without an inertial component. Molecular movement is instantaneous and size insensitive. Proteins emerging from the ribosome move and rotate without an external force if they change shape, forming and propagating helical structures that increases translocational efficiency. Forward motion ceases when the shape change or propelling force ceases. Second, application of quantum field theory to water structure predicts the spontaneous formation of low density coherent units of fixed size that expel dissolved atmospheric gases. Structured water layers with both coherent and non-coherent domains, form a sheath around the new protein. The surface of exposed hydrophobic amino acids is protected from water contact by small nanobubbles of dissolved atmospheric gases, 5 or 6 molecules on average, that vibrate, attracting even widely separated resonating nanobubbles. This force results from quantum effects, appearing only when the system is within and interacts with an oscillating electromagnetic field. The newly recognized quantum force sharply bends the peptide and is part of a dynamic field determining the pathway of protein folding. Third, the force initiating the tertiary folding of proteins arises from twists at the position of each hydrophobic amino acid, that minimizes surface exposure of the hydrophobic amino acids and propagates along the protein. When the total bend reaches 360°, the leading segment of water sheath intersects the trailing segment. This steric self-intersection expels water from overlapping segments of the sheath and by Newton׳s second law moves the polypeptide chain in an opposite direction. Consequently, with very few exceptions that we enumerate and discuss, tertiary structures are absent from proteins without hydrophobic amino acids, which control the early stages of protein

  8. Selection of IgE-binding aptameric green fluorescent protein (Ap-GFP) by the ribosome display (RD) platform

    SciTech Connect

    Chen, S.-S. Yang Yongmin; Barankiewicz, Teresa J.


    GFP-C{kappa} fusion protein was previously shown selectable on ribosome display platform with solid phase antibodies against GFP determinant [Y.-M. Yang, T.J. Barankiewicz, M. He, M. Taussig, S.-S. Chen, Selection of antigenic markers on a GFP-C{kappa} fusion scaffold with high sensitivity by eukaryotic ribosome display, Biochem. Biophys. Res. Commun. 359 (2007) 251-257]. Herein, we show that members of aptameric peptide library constructed within the site 6 and site 8/9 loops of GFP of the ribosome display construct are selectable upon binding to the solid phase IgE antigen. An input of 1.0 {mu}g of the dual site aptameric GFP library exhibiting a diversity of 7.5 x 10{sup 11} was transcribed, translated and incubated with solid phase IgE. RT-PCR products were amplified from mRNA of the aptamer-ribosome-mRNA (ARM) complex captured on the solid phase IgE. Clones of aptameric GFP were prepared from RT-PCR product of ARM complex following repetitive selection. Recombinant aptameric GFP proteins from the selected clones bind IgE coated on the 96-well plate, and the binding was abrogated by incubation with soluble human IgE but not human IgG. Selected aptameric GFP proteins also exhibit binding to three different sources of human IgE (IgE PS, BED, and JW8) but not irrelevant proteins. These observations indicate that appropriately selected aptameric GFP on a solid phase ligand by ribosome display may serve as an affinity reagent for blocking reactivity of a biological ligand.

  9. Identifying Neisseria species by use of the 50S ribosomal protein L6 (rplF) gene.


    Bennett, Julia S; Watkins, Eleanor R; Jolley, Keith A; Harrison, Odile B; Maiden, Martin C J


    The comparison of 16S rRNA gene sequences is widely used to differentiate bacteria; however, this gene can lack resolution among closely related but distinct members of the same genus. This is a problem in clinical situations in those genera, such as Neisseria, where some species are associated with disease while others are not. Here, we identified and validated an alternative genetic target common to all Neisseria species which can be readily sequenced to provide an assay that rapidly and accurately discriminates among members of the genus. Ribosomal multilocus sequence typing (rMLST) using ribosomal protein genes has been shown to unambiguously identify these bacteria. The PubMLST Neisseria database ( was queried to extract the 53 ribosomal protein gene sequences from 44 genomes from diverse species. Phylogenies reconstructed from these genes were examined, and a single 413-bp fragment of the 50S ribosomal protein L6 (rplF) gene was identified which produced a phylogeny that was congruent with the phylogeny reconstructed from concatenated ribosomal protein genes. Primers that enabled the amplification and direct sequencing of the rplF gene fragment were designed to validate the assay in vitro and in silico. Allele sequences were defined for the gene fragment, associated with particular species names, and stored on the PubMLST Neisseria database, providing a curated electronic resource. This approach provides an alternative to 16S rRNA gene sequencing, which can be readily replicated for other organisms for which more resolution is required, and it has potential applications in high-resolution metagenomic studies.

  10. Structure of the JmjC domain-containing protein NO66 complexed with ribosomal protein Rpl8

    SciTech Connect

    Wang, Chengliang; Zhang, Qiongdi; Hang, Tianrong; Tao, Yue; Ma, Xukai; Wu, Minhao; Zhang, Xuan Zang, Jianye


    The structure of the complex of NO66 and Rpl8 was solved in the native state and NO66 recognizes the consensus motif NHXH . Tetramerization is required for efficient substrate binding and catalysis by NO66. The JmjC domain-containing proteins belong to a large family of oxygenases possessing distinct substrate specificities which are involved in the regulation of different biological processes, such as gene transcription, RNA processing and translation. Nucleolar protein 66 (NO66) is a JmjC domain-containing protein which has been reported to be a histone demethylase and a ribosome protein 8 (Rpl8) hydroxylase. The present biochemical study confirmed the hydroxylase activity of NO66 and showed that oligomerization is required for NO66 to efficiently catalyze the hydroxylation of Rpl8. The structures of NO66{sup 176–C} complexed with Rpl8{sup 204–224} in a tetrameric form and of the mutant protein M2 in a dimeric form were solved. Based on the results of structural and biochemical analyses, the consensus sequence motif NHXH recognized by NO66 was confirmed. Several potential substrates of NO66 were found by a BLAST search according to the consensus sequence motif. When binding to substrate, the relative positions of each subunit in the NO66 tetramer shift. Oligomerization may facilitate the motion of each subunit in the NO66 tetramer and affect the catalytic activity.

  11. The Drosophila stubarista phenotype is associated with a dosage effect of the putative ribosome-associated protein D-p40 on spineless.


    Melnick, M B; Noll, E; Perrimon, N


    We describe the molecular characterization of the Drosophila melanogaster gene stubarista (sta) that encodes the highly conserved putative ribosome-associated protein D-p40. sta maps to cytological position 2A3-B2 on the X chromosome and encodes a protein (D-p40) of 270 amino acids. D-p40 shares 63% identity with the human p40 ribosomal protein. P element-mediated transformation of a 4.4-kb genomic fragment encompassing the 1-kb transcript corresponding to D-p40 was used to rescue both a lethal (sta2) and a viable (sta1) mutation at the stubarista (sta) locus. Developmental analysis of the sta2 mutation implicates a requirement for D-p40 during oogenesis and imaginal development, which is consistent with the expression of sta throughout development. In addition, we have analyzed the basis of the sta1 visible phenotype which consists of shortened antennae and bristles. sta1 is a translocation of the 1E1-2 to 2B3-4 region of the X chromosome onto the third chromosome at 89B21-C4. We provide genetic evidence that Dp(1;3)sta1 is mutant at the spineless (ss) locus and that it is associated with partial D-p40 activity. We demonstrate that sta1 acts as a recessive enhancer of ss; reduction in the amount of D-p40 provided by the transposed X chromosomal region of sta1 reveals a haplo-insufficient phenotype of the otherwise recessive ss mutations. This phenomenon is reminiscent of the enhancing effect observed with Minute mutations, one of which, rp49, has previously been shown to encode a ribosomal protein.

  12. Expression, purification, and evaluation for anticancer activity of ribosomal protein L31 gene (RPL31) from the giant panda (Ailuropoda melanoleuca).


    Su, Xiu-Lan; Hou, Yi-Ling; Yan, Xiang-Hui; Ding, Xiang; Hou, Wan-Ru; Sun, Bing; Zhang, Si-Nan


    Ribosomal protein L31 gene is a component of the 60S large ribosomal subunit encoded by RPL31 gene, while ribosomal protein L31 (RPL31) is an important constituent of peptidyltransferase center. In our research, the cDNA and the genomic sequence of RPL31 were cloned successfully from the giant panda (Ailuropoda melanoleuca) using RT-PCR technology respectively, following sequencing and analyzing preliminarily. We constructed a recombinant expression vector contained RPL31 cDNA and over-expressed it in Escherichia coli using pET28a plasmids. The expression product was purified to obtain recombinant protein of RPL31 from the giant panda. Recombinant protein of RPL31 obtained from the experiment acted on human laryngeal carcinoma Hep-2 and human hepatoma HepG-2 cells for study of its anti-cancer activity by MTT [3-(4, 5-dimehyl-2-thiazolyl)-2, 5-diphenyl-2H-tetrazolium bromide] method. Then observe these cells growth depressive effect. The result indicated that the cDNA fragment of the RPL31 cloned from the giant panda is 419 bp in size, containing an open reading frame of 378 bp, and deduced protein was composed of 125 amino acids with an estimated molecular weight of 14.46-kDa and PI of 11.21. The length of the genomic sequence is 8,091 bp, which was found to possess four exons and three introns. The RPL31 gene can be readily expressed in E.coli, expecting 18-kDa polypeptide that formed inclusion bodies. Recombinant protein RPL31 from the giant panda consists of 157 amino acids with an estimated molecular weight of 17.86 kDa and PI of 10.77. The outcomes showed that the cell growth inhibition rate in a time- and dose-dependent on recombinant protein RPL31. And also indicated that the effect at low concentrations was better than high concentrations on Hep-2 cells, and the concentration of 0.33 μg/mL had the best rate of growth inhibition, 44 %. Consequently, our study aimed at revealing the recombinant protein RPL31 anti-cancer function from the giant panda

  13. Extremophilic 50S Ribosomal RNA-Binding Protein L35Ae as a Basis for Engineering of an Alternative Protein Scaffold.


    Lomonosova, Anna V; Ovchinnikova, Elena V; Kazakov, Alexei S; Denesyuk, Alexander I; Sofin, Alexander D; Mikhailov, Roman V; Ulitin, Andrei B; Mirzabekov, Tajib A; Permyakov, Eugene A; Permyakov, Sergei E


    Due to their remarkably high structural stability, proteins from extremophiles are particularly useful in numerous biological applications. Their utility as alternative protein scaffolds could be especially valuable in small antibody mimetic engineering. These artificial binding proteins occupy a specific niche between antibodies and low molecular weight substances, paving the way for development of innovative approaches in therapeutics, diagnostics, and reagent use. Here, the 50S ribosomal RNA-binding protein L35Ae from the extremophilic archaea Pyrococcus horikoshii has been probed for its potential to serve as a backbone in alternative scaffold engineering. The recombinant wild type L35Ae has a native-like secondary structure, extreme thermal stability (mid-transition temperature of 90°C) and a moderate resistance to the denaturation by guanidine hydrochloride (half-transition at 2.6 M). Chemical crosslinking and dynamic light scattering data revealed that the wild type L35Ae protein has a propensity for multimerization and aggregation correlating with its non-specific binding to a model cell surface of HEK293 cells, as evidenced by flow cytometry. To suppress these negative features, a 10-amino acid mutant (called L35Ae 10X) was designed, which lacks the interaction with HEK293 cells, is less susceptible to aggregation, and maintains native-like secondary structure and thermal stability. However, L35Ae 10X also shows lowered resistance to guanidine hydrochloride (half-transition at 2.0M) and is more prone to oligomerization. This investigation of an extremophile protein's scaffolding potential demonstrates that lowered resistance to charged chemical denaturants and increased propensity to multimerization may limit the utility of extremophile proteins as alternative scaffolds. PMID:26247602

  14. Transition state analogues in structures of ricin and saporin ribosome-inactivating proteins

    SciTech Connect

    Ho, Meng-Chiao; Sturm, Matthew B.; Almo, Steven C.; Schramm, Vern L.


    Ricin A-chain (RTA) and saporin-L1 (SAP) catalyze adenosine depurination of 28S rRNA to inhibit protein synthesis and cause cell death. We present the crystal structures of RTA and SAP in complex with transition state analogue inhibitors. These tight-binding inhibitors mimic the sarcin-ricin recognition loop of 28S rRNA and the dissociative ribocation transition state established for RTA catalysis. RTA and SAP share unique purine-binding geometry with quadruple {pi}-stacking interactions between adjacent adenine and guanine bases and 2 conserved tyrosines. An arginine at one end of the {pi}-stack provides cationic polarization and enhanced leaving group ability to the susceptible adenine. Common features of these ribosome-inactivating proteins include adenine leaving group activation, a remarkable lack of ribocation stabilization, and conserved glutamates as general bases for activation of the H{sub 2}O nucleophile. Catalytic forces originate primarily from leaving group activation evident in both RTA and SAP in complex with transition state analogues.

  15. Dim2p, a KH-domain protein required for small ribosomal subunit synthesis

    PubMed Central



    Recent proteomic analyses are revealing the dynamics of preribosome assembly. Following cleavage at processing site A2, which generates the 20S pre-rRNA (the immediate precursor to the 18S rRNA), early RRPs (ribosomal RNA processing factors) are released in bulk from the preribosomes, and the resulting pre-40S subunits are left associated with a limited set of proteins that we refer to as the SSU RRP complex. Dim2p, a core constituent of the SSU RRP complex and conserved KH-domain containing protein, is required for pre-rRNA processing and is associated with early nucleolar and late cytoplasmic pre-rRNA species. Consistently, Dim2p shuttles between the nucle(ol)us and the cytoplasm, a trafficking that is tightly regulated by growth. The association of Dim2p with the 18S rRNA dimethyltransferase Dim1p, as well as its requirement for pre-rRNA processing at cleavage sites A1 and A2 and for 18S rRNA dimethylation, suggest that Dim2p may recruit Dim1p to nucleolar pre-rRNAs through its KH domain. PMID:15037774

  16. Translating the genome in time and space: specialized ribosomes, RNA regulons, and RNA-binding proteins.


    Shi, Zhen; Barna, Maria


    A central question in cell and developmental biology is how the information encoded in the genome is differentially interpreted to generate a diverse array of cell types. A growing body of research on posttranscriptional gene regulation is revealing that both global protein synthesis rates and the translation of specific mRNAs are highly specialized in different cell types. How this exquisite translational regulation is achieved is the focus of this review. Two levels of regulation are discussed: the translation machinery and cis-acting elements within mRNAs. Recent evidence shows that the ribosome itself directs how the genome is translated in time and space and reveals surprising functional specificity in individual components of the core translation machinery. We are also just beginning to appreciate the rich regulatory information embedded in the untranslated regions of mRNAs, which direct the selective translation of transcripts. These hidden RNA regulons may interface with a myriad of RNA-binding proteins and specialized translation machinery to provide an additional layer of regulation to how transcripts are spatiotemporally expressed. Understanding this largely unexplored world of translational codes hardwired in the core translation machinery is an exciting new research frontier fundamental to our understanding of gene regulation, organismal development, and evolution.

  17. The Ribosome: The Cell's Protein-Synthesizing Machine and How Antibiotics Disrupt It

    SciTech Connect

    Venki Ramakrishnan


    Determining the structure of the ribosome has made it possible for Ramakrishnan and his colleagues to image antibiotics bound to the ribosome, leading to a better understanding of their action, which could help in the development of novel drugs. In his ta

  18. The Ribosome: The Cell's Protein-Synthesizing Machine and How Antibiotics Disrupt It


    Venki Ramakrishnan


    Determining the structure of the ribosome has made it possible for Ramakrishnan and his colleagues to image antibiotics bound to the ribosome, leading to a better understanding of their action, which could help in the development of novel drugs. In his ta

  19. Evolutionary relationships of a plant-pathogenic mycoplasmalike organism and Acholeplasma laidlawii deduced from two ribosomal protein gene sequences.

    PubMed Central

    Lim, P O; Sears, B B


    The families within the class Mollicutes are distinguished by their morphologies, nutritional requirements, and abilities to metabolize certain compounds. Biosystematic classification of the plant-pathogenic mycoplasmalike organisms (MLOs) has been difficult because these organisms have not been cultured in vitro, and hence their nutritional requirements have not been determined nor have physiological characterizations been possible. To investigate the evolutionary relationship of the MLOs to other members of the class Mollicutes, a segment of a ribosomal protein operon was cloned and sequenced from an aster yellows-type MLO which is pathogenic for members of the genus Oenothera and from Acholeplasma laidlawii. The deduced amino acid sequence data from the rpl22 and rps3 genes indicate that the MLOs are more closely related to A. laidlawii than to animal mycoplasmas, confirming previous results from 16S rRNA sequence comparisons. This conclusion is also supported by the finding that the UGA codon is not read as a tryptophan codon in the MLO and A. laidlawii, in contrast to its usage in Mycoplasma capricolum. PMID:1556079

  20. Ribosomal protein genes of holometabolan insects reject the Halteria, instead revealing a close affinity of Strepsiptera with Coleoptera.


    Longhorn, Stuart J; Pohl, Hans W; Vogler, Alfried P


    The phylogenetic relationships among holometabolan insect orders remain poorly known, despite a wealth of previous studies. In particular, past attempts to clarify the sister-group of the enigmatic order Strepsiptera with rRNA genes have led to intense debate about long-branch attraction (the 'Strepsiptera problem'), without resolving the taxonomic question at hand. Here, we appealed to alternative nuclear sequences of 27 ribosomal proteins (RPs) to generate a data matrix of 10,731 nucleotides for 22 holometabolan taxa, including two strepsipteran species. Phylogenetic relationships among holometabolan insects were analyzed under several nucleotide-coding schemes to explore differences in signal and systematic biases. Saturation and compositional bias particularly affected third positions, which greatly differed in AT content (18-72%). Such confounding factors were best reduced by R-Y coding and removal of third codon positions, resulting in more strongly supported topologies, whereas amino acid coding gave poor resolution. The placement of Strepsiptera with Coleoptera (the Coleopterida) was recovered under most coding schemes and analytical methods, if often with modest support and ambiguity. In contrast, an alternative sister-group with Diptera (the Halteria) was only found in one analysis using parsimony, and weakly supported. The topologies here generally support a Coleoptera+Strepsiptera as sister-group to Mecopterida (Siphonaptera+Mecoptera+Diptera+Lepidoptera+Trichoptera), while Hymenoptera were always recovered as sister-group to the remaining Holometabola. PMID:20348001

  1. The Dedicated Chaperone Acl4 Escorts Ribosomal Protein Rpl4 to Its Nuclear Pre-60S Assembly Site

    PubMed Central

    Pillet, Benjamin; García-Gómez, Juan J.; Pausch, Patrick; Falquet, Laurent; Bange, Gert; de la Cruz, Jesús; Kressler, Dieter


    Ribosomes are the highly complex macromolecular assemblies dedicated to the synthesis of all cellular proteins from mRNA templates. The main principles underlying the making of ribosomes are conserved across eukaryotic organisms and this process has been studied in most detail in the yeast Saccharomyces cerevisiae. Yeast ribosomes are composed of four ribosomal RNAs (rRNAs) and 79 ribosomal proteins (r-proteins). Most r-proteins need to be transported from the cytoplasm to the nucleus where they get incorporated into the evolving pre-ribosomal particles. Due to the high abundance and difficult physicochemical properties of r-proteins, their correct folding and fail-safe targeting to the assembly site depends largely on general, as well as highly specialized, chaperone and transport systems. Many r-proteins contain universally conserved or eukaryote-specific internal loops and/or terminal extensions, which were shown to mediate their nuclear targeting and association with dedicated chaperones in a growing number of cases. The 60S r-protein Rpl4 is particularly interesting since it harbours a conserved long internal loop and a prominent C-terminal eukaryote-specific extension. Here we show that both the long internal loop and the C-terminal eukaryote-specific extension are strictly required for the functionality of Rpl4. While Rpl4 contains at least five distinct nuclear localization signals (NLS), the C-terminal part of the long internal loop associates with a specific binding partner, termed Acl4. Absence of Acl4 confers a severe slow-growth phenotype and a deficiency in the production of 60S subunits. Genetic and biochemical evidence indicates that Acl4 can be considered as a dedicated chaperone of Rpl4. Notably, Acl4 localizes to both the cytoplasm and nucleus and it has the capacity to capture nascent Rpl4 in a co-translational manner. Taken together, our findings indicate that the dedicated chaperone Acl4 accompanies Rpl4 from the cytoplasm to its pre-60S

  2. Thermodynamics and kinetics of protein folding on the ribosome: Alteration in energy landscapes, denatured state, and transition state ensembles

    NASA Astrophysics Data System (ADS)

    O'Brien, Edward; Vendruscolo, Michele; Dobson, Christopher


    In vitro experiments examining cotranslational folding utilize ribosome-nascent chain complexes (RNCs) in which the nascent chain is stalled at different points of its biosynthesis on the ribosome. We investigate the thermodynamics, kinetics, and structural properties of RNCs containing five different globular and repeat proteins stalled at ten different nascent chain lengths using coarse grained replica exchange simulations. We find that when the proteins are stalled near the ribosome exit tunnel opening they exhibit altered folding coopserativity, quantified by the van't Hoff enthalpy criterion; a significantly altered denatured state ensemble, in terms of Rg and shape parameters (Rg tensor); and the appearance of partially folded intermediates during cotranslation, evidenced by the appearance of a third basin in the free energy profile. These trends are due in part to excluded volume (crowding) interactions between the ribosome and nascent chain. We perform in silico temperature-jump experiments on the RNCs and examine nascent chain folding kinetics and structural changes in the transition state ensemble at various stall lengths.

  3. Structure and Dynamics of Ribosomal Protein L12: An Ensemble Model Based on SAXS and NMR Relaxation

    PubMed Central

    Bernadó, Pau; Modig, Kristofer; Grela, Przemysław; Svergun, Dmitri I.; Tchorzewski, Marek; Pons, Miquel; Akke, Mikael


    Abstract Ribosomal protein L12 is a two-domain protein that forms dimers mediated by its N-terminal domains. A 20-residue linker separates the N- and C-terminal domains. This linker results in a three-lobe topology with significant flexibility, known to be critical for efficient translation. Here we present an ensemble model of spatial distributions and correlation times for the domain reorientations of L12 that reconciles experimental data from small-angle x-ray scattering and nuclear magnetic resonance. We generated an ensemble of L12 conformations in which the structure of each domain is fixed but the domain orientations are variable. The ensemble reproduces the small-angle x-ray scattering data and the optimized correlation times of its reorientational eigenmodes fit the 15N relaxation data. The ensemble model reveals intrinsic conformational properties of L12 that help explain its function on the ribosome. The two C-terminal domains sample a large volume and extend further away from the ribosome anchor than expected for a random-chain linker, indicating that the flexible linker has residual order. Furthermore, the distances between each C-terminal domain and the anchor are anticorrelated, indicating that one of them is more retracted on average. We speculate that these properties promote the function of L12 to recruit translation factors and control their activity on the ribosome. PMID:20483347

  4. The ribosomal protein Asc1/RACK1 is required for efficient translation of short mRNAs

    PubMed Central

    Thompson, Mary K; Rojas-Duran, Maria F; Gangaramani, Paritosh; Gilbert, Wendy V


    Translation is a core cellular process carried out by a highly conserved macromolecular machine, the ribosome. There has been remarkable evolutionary adaptation of this machine through the addition of eukaryote-specific ribosomal proteins whose individual effects on ribosome function are largely unknown. Here we show that eukaryote-specific Asc1/RACK1 is required for efficient translation of mRNAs with short open reading frames that show greater than average translational efficiency in diverse eukaryotes. ASC1 mutants in S. cerevisiae display compromised translation of specific functional groups, including cytoplasmic and mitochondrial ribosomal proteins, and display cellular phenotypes consistent with their gene-specific translation defects. Asc1-sensitive mRNAs are preferentially associated with the translational ‘closed loop’ complex comprised of eIF4E, eIF4G, and Pab1, and depletion of eIF4G mimics the translational defects of ASC1 mutants. Together our results reveal a role for Asc1/RACK1 in a length-dependent initiation mechanism optimized for efficient translation of genes with important housekeeping functions. DOI: PMID:27117520

  5. Changes of ribosomal protein S3 immunoreactivity and its new expression in microglia in the mice hippocampus after lipopolysaccharide treatment.


    Lee, Hui Young; Park, Joon Ha; Lee, Choong Hyun; Yan, Bingchun; Ahn, Ji Hyeon; Lee, Young Joo; Park, Chan Woo; Cho, Jun Hwi; Choi, Soo Young; Won, Moo-Ho


    Lipopolysaccharide (LPS) has been used as a reagent for a model of systemic inflammatory response. Ribosomal protein S3 (rpS3) is a multi-functional protein that is involved in transcription, metastasis, DNA repair, and apoptosis. In the present study, we examined the changes of rpS3 immunoreactivity in the mouse hippocampus after systemic administration of 1 mg/kg of LPS. From 6 h after LPS treatment, rpS3 immunoreactivity was decreased in pyramidale cells of the hippocampus proper (CA1-CA3 regions) and in granule cells of the dentate gyrus. At this point in time, rpS3 immunoreactivity began to increase in non-pyramidal cells and non-granule cells. From 1 day after LPS treatment, rpS3 immunoreactivity in pyramidal and granule cells was hardly detected; however, strong rpS3 immunoreactivity was shown in non-pyramidal and non-granule cells. Based on double immunofluorescence staining for rpS3/ionized calcium-binding adapter 1 (Iba-1, a marker for microglia) and glial fibrillary acidic protein (GFAP, a marker for astrocytes), strong rpS3 immunoreactivity was expressed in Iba-1-immunoreactive microglia, not in GFAP-immunoreactive astrocytes, at 1 and 2 days after LPS treatment. These results indicate that rpS3 immunoreactivity changes only in pyramidal and granule cells, and rpS3 is expressed only in activated microglia after LPS treatment: this may be associated with the neuroinflammatory responses in the brain.

  6. Pineapple translation factor SUI1 and ribosomal protein L36 promoters drive constitutive transgene expression patterns in Arabidopsis thaliana.


    Koia, Jonni; Moyle, Richard; Hendry, Caroline; Lim, Lionel; Botella, José Ramón


    The availability of a variety of promoter sequences is necessary for the genetic engineering of plants, in basic research studies and for the development of transgenic crops. In this study, the promoter and 5' untranslated regions of the evolutionally conserved protein translation factor SUI1 gene and ribosomal protein L36 gene were isolated from pineapple and sequenced. Each promoter was translationally fused to the GUS reporter gene and transformed into the heterologous plant system Arabidopsis thaliana. Both the pineapple SUI1 and L36 promoters drove GUS expression in all tissues of Arabidopsis at levels comparable to the CaMV35S promoter. Transient assays determined that the pineapple SUI1 promoter also drove GUS expression in a variety of climacteric and non-climacteric fruit species. Thus the pineapple SUI1 and L36 promoters demonstrate the potential for using translation factor and ribosomal protein genes as a source of promoter sequences that can drive constitutive transgene expression patterns.

  7. Preservation of Gene Duplication Increases the Regulatory Spectrum of Ribosomal Protein Genes and Enhances Growth under Stress.


    Parenteau, Julie; Lavoie, Mathieu; Catala, Mathieu; Malik-Ghulam, Mustafa; Gagnon, Jules; Abou Elela, Sherif


    In baker's yeast, the majority of ribosomal protein genes (RPGs) are duplicated, and it was recently proposed that such duplications are preserved via the functional specialization of the duplicated genes. However, the origin and nature of duplicated RPGs' (dRPGs) functional specificity remain unclear. In this study, we show that differences in dRPG functions are generated by variations in the modality of gene expression and, to a lesser extent, by protein sequence. Analysis of the sequence and expression patterns of non-intron-containing RPGs indicates that each dRPG is controlled by specific regulatory sequences modulating its expression levels in response to changing growth conditions. Homogenization of dRPG sequences reduces cell tolerance to growth under stress without changing the number of expressed genes. Together, the data reveal a model where duplicated genes provide a means for modulating the expression of ribosomal proteins in response to stress. PMID:26686636

  8. Mescaline-induced changes of brain-cortex ribosomes. Effect of mescaline on the hydrogen-bonded structure of ribonucleic acid of brain-cortex ribosomes.


    Datta, R K; Ghosh, J J


    1. The action of mescaline sulphate on the hydrogen-bonded structure of the RNA constituent of ribosomes of goat brain-cortex slices was studied by using the hyperchromic effect of heating and formaldehyde reaction. 2. The ribosomal total RNA species of the mescaline-treated brain-cortex slices have a smaller proportion of hydrogen-bonded structure than the ribosomal RNA species of the untreated brain-cortex slices. 3. Mescaline also appears to have affected this lowering of hydrogen-bonded structure of the ribosomal 28S RNA of brain-cortex tissue.

  9. A unique phosphorylation-dependent eIF4E assembly on 40S ribosomes co-ordinated by hepatitis C virus protein NS5A that activates internal ribosome entry site translation.


    Panda, Swarupa; Vedagiri, Dhiviya; Viveka, Thangaraj Soundara; Harshan, Krishnan Harinivas


    We previously reported that the HCV (hepatitis C virus) protein NS5A up-regulated mRNA cap binding eIF4F (eukaryotic initiation factor 4F) complex assembly through mTOR (mechanistic target of rapamycin)-4EBP1 (eIF4E-binding protein 1) pathway and that NS5A (non-structural protein 5A) physically interacted with translation apparatus. In the present study, we demonstrate that NS5A co-ordinates a unique assembly of the cap binding protein eIF4E and 40S ribosome to form a complex that we call ENR (eIF4E-NS5A-ribosome). Recruitment of NS5A and eIF4E to 40S ribosome was confirmed by polysome fractionation, subcellular fractionation and high-salt-wash immunoprecipitation. These observations were also confirmed in HCV-infected cells, validating its biological significance. eIF4E phosphorylation was critical for ENR assembly. 80S ribosome dissociation and RNase integrity assays revealed that, once associated, the ENR complex is stable and RNA interaction is dispensable. Both the N- and C-terminal regions of NS5A domain 1 were indispensable for this assembly and for the NS5A-induced HCV IRES (internal ribosome entry site) activation. The present study demonstrates that NS5A initially associates with phosphorylated eIF4E of eIF4F complex and subsequently recruits it to 40S ribosomes. This is the first time the interaction of viral protein with both eIF4E and ribosomes has been reported. We propose that this assembly would determine the outcome of HCV infection and pathogenesis through regulation of viral and host translation.

  10. Studies on the origin of ribosomes in Amoeba proteus.


    Craig, N; Goldstein, L


    The origin of cytoplasmic RNA and ribosomes was studied in Amoeba proteus by transplantation of a radioactive nucleus into an unlabeled cell followed by examination of the cytoplasm of the recipient for the presence of label. When a RNA-labeled nucleus was used, label appeared in the ribosomes, ribosomal RNA, and soluble RNA. Since the kinetics of appearance of labeled RNA indicates that the nucleus was not injured during the transfer, and since the transferred nuclear pool of labeled acid-soluble RNA precursors is inadequate to account for the amount of cytoplasmic RNA label, it is concluded that cytoplasmic ribosomal RNA is derived from acid-insoluble nuclear RNA and is probably transported as an intact molecule. Likewise, cytoplasmic soluble RNA probably originated in the nucleus, although labeling by terminal exchange in the cytoplasm is also possible. The results were completely different when a protein-labeled nucleus was grafted into an unlabeled host. In this case, label was found only in soluble proteins in the host cell cytoplasm, and there were no (or very few) radioactive ribosomes. This suggests that the nuclear pool of ribosomal protein and ribosomal protein precursors is relatively small and perhaps nonexistent (and, furthermore, shows that there was no cytoplasmic ribosomal contamination of the transferred nucleus). PMID:5765758

  11. Skeletal muscle plasticity induced by seasonal acclimatization involves IGF1 signaling: implications in ribosomal biogenesis and protein synthesis.


    Fuentes, Eduardo N; Zuloaga, Rodrigo; Valdes, Juan Antonio; Molina, Alfredo; Alvarez, Marco


    One of the most fundamental biological processes in living organisms that are affected by environmental fluctuations is growth. In fish, skeletal muscle accounts for the largest proportion of body mass, and the growth of this tissue is mainly controlled by the insulin-like growth factor (IGF) system. By using the carp (Cyprinus carpio), a fish that inhabits extreme conditions during winter and summer, we assessed the skeletal muscle plasticity induced by seasonal acclimatization and the relation of IGF signaling with protein synthesis and ribosomal biogenesis. The expression of igf1 in muscle decreased during winter in comparison with summer, whereas the expression for both paralogues of igf2 did not change significantly between seasons. The expression of igf1 receptor a (igf1ra), but not of igf1rb, was down-regulated in muscle during the winter as compared to the summer. A decrease in protein contents and protein phosphorylation for IGF signaling molecules in muscle was observed in winter-acclimatized carp. This was related with a decreased expression in muscle for markers of myogenesis (myoblast determination factor (myod), myogenic factor 5 (myf5), and myogenin (myog)); protein synthesis (myosin heavy chain (mhc) and myosin light chain (mlc3 and mlc1b)); and ribosomal biogenesis (pre-rRNA and ribosomal proteins). IGF signaling, and key markers of ribosomal biogenesis, protein synthesis, and myogenesis were affected by seasonal acclimatization, with differential regulation in gene expression and signaling pathway activation observed in muscle between both seasons. This suggests that these molecules are responsible for the muscle plasticity induced by seasonal acclimatization in carp.

  12. Extremophilic 50S Ribosomal RNA-Binding Protein L35Ae as a Basis for Engineering of an Alternative Protein Scaffold

    PubMed Central

    Lomonosova, Anna V.; Ovchinnikova, Elena V.; Kazakov, Alexei S.; Denesyuk, Alexander I.; Sofin, Alexander D.; Mikhailov, Roman V.; Ulitin, Andrei B.; Mirzabekov, Tajib A.; Permyakov, Eugene A.; Permyakov, Sergei E.


    Due to their remarkably high structural stability, proteins from extremophiles are particularly useful in numerous biological applications. Their utility as alternative protein scaffolds could be especially valuable in small antibody mimetic engineering. These artificial binding proteins occupy a specific niche between antibodies and low molecular weight substances, paving the way for development of innovative approaches in therapeutics, diagnostics, and reagent use. Here, the 50S ribosomal RNA-binding protein L35Ae from the extremophilic archaea Pyrococcus horikoshii has been probed for its potential to serve as a backbone in alternative scaffold engineering. The recombinant wild type L35Ae has a native-like secondary structure, extreme thermal stability (mid-transition temperature of 90°C) and a moderate resistance to the denaturation by guanidine hydrochloride (half-transition at 2.6 M). Chemical crosslinking and dynamic light scattering data revealed that the wild type L35Ae protein has a propensity for multimerization and aggregation correlating with its non-specific binding to a model cell surface of HEK293 cells, as evidenced by flow cytometry. To suppress these negative features, a 10-amino acid mutant (called L35Ae 10X) was designed, which lacks the interaction with HEK293 cells, is less susceptible to aggregation, and maintains native-like secondary structure and thermal stability. However, L35Ae 10X also shows lowered resistance to guanidine hydrochloride (half-transition at 2.0M) and is more prone to oligomerization. This investigation of an extremophile protein’s scaffolding potential demonstrates that lowered resistance to charged chemical denaturants and increased propensity to multimerization may limit the utility of extremophile proteins as alternative scaffolds. PMID:26247602

  13. RibAlign: a software tool and database for eubacterial phylogeny based on concatenated ribosomal protein subunits

    PubMed Central

    Teeling, Hanno; Gloeckner, Frank Oliver


    Background Until today, analysis of 16S ribosomal RNA (rRNA) sequences has been the de-facto gold standard for the assessment of phylogenetic relationships among prokaryotes. However, the branching order of the individual phlya is not well-resolved in 16S rRNA-based trees. In search of an improvement, new phylogenetic methods have been developed alongside with the growing availability of complete genome sequences. Unfortunately, only a few genes in prokaryotic genomes qualify as universal phylogenetic markers and almost all of them have a lower information content than the 16S rRNA gene. Therefore, emphasis has been placed on methods that are based on multiple genes or even entire genomes. The concatenation of ribosomal protein sequences is one method which has been ascribed an improved resolution. Since there is neither a comprehensive database for ribosomal protein sequences nor a tool that assists in sequence retrieval and generation of respective input files for phylogenetic reconstruction programs, RibAlign has been developed to fill this gap. Results RibAlign serves two purposes: First, it provides a fast and scalable database that has been specifically adapted to eubacterial ribosomal protein sequences and second, it provides sophisticated import and export capabilities. This includes semi-automatic extraction of ribosomal protein sequences from whole-genome GenBank and FASTA files as well as exporting aligned, concatenated and filtered sequence files that can directly be used in conjunction with the PHYLIP and MrBayes phylogenetic reconstruction programs. Conclusion Up to now, phylogeny based on concatenated ribosomal protein sequences is hampered by the limited set of sequenced genomes and high computational requirements. However, hundreds of full and draft genome sequencing projects are on the way, and advances in cluster-computing and algorithms make phylogenetic reconstructions feasible even with large alignments of concatenated marker genes. Rib

  14. New Evidence for Differential Roles of L10 Ribosomal Proteins from Arabidopsis1[C][W][OPEN

    PubMed Central

    Falcone Ferreyra, María Lorena; Casadevall, Romina; Luciani, Marianela Dana; Pezza, Alejandro; Casati, Paula


    The RIBOSOMAL PROTEIN L10 (RPL10) is an integral component of the eukaryotic ribosome large subunit. Besides being a constituent of ribosomes and participating in protein translation, additional extraribosomal functions in the nucleus have been described for RPL10 in different organisms. Previously, we demonstrated that Arabidopsis (Arabidopsis thaliana) RPL10 genes are involved in development and translation under ultraviolet B (UV-B) stress. In this work, transgenic plants expressing ProRPL10:β-glucuronidase fusions show that, while AtRPL10A and AtRPL10B are expressed both in the female and male reproductive organs, AtRPL10C expression is restricted to pollen grains. Moreover, the characterization of double rpl10 mutants indicates that the three AtRPL10s differentially contribute to the total RPL10 activity in the male gametophyte. All three AtRPL10 proteins mainly accumulate in the cytosol but also in the nucleus, suggesting extraribosomal functions. After UV-B treatment, only AtRPL10B localization increases in the nuclei. We also here demonstrate that the three AtRPL10 genes can complement a yeast RPL10 mutant. Finally, the involvement of RPL10B and RPL10C in UV-B responses was analyzed by two-dimensional gels followed by mass spectrometry. Overall, our data provide new evidence about the nonredundant roles of RPL10 proteins in Arabidopsis. PMID:23886624

  15. Structure and probable genetic location of a "ribosome modulation factor" associated with 100S ribosomes in stationary-phase Escherichia coli cells.


    Wada, A; Yamazaki, Y; Fujita, N; Ishihama, A


    The decrease in overall translation activity occurring concomitantly with the transition from the exponential growth phase to the stationary phase of Escherichia coli cells was found to be accompanied by the appearance of 100S ribosomes (dimers of 70S ribosome monomers). Analysis of ribosomal proteins by the radical-free and highly reducing method of two-dimensional gel electrophoresis indicated that a protein, designated protein E, was exclusively associated with 100S ribosomes. From the results, we propose that protein E is a "ribosome modulation factor" (RMF), which associates with 70S ribosomes and converts them to a dimeric form. A homology search of the partial amino acid sequence of RMF using the DNA sequence data bases revealed that the rmf gene, which encodes RMF, is located next to the fabA gene at 21.8 min on the E. coli chromosome.

  16. The RICE MINUTE-LIKE1 (RML1) gene, encoding a ribosomal large subunit protein L3B, regulates leaf morphology and plant architecture in rice

    PubMed Central

    Zheng, Ming; Wang, Yihua; Liu, Xi; Sun, Juan; Wang, Yunlong; Xu, Yang; Lv, Jia; Long, Wuhua; Zhu, Xiaopin; Guo, Xiuping; Jiang, Ling; Wang, Chunming; Wan, Jianmin


    Mutations of ribosomal proteins (RPs) are known to cause developmental abnormalities in yeast, mammals, and dicotyledonous plants; however, their effects have not been studied in rice. Here, we identifiy a ribosomal biogenesis mutant, rice minute-like1 (rml1) that displays a minute phenotype as evidenced by retarded growth and defects in the vascular system. We determine that RML1 encodes a ribosome large subunit protein 3B (RPL3B) in rice by means of map-based cloning and genetic complementation. RPL3B is abundantly expressed in all the tissues, whereas RPL3A, another RPL3 gene family member, is expressed at low levels. Notably, the expression level of RPL3A in the rml1 mutant is similar to that in the wild-type, suggesting that RPL3A provides no functional compensation for RPL3B in rml1 plants. Ribosomal profiles show that mutation of RPL3B leads to a significant reduction in free 60S ribosomal subunits and polysomes, indicating a ribosomal insufficiency in the rml1 mutant. Our results demonstrate that the ribosomal protein gene RPL3B is required for maintaining normal leaf morphology and plant architecture in rice through its regulation of ribosome biogenesis. PMID:27241493

  17. Critical Diamond-Blackfan anemia due to ribosomal protein S19 missense mutation.


    Ozono, Shuichi; Mitsuo, Miho; Noguchi, Maiko; Nakagawa, Shin-Ichiro; Ueda, Koichiro; Inada, Hiroko; Ohga, Shouichi; Ito, Etsuro


    Diamond-Blackfan anemia (DBA) is a rare congenital disorder characterized by pure erythrocyte aplasia, and approximately 70% of patients carry mutations in the genes encoding ribosomal proteins (RP). Here, we report the case of a male infant with DBA who presented with anemic crisis (hemoglobin [Hb] concentration 1.5 g/dL) at 58 days after birth. On admission, the infant was pale and had tachypnea, but recovered with intensive care, including red blood cell transfusions, and prednisolone. Based on the clinical diagnosis of DBA, the father of the infant had cyclosporine-A-dependent anemia. On analysis of RP genes when the infant was 6 months old, both the infant and the father, but not the mother, were found to harbor a mutation of RPS19 (c.167G > C, p. R56P). Therefore, genetic background search and early neonatal health check-ups are recommended for families with a history of inherited bone marrow failure syndromes. PMID:27601194

  18. Integrative analyses shed new light on human ribosomal protein gene regulation

    PubMed Central

    Li, Xin; Zheng, Yiyu; Hu, Haiyan; Li, Xiaoman


    Ribosomal protein genes (RPGs) are important house-keeping genes that are well-known for their coordinated expression. Previous studies on RPGs are largely limited to their promoter regions. Recent high-throughput studies provide an unprecedented opportunity to study how human RPGs are transcriptionally modulated and how such transcriptional regulation may contribute to the coordinate gene expression in various tissues and cell types. By analyzing the DNase I hypersensitive sites under 349 experimental conditions, we predicted 217 RPG regulatory regions in the human genome. More than 86.6% of these computationally predicted regulatory regions were partially corroborated by independent experimental measurements. Motif analyses on these predicted regulatory regions identified 31 DNA motifs, including 57.1% of experimentally validated motifs in literature that regulate RPGs. Interestingly, we observed that the majority of the predicted motifs were shared by the predicted distal and proximal regulatory regions of the same RPGs, a likely general mechanism for enhancer-promoter interactions. We also found that RPGs may be differently regulated in different cells, indicating that condition-specific RPG regulatory regions still need to be discovered and investigated. Our study advances the understanding of how RPGs are coordinately modulated, which sheds light to the general principles of gene transcriptional regulation in mammals. PMID:27346035

  19. Critical Diamond-Blackfan anemia due to ribosomal protein S19 missense mutation.


    Ozono, Shuichi; Mitsuo, Miho; Noguchi, Maiko; Nakagawa, Shin-Ichiro; Ueda, Koichiro; Inada, Hiroko; Ohga, Shouichi; Ito, Etsuro


    Diamond-Blackfan anemia (DBA) is a rare congenital disorder characterized by pure erythrocyte aplasia, and approximately 70% of patients carry mutations in the genes encoding ribosomal proteins (RP). Here, we report the case of a male infant with DBA who presented with anemic crisis (hemoglobin [Hb] concentration 1.5 g/dL) at 58 days after birth. On admission, the infant was pale and had tachypnea, but recovered with intensive care, including red blood cell transfusions, and prednisolone. Based on the clinical diagnosis of DBA, the father of the infant had cyclosporine-A-dependent anemia. On analysis of RP genes when the infant was 6 months old, both the infant and the father, but not the mother, were found to harbor a mutation of RPS19 (c.167G > C, p. R56P). Therefore, genetic background search and early neonatal health check-ups are recommended for families with a history of inherited bone marrow failure syndromes.

  20. Characterization of a novel Minute-locus in Drosophila melanogaster: a putative ribosomal protein gene.


    Andersson, S; Lambertsson, A


    We describe a novel Minute locus, M(1)7C, on the X-chromosome of Drosophila melanogaster. Heterozygous deficient females have most, if not all, of the Minute features (short and fine bristles, rough and somewhat larger eyes, thin-textured wings, missing aristae, affected antennae, delayed development, reduced fertility, and decreased viability). Both Minute and non-Minute adult progeny from Minute mothers suffer from Minute maternal effects such as abdominal segmentation defects, fused tergites, and missing or defective legs and halteres. Using a plasmid clone from region 7C5-9, which harbours the D. melanogaster ribosomal protein gene RPS14, we have found that the accumulation of a single transcript of approximately 650 b is extremely reduced in Minute larvae in comparison with wild-type. We have localized the RPS14 gene to approximately 28 kbp distal from the singed locus. The results suggest that M(1)7C and RPS14 may be the same gene.

  1. Ribosome Protein L4 is essential for Epstein–Barr Virus Nuclear Antigen 1 function

    PubMed Central

    Shen, Chih-Lung; Liu, Cheng-Der; You, Ren-In; Ching, Yung-Hao; Liang, Jun; Ke, Liangru; Chen, Ya-Lin; Chen, Hong-Chi; Hsu, Hao-Jen; Liou, Je-Wen; Kieff, Elliott; Peng, Chih-Wen


    Epstein–Barr Virus (EBV) Nuclear Antigen 1 (EBNA1)-mediated origin of plasmid replication (oriP) DNA episome maintenance is essential for EBV-mediated tumorigenesis. We have now found that EBNA1 binds to Ribosome Protein L4 (RPL4). RPL4 shRNA knockdown decreased EBNA1 activation of an oriP luciferase reporter, EBNA1 DNA binding in lymphoblastoid cell lines, and EBV genome number per lymphoblastoid cell line. EBV infection increased RPL4 expression and redistributed RPL4 to cell nuclei. RPL4 and Nucleolin (NCL) were a scaffold for an EBNA1-induced oriP complex. The RPL4 N terminus cooperated with NCL-K429 to support EBNA1 and oriP-mediated episome binding and maintenance, whereas the NCL C-terminal K380 and K393 induced oriP DNA H3K4me2 modification and promoted EBNA1 activation of oriP-dependent transcription. These observations provide new insights into the mechanisms by which EBV uses NCL and RPL4 to establish persistent B-lymphoblastoid cell infection. PMID:26858444

  2. Mutation in ribosomal protein S5 leads to spectinomycin resistance in Neisseria gonorrhoeae.


    Ilina, Elena N; Malakhova, Maya V; Bodoev, Ivan N; Oparina, Nina Y; Filimonova, Alla V; Govorun, Vadim M


    Spectinomycin remains a useful reserve option for therapy of gonorrhea. The emergence of multidrug-resistant Neisseria gonorrhoeae strains with decreased susceptibility to cefixime and to ceftriaxone makes it the only medicine still effective for treatment of gonorrhea infection in analogous cases. However, adoption of spectinomycin as a routinely used drug of choice was soon followed by reports of spectinomycin resistance. The main molecular mechanism of spectinomycin resistance in N. gonorrhoeae was C1192T substitution in 16S rRNA genes. Here we reported a Thr-24→Pro mutation in ribosomal protein S5 (RPS5) found in spectinomycin resistant clinical N. gonorrhoeae strain, which carried no changes in 16S rRNA. In a series of experiments, the transfer of rpsE gene allele encoding the mutant RPS5 to the recipient N. gonorrhoeae strains was analyzed. The relatively high rate of transformation [ca. 10(-5) colony-forming units (CFUs)] indicates the possibility of spread of spectinonycin resistance within gonococcal population due to the horizontal gene transfer (HGT). PMID:23847609

  3. The ribosomal S10 protein is a general target for decreased tigecycline susceptibility.


    Beabout, Kathryn; Hammerstrom, Troy G; Perez, Anisha Maria; Magalhães, Bárbara Freitas; Prater, Amy G; Clements, Thomas P; Arias, Cesar A; Saxer, Gerda; Shamoo, Yousif


    Tigecycline is a translational inhibitor with efficacy against a wide range of pathogens. Using experimental evolution, we adapted Acinetobacter baumannii, Enterococcus faecium, Escherichia coli, and Staphylococcus aureus to growth in elevated tigecycline concentrations. At the end of adaptation, 35 out of 47 replicate populations had clones with a mutation in rpsJ, the gene that encodes the ribosomal S10 protein. To validate the role of mutations in rpsJ in conferring tigecycline resistance, we showed that mutation of rpsJ alone in Enterococcus faecalis was sufficient to increase the tigecycline MIC to the clinical breakpoint of 0.5 μg/ml. Importantly, we also report the first identification of rpsJ mutations associated with decreased tigecycline susceptibility in A. baumannii, E. coli, and S. aureus. The identified S10 mutations across both Gram-positive and -negative species cluster in the vertex of an extended loop that is located near the tigecycline-binding pocket within the 16S rRNA. These data indicate that S10 is a general target of tigecycline adaptation and a relevant marker for detecting reduced susceptibility in both Gram-positive and -negative pathogens.

  4. The mushroom ribosome-inactivating protein lyophyllin exerts deleterious effects on mouse embryonic development in vitro.


    Chan, W Y; Ng, T B; Lam, Joyce S Y; Wong, Jack H; Chu, K T; Ngai, P H K; Lam, S K; Wang, H X


    Earlier investigations disclose that some plant ribosome-inactivating proteins (RIPs) adversely affect mouse embryonic development. In the present study, a mushroom RIP, namely lyophyllin from Lyophyllum shimeji, was isolated, partially sequenced, and its translation inhibitory activity determined. Its teratogenicity was studied by using a technique entailing microinjection and postimplantation whole-embryo culture. It was found that embryonic abnormalities during the period of organogenesis from E8.5 to E9.5 were induced by lyophyllin at a concentration as low as 50 microg/ml, and when the lyophyllin concentration was raised, the number of abnormal embryos increased, the final somite number decreased, and the abnormalities increased in severity. The affected embryonic structures included the cranial neural tube, forelimb buds, branchial arches, and body axis, while optic and otic placodes were more resistant. Lyophyllin at a concentration higher than 500 microg/ml also induced forebrain blisters within the cranial mesenchyme. When the abnormal embryos were examined histologically, an increase of cell death was found to be associated with abnormal structures, indicating that cell death may be one of the underlying causes of teratogenicity of the mushroom RIP. This constitutes the first report on the teratogenicity of a mushroom RIP.

  5. Characterization and expression during development and under environmental stress of the genes encoding ribosomal proteins L11 and L13 in Chironomus riparius.


    Martínez-Guitarte, J L; Planelló, R; Morcillo, G


    The Chironomus riparius gene sequences encoding ribosomal proteins L11 and L13 were characterized and their expression analysed during development, and under different types of cellular stress. A comparative and phylogenetic study among different orders of insects was carried out by analysis of sequence databases. L11 is highly conserved, both at the level of DNA and protein, and it shares over 90% amino